GENETIC EXPLORATION AND ANALYSIS OF AUTOSOMAL RECESSIVE CATARACTS
BUSHRA IRUM
NATIONAL CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY, UNIVERSITY OF THE PUNJAB LAHORE PAKISTAN (2017) GENETIC EXPLORATION AND ANALYSIS OF AUTOSOMAL RECESSIVE CATARACTS
A THESIS SUBMITTED TO UNIVERSITY OF THE PUNJAB IN FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN
MOLECULAR BIOLOGY
BY
BUSHRA IRUM
SUPERVISORS:
DR. NOREEN LATIEF DR. SHEIKH AMER RIAZUDDIN
NATIONAL CENTRE OF EXCELLENCE IN MOLECULAR BIOLOGY, UNIVERSITY OF THE PUNJAB LAHORE PAKISTAN
(2017)
In the name of Allah, the Most Gracious, the Most Merciful
If Allah helps you, none can overcome you. And if
He forsakes you who is there after Him that can help you? And in Allah (alone) let the believers put their
trust.
Al-Quran 03:160
This thesis is dedicated to my loving parents; Sardar Ali Bukhsh & Fazila Ali
Certificate
It is certified that the research work described in this thesis is the original work of the author Ms. Bushra Irum and has been carried out under our direct supervision. We have personally gone through all the data reported in the manuscript and certify their correctness/authenticity and found that thesis has been written in pure academic language and is free from any typos and grammatical errors. It is further certified that the material included in this thesis has not been used in part or full in a manuscript already submitted or in the process of submission in partial/complete fulfillment of the award of any other degree from any other institution. It is also certified that the thesis has been prepared under our supervision according to the prescribed format and we endorse its evaluation for the award of Ph.D. degree through the official procedures of the University.
In accordance with the rules of the Centre, data books # M-127, 992, 1065 and 1324 are declared as unexpendable document that will be kept in the registry of the Centre for a minimum of three years from the date of the thesis defense examination.
Signature of the Supervisor: ______
Name: Dr. Noreen Latief
Assistant Professor
Signature of the Supervisor:
Name: Dr. Sheikh Amer Riazuddin
National Distinguished Professor
AUTHOR’S DECLARATION
I, Bushra Irum, hereby states that my Ph.D. thesis titles, “GENETIC
EXPLORATION AND ANALYSIS OF AUTOSOMAL RECESSIVE CATARACTS” is my own work and has not been submitted previously by me for taking any degree from this university, “University of the Punjab” or anywhere else in the country/world.
At any time, if my statement is found to be incorrect even after my graduation, the university has the right to withdraw my Ph.D. degree.
Date: Signature:
Bushra Irum
PLAGIARISM UNDERTAKING
I solemnly declare that research work presented in the thesis titled, “GENETIC
EXPLORATION AND ANALYSIS OF AUTOSOMAL RECESSIVE CATARACTS” is solely my research work with no significant contribution from any other person.
Small contributions/help wherever taken, has been duly acknowledged and that complete thesis has been written by me.
I understand the zero tolerance policy of the HEC and university, “University of the Punjab” towards plagiarism. Therefore, I as an author of the above titled thesis, declare that no portion of my thesis has been plagiarized and any material used as reference is properly referred/ cited.
I undertake that if I am found guilty of any formal plagiarism in the above titled thesis even after award of the Ph.D. degree, the university reserves the rights to withdraw/ revoke my Ph.D. degree and that HEC and the university has the right to publish my name on the HEC/ university website on which names of students are placed who submitted plagiarized thesis.
Date: Signature:
Bushra Irum
CONTENTS List of figures i List of tables ii Summary iv Acknowledgments vi Abbreviations and symbols viii Introduction 1-4 SECTION I (REVIEW OF LITERATURE) 5-42 CHAPTER 1 (OVERVIEW) 6-13 What is cataract? 7 Treatment of cataract 8 Prevalence of cataract 8 The lens and the cataracts 9 Disease morphology 10 CHAPTER 2 (GENETIC & MOLECULAR DESCRIPTION OF CATARACT) 14-38 Mode of inheritance of cataracts 15 Genes involved in recessive congenital cataracts 15 EPHA2 15 GJA8 17 FYCO1 18 GCNT2 20 AGK 22 TDRD7 22 CRYAB 23 HSF4 25 GALK1 27 SIPA1L3 29 LIM2 29 BFSP1 31 LSS 32 CRYAA 33 CRYBB3 34 CRYBB1 36 Loci without known disease causing genes 37 CHAPTER 3 (GENE MAPPING AND IDENTIFICATION) 39-43 Linkage analysis 40 Homozygosity mapping 40 Haplotype construction 41 LOD scores 41 Multipoint mapping 42 DNA polymorphism 42 Sanger sequencing and next generation sequencing techniques 43 SECTION II (MATERIALS & METHODS) 44-69 Ethics statement 45 Identification of families affected with cataracts 45 Clinical assessment 45 Collection of blood samples 46 DNA extraction 46 DNA quantification 47 Exclusion of loci/genes causing recessive congenital cataracts 48 Genotyping of STR by PCR 51 PCR cycle for genotyping 51 Genome wide scan 52 Multiplex polymerase chain reactions 57 Gel electrophoresis 57 Sample preparation for genetic analyzer 58 Data analysis and haplotype construction 58 LOD score calculation 59 Primer designing for sequencing 59 Sanger sequencing 60 PCR conditions and cycle 64 Electrophoresis of PCR products 65 Processing of PCR products 65 Sequencing reaction 66 Precipitation of sequencing reaction 67 Sequencing data analysis 67 Exome sequencing 68 SECTION III (RESULTS & DISCUSSION) 70-119 Exordium 71 CHAPTER 1 (LINKAGE AND MUTATIONAL ANALYSIS) 72-96 Linkage & mutational analysis of CRYBB3 (PKCC185) 73 Linkage & mutational analysis of LIM2 (PKCC214) 79 Linkage and mutational analysis of GCNT2 (PKCC215) 88 CHAPTER 2 (IDENTIFICATION OF NOVEL CATARACT GENES/LOCI) 97-120 Identification of potential novel cataract locus (PKCC206) 98 Identification of a novel gene (PKCC212) 105 Identification of a novel cataract locus (PKCC208) 114 Conclusion 121 SECTION IV (REFERENCES) 122-146
LIST OF FIGURES Figure 2.1: Thermo-cycler program; touch down (td) 64-54 °C 51 Figure 2.2: Thermo-cycler program; Julie 54 °C 52 Figure 2.3: Thermocycler program; Multiplex 54 °C 57 Figure 2.4: Thermo-cycler program; touch down (td) 68-58 °C 65 Figure 2.5: Thermocycling profile for sequencing reaction 66 Figure 3.1: Haplotype of PKCC185 74 Figure 3.2: Sequence chromatograms of CRYBB3 gene 75 Figure 3.3: Sequence alignment of CRYBB3 amino acids 77 Figure 3.4: Schematic representation of CRYBB3 protein 78 Figure 3.5: Haplotype of PKCC214 80 Figure 3.6: Sequence chromatograms of LIM2 gene 81 Figure 3.7: Slit-lamp photograph of affected individual of PKCC214 82 Figure 3.8: Sequence alignment of LIM2 amino acids 86 Figure 3.9: Graphical illustration of LIM2 protein 87 Figure 3.10: Haplotype of PKCC215 91 Figure 3.11: Graphical illustration of the GCNT2 deletion 92 Figure 3.12: A schematic representation of the GCNT2 isoforms 96 Figure 3.13: Haplotype of PKCC206 100 Figure 3.14: Slit-lamp photograph of affected individual of PKCC206 101 Figure 3.15: Critical linkage interval of PKCC206 104 Figure 3.16: Haplotype of PKCC212 106 Figure 3.17: Sequence chromatograms of CRYBB2 gene 107 Figure 3.18: Slit-lamp photograph of affected individual of PKCC212 108 Figure 3.19: Alignment of CRYBB2 exon 6 113 Figure 3.20: Agarose gel electrophoresis of PCR products of PKCC212 113 Figure 3.21: Haplotype of PKCC208 115 Figure 3.22: Two-point parametric LOD score of PKCC208 116 Figure 3.23: Critical linkage interval of PKCC208 118
i
LIST OF TABLES Table 1.1: Reported mutations in EPHA2 gene 16 Table 1.2: Reported mutations in GJA8 gene 18 Table 1.3: Reported mutations in FYCO1 gene 20 Table 1.4: Reported mutations in GCNT2 gene 21 Table 1.5: Reported mutations in AGK gene 22 Table 1.6: Reported mutations in TDRD7 gene 23 Table 1.7: Reported mutations in CRYAB gene 25 Table 1.8: Reported mutations in HFS4 gene 26 Table 1.9: Reported mutations in GALK1 gene 27 Table 1.10: Reported mutations in SIPA1L3 gene 29 Table 1.11: Reported mutations in LIM2 gene 30 Table 1.12: Reported mutations in BFSP1 gene 32 Table 1.13: Reported mutations in LSS gene 33 Table 1.14: Reported mutations in CRYAA gene 34 Table 1.15: Reported mutations in CRYBB3 gene 36 Table 1.16: Reported mutations in CRYBB1 gene 37 Table 2.1: Microsatellite markers used for linkage analysis 49 Table 2.2: Reaction mixture for genotyping of Microsatellite markers 51 Table 2.3: Sets of MD10 ABI PRISM® Panel for multiplex PCRs 53 Table 2.4: Reaction mixture for amplification of MD10 Panel primers 57 Table 2.5: Sequencing primers for GCNT2 gene 60 Table 2.6: Sequencing primers for LIM2 gene 61 Table 2.7: Sequencing primers for CRYBB1 gene 61 Table 2.8: Sequencing primers for CRYBB3 gene 61 Table 2.9: Sequencing primers for CRYBB2 gene 62 Table 2.10: Sequencing primers for CRYBA4 gene 62 Table 2.11: Sequencing primers for EPHA2 gene 62 Table 2.12: Sequencing primers for EFNB3 gene 64 Table 2.13: Reaction mixture for amplification of PCR fragments 64 Table 2.14: Reaction mixture for sequencing reaction 66 Table 3.1: Two-point LOD scores of PKCC185 75 Table 3.2: Two-point LOD scores of PKCC214 81
ii
Table 3.3: Clinical features of PKCC214 82 Table 3.4: Two-point LOD scores of PKCC215 91 Table 3.5: Sequences of primers used for deletion refinement in PKCC215 93 Table 3.6: Clinical features of PKCC215 95 Table 3.7: Clinical features of PKCC206 101 Table 3.8: Two-point LOD scores of PKCC206 102 Table 3.9: Two-point LOD scores of PKCC212 107 Table 3.10: The primer sequences and amplification conditions 107 Table 3.11: Two-point LOD scores of PKCC208 117
iii
SUMMARY
The present work was designed to identify the genetic causes of autosomal recessive cataracts in consanguineous families from Pakistan. For this purpose, twenty five families were identified from different areas of Pakistan mainly from south
Punjab. Blood samples were collected and DNAs were extracted for all the samples.
Exclusion analysis was performed on genomic DNAs to exclude known genes/loci for recessive cataracts using the traditional homozygosity mapping technique. Three families were found linked to previously reported regions on different chromosomes.
Family PKCC185 was found linked to chromosome 22q11.23 harboring CRYBB3,
CRYBB1, CRYBA4, and CRYBB2 genes. A maximum two point logarithm of odds score of 3.0 was calculated with markers D22S1174, D22S419 and D22S315 at θ = 0.
No causative mutation was found in CRYBB1, CRYBB2 and CRYBA4 genes. Sanger sequencing of CRYBB3 gene in this family identified an already reported missense mutation. In family PKCC214 cataract phenotype was found linked to chromosome
19q13.41. A maximum two point logarithm of odds score of 3.25 was calculated with markers D19S572 and D19S589 at θ = 0. This region harbors LIM2, an already reported gene in cataracts. Sanger sequencing of the gene revealed a novel missense mutation. In another large consanguineous family PKCC215; linkage was found in a region on chromosome 6p24.3-24.2 harboring GCNT2 gene with a maximum two point LOD score of 5.78 with marker D6S470 at θ = 0. PCR amplification for the
Sanger sequencing of GCNT2 gene coding exon failed in affected individuals of
PKCC215 thus indicating a large DNA deletion. Chromosomal walking and exome sequencing data analysis led to the identification of approximately 190 kb deletion resulting in excision of all the coding exons of GCNT2 gene. Failure to amplify the deletion breakpoints indicated a complex chromosomal rearrangement at this region
iv most probably presence of an insertion in addition to the large DNA deletion. In linkage analysis, PKCC206 was found linked to a region on chromosome 1p36.13. A maximum two point LOD score of 3.36 was calculated with the marker D1S2672 at θ
= 0. This region on chromosome 1p harbors EPHA2 gene. Sanger sequencing of coding exons of the genes did not reveal any causative variation. Thus a novel locus of cataract was identified on chromosome 1p36.13. Another family PKCC212 was found linked to a region on chromosome 22q11.23 with a maximum two point LOD score of 2.51 with marker D22S315, harboring cluster of crystalline genes including
CRYBB3, CRYBB1, CRYBA4, and CRYBB2. No causative variation was found in
CRYBB3, CRYBB1 and CRYBA4. While Sanger sequencing of CRYBB2 gene resulted in identification of a large DNA deletion. Interestingly this gene has been previously reported in autosomal dominant cataracts where it was responsible for causing cataracts in heterozygotes. While in case of PKCC212 heterozygous carrier were normal completely. Genome wide scan with MD-10 panel was done on two cataract families: PKCC208 and PKCC216. In PKCC208 a novel locus on chromosome 17p12 was identified. A maximum two point LOD score of 6.01 was calculated at recombination fraction of zero with marker D17S938. This study reports two novel and a previously reported mutation in known cataract genes in three consanguineous families. Furthermore this study also identified two novel loci and a novel gene in three consanguineous families responsible for cataracts.
v
.ACKNOWLEDGEMENTS
All praises and appreciations are for Almighty Allah Who bestows me fortitude and strength to accomplish this work.
Immense gratitude and appreciation for help and support are extended to the following persons who contributed in this study in one way or another.
Professor Dr. Sheikh Riazuddin: my supervisor, my project incharge, for his inspiring guidance, helping attitude and support that benefitted me a lot during my research work.
Professor Dr. Shaheen N. Khan: my research mentor, for her encouragement, continuous support and co-operation enabled me to accomplish this task.
Dr. S. Amer Riazuddin: my supervisor, for his overall guidance, support and keen interest in my Ph.D. research work
Dr. Noreen Latief: my supervisor, for her guidance, constructive suggestions and keen interest in my Ph.D. research work.
Dr. M. Asif Naeem: my lab incharge, for his helpful insight, beneficial comments and advice throughout my research work helped me to achieve my goals.
Dr. Tayyab Husnain: my worthy Director, for his helpful attitude and providing me research friendly environment.
Higher Education Commission (HEC): my funding agency, for providing me funds under Indigenous fellowship program as well as International Research Support
Initiative Program (IRSIP).
vi
Participating Family Members: all the families who participated and contributed in this study, their co-operation had a great impact on this work.
I am also thankful to my senior colleague; Dr. Haiba Kaul, my friends; Dr. Sidra
Rehman, Sana Zahra, Faiza Yaqoob, MahJabeen and all the lab fellows for their encouragement, helpful discussions and pleasant company.
Exceptional thanks to Bushra Rauf; for her continuous emotional and moral support throughout my study period. Without her motivation, this achievement would have been a dream for me. I am truly grateful for her patience, love and care.
Finally, I want to express my humble obligation to my loving family, my brothers, sisters and especially my parents for their continuous support and encouragement throughout my studies.
Bushra Irum
vii
ABBREVIATIONS & SYMBOLS
A Adenine ASR Allele Size Range B/L Bilateral Bp Base Pair cM Centi-Morgan (Marshfield map) °C Degree Celsius Conc Concentration C Cytosine DNA Deoxyribose Nucleic Acid dNTP Deoxy-Nucleotide Triphosphate EDTA Ethylenediaminetetraacetic acid DOS Disk Operating System EtBr Ethidium Bromide ENU N-ethyl-N nitrosourea g Grams G Guanine Hld Hold (PCR cycle) Kb Kilobase KCl Potassium Chloride LOD Logarithm of Odds Lt Left Min Minute M Mole Mb Megabase
MgCl2 Magnesium Chloride ml Milliliter mm Millimeter mM Millimole NaCl Sodium Chloride ng Nanogram OD Oculus Dexter OS Oculus Sinister
viii p Short arm of Chromosome PKCC Pakistani congenital cataract affected family PCR Polymerase chain reaction pH Negative logarithm of H+ ion concentration q Long arm of chromosome rpm Revolution per minute Rt Right SDS Sodium Dodecyl Sulfate Sec Second STR Short tandem repeats T Thymine TE Tris-EDTA Taq Thermus-aquaticus TBE Tris-Borate-EDTA TNE Tris-NaCl-EDTA Vol Volume UV Ultraviolet WBC White Blood Cell µl Microliter µM Micromole θ Recombination Fraction
∞ Infinity
■ Affected Male
● Affected Female
═ Consanguineous Marriage
─ Non Consanguineous Marriage
□ Male normal
ix
○ Female Normal
Ø Deceased
≤ Less than or equal to ≥ Greater than or equal to
x
Introduction
INTRODUCTION
Cataract is the disease in which lens becomes opaque. It is the primary cause of impaired vision in the world and accounts for 48% of the cases (Foster &
Resnikoff, 2005). Globally, there are an approximated 20,000 to 40,000 children born with progressive bilateral cataract and about 200,000 children become blind from cataract each year (Traboulsi, 2012). The incidence varies with the social and economic status. Cataracts affect 1-6 cases for each 10,000 live births in developed countries and 5-15 per 10,000 in developing areas of the world. These opacities during development can blur vision by hindering the sharp focus of light on retina, thus failing to build proper visual cortical synaptic connections with the retina leading to irreversible vision loss (Holmes et al., 2003).
The lens tissue increases in size during the course of the life by accumulation of newly differentiated fiber cells in concentric lamellae similar to an onion skin
(Duncan, 1981). It is an avascular structure without any venous or arterial flow. Fiber cells are ordered in the form of dense membranes, reducing the intercellular spaces thus maintaining the lens transparency (Michael et al., 2003). Disruptions of lens microarchitecture such as cellular disarray and vacuole development can lead to huge variations in optical density causing light scattering and eventually cataracts. Light scattering and opacity can also be caused by notable aggregation of proteins with high molecular weight (1000 Å or more) (Shiels & Hejtmancik, 2013).
On the basis of morphology, cataracts can be divided into many classes such as; complete lens, lamellar, polar, nuclear, sutural, cortical, cerulean, pulverulent, coralliform, and some additional minor types (Reddy et al., 2004).
Page 1
Introduction
Inherited cataracts are clinically and genetically diverse, involving congenital or developmental onset; arising at birth or through early years of life respectively
(Holmes et al., 2003). Congenital cataracts are one of the most commonly occurring developmental abnormalities of the eye (Shiels & Hejtmancik, 2007). Nearly one half of congenital cataracts are hereditary and secondary feature of about 200 genetic diseases. Congenital hereditary non-syndromic cataracts are inherited as autosomal dominant (AD), autosomal recessive (AR), or X-linked manner with autosomal dominant pattern being the most frequent (Haargaard et al., 2004). Depending upon the age of onset, a congenital or infantile cataract appears within the first year of life, a juvenile cataract arises during the first decade of life, a presenile cataract affects before 45 years of life and senile or age related cataract occurs afterward (Francois,
1982).
Inherited recessive congenital cataracts show extreme genetic heterogeneity.
Pathogenic mutations have been identified in genes such as eph-receptor type-A2
(EPHA2)(Kaul et al., 2010a), connexin50 (GJA8) (Ponnam et al., 2007), FYVE, the coiled-coil domain containing 1 (FYCO1) (Chen et al., 2011), glucosaminyl (N- acetyl) transferase 2 (GCNT2) (Pras et al., 2004), acylglycerol kinase (AGK)
(Aldahmesh et al., 2012a), crystallin alpha B (CRYAB) (Safieh et al., 2009), the tudor domain containing 7 (TDRD7) (Lachke et al., 2011), heat-shock transcription factor 4
(HSF4) (Smaoui et al., 2004), Galactokinase 1 (GALK1) (Yasmeen et al., 2010), lens intrinsic membrane protein 2 (LIM2) (Pras et al., 2002), signal-induced proliferation associated 1 like 3 (SIPA1L3) (Evers et al., 2015), beaded filament structural protein
1 (BFSP1) (Ramachandran et al., 2007), crystallin alpha A (CRYAA) (Pras et al.,
2000), lanosterol synthase (LSS) (Zhao et al., 2015), crystallin beta B1 (CRYBB1)
(Cohen et al., 2007), and crystallin beta B3 (CRYBB3) (Riazuddin et al., 2005a).
Page 2
Introduction
Higher degree of consanguinty in any population together with other aspects such as religion, ethinicity, geography and language may result in creating genetically isolated groups having multigenerational pedigrees with rare syndromes (Peltonen et al., 2000). The objective of the current study was to elucidate the genetic basis of inherited diseases like cataract in Pakistani population. As by the reason of cousin marriages, Pakistani population is a very rich source of genetic diseases unfortunately.
Twenty five families were recruited from different regions of Punjab province of
Pakistan with at least two or more individuals in a family affected with cataract.
Initial aim was to exclude all the already reported genes and loci involved in autosomal recessive congenital cataracts. For this purpose exclusion analysis based on homozygosity mapping was done. Three families were found to be linked to three already reported genes involved in cataract. These genes are LIM2, CRYBB3 and
GCNT2 genes. Mutational analysis of LIM2 gene in PKCC214 led to the identification of a novel missense mutation. Involvement of this gene in cataract is reported for the first time in Pakistani population. In PKCC215 a large DNA deletion was identified which resulted in deletion of all the coding exons of GCNT2 gene. This was also a novel variation as this was the largest deletion of the gene reported so far.
In family PKCC185 sequencing of all the coding exons of CRYBB3 gene resulted in identification of an already reported missense variation.
Another family PKCC212 was found linked to a region at chromosome
22q11.23. This region contains a cluster of crystalline proteins encoding genes including CRYBB1, CRYBB2, CRYBB3 and CRYBA4. Involvement of CRYBB3 and
CRYBB1 has already been reported in autosomal recessive congenital cataract while
CRYBB2 and CRYBA4 mutations have not been reported in recessive cataract.
Sequencing of both (CRYBB1, CRYBB3) already reported genes was done but no
Page 3
Introduction causative mutation was found. While Sequence analysis of CRYBA4 and CRYBB2 genes (not reported in recessive cataract previously) revealed a pathogenic homozygous variation in CRYBB2 gene. Interestingly this gene was previously reported in autosomal dominant cataract where a single copy of the allele was responsible for the disease phenotype. Another family PKCC206 showed linkage to
EPHA2, an already known gene involved in congenital cataract. Sequencing of this gene was done but no pathogenic mutation was found. It is proposed that in this family there might be involvement of a new gene responsible for congenital cataracts.
Genome wide scan with MD-10 panel primers was done to identify new locus involved in congenital cataracts. One family PKCC208 was found linked to a new locus at chromosome 17 with a maximum two point LOD score of 6.01 with the marker D17S938.
Health services in developing countries are often insufficient to fulfil the eye care requirements of the population. In spite of surgical lens abstraction and consequent optical adjustment, it is estimated that one third of individuals with congenital cataract will persist blind (Lambert, 1997). Research studies on identification of genetic variations causing inherited cataracts will enhance our knowledge of pathogenesis and the developmental biology of not only pediatric cataract but also adult onset cataract. Research findings on molecular genetics of cataract may eventually lead to development of new medical treatments, perhaps including gene manipulation in order to prohibit the disease or to cure the symptoms.
Page 4
Review of Literature
SECTION-I
REVIEW OF LITERATURE
Page 5
Review of Literature
CHAPTER 1
OVERVIEW
Page 6
Review of Literature
WHAT IS CATARACT?
Light rays are focused by lens on retina which consists of a layer of light sensitive cells at the back of the eye. In order to focus light rays on retina accurately, the lens must be transparent. Cataract is caused when the lens becomes opaque or cloudy resulting in decreased vision and ultimately resulting in blindness. This disease has some major health concerns as it is the major cause of global blindness (Resnikoff et al., 2004). Major symptoms of disease are following
Light sensitivity and glare.
More trouble seeing at night or in low light.
The need for reading in bright light.
Changes in eye glasses and contact lens prescription frequently.
Faded or yellow colors.
Double vision within one eye.
Painless cloudy, blurry or dim vision.
Seeing halos around lights.
Cloudiness in vision by cataract may affect a minor part of eye lens in initial stages and patient may be unaware of the cataract symptoms. But as the cataract progresses it clouds larger part of lens distorting the light passing through the lens thus leading to that can be noticed by the patient easily. Cataract can be diagnosed through extensive examination of eye with the help of following tests.
Visual acuity test: The eye chart test (Snellen chart) determines how well
your eyes can see from different distances at the chart.
Page 7
Review of Literature
Dilated eye exam: In this test eye drops are used to dilate the pupil or make it
widen. A magnifying lens is used by ophthalmologists to check the retina or
optic nerve for the signs of impairment and other eye complications.
Tonometry: It is done by an instrument to measures the intra ocular pressure
of eye. Drops that may numb your eyes may be used.
Cataracts become crucial clinically, when they affect eyesight significantly. They can be classified by age of onset. Symptoms of congenital or infantile cataracts appear in first year of life, juvenile cataracts effect through the first decade of life, presenile cataracts are caused before 45 years of age and senile or age related cataracts appear afterward. But these classes are approximately or to some degree arbitrary.
TREATMENT OF CATARACT
By using new sunglasses, brighter lightening, anti-glare sunglasses or magnifying lenses, symptoms of early cataract can be improved. If these measures could not minimize the symptoms then surgery is required which is done by replacing the cloudy lens with the new artificial lens. Cataractous lens needs to be replaced in a condition when vision loss is significantly interfering with daily life activities of the patients such as reading, watching TV or driving. But in some cases a cataract should be removed even if it does not affect vision significantly. For instance it should be removed if it hampers eye examination or treatment of some other problems for example age related macular degeneration or diabetic retinopathy.
PREVALENCE OF CATARACT
The occurrence of congenital or infantile cataracts has been estimated around
72 children per 100,000 and in undeveloped countries assessments are higher ranging
Page 8
Review of Literature from 12 to 136 more cases (Haargaard et al., 2004). Occurrence of hereditary cataracts generally ranges from 8.3% to 25% of total cases of congenital cataract
(Francois, 1982; Haargaard et al., 2005; Merin, 1991).
THE LENS AND THE CATARACTS
Function of transmitting and focusing light on the retina is done by lens which is a highly differentiated organ (Bloemendal, 1977). Light with the wavelength ranging from 380-1200 nm is transmitted by lens more efficiently. When young, human lens is colorless but yellow pigmentation increases gradually with aging that result in decreased perception of blue light (Lerman, 1980). Organization of fiber cells more importantly their sutures in addition to cellular architecture are critical for the lens to be transparent and to transmit light (Kuszak et al., 2004). The lens is suspended between two clear fluids; aqueous humor and vitreous (Mathias & Rae,
2004). Light focusing and transparency of lens is achieved through its architecture comprising of an only layer of lens epithelial cells that travel throughout development to lens equator where they get elongated and synthesize greater amount of lens crystallin proteins. During differentiation into fiber cells, these epithelial cells lose their organelles finally leading to cells without nuclei and mitochondria to form central nucleus of lens (Wride, 2011). This little developing lens is surrounded by a basement membrane which will later develop into lens capsule (Mann, 1964). Since the procedure continues during whole life, the lens sections look like annual rings of a tree having outermost superficial fiber cells as the newest one (Graw, 2004). It has been anticipated that lens fiber cells cannot change or replace impaired proteins as they do not have organelles. So the structure and stability of the lens crytallins together and preservation of powerful cellular homeostatic systems are required to sustain normal function of lens. Nevertheless recent evidences have proposed that
Page 9
Review of Literature there might be existence of newly synthesized proteins in lens nucleus (Stewart et al.,
2013). Cellular disarray as well as vacuole formation and disruptions in microarchitecture of lens can cause large variations in optical density leading to light scattering and cataract as a result of which image received by the retina becomes desaturated due to contrast-reducing effect of scattered light (Shiels & Hejtmancik,
2013). Extent of this effect is determined by morphology of cataract and area of pupil which is affected. As soon as the pupil becomes complete opaque there is no image formation as the retina receives scattered light only (Elliott et al., 1991).
DISEASE MORPHOLOGY
Cataract morphology is mainly determined by looking at the lens anatomy together with its capsule development and the variations that take place with time and the type of insult that has triggered abnormality by making alterations in the embryogenesis. These morphological changes can be multiplex and they have very vast scale. An extensive approach is to categorize these variations according to the specific part of the lens which is involved and subdividing them by inclusive depiction of lens appearance and shape (Amaya et al., 2003). There are following morphological types of cataract:
1. Zonular
Zonular cataract is the most frequent class of pediatric cataract which is distinguished by opacity present at distinct regions of lens (Hiles, 1983). a. Nuclear:
Nuclear cataracts are characterized by the opacities of almost the entire embryonic or fetal nucleus (Ionides et al., 1999). The density ranges significantly
Page 10
Review of Literature from fine dots to a white and chalk like dense central cataract. These opacities remain stationary and with the growth of lens, opacity turns out to be less significant relatively. Nature of opacity of lens determines whether surgery is needed or not.
Nuclear opacification that are confluent usually require early surgery and there may not be the need for therapeutic interventions in case of blue dot nuclear cataract
(Khaliq et al., 2002). b. Lamellar:
In lamellar cataract there is involvement of one or more layers or areas of lens, as a shell of opacity (Ippel et al., 1994) that is sandwiched between cortex and clear nucleus (Brown, 1996; Lambert & Drack, 1996). They often occur during development because of secondary to transient insult to the nucleus (Scott, 1996).
Stage at which developmental disturbance occurred is determined by size of the lamella (Conley et al., 2000). c. Sutural:
Opacities involving the sutures are more present posteriorly than anterior. These opacities are usually very frequent however less significant (Stocklin, 1957).
Generally these opacities are static causing bilateral cataract in familial cases (Brown,
1996; Duke-Elder, 1963). They are often known as “Y” shaped cataract. These cataracts can be associated with nuclear cataracts but in isolated finding they impair vision rarely. Isolated sutural cataracts are often discovered accidentally during a routine ocular examination (Lambert & Drack, 1996). d. Capsular:
Capsular cataracts involve both anterior and posterior lens capsule. Opacities are usually subtle in case of anterior capsular cataract without hampering eye sight
Page 11
Review of Literature considerably. Conversely in some cases, vision is compromised and surgical procedure is needed to cure the disease symptoms. Despite the evidence of connective tissue growth factor expression, its exact role in etiology of anterior sub capsular cataract is not yet understood clearly (Spierer et al., 1998; Wunderlich et al., 2000). In posterior capsular cataract, epithelial cells travel towards the posterior pole of the lens aberrantly (Eshaghian & Streeten, 1980). Migratory cells, in order to interlink with neighboring lens fibers, make cluster nearby the posterior pole and creating the globule and resulting in breakdown and liquification of posterior cortex (Eshaghian &
Streeten, 1980). PSC cataracts also result in dramatic decrease in vision due to their occurrence in central pupillary area generally. These cataracts are also associated with other systemic and optical diseases which include diabetes and retinitis pigmentosa. These cataracts can also develop as an outcome of influence of systemic medications for example oral corticosteroid (Edgar & Gilmartin, 1997;
Eshaghian & Streeten, 1980).
2. Polar
In cataract both anterior and posterior polar forms are present. Anterior cataract is present as minute white spots on anterior surface of lens in axial region representing the deviations of lens vesicle detachment. Both unilateral and bilateral forms are present. In posterior polar cataract opacification occurs at the posterior pole of the lens. They usually are symmetrical and can be identifies very simply after birth.
Both forms stationary (Berry et al., 2001; Ionides et al., 1997) and progressive have been described.
Page 12
Review of Literature
3. Total
When all the lens fiber cells become opaque it represents the total cataract
(Duke-Elder, 1963). In some cases they also result from partial cataract while in other lens become completely opaque when diagnosed from the start. These cataracts are normally bilateral and they begin as lamellar or nuclear cataract (Lambert & Drack,
1996). These cataracts are also associated with acute metabolic disorders, down syndrome, congenital rubella disease (shaggy nuclear cataracts present frequently).
Total cataracts are present in both familial (de Gottrau et al., 1993) and sporadic cases
(Jain et al., 1983).
4. Membranous
Congenital membranous cataract is a rare form which is characterized by a distorted and compressed capsule having lens with little or no epithelium or cortex on it (Duke-Elder, 1963).
Page 13
Review of Literature
CHAPTER 2
GENETICS AND MOLCULAR
DESCRIPTION OF
CATARACTS
Page 14
Review of Literature
MODE OF INHERITANCE OF CATARACT
All three types of Mendelian inheritance in cataracts have been reported including autosomal dominant (Litt et al., 1998; Liu et al., 2006), autosomal recessive
(Riazuddin et al., 2005a; Smaoui et al., 2004) and X-linked (Sun et al., 2014).
Autosomal dominant congenital cataracts (adCC) with high penetrance are the most frequent. Cataracts that are identical phenotypically can be a result of mutations at different genetic loci with different inheritance pattern whereas cataracts with variable phenotype can be present in same family (Hejtmancik, 2010). In autosomal dominant cataracts more than 22 genes/loci are involved. While in case of autosomal recessive congenital cataracts (arCC) 19 genes/loci have been reported so far. Many cases of X- linked inheritance pattern have also been seen in cataract with Nance-Horan syndrome (cataract dental syndrome).
GENES INVOLVED IN RECESSIVE CONGENITAL
CATARACTS
There are total sixteen genes reported to involve in causing cataract of recessive inheritance. Mutations in genes encoding crystallins, connexins, membranous, gapjunctions and heat shock proteins have been reported so far.
Following are the genes involved in autosomal recessive congenital cataracts:
EPHA2
EPHA2 / Eph-receptor-type-A2 is the epithelial cell kinase. Eph receptors represent the major family of receptors tyrosine kinase which together work with membrane bound ephrin ligands playing a very vital part in morphogenesis and also in various developmental activities (Herath et al., 2006). EPHA2 gene localizes to
Page 15
Review of Literature
chromosome 1 having 17 coding exons encodes a 976 amino acid, type-1
transmembrane protein. This protein consists of an extracellular NH2-terminal and a
cytoplasmic COOH-terminal halves (Himanen & Nikolov, 2003). The extracellular
terminal region contains a preserved Eph-ligand binding domain, a cysteine rich EGF-
like domain and two fibronectin type 3 repeats. While the cytoplasmic terminal half
comprises a tyrosine kinase domain and a sterile α motif (SAM) domain with a
compact helical structure that is thought to assist the protein-protein interactions
(Stapleton et al., 1999). Kaul and coworkers reported missense mutation in a Pakistani
family with four individuals affected with nuclear cataract. This missense variation
resulted in conversion of Alanine into Threonine at position 785 (Kaul et al., 2010a).
In-silico analysis including SIFT and PolyPhen-2 also supported the results and
predicted the mutation to be deleterious. This was the first report of EPHA2
involvement in cataract of recessive mode of inheritance. Shiels and colleagues for
the first time reported the function of this gene in lens opacity in a cataract family
with autosomal dominant mode of inheritance. A missense mutation was reported that
resulted in conversion of Glycine at position 948 into tryptophan indicating that
predicted substitution may inhibits the oligomerization of Eph-receptor and also its
clustering into higher order complexes which are crucial for physiologic signaling
(Shiels et al., 2008).
Table 1.1: Reported mutations in EPHA2 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype p.A785T c.2353G>A 14 Nuclear - Pakistan (Kaul et al., 2010a) p.Y469H c.1405T>C 6 - Persistent Saudi (Aldahmesh et fetus Arabia al., 2012b) vasculature
Page 16
Review of Literature
GJA8/Connexin (CX50)
Extensive network of gap junction proteins is important for inter cellular communications among the cells of the lens thus preserving the lens fiber cells homeostasis. Gap junctions are smaller membranous structures comprising clusters of fine intercellular channels. These channels allow the small solutes (≤ 1kDa) and ions to pass through, thus behaving as functional syncytium and distributing the ions and small metabolites through lens fibers (Goodenough et al., 1980; Sperelakis & Cole,
1989). Each gap junction channel consists of two hemi-channels, or connexons which harbors in extracellular space between neighboring cells and these connexons are composed of six integral transmembrane subunits called connexins (Goodenough et al., 1996). Structural proteins belonging to multigene family connexin constitute the intercellular networks present in gap junctions. Expression of three discrete connexin
(CX) genes; CX43, CX46, and CX50 have been observed in lens (Goodenough,
1992). GJA8/CX50 gene located on chromosome 1q21.1 comprises two exons (one of which non-coding). This gene encodes a protein consisting of 433 amino acid residues. Ponnam and colleagues in 2007 described the involvement of this gene in recessive congenital cataract with nystagmus and amblyopia. But one affected member with microphthalmia and microcornea due to severe visual deprivation
(Ponnam et al., 2007). It was also observed that microphthalmia was also characteristic of knock out mice signifying its role for normal eye development and proper growth (White et al., 1998). An insertion consisting of single base resulting in frameshift at codon 203 of connexin 50 co-segregating with the disease phenotype was reported. This mutation was expected to damage the second extracellular domain followed by deterioration of transmembrane and cytoplasmic domains thus producing a null allele leading to unstable and nonfunctional protein. While in case of autosomal
Page 17
Review of Literature
dominant cataract conversion of proline into serine at position 88 was reported for the
first time by Shiels and coworkers (Shiels et al., 1998). GJA8 have also been reported
to express in mouse brain besides its significance for the lens transparency and
functional integrity. Therefore it is not surprising that this gene is also associated with
psychiatric or neurologic conditions like schizophrenia (Ni et al., 2007).
Table 1.2: Reported mutations in GJA8 gene
Nucleotide Cataract Additional AA Change Exon Population Reference Change Phenotype Phenotype (Ponnam et p.T203NfsX47 c.608insA 2 Total Nystagmus India al., 2007) Dense (Schmidt et p.A256GfsX1 c.767insG 2 Triangular - Germany al., 2008) Nuclear (Ponnam et p.V196M c.649G>A 2 - - India al., 2013) (Ma et al., p.I31HfsX18 c. 89dupT 2 - - Australia 2016)
FYCO1
FYCO1 gene on chromosome 3 comprises 18 exons covering 79 Kb. This
gene encodes a protein consisting of 1478 amino acids (Kiss et al., 2002a; Kiss et al.,
2002b). The full length FYCO1 RNA encodes 167 kDa protein. Involvement of this
gene in cataracts was first reported by Chen and coworkers in a large study which
includes thirteen consanguineous families, twelve from Pakistan and one family with
Arab Israeli origin (Chen et al., 2011). They performed genome wide scan and
calculated a collective LOD score of 33.42 at the locus CATC2 harboring FYCO1
gene. Through Sanger sequencing they identified a total of nine mutations including
Page 18
Review of Literature five nonsense mutations. Q736X mutation at exon 8 was shared by three families.
These families also shared a common haplotype of 14 consecutive SNP markers across the FYCO1 thus indicating the involvement of common ancestor. Their finding also includes a homozygous five base pair duplication and one homozygous single base pair deletion both resulting in stop codon (L1288WfsX37, A1252DfsX71 respectively) followed by premature chain termination. Their results show only one missense mutation (L1376P) at exon 16 in two families. Once again these families also shared a common 14 intragenic SNPs haplotype proposing the origin of diseased allele from a common ancestor. The structure of FYCO1 consists of a large central coiled-coil region flanked by an alpha helical RUN domain or a zinc finger domain at
N-terminus and by a FYVE domain at C-terminus. It contains a C-terminal extension with a GOLD (Golgi dynamics) domain as well as an unstructured loop region joining the GOLD and FYVE domains together. This structure is very unique to
FYCO1. Identified mutations in FYCO1 were expected to result in termination of peptide chain before formation of GOLD domain structure and ultimately resulting in loss of protein activity. Furthermore, these truncating mutations caused nonsense mediated decay by making these mRNAs potential targets as they occur in internal exons (Chen et al., 2011).
Page 19
Review of Literature
Table 1.3: Reported mutations in FYCO1 gene
Nucleotide Cataract Additional AA Change Exon Population Reference Change Phenotype Phenotype Posterior Saudi (Khan et p.I150T c.449T>C 6 - capsular Arabia al., 2015) (Chen et al., p.Q349X c.1045C>T 8 Nuclear - Pakistan 2011) (Chen et al., p.Q736X c.2206C>T 8 Nuclear - Pakistan 2011) (Chen et al., p.Q516X c.1546C>T 8 - - Israel 2011) (Aldahmesh Saudi p.A836PfsX80 c.2505del 8 - - et al., Arabia 2012b) (Chen et al., p.R921X c.2761C>T 8 - - Pakistan 2011) c.3150 (Chen et al., Splice Variant IVS9 - - Pakistan +1G>T 2011) (Chen et al., p.R944X c.2830C>T 8 - - Pakistan 2011) (Chen et al., p.A125DfsX71 c.3755delC 13 - - Pakistan 2011) c.3858- (Chen et al., p.L1288WfsX37 14 - - Pakistan 3862dupGGAAT 2011) (Chen et al., p.L1376P c.4127T>C 16 - - Pakistan 2011)
GCNT2
The GCNT2 gene on chromosome 6p24.3-24.2 extends over 137 kb. Three
different transcripts are produced as a result of alternate splicing of this gene. These
transcripts share common exons 2, 3 and have different exon 1 (1A, 1B, 1C) (Yu et
Page 20
Review of Literature
al., 2003). This gene encodes I branching enzyme glucosaminyl (N-acetyl) transferase
2 which is expressed in lens cells and erythrocytes. This enzyme is responsible for the
conversion of i antigen found in human fetus and newborn into adult I antigen (Inaba
et al., 2003; Yu et al., 2001; Yu et al., 2003). In 2011 Borck and colleagues identified
a large deletion of 93 kb mediated by Alu repeats resulting in deletion of exon 1B, 1C,
2 and 3 of GCNT2 gene in two consanguineous Pakistani families with adult i blood
group and autosomal recessive cataract (Borck et al., 2012). Earlier Yu and colleagues
in 2001 and 2003 also reported a large deletion encompassing exon 1b through 3 in a
Taiwanese woman with i adult blood group but no cataract. This deletion spanned 73
kb. Comparing the results of both studies it can be suggested that GCNT2 gene
transcript comprising exon 1B is expressed in the lens and is believed to perform a
key part in cataract development. Contrariwise mutations in exon 1C which is
expressed in reticulocytes and erythrocytes are related to adult i blood type without
cataracts development. Because GCNT2 locus is rich in short Interspersed Elements
(SINE repeats) thus it is likely prone to genomic rearrangements.
Table 1.4: Reported mutations in GCNT2 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype (Wussuki- Adult i p.G312D c.935 G>A 2 - Persia Lior et al., blood type 2011) Adult i (Pras et al., p.W328X c.983 G>A 2 - Israel blood type 2004) c.1040 Adult i Saudi (Aldahmesh p.Y347C 3 - A>G blood type Arabia et al., 2012b) Exon1B, Nuclear/anterior Adult i (Borck et al., Del - Pakistani 1C, 2, 3 polar blood type 2012)
Page 21
Review of Literature
AGK/Acylglycerolkinase
AGK also known as MuLK for multi substrate lipid kinase was identified by two different groups independently. The first group identified it as a kinase capable of phosphorylating monoacylglycerol and diacyleglycerol as well as ceramide therefore the name MuLK. Whereas the other group termed it as acylglycerol kinase for the reason that they were not able to perform ceramide phosphorylating activity (Bektas et al., 2005; Waggoner et al., 2004). Only mutation reported in this gene in autosomal recessive congenital cataract is by Aldahmesh and coworkers (Aldahmesh et al.,
2012a). They reported a splice site acceptor mutation that caused deletion of exon 8 of the gene. They suggested that mutation and expected complete truncation of kinase domain of this gene is probable to damage lenticular lipid composition by reducing the existing pool of phosphatidic acid and lysophosphatidic acid which are the products of the this enzyme.
Table 1.5: Reported mutations in AGK gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype c.424- Saudi (Aldahmesh c.A142TfsX4 8 - - 518del Arabia et al., 2012a)
TDRD7
TDRD7/ RNA granule component tudor domain-containing protein 7 has a very high expression in the vertebrate eye lens playing a very vital part in formation of cataract. TDRD7 encodes a protein of 1098 amino acids, is a member of tudor containing family and is located at 9q22.33 This gene comprises of three
LOTUS/OST-HTH domains and five conserved tudor domains. This gene has been involved in causing cataract in both human and mouse which become severe with the
Page 22
Review of Literature
age. Mutation in this gene in autosomal recessive cataract was first reported by
Lachke and colleagues in an Arab family with individuals affected with cataract
(Lachke et al., 2011). A small deletion in exon 10 of TDRD7 gene was reported which
caused elimination of Valine; a highly conserved amino acid at position 618 (Lachke
et al., 2011). They also showed in their study that this gene plays a very significant
role in regulating some particular genes which are important for development of lens
together with the genes which are responsive to stress for example HSPB1, CRYBB3,
SPARC and EPHA2.
Table 1.6: Reported mutations in TDRD7 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype p. V618 c. 1852-1854 (Lachke et 10 - Glaucoma - del del al., 2011)
CRYAB
The exact mechanism through which mutations in CRYAB gene trigger lens
opacity is not known. Brady and colleagues generated CRYAA (Brady et al., 1997)
and CRYAB (Brady et al., 2001) knock out mice and compared the expression of both
genes. Mice with disrupted CRYAA gene caused reduction in size and weight of lens
leading ultimately to cataract development and microphthalmia before 7 weeks of age.
While in case of CRYAB, the lenses developed normally throughout life of mice like
the lens of wild type. In addition to that in CRYAB knockout mice, chaperone activity
was relatively normal as compared with the CRYAA mice suggesting that CRYAB is
not necessary for normal lens development although several cataract causing
mutations are reported in this gene. The fact is these both proteins create a soluble
Page 23
Review of Literature complex (in a molar ratio of approximately 3:1) forming hetero-oligomers to maintain lens transparency (Churchill & Graw, 2011). The CRYAB gene located on chromosome 11 also belongs to sHSP family and is extensively expressed in multiple organs and tissues. Beyond the optical transparency it provides in lens, the CRYAB expression has also been reported in retina along with kidney, cardiac, and skeletal muscles where it carries out a cellular function (Srinivasan et al., 1992). In case of autosomal dominant cataract first case was reported from UK. Berry and colleagues in
2001 reported a deletion mutation c.450delA in a four generation English family affected with posterior polar cataract (Berry et al., 2001). This change caused a frameshift at amino acid position 150 thus resulting in an abnormal protein of 184 amino acids residues with 35 new amino acids at C-terminus thus affecting post translational modification reactions. First mutation in this gene in recessive cataracts of juvenile onset was reported by Safieh and colleagues in 2009 (Safieh et al., 2009).
A change in amino acid arginine into tryptophan at location 56 was reported. The recessive mode of inheritance of mutation has to be addressed in the background of nature of this mutation and its comparison with mutations reported previously.
CRYAB a small heat shock protein (sHSP) plays both functions i.e structural (as in lens fiber cells it interacts with alpha α-crystallin) and functional (serve as chaperone to stabilize and inhibit β and γ-crystallins aggregations) (Ghosh et al., 2005). The
CRYAB gene consists of 3 exons encoding 20kDa protein of 175 amino acid residues
(Chen et al., 2009).
Page 24
Review of Literature
Table 1.7: Reported mutations in CRYAB gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype Dense Saudi (Safieh et p.R56W c.166C>T 1 complete - Arabia al., 2009) white Minimal to Saudi (Khan et p.R56W c.166C>T 1 - total white Arabia al., 2015) (Jiaox et p.R11C c.31C>T 1 - - Pakistan al., 2015) (Jiaox et p.R12C c.34C>T 1 Nuclear - Pakistan al., 2015)
HSF4
HSF4 is the member of the family heat shock transcription factors that maintain the expression of heat shock proteins with regard to various cellular stresses for instance higher temperatures, viral or bacterial infections, oxidants and heavy metals. This gene encodes a 462 amino acid protein with thirteen coding exons. Two different spliced sites in exon 8 and 9 produce two different isoforms HSF4a and
HSF4b (Frejtag et al., 2001; Pirkkala et al., 2001). HSF4a diligently suppresses the transcription of other heat shock factor genes by directly binding to the heat shock elements. HSF4b isoform serves as transcription activator and the additional 30 amino acids are responsible for this action (Nakai et al., 1997; Tanabe et al., 1999). Heat shock proteins are extensively found in the lens. These proteins as chaperones play an important role protein synthesis, assembly, transportation, folding, reparation and degradation (Bukau & Horwich, 1998; Hartl, 1996). Association of HSF4 with autosomal recessive congenital cataracts was first presented by Smaoui and
Page 25
Review of Literature
colleagues in a large consanguineous Tunisian family consisting of total 63
individuals with 22 having total cataract (Smaoui et al., 2004). Sanger sequencing of
gene revealed a homozygous mutation at 5′ splice site of intron 12 (c. 1327+4A→G)
that caused deletion of exon 12 of HSF4 mRNA resulting in a frameshift (Smaoui et
al., 2004). This mutation in affected homozygotes was expected to result in a
premature stop codon thus preventing the protein translation. This ultimately results in
a thorough loss of aberrant protein function affecting disease phenotype severely
resulting in recessive cataract of congenital onset. Mutations in HSF4 gene have also
been reported in dominant forms. Remarkably all mutations reported in dominant
form so far are located in DNA binding domain adjacent to N-terminal of HSF4
however all the recessive mutations exist within hydrophobic repeats or downstream
of hydrophobic repeats (Bu et al., 2002; Forshew et al., 2005; Gillespie et al., 2014;
Ke et al., 2006; Lv et al., 2014; Sajjad et al., 2008; Smaoui et al., 2004).
Table 1.8: Reported mutations in HFS4 gene
Nucleotide Cataract Additional AA Change Exon Population Reference Change Phenotype Phenotype (Behnam et p.L174P c.521T>C 5 - Nystagmus Iran al., 2016)
Nuclear & (Forshew et p.R175P c.524G>C 5 - Pakistan cortical al., 2005) (Forshew et p.G199EfsX15 c.595-599del 6 - - Pakistan al., 2005) (Sajjad et al., p.R405X c.1213C>T 12 - - Pakistan 2008) p.M419GfsX29(del (Smaoui et al., c.1327+4A>G 13 Total - Tunisia ex 12) 2004)
Page 26
Review of Literature
GALK1
Galactokinase is the key enzyme involved in galactose metabolism. GALK1
gene encodes a protein consisting of 392 amino acids with nine exons; eight of them
are protein coding. This gene is positioned on chromosome 17q25.1. Stambolian et al
isolated cDNAs encoding human galactokinase. They identified two homozygous
missense mutations; 94 G>A (V32M) and 238 G>T (E80X) in children with
galactokinase deficiency (Stambolian et al., 1995). With GALK1 deficiency, the
accumulated galactose, in the presence of aldose reductase is transformed into
galactitol. Accumulation and subsequent osmotic swelling of galactitol leads to
cataract development (Hejtmancik & Kantorow, 2004).
Table 1.9: Reported mutations in GALK1 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype
Galactokinase African (Kolosha et al., p.M1I c.3G>T 1 - deficiency American 2000) (Kalaydjieva et al., Bulgaria, Galactokinase 1999; Kolosha et al., p.P28T c.82C>A 1 - Bosnia, deficiency 2000; Reich et al., Turkey 2002)
Galactokinase (Stambolian et al., p.V32M c.94G>A 1 - USA deficiency 1995) p.G36R/p. c.106G>C/c.6 Galactokinase (Kolosha et al., R204RfsX 1/4 Switzerland 10insG deficiency 2000) 22 p.H44Y/p. c.130C>T/c.1 Galactokinase (Kolosha et al., 1/7 - Germany G349S 045G>A deficiency 2000) p.R68C/p. c.202C>T/c.1 Galactokinase 2/8 - Australia (Hunter et al., 2001) A384P 150G>C deficiency
Galactokinase (Kolosha et al., p.G77fs c.228ins67bp 2 - USA deficiency 2000)
Page 27
Review of Literature
Galactokinase p.S79F c.236C>T 2 India (Singh et al., 2012) deficiency Galactokinase p.S79Y c.236C>A 2 India (Singh et al., 2012) deficiency
Galactokinase (Stambolian et al., p.E80X c.238G>T 2 - - deficiency 1995) p.T94NfsX Galactokinase (Kolosha et al., c.280ins7bp 2 - USA 110 deficiency 2000) (Asada et al., 1999; p.G137Vfs Galactokinase Japan/Pakist c.410delG 3 Nuclear Yasmeen et al., X27 deficiency an 2010)
Galactokinase (Yasmeen et al., p.L139P c.416T>C 3 - Pakistan deficiency 2010) p.C170Sfs c.509- Galactokinase 4 - Japan (Asada et al., 1999) X32 510delGT deficiency p.P237Lfs c.710delC/c.8 Galactokinase X27/p.T28 5/6 - Australia (Hunter et al., 2001) 63C>T deficiency 8M
p.S254Tfs Galactokinase (Kolosha et al., c.761delG 5 - Costa Rica X9 deficiency 2000) Galactokinase p.R256W c.766C>T 5 - Japan (Asada et al., 1999) deficiency Galactokinase p.T344M c.1031C>T 7 - Japan (Asada et al., 1999) deficiency Galactokinase p.G349S c.1045G>A 7 - Japan (Asada et al., 1999) deficiency
Galactokinase (Kolosha et al., p.Q382X c.1144C>T 8 - Costa Rica deficiency 2000) Galactokinase p.A384P c.1150G>C 8 India (Singh et al., 2012) deficiency
Page 28
Review of Literature
SIPA1L3
Signal induced proliferation associated 1 like 3/SIPA1L3 gene encodes 1781 amino acid protein and consist of 22 exons. It contains a Rap GTPase-activating domain, a domain of unknown function (DUF3401) and a C-terminal coiled coil domain. Evers and coworkers reported involvement of this gene in recessive cataract in a German family having two affected members. They reported a nonsense mutation p.R1497X in exon 17 of SIPA1L3. Its involvement in cataract of dominant inheritance has not been reported until now (Evers et al., 2015). A study conducted by Greenlees and coworkers showed that defects in SIPA1L3 can result in abnormalities of eye and lens in human, zebra fish and mouse (Greenlees et al., 2015). Studies on reduced expression of this gene in mouse and cell line showed that this gene is involved in accurate epithelial cell morphogenesis, polarity and cytoskeletal organization. They identified SIPA1L3 as a novel element in abnormalities of epithelial cell and in controlling normal cell behavior (Greenlees et al., 2015).
Table 1.10: Reported mutations in SIPA1L3 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype (Evers et p.R1497X c.4489C>T 17 - - Germany al., 2015)
LIM2
Lens intrinsic membrane protein/LIM2 is the second most abundant intrinsic membrane protein in lens fiber cells. The role of LIM2 is not understood clearly. It is localized at the junctional region of lens fiber membrane. In addition to that it is also present throughout the fiber cell membrane suggesting its function in lens junctional
Page 29
Review of Literature
communication (Louis et al., 1989; Tenbroek et al., 1992). The LIM2 gene is mapped
to human chromosome 19q13.4 (Lieuallen et al., 1994). This gene encodes a
conserved integral membrane protein consisting of 173 amino acids. This gene has 5
exons with first being non-coding. MP-20 the protein product of LIM2 also known as
MP-19 is a 20 kDa membrane protein with four intra-membrane domains (Arneson &
Louis, 1998) including short intracellular N- and C- termini, two extracellular loops,
the first is the larger than the second and a short intracellular loop. Early experiments
proved that the C- terminus is cytoplasmic. Involvement of this gene in cataract was
first reported by steel and coworkers in To-3 mouse. The reported mutation was a
substitution at position 15 (p.G15V) which resulted in congenital cataract (Steele et
al., 1997). There is only a single report of involvement of this gene in autosomal
recessive congenital cataract. Ponnam and coworkers reported a missense variation in
an Indian family with four affected individuals. This mutation resulted in substitution
of Glycine at position 154 into Glutamic acid (Ponnam et al., 2008). There is another
report of involvement of this gene in autosomal recessive presenile cortical cataract.
Pras and coworkers reported a missense mutation p.F105V in a three affected inbred
Iraqi Jewish family with cataract (Pras et al., 2002).
Table 1.11: Reported mutations in LIM2 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype Pulverulent (Pras et al., p.F105V c.313T>G 3 - Iraq Cortical/Nuclear 2002) Nystagmus, (Ponnam et p.G154E c.462G>A 5 - dense India al., 2008) amblyopia
Page 30
Review of Literature
BFSP1
Protein coded by BFSP1 gene is beaded fiber specific proteins (BFSPs). This protein is a member of the family of intermediate filament proteins (IF). They constitute exclusive lens structures consisting of beaded filaments; cytoskeletal structures (Perng & Quinlan, 2005). These comprises of a globular protein particle
(12-15nm) adjacent to the filament (7-9nm). The middle filamentous strand is made up of the 115 kDa protein BFSP1 (Filensin or CP-115) while the globular head includes BFSP1 and BFSP2; a 49 kDa protein (Phakinin or CP-49) (FitzGerald &
Gottlieb, 1989; Goulielmos et al., 1996). Both these proteins show greater accumulation near the end of the elongation process and all through the differentiation process from lens epithelial cells into fiber cells. Even though role of these proteins role in lens biology has not been understood evidently yet they have a significant role in keeping the lens clear (Blankenship et al., 2001). However, BFSP1 and BFSP2 genes deficient mice showed cataract development hence highlighting the key role of these proteins (Alizadeh et al., 2003; Alizadeh et al., 2002) A previous report also showed involvement BFSP2 gene in autosomal dominant cataract in humans (Conley et al., 2000; Jakobs et al., 2000). BFSP1 gene located on chromosome 20p12.1 consists of eight exons and encodes a protein of 665 amino acid residues.
Ramachandran and coworkers reported the association of this gene in autosomal recessive cataract of juvenile onset in a family of Indian origin with 11 affected and 8 unaffected individuals (Ramachandran et al., 2007). They reported a large deletion that resulted in elimination of exon six of BFSP1 gene. By Sanger sequencing of 973 bp product, a 3343 bp DNA deletion c.736-1384͟ c.957-966 covering exon 6 was found. They showed that the mutant protein product with missing exon 6 would consists of an initial 245 amino acids like wild type protein as well as new additional
Page 31
Review of Literature
six amino acids as a result of the frame shift leading to premature stop codon. The
deletion resulted in loss of a part of the rod and second coil and complete tail section
of protein. Mutation in this gene in autosomal dominant form has not been reported so
far (Ramachandran et al., 2007).
Table 1.12: Reported mutations in BFSP1 gene
Nucleotide Cataract Additional AA Change Exon Population Reference Change Phenotype Phenotype c.736-1384 _ Cortical (Ramachandran p.T246del74fsX6 6 - India c.957- progressive et al., 2007) 966del p.I271T, c.812T>C (Ma et al., 6, 8 - - Australia p.S498LfsX24 c.1492delT 2016)
LSS
Lanosterol synthatase encoded by LSS gene catalyzes the conversion of (S)-
2,3-oxidosqualene to lanosterol which is crucial early rate limiting step involved in
vitamin D synthesis and cholesterol steroid hormone (Huff & Telford, 2005). This
gene was found to express in lens (Diehn et al., 2005). Zhou and coworkers identified
two missense mutations in LSS gene in two families from America with recessive
mode of inheritance (Zhao et al., 2015). In their study they explored that lanosterol
has the ability to reduce protein aggregation and eventually lessening the chances of
lens opacity. Their study demonstrated that treatment with lanosterol resulted in
reduction of both protein aggregation in cell culture due to mutant crystalline protein
and also reduced severity of preformed cataract by means of increasing lens lucidity
in animal models. There is also possibility that the amphipathic nature of lanosterol
Page 32
Review of Literature lets it to intercalate and coat the hydrophobic core region of larger aggregates of protein. This as a result makes the aggregation water soluble gradually but effectively
(Zhao et al., 2015).
Table 1.13: Reported mutations in LSS gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype c.1741 (Zhao et p.W581R 19 Total - USA T>C al., 2015) (Zhao et p.G588S c.1762G>A 19 Total - USA al., 2015)
CRYAA
The crystallins constitute nearly 90% of the total lens proteins. These proteins are water soluble and are present in α, β and gamma crystallin forms relative to the order of their elution on gel exclusion chromatography (Graw, 2009). They are very stable proteins and play a very vital part in keeping the lens clear that is why they are excellent candidate genes for hereditary cataracts. In autosomal recessive cataract mutations in only alpha and beta crystallin forms have been reported so far.
Located on chromosome 21, the CRYAA gene contains 3 exons and encodes a protein that consists of 173 amino acids. This gene is mainly expressed in lens cells and is a member of small heat shock proteins (sHSP) with chaperone activity that plays a very important role in maintaining lens transparency (Santana et al., 2009; Sun et al., 2011). Molecular chaperone maintain the lens transparency by supporting the accurate in vivo proteins folding and are also very vital in maintaining these proteins in a condition at which they remain functional and folded appropriately (Kumar et al.,
1999). The multi-meric protein α-crystallin, is made by the product of two genes αA
Page 33
Review of Literature and αβ. αA subunit is encoded by CRYAA gene (located on chromosome 21) while αB is encoded by CRYAB gene (located on chromosome 11q). Thus this complex is important in keeping the lens transparent perhaps by ensuring the solubility of complexes formed by them and other proteins (Caspers et al., 1995). Mutations in this
αA-crystallins gene have been reported in both autosomal recessive (Pras et al., 2000) and autosomal dominant cataracts (Litt et al., 1998). In autosomal recessive cataracts a nonsense mutation in the exon 1 of CRYAA gene was reported, which resulted in conversion of amino acid tryptophan at position 9 into termination codon. This was the first report involvement of this gene in recessive inherited cataract. In case of autosomal dominant cataracts most of the reported mutations including the first one involve arginine amino acid at position 116 (Li et al., 2010; Litt et al., 1998; Vanita et al., 2006). Functional changes that are involved in R116C mutation include polydispersity, partial loss in chaperone activity, marked protein misfolding, and an increase in membrane-binding capacity (Bera & Abraham, 2002; Shroff et al., 2000).
Table 1.14: Reported mutations in CRYAA gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype (Pras et p.W9X c.27G>A 1 - - Iran al., 2000) Saudi (Khan et p.R54C c.160C>T 1 Total Microcornea Arabia al., 2007)
CRYBB3
The beta-crystallins genes are distributed into seven subdivisions. Three basic crystallins including CRYBB1, CRYBB2, CRYBB3 (22q11) and four acidic forms
CRYBA1/A3 crystallins (17q11), CRYBA2-crystallin (2q33), and CRYBA4 crystallin
Page 34
Review of Literature
(22q11) (He & Li, 2000). Only two of them CRYBB3 and CRYBB1are so far reported in recessive cataracts.
Members of beta-crystallin gene family contain 6 exons. The first exon is non- coding, the second exon encodes the NH2-terminal extension and succeeding 4 exons are responsible for 4 Greek key motifs (Wang et al., 2011). In beta-crystallins both amine and carboxyl-terminal extensions are of greater significance in protein aggregation and orientation. Loss of terminal arms can result in either increase or decrease dimerization of the beta-crystalline causing cataract (Berbers et al., 1982).
The CRYBB3 gene is an early gene and encodes 211 amino acid protein, located mainly in the nucleus of lens. Even though it is also expressed in the lens epithelial cells, its expression increases significantly as the lens epithelial cells get longer to form fiber cells in lens nucleus. The expression in lens epithelial cells also increases evidently in cataract when compared with transparent lens (Riazuddin et al.,
2005a; Zhang et al., 2008). Involvement of CRYBB3 gene in recessive cataracts was first reported by Riazuddin and coworkers in two Pakistani families with five individuals affected having nuclear cataract. They reported a missense mutation p.G165R in exon 6 of CRYBB3 gene and supported their results by analyzing some particular effects of this substitution based on atomic model of C-terminal domain of BB3-crystallin. These effects include transition in angle causing the opening of
Greek-key motif, almost 8% expansion in the domain structure, rise in charge density, destabilization and charge repulsion from neighboring arginine residues
(Riazuddin et al., 2005a). In addition of recessive cataract, mutations in this gene in autosomal dominant form of cataract have also been reported (Hansen et al., 2009;
Reis et al., 2013).
Page 35
Review of Literature
Table 1.15: Reported mutations in CRYBB3 gene
AA Nucleotide Cataract Additional Exon Population Reference Change Change Phenotype Phenotype Nuclear (Riazuddin et p.G165R c.493G>C 6 cortical - Pakistan al., 2005a) riders (Ma et al., p.G165R c. 493G>C 6 - - Australia 2016)
CRYBB1
The CRYBB1 gene is translated into a 252 amino acid protein, expressed
largely in early lens nucleus. CRYBB1 is a main subunit of beta-crystallin, accounting
for 9% of total soluble crystalline proteins in human lens and declines intensely with
age (Wang et al., 2007). Cohen and colleagues in 2007 reported the first case of
involvement of this gene in nuclear recessive cataracts. They reported a frameshift
mutation in two unrelated Israeli Bedouin families comprising 14 affected and 21
unaffected individuals. This frameshift led to missense protein sequence at amino acid
57 (c.171delG/p.G57GfsX107) truncating the CRYBB1 protein at amino acid 107
(Cohen et al., 2007). Same mutation was also reported by Khan and colleagues in
2012 in an Arab family with central pulverulent cataract (Khan et al., 2012). This
mutation resulted in abrogation of protein very close to N terminus. Mackay and
colleagues in 2002 mapped the autosomal dominant cataract first time to CRYBB1
gene on chromosome 22q11.2. They found a nonsense mutation p.G220X in exon 6.
CRYBB1 gene expression was believed to play a significant role in maintaining lens
transparency by forming heteromers with acidic beta crystallins (Mackay et al., 2002).
Page 36
Review of Literature
Table 1.16: Reported mutations in CRYBB1 gene
Nucleotide Cataract Additional AA Change Exon Population Reference Change Phenotype Phenotype Nuclear (Meyer et p.M1K c.2T>A 1 - Somalia Pulverulent al., 2009) (Cohen et p.G57GfsX107 c.171delG 2 Nuclear - Israel al., 2007) (Khan et p.N58TfsX106 c.171delG 2 Pulverulent - Arabian al., 2012)
LOCI WITHOUT KNOWN DISEASE CAUSING GENE
There are six loci for autosomal recessive congenital cataracts with
unidentified disease causing genes. Tariq and coworkers identified a locus on
chromosome 1p34.3-32.2 in two consanguineous Pakistani families. A common
linked region of 20.76 cM (20.80 Mb) flanked by markers D1S2729 and D1S2890
was identified. Sabir and colleagues identified disease loci on chromosome 3q and 8p
in two consanguineous Pakistani families. Haplotype analysis refined the critical
interval to 23.3 cM (18.01 Mb) on chromosome 3q and 37.92 cM (16.28 Mb) on
chromosome 8p with maximum LOD scores of 3.87 and 3.19 respectively at
recombination fraction 0 (Sabir et al., 2010a; Sabir et al., 2010b). Another disease
causing cataract locus on chromosome 7q21.11-q31.1 was identified in a
consanguineous Pakistani family. Linkage analysis refined the critical interval to
27.78 cM with maximum LOD score of 5.08 with marker D7S2540 (Kaul et al.,
2010b) . A locus for autosomal recessive progressive cataract on chromosome 9q13-
q22 was identified by Heon and coworkers with a LOD score of 4.7 with the marker
D9S768 to a linkage interval of 14 cM (Heon et al., 2001) .
Page 37
Review of Literature
Riazuddin et al identified a disease locus in a large consanguineous Pakistani family affected with autosomal recessive congenital nuclear cataract to a 7 cM interval on chromosome 19q12-q13.12. A maximum LOD score of 3.09 was calculated for marker D19S416 (Riazuddin et al., 2005b) .
Page 38
Review of Literature
CHAPTER 3
GENE MAPPING AND
IDENTIFICATION
Page 39
Review of Literature
LINKAGE ANALYSIS
Aim of the linkage analysis is done to pinpoint a genomic region where locus/loci controlling the expression of a trait may be present. Linked region is typically extensive because it contains many genes. Within families genomic regions containing copies of disease causing genes are co-inherited thus indicating lack of recombination between the loci and disease sharing individuals will also share alleles of markers near the disease locus. The value of probability of two alleles to be inherited together is 0.5. When the two loci are said to be linked together than the likelihood that a recombination event or crossing over will occur will be <0.5.
Recombination fraction (θ) is the rate of probability or measure of genetic distance between two loci. This distance between two loci is measured in centiMorgan (cM) and one centiMorgan is defined as genetic distance between two loci with a recombination fraction of 1%. It is typically equated to physical distance of one million base pairs. Thus 1 cM represents 0.9 Mb on sex averaged physical map
(Foroud, 1997).
HOMOZYGOSITY MAPPING
In large outbred population genetic mapping of rare recessive disorders is often very hard due to lack of families having multiple affected individuals.
Contrariwise, it is an effective approach for genetic mapping of rare recessive disorders in inbred populations. This procedure is based on the fact that affected individuals with inherited diseases are expected to possess two copies of pathogenic allele from a common ancestor i.e. two identical-by-descent alleles. As small chromosomal regions are generally transferred together therefore, the affected individuals will have identical-by-descent alleles at markers. The main strategy of the
Page 40
Review of Literature idea is the search for the homozygous DNA regions which are shared by different affected individuals and consequent identification of gene responsible for rare recessive traits.
HAPLOTYPE CONSTRUCTION
Set of alleles of different markers for a locus on a certain chromosome are shown by constructing haplotype. Alleles set (for tightly linked genes and loci) which are inherited together in the haplotype remain conserved in succeeding generations.
Crossing over is observed as a result of recombination event mainly if the loci are located distantly. For tightly linked loci, likelihood of recombination event is very less. Hence for constructing haplotype for closer markers, minimum number of cross over is taken into consideration (Strachan & Read, 2004).
LOD SCORES
LOD Score is calculated to check the significance of linkage between disease trait and specific markers. The score provides strength of evidence in favor of linkage.
푝푟표푏푎푏𝑖푙𝑖푡푦 표푓 푡ℎ푒 푑푎푡푎 𝑖푓 푡ℎ푒 푑𝑖푠푒푎푠푒 푚푎푟푘푒푟푠 푎푟푒 푙𝑖푛푘푒푑 LOD Score (Z) = Log10 × 푝푟표푏푎푏𝑖푙𝑖푡푦 표푓 푡ℎ푒 푑푎푡푎 𝑖푓 푡ℎ푒 푑𝑖푠푒푎푠푒 푚푎푟푘푒푟푠 푎푟푒 푢푛푙𝑖푛푘푒푑
Outcomes of linkage analysis are presented by calculating LOD scores. LOD scores demonstrate the relative probability that a disease locus and a genetic marker are genetically linked (with a recombination fraction theta), rather then they are unlinked. A LOD score of 3.0 or above is normally considered as an indication of linkage. LOD score of -2 or less rejects the chances of linkage to the specific region
(Ott, 1999).Various soft-wares and online programs are used to calculate the LOD score (Ott, 1999; Terwilliger & Ott, 1994).
Page 41
Review of Literature
MULTIPOINT MAPPING
Location of disease gene in combination with many linked loci is considered in multipoint linkage analysis. The distance between the loci and their order relative to one and other may be extracted from genetic map. Localization of the disease genes between two markers and for maximization of information of a series of markers is the main purpose of this technique. In this technique, a series of markers of known location, order and spacing are used to calculate the probability of the pedigree data for the disease gene to be at any position. A comparison is done between the hypothesis of presence of linkage between the disease gene and markers to the hypothesis that there is no linkage between the disease gene and specific markers. A multipoint score is calculated to search the location of disease gene between two or more markers.
DNA POLYMORPHISM
Two random chromosomes vary at approximately one in thousand nucleotides when they are compared (Kwok et al., 1996). Coding regions occupy ̴ 5% of the genome so only a slight share SNPs are likely to occur in coding regions (Nickerson et al., 1998). The most frequent method to discover DNA sequence variations before the discovery of polymerase chain reactions (PCRs) was by using restriction enzymes and southern blotting (restriction fragment length polymorphism; RFLPs) (Botstein et al., 1980). The RFLPs identify differences in genome sequence as a result of presence or absence of a restriction enzyme cutting site. A new class of short tandem repeat polymorphism was discovered with the advent of PCR (Weber & May, 1989). The
STRs are nucleotide sequences of di, tri and tetra repeats. Polymorphic markers are
Page 42
Review of Literature essential to perform the linkage analysis for checking the inheritance with the specific disease locus.
SANGER SEQUENCING AND NEXT GENERATION
SEQUENCING TECHNIQUES
Sanger sequencing is the DNA sequencing technology based on chain termination method, developed by Frederick Sanger. Huge technological developments have been made and different methods have been discovered from the time of completion of assembly of the first genome using Sanger capillary sequencing in 1977 (Sanger et al., 1977). These methods aim to increase the sequencing output as well as quality and length of reads. For the completion of human genome project in
2001, Sanger sequencing technology turned out to be the main tool (Collins et al.,
2003). Thus Sanger sequencing technique made it possible to develop innovative sequencing instrument to enhance the accuracy and increase speed while at the same time dropping the cost and manpower significantly. The NGS technologies vary from
Sanger sequencing in diverse characteristics of massively parallel analysis, cheap cost and high output. Even though NGS has made genome sequencing handy but biological elucidation and analysis of data are yet bottle neck.
Page 43
Materials and Methods
SECTION-II
MATERIALS AND
METHODS
Page 44
Materials and Methods
ETHICS STATEMENT
The Institutional Review Board (IRB) of National Centre of Excellence in
Molecular Biology, Lahore Pakistan, National Eye Institute (NEI), Bethesda MD and
Johns Hopkins University, Baltimore MD gave approval for the study. Written informed consents were taken from all the participants of the study.
IDENTIFICATION OF FAMILIES AFFECTED WITH
CATARACTS
Families with two or more individuals affected with cataracts were identified from hospitals after clinical evaluation of the patients. Families with recessive mode of inheritance of disease were selected for the research. All of the families collected were from Punjab province of Pakistan. Details of families’ data were taken by visiting these families at home. The affected individuals were examined and detailed family history and disease history was taken for cataract and other disorders.
Caste/ethnic group, age, affection status, consanguinity background and other important data were documented and familial transmission pattern of the disease was assessed. Signed consents were taken from the individuals participating in the study.
In case of minor individuals consents were taken from the parents or guardian.
CLINICAL ASSESSMENT
Clinical assessment of patients was done by performing visual acuity test, ophthalmoscopy, slit lamp examination and fundus evaluation.
Page 45
Materials and Methods i. VISUAL ACUITY TEST
Snellen chart was used to measure the visual acuity of the affected individuals while in case of younger children picture acuity was done. Tests were performed at
Layton Rahmatullah Benevolent Trust Hospital, Lahore Pakistan. ii. SLIT LAMP EXAMINATION
Slit lamp biomicroscopy was done to view the lens opacity and to document its phenotype. It was done with fully dilated pupil to determine presence and severity of cataract. iii. OPHTHALMOSCOPY
Both direct and indirect ophthalmoscopy was used to check eye disease symptoms at the back of the eye. Ophthalmoscopy is used to check the optic disc, pupil, vitreous humor and blood vessels. This exam allows the ophthalmologist to see the front of the eye i.e. eye lids, iris, conjunctiva, lens, sclera and also retina and optic disc.
COLLECTION OF BLOOD SAMPLES
10 ml blood was drawn in 50 ml Sterilin® falcon tubes having 400 µl of 0.5 M
EDTA. Blood samples were kept at -70 or at -20 till the DNA extraction. Extraction of genomic DNA was done by organic method (Sambrook et al., 1989).
DNA EXTRACTION
Blood samples were defrosted for red blood cells lysis. For washing the blood sample 35 ml of TE buffer (10 mM Tris HCl, 2mM EDTA (pH 8.0) was added in the falcon tubes. Samples were centrifuged for 20-30 minutes at 3000 rpm. Pellet was re- suspended in 40 ml TE (washing buffer) after discarding the supernatant. Washing
Page 46
Materials and Methods procedure was repeated for 3-4 times until the WBC pellet was free of hemoglobin.
Digestion of protein in WBC pellet was done by adding 50 µl proteinase K (10mg/ml) in addition to 200 µl of 10% SDS and 6 ml TNE buffer (10mM Tris HCl, 2 Mm
EDTA, 400 mM NaCl). The samples were kept overnight in an incubator shaker at temperature of 37 ˚C at a speed of 250 rpm. 1 ml of supersaturated NaCl was added for the precipitation of proteins, followed by vigorous shaking and chilling on ice for
15 minutes before centrifugation. For phase separation 3ml of phenol/chloroform/isoamlyalcohol (25:24:1) solution was added for 10 ml 0f blood sample, was mixed thoroughly and centrifuged at 3000 rpm for 20 minutes.
Supernatant having upper aqueous layer was cautiously shifted to a new tube avoiding the phenol interface thus leaving protein layer in bottom of phenol layer. DNA was obtained by using equal volumes of isopropanol. DNA was dissolved in TE buffer
(10mM Tris, 0.2 mM EDTA) after washing with 70% ethanol. DNA was then heated at 70 ˚C in water bath for an hour to deactivate any residual nucleases and proteinase
K (Sambrook et al., 1989).
DNA QUANTIFICATION
Two methods were used for the estimation of DNA concentration and quality i. GEL ELECTROPHORESIS
Agarose gel (0.8%) was used to check the quantity and quality of DNA samples. Agarose gel was prepared in 1X TBE (10 mM Tris HCl pH 8, Boric Acid,
EDTA) by dissolving 1.6 grams of agarose in 200 ml of 1X TBE buffer. Ethidium
Bromide was added before casting the gel for the visualization of DNA bands. DNA dilution was prepared by adding 2 µl of stock DNA in 8 µl of TE buffer (10 mM Tris
HCL pH 8, 0.2mM EDTA). DNA dilution (2 µl) was loaded with (3 µl) loading dye
Page 47
Materials and Methods
(0.25% bromophenol blue and 40% sucrose). The extent of florescence of particular
DNA sample as well as distance travelled was compared with the sample having known florescence and distance. DNA was visualized underneath UV light on a transilluminator. DNA concentration was estimated visually by making the comparison of concentration of samples with standard (sample with known DNA concentration). Other dilutions were prepared accordingly. ii. SPECTROPHOTOMETER
DNA concentrations were also calculated on spectrophotometer. The maximum absorption of nucleic acids is 260 nm by the reason of presence of nitrogenous bases. Contrary to that, due to presence of tryptophan residues, maximum absorption of proteins is at 280 nm. For pure DNA OD: 260/280 should be equals to
1.8. OD ratio between 260 and 280 nm decreases if there is any impurity, like protein is present.
EXCLUSION OF LOCI/GENES CAUSING AUTOSOMAL
RECESSIVE CATARACTS
Exclusion analysis was done to exclude the linkage to known cataract loci/genes. Homozygosity mapping was done on DNAs of all the affected individuals from each family. Microsatellite markers which were closely linked to each locus/genes were selected for the exclusion analysis. Markers used for genotyping were fluorescently labeled with FAM, VIC and NED dyes. Markers heterozygosity was checked from Marshfield maps. DNA dilution of 25 ng/ µl was prepared and 2 µl of DNA was used for PCR. Plate map comprising affected individuals, their normal siblings and parents was designed with 15-17 families in one plate map.
Page 48
Materials and Methods
Table 2.1: Microsatellite markers used for linkage analysis of autosomal recessive congenital cataract
PCR Conditions Locus/Gene Markers cM ASR Dye Primer Mg++ Conc. Cycle µl D1S186 67.22 81-106 VIC 0.2 2.5 mM td 64-54 °C D1S432 69.86 246-268 NED 0.2 2.0 mM Julie 53 °C CHR 1 D1S3721 72.59 204-256 NED 0.3 1.5mM Multi 52 °C (1p) D1S197 76.27 115-129 FAM 0.25 2.0 or 2.5 td 64-54 °C D1S2652 80.77 94-106 FAM 0.25 1.5 mM td 62-52 °C D1S2890 85.68 175-193 VIC 0.2 2.5 mM td 62-52 °C D1S402 31.02 249 FAM 0.15 2.5 mM Multi 55°C D1S2826 41.92 123-141 FAM 0.3 2.5 mM Multi 54 °C EPHA2 D1S436 37.05 200-240 VIC 0.15 2.5 mM Multi 55°C (1p36.13) D1S2697 37.05 273-281 FAM 0.2 2.5 mM td 62-52 °C D1S1592 38.51 243 NED 0.3 2.5 mM Multi 54 °C D1S2864 50.28 121-167 FAM 0.3 2.5 mM Multi 54 °C D1S2726 144.38 276-288 FAM 0.2 1.5 mM td 62-52 °C GJA8 D1S252 150.27 98-119 VIC 0.25 2.5 mM Multi 54 °C (1q21.2) D1S498 155.89 183-205 VIC 0.2 2.0 mM Julie 53 D1S2635 165.62 135-159 FAM 0.3 1.5 mM td 62-52 °C D3S1565 186.04 178-194 FAM 0.15 2.5 mM Multi 55°C CHR3 D3S3715 190.43 138-150 NED 0.15 2.5 mM Multi 55°C (3q) D3S3609 195.6 168-190 FAM 0.15 2.5 mM Multi 55°C D3S3685 67.94 199-225 NED 0.15 2.5 mM Multi 55°C FYCO1 D3S1581 70.61 75-105 FA,M 0.15 2.5 mM Multi 55°C (3p21.31) D3S1289 71.41 202-224 NED 0.15 2.5 mM Multi 55°C D6S1034 23.23 124-157 FAM 0.12 1.5 mM td 64-54 °C GCNT2 D6S1653 26.71 154-180 FAM 0.15 2.0 mM td 63-53 °C (6p24.3-24.2) D6S429 26.71 222-238 FAM 0.25 2.5mM td 63-53 °C D7S492 100.05 145-155 FAM 0.3 2.5 mM Multi 54 °C D7S2482 108.59 148-162 VIC 0.3 2.5 mM Multi 52 °C CHR7 D7S657 108.59 245-264 NED 0.3 2.5 mM Multi 54 °C (7q21.11- D7S2430 105.39 139-151 FAM 0.3 2.5 mM Multi 54 °C q31.1) D7S515 112.32 128-190 FAM 0.2 2.5 mM td 64-54 °C D7S692 121.41 161-171 FAM 0.25 2.5 mM td 64-54 °C D7S2554 123.01 93-121 NED 0.2 2.5 mM td 60-50 °C D7S2513 151.25 161-185 VIC 0.15 2.5 mM Multi 55°C AGK D7S661 155.1 305-337 FAM 0.15 2.5 mM Multi 55°C (7q34) D7S636 162.33 137-173 NED 0.15 2.5 mM Multi 55°C D8S550 21.33 187-217 NED 0.15 2.5 mM Multi 55°C CHR8 D8S552 26.43 110-124 NED 0.15 2.5 mM Multi 55°C (8p) D8S1827 30.49 158-168 NED 0.15 2.5 mM Multi 55°C
Page 49
Materials and Methods
D8S549 31.73 72-82 VIC 0.15 2.5 mM Multi 55°C D8S1734 46.26 107-117 FAM 0.15 2.5 mM Multi 55°C D9S933 80.31 266 FAM 0.2 2.0 mM td 65-55 °C CHR9 D9S167 83.41 260-286 NED 0.15 2.0 mM Julie 54 °C (9q13-q22) D9S776 87.29 119 FAM 0.2 2.0 mM td 64-54 °C D9S1790 88.92 176-194 FAM 0.2 2.5 mM td 64-54 °C D9S1781 99.40 237-257 NED 0.15 2.5 mM Multi 55°C TDRD7 (9q22.33) D9S287 103.42 295-315 VIC 0.15 2.5 mM Multi 55°C CRYAB D11S4090 105.75 169-189 FAM 0.15 2.5 mM Multi 55°C (11q23.1) D11S908 108.59 172-190 VIC 0.15 2.5 mM Multi 55°C D16S3043 83.1 118-150 FAM 0.2 2.5 mM Julie 54 °C HSF4 D16S421 84.4 206-216 NED 0.2 2.5 mM td 64-54 °C (16q21.1) D16S3086 85.94 182-198 FAM 0.2 2.5 mM td 64-54 °C D16Z65767 180-210 VIC 0.4 2.5 mM td 64-54 °C
D17S1862 97.60 202-232 NED 0.15 2.5 mM Multi 55°C GALK1 D17S1807 99.21 256-284 FAM 0.15 2.5 mM Multi 55°C (17q25.1) D17S785 103.53 165-193 NED 0.15 2.5 mM Multi 55°C D19S246 78.08 185-223 FAM 0.2 2.5 mM td 65-55 °C LIM2 D19S589 87.66 181-186 VIC 0.2 2.5 mM td 64-54 °C (19q13.41) D19S254 100.6 110-150 FAM 0.25 2.0 mM td 63-53 °C D19S433 51.88 195-225 VIC 0.25 2.5 mM Julie 54 °C CHR19 D19S416 58.69 165-185 FAM 0.3 2.0 mM td 65-55 °C (19q13) D19S220 61.49 265-283 FAM 0.3 2.5 mM td 65-55 °C D20S852 36.58 152-176 FAM 0.22 2.5 mM Julie 53 °C BFSP1 D20S112 39.25 199-221 VIC 0.22 2.5 mM Julie 53 °C (20p12.1) D20S860 40.55 222-239 VIC 0.2 2.5 mM Julie 54 °C D20S912 46.71 243-283 FAM 0.2 2.0 mM td 62-52 °C CRYAA D21S1411 51.49 275-319 NED 0.2 2.0 mM Julie 53 °C (21q22.3) D21S1259 52.5 208-298 FAM 0.2 2.5 mM td 62-52 °C LSS D21S1255 39.22 308-325 NED 0.15 2.5 mM Multi 55°C (21q22.3) D21S266 45.87 156-178 FAM 0.15 2.5 mM Multi 55°C D22S427 8.32 96-110 NED 0.2 2.0 mM Julie 55 °C CRYBB3 D22S686 13.6 180-220 FAM 0.2 2.0 mM Julie 55 °C (22q11.23) D22S689 28.02 202-230 FAM 0.2 2.0 mM td 64-54 °C D22S419 21.47 257-273 FAM 0.2 2.0 mM td 62-52 °C CRYBB1 D22S1167 24.74 266-278 VIC 0.22 2.5 mM td 62-52 °C (22q12.1) D22S1144 27.48 177-199 FAM 0.3 1.5 mM Multi 52°C
Page 50
Materials and Methods
GENOTYPING OF STR BY PCR
Microsatellite markers were genotyped by Polymerase Chain Reaction. 50ng genomic DNA was used to perform PCR in a 5 µl reaction mixture as explained in
Table 2.2 below.
Table 2.2: Reaction mixture for genotyping of Microsatellite markers
STOCK FINAL REQUIRED INGREDIANTS CONC. CONC. VOL. Genomic DNA 25ng/ µl 50ng 2 µl Primer (Forward+ Reverse) 4.0 pM 0.4-0.8 pM 0.1-0.2 µl dNTPs (dATP, dTTP, dGTP, 2.5 mM 250 µM 0.5 µl dCTP) PCR Buffer *10X 1X 0.5µl Taq Polymerase 5 units/µl 1 unit 0.2 µl
dH2O **q.s. to 5 µl
*10X PCR Buffer (100 mM Tris Cl-pH 8.4, 500 mM KCl, 15-25 mM MgCl2 and 1% Triton) **q.s. = quantity sufficient
PCR CYCLE FOR GENOTYPING
Gene Amp® PCR system ABI 2700 or 9700 (Applied Biosystems) were used to perform polymerase chain reaction. Touch down and Julie thermo-cycler programs were used to amplify different microsatellite markers.
Figure 2.1: Thermo-cycler program; touch down (td) 64-54 °C
Page 51
Materials and Methods
Figure 2.2: Thermo-cycler program; Julie 54 °C
GENOME WIDE SCAN
Genome wide scan was done on families which were not linked to previously reported arc genes/loci to find out novel loci. Whole genome scan was performed by using ABI PRISM® Linkage Mapping Set v2.5 MD 10; defining a ~10cM resolution human index map. The panel contains 400 microsatellite markers arranged in 28 panels; 27 for autosomes and 1 for X chromosome, at 10 cM interval. These 382 microsatellite markers on the basis of their chromosomal location and heterozygosity were designed from 1996 Genethon Human genetic map.
Each panel is divided into different sets with suitable number of markers according to their allele size range and fluorescent dyes. One set of PCR conditions and multiplex PCR protocols are optimized for all these markers.
Page 52
Materials and Methods
Table 2.3: Sets of MD10 ABI PRISM® Panel for multiplex PCRs
SET PANEL 1 Vol. Used A D1S2797, D1S2800, D1S234, D1S255, D1S2785, D1S2890, D1S484 0.15µl B D1S2878, D1S206, D1S2842, D1S2726 0.15µl C D1S249, D1S450, D1S2667, D1S196, D1S2836 0.15µl SET PANEL 2 Vol. Used A D1S207, D1S413, D1S2866, D1S438, D1S2841, D1S2697 0.15µl B D1S199, D1S252, D1S230, D1S214, D1S218, D1S425 0.15µl SET PANEL 3 Vol. Used D2S286, D2S165, D2S160, D2S2211, D2S367, D2S125, D2S325, A 0.15µl D2S337 B D2S2333, D2S126, D2S364 0.15µl C D2S206, D2S117, D2S142 0.15µl SET PANEL 4 Vol. Used A D2S319, D2S2382, D2S335, D2S162, D2S338 0.15µl B D2S112, D2S2330, D2S2216, D2S347, D2S2259, D2S168, D2S151 0.15µl SET PANEL 5 Vol. Used A D3S1263, D3S1311, D3S1565, D4S1575, D4S405, D4S1534, D4S392 0.15µl B D3S1271, D3S3681, D3S1614, D4S406, D4S414 0.15µl SET PANEL 6 Vol. Used A D3S1304, D3S1601, D4S2935, D4S415 0.15µl B D3S1262, D4S1572, D4S413, D4S426, D4S391 0.15µl C D3S1569, D3S1300, D3S1292, D3S1297, D4S1592, D4S419 0.15µl SET PANEL 7 Vol. Used A D3S1289, D3S1277, D3S1279, D3S1266, D4S1539, D4S102, D4S403 0.15µl B D3S1580, D3S2338, D4S412, D4S2964 0.15µl C D3S1267, D3S1566, D3S1278, D4S424, D4S1535 0.15µl SET PANEL 8 Vol. Used A D5S407, D5S406, D5S400, D5S422, D5S433, D6S281 0.15µl B D5S406, D6S1581, D6S262, D6S309 0.15µl
Page 53
Materials and Methods
SET PANEL 9 Vol. Used D5S408, D5S1981, D5S641, D6S264, D6S276, D6S308, D6S434, A 0.15µl D6S257 B D5S426, D6S1574, D6S287, D6S292, D6S446 0.15µl SET PANEL 10 Vol. Used A D5S436, D5S2115, D5S630, D5S647, D6S462, D6S470, D6S441 0.15µl B D5S2027, D5S428, D5S471, D6S460 0.15µl C D5S410, D5S418, D5S416 0.15µl SET PANEL 11 Vol. Used A D7S530, D7S517, D7S484, D8S264, D8S549, D8S258 0.15µl B D7S516, D7S510, D7S502. D7S630, D7S640, D8S272 0.15µl C D7S2465, D8S260, D8S1784, D8S1771 0.15µl SET PANEL 12 Vol. Used A D7S507, D7S515, D7S486, D7S519, D7S661, D8S277 0.15µl B D7S684, D8S284, D8S270 0.15µl C D7S798, D7S636, D8S505 0.15µl D D7S493, D7S531, D8S550, D8S285 0.15µl SET PANEL 13 Vol. Used D9S1677, D10S547, D11S937, D11S935, D11S902, D11S904, A 0.15µl D11S905 B D9S285, D11S4175, D11S987, D11S1314 0.15µl SET PANEL 14 Vol. Used A D9S161, D10S197, D10S1653, D10S1686, D11S901 0.15µl B D9S175, D9S287, D9S1597, D9S167, D9S288, D10S185, D10S212 0.15µl SET PANEL 15 Vol. Used D9S286, D9S1690, D9S1776, D10S591, D11S1320, D11S968, A 0.15µl D11S1338 B D9S164, D10S537, D11S4151, D11S4191, D11S925 0.15µl SET PANEL 16 Vol. Used A D9S1826, D9S1682, D9S290, D10S548, D10S1693, D11S908 0.15µl B D9S283, D10S196, D10S217, D10S165, D11S898 0.15µl C D9S1817, D9S158 0.15µl
Page 54
Materials and Methods
SET PANEL 17 Vol. Used D12S78, D12S1659, D12S1723, D12S346, D13S218, D13S217, A 0.15µl D13S175 B D12S83, D13S285, D13S170, D13S263 0.15µl SET PANEL 18 Vol. Used A D12S85, D12S351, D12S368, D12S79, D13S1265 0.15µl B D12S345, D12S99, D12S87, D12S336, D13S156 0.15µl SET PANEL 19 Vol. Used D12S364, D12S352, D12S326, D12S324, D13S158, D13S173, A 0.15µl D13S171 B D12S310, D13S159, D13S265, D13S153 0.15µl SET PANEL 20 Vol. Used A D14S475, D14S280, D14S985, D14S65, D14S258, D14S283, D14S70 0.15µl B D14S292, D14S63, D14S74, D14S261, D14S288, D14S68 0.15µl SET PANEL 21 Vol. Used A D15S130, D15S165, D16S3075, D16S3136, D16S3068, D16S503 0.15µl B D15S1002, D15S131, D15S117, D16S515, D16S520 0.15µl SET PANEL 22 Vol. Used A D15S978, D15S120, D16S3046, D16S415, D16S3103 0.15µl B D15S205, D15S128, D16S404, D16S516 0.15µl C D15S1007, D15S1012, D15S994, D16S423 0.15µl SET PANEL 23 Vol. Used D17S1857, D17S1852, D17S799, D17S849, D18S462, D18S70, A 0.15µl D18S1102 D17S949, D17S831, D17S1868, D17S798, D17S787, D18S478, B 0.15µl D18S61 SET PANEL 24 Vol. Used A D17S944, D17S784, D18S474, D18S63, D18S464, D18S64 0.15µl D17S938, D17S921, D17SS928, D17S785, D18S53, D18S59, B 0.15µl D18S452 SET PANEL 25 Vol. Used A D19S420, D19S220, D19S414, D20S889, D20S117, D20S112, 0.15µl
Page 55
Materials and Methods
D20S171 B D19S221, D19S210, D20S100 0.15µl SET PANEL 26 Vol. Used D19S902, D20S119, D20S107, D20S186, D21S266, D22S420, A 0.15µl D22S280 B D19S884, D21S1252, D22S539 0.15µl C D22S274 0.15µl SET PANEL 27 Vol. Used D19S209, D19S418, D20S195, D20S173, D21S263, D22S283, A 0.15µl D22S315 SET X-Chromosome Vol. Used DXS1227, DXS1106, DXS1060, DXS987, DXS1224, DXS8051, A 0.15µl DXS986, DXS8091, DXS991 DXS990, DXS1001, DXS1226, DXS993, DXS1047, DXS8067, B 0.15µl DXS1073, DXS1068, DXS8043 DXS1223, DXS8055, DXS8088, DXS8045, DXS8009, DXS8019, C 0.15µl DXS8080, DXS7593, DXS8077 DXS1039, DXS1214, DXS8064, DXS1196, DXS1205, DXS8069, D 0.15µl DXS1061, DXS8090, DXS998 E DXS7108, DXS984, DXS1062, DXS8015, DXS1217, DXS1059 0.15µl F DXS1055, DXS8102, DXS1216, DXS8106, DXS8083, DXS8020 0.15µl
Page 56
Materials and Methods
MULTIPLEX POLYMERASE CHAIN REACTION
Working DNA dilutions of 50-100 ng/µl were prepared for two unlinked arCC families. For multiplex PCR , 200 ng of genomic DNA was used in a 5 µl reaction mixture as described in Table 2.4 below.
Table 2.4: Reaction mixture for amplification of MD10 Panel primers
INGREDIANTS FINAL CONC. REQUIRED VOL. Genomic DNA 200 ng 2 µl Primer (Forward + Reverse) 0.04 - 0.08 µM 0.1 - 0.15 µl dNTPs (dATP, dTTP, dGTP, dCTP) 250 µM 0.5 µl *10X PCR Buffer 1X 0.5 µl Taq Polymerase (5 units/ µl) 1 unit 0.2 µl
dH2O **q.s. to 5 µl
*10X PCR Buffer (100 mM Tris Cl-pH 8.4, 500 mM KCl, 15-25 mM MgCl2 and 1% Triton) **q.s. = quantity sufficient
Figure 2.3: Thermocycler program; Multiplex 54 °C
GEL ELECTROPHORESIS
The amplified PCR product for each microsatellite marker was analyzed on
2% agarose gel (2 g of agarose in 100 ml 1X Tris-Borate-EDTA (TBE) buffer) stained with ethidium bromide (0.5 µg/ml). 2 µl of amplified PCR product along with
3 µl of tracking dye (0.25% bromophenol blue and 40% sucrose) was loaded into the wells of the agarose gel. Electrophoresis was then performed in gel electrophoresis
Page 57
Materials and Methods apparatus containing 1X TBE buffer at 100 volts for 15-20 minutes and later visualized on UV Transilluminator (Biometra, Germany).
SAMPLE PREPARATIPON FOR GENETIC ANALYZER
1-1.5 µl of each PCR product (labeled with one of the fluorescent dyes FAM,
VIC and NED) was aliquoted in 96-well MicoAmp®` pooling plate using Hamilton® syringes and PCR products of 3-4 microsatellite markers were pooled together. In each well 11.8 µl Hi-DiTM Formamide (Applied Biosystems) and 0.2 µl of internal size standard LIZ® or ROX® (Applied Biosystems) mixture was also added. Pooling plan was made in such a way that marker with different allele sizes and similar dye label or markers having similar allele size, but different fluorescent label were pooled together. Denaturation of samples was done at 95 ˚C for 5 minutes. Then samples were given cold shock quickly by keeping them on ice for 10-15 minutes. Plate was sent for genotyping on ABI PRISM® 3100 or 3730 ABI Genetic Analyzer.
DATA ANALYSIS AND HAPLOTYPE CONSTRUCTION
Analysis of genotyping data was done on Genemapper software v4.0.
Haplotypes were constructed after analysis using Cyrillic software v2.1. To construct haplotype of off springs, maternal and paternal alleles for each marker were assigned in such a way so that there was minimum number of cross over involved. Proximal and distal boundaries of linkage were determined by genotyping the markers spanning the locus, which were clearly heterozygous in affected individuals. Additional family samples were collected and more microsatellite markers were typed to confirm the presumed linkage to a specific region.
Page 58
Materials and Methods
LOD SCORES CALCULATION
LOD scores were calculated through MLINK program of FASTLINK (v4.1p).
It is a DOS based computer application to calculate two point LOD scores of diseased loci (Schaffer et al., 1994). For multipoint LOD scores calculation, LINKMAP was used (Terwilliger & Ott, 1994). Genetic distances for each disease marker were based on human Marshfield genetic map and LOD scores were calculated with an allele frequency of 0.001 assuming the disease (arCC) locus to be inherited as fully penetrant autosomal recessive disorder.
Basic information of the family pedigree structure, sex of individuals, affectation status and the genotyping data for all the markers spanning the disease locus were used to create A PRE file. For each marker a PED file comprising the information about consanguineous marriages and loops in the family was generated with the help of MAKEPED program. Loops having consanguineous marriages were broken down by using MAKEPED and double entry for those individuals was used by the program.
PRIMER DESIGNING FOR SEQUENCING
Primer designing for Sanger sequencing was done using Primer3 software v.
0.4.0 (http://bioinfo.ut.ee/primer3-0.4.0/). Genomic sequence for primer designing was taken from UCSC genome browser (https://genome.ucsc.edu). To get more accurate results, intronic sequence consisting of 70-80 bp from the upstream and downstream of the exon was included for primer designing. SNPcheck3
(https://secure.ngrl.org.uk/SNPCheck/snpcheck.htm) software was used to check and avoid any single nucleotide polymorphism (SNP) in the specific region. In-Silico
Page 59
Materials and Methods
analysis on UCSC genome browser was done to check binding of the primer at
specific region of DNA.
SANGER SEQUENCING
DNA sequencing was done for the selected genes to find the disease causing
mutation. All the exon intron boundaries and 3' and 5' UTR (un-translated regions)
were sequenced. Sequencing was done on an automated ABI PRISM® 3730 Genetic
Analyzer. BigDye® Terminator v 3.1 Ready Reaction Mix (Applied Biosystems) was
used for sequencing. Segregation of causative mutation was checked in the samples
from the whole family once the mutation was identified in one or two affected
individuals. Reference sequence corresponding to all coding exons and their 5' and 3'
UTR regions were obtained from the Ensemble database.
PRIMERS SEQUENCES USED FOR SEQUENCING OF GENES
Table 2.5: Sequencing primers for GCNT2 gene
Annealing Exon Forward Primer Reverse Primer Temperature
1A1 TGTAGACACAGGTTGCAGGTT GGCTTCGAACCATGTACTCA 68-58
1A2 TTAGCAGAAGCCTGTCATCAG CTGAACTATTTCCCTGTTGGTT 68-58 1A3 CTTGTGGCCTCTGAAGTTCC TGACCATGCAGTGTTTATTCG 68-58 1B1 AGATTTTGACGGTCTCTTGACA CAGTTGTTGCTTTTTCATCCAC 68-58 1B2 GGCTATTTACATGCCCCAAA CCACATAGGCAGAGCCAAAG 68-58 1B3 AGAGCACCTGGGCAAAGAG GGCCACAGAGTGAGATCCAG 68-58 1C1 AAGCTGTCGAAATTCAAGACTG AGCCCTAAAGAGCCTTTCAA 68-58 1C2 AGAGGCTGCATTCCCTTTG GCTGATGTGGAGGTGAAGTTTT 68-58 1C3 TGTCCACCAAGAGCATACAG GCAATACACTGTTGCTACAAGC 68-58 2 TGATGAAATTGATGCCCTTC GCTGAAAACTAGCAGGAAGAAA 68-58 3 CCATTGGCACAGTTGTAGTTAG TCTACCCAGCCATCCTGTTA 68-58
Page 60
Materials and Methods
Table 2.6: Sequencing primers for LIM2 gene
Annealing Exon Forward Primer Reverse Primer Temperature 1 GACCATTGTGTAGGGAGGCTTA GCTTCCTGAGTCCTAGGTGAGA 68-58
2 CGTCTAGGTCTCCATCTCCTTC CCCAACTTAACCTTCAAACCAG 68-58
3 TTTCATCTCAGAGGTAGCAGCA AGGAGTAAGGGGTGAGAATGGT 68-58
4 ACCCCTTTCCCCAATCTTAGTT ACTCCATAGGCCTGGAGTCTTC 68-58
5 GGATACCCAGGGAGAAAGAGAGT ACGGGGACTTGAGTCTTCTCAG 68-58
Table 2.7: Sequencing primers for CRYBB1 gene
Annealing Exon Forward Primer Reverse Primer Temperature 2 TAGAGAGGAAACGAGCTCCAAG AGGTGCGGAGGAGTAAGAGG 68-58
3 GCACTGCTGGCTTTTATTTATG AGAAATGGCAGCTACTGTTGTG 68-58
4 AGGGGAGAGAGAAAGGCAAG CTCCCTACCCACCATCATCTC 68-58
5 CCCGCTAAGTTTCTTCTCTTTG AGCCTCTGATTCTGCCTGTG 68-58
6 AGGGATCAATGAAGGACAGG GGAAGTCACATCCCAGTAACTATG 68-58
Table 2.8: Sequencing primers for CRYBB3 gene
Annealing Exon Forward Primer Reverse Primer Temperature 2 TCACATCAACACCTGGCTTC AAGATGACCCTGAGGCCC 68-58
3 CTCTAATGCCCAAAGGAGGG CCTCCACACTCCCAGAAGG 68-58
4 AAACTTGAATCCTTCCTCAGC TCTCAGTGCACCCTGCTTC 68-58
5 CTGGAGCCTCCTTGACCTC TGATTCTGTTTGGAGCCAGAG 68-58
6 GAGGCAGGGTGACTGGAAG CTTCCAGTCACCCTGCCTC 68-58
Page 61
Materials and Methods
Table 2.9: Sequencing primers for CRYBB2 gene
Annealing Exon Forward Primer Reverse Primer Temperature 2 TCTCAAGGCCCCACAGAGT GCCAAGCCCATTTTACAGAA 68-58
3 ACGGCTGCTTATAGCCAGAG CAGATTTGCAGACAGGAGCA 68-58
4 GGGATTTTGCACTTGGATTT AGGATGATGGGCAGAGAGAG 68-58
5 GTAGTGGGTGCACTGGGAAG CCCCAGAGTCTCAGTTCCTG 68-58
6 CTGACCCCAGTACAGTACAGT CATTTCTCTCTCGCTGTCACTCTCTC 68-58
Table 2.10: Sequencing primers for CRYBA4 gene
Annealing Exon Forward Primer Reverse Primer Temperature
2 AGCCATGCATTGCCCCTA TCCTAGGATTCATGGGGACCT 68-58
3 GAGTTTGCAATCCCTGCTTT CTAGGGAGAGGGGACCTAGAA 68-58
4 CCGTTCTAGACCCAATTGCTG TCCGAAGTGCCCACATGA 68-58
5 GCTCCTGGGTTTCCAACTG GGTACACCTACCCCTCCCAGTA 68-58
6 ATAGATCCCTTTGCCCCTGT ACTGTGCACGGACCAGTTC 68-58
Table 2.11: Sequencing primers for EPHA2 gene
ANEALING EXON FORWARD PRIMER REVERSE PRIMER TEMPRATURE
1 68-58 CCAAGGTCCTCCTCCAAAC GACACCAGGTAGGTTCCAAAG 2 68-58 TTGGATATGGTGACCCTGTG TCTGAGCCTGGTGTGAGAAG 3A 68-58 CTCAGGCCTCAGTTTCCTTC CTCCTCCACGTTCAGCTTC 3B 68-58 GCTCCTGCAAGGAGACTTTC CCAAGATTCCATGATTCCAA
Page 62
Materials and Methods
4 68-58 CACAAGACATTTTGCCGATG CACGGCTGTGAGGTAGTGTG 5 68-58 CACACGTGAGTCTTGCAGTG CCTCCTTAAGCCCCACCT 6 68-58 AAAGAATCTGGGCTGTGGAG AGGACGCCATGTCTTCTCTC 7 68-58 CTAACAAAGGCAAGCCACCT GAGAAAGGGGCATTTCTAAGTT 8 68-58 AGTACCCTCTGGAGCCTTCC CAGGCACTTCGCTACACACT 9 68-58 TCACTTCCTCCCTGTTCCTC AGACTTGGACCAGGCTGTG 10 68-58 AGCCTGGTCCAAGTCTCTGA TACACCTCCCCAAACTCTCC 11 68-58 GTGTCACTCGGCAGAAGGT GTAGAGGAGGTGGGTGCAG 12 68-58 AGCTTTCCCCACACCTCTC GGTCACGGTGCACATAGTTC 13 68-58 GGACAAGTTCCTTCGGGTAA TACAGGTGTTCTGCCTCCTG 14 68-58 CAGGAGGCAGAACACCTGTA TGGAGCAAGCCTAAGAAGGT 15 68-58 TCCTGTCTGTTTCTGGGATG GCCATCGTGTCCAGTCTAAG 16 68-58 CCTGTTGCCCAGATAAGGAG AGTTCTGCCCTTCTCTTCCA 17A 68-58 AGCTCTCTTGCCCTACAGGT GCTAAGTGCTCAGCTGTGTG 17B 68-58 GGCCACTGGGGACTTTATT GAAGGCACTAGAGGGACAGG 17C 68-58 GGTACCTCAAGCCCCATTT CGGTTTGAATCATCTGCAAC 17D 68-58 GGGTGTCAAACATTCGTGAG ACTCTGAGCAGCCTGGAGAT
Page 63
Materials and Methods
Table 2.12: Sequencing primers for EFNB3 gene
Annealing Exon Forward Primer Reverse Primer Temperature AAGAGCCAGGCAGCCAAG CAGAGCTTCCCTACCCACTG 1 68-58
GAGGGAAGGAAAGTTCTGGG ACTGGGATCTCCCTCTTGG 2 68-58
TGCCCTCAGGCAGTGTTC AAGAGGGAGGGAGGGTGAC 3&4 68-58
CAGGTGGCTCCTTCAGTCC CCACTCACCTTCTCATAGTGGG 5A 68-58
CTTCGGAGAGTCGCCACC AGAGGTGTCCCTCAAACCAG 5B 68-58
PCR CONDITIONS AND CYCLE
For Sanger sequencing, initially two affected were selected from each family. For 25 µl reaction mixture, 100ng of genomic DNA was used to amplify each exon. Detail of reaction mixture is described below:
Table 2.13: Reaction mixture for amplification of PCR fragments
INGREDIANTS STOCK FINAL CONC. REQUIRED VOL. Genomic DNA 25 ng 100 ng 4 µl Primer (Forward) 8.0 pM 0.16 – 0.24 pM 0.5 – 0.75 µl Primer (Reverse) 8.0 pM 0.16 – 0.24 pM 0.5 – 0.75 µl dNTPs (dATP, dTTP, dGTP, dCTP) 2.5 mM 250 µM 2.5 µl PCR Buffer *10X 1X 2.5 µl Taq Polymerase (5 units/ µl) 5 units/µl 0.4 µl
dH2O **q.s. to 25 µl
*10X PCR Buffer (100 mM Tris Cl-pH 8.4, 500 mM KCl, 15-25 mM MgCl2 and 1% Triton) **q.s. = quantity sufficient
Page 64
Materials and Methods
Figure 2.4: Thermo-cycler program; touch down (td) 68-58 °C
ELECTROPHORESIS OF PCR PRODUCTS
Amplifications of PCR samples were checked on 1.5% agarose gel. 3µl of
PCR product was mixed with 2 µl of loading dye and was loaded on gel. Samples were processed for further purification if nonspecific amplification or any primer dimer were present.
PROCESSING OF PCR PRODUCT
PCR products were treated with ethanol to remove excess unincorporated nucleotides and primers. The remaining 8 µl PCR product was treated with 3M sodium acetate solution (pH 5.2, 1/10th to that of PCR product’s volume) and was mixed thoroughly. 100% ethanol was added in 2 – 2.5 volumes, was mixed well. Then samples were kept at -20 °C for about 20 minutes. Centrifugation of samples was done at 14000 rpm for 15 minutes. Pellet was washed with 75% ethanol, mixed and then centrifuged at 14000 rpm for 15 minutes after discarding the supernatant carefully. After decanting the supernatant carefully, samples were kept at room temperature to let the pellet dry. The pellet was re-suspended in 6 µl PCR water and sample was tested on gel to check the quality and quantity of purified product.
Page 65
Materials and Methods
SEQUENCING REACTION
Sequencing PCR was performed either with forward or reverse primer using
BigDye® Terminator v3.1 Ready Reaction Mix in a 96-well MicoAmp® Reaction plate
Details of reagents used in sequencing reaction:
Table 2.14: Reaction mixture for sequencing reaction
INGREDIENTS REQUIRED VOLUME Diluted DNA 1 µl Big Dye Sequencing Mix 0.8 µl Primer 1 µl *5X Dilution Buffer 1 µl
dH2O **q.s. to 10 µl
*5X Dilution Buffer (400 mM Tris HCl, pH8.7, 10 mM MgCl2) **q.s. = quantity sufficient
Figure 2.5: Thermocycling profile for sequencing reaction
Page 66
Materials and Methods
PRECIPITATION OF SEQUENCING REACTION
75 µl of 70% ethanol was added in each well of sequencing reaction. Plate was covered with aluminum foil and was kept on ice for 15 minutes. Then it was centrifuged at 4000 rpm for 20 minutes. After centrifugation, supernatant was discarded by inverting the plate on a paper towel carefully. Plate was kept in dark for
15 minutes. After 15 minutes, 12 µl of Hi-Di™ Formamide (Applied Biosystems) was added in each well. Samples were denatured at 95˚c for 5 minutes and again plate was kept on ice for 10 minutes. After short spin plate was sent for sequencing.
SEQUENCING DATA ANALYSIS
Analysis of sequencing data was done by using Sequencher® version 5.4.1
(https://www.genecodes.com) software. Files containing both sequencing data and reference sequences were exported along to the software and comparison was done to discover the disease causing mutation. Mutation once identified was checked in dbSNP (http://www.ncbi.nlm. nih.gov/SNP/) to confirm whether it is novel or reported previously. Evolutionary conservation of substituted amino acid in case of missense mutation was checked by using UCSC genome browser
(https://genome.ucsc.edu). The possible consequence of an amino acid substitution on the of protein structure was further tested with SIFT (http://sift.jcvi.org), PolyPhen-2
(http://genetics.bwh.harvard.edu/pph2/), Condel (http://bg.upf.edu/fannsdb/),
Mutation Assessor (http://mutationassessor.org/r3/), and Mutation Taster
(http://www.mutationtaster.org).
Page 67
Materials and Methods
EXOME SEQUENCING
Exome sequencing was performed on three Cataract families and two to three samples per family were selected for whole exome sequencing. Next generation sequencing approach was sued to identify the causative variant in these autosomal recessive cataract families. Whole exome sequencing libraries were prepared by using the Nextera Rapid Capture Expanded Exome kit in accordance with the manufacturer’s protocol (Illumina, San Diego, CA). Quantification of genomic DNA was done by using Fluorometer (Qubit 2.0; Invitrogen). Agilent 2100 Bioanalyzer
(Agilent, Palo Alto, CA) was used to quantitate the enriched libraries and pooled together in equal concentration. The pooled, bar-coded exome libraries were clustered using TruSeq V3 flow cell at a 13 pM concentration, and paired-end (2 × 100 bp) sequenced using the TruSeq SBS Kit V3 on a HiSeq 2000 Genome Analyzer
(Illumina).
Laser gene Genomics Suite (DNASTAR, Madison,WI) was used for bioinformatics analysis of the whole exome sequencing data. The FASTQ (paired-end raw reads) yielded by high-throughput sequencing were aligned to human genome assembly 38 (hg38/GRCH38) with the help of assembly software; SeqMan NGen version 12. Variant analysis was performed on these aligned reads by using ArrayStar
(v 12) and annotation of variants was done on the basis of sequencing depth, read quality, heterozygosity and conservation. False positive results were discarded by applying stringent criteria and all intronic, heterozygous and synonymous variants were removed. Variants with read quality ≤Q20 and sequencing depth ≤2 were also removed to ensure good data quality. Additional filtering steps were performed including the removal of those variants which were not segregating among other
Page 68
Materials and Methods affected individuals of the same family. Minor allele frequency (MAF) of the remaining variants were checked on different public databases including Exome
Variant Server (http://evs.gs.washington.edu/EVS/), 1000 Genomes
(http://www.1000genomes.org), ExAc (http://exac.broadinstitute.org) dbSNP
(http://www.ncbi.nlm.nih.gov/SNP/) and in-house exome database of ethnically matched unrelated control samples and variants with MAF ≥0.01 were discarded.
These filtering steps yielded a few homozygous, non-synonymous candidate variants common in all affected members of the family. These variants were further analyzed through criteria of pathogenicity; PHRED score ≥20, SIFT score ≤0.04, PolyPhen-2 score ≥0.6 and Gene Expression in Eye Transcript per million ≥9.
Page 69
Results and Discussion
SECTION-III
RESULTS AND DISCUSSION
Page 70
Results and Discussion
EXORDIUM
Twenty five consanguineous Pakistani families with two or more individuals affected with cataract were identified and collected from Punjab province. Almost all these families showed a pattern consistent to autosomal recessive mode of inheritance.
Exclusion analysis was done on all the collected families to exclude the already reported congenital cataract genes/loci (Table 2.1). Linkage analysis revealed linkage of five families affected with arCC with already reported genes/loci. These families were eventually sequenced to find the disease causing mutation out of which three mutations were identified in previously reported arCC genes in three linked families.
Whereas the remaining two families, one was found linked to a novel locus and another with a novel gene; as no causative mutation was identified in already reported genes of linked region.
After completion of exclusion analysis, two unlinked families consisting of multiple affected individuals were selected to perform genome wide scan. As a result of genome wide scan, one large consanguineous family was found linked to a novel locus on chromosome 17p13.3-p12.
Page 71
Results and Discussion
CHAPTER 1
LINKAGE AND
MUTATIONAL ANALYSIS
Page 72
Results and Discussion
LINKAGE & MUTATIONAL ANALYSIS OF CRYBB3
PKCC185
PKCC185 was recruited from Jhang city of Punjab Province of Pakistan. This family belongs to Sial caste. A total of nine individuals were collected including 3 affected and 6 unaffected members in two loops. Medical records showed cataract development in affected individuals of the family with an early onset. Detailed inspection of the family pedigree showed autosomal recessive mode of inheritance
(Figure 3.1).
This family showed linkage to 22q11.23 region when exclusion analysis was done with STR markers for already reported genes/loci of autosomal recessive congenital cataracts. All the affected members of the family were homozygous for the alleles of markers D22S1174, D22S419 and D22S315. A linkage interval of 19.31 cM
(8 Mb) was observed. A recombination event in individuals 12 and 13 with the alleles of marker D22S420 defined the proximal boundary of the linkage whereas recombination event in affected individual 18 with the alleles of the marker
D22S1154 set the distal boundary (Figure 3.1). Maximum two point LOD score of 3.0 was calculated at recombination fraction zero (θ=0) with the markers D22S1174,
D22S419 and D22S315 (Table 3.1).
This linked region in PKCC185 contains cluster of crystallin coding protein genes including CRYBB3, CRYBB2, CRYBB1, and CRYBA4. Sanger sequencing of all the coding exons of CRYBB3, CRYBB2, CRYBB1, CRYBA4 and exon intron boundaries along with 5' and 3' un-translated region was done to identify the pathogenic mutation in this family. A homozygous missense mutation c.493 G>C in exon 6 of the CRYBB3 gene was identified. This mutation resulted in conversion of
Page 73
Results and Discussion glycine into arginine at position 165 of polypeptide chain (Figure 3.2). This mutation segregated with the disease phenotype in an autosomal recessive manner and was absent in 192 normal control chromosomes.
Figure 3.1: Pedigree drawing and haplotype of PKCC185
Page 74
Results and Discussion
Table 3.1: Two-point LOD scores of PKCC185
Markers cM Mbps 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D22S420 4.06 17.37 -1.17 0.58 0.93 1.03 1.05 1.04 1.02 0.73 0.41 1.05 0.07 D22S1174 19.32 24.09 3.00 2.94 2.80 2.67 2.53 2.40 2.33 1.63 0.95 3.00 0.00 D22S419 21.47 25.54 3.00 2.94 2.80 2.67 2.53 2.40 2.33 1.63 0.95 3.00 0.00 D22S315 21.47 25.61 3.00 2.94 2.80 2.67 2.53 2.40 2.33 1.63 0.95 3.00 0.00 D22S1154 23.37 26.22 -3.00 -0.44 -0.03 0.13 0.21 0.26 0.27 0.24 0.11 0.27 0.10 D22S1144 27.48 27.28 − ∞ -0.97 -0.12 0.21 0.40 0.51 0.54 0.58 0.38 0.58 0.20
Figure 3.2: Sequence chromatograms of CRYBB3 gene for c.493 G>C (p.G165R) in PKCC185. A) Homozygous affected B) Heterozygous carrier
Sanger sequencing of CRYBB3 identified a previously reported G→C
transversion in family PKCC185. The affected members of the family PKCC185 were
homozygous for the c.493 G>C change, while the unaffected members were
heterozygous for the missense variation. Interestingly, mutation in PKCC185 is
already very well-known and the most commonly reported mutation in Pakistani
population. This is the seventh case representing the p.G165R mutation in Pakistani
population.
In order to keep lens transparent, the high concentration of closely packed
crystallin proteins is necessary (Delaye & Tardieu, 1983). Mutations in CRYBB3 are
reported previously in cataracts development in both autosomal dominant and
Page 75
Results and Discussion recessive inherited cataracts. Mutation p.G165R in PKCC185 is previously reported and probably only mutation reported in Pakistani population. Modeling of CRYBB3 protein mutated with p.G165R variation was done in a study which showed that arginine at amino acid position 165 resulted in opening of hair pin loop and destabilization of fourth Greek-key motif (Figure 3.4) causing the expansion and destabilization of the domain. In addition to that, charge repulsion from neighboring arginine residues and higher charge density due to insertion of relatively hydrophobic
Arginine into polar environment would destabilize the protein domain. The p.G165R mutation raises the polarity of the C-terminal domain surface resulting in repulsion and major change in electrostatic energy (Riazuddin et al., 2005a).
In silico analyses of c.493 G>C mutation with Condel, SIFT, PolyPhen-2,
Mutation Taster and Mutation Assessor were done to check the possible consequence of mutation on structure of CRYBB3 protein. Analysis with these tools confirmed that p.G165R variation would have very destructive impact on structure of CRYBB3 protein and would be highly pathogenic. Condel tool predicted this mutation as damaging with a score of 0.69. Polyphen-2 and SIFT also predicted this change to be damaging with a score of 1.0 and 0 respectively. While mutation assessor predicted the functional impact of this mutation medium with a score of 2.8, variant conservation score of 2.5 and variant specificity score of 3.1. Mutation Taster predicted this mutation as disease causing with a score of 125. Evolutionary conservation of the substituted amino acid showed that not only glycine at 165 but also the amino acids in the immediate neighborhood are highly conserved among other primates, placental mammals and vertebrates (Figure 3.3).
Page 76
Results and Discussion
Figure 3.3: Sequence alignment of CRYBB3 amino acids; illustrating conservation of G165 among its orthologs. Colored Brown: primates; Green: euarchontoglires; Blue: laurasiatheria;
and Orange: afrotheria; Black: Mammals
Page 77
Results and Discussion
Variations shown in red are identified in this this in identified are inred shown Variations
study.
Horizontal line indicates regions unknown to be specific domains specific to be unknown regions indicates line Horizontal
Schematic representation of CRYBB3 protein. ofCRYBB3 representation Schematic Figure 3.4: Figure
Page 78
Results and Discussion
LINKAGE & MUTATIONAL ANALYSIS OF LIM2
PKCC214
A consanguineous family PKCC214 was collected from Pasrur city of Sialkot district in Punjab province of Pakistan. This family belongs to Mughal caste and consists of four affected and three unaffected individuals in one loop. All the affected individuals underwent detailed medical examination which revealed nuclear cataract of congenital onset while analysis of pedigree structure of PKCC214 showed recessive mode of inheritance of disease phenotype.
Linkage analysis was performed on all the affected and unaffected members of
PKCC214 to check the involvement of previously reported genes/loci. Linkage analysis led to the identification of a homozygous region, localizing the disease on
14.5 cM interval on chromosome 19q13.41. Alleles for the markers D19S572,
D19S589, D19S888 and D19S571 showed homozygosity in all the affected individuals (Figure 3.5). Maximum two point LOD scores of 3.25, 3.25, 2.11, and
2.61 were obtained at recombination fraction zero (θ=0) using MLINK with markers
D19S572, D19S589, D19S888 and D19S571 respectively (Table 3.2). Recombination event in individual 9 at marker D19S246 defined the proximal boundary and recombination event in affected individual 10 at D19S418 on distal side set the distal boundary of linkage. Disease was localized to a linkage interval of 14.5 cM between the markers D19S246 and D19S418 harboring more than hundred genes. But according to Cat-Map database (http://cat-map.wustl.edu) LIM2 is the lone gene, reported previously to be involved in cataractogenesis.
Page 79
Results and Discussion
Sanger sequencing of four coding exons, exon intron boundaries and 5′ and 3′
UTR regions of LIM2 gene was done to identify the causative mutation. Sequence analysis of LIM2 gene discovered a novel homozygous missense mutation c.233G>A in exon 3 resulting in conversion of a smallest nonpolar amino acid Glycine at position 78 into a larger negatively charged Aspartic acid (Figure 3.6). This variation segregated with the disease phenotype in PKCC214. Screening of 192 normal control chromosomes was done to further confirm the pathogenicity of the variant. This variant was not present in any of the normal control chromosomes.
Figure 3.5: Pedigree drawing and haplotype of PKCC214
Page 80
Results and Discussion
Table 3.2: Two-point LOD scores of PKCC214
Markers cM Mb 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D19S246 78.08 50.95 − ∞ 0.07 0.46 0.60 0.66 0.69 0.69 0.58 0.35 0.69 0.1 D19S571 84.08 53.29 2.61 2.56 2.46 2.36 2.25 2.15 2.10 1.57 1.04 2.6 0 D19S888 85.87 53.65 2.11 2.06 1.96 1.87 1.77 1.67 1.63 1.14 0.64 2.1 0 D19S589 87.66 53.8 3.25 3.19 3.08 2.96 2.84 2.72 2.66 2.04 1.39 3.2 0 D19S572 88.85 54.1 3.25 3.19 3.08 2.96 2.84 2.72 2.66 2.04 1.39 3.2 0 D19S418 92.56 55.54 − ∞ 0.66 1.04 1.17 1.22 1.23 1.22 1.04 0.73 1.2 0.09 D19S254 100.61 57.66 − ∞ -3.19 -1.85 -1.26 -0.90 -0.65 -0.55 -0.05 0.05 0.05 0.3
Figure 3.6: Sequence chromatograms of LIM2 gene for c.233G>A (p.G78D) in PKCC214.
A) Homozygous affected B) Heterozygous carrier
Page 81
Results and Discussion
Figure 3.7: Slit-lamp photograph of affected individual 9 of PKCC214 depicting nuclear cataract
Table 3.3: Clinical features of PKCC214
Visual Individual Age of Age at the time Gender Acuity Clinical Findings ID onset of study (OD/OS) Since B/L Cataract, B/L 9 M 5 CF/CF Birth Nystagmus Since 10 M 6 NA B/L Cataract Birth B/L Cataract, B/L Since 11 F 4 CF/PL Nystagmus, B/L Birth pseudophakia Since 12 F 8 NA B/L Cataract Birth
M: male; F: female; OD: oculus dextrus; OS: oculus sinister; CF: counting fingers; B/L: bilateral; PL: perception of light; NA: not available.
Page 82
Results and Discussion
PKCC214 was collected from a remote village of Punjab province of Pakistan
(Figure 3.7). Medical records of affected individuals of the family revealed congenital cataract with nystagmus (Table 3.3). Slit lamp bio-microscopy of individual 9 showed bilateral nuclear cataract (Figure 3.7). No other ocular abnormalities were evident in affected participants.
PKCC214 was found linked to chromosome 19 locus harboring LIM2 gene.
Mutational analysis of LIM2 identified a novel missense homozygous variant at coding nucleotide position; c.233G>A (Irum et al., 2016b). This variant was absent in
1000 genome, ExAC browser, dbSNP database and Exome Variant Server (EVS).
LIM2 involvement in lens opaqueness was initially reported by Steel et al, in an ENU generated Total Opacity of lens # 3 (To3) mouse with autosomal semi dominant cataract (Steele et al., 1997). A single c. G>T change in the first coding exon of LIM2 gene was identified. This change led to non-conservative replacement of valine into glycine at amino acid 15 of MP19 polypeptide chain thus suggesting that MP19 may have a significant role in normal lens development as well as in cataract formation. In mouse genome, LIM2 maps to chromosome 7 (Kerscher et al.,
1995) and in human genome it maps to chromosome 19 (Church & Wang, 1993;
Lieuallen et al., 1994).
Previous studies showed that expression of LIM2 is very critical for the formation of membrane fusion and subsequent intercellular diffusion of proteins (Shi et al., 2009). From mammals to zebra fish, LIM2 gene is highly conserved across the vertebrate lineage (Vihtelic et al., 2005), showing its significant role in lens. Lens is the lone tissue in which it is recognized to express at abundant level (Lattin et al.,
2008). The role of MP19 in cell to cell fusion and intracellular adhesion has also been
Page 83
Results and Discussion suggested in some prior studies but the precise role of MP19 still needs to be confirmed. Comparative analysis of LIM2 deficient lens and wild type described the role of LIM2 in maintenance of intracellular communication, cell morphology, and cytoskeletal integrity (Shi et al., 2009).
Previously only two causal mutations in LIM2 have been identified in patients with cataracts. The mutation identified here is now a third avenue of insight into the role of LIM2 in cataractogenesis and the first reported case in Pakistani population.
Patients in all the three studies showed diverse clinical characteristics even though the cataracts are being caused by mutations in the same gene. The patients reported in the study of Pras and colleagues showed cataract development in their presenile years
(Pras et al., 2002), which is in distinction to the members of PKCC214 and the patients reported by Ponnam and colleagues, who all exhibited cataract onset in early years of life (Ponnam et al., 2008). Moreover, no additional ocular anomalies were shown by the patients of Pras & colleagues whereas cataract development in case of
PKCC214 as well as in patients reported by Ponnam & co-workers was simultaneous with nystagmus. Last but not least, cataracts morphology is also different in all the three reports. Patients in family reported by Pras et al. showed concentric layers of cortical bluish white opacification with nuclear opacities evolving from prominent sutures contrary to the patients reported by Ponnam et al. and in PKCC214; having total and nuclear cataracts respectively.
In silico analyses of c.233 G>A were done with Condel, SIFT, Polyphen-2,
Mutation Taster and Mutation Assessor to check the likely effect of mutation on structure of LIM2 protein. Analyses confirmed that p.G78D variation would not be tolerated by native structure of LIM2 protein and would be highly destructive and pathogenic. Condel predicted the c.233 G>A change as damaging with a score of
Page 84
Results and Discussion
0.61. Mutation Assessor predicted the combined functional impact score of 2.36, conservation score of 2.77 and variant specificity score of 1.95. Mutation Taster predicted this variation to be disease causing with a score of 94. Polyphen-2 provided a score of 1.0, predicting the mutation as probably damaging for the LIM2 protein.
While SIFT predicted this variation as damaging with a SIFT score of zero. Glycine at position 78 was shown to be highly conserved when its evolutionary conservation among different species was checked (Figure 3.8).
Page 85
Results and Discussion
Figure 3.8: Sequence alignment of LIM2 amino acids; illustrating conservation of G78 among its orthologs. Colored Brown: primates; Green: euarchontoglires; Blue: laurasiatheria; and Orange: afrotheria
Page 86
Results and Discussion
. .
n the transmembrane domains of LIM2 protein (MP19). (MP19). protein LIM2 of domains transmembrane the n
Mutation shown in red is identified in this study in this identified is red in shown Mutation
showing missense mutations i mutations missense showing
illustration
raphical raphical
G
Figure 3.9: Figure
Page 87
Results and Discussion
LINKAGE & MUTATIONAL ANALYSIS OF GCNT2
PKCC215
A large consanguineous familial case, PKCC215, consisting of six affected and ten unaffected individuals was ascertained from the city Patoki (Kasur District) in
Punjab province of Pakistan. This family belongs to caste Rehmani. Detailed inspection of the pedigree structure revealed autosomal recessive mode of inheritance
(Figure 3.10).
Exclusion analysis on PKCC215 was done to check the involvement of already reported genes/loci of autosomal recessive congenital cataracts. In linkage analysis, this family showed linkage to chromosome 6p24.3-24.2 markers. Additional markers were typed and haplotypes were constructed to check the linkage boundaries.
Disease phenotype was localized to a region of 12.64 cM consisting of 6.22 Mb between markers D6S309 and D6S1653. Recombination event in individuals 11 and
12 constructed the proximal boundary while the recombination event in individual 15 defined the distal boundary of linked region. All the affected individuals of the family were homozygous for the alleles of markers D6S309 and D6S470 (Figure 3.10).
Maximum two point LOD scores obtained were 5.78 and 5.53 at θ=0 with markers
D6S470 and D6S309 respectively (Table 3.4). Linkage interval on chromosome
6p24.3-24.2 harbors GCNT2; a gene involved in cataracts based on previous reports
(Borck et al., 2012).
Sanger sequencing of this gene was done including all the coding exons, exon intron boundaries along with 5' and 3' un-translated regions to identify the disease causing variation in PKCC215. PCR with the DNAs of all the affected individuals failed to give specific products when amplifications were analyzed on gel. While the
Page 88
Results and Discussion
DNAs of all unaffected members of PKCC215 yielded specific PCR products. This was the indication of a large deletion in this region. To confirm this indication, PCR were repeated but it produced the similar results.
To further investigate the disease causing variant, exome sequencing of three affected members of PKCC215 was performed and data was analyzed by applying different filtering parameters. None of the variants fulfilled the criteria of pathogenicity; sequencing depth ≥5, P not ref ≥90% and Q-call ≥50, PolyPhen-2 score
≥0.6, SIFT score ≤0.04, ≤0.01 MAF and PHRED score ≥20. Further analysis of exome sequencing data revealed the absence of variants in chromosome 6p region.
Two SNPs; rs35318586 (chr6: 10465035bp) and rs3756954 (chr6: 10724560bp), spanning 259.5 Kb were identified, suggesting the proximal and distal boundaries of deletion.
A total of 23 primer pairs were designed covering the suggested deletion and flanking 5' and 3' regions to further confirm the deletion and its boundaries (Table
3.5). Genomic DNAs of unaffected parent (individual 7) and affected child
(individual 8) were used to amplify these 23 primer pairs. PCR reactions distal to primer pair “f” and proximal to primer pair “r” failed to amplify with the genomic
DNA of the affected individual 8. After confirmation of distal and proximal boundaries of deletion, DNAs of remaining affected individuals 11, 12, 15, 16 and 18 were also used to amplify those 23 primer pairs. All the affected individuals of
PKCC215 did not yield specific PCR products in chromosome 6p region of approximately 190 Kb (chr6: 10468657-10657693) (Figure 3.11). The causal deletion on chromosome 6p harbors GCNT2, RP1-290I10.5 (long intergenic non-coding
RNA), RP11-360O19.4 (antisense non-coding RNA) and RP11-360O19.5 (processed
Page 89
Results and Discussion pseudogene). Among the deleted species, GCNT2 is the only gene expressed in ocular lens.
To further refine the proximal and distal boundaries of deletion, PCRs of genomic regions across the deletion were done by using forward primer of primer pair
“f” and reverse primer of primer pair “r” designated as LR1. An additional primer pair designated as LR2 was also designed. The forward primer of this new primer was designed proximal to forward primer of LR1 while reverse primer was designed to distal region of reverse primer of LR1. None of the 12 PCRs using primer pairs LR1,
LR2 and their reciprocal combinations yielded specific products. Thus this data suggested a complex chromosomal rearrangement at the GCNT2 locus in PKCC215 comprised of an insertion, most probably, in addition to the large deletion.
Page 90
Results and Discussion
Figure 3.10: Pedigree drawing and haplotype of PKCC215
Table 3.4: Two-point LOD scores of PKCC215
Markers cM Mb 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D6S1574 9.18 6.01 − ∞ 0.89 1.63 1.86 1.94 1.95 1.94 1.50 0.91 1.95 0.09 D6S309 14.07 8.22 5.53 5.43 5.21 5.00 4.77 4.55 4.43 3.23 1.94 5.53 0 D6S470 18.22 10.02 5.78 5.69 5.44 5.22 4.97 4.75 4.63 3.34 2.03 5.78 0 D6S1034 23.23 12.2 − ∞ 3.41 3.66 3.64 3.55 3.41 3.33 2.38 1.34 3.66 0.03 D6S1653 26.71 14.44 − ∞ -2.91 -1.52 -0.90 -0.52 -0.26 -0.16 0.33 0.34 0.34 0.3
Page 91
Results and Discussion
Figure 3.11: Graphical illustration of the GCNT2 deletion identified in PKCC215. A) Placement of primer pairs used for the amplification of the GCNT2 region. Amplification of the GCNT2 region specific primers for B) an unaffected individual C) affected members of PKCC215. Primer pairs shown in green indicate PCR amplification while primer pairs in red indicate no amplification.
Asterisk indicates the nonspecific PCR products.
Page 92
Results and Discussion
Table 3.5: The sequences, annealing temperature, product size, and region of amplification of all primer pairs Annealing Product Primers Direction Sequence temperature Region Size (°C) (bp) Forward GCCTCTGCGAAAGTGAAATG 10413447- a 68-58 407 Reverse TTGCAGCTGAGAATGTTAGGC 10413854 Forward TCCCCTTCTATTAGCCTGCTC 10462475- b 68-58 320 Reverse GGCTCTTCTGCCATGTAAGG 10462795 Forward GGAAATCATCCTTGCAGAGC 10465833- c 68-58 379 Reverse GAGGTGCCTTTGTGTTTGTG 10466212 Forward TGGCTTGGGTTCTATTCTGG 10466314- d 68-58 308 Reverse TCCAGAGCTGTGAGCGAATA 10466622 Forward TCAACCCTGACACAGTGCTT 10467543- e 68-58 365 Reverse GCACATGTCACTCTGCGTTA 10467908 Forward GGAACCGTGAGCCAATTAAA 10468290- f 70-60 384 Reverse GCAGCAGCTAACTGGTCTCC 10468674 Forward AGACCAGTTAGCTGCTGCAC 10468657- g 68-58 272 Reverse TGCCCTGCTAATTTTTGTATTTT 10468929 Forward GATTACTACCAGGGCTGTGGAC 10468697- h 70-60 184 Reverse GCCAGACTGGTCTTGAACTTCT 10468879 Forward CAGGGCTGTGGACTGTTGTA 10468706- i 70-60 434 Reverse CTGAGCAGGGGACACAACTA 10469140 Forward ACATGGCTGCCTGTCTTCA 10469216- j 70-60 362 Reverse CACCATCTGTGGTAGGCAGA 10469578 Forward ACCACATCATCTGCTAAAACG 10472212- k 70-60 369 Reverse TTGTTTTGGGTAGTGTTGACAT 10472581 Forward GTGCCAGCTGTGTGACTGTT 10488488- l 70-60 383 Reverse CCCAGGAGACATTCAGTGCT 10488871 Forward TGCATTGCGTTAGCTGAATC 10501483- m 70-60 396 Reverse ACACCAGGGTTCAGGTCCTA 10501879 Forward AGAGGTCTGGGCAATCTCTG 10653054- n 70-60 384 Reverse GTTTCCCTTGGTGGCAACT 10653438 Forward GCACTGGGAACTTGGAAATG 10654655- o 70-60 393 Reverse TGGCTCTTCCATGGACTGTT 10655048 Forward AAATGCTGCCTGGATGTTG 10656747- p 70-60 395 Reverse TCCCAAACTGCGATCTATGA 10657142 Forward GTGTGCCCACATCTCTTCCT 10657266- q 68-58 427 Reverse GGTTGGATTTGGACCATGAG 10657693 Forward CAGAGCAGGACTCCATCTCAAT 10657573- r 68-58 195 Reverse GTAGAAGCAGCCAAAAAGGAAA 10657768 Forward AACCTGCCACCTGTTCTTGT 10657690- s 68-58 421 Reverse CCCTAGCAGTGATCCCATGT 10658111 Forward GATCACTGCTAGGGCTGGAG 10658098- t 68-58 392 Reverse GTTTCCCTCTGCACCAGAAA 10658490 Forward TTTCTGGTGCAGAGGGAAAC 10658471- u 68-58 416 Reverse CACAGGACAAGCTCTGAAAACA 10658887 Forward TGTCTACTGGGGCCTGTCA 10659000- v 70-60 449 Reverse CACCACGTCCGGCTACTTT 10659449 Forward CCACATCCACCCTGGAATTA 10663284- w 68-58 396 Reverse ATGGGGTTGGAAGCCATTAT 10663680
Page 93
Results and Discussion
PKCC215, a large consanguineous family was identified and collected from a small city of Kasur district of Punjab, Pakistan. Medical record and interview with the family members showed that affected individuals of the PKCC215 developed cataracts since childhood. Ophthalmic examination with slit lamp indicated bilateral nuclear cataracts in affected members of the family (Table 3.6).
Alternating splicing of GCNT2 gene produces three different transcriptional products. These transcripts have common exon 2 and 3 with different exon 1 (exon
1A, exon 1B or exon 1C) spanning 137 Kb (Figure 3.12). Transcripts with GCNT2B isoform are expressed in epithelial cells while transcripts with only having GCNT2C isoform are expressed in reticulocytes (Yu et al., 2003). Previous studies showed that i adult phenotype is partially associated with congenital cataracts as a result of mutation in GCNT2 gene (Borck et al., 2012; Happ et al., 2016a; Yu et al., 2001; Yu et al., 2003).
Eleven different mutations including seven missense, one nonsense and three large genomic deletions have been reported previously in GCNT2 gene (Borck et al.,
2012; Happ et al., 2016a; Yu et al., 2001; Yu et al., 2003). In PKCC215, a genomic deletion consisting of 190 Kb was identified which is the largest deletion reported so far in this gene and might also be accompanied with an insertion. Borck and Yu previously reported genomic deletions which resulted in removal of exon 1B, 1C, 2 and 3 while in a most recent study, Hannah and colleagues reported a deletion that resulted in excision of exons 1A and 1B without involving isoform 1C (Borck et al.,
2012; Happ et al., 2016b) While in PKCC215, deletion involves all the coding exons including 1A, 1B 1C, 2, 3 as well as 5' and 3' un-translated region of GCNT2 gene and most probably this deletion is also accompanied with an insertion (Irum et al., 2016a).
Page 94
Results and Discussion
Table 3.6: Clinical features of PKCC215
Age of onset Age at Visual Individual Gender (through the time Acuity Clinical Findings ID family of study (OD/OS) records) 12 F Since Birth 3 Months PL/PL B/L Nuclear Cataract B/L Nuclear Cataract, B/L 15 M Since Birth 5 Years CF/CF Nystagmus 16 F Since Birth 8 Months CF/PL B/L Cataract
F: female; M: male; OD: oculus dextrus; OS: oculus sinister; CF: counting fingers; B/L: bilateral; PL: perception of light
Page 95
Results and Discussion
d through alternative splicing splicing alternative through d
C)
isoforms generate isoforms
GCNT2 GCNT2
IGnTB &IGnT IGnTB
A, A,
of the of
IGnT
(
representation
A schematic A
Figure 3.12: Figure
Page 96
Results and Discussion
CHAPTER 2
IDENTIFICATION OF
NOVEL CATARACT
GENES/LOCI
Page 97
Results and Discussion
IDENTIFICATION OF POTENTIAL NOVEL
CATARACT LOCUS AT CHR 1
PKCC206
PKCC206, comprising of four affected and four unaffected members was collected for this study from Multan district, Punjab province of Pakistan. This family belongs to Sial caste. Medical records of the affected individuals and interview with the family members confirmed the cataract development in affected members of the family during early infancy (Table 3.7). Slit lamp bio-microscopy of individual 12 showed B/L nuclear cataract (Figure 3.14). All the members of this family had no signs of any other systemic/ocular abnormalities.
Blood samples were taken from the affected and unaffected individuals of the family to perform linkage analysis. Exclusion analysis was performed on individuals of PKCC206 to screen the possible involvement of previously reported congenital cataract genes/loci. In exclusion analysis, this family showed linkage to a region on chromosome 1p36.22-p36.12. All the affected members were homozygous for the alleles of markers D1S2672, D1S3097 and D1S2697. A recombination event in individuals 13, 14 and 16 between the markers D1S2667 and D1S2672 restricted the candidate region proximally, while a cross in individuals 13 and 16 between the markers D1S2697 and D1S2864 defined the distal boundary of the linkage (Figure
3.13). A linkage interval of 25.6 cM consisting of 11.12 Mb was obtained (Figure
3.15). LOD scores were calculated using the FASTLINK version of MLINK from the
LINKAGE program package supposing the autosomal recessive mode of disease transmission. A maximum LOD score of 3.36 was obtained at recombination frequency zero (θ=0) with markers D1S2672 and D1S2697 (Table 3.8).
Page 98
Results and Discussion
The linked region on chromosome 1p36.22-p36.12 harbors EPHA2 gene. On the basis of previous reported association of this gene with congenital cataracts, it was a good candidate for sequencing to identify disease causing mutation in PKCC206
(Kaul et al., 2010a). For this purpose, Sanger sequencing was done for all the seventeen coding exons of EPHA2 gene and its exon intron boundaries along with 5' and 3' untranslated regions. Sequencing results did not reveal any causative mutation in this family except for a polymorphism; c.*297G>A (rs1803527) which showed that
EPHA2 gene at locus chromosome 1p36.22-p36.12 is not responsible for cataract phenotype in this family.
It is worth mentioning that pedigree structure of PKCC206 also suggested that disease might be inherited through an X-linked pattern. In order to exclude this, microsatellite markers for X chromosome from both MD5 and MD10 panel of ABI
PRISM® Linkage Mapping set, Version 2.5 (Applied Biosystems) were typed on
DNA samples of PKCC206. No significant two point LOD score was obtained with any of the marker thus excluding the possibility of presence of disease locus on X chromosome.
Page 99
Results and Discussion
Figure 3.13: Pedigree drawing and haplotype of PKCC206
Page 100
Results and Discussion
Figure 3.14: Slit-lamp photograph of affected individual 12 of PKCC206 showing nuclear cataract
Table 3.7: Clinical features of PKCC206
Visual Individual Age of Age at the time Gender Acuity Clinical Findings ID onset of study (OD/OS) Since B/L Nuclear Cataract, B/L 12 M 4 Years PL/HM Birth Nystagmus Since 14 M 5 Years PL/PL B/L Nuclear Cataract, Birth
M: male; OD: oculus dextrus; OS: oculus sinister; PL: perception of light; HM: hand movement; B/L: bilateral
Page 101
Results and Discussion
Table 3.8: Two-point LOD scores of PKCC206
Markers cM Mb 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D1S2667 24.68 11.42 1.63 − ∞ 1.19 1.53 1.59 1.63 1.59 1.56 1.22 0.78 0.09 D1S2672 33.75 14.95 3.36 3.36 3.29 3.14 2.99 2.84 2.70 2.62 1.85 1.07 0.00 D1S3097 - 15.71 3.06 3.06 2.99 2.85 2.71 2.57 2.43 2.36 1.67 1.00 0.00 D1S2697 37.05 16.09 3.36 3.36 3.29 3.14 2.99 2.84 2.70 2.62 1.85 1.07 0.00 D1S2864 50.28 22.54 0.52 − ∞ -0.15 0.25 0.40 0.47 0.51 0.52 0.44 0.27 0.20
During exclusion analysis, the phenotype of PKCC206 was found linked to a
locus at chromosome 1p36.22-36.12 overlapping to a previously reported locus at
chromosome 1p36.21-35.2 which has already been cloned with EPHA2 gene. The
critical interval of PKCC206 comprise of 11.12 Mb (25.6 cM) whereas the critical
region reported in previous study consisted of 15.08 Mb (20.78 cM) (Kaul et al.,
2010a) (Figure 3.15). Mutational analysis of EPHA2 gene didn't identify any disease
causing mutation in PKCC206.
The linked region on chromosome 1p36.22-36.12 harbors more than hundred
protein coding genes other than EPHA2. Some of the strong candidate genes in this
region which might be involved in cataractous lens development in this family based
on their expression in eye include; DNAJC16 (DnaJ heat shock family Hsp40
member C16); protein encoded by this gene is an integral part of membrane and is
involved in maintaining cell redox homeostasis. KAZN (kazrin periplakin interacting
protein) performs a key role in cell adhesion, desmosome assembly, epidermal
differentiation and cytoskeletal organization. FBLIM1 (Filamin binding LIM protein
1) is involved in regulation of cell morphology, cell junction assembly and regulation
of integrin triggering. ATP13A2 (ATPase 13A2) encodes a member of the P5 family
of ATPases and plays an important role in transport of inorganic cations homeostasis
Page 102
Results and Discussion and also in regulation of neuronal activity. PEX7 (paired box7) encodes a protein which is involved in protein homo-dimerization, peroxisome targeting signal and in importation of protein.
There is a possibility of involvement of any of the above gene in cataract formation in PKCC206. But the likelihood of any variation present in intronic or regulatory region of EPHA2 gene cannot be ruled out. Genetic basis of cataract development in the family could not be identified and further sequencing of candidate genes or the targeted exome sequencing of the region is needed to identify the genetic variation which causes cataract development in PKCC206.
Page 103
Results and Discussion
Figure 3.15: Relative position of microsatellite markers on chromosome 1 defining critical linkage interval of PKCC206 at chromosome 1p36.22-p36.12
Page 104
Results and Discussion
IDENTIFICATION OF A NOVEL GENE INVOLVED IN
AUTOSOMAL RECESSIVE CONGENITAL CATARACT
PKCC212
PKCC212 was collected from Rahim Yar Khan City of Punjab Province of
Pakistan. This family belongs to ethnic group ‘Rajput’ and consists of three affected and five unaffected individuals. Detailed interview with the family members of
PKCC212 and then pedigree structure analysis revealed recessive mode of cataract inheritance.
Linkage analysis was performed on PKCC212 to exclude the involvement of all the known genes/loci reported for autosomal recessive congenital cataracts. In exclusion analysis, this family was found linked to chromosome 22q11.22 region.
Additional markers were typed to confirm the linkage and subsequent proximal and distal borders were identified. A 13.16 cM region consisting of 7.5 Mb was found linked in this family. All affected members of the family were homozygous for the alleles of markers D22S427, D22S539, D22S686, D22S1174, D22S315 and
D22S1154. Recombination event in individual 11 between the markers D22S315 and
D22S1174 defined the distal boundary of the linkage (Figure 3.16). LOD scores were calculated using FASTLINK version of MLINK and a maximum LOD score of 2.51 at θ=0 was obtained with marker D22S315 (Table 3.9).
Linked region in PKCC212 harbors a cluster of crystallin genes including
CRYBB3, CRYBB1, CRYBA4 and CRYBB2. Sanger sequencing of five coding exons, exon intron boundaries along with 5' and 3' UTR regions of previously reported
CRYBB3 and CRYBB1 genes was done. Analysis of sequencing data did not identify
Page 105
Results and Discussion any pathogenic variant in both genes. Cluster of crystallins in this region also includes
CRYBB2 and CRYBA4 genes. Sanger sequencing of these genes was also done and a pathogenic mutation was identified in exon six of CRYBB2. A single nucleotide change c.463 C>T resulted in conversion of Glutamine into a premature stop codon p.Q155X (Figure 3.17). This mutation segregated with the disease phenotype in
PKCC212 and was absent in 192 ethnically matched control chromosomes.
Figure 3.16: Pedigree drawing and haplotype of PKCC212
Page 106
Results and Discussion
Table 3.9: Two-point LOD scores of PKCC212
Markers cM Mb 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D22S427 8.32 18.1 1.98 1.93 1.84 1.74 1.64 1.55 1.50 1.00 0.51 1.98 0.00 D22S539 14.44 21.9 1.98 1.93 1.84 1.74 1.64 1.55 1.50 1.00 0.51 1.98 0.00 D22S686 13.6 22.72 2.28 2.23 2.12 2.02 1.92 1.81 1.76 1.24 0.73 2.28 0.00 D22S1174 19.32 24.09 2.21 2.16 2.07 1.97 1.88 1.78 1.73 1.23 0.74 2.21 0.00 D22S315 21.47 25.61 2.51 2.46 2.36 2.25 2.15 2.05 1.99 1.47 0.95 2.51 0.00 D22S1154 23.37 26.22 2.28 2.23 2.14 2.04 1.94 1.85 1.80 1.29 0.79 2.28 0.00 D22S689 28.02 28.46 − ∞ -1.53 -0.66 -0.30 -0.10 0.04 0.09 0.27 0.22 0.27 0.20
Table 3.10 The primer sequences and amplification conditions
Annealing Gene Exon Forward Primer Reverse Primer Temp (°C) CRYBB2 TACCAGCTTGTAAGAACTTTTT TCATGTGAATTCTTAAAGTATTT 68-58 Int5 CRYBB2K1 GCAGCTGCTTAGCTGTGTG AGAGGTTGCGTAGATTCTTCAA 68-58 CRYBB2K2 AGACGCAGTTTCACCACGTT GCAGTGGTCCCCAAATGTT 68-58 CRYBB2K3 GGACATAGGGAGGGGAACAT CTTTGGCCTCTTTACCCTTG 68-58 Additional CRYBB2K4 TGGGCAGAGTAGGGATACAAA CATAGACACCAGTCACATTCCA 68-58 Primers BB2_LRP CCAGCAAATGGGAAACTTAGAGA ACAGGCATGAGCCACTATCAC 68-58 LRP5L_Ex2 AGACAGATGCATGGGGTCAT CTTGTCTGTCTTGGCATCTCC 68-58 LRP5L_Int3 CCATGGTTTACTAAAGGAGATGAAC CTCCGACCCAGGAAGAACA 68-58 BB2P1_Int2 AGAGTTTCACTGGTCTCGAAC GGCATGGCTAATAGAAGAAAGC 60-50 BB2Int5_BB CAGCTTATACCAGCTTGTAAGAACTTT TAGCCCAGATACTTGCCAATTC 68-58 2P1Ex6
Page 107
Results and Discussion
Figure 3.17: Sequence chromatograms of CRYBB2 gene for c.463 C>T (p.Q155X) in PKCC212. Homozygous affected B) Heterozygous carrier C) Homozygous Wild type
Blue arrow indicates a missense variant; c.471C>T
Figure 3.18: Slit-lamp photograph of affected individual 9 of PKCC212 showing nuclear cataract
Page 108
Results and Discussion
A partial pseudogene copy of CRYBB2 gene is located in the same cluster at a distance of nearly 250 Kb. This pseudogene CRYBB2P1 has 97% sequence homology with the original protein coding gene. There are previous reports about the gene conversion events in this region (Garnai et al., 2014; Wang et al., 2009).
In order to further confirm the results and to avoid the nonspecific amplification at this region due to presence of neighboring pseudogene, another primer pair which was more specific for functional gene was designed for the exon 6 of CRYBB2 gene. However, this primer pair for exon 6 of the gene failed to amplify; no PCR bands were seen on the gel, indicative of either gene conversion or deletion of this exon in affected individuals of the family. More primer pairs were designed for the confirmation of this suggestive deletion/conversion (Table 3.10). PCRs of additional primer pairs were performed on DNAs of affected as well as normal individuals of the family. A primer pair with forward primer from CRYBB2 sequence and reverse from CRYBB2P1 gene theoretically amplifying a 229 kb region of chromosome 22q (BB2INT5_BB2P1Ex6) (Table 3.10) amplified a region of 1832 bp in affected and carrier individuals. Sanger sequencing of this amplified product was done and analysis of sequencing data showed that out of 1832 bp product; 353 were from CRYBB2 gene and 1145 from CRYBB2P1 gene whereas remaining 334 bp between them were shared. Homozygous variations in sequencing data of affected individuals at different coding as well as non-coding positions of CRYBB2 gene were seen. Eleven of these variations including five missense (rs765894916, rs756215806, rs772533013, rs147344332, rs200845666), a nonsense (rs74315489), four synonymous (rs745938679, c.546C>T, rs758280695, c.568T>C) and one 3' UTR
(rs201645539) were present in exon six of the gene. In order to confirm proposed gene conversion, sequencing data of affected individuals was compared with
Page 109
Results and Discussion reference sequence of neighboring Pseudogene. It was found that all these variations were present as a reference sequence of CRYBB2P1, displaying complete homology, hence showing an event of homozygous gene conversion which resulted in alteration of a part of 5-6 intron, exon 6 and 3' downstream region of CRYBB2 gene into its corresponding region of neighboring CRYBB2P1. Due to sequence homology, particular nucleotide that was converted at the start and end of gene conversion event could not be traced. In addition to nonsense, out of five missense mutations present in the coding region; four were predicted as damaging/deleterious to the protein structure according to in-Silico analysis tools, while one variation was predicted as benign. These variations segregated with the disease phenotype in PKCC212; the normal individuals of the family were either heterozygous for these changes or were carrying both copies of a normal sequence of CRYBB2 gene.
Gene conversion is the process by which one DNA sequence replaces a homologous sequence in a manner that it becomes identical after conversion event.
When the above mentioned variations in PKCC212 were compared to CRYBB2P1, it was seen that all these variations were present as a reference sequence in exon six of pseudogene. Exon six in affected individuals of PKCC212 was 100% homologous with the pseudogene. These results indicated that gene conversion events had occurred which caused conversion of exon six of CRYBB2 gene into CRYBB2P1 exon six (Figure 3.19). No other variations were found in the remaining coding exons of
CRYBB2 gene.
In order to rule out DNA deletion in this region, (as a region of chromosome 22q which was 229 kb apart theoretically was amplified successfully), primers were designed from different regions between CRYBB2 and CRYBB2P1 genes. For this purpose four additional primer pairs amplifying the regions; between CRYBB2 and
Page 110
Results and Discussion
LRP5L (Primer1; 25,284,589-25,285,021), exon 2 (LRP5L_Ex2; 25,357,218-
25,357,596) and intron 3 of LRP5L (LRP5L_Int3; 25,352,495-25,352,808) and intron
2 of CRYBB2P1 gene (CRYBB2P1_Int2; 25,454,736-25,455,077) (Table 3.10) were designed. Contrary to expectations, these primers failed to amplify in affected individuals of the family in contrast to normal and carrier individuals which gave clear PCR bands on gel (Figure 3.20). Thus instead of gene conversion event of
CRYBB2 into CRYBB2P1, a large DNA deletion was evident in this region which joined these both homologous genes in affected and carrier members of the family. In the above amplified sequence, both the genes were attached together in a way that not a single nucleotide of the sequence was missing; CRYBB2 gene intron 5 was joined to the very next nucleotide of CRYBB2P1 gene at the same region (as both the genes are identical) in a way that region was containing first five exons and a part of intron 5 from CRYBB2 gene and the remaining intron 5 and exon 6 from CRYBB2P1 gene.
The exact break points of this deletion are not clear as there is a 334 bp sequence at the point of deletion between the two genes which is shared by the both.
Previously gene conversion events have been reported between the CRYBB2 and CRYBB2P1 genes but no deletion was evident ever. However, this kind of deletion where both homologous genes are joined end to end has never been reported.
More interestingly, this gene has been reported causing autosomal dominant cataract only. While in case of PKCC212, cataract was inherited in an autosomal recessive pattern. So this is the first report of the gene causing autosomal recessive cataracts, and also the first reporting the large DNA deletion between the both genes.
Medical records and family interviews of all affected members showed bilateral cataracts development at early infancy. No other ocular or systemic abnormalities were present in affected family members. Slit lamp bio-microscopy of
Page 111
Results and Discussion individual 9 revealed bilateral nuclear cataract (Figure 3.18). No ocular anomaly was revealed in any of the parent or normal individuals of the family except in individual
8 who developed glaucoma after cataract surgery which sometimes may occurs due to surgical complications. Although deleted region is the large in PKCC212 including
LRP5L gene and CRYBB2P1 exons 1-5, yet no any other clinical complication was noticed in affected members of the family. However possibility of late onset of any other disease could not be ruled out.
Page 112
Results and Discussion
Figure 3.19: Alignment of CRYBB2 exon 6 with Homologous sequence of CRYBB2P1
Figure 3.20: Agarose gel electrophoresis of PCR products of affected and unaffected members of PKCC212 obtained from four primers amplifying different regions between homologous genes; CRYBB2, CRYBB2P1. Lane L; DNA ladder.1-8; PCR amplifications of primer pair BB2_LRP, 9-16; amplifications of primer pair LRP5L_Ex2, 17-24; amplifications of primer pair LRP5L_Int3, and 25- 32; amplifications of primer pair BB2P1_Int2
Page 113
Results and Discussion
IDENTIFICATION OF A NOVEL CATARACT LOCUS
AT CHR 17
PKCC208
A large consanguineous Pakistani family; PKCC208 was collected from
Muzaffargarh District of Punjab Province. Family belongs to ‘Tagga Rajput’ caste and consisted of eight affected and nine unaffected individuals in two loops. Medical records of the family and interview with the family members indicated that cataract in affected members developed during early infancy. All the affected members of the family were operated, thus cataract picture was not available.
Initially, an exclusion analysis was done on affected and unaffected members of the PKCC208; as a result, all the reported genes/loci of recessive cataracts were excluded. A genome wide scan was performed on PKCC208 with MD10 panel of
ABI PRISM® Linkage Mapping set, Version 2.5 (Applied Biosystems). LOD scores were calculated by using the Superlink v1.4 program of easyLINKAGE Plus v5.0.
Four markers at chromosome 17 and 18 provided a significant LOD score of above one. The LOD scores obtained at recombination fraction zero (θ=0) were 1.77, 1.70,
1.19 and 1.05 with markers D17S938, D17S1791, D18S70 and D17S831 respectively
(Figure 3.22). Additional markers from MD-5 panel of ABI PRISM® Linkage
Mapping set, Version 2.5 (Applied Biosystems) were typed for both chromosomes to confirm the linkage. Genotyping results confirmed the linkage of PKCC208 at chromosome 17p13.3-p12 region. All the affected members of the family PKCC208 showed homozygosity with the alleles of markers D17S1876, D17S938, D17S1791 and D17S1852 (Figure 3.21). Two point LOD scores were calculated with
FASTLINK version of MLINK from the LINKAGE program package assuming an
Page 114
Results and Discussion autosomal mode of inheritance with 100% penetrance in both sexes and equal allele frequencies. A maximum LOD score of 6.01 was obtained with markers D17S938,
D17S1852 at θ=0 (Table 3.11). A recombination event in individuals 18 provided the proximal boundary of the linkage at marker D17S938. Whereas a recombination event in individual 10, 14 and 23; defined the distal boundary of the linkage between the markers D17S799 and D17S1852 (Figure 3.21). This placed the disease locus in
PKCC208 to 17.27 cM (6.92 Mb) interval flanked by markers D17S938 and D17S799
(Figure 3.23).
Figure 3.21: Pedigree drawing and haplotype of PKCC208
Page 115
Results and Discussion
Figure 3.22: Two-point parametric linkage analysis of genome wide scan markers of PKCC208. Asterisk indicates highest two-point LOD scores obtained with D17S938, D17S1791, D18S70 and D17S831 markers
Page 116
Results and Discussion
Table 3.11: Two-point LOD scores of PKCC208
PKCC208
Markers cM Mb 0 0.01 0.03 0.05 0.07 0.09 0.1 0.2 0.3 Zmax θmax D17S831 6.6 2 1.46 2.99 3.24 3.25 3.17 3.06 3.00 2.20 1.36 3.25 0.05 D17S1876 10.72 4.44 5.86 5.75 5.52 5.29 5.05 4.81 4.69 3.47 2.20 5.86 0.00 D17S938 14.69 6.34 6.01 5.89 5.66 5.43 5.19 4.96 4.84 3.61 2.34 6.01 0.00 D17S1791 17.92 9.25 5.86 5.75 5.53 5.31 5.08 4.85 4.73 3.52 2.26 5.86 0.00 D17S1852 22.24 10.61 6.01 5.88 5.64 5.39 5.14 4.89 4.76 3.49 2.22 6.01 0.00 D17S921 36.14 14.35 − ∞ 1.82 2.55 2.77 2.83 2.82 2.79 2.21 1.38 2.83 0.07
Page 117
Results and Discussion
Figure 3.23: Relative position of microsatellite markers on chromosome 17 defining critical linkage interval of PKCC208 at chromosome 17p13.3-p12
Page 118
Results and Discussion
PKCC208; a large consanguineous family was collected from a remote village of Muzaffargarh, Punjab, Pakistan. Genetic mapping analysis of PKCC208 identified a novel locus for autosomal recessive congenital cataract. Disease interval for this new locus in PKCC208 was mapped at chromosome 17p13.3-p12 to 17.27 cM (6.92
Mb). Previously, Berry and colleagues reported a locus for autosomal dominant anterior polar cataract mapped to chromosome 17p13.3-p13.2. A region of homozygosity on chromosome 17p consisting of 13cM flanked by markers D17S849 proximally and D17S796 distally was identified (Berry et al., 1996).
Linked interval in PKCC208 harbors more than hundred genes. Based upon their function and expression in the eye, some of the genes are very important.
EFNB3 (ephrin-b3) is a vital member of ephrin family. This gene is involved in cell to cell signaling, facilitating the transfer of information from one cell to another by soluble ligand, gap junctions or cell adhesion molecule. RCVRN (recoverin) encodes a member of recoverin family of neuronal calcium sensors. This gene is involved in a cellular process where signal is transferred to change the activity of cell or state of cell. TRAPPC1 (trafficking protein particle complex 1) encodes multi subunit transport protein and plays a vital role in vesicular transport of proteins from the endoplasmic reticulum to the Golgi apparatus. VAMP2 (vesicle associated membrane protein 2) is involved in establishment of protein complex assembly. It is also involved in fusion of the membrane of transport vesicle to its target.
Linkage interval of PKCC208 harbors many genes other than the above mentioned which are important on the basis of their function and their expression in eye. Sanger sequencing of a gene lying in critical interval was done to identify the disease causing mutation in PKCC208. All the coding exons, their boundaries and 5' and 3' untranslated regions of EFNB3 gene were sequenced. No pathogenic variation
Page 119
Results and Discussion or polymorphism was identified in this gene, thus excluding the potential candidacy of the gene in causing disease. Genetic causes of cataract formation in the family could not be identified. Sanger sequencing of more candidate genes or the targeted exome sequencing of the region is needed to identify the pathogenic variation. But the time restrictions and limited funds were the preventive factors to carry out more work in order to identify the disease causing variant.
Page 120
Conclusion
CONCLUSION
A total of twenty five families were collected for this study. Six families showed linkage to different chromosomal regions; three of them were novel. Genome wide scan with MD10 Panel was performed on two unlinked families; one family
PKCC216 remained unlinked. Genome wide scan with MD5 Panel is needed to identify the novel linkage in this family. A total of nineteen families remained unlinked in exclusion analysis which showed the genetic heterogeneity of autosomal recessive cataracts. With the availability of time and funding in future, exome sequencing or genome wide scan can be performed to identify the genetic causes of cataract phenotype in these families.
Cataract is the principal cause of blindness which involves multiples factors.
Identifying these genetic defects underlying the disease will be helpful not only in developing the cure but also in future gene therapy trials. Genetic counselling and carrier testing of the families affected with arCC will lessen the socio-economic disease burden. In addition, understanding the disease pathogenesis will also play a vital role in prenatal diagnosis and ultimately prevention of disease. We can conclude that the findings of the present work will not only contribute to the better understanding of genetics of cataracts but will also be helpful in developing therapeutic strategies and disease preventive measures.
Page 121
References
SECTION-IV
REFERENCES
Page 122
References
REFERENCES Aldahmesh, M. A., Khan, A. O., Mohamed, J. Y., Alghamdi, M. H., & Alkuraya, F.
S. (2012a). Identification of a truncation mutation of acylglycerol kinase
(AGK) gene in a novel autosomal recessive cataract locus. Hum Mutat, 33(6),
960-962.
Aldahmesh, M. A., Khan, A. O., Mohamed, J. Y., Hijazi, H., Al-Owain, M., Alswaid,
A., & Alkuraya, F. S. (2012b). Genomic analysis of pediatric cataract in Saudi
Arabia reveals novel candidate disease genes. Genet Med, 14(12), 955-962.
Alizadeh, A., Clark, J., Seeberger, T., Hess, J., Blankenship, T., & FitzGerald, P. G.
(2003). Targeted deletion of the lens fiber cell-specific intermediate filament
protein filensin. Invest Ophthalmol Vis Sci, 44(12), 5252-5258.
Alizadeh, A., Clark, J. I., Seeberger, T., Hess, J., Blankenship, T., Spicer, A., & FitzGerald,
P. G. (2002). Targeted genomic deletion of the lens-specific intermediate filament
protein CP49. Invest Ophthalmol Vis Sci, 43(12), 3722-3727.
Amaya, L., Taylor, D., Russell-Eggitt, I., Nischal, K. K., & Lengyel, D. (2003). The
morphology and natural history of childhood cataracts. Surv Ophthalmol,
48(2), 125-144.
Arneson, M. L., & Louis, C. F. (1998). Structural arrangement of lens fiber cell
plasma membrane protein MP20. Exp Eye Res, 66(4), 495-509.
Asada, M., Okano, Y., Imamura, T., Suyama, I., Hase, Y., & Isshiki, G. (1999).
Molecular characterization of galactokinase deficiency in Japanese patients.
Journal of human genetics, 44(6), 377-382.
Behnam, M., Imagawa, E., Chaleshtori, A. R., Ronasian, F., Salehi, M., Miyake, N.,
& Matsumoto, N. (2016). A novel homozygous mutation in HSF4 causing
autosomal recessive congenital cataract. J Hum Genet, 61(2), 177-179.
Page 123
References
Bektas, M., Payne, S. G., Liu, H., Goparaju, S., Milstien, S., & Spiegel, S. (2005). A
novel acylglycerol kinase that produces lysophosphatidic acid modulates cross
talk with EGFR in prostate cancer cells. J Cell Biol, 169(5), 801-811.
Bera, S., & Abraham, E. C. (2002). The alphaA-crystallin R116C mutant has a higher
affinity for forming heteroaggregates with alphaB-crystallin. Biochemistry,
41(1), 297-305.
Berbers, G. A., Boerman, O. C., Bloemendal, H., & de Jong, W. W. (1982). Primary
gene products of bovine beta-crystallin and reassociation behavior of its
aggregates. Eur J Biochem, 128(2-3), 495-502.
Berry, V., Alexander, C., Moore, A. T., Plant, C., Bhattacharya, S. S., & Shiels, A.
(1996). A locus for autosomal dominant anterior polar cataract on
chromosome 17p. Human molecular genetics, 5(3), 415-419.
Berry, V., Francis, P., Reddy, M. A., Collyer, D., Vithana, E., MacKay, I., Dawson,
G., Carey, A. H., Moore, A., Bhattacharya, S. S., & Quinlan, R. A. (2001).
Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital
posterior polar cataract in humans. Am J Hum Genet, 69(5), 1141-1145.
Blankenship, T. N., Hess, J. F., & FitzGerald, P. G. (2001). Development- and
differentiation-dependent reorganization of intermediate filaments in fiber
cells. Invest Ophthalmol Vis Sci, 42(3), 735-742.
Bloemendal, H. (1977). The vertebrate eye lens. Science, 197(4299), 127-138.
Borck, G., Kakar, N., Hoch, J., Friedrich, K., Freudenberg, J., Nurnberg, G., Yilmaz,
R., Daud, S., Baloch, D. M., Nurnberg, P., Oldenburg, J., Ahmad, J., &
Kubisch, C. (2012). An Alu repeat-mediated genomic GCNT2 deletion
underlies congenital cataracts and adult i blood group. Hum Genet, 131(2),
209-216.
Page 124
References
Botstein, D., White, R. L., Skolnick, M., & Davis, R. W. (1980). Construction of a
genetic linkage map in man using restriction fragment length polymorphisms.
Am J Hum Genet, 32(3), 314-331.
Brady, J. P., Garland, D., Duglas-Tabor, Y., Robison, W. G., Jr., Groome, A., &
Wawrousek, E. F. (1997). Targeted disruption of the mouse alpha A-crystallin
gene induces cataract and cytoplasmic inclusion bodies containing the small
heat shock protein alpha B-crystallin. Proc Natl Acad Sci U S A, 94(3), 884-
889.
Brady, J. P., Garland, D. L., Green, D. E., Tamm, E. R., Giblin, F. J., & Wawrousek,
E. F. (2001). AlphaB-crystallin in lens development and muscle integrity: a
gene knockout approach. Invest Ophthalmol Vis Sci, 42(12), 2924-2934.
Brown, N., & Bron, A. J. , . (1996). Lens Disorders: Oxford, Butterworth-
Heinemann Ltd,.
Bu, L., Jin, Y., Shi, Y., Chu, R., Ban, A., Eiberg, H., Andres, L., Jiang, H., Zheng, G.,
Qian, M., Cui, B., Xia, Y., Liu, J., Hu, L., Zhao, G., Hayden, M. R., & Kong,
X. (2002). Mutant DNA-binding domain of HSF4 is associated with
autosomal dominant lamellar and Marner cataract. Nat Genet, 31(3), 276-278.
Bukau, B., & Horwich, A. L. (1998). The Hsp70 and Hsp60 chaperone machines.
Cell, 92(3), 351-366.
Caspers, G. J., Leunissen, J. A., & de Jong, W. W. (1995). The expanding small heat-
shock protein family, and structure predictions of the conserved "alpha-
crystallin domain". J Mol Evol, 40(3), 238-248.
Chen, J., Ma, Z., Jiao, X., Fariss, R., Kantorow, W. L., Kantorow, M., Pras, E.,
Frydman, M., Pras, E., Riazuddin, S., Riazuddin, S. A., & Hejtmancik, J. F.
Page 125
References
(2011). Mutations in FYCO1 cause autosomal-recessive congenital cataracts.
Am J Hum Genet, 88(6), 827-838.
Chen, Q., Ma, J., Yan, M., Mothobi, M. E., Liu, Y., & Zheng, F. (2009). A novel
mutation in CRYAB associated with autosomal dominant congenital nuclear
cataract in a Chinese family. Mol Vis, 15, 1359-1365.
Church, R. L., & Wang, J. H. (1993). The human lens fiber-cell intrinsic membrane
protein MP19 gene: isolation and sequence analysis. Curr Eye Res, 12(12),
1057-1065.
Churchill, A., & Graw, J. (2011). Clinical and experimental advances in congenital
and paediatric cataracts. Philos Trans R Soc Lond B Biol Sci, 366(1568),
1234-1249.
Cohen, D., Bar-Yosef, U., Levy, J., Gradstein, L., Belfair, N., Ofir, R., Joshua, S.,
Lifshitz, T., Carmi, R., & Birk, O. S. (2007). Homozygous CRYBB1 deletion
mutation underlies autosomal recessive congenital cataract. Invest Ophthalmol
Vis Sci, 48(5), 2208-2213.
Collins, F. S., Morgan, M., & Patrinos, A. (2003). The Human Genome Project:
lessons from large-scale biology. Science, 300(5617), 286-290.
Conley, Y. P., Erturk, D., Keverline, A., Mah, T. S., Keravala, A., Barnes, L. R.,
Bruchis, A., Hess, J. F., FitzGerald, P. G., Weeks, D. E., Ferrell, R. E., &
Gorin, M. B. (2000). A juvenile-onset, progressive cataract locus on
chromosome 3q21-q22 is associated with a missense mutation in the beaded
filament structural protein-2. Am J Hum Genet, 66(4), 1426-1431. de Gottrau, P., Schlotzer-Schrehardt, U., Dorfler, S., & Naumann, G. O. (1993).
Congenital zonular cataract. Clinicopathologic correlation with electron
microscopy and review of the literature. Arch Ophthalmol, 111(2), 235-239.
Page 126
References
Delaye, M., & Tardieu, A. (1983). Short-range order of crystallin proteins accounts
for eye lens transparency. Nature, 302(5907), 415-417.
Diehn, J. J., Diehn, M., Marmor, M. F., & Brown, P. O. (2005). Differential gene
expression in anatomical compartments of the human eye. Genome Biol, 6(9).
Duke-Elder, S. (1963). System of ophthalmology. Normal and abnormal development.
Pt. 2: Congenital deformities: Henry Kimpton.
Duncan, G. (1981). Mechanisms of Cataract Formation in the Human Lens: Acad.
Press.
Edgar, D. F., & Gilmartin, B. (1997). Ocular adverse reactions to systemic
medication. Ophthalmic Physiol Opt, 17 Suppl 2, S2-8.
Elliott, D. B., Hurst, M. A., & Weatherill, J. (1991). Comparing clinical tests of visual
loss in cataract patients using a quantification of forward light scatter. Eye
(Lond), 5 ( Pt 5), 601-606.
Eshaghian, J., & Streeten, B. W. (1980). Human posterior subcapsular cataract. An
ultrastructural study of the posteriorly migrating cells. Arch Ophthalmol,
98(1), 134-143.
Evers, C., Paramasivam, N., Hinderhofer, K., Fischer, C., Granzow, M., Schmidt-
Bacher, A., Eils, R., Steinbeisser, H., Schlesner, M., & Moog, U. (2015).
SIPA1L3 identified by linkage analysis and whole-exome sequencing as a
novel gene for autosomal recessive congenital cataract. Eur J Hum Genet,
23(12), 1627-1633.
FitzGerald, P. G., & Gottlieb, W. (1989). The Mr 115 kd fiber cell-specific protein is
a component of the lens cytoskeleton. Curr Eye Res, 8(8), 801-811.
Foroud, T. (1997). Introduction to genetic linkage analysis. Cancer Invest, 15(6), 548-
552.
Page 127
References
Forshew, T., Johnson, C. A., Khaliq, S., Pasha, S., Willis, C., Abbasi, R., Tee, L.,
Smith, U., Trembath, R. C., Mehdi, S. Q., Moore, A. T., & Maher, E. R.
(2005). Locus heterogeneity in autosomal recessive congenital cataracts:
linkage to 9q and germline HSF4 mutations. Hum Genet, 117(5), 452-459.
Foster, A., & Resnikoff, S. (2005). The impact of Vision 2020 on global blindness.
Eye (Lond), 19(10), 1133-1135.
Francois, J. (1982). Genetics of cataract. Ophthalmologica, 184(2), 61-71.
Frejtag, W., Zhang, Y., Dai, R., Anderson, M. G., & Mivechi, N. F. (2001). Heat
shock factor-4 (HSF-4a) represses basal transcription through interaction with
TFIIF. J Biol Chem, 276(18), 14685-14694.
Garnai, S. J., Huyghe, J. R., Reed, D. M., Scott, K. M., Liebmann, J. M., Boehnke,
M., Richards, J. E., Ritch, R., & Pawar, H. (2014). Congenital cataracts: de
novo gene conversion event in CRYBB2. Molecular vision, 20, 1579.
Ghosh, J. G., Estrada, M. R., & Clark, J. I. (2005). Interactive domains for chaperone
activity in the small heat shock protein, human alphaB crystallin.
Biochemistry, 44(45), 14854-14869.
Gillespie, R. L., O'Sullivan, J., Ashworth, J., Bhaskar, S., Williams, S., Biswas, S.,
Kehdi, E., Ramsden, S. C., Clayton-Smith, J., Black, G. C., & Lloyd, I. C.
(2014). Personalized diagnosis and management of congenital cataract by
next-generation sequencing. Ophthalmology, 121(11), 2124-2137.
Goodenough, D. A. (1992). The crystalline lens. A system networked by gap
junctional intercellular communication. Semin Cell Biol, 3(1), 49-58.
Goodenough, D. A., Dick, J. S., 2nd, & Lyons, J. E. (1980). Lens metabolic
cooperation: a study of mouse lens transport and permeability visualized with
Page 128
References
freeze-substitution autoradiography and electron microscopy. J Cell Biol,
86(2), 576-589.
Goodenough, D. A., Goliger, J. A., & Paul, D. L. (1996). Connexins, connexons, and
intercellular communication. Annu Rev Biochem, 65, 475-502.
Goulielmos, G., Gounari, F., Remington, S., Muller, S., Haner, M., Aebi, U., &
Georgatos, S. D. (1996). Filensin and phakinin form a novel type of beaded
intermediate filaments and coassemble de novo in cultured cells. J Cell Biol,
132(4), 643-655.
Graw, J. (2004). Congenital hereditary cataracts. Int J Dev Biol, 48(8-9), 1031-1044.
Graw, J. (2009). Genetics of crystallins: cataract and beyond. Exp Eye Res, 88(2),
173-189.
Greenlees, R., Mihelec, M., Yousoof, S., Speidel, D., Wu, S. K., Rinkwitz, S.,
Prokudin, I., Perveen, R., Cheng, A., Ma, A., Nash, B., Gillespie, R., Loebel,
D. A., Clayton-Smith, J., Lloyd, I. C., Grigg, J. R., Tam, P. P., Yap, A. S.,
Becker, T. S., Black, G. C., Semina, E., & Jamieson, R. V. (2015). Mutations
in SIPA1L3 cause eye defects through disruption of cell polarity and
cytoskeleton organization. Hum Mol Genet, 24(20), 5789-5804.
Haargaard, B., Wohlfahrt, J., Fledelius, H. C., Rosenberg, T., & Melbye, M. (2004).
Incidence and cumulative risk of childhood cataract in a cohort of 2.6 million
Danish children. Invest Ophthalmol Vis Sci, 45(5), 1316-1320.
Haargaard, B., Wohlfahrt, J., Rosenberg, T., Fledelius, H. C., & Melbye, M. (2005).
Risk factors for idiopathic congenital/infantile cataract. Invest Ophthalmol Vis
Sci, 46(9), 3067-3073.
Hansen, L., Mikkelsen, A., Nurnberg, P., Nurnberg, G., Anjum, I., Eiberg, H., &
Rosenberg, T. (2009). Comprehensive mutational screening in a cohort of
Page 129
References
Danish families with hereditary congenital cataract. Invest Ophthalmol Vis Sci,
50(7), 3291-3303.
Happ, H., Weh, E., Costakos, D., Reis, L. M., & Semina, E. V. (2016a). Case report
of homozygous deletion involving the first coding exons of GCNT2 isoforms
A and B and part of the upstream region of TFAP2A in congenital cataract.
BMC Med Genet, 17(1), 64.
Happ, H., Weh, E., Costakos, D., Reis, L. M., & Semina, E. V. (2016b). Case report
of homozygous deletion involving the first coding exons of GCNT2 isoforms
A and B and part of the upstream region of TFAP2A in congenital cataract.
BMC Medical Genetics, 17(1), 64.
Hartl, F. U. (1996). Molecular chaperones in cellular protein folding. Nature,
381(6583), 571-579.
He, W., & Li, S. (2000). Congenital cataracts: gene mapping. Hum Genet, 106(1), 1-
13.
Hejtmancik, J. F., & Shiels, A. (2010). Genetics of Congenital Cataracts (D. A. Dartt,
Besharse, J. & Dana, R. Ed. Encyclopedia of the Eye ed.): Elsevier ; New
York :.
Hejtmancik, J. F., & Kantorow, M. (2004). Molecular genetics of age-related cataract.
Experimental eye research, 79(1), 3-9.
Heon, E., Paterson, A. D., Fraser, M., Billingsley, G., Priston, M., Balmer, A.,
Schorderet, D. F., Verner, A., Hudson, T. J., & Munier, F. L. (2001). A
progressive autosomal recessive cataract locus maps to chromosome 9q13-
q22. Am J Hum Genet, 68(3), 772-777.
Herath, N. I., Spanevello, M. D., Sabesan, S., Newton, T., Cummings, M., Duffy, S.,
Lincoln, D., Boyle, G., Parsons, P. G., & Boyd, A. W. (2006). Over-
Page 130
References
expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene
expression correlates with shortened survival. BMC Cancer, 6, 144.
Hiles, D. A. (1983). Infantile cataracts. Pediatr Ann, 12(8), 556-573.
Himanen, J. P., & Nikolov, D. B. (2003). Eph signaling: a structural view. Trends
Neurosci, 26(1), 46-51.
Holmes, J. M., Leske, D. A., Burke, J. P., & Hodge, D. O. (2003). Birth prevalence of
visually significant infantile cataract in a defined U.S. population. Ophthalmic
Epidemiol, 10(2), 67-74.
Huff, M. W., & Telford, D. E. (2005). Lord of the rings--the mechanism for
oxidosqualene:lanosterol cyclase becomes crystal clear. Trends Pharmacol
Sci, 26(7), 335-340.
Hunter, M., Angelicheva, D., Levy, H. L., Pueschel, S. M., & Kalaydjieva, L. (2001).
Novel mutations in the GALK1 gene in patients with galactokinase deficiency.
Hum Mutat, 17(1), 77-78.
Inaba, N., Hiruma, T., Togayachi, A., Iwasaki, H., Wang, X. H., Furukawa, Y., Sumi,
R., Kudo, T., Fujimura, K., Iwai, T., Gotoh, M., Nakamura, M., & Narimatsu,
H. (2003). A novel I-branching beta-1,6-N-acetylglucosaminyltransferase
involved in human blood group I antigen expression. Blood, 101(7), 2870-
2876.
Ionides, A., Francis, P., Berry, V., Mackay, D., Bhattacharya, S., Shiels, A., & Moore,
A. (1999). Clinical and genetic heterogeneity in autosomal dominant cataract.
Br J Ophthalmol, 83(7), 802-808.
Ionides, A. C., Berry, V., Mackay, D. S., Moore, A. T., Bhattacharya, S. S., & Shiels,
A. (1997). A locus for autosomal dominant posterior polar cataract on
chromosome 1p. Hum Mol Genet, 6(1), 47-51.
Page 131
References
Ippel, P. F., Wittebol-Post, D., van Nesselrooij, B. P., & Bijlsma, J. B. (1994). Sutural
cataract, retinitis pigmentosa, microcephaly and psychomotor retardation. A
new autosomal recessive disorder? Ophthalmic Genet, 15(3-4), 121-127.
Irum, B., Khan, S. Y., Ali, M., Daud, M., Kabir, F., Rauf, B., Fatima, F., Iqbal, H.,
Khan, A. O., Al Obaisi, S., Naeem, M. A., Nasir, I. A., Khan, S. N., Husnain,
T., Riazuddin, S., Akram, J., Eghrari, A. O., & Riazuddin, S. A. (2016a).
Deletion at the GCNT2 Locus Causes Autosomal Recessive Congenital
Cataracts. PLoS One, 11(12).
Irum, B., Khan, S. Y., Ali, M., Kaul, H., Kabir, F., Rauf, B., Fatima, F., Nadeem, R.,
Khan, A. O., Al Obaisi, S., Naeem, M. A., Nasir, I. A., Khan, S. N., Husnain,
T., Riazuddin, S., Akram, J., Eghrari, A. O., & Riazuddin, S. A. (2016b).
Mutation in LIM2 Is Responsible for Autosomal Recessive Congenital
Cataracts. PLoS One, 11(11).
Jain, I. S., Pillay, P., Gangwar, D. N., Dhir, S. P., & Kaul, V. K. (1983). Congenital
cataract: etiology and morphology. J Pediatr Ophthalmol Strabismus, 20(6),
238-242.
Jakobs, P. M., Hess, J. F., FitzGerald, P. G., Kramer, P., Weleber, R. G., & Litt, M.
(2000). Autosomal-dominant congenital cataract associated with a deletion
mutation in the human beaded filament protein gene BFSP2. Am J Hum Genet,
66(4), 1432-1436.
Jiaox, X., Khan, S. Y., Irum, B., Khan, A. O., Wang, Q., Kabir, F., Khan, A. A.,
Husnain, T., Akram, J., Riazuddin, S., Hejtmancik, J. F., & Riazuddin, S. A.
(2015). Missense Mutations in CRYAB Are Liable for Recessive Congenital
Cataracts. PLoS One, 10(9).
Page 132
References
Kalaydjieva, L., Perez-Lezaun, A., Angelicheva, D., Onengut, S., Dye, D., Bosshard,
N. U., Jordanova, A., Savov, A., Yanakiev, P., & Kremensky, I. (1999). A
founder mutation in the GK1 gene is responsible for galactokinase deficiency
in Roma (Gypsies). The American Journal of Human Genetics, 65(5), 1299-
1307.
Kaul, H., Riazuddin, S. A., Shahid, M., Kousar, S., Butt, N. H., Zafar, A. U., Khan, S.
N., Husnain, T., Akram, J., Hejtmancik, J. F., & Riazuddin, S. (2010a).
Autosomal recessive congenital cataract linked to EPHA2 in a consanguineous
Pakistani family. Mol Vis, 16, 511-517.
Kaul, H., Riazuddin, S. A., Yasmeen, A., Mohsin, S., Khan, M., Nasir, I. A., Khan, S.
N., Husnain, T., Akram, J., Hejtmancik, J. F., & Riazuddin, S. (2010b). A new
locus for autosomal recessive congenital cataract identified in a Pakistani
family. Mol Vis, 16, 240-245.
Ke, T., Wang, Q. K., Ji, B., Wang, X., Liu, P., Zhang, X., Tang, Z., Ren, X., & Liu,
M. (2006). Novel HSF4 mutation causes congenital total white cataract in a
Chinese family. Am J Ophthalmol, 142(2), 298-303.
Kerscher, S., Church, R. L., Boyd, Y., & Lyon, M. F. (1995). Mapping of four mouse
genes encoding eye lens-specific structural, gap junction, and integral
membrane proteins: Cryba1 (crystallin beta A3/A1), Crybb2 (crystallin beta
B2), Gja8 (MP70), and Lim2 (MP19). Genomics, 29(2), 445-450.
Khaliq, S., Hameed, A., Ismail, M., Anwar, K., & Mehdi, S. Q. (2002). A novel locus
for autosomal dominant nuclear cataract mapped to chromosome 2p12 in a
Pakistani family. Invest Ophthalmol Vis Sci, 43(7), 2083-2087.
Khan, A. O., Aldahmesh, M. A., & Alkuraya, F. S. (2015). Phenotypes of Recessive
Pediatric Cataract in a Cohort of Children with Identified Homozygous Gene
Page 133
References
Mutations (An American Ophthalmological Society Thesis). Trans Am
Ophthalmol Soc, 113.
Khan, A. O., Aldahmesh, M. A., & Meyer, B. (2007). Recessive congenital total
cataract with microcornea and heterozygote carrier signs caused by a novel
missense CRYAA mutation (R54C). Am J Ophthalmol, 144(6), 949-952.
Khan, A. O., Aldahmesh, M. A., Mohamed, J. Y., & Alkuraya, F. S. (2012). Clinical
and molecular analysis of children with central pulverulent cataract from the
Arabian Peninsula. Br J Ophthalmol, 96(5), 650-655.
Kiss, H., Darai, E., Kiss, C., Kost-Alimova, M., Klein, G., Dumanski, J. P., & Imreh,
S. (2002a). Comparative human/murine sequence analysis of the common
eliminated region 1 from human 3p21.3. Mamm Genome, 13(11), 646-655.
Kiss, H., Yang, Y., Kiss, C., Andersson, K., Klein, G., Imreh, S., & Dumanski, J. P.
(2002b). The transcriptional map of the common eliminated region 1
(C3CER1) in 3p21.3. Eur J Hum Genet, 10(1), 52-61.
Kolosha, V., Anoia, E., De Cespedes, C., Gitzelmann, R., Shih, L., Casco, T.,
Saborio, M., Trejos, R., Buist, N., & Tedesco, T. (2000). Novel mutations in
13 probands with galactokinase deficiency. Human mutation, 15(5), 447.
Kumar, L. V., Ramakrishna, T., & Rao, C. M. (1999). Structural and functional
consequences of the mutation of a conserved arginine residue in alphaA and
alphaB crystallins. J Biol Chem, 274(34), 24137-24141.
Kuszak, J. R., Zoltoski, R. K., & Sivertson, C. (2004). Fibre cell organization in
crystalline lenses. Exp Eye Res, 78(3), 673-687.
Kwok, P. Y., Deng, Q., Zakeri, H., Taylor, S. L., & Nickerson, D. A. (1996).
Increasing the information content of STS-based genome maps: identifying
polymorphisms in mapped STSs. Genomics, 31(1), 123-126.
Page 134
References
Lachke, S. A., Alkuraya, F. S., Kneeland, S. C., Ohn, T., Aboukhalil, A., Howell, G.
R., Saadi, I., Cavallesco, R., Yue, Y., Tsai, A. C., Nair, K. S., Cosma, M. I.,
Smith, R. S., Hodges, E., Alfadhli, S. M., Al-Hajeri, A., Shamseldin, H. E.,
Behbehani, A., Hannon, G. J., Bulyk, M. L., Drack, A. V., Anderson, P. J.,
John, S. W., & Maas, R. L. (2011). Mutations in the RNA granule component
TDRD7 cause cataract and glaucoma. Science, 331(6024), 1571-1576.
Lambert, S. R. (1997). Lens, in Paediatric Ophthalmolgy (Taylor, D ed.): Blackwell
Scientific.
Lambert, S. R., & Drack, A. V. (1996). Infantile cataracts. Surv Ophthalmol, 40(6),
427-458.
Lattin, J. E., Schroder, K., Su, A. I., Walker, J. R., Zhang, J., Wiltshire, T., Saijo, K.,
Glass, C. K., Hume, D. A., Kellie, S., & Sweet, M. J. (2008). Expression
analysis of G Protein-Coupled Receptors in mouse macrophages. Immunome
Res, 4, 5.
Lerman, S. (1980). Radiant Energy and the Eye: Macmillan.
Li, F. F., Yang, M., Ma, X., Zhang, Q., Zhang, M., Wang, S. Z., & Zhu, S. Q. (2010).
Autosomal dominant congenital nuclear cataracts caused by a CRYAA gene
mutation. Curr Eye Res, 35(6), 492-498.
Lieuallen, K., Christensen, M., Brandriff, B., Church, R., Wang, J., & Lennon, G.
(1994). Assignment of the human lens fiber cell MP19 gene (LIM2) to
chromosome 19q13.4, and adjacent to ETFB. Somat Cell Mol Genet, 20(1),
67-69.
Litt, M., Kramer, P., LaMorticella, D. M., Murphey, W., Lovrien, E. W., & Weleber,
R. G. (1998). Autosomal dominant congenital cataract associated with a
Page 135
References
missense mutation in the human alpha crystallin gene CRYAA. Hum Mol
Genet, 7(3), 471-474.
Liu, M., Ke, T., Wang, Z., Yang, Q., Chang, W., Jiang, F., Tang, Z., Li, H., Ren, X.,
Wang, X., Wang, T., Li, Q., Yang, J., Liu, J., & Wang, Q. K. (2006).
Identification of a CRYAB mutation associated with autosomal dominant
posterior polar cataract in a Chinese family. Invest Ophthalmol Vis Sci, 47(8),
3461-3466.
Louis, C. F., Hur, K. C., Galvan, A. C., TenBroek, E. M., Jarvis, L. J., Eccleston, E.
D., & Howard, J. B. (1989). Identification of an 18,000-dalton protein in
mammalian lens fiber cell membranes. J Biol Chem, 264(33), 19967-19973.
Lv, H., Huang, C., Zhang, J., Liu, Z., Zhang, Z., Xu, H., You, Y., Hu, J., Li, X., &
Wang, W. (2014). A novel HSF4 gene mutation causes autosomal-dominant
cataracts in a Chinese family. G3 (Bethesda), 4(5), 823-828.
Ma, A. S., Grigg, J. R., Ho, G., Prokudin, I., Farnsworth, E., Holman, K., Cheng, A.,
Billson, F. A., Martin, F., Fraser, C., Mowat, D., Smith, J., Christodoulou, J.,
Flaherty, M., Bennetts, B., & Jamieson, R. V. (2016). Sporadic and Familial
Congenital Cataracts: Mutational Spectrum and New Diagnoses Using Next-
Generation Sequencing. Hum Mutat, 37(4), 371-384.
Mackay, D. S., Boskovska, O. B., Knopf, H. L., Lampi, K. J., & Shiels, A. (2002). A
nonsense mutation in CRYBB1 associated with autosomal dominant cataract
linked to human chromosome 22q. Am J Hum Genet, 71(5), 1216-1221.
Mann, I. (1964). The development of the human eye: Grune & Stratton.
Mathias, R. T., & Rae, J. L. (2004). The lens: local transport and global transparency.
Exp Eye Res, 78(3), 689-698.
Merin, S. (1991). Inherited eye diseases: Marcel Dekker.
Page 136
References
Meyer, E., Rahman, F., Owens, J., Pasha, S., Morgan, N. V., Trembath, R. C., Stone,
E. M., Moore, A. T., & Maher, E. R. (2009). Initiation codon mutation in
betaB1-crystallin (CRYBB1) associated with autosomal recessive nuclear
pulverulent cataract. Mol Vis, 15, 1014-1019.
Michael, R., van Marle, J., Vrensen, G. F., & van den Berg, T. J. (2003). Changes in
the refractive index of lens fibre membranes during maturation--impact on
lens transparency. Exp Eye Res, 77(1), 93-99.
Nakai, A., Tanabe, M., Kawazoe, Y., Inazawa, J., Morimoto, R. I., & Nagata, K.
(1997). HSF4, a new member of the human heat shock factor family which
lacks properties of a transcriptional activator. Mol Cell Biol, 17(1), 469-481.
Ni, X., Valente, J., Azevedo, M. H., Pato, M. T., Pato, C. N., & Kennedy, J. L.
(2007). Connexin 50 gene on human chromosome 1q21 is associated with
schizophrenia in matched case control and family-based studies. J Med Genet,
44(8), 532-536.
Nickerson, D. A., Taylor, S. L., Weiss, K. M., Clark, A. G., Hutchinson, R. G.,
Stengard, J., Salomaa, V., Vartiainen, E., Boerwinkle, E., & Sing, C. F.
(1998). DNA sequence diversity in a 9.7-kb region of the human lipoprotein
lipase gene. Nat Genet, 19(3), 233-240.
Ott, J. (1999). Analysis of human genetic linkage: JHU Press.
Peltonen, L., Palotie, A., & Lange, K. (2000). Use of population isolates for mapping
complex traits. Nat Rev Genet, 1(3), 182-190.
Perng, M. D., & Quinlan, R. A. (2005). Seeing is believing! The optical properties of
the eye lens are dependent upon a functional intermediate filament
cytoskeleton. Exp Cell Res, 305(1), 1-9.
Page 137
References
Pirkkala, L., Nykanen, P., & Sistonen, L. (2001). Roles of the heat shock transcription
factors in regulation of the heat shock response and beyond. FASEB J, 15(7),
1118-1131.
Ponnam, S. P., Ramesha, K., Matalia, J., Tejwani, S., Ramamurthy, B., &
Kannabiran, C. (2013). Mutational screening of Indian families with
hereditary congenital cataract. Mol Vis, 19, 1141-1148.
Ponnam, S. P., Ramesha, K., Tejwani, S., Matalia, J., & Kannabiran, C. (2008). A
missense mutation in LIM2 causes autosomal recessive congenital cataract.
Mol Vis, 14, 1204-1208.
Ponnam, S. P., Ramesha, K., Tejwani, S., Ramamurthy, B., & Kannabiran, C. (2007).
Mutation of the gap junction protein alpha 8 (GJA8) gene causes autosomal
recessive cataract. J Med Genet, 44(7).
Pras, E., Frydman, M., Levy-Nissenbaum, E., Bakhan, T., Raz, J., Assia, E. I.,
Goldman, B., & Pras, E. (2000). A nonsense mutation (W9X) in CRYAA
causes autosomal recessive cataract in an inbred Jewish Persian family. Invest
Ophthalmol Vis Sci, 41(11), 3511-3515.
Pras, E., Levy-Nissenbaum, E., Bakhan, T., Lahat, H., Assia, E., Geffen-Carmi, N.,
Frydman, M., Goldman, B., & Pras, E. (2002). A missense mutation in the
LIM2 gene is associated with autosomal recessive presenile cataract in an
inbred Iraqi Jewish family. Am J Hum Genet, 70(5), 1363-1367.
Pras, E., Raz, J., Yahalom, V., Frydman, M., Garzozi, H. J., Pras, E., & Hejtmancik, J.
F. (2004). A nonsense mutation in the glucosaminyl (N-acetyl) transferase 2
gene (GCNT2): association with autosomal recessive congenital cataracts.
Invest Ophthalmol Vis Sci, 45(6), 1940-1945.
Page 138
References
Ramachandran, R. D., Perumalsamy, V., & Hejtmancik, J. F. (2007). Autosomal
recessive juvenile onset cataract associated with mutation in BFSP1. Hum
Genet, 121(3-4), 475-482.
Reddy, M. A., Bateman, O. A., Chakarova, C., Ferris, J., Berry, V., Lomas, E., Sarra,
R., Smith, M. A., Moore, A. T., Bhattacharya, S. S., & Slingsby, C. (2004).
Characterization of the G91del CRYBA1/3-crystallin protein: a cause of
human inherited cataract. Hum Mol Genet, 13(9), 945-953.
Reich, S., Hennermann, J., Vetter, B., Neumann, L. M., Shin, Y. S., Söling, A.,
MÖnch, E., & Kulozik, A. E. (2002). An unexpectedly high frequency of
hypergalactosemia in an immigrant Bosnian population revealed by newborn
screening. Pediatric research, 51(5), 598-601.
Reis, L. M., Tyler, R. C., Muheisen, S., Raggio, V., Salviati, L., Han, D. P., Costakos,
D., Yonath, H., Hall, S., Power, P., & Semina, E. V. (2013). Whole exome
sequencing in dominant cataract identifies a new causative factor, CRYBA2,
and a variety of novel alleles in known genes. Hum Genet, 132(7), 761-770.
Resnikoff, S., Pascolini, D., Etya'ale, D., Kocur, I., Pararajasegaram, R., Pokharel, G.
P., & Mariotti, S. P. (2004). Global data on visual impairment in the year
2002. Bulletin of the world health organization, 82(11), 844-851.
Riazuddin, S. A., Yasmeen, A., Yao, W., Sergeev, Y. V., Zhang, Q., Zulfiqar, F.,
Riaz, A., Riazuddin, S., & Hejtmancik, J. F. (2005a). Mutations in betaB3-
crystallin associated with autosomal recessive cataract in two Pakistani
families. Invest Ophthalmol Vis Sci, 46(6), 2100-2106.
Riazuddin, S. A., Yasmeen, A., Zhang, Q., Yao, W., Sabar, M. F., Ahmed, Z.,
Riazuddin, S., & Hejtmancik, J. F. (2005b). A new locus for autosomal
Page 139
References
recessive nuclear cataract mapped to chromosome 19q13 in a Pakistani family.
Invest Ophthalmol Vis Sci, 46(2), 623-626.
Sabir, N., Riazuddin, S. A., Butt, T., Iqbal, F., Nasir, I. A., Zafar, A. U., Qazi, Z. A.,
Butt, N. H., Khan, S. N., Husnain, T., Hejtmancik, J. F., & Riazuddin, S.
(2010a). Mapping of a new locus associated with autosomal recessive
congenital cataract to chromosome 3q. Mol Vis, 16, 2634-2638.
Sabir, N., Riazuddin, S. A., Kaul, H., Iqbal, F., Nasir, I. A., Zafar, A. U., Qazi, Z. A.,
Butt, N. H., Khan, S. N., Husnain, T., Hejtmancik, J. F., & Riazuddin, S.
(2010b). Mapping of a novel locus associated with autosomal recessive
congenital cataract to chromosome 8p. Mol Vis, 16, 2911-2915.
Safieh, L. A., Khan, A. O., & Alkuraya, F. S. (2009). Identification of a novel
CRYAB mutation associated with autosomal recessive juvenile cataract in a
Saudi family. Mol Vis, 15, 980-984.
Sajjad, N., Goebel, I., Kakar, N., Cheema, A. M., Kubisch, C., & Ahmad, J. (2008). A
novel HSF4 gene mutation (p.R405X) causing autosomal recessive congenital
cataracts in a large consanguineous family from Pakistan. BMC Med Genet, 9,
99.
Sambrook, J., Fritsch, E., & Maniatis, T. (1989). Molecular cloning: a laboratory
manual (2 ed.): Cold Spring Harbor, NY: Cold Spring Harbor Laboratory
Press.
Sanger, F., Air, G. M., Barrell, B. G., Brown, N. L., Coulson, A. R., Fiddes, C. A.,
Hutchison, C. A., Slocombe, P. M., & Smith, M. (1977). Nucleotide sequence
of bacteriophage phi X174 DNA. Nature, 265(5596), 687-695.
Santana, A., Waiswol, M., Arcieri, E. S., Cabral de Vasconcellos, J. P., & Barbosa de
Melo, M. (2009). Mutation analysis of CRYAA, CRYGC, and CRYGD
Page 140
References
associated with autosomal dominant congenital cataract in Brazilian families.
Mol Vis, 15, 793-800.
Schaffer, A. A., Gupta, S. K., Shriram, K., & Cottingham, R. W., Jr. (1994). Avoiding
recomputation in linkage analysis. Hum Hered, 44(4), 225-237.
Schmidt, W., Klopp, N., Illig, T., & Graw, J. (2008). A novel GJA8 mutation causing
a recessive triangular cataract. Mol Vis, 14, 851-856.
Scott, R., & Lambert, M. , D . ,. (1996). Survey of Ophthlmology (Vol. 40).
Shi, Y., Barton, K., De Maria, A., Petrash, J. M., Shiels, A., & Bassnett, S. (2009).
The stratified syncytium of the vertebrate lens. J Cell Sci, 122(Pt 10), 1607-
1615.
Shiels, A., Bennett, T. M., Knopf, H. L., Maraini, G., Li, A., Jiao, X., & Hejtmancik,
J. F. (2008). The EPHA2 gene is associated with cataracts linked to
chromosome 1p. Mol Vis, 14, 2042-2055.
Shiels, A., & Hejtmancik, J. F. (2007). Genetic origins of cataract. Arch Ophthalmol,
125(2), 165-173.
Shiels, A., & Hejtmancik, J. F. (2013). Genetics of human cataract. Clin Genet, 84(2),
120-127.
Shiels, A., Mackay, D., Ionides, A., Berry, V., Moore, A., & Bhattacharya, S. (1998).
A missense mutation in the human connexin50 gene (GJA8) underlies
autosomal dominant "zonular pulverulent" cataract, on chromosome 1q. Am J
Hum Genet, 62(3), 526-532.
Shroff, N. P., Cherian-Shaw, M., Bera, S., & Abraham, E. C. (2000). Mutation of R116C
results in highly oligomerized alpha A-crystallin with modified structure and
defective chaperone-like function. Biochemistry, 39(6), 1420-1426.
Page 141
References
Singh, R., Ram, J., Kaur, G., & Prasad, R. (2012). Galactokinase deficiency
induced cataracts in indian infants: identification of 4 novel mutations in
GALK gene. Current eye research, 37(10), 949-954.
Smaoui, N., Beltaief, O., BenHamed, S., M'Rad, R., Maazoul, F., Ouertani, A.,
Chaabouni, H., & Hejtmancik, J. F. (2004). A homozygous splice mutation
in the HSF4 gene is associated with an autosomal recessive congenital
cataract. Invest Ophthalmol Vis Sci, 45(8), 2716-2721.
Sperelakis, N., & Cole, W. C. (1989). Cell interactions and gap junctions: CRC
Press.
Spierer, A., Desatnik, H., Rosner, M., & Blumenthal, M. (1998). Congenital
cataract surgery in children with cataract as an isolated defect and in
children with a systemic syndrome: a comparative study. J Pediatr
Ophthalmol Strabismus, 35(5), 281-285.
Srinivasan, A. N., Nagineni, C. N., & Bhat, S. P. (1992). alpha A-crystallin is
expressed in non-ocular tissues. J Biol Chem, 267(32), 23337-23341.
Stambolian, D., Ai, Y., Sidjanin, D., Nesburn, K., Sathe, G., Rosenberg, M., &
Bergsma, D. J. (1995). Cloning of the galactokinase cDNA and
identification of mutations in two families with cataracts. Nature genetics,
10(3), 307-312.
Stapleton, D., Balan, I., Pawson, T., & Sicheri, F. (1999). The crystal structure of
an Eph receptor SAM domain reveals a mechanism for modular
dimerization. Nat Struct Biol, 6(1), 44-49.
Steele, E. C., Jr., Kerscher, S., Lyon, M. F., Glenister, P. H., Favor, J., Wang, J., &
Church, R. L. (1997). Identification of a mutation in the MP19 gene, Lim2,
in the cataractous mouse mutant To3. Mol Vis, 3, 5.
Page 142
References
Stewart, D. N., Lango, J., Nambiar, K. P., Falso, M. J., FitzGerald, P. G., Rocke, D. M.,
Hammock, B. D., & Buchholz, B. A. (2013). Carbon turnover in the water-
soluble protein of the adult human lens. Mol Vis, 19, 463-475.
Stocklin, P. (1957). [Normal variations of morphology of crystalline lens in children].
Albrecht Von Graefes Arch Ophthalmol, 158(4), 346-359.
Strachan, T., & Read, A. P. (2004). Human molecular genetics. Garland Science, New
York, 635.
Sun, W., Xiao, X., Li, S., Guo, X., & Zhang, Q. (2011). Mutational screening of six
genes in Chinese patients with congenital cataract and microcornea. Mol Vis, 17,
1508-1513.
Sun, W., Xiao, X., Li, S., Guo, X., & Zhang, Q. (2014). Exome sequencing of 18
Chinese families with congenital cataracts: a new sight of the NHS gene. PLoS
One, 9(6).
Tanabe, M., Sasai, N., Nagata, K., Liu, X. D., Liu, P. C., Thiele, D. J., & Nakai, A.
(1999). The mammalian HSF4 gene generates both an activator and a repressor
of heat shock genes by alternative splicing. J Biol Chem, 274(39), 27845-27856.
Tenbroek, E., Arneson, M., Jarvis, L., & Louis, C. (1992). The distribution of the fiber
cell intrinsic membrane proteins MP20 and connexin46 in the bovine lens. J
Cell Sci, 103 ( Pt 1), 245-257.
Terwilliger, J. D., & Ott, J. (1994). Handbook of human genetic linkage: JHU Press.
Traboulsi, E. I. (2012). Genetic Diseases of the Eye (2 ed.): Oxford University Press,
New York.
Vanita, V., Singh, J. R., Hejtmancik, J. F., Nuernberg, P., Hennies, H. C., Singh, D.,
& Sperling, K. (2006). A novel fan-shaped cataract-microcornea syndrome
caused by a mutation of CRYAA in an Indian family. Mol Vis, 12, 518-522.
Page 143
References
Vihtelic, T. S., Fadool, J. M., Gao, J., Thornton, K. A., Hyde, D. R., & Wistow, G.
(2005). Expressed sequence tag analysis of zebrafish eye tissues for NEIBank.
Mol Vis, 11, 1083-1100.
Waggoner, D. W., Johnson, L. B., Mann, P. C., Morris, V., Guastella, J., & Bajjalieh,
S. M. (2004). MuLK, a eukaryotic multi-substrate lipid kinase. J Biol Chem,
279(37), 38228-38235.
Wang, J., Ma, X., Gu, F., Liu, N. P., Hao, X. L., Wang, K. J., Wang, N. L., & Zhu, S.
Q. (2007). A missense mutation S228P in the CRYBB1 gene causes
autosomal dominant congenital cataract. Chin Med J (Engl), 120(9), 820-824.
Wang, K. J., Wang, B. B., Zhang, F., Zhao, Y., Ma, X., & Zhu, S. Q. (2011). Novel
beta-crystallin gene mutations in Chinese families with nuclear cataracts. Arch
Ophthalmol, 129(3), 337-343.
Wang, L., Lin, H., Gu, J., Su, H., Huang, S., & Qi, Y. (2009). Autosomal-dominant
cerulean cataract in a Chinese family associated with gene conversion
mutation in beta-B2-crystallin. Ophthalmic research, 41(3), 148-153.
Weber, J. L., & May, P. E. (1989). Abundant class of human DNA polymorphisms
which can be typed using the polymerase chain reaction. Am J Hum Genet,
44(3), 388-396.
White, T. W., Goodenough, D. A., & Paul, D. L. (1998). Targeted ablation of
connexin50 in mice results in microphthalmia and zonular pulverulent
cataracts. J Cell Biol, 143(3), 815-825.
Wride, M. A. (2011). Lens fibre cell differentiation and organelle loss: many paths
lead to clarity. Philos Trans R Soc Lond B Biol Sci, 366(1568), 1219-1233.
Wunderlich, K., Pech, M., Eberle, A. N., Mihatsch, M., Flammer, J., & Meyer, P.
(2000). Expression of connective tissue growth factor (CTGF) mRNA in
Page 144
References
plaques of human anterior subcapsular cataracts and membranes of posterior
capsule opacification. Curr Eye Res, 21(2), 627-636.
Wussuki-Lior, O., Abu-Horowitz, A., Netzer, I., Almer, Z., Morad, Y., Goldich, Y.,
Yahalom, V., Pras, E., & Pras, E. (2011). Hematologic biomarkers in
childhood cataracts.
Yasmeen, A., Riazuddin, S. A., Kaul, H., Mohsin, S., Khan, M., Qazi, Z. A., Nasir, I.
A., Zafar, A. U., Khan, S. N., Husnain, T., Akram, J., Hejtmancik, J. F., &
Riazuddin, S. (2010). Autosomal recessive congenital cataract in
consanguineous Pakistani families is associated with mutations in GALK1.
Mol Vis, 16, 682-688.
Yu, L. C., Twu, Y. C., Chang, C. Y., & Lin, M. (2001). Molecular basis of the
adult i phenotype and the gene responsible for the expression of the human
blood group I antigen. Blood, 98(13), 3840-3845.
Yu, L. C., Twu, Y. C., Chou, M. L., Reid, M. E., Gray, A. R., Moulds, J. M.,
Chang, C. Y., & Lin, M. (2003). The molecular genetics of the human I
locus and molecular background explain the partial association of the adult
i phenotype with congenital cataracts. Blood, 101(6), 2081-2088.
Zhang, J., Li, J., Huang, C., Xue, L., Peng, Y., Fu, Q., Gao, L., Zhang, J., & Li, W.
(2008). Targeted knockout of the mouse betaB2-crystallin gene (Crybb2)
induces age-related cataract. Invest Ophthalmol Vis Sci, 49(12), 5476-5483.
Zhao, L., Chen, X. J., Zhu, J., Xi, Y. B., Yang, X., Hu, L. D., Ouyang, H., Patel, S.
H., Jin, X., Lin, D., Wu, F., Flagg, K., Cai, H., Li, G., Cao, G., Lin, Y.,
Chen, D., Wen, C., Chung, C., Wang, Y., Qiu, A., Yeh, E., Wang, W., Hu,
X., Grob, S., Abagyan, R., Su, Z., Tjondro, H. C., Zhao, X. J., Luo, H.,
Hou, R., Jefferson, J., Perry, P., Gao, W., Kozak, I., Granet, D., Li, Y.,
Page 145
References
Sun, X., Wang, J., Zhang, L., Liu, Y., Yan, Y. B., & Zhang, K. (2015).
Lanosterol reverses protein aggregation in cataracts. Nature, 523(7562),
607-611.
Page 146