Poegmalation – a Next-‐‑Generation Pegylation Technology by Yizhi Qi Department of Biomedical

Home , PEGylation

POEGMAlation – A Next-Generation PEGylation Technology

Yizhi Qi

Department of Biomedical Engineering Duke University

Date:______Approved:

______Ashutosh Chilkoti, Supervisor

______Stephen Craig

______Mark Feinglos

______Fan Yuan

______Stefan Zauscher

Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biomedical Engineering in the Graduate School of Duke University

2016

ABSTRACT

POEGMAlation – A Next-Generation PEGylation Technology

Yizhi Qi

Department of Biomedical Engineering Duke University

Date:______Approved:

______Ashutosh Chilkoti, Supervisor

______Stephen Craig

______Mark Feinglos

______Fan Yuan

______Stefan Zauscher

An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biomedical Engineering in the Graduate School of Duke University

2016

Abstract

The delivery of therapeutic peptides and proteins is often challenged by a short circulation half-life, necessitating frequent injections that limit efficacy, reduce patient compliance and increase treatment cost. The covalent conjugation of therapeutic peptides and proteins, and more recently oligonucleotide-based drugs, with the

“stealth” polymer poly(ethylene glycol) (PEG), termed PEGylation, is one of the most commonly used approaches to increase the in vivo half-life and reduce the immunogenicity of these therapeutic biomolecules. However, after several decades of research and clinical use, the limitations of PEGylation have begun to emerge.

Conventional methods for synthesizing peptide/protein-polymer conjugates have drawbacks including low yield, non-trivial separation of conjugates from reactants, and lack of control over site and stoichiometry of conjugation, which results in heterogeneous products with significantly compromised biological activity.

Additionally, anti-PEG antibodies have been induced in patients treated with PEGylated drugs and have been shown to correlate with rapid clearance of these drugs. High levels of pre-existing anti-PEG antibodies have also been found in individuals naïve to

PEGylated agents, which are associated with serious first-exposure allergic reactions.

To address the synthetic limitations of PEGylation, a general approach for the high-yield synthesis of site-specific (C-terminal) and stoichiometric (1:1)

peptide/protein-polymer conjugates, named sortase-catalyzed polymer conjugation, was developed. Demonstrating proof-of-concept of the approach with green fluorescent protein (GFP) as a model protein, sortase A from Staphylococcus aureus was used to site- specifically attach an initiator solely at the C-terminus of GFP, followed by in situ growth of the PEG-based brush polymer, poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA) from the protein macroinitiator by atom transfer radical polymerization (ATRP). Sortase-catalyzed initiator attachment proceeded with high specificity and near-complete (~ 95%) product conversion. Subsequent in situ ATRP in aqueous buffer produced 1:1 stoichiometric conjugates with > 90% yield, tunable MW, low dispersity, and no denaturation of the protein. The extraordinarily high yield compares favorably to order of magnitude losses typically seen in conventional

PEGylation processes.

Next, the therapeutic potential of POEGMAlation, or the conjugation of

POEGMA to a peptide or protein, was demonstrated by implementing the developed sortase-catalyzed polymer conjugation strategy with exendin-4 (exendin), a therapeutic peptide for treating type 2 diabetes, to synthesize exendin-C-POEGMA conjugates with a wide and tunable range of molecular weights (MWs) and low dispersity. A single subcutaneous injection of exendin-C-POEGMA conjugates lowered blood glucose for up to 120 h in a diabetic mouse model. Most intriguingly, we showed that appending PEG as oligomeric side-chains on the conjugated POEGMA and tuning the side-chain length

completely eliminated the reactivity of exendin-C-POEGMA conjugates toward patient- derived anti-PEG antibodies without compromising in vivo efficacy. Clinically, the lack of anti-PEG antigenicity of POEGMA conjugates is expected to completely eliminate serious first-exposure allergic reactions and the accelerated blood clearance of

POEGMA-drug conjugates due to pre-existing anti-PEG antibodies in patients.

Collectively, these results establish POEGMAlation as a next-generation

PEGylation technology that is highly useful for improving the pharmacological performance of therapeutic biomolecules while providing a timely solution to the increasing levels of pre-existing anti-PEG antibodies in patients that are seriously hindering the safety and efficacy of traditional PEGylated drugs.

Dedication

谨以此论⽂献给

我最亲爱的⽗母–我巨⼈的肩膀

和我的爱⼈–我坚强的后盾

vii

Contents

Abstract ...... iv

List of Tables ...... xii

List of Figures ...... xiv

Acknowledgements ...... xx

1. Introduction ...... 1

1.1 Peptides and Proteins as Therapeutics ...... 1

1.2 Delivery Strategies for Peptide and Protein Therapeutics ...... 1

1.3 PEGylation ...... 2

1.4 Motivation and Overview ...... 5

2. Development of Sortase-Catalyzed Polymer Conjugation ...... 6

2.1 Introduction ...... 6

2.1.1 Recent Developments in Peptide/Protein-Polymer Conjugation ...... 6

2.1.2 Control of Site-Specificity and Stoichiometry ...... 8

2.1.3 Atom Transfer Radical Polymerization (ATRP) ...... 10

2.1.4 Sortase-Catalyzed C-Terminal Ligation ...... 13

2.1.5 Overview and Choice of Components ...... 15

2.2 Materials and Methods ...... 16

2.2.1 Materials ...... 16

2.2.2 Cloning of GFP-srt-His6-ELP ...... 16

2.2.3 Expression and Purification of GFP-srt-His6-ELP ...... 18

viii

2.2.4 Cloning, Expression and Purification of His6-Sortase A ...... 19

2.2.5 Synthesis of ATRP Initiator AEBMP ...... 21

2.2.6 Sortase-Catalyzed Initiator Attachment and Macroinitiator Purification ...... 23

2.2.7 In Situ ATRP of POEGMA from GFP-C-Br ...... 24

2.2.8 SDS-PAGE Analysis and Calculation of Initiator Attachment Efficiency ...... 25

2.2.9 Liquid Chromatography Electrospray-Ionization Mass Spectrometry (LC/ESI- MS) ...... 27

2.2.10 Liquid Chromatography Electrospray Ionization Tandem Mass Spectrometry (LC/MS-MS) ...... 27

2.2.11 Size Exclusion Chromatography (SEC) and Calculation of Conjugation Efficiency ...... 29

2.2.12 Size Exclusion Chromatography Multi-Angle Light Scattering (SEC-MALS) 30

2.2.13 Dynamic Light Scattering (DLS) ...... 31

2.2.14 Fluorescence Spectroscopy ...... 32

2.3 Results and Discussion ...... 32

2.3.1 Sortase-Catalyzed Attachment of Initiator on the C-Terminus of GFP ...... 32

2.3.2 In situ ATRP of POEGMA from the C-Terminus of GFP ...... 38

2.3.3 Characterization of GFP-C-POEGMA Conjugates ...... 41

2.3.4 Conclusion and Significance ...... 43

3. Site-Specific Conjugation of POEGMA to the C-Terminus of Exendin-4 ...... 46

3.1 Introduction ...... 46

3.1.1 Type 2 Diabetes ...... 46

3.1.2 Incretins for Type 2 Diabetes Therapy ...... 48

3.1.3 ARGET ATRP ...... 50

3.1.4 Motivation and Overview ...... 51

3.2 Materials and Methods ...... 52

3.2.1 Cloning of Exendin-srt-His6-ELP ...... 52

3.2.2 Expression and Purification of Fusion Proteins ...... 53

3.2.3 Sortase-Catalyzed Initiator Attachment to the C-Terminus of Exendin and Macroinitiator Purification ...... 53

3.2.4 Mass Spectrometry ...... 54

3.2.5 In situ ARGET ATRP ...... 54

3.2.6 Physico-Chemical Characterizations ...... 55

3.2.7 In Vitro cAMP ELISA ...... 56

3.2.8 Animal Studies ...... 57

3.2.9 In Vivo Fed Glucose Measurements ...... 58

3.2.10 In Vivo IPGTT ...... 59

3.2.11 Statistical Analysis ...... 59

3.3 Results and Discussion ...... 60

3.3.1 Sortase-Catalyzed C-Terminal Initiator Attachment to Exendin ...... 60

3.3.2 Synthesis and Characterization of Exendin-C-POEGMA Conjugates ...... 63

3.3.3 In Vitro Activity of EG9 Exendin-C-POEGMA ...... 65

3.3.4 In Vivo Therapeutic Efficacy of EG9 Exendin-C-POEGMA ...... 66

3.3.5 Conclusion and Significance ...... 73

4. Eliminating PEG Antigenicity of POEGMA Conjugates ...... 75

4.1 Introduction ...... 75

4.1.1 Immunogenicity and Antigenicity of PEG ...... 75

4.1.2 Motivation and Overview ...... 76

4.2 Materials and Methods ...... 76

4.2.1 Anti-PEG ELISA ...... 76

4.2.2 Circular Dichroism Spectroscopy ...... 79

4.2.3 Synthesis of Exendin-C-PEG Conjugates ...... 80

4.2.4 In Vivo Fed Glucose Measurements ...... 81

4.2.5 In Vivo Pharmacokinetics ...... 81

4.2.6 Statistical analysis ...... 82

4.3 Results and Discussion ...... 82

4.3.1 Antigenicity of EG9 Exendin-C-POEGMA Conjugates ...... 82

4.3.2 Synthesis and Characterization of EG3 Exendin-C-POEGMA Conjugates ...... 84

4.4.3 Antigenicity of EG3 Exendin-C-POEGMA Conjugates ...... 90

4.4.4 In Vivo Efficacy of EG3 Exendin-C-POEGMA Conjugates ...... 92

4.4.5 Pharmacokinetics of Exendin-C-POEGMA Conjugates ...... 97

4.4.5 Conclusion ...... 100

5. Future Directions ...... 102

Biography ...... 122

List of Tables

Table 1: Three sets of classic ATRP reaction conditions (Rxn 1-3) used to graft POEGMA from GFP-C-Br (85)...... 24

Table 2: Light scattering (LS) characterizations of GFP-C-Br macroinitiator and GFP-C- POEGMA conjugates. MWs, Ðs and Rgs were determined by size exclusion chromatography multi-angle light scattering (SEC-MALS). Rhs were measured by dynamic light scattering (DLS). Mw: weight-average MW, Mn: number-average MW, Ð: dispersity (Mw/Mn), Rg: radius of gyration, Rh: hydrodynamic radius. N/A: below instrument lower limit of detection (85)...... 42

Table 3: Physical properties and biological activity of EG9 exendin-C-POEGMA. MWs and Ðs were determined by SEC-MALS. Rhs were measured by DLS. EC50 values were derived from cAMP response curves in Figure 11D. aCalculated from amino acid sequence. bDefault value due to unimolecular nature of the peptide (88)...... 65

Table 4: Summary of statistical significance levels of dose-dependent fed blood glucose measurements of EG9 exendin-C-POEGMA shown in Figure 12A. Data were analyzed by repeated measures two-way analysis of variance (ANOVA), followed by post hoc Dunnett’s test to evaluate individual differences between a treatment and PBS control at each time point (n=3, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001) (88)...... 67

Table 5: Summary of statistical significance levels of MW-dependent fed blood glucose measurements of EG9 conjugates compared to PBS control shown in Figure 13. Data were analyzed by repeated measures two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test to evaluate individual differences between a treatment and PBS control at each time point (n=6, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001). -- -Groups treated with conjugates were not measured at t=6 h (88)...... 70

Table 6: Variable amounts of Adagen® and exendin-C-POEGMA conjugates and their corresponding PEG/OEG contents loaded as competing antigens per well in the competitive ELISA. PEG content of Adagen® was approximated by assuming 14 PEG chains per Adagen® conjugate, while OEG content of the exendin-C-POEGMA conjugates was directly calculated by subtracting the poly(methyl methacrylate) backbone (88)...... 79

Table 7: Physical properties and biological activity of EG3 exendin-C-POEGMA conjugates. MWs and Ðs were determined by SEC-MALS. Rhs were measured by DLS.

xii

EC50 values were derived from cAMP response curves in Figure 16F. aCalculated from amino acid sequence. bDefault value due to unimolecular nature of the peptide (88). .... 86

Table 8: Physical properties and biological activity of exendin-C-PEG conjugates. MWs and Ðs were determined by SEC-MALS. Rhs were measured by DLS. EC50 values were derived from cAMP response curves in Figure 17D...... 89

Table 9: Summary of statistical significance levels of dose-dependent fed blood glucose measurements of EG3 exendin-C-POEGMA compared to PBS control shown in Figure 19A. Data were analyzed by repeated measures two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test to evaluate individual differences between a treatment and PBS control at each time point (n=3, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001)...... 93

Table 10: Summary of statistical significance levels of fed blood glucose measurements of EG3 exendin-C-POEGMA and exendin-C-PEG conjugates compared to PBS control shown in Figure 21. Data were analyzed by repeated measures two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test to evaluate individual differences between a treatment and PBS control at each time point (n=3, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001). aDesignated by nominal MW of the PEG component...... 95

Table 11: Pharmacokinetic parameters of exendin and exendin-C-POEGMA conjugates injected s.c. derived from data analyzed with a non-compartmental fit in Figure21. t1/2 a : absorption half-life, t1/2 el: elimination half-life, Cmax: maximum plasma concentration, tmax: time to attain Cmax. aDerived from curve fitting. bCalculated from t = 0 to ∞ from curve fitting (88)...... 98

xiii

List of Figures

Figure 1: Mechanism of classic ATRP. kact: rate constant of activation, kdeact: rate constant of deactivation, kp: rate constant of propagation, kt: rate constant of termination, M: monomer, R-R: termination by radical coupling, RH: termination by chain-end hydrolysis, R=: termination by chain-end disproportionation. Figure from (64)...... 11

Figure 2: C-terminal ligation mechanism of sortase A. A) Sortase A recognizes the pentapeptide sequence “LPXTG” embedded in or terminally appended to a target biomolecule, and its thiol group on a key catalytic cysteine residue nucleophilically attacks the amide bond between “T” and “G” within the recognition sequence, resulting in an intermediate consisted of sortase A temporarily connected to the C-terminus of the target biomolecule via a thioacyl bond. B) A second (bio)molecule carrying an N- terminal oligoglycine motif nuceophilically attacks the thioacyl bond to displace sortase A and the two (bio)molecules are ligated via a native peptide bond. LPXTG: lysine- proline-X-threonine-glycine, where “X” is any standard amino acid residue...... 14

Figure 3: Synthetic scheme of ATRP initiator N-(2-(2-(2-(2- aminoacetamido)acetamido)acetamido)ethyl)-2-bromo-2-methylpropanamide (AEBMP, compound 4) (85)...... 21

Figure 4: Synthetic route of GFP-C-POEGMA. A) Recombinant expression of quaternary fusion protein GFP-srt-His6-ELP and purification by inverse transition cycling (ITC). B) Sortase-catalyzed site-specific attachment of the ATRP initiator AEBMP to the C- terminus of GFP. C) In situ ATRP of OEGMA yielding GFP-C-POEGMA (85)...... 32

Figure 5: CuIICl2-stained SDS-PAGE analysis of A) ITC purification of GFP-srt-His6-ELP. Lane 1: marker, lane 2: E. coli lysate, and lanes 3-6: soluble protein after one to four ITC cycles. B) His-tag purification of His6-sortase A. Lane 1: marker, lane 2: E. coli lysate, lanes 3 and 4: first and second elution washes with imidazole. C) sortase-catalyzed attachment of the ATRP initiator AEBMP at the C-terminus of GFP and purification of GFP-C-Br macroinitiator. Lane 1: MW marker, lane 2: purified GFP-srt-His6-ELP, lane 3: purified His6-sortaseA, and lane 4: sortase reaction mixture after 5 h of reaction at 37 °C. D) Purification of GFP-C-Br by reverse His-tag purification. Lane 1: marker, lane 2: sortase reaction mixture, lanes 3 and 4: GFP-C-Br (has no His6-tag) in the first and second elutions without imidazole, lanes 5 and 6: all other unwanted His6-tagged components in the first and second elutions with imidazole (85)...... 34

xiv

Figure 7: LC/ESI-MS characterization of OEGMA monomer with Mn ~ 500 Da or on average ~ 9 side-chain ethylene glycol repeats (EG9). Peaks were detected as [M+Na]+ (88)...... 38

Figure 8: Characterizations of in situ ATRP reactions of grafting POEGMA from GFP-C- Br. A and B) Size exclusion chromatography (SEC) traces of GFP-Br (Blue), Rxn 1 (green), Rxn 2 (maroon), and Rxn 3 (red) detected by UV-vis absorbance at 280nm and fluorescence at 460 nm excitation and 507 nm emission. C) CuIICl2-stained SDS-PAGE analysis of ATRP reaction mixtures. Lane 1: marker, lane 2: GFP-C-Br macroinitiator before ATRP, lanes 3-5: GFP-C-POEGMA conjugate and residual unreacted macroinitiator from Rxns 1, 2 and 3, lane 6: GFP-C-Gly3 control after ATRP using Rxn 3 condition, and lane 7: GFP-C-Br physically mixed with free POEGMA synthesized using Rxn 3 conditions. Free POEGMA does not appear in gel due to lack of charge. D) Fluorescence spectra of GFP before initiator attachment (red), after initiator attachment (yellow), and after in situ ATRP (navy, Rxn 3 condition, conjugate Mw =263.1 kDa as measured by SEC-MALS); all samples at 20 µM (85)...... 40

Figure 9: SDS-PAGE analysis of A) ITC purification of exendin-srt-His6-ELP. Lane 1: marker, lane 2: E. coli lysate, lanes 3 and 4: soluble protein after one and two ITC cycles. Gel stained by CuIICl2. B) Sortase-catalyzed attachment of the ATRP initiator AEBMP at the C-terminus of exendin and purification of exendin-C-Br macroinitiator. Lane 1: MW marker, lane 2: sortase reaction mixture after 18 h of reaction at 20 °C, and lane 3: exendin-C-Br macroinitiator purified by reverse His-tag purification. Gel stained by Coomassie (88)...... 61

Figure 10: MS analysis of exendin-C-Br macroinitiator. A) Matrix-assisted laser desorption ionization-MS (MALDI-MS) spectrum of exendin-C-Br. Major peak at 5,132.55 Da agrees well with theoretical mass of 5,131.44 Da corresponding to a single AEBMP initiator attached to exendin. B) Isotopic distribution of exendin-C-Br C- terminal peptide [NGGPSSGAPPPSLPET–“AEBMP”]2+ detected by LC/MS-MS after trypsin digestion. C) Theoretical isotopic distribution of the C-terminal peptide generated by Molecular Mass Calculator software (Pacific Northwest National Laboratory) (88)...... 62

Figure 11: Characterizations of EG9 exendin-C-POEGMA conjugates. A and B) SEC traces of ATRP reaction mixtures of grafting EG9 POEGMA from exendin-C-Br carried out for 0.5 h, 1 h, 1.25 h, 2 h and 3 h, detected by UV-vis absorbance at 280 nm and refractive index (RI). The signal from the residual exendin-C-Br was too low to be detected due to its small size and low concentration. C) Coomassie-stained SDS-PAGE analysis of EG9 exendin-C-POEGMA conjugates purified by a single round of preparative SEC. Lane 1: marker, lanes 2-6: purified 25.4 kDa, 54.6 kDa, 66.2 kDa, 97.2 kDa and 155.0 kDa EG9 conjugates. D) Cyclic adenosine monophosphate (cAMP) responses of native exendin and EG9 exendin-C-POEGMA conjugates in baby hamster kidney (BHK) cells expressing the GLP-1 receptor. Half-maximal effective concentration (EC50) values are summarized in Table 3 (88)...... 64

Figure 12: Assessment of in vivo dose-dependent efficacy of EG9 exendin-C-POEGMA. A) Overlaid normalized blood glucose levels of 6-wk-old male C57BL/6J mice (n=3) maintained on a 60 kCal% diet measured before and after a single s.c. injection of a 66.2 kDa EG9 exendin-C-POEGMA conjugate at 25, 50, 80 nmol/kg or PBS control of equivalent volume administered at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h prior to and immediately before injection. B) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point (88)...... 66

Figure 13: Assessment of MW-dependent in vivo efficacy of EG9 exendin-C-POEGMA conjugates. Blood glucose levels in fed mice were measured before and after a single s.c. injection of A) unmodified exendin, or B-E) 25.4 kDa, 54.6 kDa, 97.2 kDa, and 155.0 kDa EG9 exendin-C-POEGMA conjugates, compared to PBS control. The peptide and conjugates were injected at 25 nmol/kg and PBS was injected at equivalent volume at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h and immediately before injection. Data were analyzed by repeated measures two-way analysis of variance (ANOVA), followed by post hoc Dunnett’s multiple comparison test. F) Glucose profiles in B-E overlaid for comparison. G) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point. Weights for the exendin group were not measured at t=144 h. H) Area under the curve (AUC) of blood glucose profiles (0 h to 144 h, with respect to 0% baseline) as a function of conjugate Mn. AUCs were compared using one-way ANOVA followed by post hoc Tukey’s multiple comparison test. For all studies, n=6, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001 (88)...... 69

Figure 14: Intraperitoneal glucose tolerance test (IPGTT) of an EG9 exendin-POEGMA in mice. Blood glucose levels measured in mice in an IPGTT performed at 24 h and 72 h

xvi

after a single s.c. injection of A and B) the 54.6 kDa EG9 exendin-POEGMA conjugate or C and D) unmodified exendin at 25 nmol/kg, compared to PBS of equivalent volume. AUCs of treatment and PBS were compared using an unpaired parametric two-tailed t test (n=5 for A and C, n=3 for B and D, **P < 0.01, and ****P <0.0001). Exendin was not significant at either time point (88)...... 72

Figure 15: Assessment of reactivity of an EG9 exendin-C-POEGMA conjugate toward anti-PEG antibodies in patient plasma samples. A) Direct ELISA probing native exendin, 54.6 kDa EG9 exendin-C-POEGMA conjugate, ADA, BSA, Krystexxa® (PEG-uricase) and Adagen® (PEG-ADA) with diluent, an anti-PEG negative patient plasma sample, or one of two anti-PEG positive plasma samples. B) Competitive ELISA, where various amounts of exendin, 54.6 kDa EG9 exendin-C-POEMGA, ADA and Adagen® were allowed to compete with Krystexxa® for binding with anti-PEG antibodies in a positive plasma sample. In both assays, the same unmodified peptide/protein content or similar PEG/OEG content in the case of polymer-modified samples per well were compared. See Methods section for details. Data were analyzed by two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test (n=3, ****P <0.0001) (88)...... 83

Figure 16: Characterizations of EG3 OEGMA monomer and exendin-C-POEGMA conjugates. A) LC/ESI-MS characterization of OEGMA monomer with Mn 232 Da or precisely 3 side-chain EG repeats. Peak detected as [M+Na]+. B and C) SEC traces of ATRP reaction mixtures of grafting EG9 POEGMA from exendin-C-Br carried out for 2.5 h, 3 h, 4.5 h, 5.5 h and 8 h, detected by UV-vis absorbance at 280 nm and RI. Signal from residual exendin-C-Br was too low to be detected due to its small size and low concentration. D) Coomassie-stained SDS-PAGE analysis of EG3 exendin-C-POEGMA conjugates purified by a single round of preparative SEC. Lane 1: marker, lanes 2-6: purified 20.1 kDa, 26.3 kDa, 42.7 kDa, 55.6 kDa and 71.5 kDa EG3 conjugates. E) Circular dichroism (CD) spectra of exendin and the 71.6 kDa EG3 exendin-C-POEGMA scanned at 10 µM. F) cAMP response of native exendin and EG3 exendin-C-POEGMA conjugates in BHK cells expressing the GLP-1R. EC50 values are summarized in Table 7 (88)...... 85

Figure 17: Characterizations of exendin-C-PEG conjugates. A and B) SEC traces of purified exendin-C-PEG conjugates with nominal PEG MWs of 10, 20, and 30 kDa, detected by UV-vis absorbance at 280 nm and RI. C) Coomassie-stained SDS-PAGE analysis of exendin-C-PEG conjugates. Lane 1: marker, lanes 2-4: purified exendin-C- PEG conjugates with nominal PEG MWs of 10, 20, and 30 kDa. D) cAMP responses of native exendin and exendin-C-PEG conjugates in BHK cells expressing the GLP-1R. EC50 values are summarized in Table 8...... 88

xvii

Figure 18: Assessment of reactivity of EG3 and EG9 exendin-C-POEGMA conjugates toward anti-PEG antibodies in patient plasma samples. A) Direct ELISA probing native exendin, 55.6 kDa EG3 and 54.6 kDa EG9 exendin-C-POEGMA conjugates, ADA, BSA, Krystexxa® (PEG-uricase) and Adagen® (PEG-ADA) with diluent, an anti-PEG negative patient plasma sample, or one of two anti-PEG positive plasma samples. B) Competitive ELISA, where various amounts of exendin, 55.6 kDa EG3 and 54.6 kDa EG9 exendin-C- POEMGA conjugates, ADA and Adagen® were allowed to compete with Krystexxa® for binding with anti-PEG antibodies in a positive plasma sample. In both assays, the same unmodified peptide/protein content or similar PEG/OEG content in the case of polymer- modified samples per well were compared. Data were analyzed by two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test (n=5, **<0.01, ****P <0.0001) (88)...... 90

Figure 19: Assessment of in vivo dose-dependent efficacy of EG3 exendin-C-POEGMA. A) Overlaid normalized blood glucose levels of fed mice (n=3) measured before and after a single s.c. injection of a 71.6 kDa EG3 exendin-C-POEGMA conjugate at 25, 50, 75, 150, 250 nmol/kg or PBS control of equivalent volume administered at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h prior to and immediately before injection. B) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point...... 93

Figure 20: Assessment of in vivo efficacy of EG9 exendin-C-POEGMA and exendin-C- PEG conjugates of various MWs. Blood glucose levels in fed mice (n=5) were measured before and after a single s.c. injection of A, C, E) 26.3 kDa, 55.6 kDa and 71.6 kDa EG9 exendin-C-POEGMA conjugates and B, D, F) exendin-C-PEG conjugates with nominal PEG MWs of 10, 20 and 30 kDa, compared to PBS control. All conjugates were injected at 25 nmol/kg and PBS was injected at equivalent volume at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h and immediately before injection. Data were analyzed by repeated measures two-way analysis of variance (ANOVA), followed by post hoc Dunnett’s multiple comparison test. F) Glucose profiles in A-F overlaid for comparison. G) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point. Glucose and weights at 120 h were only measured for the PBS, 55.6 kDa EG3 exendin-C-POEGMA, and exendin- C-PEG20k groups...... 94

xviii

Blood samples were collected via tail vein at various time points for fluorescence quantification. Data were analyzed using a non-compartmental fit (solid lines) to derive the pharmacokinetic parameters shown in Table 11 (88)...... 98

Figure 22: Overlaid un-normalized blood glucose profiles of fed mice (n=3) measured before and after a single s.c. injection of a 66.2 kDa EG9 exendin-C-POEGMA conjugate at 25, 50, 80 nmol/kg or PBS control of equivalent volume administered at t= 0 h...... 104

Figure 23: Assessment of in vivo efficacy of unmodified exendin. Full A) normalized and B) un-normalized blood glucose profiles of fed mice (n=6) that received a single s.c. injection of unmodified exendin administered at 25 nmol/kg or PBS control at equivalent volume injected at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h prior to and immediately before injection...... 104

Figure 24: Overlaid un-normalized blood glucose profiles of fed mice (n=6) measured before and after receiving a single s.c. injection of 25.4 kDa, 54.6 kDa, 97.2 kDa, 155.0 kDa EG9 exendin-C-POEGMA conjugates at 25 nmol/kg or PBS control at equivalent volume injected at t= 0 h...... 105

Figure 25: Overlaid un-normalized blood glucose profiles of fed mice (n=3) measured before and after receiving a single s.c. injection of a 71.6 kDa EG3 exendin-C-POEGMA conjugate at 25, 50, 75, 150, 250 nmol/kg or PBS control at equivalent volume injected at t= 0 h...... 105

Figure 26: Overlaid un-normalized blood glucose profiles of fed mice (n=3) measured before and after receiving a single s.c. injection of EG3 exendin-C-POEGMA and exendin-C-PEG conjugates at 25 nmol/kg or PBS control at equivalent volume injected at t= 0 h...... 106

xix

Acknowledgements

This work was supported by grants to Dr. Ashutosh Chilkoti from the National

Institutes of Health. I thank the Center for Biomolecular and Tissue Engineering for supporting me with a two-year graduate student training grant, as well as the Duke

Graduate School for their support with a James B. Duke fellowship.

I am deeply grateful to my advisor, Dr. Ashutosh Chilkoti, for his continued guidance and support over the years, particularly in times of challenges, for his encouragement and willingness to help me seek out the resources needed to push the project forward. I am also appreciative to my committee members for their time and valuable feedback.

A special thank you is owed to my collaborators: Dr. Krzysztof Matyjaszewski and Dr. Antonina Simakova at the Department of Chemistry at Carnegie Mellon

University, for generously allowing me to visit their laboratory and sharing their expertise in ATRP without any reservation; Dr. Michael Hershfield and Dr. Nancy

Ganson at the Duke Department of Biochemistry, for providing us with their expertise and unparalleled resources to investigate the antigenicity aspect of POEGMAlation.

Additionally, I am thankful to all of my talented and diligent colleagues in the

Chilkoti lab for contributing to and sustaining a collaborative and intellectually stimulating environment. In particular, I would like to acknowledge Dr. Miriam

Amiram (former Ph.D. student, now a post-doctoral fellow at Yale University) for contributing to the molecular biology work in Chapter 2, Dr. Xinghai Li, Dr. Wenge Liu, and Imran Özer for their help with conducting the in vivo studies in Chapters 3 and 4, and Kelli Luginbuhl for constructive discussions on diabetes-related experiments in

Chapters 3 and 4. I would also like to thank Dr. Jinyao Liu and Dr. Yan Pang, whom I collaborated with on a related project (135). Although not discussed in detail in this dissertation, the collaboration work simplified the synthesis of linear PEG conjugates that were used for comparison in this study.

Finally, my greatest appreciation goes to my family, especially my parents and grandparents for their unconditional love and support, and my husband for always believing in me. It would not have been possible without them.

xxi

1. Introduction

1.1 Peptides and Proteins as Therapeutics

With more than a hundred peptides and proteins approved by the FDA to treat various diseases and many more in clinical and pre-clinical development, therapeutic peptides and proteins make an important class of drugs today (1-4). Peptide and protein drugs have exquisite specificity, low toxicity, and high affinity for diverse targets (2, 4).

However, the clinical use of all peptides and most proteins (with the exception of antibodies, albumin (5) and transferrin (6)) is challenged by their rapid clearance from circulation following parenteral administration due to a small size and/or immunogenicity in the case that the biomolecule is derived from a non-human origin (7).

Their short plasma half-lives on the order of minutes to a few hours necessitate frequent injections, which can cause an undesirable peak-to-valley fluctuation of the drug concentration in vivo as well as reduce patient compliance and increase treatment cost

(8). Other limitations of peptide and protein therapeutics may include poor stability and low solubility (9). These limitations make native peptide and protein drugs unsuitable for therapeutic use without an engineered alternative (8, 10).

1.2 Delivery Strategies for Peptide and Protein Therapeutics

There are generally three common approaches to improving the half-life of a biologic drug: 1) engineering the sequence to enhance stability (4, 7), 2) developing novel

formulations that provide sustained release (8, 10-12), and 3) fusing long-circulating carrier proteins (13-15) or conjugating “stealth” polymers (9, 16) to the drug to reduce renal clearance. However, these methods are not without limitations. Sequence engineering, such as the incorporation of D-amino acids or other chemically esoteric amino acid derivatives, is effective in limiting proteolytic degradation of the peptide or protein (7), but can also prevent it from being manufactured using recombinant technology (17). Encapsulation in delivery carriers often limit bioavailability or require complex multi-step formulation processes with variable loading capacity (12, 18, 19), while most pump and depot systems require surgical implantation (20-22). Fusion of proteins and peptides to long-circulating carrier molecules such as human serum albumin (14), or Fc fragments (15) has shown promise in enhancing circulating half-life.

However, this half-life extension typically reduces activity by one to several orders of magnitude and requires expensive mammalian expression systems (13, 23).

1.3 PEGylation

Among the various delivery approaches, PEGylation, or the covalent conjugation of poly(ethylene glycol) (PEG) to therapeutic peptides and proteins, and more recently oligonucleotide-based drugs, has the longest history of successful clinical use (24). The emergence of PEGylation dates back to the late 1970s, when the seminal papers by Davis and coworkers established PEG as a “stealth” polymer, as defined by its ability to

prolong the in vivo circulation half-life and reduce the immunogenicity of biomolecules upon covalent conjugation (25, 26). These benefits are attributed to the fact that in aqueous solution, the conjugated PEG forms hydrogen bonds with water to create a hydration layer on its surface, which significantly increases the hydrodynamic radius of the conjugate to minimize renal clearance, and shields the immunogenic epitopes on the target biomolecule from immune system recognition (16, 27). Since the approval of the first PEGylated drug, PEG-adenosine deaminase (PEG-ADA, trade name Adagen®) for treating severe combined immunodeficiency disease (SCID), by the U.S. Food and Drug

Administration (FDA) in 1990, PEGylation has quickly become one of the most commonly used drug delivery approaches, evident from the numerous PEGylated drugs currently on the market for treating a variety of diseases and many more in clinical and pre-clinical development (16, 28-30).

However, after close to forty years of research and over two decades of clinical use, the limitations of PEGylation have begun to emerge, which include its synthetic limitations, non-degradability and immunogenicity of the polymer (31-33).

Conventional methods for the synthesis of PEGylated conjugates have the following limitations: 1) conjugation involves the reaction between protein-repulsive PEG chains and biomacromolecules, so that even with a large excess of polymer, steric hindrance still results in a low yield of conjugate, typically in the 10-20% range (34); 2) the presence of a large excess of unreacted polymer makes product purification non-trivial; and 3)

conjugation typically involves reacting the chain-ends of the polymer with reactive side- groups on lysine and cysteine residues, which are often promiscuously distributed on the biomolecule, thus yielding chemically heterogeneous products that can significantly compromise the bioactivity of the drug and greatly complicate regulatory approval (31,

33, 35).

In applications where the molecular weight (MW) of the conjugated PEG is chosen to be greater than renal clearance so as to confer a long circulation half-life of the drug, the lack of degradation of PEG in systemic circulation may cause the polymer or the PEGylated conjugate to linger in circulation and eventually either clear through the liver or deposit in various tissues (16). Early studies have shown vacuole formation in organs including liver, kidneys and spleen associated with PEGylated proteins administered in several animal models (36-38), though more in-depth investigation is needed to confirm a cause-and-effect relationship between PEGylation and vacuolation.

Furthermore, while PEG had been generally accepted as an inert and biocompatible material for many years, studies have now confirmed that it is immunogenic. Anti-PEG antibodies have been induced in patients treated with

PEGylated drugs and have been shown to correlate with rapid clearance of these drugs

(39-42). High levels of pre-existing anti-PEG antibodies have also been found in individuals naïve to PEGylated agents, which are associated with serious first-exposure

allergic reactions (43). These adverse consequences of PEG immunogenicity are seriously undermining the safety and efficacy of traditional PEGylated drugs.

1.4 Motivation and Overview

Motivated by the synthetic and safety limitations of traditional PEGylation, we herein report the development of a next-generation PEGylation technology, which we named POEGMAlation, or the covalent conjugation of the PEG-based brush polymer poly[oligo(ethylene glycol) methyl ether methacrylate] (POEGMA) to therapeutic biomolecules.

Each of the following three chapters discusses a different aspect of the

POEGMAlation technology. Chapter 2 describes the development of the sortase- catalyzed polymer conjugation technology, which addresses the synthetic limitations of conventional PEGylation by enabling high-yield synthesis of C-terminally site-specific and 1:1 stoichiometric POEGMA conjugates of a peptide or protein. In Chapter 3, the therapeutic potential of POEGMA conjugates is demonstrated by implementing sortase- catalyzed polymer conjugation strategy with exendin-4 (exendin), a therapeutic peptide clinically used to treat type 2 diabetes, and assessing the therapeutic efficacy of exendin-

C-POEGMA conjugates in a diabetic mouse model. Chapter 4 demonstrates the modulation and elimination of anti-PEG antigenicity of exendin-C-POEGMA

conjugates, or their reactivity toward pre-existing anti-PEG antibodies in patients, by optimizing the side-chain length of the conjugated POEGMA.

2. Development of Sortase-Catalyzed Polymer Conjugation

2.1 Introduction

2.1.1 Recent Developments in Peptide/Protein-Polymer Conjugation

Peptide/protein-polymer conjugates are a class of hybrid biomacromolecules offering a diverse range of functions. Covalent conjugation with stealth polymers like

PEG can improve the pharmacokinetics and reduce the immunogenicity of therapeutic proteins and peptides (44, 45). Conjugation with “smart” polymers can also impart interesting and useful behaviors such as externally triggered activity switching of the biomolecule (46, 47).

The conventional route of synthesizing peptide/protein-polymer conjugates, as in the case of PEGylation, involves separate synthesis and attachment of a polymer to the biomolecule of interest. This so-called “grafting to” approach often suffers from low yield due to steric hindrance between the biomolecule and polymer and difficulty in product purification as a result of similar sizes and surface properties of the reactants and products (31, 33, 35).

In an effort to achieve high-yield synthesis of peptide/ protein-polymer conjugates and to simplify purification of the conjugate, the concept of “grafting from”

was introduced in recent years (48-51). The “grafting from” approach, also termed in situ polymerization, entails the attachment of polymerization initiator(s) or chain transfer agent(s) [CTA(s)] to the biomolecule of interest, followed by grafting the desired polymer(s) from the macroinitiator or macroCTA. The use of synthetic monomers that are far smaller than polymers as reactants significantly reduces the steric hindrance and increases diffusivity, and enhances conjugation efficiency. The large size difference between the residual monomer, the protein macroinitiator and the protein–polymer conjugate allows for easy separation of the conjugate by chromatography (31, 52, 53).

However, control over the site and stoichiometry of polymer conjugation remained a challenge. Site-specificity and well-defined stoichiometry are important features of peptide/protein-polymer conjugates as they provide homogeneous products and minimize the loss of bioactivity. Earlier studies either exploited interactions that are not generally found in peptides and proteins (48) or non-specifically targeted reactive side-chains on lysine (54, 55) or cysteine (47, 50, 56) residues to attach the initiation sites.

Although in some cases, care was taken to ensure 1:1 stoichiometry by tuning initiator- to-protein ratio or introducing mutations by protein engineering, none of these methods are generally applicable.

2.1.2 Control of Site-Specificity and Stoichiometry

Addressing the issues in the earlier studies, a number of general methods have emerged for the grafting of polymers from proteins and peptides in a site-specific and stoichiometric fashion. One approach uses unnatural amino acid (UAA) incorporation to install a polymerization initiator at a desired location into a protein, followed by in situ polymerization from the protein macroinitiator (57, 58). With careful design and engineering, this strategy can be used to incorporate a polymerization initiation site at virtually any residue on a biomolecule. However, UAA incorporation has several drawbacks: 1) it requires substantial protein and cell-line engineering to install the genetic machinery to translate a stop codon as a UAA (17, 59); 2) product costs are high as a large amount of expensive UAA has to be included in the culture media (60); 3) yields are significantly lower for UAA-containing protein variants compared to their wild-type counterparts (60); and 4) the toxicity and immunogenicity of UAA-containing proteins are unknown.

Our group had previously developed two complementary strategies for the in situ growth of a polymer site-specifically from the N- or C-terminus of a peptide or protein (61, 62). As the N- and C-termini are conserved in all biomolecules, and are frequently solvent accessible, these strategies collectively offer a general methodology for the “grafting from” synthesis of site-specific and stoichiometric (one polymer chain per peptide or protein subunit) peptide/protein-polymer conjugates. The N-terminal

strategy exploits the sufficiently large difference between the pKa of the N-terminal amine (pKa ~7.8) and that of amines on the lysine side chains (pKa ~10.5-12), to achieve site-specific attachment of an initiator solely at the N-terminus of a peptide or protein, followed by grafting of a polymer from the macroinitiator by in situ Atom Transfer

Radical Polymerization (ATRP) (61).

The complementary C-terminal strategy exploits the cleavage mechanism of a mutated intein that is recombinantly fused to the C-terminus of the peptide or protein of interest, to generate a reactive thioester on the C-terminus of the biomolecule. This C- terminal thioester can then react with an N-terminal cysteine on an ATRP initiator to site-specifically install the initiator at the C-terminus of the peptide or protein, enabling subsequent grafting of a polymer from the C-terminus of the peptide or protein via in situ ATRP (62). The main advantages of this C-terminal intein strategy are its simple, one-step initiator attachment and its “scarless nature”, in which the intein cleanly cleaves itself out, leaving no extra residue between the C-terminal end of the target protein and the attached initiator. However, this strategy has several drawbacks. First, because inteins are relatively large protein domains, their incorporation may reduce the expression of the fusion protein. Second, a purification tag is initially fused at the C- terminus of the peptide/protein-intein fusion and is designed to be removed simultaneously by the intein cleavage after purification of the fusion protein. However, the N->S acyl shift step of the intein cleavage mechanism takes place post-translationally

in E. coli, and the resultant thioester linkage between the protein and intein is prone to intracellular reduction, which results in premature cleavage of the purification tag and thus decreasing overall yield of the fusion protein. Additionally, the presence of a cysteine at the ligation site leads to the formation of small fractions of several undesirable side-products, including one with two ATRP initiators (62).

2.1.3 Atom Transfer Radical Polymerization (ATRP)

An additional challenge of “grafting from” conjugation is the need to grow a polymer from a peptide or protein in aqueous conditions – necessary to preserve its structural integrity and thus biological activity – wherein the MW of the polymer can be precisely specified and its dispersity minimized. This challenge has, to a large extent, been solved by the maturation of controlled/living radical polymerization (CRP) methods, such as atom transfer radical polymerization (ATRP), reversible addition– fragmentation chain-transfer polymerization (RAFT), and nitroxide-mediated radical polymerization (NMP) (53, 63).

ATRP was invented by Matyjaszewski and coworkers in 1995 (65). It is a highly versatile technique that enables the synthesis of compositionally and architecturally diverse polymers with a high degree of control over molecular weight and narrow dispersity. As shown in Figure 1, the main components of a classic ATRP reaction are an alkyl halide initiator (R-X), the vinyl monomer of interest (M), and a transition

metal/ligand complex (Mt/Ln) capable of equilibrating between two oxidation states. The transition metal typically takes the form of a metal halide. Depending on the application, the initiator can also be conjugated to a surface or to a macromolecule to form a macroinitiator (47, 48, 66).

The ATRP mechanism builds on the reversible switching between the two oxidation states of the transition metal (Mt). When Mt is in its lower oxidation state

(Mtm), also known as the activator, the halogen radical (X) end-caps the propagating chain to keep it in the dormant or deactivated state. As Mt goes through electron transfer to reversibly switch to its higher oxidation state (Mtm+1), also known as the deactivator, X then couples with the transition metal, turning the propagating chain end into an active radical for monomer attachment (65, 67). Simply speaking, the transition metal essentially serves as the oscillating “on-off switch” of an ATRP reaction. Reaction conditions are tuned such that the equilibrium is strongly shifted in the direction of

deactivation, thus the propagating chains are primarily in the deactivated state and only transiently activated, causing the reaction to proceed in a highly controlled manner. As the rate of initiation is significantly higher compared to the rate of propagation, all chains in the reaction are thus essentially growing concurrently. The direction of this equilibrium is influenced by many factors, including the structure of the reaction components and conditions such as choice of solvent and temperature (68-70), thus some initial optimization is required. The slow and controlled propagation ensures that the concentration of active radical in the reaction mixture at any given time is very low, consequently the probability of termination is minimized. The controlled propagation of all chains and minimized termination give rise to the distinct features of ATRP that define it as a controlled/living radical polymerization: 1) first-order reaction kinetics, 2) pre-determinable degree of polymerization (DPn) as it linearly correlates with monomer conversion, 3) narrow polymer dispersity due to negligible termination events, and 4) long-lived polymer chains with preserved functionalities. The last feature enables the facile synthesis of compositionally and structurally complex polymers such as block copolymer and star-like polymers (71).

ATRP conducted in polar solvents such as aqueous buffers is prone to having several competing side-reactions, including decreased stability of the activator-ligand complex, dissociation of the halide from the deactivator, disproportionation of the activator, and disproportionation or hydrolysis of the carbon-halogen bond (72, 73),

which can adversely affect the reaction kinetics and outcome. However, careful selection of reaction components and optimization of conditions are often sufficient to ensure a well-controlled reaction that gives rise to product with precisely defined MW and narrow dispersity (74, 75).

2.1.4 Sortase-Catalyzed C-Terminal Ligation

Aiming to address the issues associated with the previous conjugation strategies and to continue expanding the toolbox of site-specific and stoichiometric “grafting from” polymer conjugation, the canonical C-terminal ligation mechanism of the sortase

A transpeptidase from Staphylococcus aureus was chosen for initiator attachment because its high specificity and mild reaction conditions are ideal for protein and peptide modification (76, 77). The natural function of this mechanism is to anchor surface proteins to the bacterial cell wall (78). The versatility of sortase-catalyzed C-terminal ligation had been demonstrated previously (79-82), but it had not been exploited to install a polymerization initiator at a defined site on a protein or peptide, to enable in situ grafting of a polymer from the biomolecule.

Figure 2: C-terminal ligation mechanism of sortase A. A) Sortase A recognizes the pentapeptide sequence “LPXTG” embedded in or terminally appended to a target biomolecule, and its thiol group on a key catalytic cysteine residue nucleophilically attacks the amide bond between “T” and “G” within the recognition sequence, resulting in an intermediate consisted of sortase A temporarily connected to the C- terminus of the target biomolecule via a thioacyl bond. B) A second (bio)molecule carrying an N-terminal oligoglycine motif nuceophilically attacks the thioacyl bond to displace sortase A and the two (bio)molecules are ligated via a native peptide bond. LPXTG: lysine-proline-X-threonine-glycine, where “X” is any standard amino acid residue.

As shown in Figure 2, sortase A recognizes the pentapeptide sequence “LPXTG”

(lysine-proline-X-threonine-glycine, where “X” is any standard amino acid residue) embedded in or terminally attached to a protein or peptide, and its cysteine (C) nucleophilically attacks the amide bond between threonine and glycine within the recognition sequence, generating a relatively long-lived enzyme-thioacyl intermediate

(76). To complete transpeptidation, a second (bio)molecule with an N-terminal

nucleophilic group, typically an oligoglycine motif, attacks the intermediate, displacing sortase A and joining the two molecules via a native peptide bond (76).

2.1.5 Overview and Choice of Components

Sortase A was used to site-specifically attach an initiator solely at the C-terminus of green fluorescent protein (GFP), followed by growth of the stealth polymer POEGMA from the protein by in situ ATRP in aqueous buffer, to yield site-specific (C-terminal) and stoichiometric (1:1) GFP-C-POEGMA conjugates. GFP was chosen as a model protein in this proof-of-concept study as its fluorescence allows easy tracking of the protein through the initiator installation and in situ polymerization, and it also serves as an indicator of the folding and activity of the protein.

The PEG-based brush polymer POEGMA was chosen for in situ polymer growth because our group had previously shown that POEGMA conjugates of model proteins significantly increased circulation half-lives (61, 62) and tumor retention of the proteins

(62). Furthermore, POEGMA can be synthesized by ATRP in aqueous medium with good control of the polymer molecular weight (MW) and dispersity (54, 55, 83), attributes that are essential for producing functionally uniform peptide/protein-polymer conjugates. Additionally, POEGMA is potentially biodegradable as its oligo(ethylene glycol) [OEG] side chains are linked to the backbone by enzyme-degradable and hydrolyzable ester bonds, and the degradation products are small enough to be cleared

from the body by renal filtration. Thus, the potential degradability of POEGMA may overcome the non-biodegradable problem of PEG for the design of the next generation protein drugs (33).

2.2 Materials and Methods

2.2.1 Materials

All molecular biology reagents were purchased from New England Biolabs, unless otherwise specified. All chemical reagents were purchased from Sigma Aldrich and used as received, unless otherwise specified. Nucleotides are denoted by their single letter code.

2.2.2 Cloning of GFP-srt-His6-ELP

A previously constructed pET25b(+) vector encoding a protein-srt-His6-ELP fusion gene was used as the target vector for cloning the GFP-srt-His6-ELP construct. In this vector, the protein-srt insert was flanked by XbaI and HindIII restriction sites followed by codons that encode a hexahistidine-tag (His6-tag), a thrombin cleavage site and an ELP with a sequence of (VPGXG)90, where X represents alanine (A), glycine (G) and valine (V) at 2:3:5 molar ratio. 1.5 µg of this target vector was digested with 2 µL each of XbaI and HindIII in 1X NEB buffer 2 with 1X bovine serum albumin (BSA) for

1.5 h at 37 °C. The digestion mixture was enzymatically dephosphorylated with 1 µL calf intestinal phosphatase (CIP) for 1 h at 37 °C to prevent self-circularization of the vector.

The restricted and dephosporylated vector was then purified using a polymerase chain reaction (PCR) purification kit (QIAquick, QIAGEN).

The gene for GFP was PCR-amplified from an available GFP-containing pET32b(+) vector from a previous study (62) using the forward and reverse primers:

GFP-F: 5’ TTCCCCTCTAGAAATAATTTTGT 3’

GFP-R: 3’ CTACTTGACATGTTGCAGCTGCCGCCACCCCCGTCGAACGGCCTTT

GGCCGCC ATTCGAAACGAAC 5’

The GFP-F primer was designed to anneal at the ribosomal binding site (RBS) immediately upstream of the target GFP sequence and includes an XbaI site for cloning into the target vector. The GFP-R primer was designed to anneal to the C-terminus of

GFP and includes an overhang that codes for a Gly4Ser linker and the ‘LPETG’ sortase A recognition sequence as well as a HindIII site for cloning into the target vector.

The GFP-srt fragment was amplified in two 50 µL PCR reactions, each containing

25 µL GoTaq green master mix, 10 pmol each of forward and reverse primers, 0.25 µL template and nuclease-free water in a total volume of 50 µL. The PCR reaction conditions were: 95 °C for 2 min for initial denaturation, followed by 40 cycles at 95 °C for 30 s, 52 °C for 30 s, and 72 °C for 1 min. The resulting ‘GFP-srt’ PCR product was purified using a PCR purification kit and visualized on a 1% agarose gel stained with

SYBR® Safe DNA stain. 1.5 µg of the GFP product was then digested with 2 µL each of

XbaI and HindIII in 1X NEB buffer 2 and 1X BSA for 1.5 h at 37 °C and was purified using a PCR purification kit (QIAquick, QIAGEN).

The ‘GFP-srt’ PCR insert (5 µL) was ligated into the target vector (3 µL) using 4

µL of T4 ligase in 1X T4 ligase buffer and nuclease-free water in a total volume of 20 µL.

The ligation mixture was incubated at room temperature for 1 h. BL21 (DE) E. coli cells were then transformed with 7 µL of the ligation mixture for 15 min in an ice-water bath, heat-shocked at 42 °C for 30 s, and returned to the ice-water mixture for another 2 min.

The cells were recovered in SOC media while horizontally shaking at 200 rpm at 37 °C for 40 min, and were then plated on TB agarose plates containing 100 µg/ml ampicillin

(Calbiochem). Several clones were grown overnight in 3 mL TB media supplemented with 100 µg/ml ampicillin, and the plasmids were isolated by a miniprep plasmid purification kit (Qiagen) for DNA sequence verification.

2.2.3 Expression and Purification of GFP-srt-His6-ELP

Transformed cells verified to contain the desired GFP-srt-His6-ELP construct were cultured in Terrific Broth (TB, Mo Bio Laboratories, Inc.) supplemented with 100

µg/ml of ampicillin at 37 °C. Once the optical density at 600 nm (OD600) of the culture reached 0.6, Isopropyl β-D-1- thiogalactopyranoside (IPTG, AMRESCO) was added to a final concentration of 0.5 mM to induce overnight expression. Cells were harvested 15 h post induction by centrifugation at 700xg for 10 min and were lysed by sonication on a

Misonex Ultrasonic Liquid Processer (Qsonica, LLC.) at amplitude 85 for 3 min. Nucleic acids were removed from the crude extract by addition of 1 v% polyethyleneimine (PEI,

Acros) followed by centrifugation at 4 °C at 21,000xg for 10 min. The ELP tag enable of the fusion by Inverse Transition Cycling (ITC), a nonchromatographic method that our group have developed for the purification of ELP fusion proteins by taking advantage of their inverse phase transition behavior (84). After triggering the inverse phase transition of the fusion by addition of 1M NaCl, the aggregated proteins were collected by centrifugation at 21,000xg for 10 min at ~ 35 °C. The pellet was then resolubilized in cold phosphate buffered saline (PBS, pH 7.4, EMD Millipore) and the resulting solution was centrifuged at 4°C at 21,000xg for 10 min to remove any remaining insoluble material.

The last two steps were repeated, typically three or four times, until satisfactory purity was achieved as verified by sodium dodecyl sulfate polyacrylamide gel electrophoresis

(SDS-PAGE). In the final step, the protein was resolubilized in sortase buffer (50 mM

Tris-Cl, 150 mM NaCl, 10 mM CaCl2, pH 7.5) in preparation for sortase-catalyzed initiator attachment. Protein concentration and yield were assessed on an ND-1000

Nanodrop Spectrophotometer (Thermo Scientific) by UV-vis absorption spectroscopy.

2.2.4 Cloning, Expression and Purification of His6-Sortase A

The gene for sortase A with a 59 N-terminal amino acid truncation (previously shown to not affect its transpeptidase activity (78)) and an N-terminal His6-tag in a

pET15b vector was transformed into BL21 E. coli cells. Expression of protein and cell lysis was carried out identically as for the GFP-srt-His6-ELP fusion protein. The His6- sortase A fusion protein was purified by immobilized metal affinity chromatography

(IMAC) on HisPur™ cobalt spin columns (Thermo Scientific) following the manufacturer’s protocol. Briefly, the cell lysate was mixed with equal volume of equilibration buffer (50 mM sodium phosphate, 300 mM sodium chloride, 10 mM imidazole; pH 7.4) and was loaded onto a pre-equilibrated HisPur™ column. After rotating the loaded columns at 4°C for 30 min to maximize binding, unbound proteins were eluted by centrifugation at 700xg for 2 min. Additional equilibration washes were performed until absorbance measurement at 280 nm of the eluent reached baseline as monitored on a ND-1000 Nanodrop Spectrophotometer. Concentration and yield at each step were calculated from the absorbance measurements. The bound His6-sortase A fusion protein was eluted by centrifugation at 700xg for 2 min in elution buffer (50 mM sodium phosphate, 300 mM sodium chloride, 150 mM imidazole; pH 7.4). Typically the first three elution washes were combined and solvent exchanged by overnight dialysis against sortase buffer in preparation for use.

2.2.5 Synthesis of ATRP Initiator AEBMP

Figure 3: Synthetic scheme of ATRP initiator N-(2-(2-(2-(2- aminoacetamido)acetamido)acetamido)ethyl)-2-bromo-2-methylpropanamide (AEBMP, compound 4) (85).

tert-butyl (2-(2-bromo-2-methylpropanamido)ethyl)carbamate (Figure 3, compound 1): Over a period of 15 min, 2-bromoisobutyryl bromide (3.9 mL, 31.2 mmol) was added to a NaCl/ice cooled bath solution of N-Boc-ethylenediamine (5.01 g, 31.2 mmol) and diisopropylethylamine (6 mL, 34 mmol, 1.1 eq.) in anhydrous dichloromethane (35 mL). After 1 h, the ice bath was removed and the reaction was allowed to warm to room temperature and stirring was continued for 18 h. Silica gel

(~10 g) was added and the mixture was concentrated to dryness under reduced pressure on a rotary evaporator. Flash column chromatography [RediSepRf SiO2 (80 g), 100%

CH2Cl2→ 50% ethyl acetate (EtOAc) in CH2Cl2] gave 1 as an off-white solid (7.36 g, 75%).

1H NMR (CDCl3, 300 MHz): δ 7.2 (bs, 1H), 4.91 (bs, 1H), 3.33 (m, 4H), 1.93 (s, 6H), 1.43 (s,

9H). 13C NMR (CDCl3, 300 MHz): δ 172.9, 157.1, 80.1, 61.9, 42.0, 40.0, 32.5, 28.6. EIMS m/z: 331 ([M+Na]+), 333 ([M+Na]+).

N-(2-aminoethyl)-2-bromo-2-methylpropanamide hydrochloride (Figure 3, compound 2): A solution of 1 (7.36 g, 23.8 mmol) in 4 M HCl in 1,4-dioxane (64 mL, 256 mmol) was stirred at room temperature for 1 h. The reaction mixture was concentrated to dryness on a rotary evaporator and further dried under high vacuum using a vacuum manifold connected to a vacuum pump, giving an off-white solid. The solid was triturated under diethyl ether (Et2O, 3 x 100 mL) and the supernatant was removed by careful decantation. The insoluble material was dried under reduced pressure on a rotary evaporator giving 2 as a pale solid (5.8 g, 99%). 1H NMR (CD3OD, 300 MHz): δ

8.36 (bs, 1H), 3.65 (bs, 1H), 3.51 (s, 2H), 3.09 (s, 2H), 1.94 (s, 6H). 13C NMR (CD3OD, 300

MHz): δ 174.3, 58.9, 39.3, 37.8, 30.7. EIMS m/z: 209 ([M-Cl]+), 211 ([M-Cl]+).

tert-butyl (14-bromo-14-methyl-2,5,8,13-tetraoxo-3,6,9,12- tetraazapentadecyl)carbamate (Figure 3, compound 3): Diisopropylethylamine (10.4 mL, 60 mmol, 2.5 eq.) was added in one portion to an ice-bath cooled suspension of 2

(5.8 g, 23.8 mmol), Boc- Gly-Gly-Gly-OH (6.9 g, 23.8 mmol), and EDC (6.84 g, 36 mmol,

1.5 eq.) in anhydrous CH2Cl2 (80 mL). The mixture was stirred overnight (16 h) then diluted with CH2Cl2 (80 mL). Insoluble material was isolated by vacuum filtration and the filter cake was washed sequentially with H2O (100 mL), cold MeOH (3 x 20 mL),

Et2O (2 x 100 mL) and dried in vacuo giving 3 as a white powder (9.14 g, 80 %). 1H NMR

(CDCl3, 300 MHz): δ 4.15- 4.10 (m, 4H), 3.89 (s, 2H), 3.72 (m, 4H), 1.91 (s, 6H), 1.43 (s,

9H). 13C NMR (CDCl3, 300 MHz): δ 172.4, 168.9, 164.5, 156.8, 79.5, 52.8, 44.9, 44.4, 44.1,

38.2, 29.3, 25.2. EIMS m/z: 503 ([M+Na]+), 505 ([M+Na]+).

N-(2-(2-(2-(2 aminoacetamido)acetamido)acetamido)ethyl)-2-bromo-2- methylpropanamide hydrochloride (Figure 3, compound 4): A solution of 3 (9.0 g, 18.8 mmol) in 4 M HCl in 1,4-dioxane (80 mL, 320 mmol) was stirred at room temperature for

1 h. The reaction mixture was diluted with Et2O (300 mL). Insoluble material was collected and dried by vacuum filtration, giving the product as a white powder (7.7 g,

98%). 1H NMR (CD3OD, 500 MHz): δ 4.20 (m, 4H), 3.85 (s, 2H), 3.70 (m, 4H), 1.92 (s, 6H).

(CDCl3, 300 MHz): δ 171.0, 169.8, 166.5, 163.8, 52.6, 43.3, 42.7, 38.8, 30.3. EIMS m/z: 380

([MH-Cl]+), 382 ([MH-Cl]+).

2.2.6 Sortase-Catalyzed Initiator Attachment and Macroinitiator Purification

A reaction mixture consisting of GFP-srt-His6-ELP, His6-sortase A, and the ATRP initiator AEBMP at a 2:1:60 ratio in sortase buffer was incubated at 37 °C for 5 h. Post reaction, a reverse His-tag purification was performed, where the GFP-C-Br macroinitiator was purified by eluting through a HisPur™ cobalt spin column (Thermo

Scientific) while leaving all other unwanted species bound to the resin, by exploiting the fact that the macroinitiator is the only species in the reaction mixture without a His6-tag.

Equilibration and elution washes were done as described in Section 2.2.4. The first two equilibration washes containing the eluted GFP-C-Br were collected and solvent

exchanged by overnight dialysis against in preparation for use. A control reaction was done by replacing AEBMP with triglycine (Gly3), while keeping all other conditions the same. The resulting GFP-C-Gly3 was used as a negative control in the subsequent in situ

ATRP reaction.

2.2.7 In Situ ATRP of POEGMA from GFP-C-Br

An OEGMA monomer with Mn ~500 Da or ~9 side-chain ethylene glycol repeats

(EG9) on average (Sigma Aldrich, #447943) was eluted through a column packed with activated basic alumina to remove the polymerization inhibitors. Three sets of reaction conditions were attempted and the parameters are summarized in Table 1.

Table 1: Three sets of classic ATRP reaction conditions (Rxn 1-3) used to graft POEGMA from GFP-C-Br (85).

GFP-C-Br CuICl CuIICl2 HMTETA OEGMA Time (µmol/eqv.) (µmol/eqv.) (µmol/eqv.) (µmol/eqv.) (µmol/eqv.) Rxn 1 0.2/1 5.1/25 15.0/75 25.0/125 110/550 30 min

Rxn 2 0.2/1 5.1/25 11.1/55 20.0/100 220/1100 30 min

Rxn 3 0.2/1 5.1/25 11.1/55 20.0/100 440/2200 2 h

Polymerization was typically carried out by first mixing specified amounts of

CuICl, CuIICl2, and 1,1,2,7,10,10-hexamethyltriethylenetetramine (HMTETA) in 100 µL of

MilliQ water until all reagents were completely dissolved and then topped up with 400

µL of PBS. A second solution was prepared by adding OEGMA to 2 mL of 100 µM GFP-

C-Br in PBS. The two solutions were degassed by bubbling separately with argon for 30

min using a Schlenk line, after which the first solution was quickly transferred into the second solution by a cannula. Polymerization was allowed to proceed for a specified time at room temperature under argon and was quenched by bubbling with air. An initial separation of the conjugate from the low molecular weight (MW) reagents was carried out by gel filtration on a disposable PD-10 column (GE Life Science) before subsequent purification and characterization.

2.2.8 SDS-PAGE Analysis and Calculation of Initiator Attachment Efficiency

Samples were prepared in Laemmli loading dye (Bio-Rad) containing 5 v% β- mercaptoethanol. After brief heating at 98 °C, the samples were loaded onto precast 4-

20% Tris-HCl gels (Bio-Rad). Gels were run at 130 V and 400 mA for 55 min in 1x running buffer (25 mM Tris, 192 mM Glycine, and 0.1% SDS) on a Bio-Rad Mini-

PROTEAN gel apparatus. Gels were stained with copper chloride.

To determine the efficiency of initiator attachment, quantification of gel band intensity was performed using ImageJ. This method for quantification of the yield of initiator attachment to GFP is valid because the attachment of the initiator to GFP is not expected to alter the staining of the protein. For each SDS-PAGE gel, bands in each lane were defined in ImageJ and converted into intensity profile plots using a built-in function, where each band was assigned a corresponding peak. After defining the

baseline for each peak, band intensities were computed by calculating the area under each peak. Values were then imported into Excel for analysis.

Because the errors involved in sample loading can be significant when the product of a sortase cleavage reaction is normalized to a standard amount of GFP-srt-

His6-ELP loaded in a separate lane, the yield of each sortase reaction was calculated by internal normalization, wherein it was assumed that the intensity of the products of a sortase cleavage reaction sums to that of the parent fusion construct it was derived from.

Hence, the band intensity of the initial amount of GFP-srt-His6-ELP used in each reaction was determined by summing up all of its products after reaction, namely residual unreacted GFP-srt-His6-ELP, cleaved G-His6-ELP, and transpeptidized GFP-C-Br. The % unreacted product is thus the band intensity of unreacted GFP-srt-His6-ELP divided by the sum of all products and multiplied by 100%, and % transpeptidation is thus 100% -

% unreacted. A very faint band slightly above 50 kDa could also be observed upon close inspection, which corresponds to an intermediate species of the reaction, where sortase

A is linked to the C-terminus of GFP via a thioacyl bond. The presence of sortase A in this species makes its staining not directly comparable to that of the other species, so that the intensity of this band was not incorporated into the overall calculation of reaction yield. However, including it in the sum of intensities and taking its percentage showed that this intermediate only comprised < 1% of the overall intensity at most, so

that omitting it in the calculation of % transpeptidation yield does not significantly change the results.

2.2.9 Liquid Chromatography Electrospray-Ionization Mass Spectrometry (LC/ESI-MS)

Samples at a concentration of 5 µM were first desalted by dialyzing against

MilliQ water overnight. LC/ESI-MS was performed on an Agilent 1100 LC/MSD

Quadrupole Mass Spectrometer. The instrument was calibrated with Cytochrome C and

BSA. The ESI source was set to operate at 300°C with a nebulizer gas pressure of 20 psi and a dry gas flow rate of 7 L/min. 1 µL of sample was separated by reverse phase chromatography on a Zorbax SB-C18 column (Agilent) at 20%-80% acetonitrile/water gradient and a flow rate of 60 µL/min. Spectra were acquired in positive ion mode over the mass to charge range (m/z) of 400-1,600. Theoretical MW of GFP-C-Br was calculated using Molecular Weight Calculator (v. 6.49, Pacific Northwest National Laboratory, ncrr.pnl.gov/software).

2.2.10 Liquid Chromatography Electrospray Ionization Tandem Mass Spectrometry (LC/MS-MS)

100 µL of ~8 µM sample was loaded on to a 0.5 ml ZebaSpin desalting column

(Thermo Scientific) for solvent exchange into 50 mM ammonium bicarbonate (pH 8.0) supplemented with 0.1% Rapigest SF surfactant (Waters Corp), by washing the loaded column with 300 µL of the solvent solution four times. The sample was then reduced

with 5 mM dithiolthreitol for 30 min at 70 °C and free sulfhydryls were alkylated with

10 mM iodoacetamide for 45 min at room temperature. Proteolytic digestion was accomplished by the addition of 500 ng sequencing grade trypsin (Promega) directly to the resin with incubation at 37 °C for 18 h. The digested sample was collected following a 2 min centrifugation at 100 xg, acidified to pH 2.5 with TFA and incubated at 60 °C for

1 h to hydrolyze remaining Rapigest surfactant. Insoluble hydrolyzed surfactant was cleared by centrifugation at 24,000 rpm for 5 min and the sample was then dried by vacuum centrifugation.

The dried sample was resuspended in 20 µL of 2% acetonitrile and 0.1% formic acid, and was subjected to chromatographic separation on a Waters NanoAquity ultra performance liquid chromatography (UPLC) equipped with a 1.7 µm BEH130 C18 reverse-phase column (75 µm I.D. X 250 mm). The mobile phase consisted of (A) 0.1% formic acid in water and (B) 0.1% formic acid in acetonitrile. Following a 1 µL injection, the digested peptides were trapped for 5 min on a 5 µm Symmetry C18 (20 µm I.D. X

180 mm) column at 20 µL/min in 99.9% A. The analytical column (BEH130) was then switched in-line and a linear elution gradient of 5% B to 40% B was performed over 60 min at 400 nL/min. The analytical column was connected to a fused silica PicoTip emitter (New Objective, Cambridge, MA) with a 10 µm tip orifice and coupled to a

Waters Synapt G2 HDMS QToF mass spectrometer through an electrospray interface.

The instrument was operated in a data-dependent mode of acquisition in resolution

mode with the top three most abundant ions selected for MS/MS using a charge state dependent CID energy setting with a 60 s dynamic exclusion list employed.

Mass spectra were processed with Mascot Distiller (Matrix Science) and were then submitted to Mascot searches (Matrix Science) against a SwissProt_Ecoli database appended with the custom Aequorea victoria GFP sequence with 10 ppm precursor and

0.04 Da product ion mass tolerances. Static mass modifications corresponding to carbamidomethylation on Cys residues, dynamic mass modifications corresponding to the ATRP initiator AEBMP, and oxidation of Met residues were included. Searched spectra were imported into Scaffold v4.0 (Proteome Software) and scoring thresholds were set to yield a minimum of 99% protein confidence (implemented by the

PeptideProphet algorithm) based on decoy database searches (86). A minimum of two unique peptides from each protein were required for identification. Extracted ion chromatograms of the expected C-terminal tryptic peptide modified by AEBMP were performed in MassLynx (v4.1) at a 20 ppm mass accuracy window and experimental isotope distributions of the triply charged precursor ion was compared to a theoretical isotope distribution modeled in Molecular Weight Calculator.

2.2.11 Size Exclusion Chromatography (SEC) and Calculation of Conjugation Efficiency

Analytical SEC was performed on a Shimadzu HPLC system equipped with a

UV-vis detector (SPD-10A VP) operating at 280 nm and a fluorescence detector (RF-

10Axl) set at 460 nm excitation and 507 nm emission. 30 µL of samples at ~25 µM concentration were separated on a Protein KW-803 column (with a guard column) using

0.1M Tris-HCl buffer (pH 7.4) as mobile phase at 25 °C and a flow rate of 0.5 mL/min.

Preparative SEC to purify the conjugates was performed on an AKTA system

(GE Healthcare) equipped with a photodiode detector set at 280 nm and a HiLoad

26/600 Superdex 200 PG column using PBS as mobile phase at 4 °C and a flow rate of 3 mL/min. To determine conjugation efficiency of in situ ATRP from the C-terminus of

GFP, area under the curve (AUC) of the GFP-C-POEGMA conjugate peak and the residual unreacted GFP-C-Br macroinitiator peak in the chromatogram of each polymerization reaction mixture were computed by a built-in function in EZStart software (v. 7.4, Shimadzu). Sum of the areas of the two peaks corresponding to the macroinitiator and the conjugate in each chromatogram was regarded as 100% and % fraction of the conjugate peak was recorded as the conjugation efficiency of that particular polymerization reaction. The calculation was done for chromatograms detected by both UV-vis absorbance and fluorescence. Values from the three reactions were averaged to give average % conjugation efficiency.

2.2.12 Size Exclusion Chromatography Multi-Angle Light Scattering (SEC-MALS)

The fluid line of the analytical HPLC system was connected downstream in series to a DAWN HELEOS II MALS detector followed by an Optilab T-rEX

refractometer (both from Wyatt Technology). The system was calibrated with toluene and normalized with 2.0 mg/mL Bovine Serum Albumin (BSA). Samples were filtered with 0.1 µm filters before injection. The One-detector method involving only the refractometer was used due to low degree of UV absorbance detected when running

POEGMA polymer. Online determination of dn/dc was performed using built-in method “dn/dc from peak” under the assumption of 100% mass recovery. The assumption was verified by confirming that mass recovered as measured by online UV detection at 280 nm and mass injected as measured by offline UV absorbance at 280 nm using Nanodrop Spectrophotometer were in close agreement. The full recovery of sample through the column was likely due to presence of the stealth POEGMA polymer on the conjugates that minimized binding to the column. A dn/dc value of 0.185 mL/g was used for GFP-C-Br. dn/dc values of conjugates from Rxn 1, Rxn 2, and Rxn 3 were determined to be 0.160 mL/g, 0.155 mL/g, and 0.149 mL/g, respectively. The actual mass injected was determined by lyophilization followed by weighing, and the number was entered into ASTRA (v. 6.0, Wyatt Technology) to compute dn/dc values of the conjugates. All results were analyzed using ASTRA 6.0.

2.2.13 Dynamic Light Scattering (DLS)

DLS was performed on a DynaPro Plate Reader (Wyatt Technology). Samples were prepared at 25 µM and filtered with 0.1 µm filters before analysis. The instrument

was operating at a laser wavelength of 831.95 nm, a scattering angle of 90° and at 25 °C.

Data were analyzed in Dynals mode using Dynamics 6.12.0.3.

2.2.14 Fluorescence Spectroscopy

Fluorescence spectra were recorded on a CARY Eclipse fluorescence spectrophotometer (Varian) in scan mode at 25 °C. The fluorescence of samples at a concentration of 20 µM were measured with an excitation wavelength of 460 nm and the emission intensity was recorded from 485-530 nm.

2.3 Results and Discussion

2.3.1 Sortase-Catalyzed C-Terminal Initiator Attachment on GFP

Figure 4: Synthetic route of GFP-C-POEGMA. A) Recombinant expression of quaternary fusion protein GFP-srt-His6-ELP and purification by inverse transition

cycling (ITC). B) Sortase-catalyzed site-specific attachment of the ATRP initiator AEBMP to the C-terminus of GFP. C) In situ ATRP of OEGMA yielding GFP-C- POEGMA (85).

A quaternary fusion protein, abbreviated as “GFP-srt-His6-ELP”, was recombinantly expressed to serve as the sortase substrate (Figure 4A). Here, “srt” stands for the native sortase A recognition sequence “LPETG” (87) (“E”: glutamine), His6 is a hexahistidine tag incorporated to facilitate downstream purification of the generated macroinitiator (explained in more detailed below), and ELP refers to an environmentally responsive elastin-like polypeptide that was included in the fusion to enable easy purification of the quaternary fusion by inverse transition cycling (ITC), a nonchromatographic protein purification method that our group previously developed

(84). The recognition sequence was deliberately located between the protein and the

His6-tag and ELP, so that transpeptidation by sortase A not only attaches the initiator to

GFP but also conveniently liberates the purification tags. As transpeptidation relies on the presence of the enzyme, cleavage does not begin until sortase A is added in vitro.

Very little, if any, of the protein is thus expected to be lost in vivo before purification, hence maximizing product yield. This hypothesis was confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis of ITC purification of

GFP-srt-His6-ELP. As shown in Figure 5A, the only species that exhibited inverse transition behavior and thus was purified by ITC was GFP-srt-His6-ELP. The lack of a free ELP band clearly demonstrates that no premature in vivo cleavage occurred. The

fusion protein was obtained at high purity with an excellent yield of ~ 300 mg/L from E. coli shaker flask culture. Sortase A carrying an N-terminal His6-tag was also recombinantly expressed in E. coli with high yield (~ 400 mg/L) and was obtained in high purity by His-tag purification, an immobilized metal affinity chromatography (IMAC) technique (Figure 5B). The ATRP initiator AEBMP (Figure 4) was chemically synthesized with an N-terminal Gly3 motif serving as the nucleophile, as maximum reaction rates for sortase-catalyzed ligation have been reported with two or more glycines (82).

A B

C D

coli lysate, lanes 3 and 4: first and second elution washes with imidazole. C) sortase- catalyzed attachment of the ATRP initiator AEBMP at the C-terminus of GFP and purification of GFP-C-Br macroinitiator. Lane 1: MW marker, lane 2: purified GFP-srt- His6-ELP, lane 3: purified His6-sortaseA, and lane 4: sortase reaction mixture after 5 h of reaction at 37 °C. D) Purification of GFP-C-Br by reverse His-tag purification. Lane 1: marker, lane 2: sortase reaction mixture, lanes 3 and 4: GFP-C-Br (has no His6-tag) in the first and second elutions without imidazole, lanes 5 and 6: all other unwanted His6-tagged components in the first and second elutions with imidazole (85).

Sortase-catalyzed initiator attachment was then carried out at a GFP-srt-His6-

ELP: His6-sortase A: AEBMP ratio of 2:1:60 (Figure 4B). Successful reaction results in cleavage of GFP-LPETG-His6-ELP into GFP-LPET and G-His6-ELP followed by attachment of AEBMP to GFP-LPET to generate the macroinitiator product (GFP-C-Br).

SDS-PAGE analysis of the reaction mixture showed near complete disappearance of the

GFP-srt-His6-ELP band close to 67 kDa, and the appearance of two bands around 39 and

28 kDa, corresponding to the cleaved G-His6-ELP and the generated GFP-C-Br, respectively (Figure 5C). A control reaction was done using Gly3 as the nucleophile, to yield GFP-C-Gly3 as a negative control for subsequent ATRP reaction. Quantification of band intensity in SDS-PAGE showed that initiator attachment efficiency was near quantitative (~ 95% averaged across five reactions).

B C

Figure 6: Mass spectrometry (MS) analysis of GFP-C-Br macroinitiator. A) Deconvoluted liquid chromatography/ electrospray ionization-MS (LC/ESI-MS) spectra of GFP-C-Br. Major peak at 28,120.4 Da agrees well with theoretical mass of 28,123.8 Da corresponding to a single AEBMP initiator attached to GFP. B) Isotopic distribution of GFP-C-Br C-terminal peptide [DHMVLLEFVTAAGITHGMDELY NVDGGGSLPET–“AEBMP”]3+ detected by LC/MS-MS after trypsin digestion. C) Theoretical isotopic distribution of the C-terminal peptide generated by Molecular Mass Calculator software (Pacific Northwest National Laboratory) (85).

To purify GFP-C-Br, a His6-tag was intentionally inserted between “srt” and the

ELP, such that upon transpeptidation by sortase A, all species except GFP-C-Br carried a

His6-tag. Consequently, elution through an IMAC column yielded pure macroinitiator in the eluent while leaving all other unwanted species bound to the resin. SDS-PAGE

analysis indicated that all of the GFP-C-Br was recovered by this method (Figure 5XD).

The purified GFP-C-Br was then characterized by liquid chromatography/electrospray- ionization mass spectrometry (LC/ESI-MS) to confirm initiator attachment (Figure 6A).

A major peak was detected at 28,120.4 Da, which closely agrees with the theoretical mass of 28,123.8 Da for GFP-C-Br. To prove site-specificity of initiator attachment, GFP-C-Br was subjected to trypsin digestion and the peptide fragments were analyzed by liquid chromatography/tandem mass spectrometry (LC-MS/MS). Only the C-terminal peptide fragment was detected as a brominated cation and its experimental isotope distribution

(Figure 6B) showed nearly perfect overlap with its theoretical distribution (Figure 6C).

These results provided strong evidence that the brominated ATRP initiator was solely attached to the C-terminus of GFP by sortase A. Aside from the singly brominated C- terminal peptide, no other derivatives were detected.

2.3.2 In situ ATRP of POEGMA from the C-Terminus of GFP

Figure 7: LC/ESI-MS characterization of OEGMA monomer with Mn ~ 500 Da or on average ~ 9 side-chain ethylene glycol repeats (EG9). Peaks were detected as [M+Na]+ (88).

Subsequently, in situ classic ATRP was performed to graft POEGMA from GFP-

C-Br (Figure 4C). An OEGMA monomer with an Mn ~500 Da or on average ~9 side-chain ethylene glycol repeats (EG9) was used, as shown by LC/ESI-MS characterization

(Figure 7). Three sets of polymerization conditions (Table 1) were investigated to synthesize conjugates of increasing MWs, denoted herein as Rxn 1, Rxn 2, and Rxn 3.

Size exclusion chromatography (SEC) was performed after ATRP to characterize the polymerization products. SEC of GFP-C-Br prior to polymerization with UV/vis absorbance detection at 280 nm showed a single peak at an elution time of 20.6 min

(Figure 8A). This peak greatly diminished after polymerization, and was accompanied by the emergence of peaks at 17.9, 15.9, and 13.3 min, corresponding to GFP-C-

POEGMA conjugates in each of the three reactions. The results from UV/vis detection

were consistent with those from fluorescence detection (Figure 8B). The small fraction of unreacted GFP-C-Br in each reaction is likely due to hydrolysis or disproportionation at the C-terminus of the macroinitiator, which are common side-reactions of ATRP in aqueous conditions that lead to loss of the Br functionality and thus inactivation of the macroinitiator (89). Integration of peak areas showed that the conjugates constituted >

90% of the polymerization product on average, indicating that in situ ATRP from GFP-C-

Br proceeds with extremely high efficiency.

SDS-PAGE analysis provided additional evidence for the successful growth of

POEGMA from GFP-C-Br (Figure 8C). After each reaction, the band corresponding to

GFP-C-Br (~ 28 kDa) decreased to a much lower intensity, accompanied by a new higher molecular weight band corresponding to the conjugate. Due to their polydisperse nature and the large and often uncharged polymer component that limits mobility, protein- polymer conjugates typically appear as a “smear” in SDS-PAGE. In contrast, when the

GFP-C-Gly3 control was used in the polymerization, or when GFP-C-Br was physically mixed with pre-synthesized POEGMA, only a single band was observed around 28 kDa, proving that POEGMA was only grown in situ from the C-terminal initiator attached by sortase A.

A B

C D

Figure 8: Characterizations of in situ ATRP reactions of grafting POEGMA from GFP- C-Br. A and B) Size exclusion chromatography (SEC) traces of GFP-Br (Blue), Rxn 1 (green), Rxn 2 (maroon), and Rxn 3 (red) detected by UV-vis absorbance at 280nm and fluorescence at 460 nm excitation and 507 nm emission. C) CuIICl2-stained SDS-PAGE analysis of ATRP reaction mixtures. Lane 1: marker, lane 2: GFP-C-Br macroinitiator before ATRP, lanes 3-5: GFP-C-POEGMA conjugate and residual unreacted macroinitiator from Rxns 1, 2 and 3, lane 6: GFP-C-Gly3 control after ATRP using Rxn 3 condition, and lane 7: GFP-C-Br physically mixed with free POEGMA synthesized using Rxn 3 conditions. Free POEGMA does not appear in gel due to lack of charge. D) Fluorescence spectra of GFP before initiator attachment (red), after initiator attachment (yellow), and after in situ ATRP (navy, Rxn 3 condition, conjugate Mw =263.1 kDa as measured by SEC-MALS); all samples at 20 µM (85).

2.3.3 Characterization of GFP-C-POEGMA Conjugates

The conjugates were further characterized by light scattering (Table 2). First, size exclusion chromatography multi-angle light scattering (SEC-MALS) was performed to determine the weight-average molecular weight (Mw), number-average molecular weight (Mn, derived from chromatogram peak distribution), dispersity (Ð = Mw/Mn) and radius of gyration (Rg) of the conjugates. The Mw of GFP-C-Br measured was 28.0 kDa and Ð was 1.01, consistent with the theoretical value of 28,123.8 Da and the expected monodispersity of the macroinitiator. The Mws of the three conjugates measured by SEC-

MALS were 61.2, 89.9, and 263.1 kDa, respectively, with corresponding PDIs of 1.23,

1.26, and 1.25. These results show that by tuning the ATRP conditions, conjugates can be synthesized from macroinitiators generated by sortase-catalyzed initiator attachment with different molecular weights and fairly low polydispersity. The Rgs of GFP-C-Br and the Rxn 1 conjugate could not be accurately determined by SEC-MALS as they fell below the 10 nm lower limit of detection at a laser wavelength of 638 nm. Rgs of the products of

Rxn 2 and 3 were 10.6 and 19.2 nm, respectively.

Table 2: Light scattering (LS) characterizations of GFP-C-Br macroinitiator and GFP- C-POEGMA conjugates. MWs, Ðs and Rgs were determined by size exclusion chromatography multi-angle light scattering (SEC-MALS). Rhs were measured by dynamic light scattering (DLS). Mw: weight-average MW, Mn: number-average MW, Ð: dispersity (Mw/Mn), Rg: radius of gyration, Rh: hydrodynamic radius. N/A: below instrument lower limit of detection (85).

Mw (kDa) Mn (kDa) Ð (Mw/ Mn) Rg (nm) Rh (nm)

GFP-C-Br 28.0 27.7 1.01 N/A 3.6 Rxn 1 61.2 49.8 1.23 N/A 6.4

Rxn 2 89.9 71.3 1.26 10.6 10.0

Rxn 3 263.1 208.9 1.25 19.2 18.3

Next, the hydrodynamic radius (Rh) of each species was measured by dynamic light scattering (DLS). The Rh of GFP-C-Br was determined to be 3.6 nm. In situ growth of POEGMA from the macroinitiator resulted in an increase of the Rh to 6.4, 10.0, and

18.3 nm, for the three polymerization reactions, respectively. With both Rg and Rh available for Rxn 2 and 3, their corresponding Rg/Rh ratios (ρ = form factor) were calculated, yielding values of 1.06 and 1.05, respectively. To put these values in perspective, ρ for globular proteins is ~ 0.775 (90), while that of a monodisperse random coil polymer in theta solvent is 1.50. An increase in polymer polydispersity and the presence in a good solvent can increase ρ (91). Thus, their ρ values suggest that the overall conformation of the GFP-C-POEGMA conjugates lies somewhere between that of their components. The conjugates could be easily and completely purified by a single

round of preparative SEC. Fluorescence spectroscopy of unmodified GFP, GFP-C-Br, and purified GFP-C-POEGMA (Rxn 3 product, Mw 263.1 kDa as measured by SEC-

MALS) clearly shows that each step in the synthesis of the conjugate has minimal effect on the activity of the protein (Figure 8D).

2.3.4 Conclusion and Significance

Sortase-catalyzed installation of the ATRP initiator on the C-terminus of GFP proceeded to > 95% conversion with no side products. Subsequent in situ ATRP of

POEGMA from the macroinitiator yielded site-specific and stoichiometric

(1:1) GFP-C-POEGMA conjugates with > 90% conjugation efficiency. The conjugates could be easily and completely purified and the overall yield of the conjugate normalized to purified protein was > 85%. Such a high yield shows minimal loss during installation of the ATRP initiator, in situ ATRP and purification of conjugates, and is notable given that order of magnitude losses are considered routine in the synthesis of protein-polymer conjugates (34). This extraordinarily high yield is important for biomolecule-polymer conjugate synthesis, especially when the biomolecule of interest is a high value “biologic” peptide or protein drug. In addition, as a controlled radical polymerization technique, ATRP enabled synthesis of conjugates with a wide and tunable range of MWs and narrow MW distributions. Together, this synthesis approach gives rise to polymer conjugates of therapeutic biomolecules that are far more

homogeneous than PEGylated drugs currently in clinical use. The full control over site and stoichiometry of conjugation, high degree of MW tunability, and low dispersity are highly desirable features for polymer conjugates of therapeutic biomolecules, as they translate to a more predictable therapeutic performance. In conclusion, this sortase- catalyzed polymer conjugation method provides a new and useful tool for the synthesis of peptide/protein-polymer conjugates for pharmaceutical applications.

Comparison of sortase-catalyzed initiator attachment (SCIA) with the previous intein-mediated initiator attachment (IMIA) approach is instructive. SCIA improves upon IMIA in several ways. First, the product yield of IMIA is adversely affected by premature in vivo cleavage of the intein (~ 30%) during expression, which results in loss of the appended purification tag from the protein, leading to appreciable product loss

(62). In contrast, SCIA occurs solely in vitro, hence offering greater control over the reaction and product yield. Second, in the IMIA approach, the protein of interest needs to be fused to a relatively large intein domain that can reduce the expression of the fusion protein in some instances (92), whereas SCIA only requires incorporation of a short pentapeptide recognition sequence that has minimal impact on protein expression.

In addition, the presence of a thiol group at the ligation site in IMIA makes the method prone to generating small amounts of side-products through disulfide bonding, a problem that does not occur in SCIA. One disadvantage of SCIA, however, is that it

leaves the extraneous LPET(G)n motif in the final product, which may have some potential immunogenic consequences, although this remains to be clarified.

As the C-terminus is conserved in all proteins and peptides and is often solvent- accessible, the sortase-catalyzed polymer conjugation approach is thus a generally applicable platform for improving the pharmacological performance of therapeutic proteins and peptides where the C-terminus is not essential for the activity of the biomolecule. For other biologics where the C-terminal end may be critical to its activity, our group has developed a complementary N-terminal approach (20). In the event that both N- and C-termini of the peptide/protein are critical to its activity, methods developed by us and other investigators can be used for site-specific incorporation of an

ATRP initiator at solvent-accessible sites within the primary amino acid sequence of the peptide or protein drug (58, 93). These methods collectively offer a general toolbox that should enable site-specific polymer conjugation at any desired solvent-accessible site on a peptide or protein.

3. Site-Specific Conjugation of POEGMA to the C- Terminus of Exendin-4

3.1 Introduction

3.1.1 Type 2 Diabetes

Diabetes is a class of metabolic diseases characterized by elevated blood glucose levels as a result of defects in insulin production and/or action. It is rapidly growing in prevalence around the world owing to a global increase in dietary intake and decrease in energy expenditure (94). The incidence of Type 2 Diabetes (T2D), which accounts for 90-

95% of all diabetes cases in adults, is estimated to be over 300 million worldwide by 2025

(95). For many years, insulin resistance, a condition in which cells in the body do not properly respond to circulating levels of insulin, was believed to be the initial cause of

T2D, and the inability of pancreatic β-cells to secret sufficient insulin was thought as a later development (96). This notion has changed with more recent findings that, as with most endocrine systems in the human body, glucose homeostasis relies on a feedback loop that mediates crosstalk between pancreatic β-cells and insulin-sensitive tissues (97).

Impaired β-cell function in the presence of insulin resistance leads to initial glucose intolerance and elevated blood glucose. Progressive deterioration of β-cell function causes further elevation in blood glucose, which eventually leads to the development of

T2D and accounts for the evolving pathophysiology of the disease (98, 99). Prolonged tissue exposure to high glucose concentrations causes microvascular and macrovascular complications that can lead to serious consequences such as blindness, amputation and

stroke (100, 101). Therefore, the goal of T2D therapy is to control high blood glucose levels in patients and thereby minimizing long-term T2D-induced damages.

Early T2D management typically involves lifestyle changes and prescription of metformin as a first-line treatment, which is taken orally to help increase insulin sensitivity in the liver and reduce hepatic glucose output. The main advantage of metformin is that it generally does not cause hypoglycemia commonly associated with many other oral agents, though it has not been shown to have long-term therapeutic benefit such as preserving β-cell function (102). In the case of further intensification of the disease, additional oral medications are available to be added as second-line agents, such as sulfonylureas, meglitinides, and dipeptidyl peptidase-4 (DPP-4) inhibitors, among others. Given their different and often complementary mechanisms of action, these drugs can be used in combination to offer a more comprehensive treatment (103).

Sulfonylureas and meglitinides are insulin secretogogues that work by triggering endogenous pancreatic insulin secretion, though independent of glucose concentration, thus have the risk of hypoglycemia. Moreover, these drugs have been associated with weight gain (104) and are not suitable for long-term T2D management as they provide no protective effect on β-cells (105). DPP-4 inhibitors are a newer class of T2D oral medications. DPP-4, an exopeptidase that cleaves dipeptides containing proline or alanine as the second residue, is responsible for inactivating glucagon-like polypeptide 1

(GLP-1), a peptide hormone secreted by gastrointenstinal cells to stimulate insulin

secretion and thereby reduce blood glucose in response to food intake. DPP-4 inhibitors prevent the inactivation of GLP-1 by DPP-4 to control blood glucose without causing hypoglycemia. These drugs are weight neutral, but have been reported to lose effectiveness as the disease progresses (106). While many T2D patients do not need insulin therapy initially, the typical progressive decline in β-cell function in T2D may eventually render insulin therapy necessary. Insulin is administered subcutaneously by injection or by an insulin pump. Various types of formulations ranging from rapid-, intermediate- to long-acting are now available to meet different therapeutic needs.

However, drawbacks of insulin therapy include weight gain and life-threatening hypoglycemia in the event of inaccurate insulin dosing (107). Due to the complexity of the disease and progressive deterioration in β-cell function, long-term T2D management with currently available medications, most of which do not offer benefits on β-cell function, still remains a challenge (101).

3.1.2 Incretins for Type 2 Diabetes Therapy

Incretins, a group of metabolic hormones that reduce blood glucose by stimulating insulin release in response to food intake, have recently attracted much interest as drugs for long-term T2D treatment (108). GLP-1 is an incretin hormone released by gastrointestinal cells. It binds to the GLP-1 receptor (GLP-1R), which activates a G protein-coupled cyclic adenosine monophosphate (cAMP) signaling cascade that ultimately leads to insulin secretion. As part of the mechanism utilizes

adenosine triphosphate (ATP) formed by glucose transport and glycolysis, the insulinotrophic effect of GLP-1 is thus glucose-dependent and vanishes upon achieving euglycemia, thereby preventing life-threatening hypoglycemia (109). Additionally, GLP-

1 has also been shown to suppress glucagon secretion, reduce appetite, slow gastric emptying, reduce hepatic glucose production (105, 110), and have a number of beneficial effects on β-cells, including reduction in apoptosis and enhancement of β-cell proliferation and neogenesis (111, 112). These comprehensive benefits make GLP-1 an excellent drug candidate for long-term T2D management. However, native GLP-1 has two main limitations as a drug: 1) the first two amino acids on the N-terminus of GLP-1 is rapidly cleaved by DPP-4, resulting in the loss of its bioactivity (113); and 2) GLP-1 has a very short in vivo half-life of less than 2 minutes (114).

In order to overcome these limitations, GLP-1 analogs with longer half-lives have been explored. Exendin-4 (exendin) is a 39-amino acid peptide originally isolated from the saliva of the lizard Heloderma Suspectum. It shares 53% sequence homology with

GLP-1 while maintaining a strong binding affinity to GLP-1R and all the desirable therapeutic benefits of GLP-1 (115). Exendin is DPP-4-resistant and thus has higher in vivo activity compared to GLP-1. However, its small size still limits its in vivo half-life to about 2 hours (116). Exenatide, the synthetic version of exendin, was approved in 2005 for twice-daily subcutaneous (s.c.) injection. In 2012, exenatide formulated in poly(lactic- co-glycolic acid) [PLGA] microspheres for sustained delivery was approved for once-

weekly s.c. administration (18). This longer-acting formulation significantly reduces administration frequency, thus enhances patient compliance and therapeutic outcome, but the PLGA microsphere design has several potential drawbacks: 1) the production of polymeric microspheres often involves complex and costly multi-step formulation processes; 2) drug loading can be variable and requires tight control; 3) drug release profile has an undesired initial burst-release phase followed by a long “lag period”, 4) the degradation products of the formulation are small MW acids that may induce inflammation, and 5) a considerably larger needle is required for administration as the formulation is viscous (18). Thus, simpler yet effective methods without the above mentioned drawbacks are in demand to further improve the prolonged delivery of exendin.

3.1.3 ARGET ATRP

Classic ATRP uses a lower oxidation state metal halide activator (eg. CuIBr) directly, which is prone to oxidation, and the reaction thus requires stringent deoxygenation and handling. This hinders scalability and reproducibility as trace amounts of oxygen can irreversibly oxidize the activator and distort reaction kinetics

(117). Additionally, increasing number of biological applications demand the use of lower transition metal content (75). In a continuous effort to develop reaction schemes that are easier to implement and more biologically friendly, Activator Regenerated by

Electron Transfer (ARGET) ATRP was introduced in recent years (118, 119). As an

example, in a reaction where CuIBr serves as the activator, ARGET ATRP builds on the concept that the oxidatively unstable CuIBr can be generated and continuously regenerated in situ from the oxidatively stable CuIIBr2 via sustained feeding of a small amount of a reducing agent (eg. ascorbic acid) throughout the reaction. This completely eliminates the need to use the oxidatively unstable CuIBr, making reaction handling significantly more convenient. The continuous regeneration process ensures that a sufficient amount of activator is always present to sustain propagation, while an appropriate concentration of deactivator is simultaneously maintained for proper reaction control, which coupled with the revelation that the rate of reaction is directly proportional to the absolute ratio of the activator and deactivator concentrations, enables well-controlled polymerizations to be conducted at very low transition metal content

(ppm level with respect to monomer) (64).

3.1.4 Motivation and Overview

Motivated by the delivery challenges of exendin and the continuous clinical need for better type 2 diabetes treatment, sortase-catalyzed polymer conjugation was implemented with exendin, to synthesize site-specific and 1:1 stoichiometric exendin-C-

POEGMA conjugates. ARGET ATRP was used to graft POEGMA from the C-terminus of exendin given its ease of implementation, ppm level metal content and improved reaction control compared to classic ATRP. The synthesized conjugates were characterized in vitro and in vivo in a diabetic mouse model, to reveal the therapeutic

potential of POEGMAlation, or covalent conjugation of POEGMA to a therapeutic biomolecule.

3.2 Materials and Methods

3.2.1 Cloning of Exendin-srt-His6-ELP

All molecular biology reagents were purchased from New England Biolabs unless otherwise specified. The gene encoding exendin in a pMA-T vector was codon optimized and synthesized by Life Technologies. The first methionine residue encoding the translational start codon in proteins recombinantly expressed in E. coli needs to be cleaved post-translationally for proper function and stability of the protein (120).

However, the first amino acid of exendin is a histidine, and our past experience and reports in the literature (120) both suggest that having histidine as the residue immediately following methionine prevents proper methionine cleavage. Thus, a di- alanine leader was incorporated at the N-terminus of the peptide to facilitate methionine cleavage. Once in vivo, the di-alanine leader can be cleaved by DPP-4. The exendin gene was amplified by PCR, using forward and reverse primers containing NdeI overhangs and with the sequence for the sortase A recognition motif “LPETG” (named “srt” for brevity) followed by a His6-tag incorporated in the reverse primer. The amplified

“exendin-srt-His6” fragment was inserted into a modified pET-24a+ vector (121) at an

NdeI restriction site immediately upstream of an ELP with the sequence (VPGVG)60, to yield “exendin-srt-His6-ELP”.

3.2.2 Expression and Purification of Fusion Proteins

Expression and purification of exendin-srt-His6-ELP were carried out following procedures similar to those described in Section 2.2.3 with the following changes: Cells containing the exendin-srt-His6-ELP construct were cultured in TB supplemented with

45 µg/mL of kanamycin at 25 °C. Once OD600 of the culture reached 0.6, temperature was lowered to 16 °C and IPTG was added to a final concentration of 0.1 mM to induce protein expression. Inverse phase transition of the fusion was induced by addition of 0.1

M ammonium sulfate. Two cycles of ITC were typically sufficient to obtain homogeneous protein, as verified by SDS-PAGE. His6-sortase was expressed and purified as described in Section 2.2.4.

3.2.3 Sortase-Catalyzed Initiator Attachment to the C-Terminus of Exendin and Macroinitiator Purification

Sortase-catalyzed attachment of the ATRP initiator AEBMP to the C-terminus of exendin was carried out by incubating a reaction mixture consisted of exendin-srt-His6-

ELP, His6-sortase A, and AEBMP [latter two available from the study described in the previous chapter (85)] at a 2:1:60 ratio in sortase buffer at 20 °C for 18 h. A reaction temperature below the inverse transition temperature (Tt) of exendin-srt-His6-ELP was chosen to prevent the fusion protein from going through inverse phase transition during the reaction. To compensate for a drop in sortase A activity as a result of the decreased reaction temperature, a longer reaction time was used. After reaction, the exendin-C-Br macroinitiator was purified as described in Section 2.2.6.

3.2.4 Mass Spectrometry

MALDI-MS was performed on a Voyager-DE Pro mass spectrometer (Life

Technologies) to confirm the successful attachment of AEBMP to exendin. Samples at

~25 µM in PBS were diluted 1:10 with 10 mg/mL sinapinic acid in 90:10 water/acetonitrile with 0.1 v% trifluoroacetic acid (TFA) as the ionization matrix. The instrument was operated in linear mode with positive ions generated using a N2 laser.

Ubiquitin was used as a molecular weight standard to calibrate the instrument.

LC/MS-MS was performed following procedures described in Section 2.2.10 to confirm the site-specificity of initiator attachment.

LC/ESI-MS was performed to characterize the OEGMA monomers used in study.

Monomers diluted 1:20,000 in methanol were separated on an Agilent 1100 LC system equipped with a Zorbax Eclipse Plus C18 column (Agilent) using a mobile phase consisting of (A) 0.3% formic acid in water and (B) 0.3% formic acid in acetonitrile. A linear gradient of 50% B to 95% B was performed over 10 min at 50°C. Separated samples were ionized by ESI followed by MS analysis on an Agilent MSD ion trap mass spectrometer.

3.2.5 In situ ARGET ATRP

All chemical reagents were purchased from Sigma Aldrich and used as received, unless otherwise specified. EG9 OEGMA monomer (Mn ~500 Da or ~9 side-chain EG repeats on average, Sigma Aldrich, #447943) and EG3 OEGMA monomer (triethylene

glycol methyl ether methacrylate, Mn 232 Da, Sigma Aldrich, #729841) were passed through a column of activated basic alumina to remove the inhibitors.

In a typical reaction, 216 µmol of OEGMA and 21.6 µL of a stock solution of 200 mM CuIIBr2 and 1.6 M tris(2-pyridylmethyl)amine (TPMA) pre-complexed in MilliQ water with 5% dimethylformamide (DMF) were mixed with 1 mL of 500 µM exendin-C-

Br in PBS in a Schlenk flask. A 3.2 mM solution of ascorbic acid in MilliQ water was prepared in a separate flask. The two solutions were degassed by bubbling with argon for 30 min, after which ARGET ATRP was initiated and maintained by continuously injecting the ascorbic acid solution into the reaction medium using a syringe pump at a rate of 1.6 nmol/min. Polymerization was allowed to proceed for a specified time at 20

°C under argon and was quenched by bubbling with air. Reactions of the EG3 OEGMA were done with 443 µmol of the monomer in 20 v/v% methanol in PBS while all other conditions remained the same. At the end of the reaction, the reaction mixture was dialyzed against PBS overnight to remove residual small molecule reagents in preparation for downstream purification and characterization.

3.2.6 Physico-Chemical Characterizations

Analytical SEC and SEC-MALS were performed as described in Sections 2.2.11 and 2.2.12. Conjugation efficiency of in situ ATRP from exendin was calculated by quantifying AUC of peaks in SEC chromatograms detected by UV-vis absorbance at 280 nm. dn/dc values of exendin-C-POEGMA conjugates for SEC-MALS derivations were

determined on an Anton Paar Abbemat 500 refractometer (Anton Paar). Synthesized conjugates were purified by a single round of preparative SEC on an AKTA Purifier as described in Section 2.2.11. DLS was carried out as described in Section 2.2.13.

Concentrations of fusion proteins were measured on a ND-1000 Nanodrop spectrophotometer (Thermo Scientific) by UV-vis absorption spectroscopy.

Concentration of exendin and conjugates for in vitro assays and in vivo studies was assessed using a Bicinchoninic Acid (BCA, Pierce) assay following the manufacturer’s protocol. SDS-PAGE analyses of all exendin derivatives were performed using precast

Tris/Tricine gels (Bio-Rad). Quantification of sortase reaction conversion was done by gel densitometry analysis using a built-in function in Image Lab (v. 4.0.1, Bio-Rad).

3.2.7 In Vitro cAMP ELISA

Activity of native exendin and conjugates was assessed in vitro by quantifying intracellular cyclic adenosine monophosphate (cAMP) release as a result of GLP-1R activation in BHK cells stably transfected with rat GLP-1R (a generous gift of Drucker group, University of Toronto, Toronto, Canada) (122). Cells were allowed to reach 70–

80% confluence in 24-well plates. Prior to the assay, ~20 µg of peptide or equivalent of conjugates were treated with 0.5 µg DPP4 (ProSpect) overnight to remove the di-alanine leader. On the day of the assay, cells were incubated with 3-isobutyl-1-methylxanthineto

(IBMX, EMD Millipore) for 1 h to prevent cAMP degradation (123), followed by incubation with varying concentrations (0.001-1000 nM in log-scale increments) of

exendin (Genscript) or conjugates for 10 min to trigger GLP-1R activation. 0.1M HCl was then added to disrupt the cells and release intracellular cAMP. cAMP concentration was measured by a competitive cAMP enzyme-linked immunosorbant assay (ELISA) according to the manufacturer’s protocol (Enzo Life Sciences). Each sample was assayed in triplicate and data were analyzed in Igor Pro (v. 6.2, Wavemetrics) using a Hill equation fit to determine the EC50 of each construct (124).

3.2.8 Animal Studies

In vivo experiments were performed with 6-week-old male C57BL/6J mice (stock no. 000664) purchased from Jackson Laboratories. Upon arrival, mice were initiated on a

60 kCal% fat diet (#D12492, Research Diets Inc.) to induce a diabetic phenotype.

Previous studies have established high fat-fed C57BL/6J mice as an adequate model for type 2 diabetes, as after one week on a high-fat diet, mice exhibit elevated blood glucose, progressively increasing insulin level, and severely compromised insulin response and glucose tolerance (125, 126). Mice were housed under controlled light on a 12 h light/12 h dark cycle with free access to food and water. All mice were allowed to acclimate to the high-fat diet and the facility for 10 d before initiation of experiments. Mice used for fed glucose measurement study of the EG3 conjugate were maintained on the high-fat diet for 3 weeks and used at the age of 8 weeks. All animal care and experimental procedures were approved by the Duke Institutional Animal Care and Use Committee.

3.2.9 In Vivo Fed Glucose Measurements

The effect of native exendin and the conjugates on fed blood glucose levels was measured following a single s.c. injection of each sample. Before blood glucose measurement, the tail was wiped with a sterilizing alcohol solution and wiped dry. A tiny incision was made on the mouse tail vein using a disposable lancet, and the first 1

µL drop of blood was wiped off. The second 1-2 µL blood drop was used for glucose measurement using a hand-held glucometer (AlphaTrack, Abbott). Blood glucose levels were measured 1 d before the experiment. On the day of injection, weights and blood glucose were measured, and a sample solution or PBS control of equivalent volume was injected s.c. Immediately following injection, mice were placed back in the cage with free access to food and water, and blood glucose was measured at 1, 4, 6 (exendin only), 8,

24, 48, 72, 96, 120 and 144 h post-injection. Weights were monitored daily. In the EG9 dose-dependent study, a 66.2 kDa EG9 exendin-C-POEGMA conjugate was injected into mice (n=3) at 25, 50, and 85 nmol/kg mouse body weight. In the EG9 MW-dependent study, EG9 conjugates of 25.4, 54.6, 97.2 and 155.0 kDa Mns were injected into mice (n=6) at 25 nmol/kg. Blood glucose levels were normalized by the average glucose levels measured 24 h and immediately before injection to reflect the percent change in blood glucose and to correct for transient variations in glucose.

3.2.10 In Vivo IPGTT

Mice were randomly divided into groups (n=5 in Figures 14A and B, n=3 in

Figures 14C and D). On day one, every two groups of mice received a s.c. injection of either 54.6 kDa EG9 exendin-C-POEGMA conjugate, exendin as positive control, or PBS at equivalent volume as negative control. Exendin and the conjugate were injected at 25 nmol/kg. 18 h after injection, one group of mice in each category were fasted by removal of food for 6 h. At the end of the fast period (24 h following injection), mice were given

1.5 g /kg glucose (10 w/v % sterile glucose solution, Sigma) via i.p. injection. Blood glucose levels were monitored by nicking the tail vein and measuring the glucose level in the blood using a glucometer at 0, 20, 40, 60, 90, and 120 min after glucose administration. 66 h after injection, the remaining groups of mice were subjected to the same protocol and an IPGTT was similarly performed 72 h following injection.

3.2.11 Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). Blood glucose levels in fed glucose measurement studies (n=6) were normalized by the average glucose levels measured 24 h and immediately before injection. Treatment effects on fed glucose levels were analyzed using repeated measures two-way ANOVA, followed by post hoc

Dunnett’s multiple comparison test to evaluate individual differences between a treatment and PBS control at each time point. AUCs of fed glucose profiles were compared using one-way ANOVA followed by post hoc Tukey’s multiple comparison

test (n=6). For evaluating AUC of IPGTT (n=5), treatment and PBS were compared using an unpaired parametric two-tailed t test. A test was considered significant if the P value was less than 0.05. Statistical analyses were performed using Prism 6 (GraphPad software Inc.).

3.3 Results and Discussion

3.3.1 Sortase-Catalyzed C-Terminal Initiator Attachment to Exendin

The previously developed sortase-catalyzed polymer conjugation method (85) was next implemented with exendin. The synthetic route in Figure 4 was followed with exendin as peptide of interest. A quaternary fusion protein, abbreviated as “exendin-srt-

His6-ELP”, was recombinantly expressed to serve as the sortase A substrate. Expression in E. coli shaker flask culture followed by ITC purification yielded the fusion protein in high purity (Figure 9A) at ~60 mg/L of culture.

Sortase-catalyzed initiator attachment was carried out at an exendin-srt-His6-

ELP: His6-sortase A: AEBMP ratio of 2:1:60 at 20 °C for 18 h. A lower reaction temperature was used to prevent the exendin-srt-His6-ELP fusion from going through inverse transition. To compensate for the drop in enzyme activity as a result the reduced temperature, the reaction was carried out for a longer period of time. Successful reaction results in cleavage of exendin-LPETG-His6-ELP into exendin-LPET and G-His6-ELP followed by attachment of AEBMP to exendin-LPET to generate the macroinitiator product (exendin-C-Br). SDS-PAGE analysis of the reaction mixture (Figure 9B) showed

> 90% conversion to exendin-C-Br, as assessed by gel densitometry. As the desired exendin-C-Br was the only species in the reaction mixture not carrying a His6-tag, a quick elution through an IMAC column yielded pure exendin-C-Br (Figure 9B) in the eluent while leaving all other unwanted His6-tagged species bound to the resin.

A B

B C

The purified exendin-C-Br was characterized by matrix assisted laser desorption ionization-mass spectrometry (MALDI-MS) to confirm initiator attachment (Figure 10A).

A major peak was detected at 5,132.55 Da, which closely agrees with the theoretical mass of 5,131.44 Da corresponding to a single AEBMP attached to exendin. To verify site- specificity of initiator attachment, exendin-C-Br was subjected to trypsin digestion and

the peptide fragments were analyzed by LC-MS/MS. Only the C-terminal peptide fragment was detected as a singly brominated cation and its experimental isotope distribution (Figure 10B) showed nearly perfect overlap with its theoretical distribution

(Figure 10C), proving that a single initiator was attached exclusively to the C-terminus of exendin.

3.3.2 Synthesis and Characterization of Exendin-C-POEGMA Conjugates

Next, in situ ARGET ATRP (118) was carried out in PBS to graft POEGMA from exendin-C-Br. The EG9 OEGMA monomer with Mn ~500 Da or on average ~9 side-chain

EG repeats was used. The reaction time was varied to produce EG9 exendin-C-

POEGMA conjugates with a range of MWs. SEC of exendin-C-Br prior to polymerization with UV-vis absorbance detection at 280 nm (Figure 11A) showed a single peak at an elution time of 23.7 min, corresponding to the peptide macroinitiator. The intensity of this peak greatly diminished after polymerization, and was accompanied by the emergence of peaks at 21.3, 19.5, 17.8, 16.5 and 15.0 min, corresponding to EG9 exendin-

C-POEGMA conjugates with increasing MWs as the reaction time was increased. The results from UV-vis detection were consistent with those from refractive index (RI) detection (Figure 11B). Integration of peak areas showed that, on average, the conjugates constituted ~80% of the polymerization product. Taken together, sortase-catalyzed polymer conjugation was used to synthesize site-specific (C-terminal) and stoichiometric

(1:1) exendin-C-POEGMA conjugates with an average overall yield of > 70%, which

compares favorably to 10-20 % overall yield often seen in conventional PEGylation

processes (34).

3 h 1.25 h 0.5 h 3 h 1.25 h 0.5 h A 2 h 1 h exendin-C-Br B 2 h 1 h

100 100 A

75 75

50 50

Normalized intensity (%) 25 25 Normalized intensity (%)

0 0 12 14 16 18 20 22 24 26 10 12 14 16 18 20 22 24 Time (min) Time (min)

C D

Figure 11: Characterizations of EG9 exendin-C-POEGMA conjugates. A and B) SEC traces of ATRP reaction mixtures of grafting EG9 POEGMA from exendin-C-Br carried out for 0.5 h, 1 h, 1.25 h, 2 h and 3 h, detected by UV-vis absorbance at 280 nm and refractive index (RI). The signal from the residual exendin-C-Br was too low to be detected due to its small size and low concentration. C) Coomassie-stained SDS- PAGE analysis of EG9 exendin-C-POEGMA conjugates purified by a single round of preparative SEC. Lane 1: marker, lanes 2-6: purified 25.4 kDa, 54.6 kDa, 66.2 kDa, 97.2 kDa and 155.0 kDa EG9 conjugates. D) Cyclic adenosine monophosphate (cAMP) responses of native exendin and EG9 exendin-C-POEGMA conjugates in baby hamster kidney (BHK) cells expressing the GLP-1 receptor. Half-maximal effective concentration (EC50) values are summarized in Table 3 (88).

SEC-MALS was used to determine the Mw, Mn and Ð of the EG9 exendin-C-

POEGMA conjugates. As shown in Table 3, ARGET ATRP enabled synthesis of conjugates with a wide and tunable range of MWs (Mn = 25.4 - 155.0 kDa) and dispersities (Ð ≤ 1.15) even narrower than what was achieved by classic ATRP. This high degree of MW tunability and low dispersity are both highly desirable features for polymer conjugates of therapeutic biologics, as they translate to a more predictable therapeutic performance. The conjugates could be easily and completely purified by a single round of preparative SEC (Figure 11C).

Species/ Reaction Mw (Da) Mn (Da) Ð (Mw/ Mn) Rh (nm) EC50 (nM) Time (h) exendin -- 4,186.6a 1.00b 2.2 ± 0.1 0.08 ± 0.01

0.5 26,400 25,400 1.04 4.5 ± 0.4 0.84 ± 0.09

1 56,800 54,600 1.04 5.6 ± 0.5 1.91 ± 0.35

1.25 72,200 66,200 1.09 5.9 ± 0.5 2.10 ± 0.08

2 100,000 97,200 1.03 6.8 ± 0.7 6.67 ± 0.21

3 178,000 155,000 1.15 7.6 ± 0.5 7.69 ± 0.04

3.3.3 In Vitro Activity of EG9 Exendin-C-POEGMA

Exendin acts by binding and activating the G protein-coupled GLP-1 receptor

(GLP-1R), which results in the release of cyclic adenosine monophosphate (cAMP) as a

second messenger in a downstream signaling cascade, ultimately leading to secretion of

insulin to regulate blood glucose (127). The potency of native exendin and the EG9

exendin-C-POEGMA conjugates were next assessed by quantifying intracellular cAMP

release as a result of GLP-1R activation in baby hamster kidney (BHK) cells that were

stably transfected with rat GLP-1R (a generous gift of Drucker group, University of

Toronto, Toronto, Canada). As shown in Figure 11D, native exendin activates GLP-1R

with a half-maximal effective concentration (EC50) of 0.08 ± 0.01 nM (Table 3). Grafting

EG9 POEGMA from exendin increases the EC50 of the peptide in an overall MW-

dependent manner, ranging from 0.84 ± 0.09 nM for the 25.4 kDa conjugate to 7.69 ± 0.04

for the 155.0 kDa conjugate, which indicates decreased receptor binding with increasing

polymer MW as a result of steric hindrance.

3.3.4 In Vivo Therapeutic Efficacy of EG9 Exendin-C-POEGMA

A B PBS 50nmol/kg PBS 50nmol/kg 200 25nmol/kg 85nmol/kg 10 25nmol/kg 85nmol/kg 175 150 125 0 100 75 -10 50 change) (% Weight 25 Plasma Glucose baseline) (% Plasma 0 -20 -24 0 24 48 72 96 120 -24 0 24 48 72 96 120 Time (h) Time (h)

injection of a 66.2 kDa EG9 exendin-C-POEGMA conjugate at 25, 50, 80 nmol/kg or PBS control of equivalent volume administered at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h prior to and immediately before injection. B) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point (88).

Dosage (nmol/kg) Time (h) 25 50 85 1

4 **** **** ****

8 ** ** ***

24 **** **** ****

48 *** *** ***

72 ** **** 96 *

The in vivo efficacy of EG9 exendin-C-POEGMA conjugates was assessed in 6- wk-old male C57BL/6J mice that were maintained on a 60 kCal% fat diet, so as to develop a diabetic phenotype (125, 126). A dose-dependent study was first performed to determine an adequate dose. A 66.2 kDa EG9 exendin-C-POEGMA conjugate was administered into mice (n=3) via a single s.c. injection at 25, 50 and 85 nmol/kg mouse body weight of the conjugate, and an equivalent volume of PBS was injected as a

negative control. Fed glucose levels measured at various time points post-injection revealed an overall slight increase in the duration of glucose reduction with increasing dose of the conjugate (Figure 12A, Table 4, full glucose profiles in Appendix Figure 22).

A similar trend was observed in the mouse body weights (Figure 12B). A drop in body weight at the beginning of the study is expected for all mice including the PBS control group, as the mice are subjected to stress factors including injection and repetitive tail vein glucose measurements. This stress-induced response is also evident in the sharp spike in their glucose levels at the initial time points. Aside from the expected weight loss due to procedural stress, the weight-lowering benefit of exendin has been well established (128), however, overdosing can cause nausea, which is manifested as acute weight loss in rodents (129). The excessive weight loss seen in mice that received the highest dose suggests the possibility of nausea, and all subsequent studies were hence carried out with a dose of 25 nmol/kg.

To investigate the effect of MW on the glucose regulatory effect of EG9 exendin-

C-POEGMA conjugates, native exendin and conjugates of four different MWs (Mn= 25.4,

54.6, 97.2 and 155.0 kDa) were administered into mice (n=6) via a single s.c. injection at

25 nmol/kg mouse body weight, and fed glucose levels were monitored at various time points post-injection. While unmodified exendin was only able to lower blood glucose for 6 h relative to PBS control (Figure 13A, full glucose profiles in Appendix Figure 23), modification with EG9 POEGMA significantly extended the glucose-lowering effect of

PBS PBS 150 A B 25.4 kDa EG9 150 exendin 125 125 100 100 75 * 75 * * * * 50 *** * 50 * ** * * * ** * 25 * * 25 * * * 0 Plasma glucose baseline) (% Plasma 0 0 2 4 6 8 glucose baseline) (% Plasma -24 0 24 48 72 96 120 144 Time (h) Time (h) C 150 PBS D 150 PBS 54.6 kDa EG9 97.2 kDa EG9 125 125 100 100 * 75 75 * * * * * * * * * * 50 * * 50 * * * * * * * * * * * * * * 25 * * * 25 * * * * 0 0 Plasma glucose baseline) (% Plasma -24 0 24 48 72 96 120 144 glucose baseline) (% Plasma -24 0 24 48 72 96 120 144 Time (h) Time (h) PBS 25.4 kDa EG9 PBS 175 150 54.6 kDa EG9 97.2 kDa EG9 E 155.0 kDa EG9 F 150 155.0 kDa EG9 125 125 100 * 75 * 100 * * 50 * * * * 75 * * * * 25 * * 50

0 glucose baseline) (% Plasma Plasma Glucose baseline) (% Plasma 25 -24 0 24 48 72 96 120 144 -24 0 24 48 72 96 120 144 Time (h) Time (h) PBS exendin G 10 25.4 kDa EG9 97.2 kDa EG9 H 54.6 kDa EG9 155.0 kDa EG9 5

-5

Weight (% change) (% Weight -10

-15 -24 0 24 48 72 96 120 144 Time (h) Figure 13: Assessment of MW-dependent in vivo efficacy of EG9 exendin-C- POEGMA conjugates. Blood glucose levels in fed mice were measured before and after a single s.c. injection of A) unmodified exendin, or B-E) 25.4 kDa, 54.6 kDa, 97.2

kDa, and 155.0 kDa EG9 exendin-C-POEGMA conjugates, compared to PBS control. The peptide and conjugates were injected at 25 nmol/kg and PBS was injected at equivalent volume at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h and immediately before injection. Data were analyzed by repeated measures two-way analysis of variance (ANOVA), followed by post hoc Dunnett’s multiple comparison test. F) Glucose profiles in B-E overlaid for comparison. G) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point. Weights for the exendin group were not measured at t=144 h. H) Area under the curve (AUC) of blood glucose profiles (0 h to 144 h, with respect to 0% baseline) as a function of conjugate Mn. AUCs were compared using one-way ANOVA followed by post hoc Tukey’s multiple comparison test. For all studies, n=6, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001 (88).

Table 5: Summary of statistical significance levels of MW-dependent fed blood glucose measurements of EG9 conjugates compared to PBS control shown in Figure 13. Data were analyzed by repeated measures two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test to evaluate individual differences between a treatment and PBS control at each time point (n=6, *P < 0.05, **P < 0.01, ***P < 0.001 and ****P <0.0001). ---Groups treated with conjugates were not measured at t=6 h (88).

EG9 exendin-POEGMA Time (h) exendin 25.4 kDa 54.6 kDa 97.2 kDa 155.0 kDa 1 *** **** 4 **** **** *** *

6 **** ------

8 **** **** ** *

24 **** **** **** ****

48 * **** **** ****

72 ** **** **** ****

96 *** *** ****

120 **

exendin for up to 120 h, with a MW-dependence on the onset, magnitude and duration of the effect (Figure 13B-E, overlaid un-normalized glucose profiles in Appendix Figure

24). As is evident from the overlaid glucose profiles in Figure 13F, an increase in MW delays the onset but prolongs the duration of glucose reduction, and the two higher MW conjugates showed an overall smaller magnitude of glucose reduction. This trend is mirrored by the weight profiles of treated animals as well (Figure 13G). These are speculated to be due in part to the reduced receptor binding activity and also perhaps due to retarded diffusion from the subcutaneous space into systemic circulation affected by an increase in conjugate size. The two higher MW conjugates also showed much more flat and steady glucose profiles. The glucose profile of the 155.0 kDa conjugate in particular resembled that of a sustained release depot, with no “peak and valley” effect that can cause undesirable side effects.

The in vitro cAMP results and the in vivo MW-dependent fed glucose measurements collectively show that an increase in MW of the conjugated polymer decreases the potency but increases the circulation duration of the EG9 exendin-

POEGMA conjugate. Therefore, it was hypothesized that there exists an optimal MW of the conjugate that best balances these two opposing effects. The area under the curve

(AUC) of the fed glucose profiles with respect to 0% baseline signifies total glucose exposure, which accounts for both the magnitude and duration of glucose reduction, and is therefore a manifestation of the combined effect of the two opposing factors.

Plotting the AUC of fed glucose levels as a function of conjugate Mn indeed yielded a roughly inverted bell-shaped distribution with a minimum at 54.6 kDa (Figure 13H).

This suggests that the renal clearance threshold for these EG9 conjugates is between 25.4 and 54.6 kDa, as although the 25.4 kDa conjugate is more potent than the 54.6 kDa conjugate in vitro, its overall glucose lowering effect is smaller than that of the 54.6 kDa conjugate and its effect also diminished more quickly, which points to a much faster renal clearance. Additionally, the result shows that the 54.6 kDa conjugate is the optimal among the tested EG9 conjugates in terms of balancing receptor activation potency and sustained duration of action. We thus investigated the 54.6 kDa EG9 conjugate further in subsequent experiments.

A 800 24 h PBS 54.6 kDa EG9 B 800 72 h PBS 54.6 kDa EG9 700 700 600 A 600 500 AUC =67,878±5,144 500 AUC =63,307±5,110 400 400

300 300

200 200 Blood glucose (mg/dL) Blood glucose (mg/dL) AUC =32,890±3,362 ** 100 AUC =21,785±1,073 **** 100

0 20 40 60 80 100 120 0 20 40 60 80 100 120 C Time (min) Time (min) 800 24h PBS exendin D 800 72 h PBS exendin 700 AUC =61,993 4,559 700 ± AUC =57,105±5,084 600 600

500 AUC =59,317±2,802 500 AUC =54,905±8,951 400 400

300 300

200 200 Blood glucose (mg/dL) Blood glucose (mg/dL) 100 100

0 20 40 60 80 100 120 0 20 40 60 80 100 120 Time (min) Time (min)

Figure 14: Intraperitoneal glucose tolerance test (IPGTT) of an EG9 exendin- POEGMA in mice. Blood glucose levels measured in mice in an IPGTT performed at

24 h and 72 h after a single s.c. injection of A and B) the 54.6 kDa EG9 exendin- POEGMA conjugate or C and D) unmodified exendin at 25 nmol/kg, compared to PBS of equivalent volume. AUCs of treatment and PBS were compared using an unpaired parametric two-tailed t test (n=5 for A and C, n=3 for B and D, **P < 0.01, and ****P <0.0001). Exendin was not significant at either time point (88).

To validate the results from the fed glucose measurements and to obtain further evidence of the efficacy of EG9 exendin-C-POEGMA conjugates, an intraperitoneal glucose tolerance test (IPGTT) was performed 24 h and 72 h after a single s.c. injection of the 54.6 kDa EG9 conjugate at 25 nmol/kg. Mice were fasted for 6 h prior to glucose challenge by an intraperotoneal (i.p.) injection of 1.5 g/kg of glucose, after which blood glucose levels were monitored at various time points. IPGTT confirmed the prolonged presence of the conjugate in circulation and its significant effect on glycemic control: at

24 h post-injection, the AUC of blood glucose level over 2 h after glucose challenge is reduced by 68% (P < 0.0001, Figure 14A), and at 72 h post-injection, the AUC is reduced by 48% for conjugate-treated mice compared with PBS controls (P < 0.01, Figure 14B). In contrast, unmodified exendin was insignificant at both time points (Figure 14C and D).

3.3.5 Conclusion and Significance

The previously developed sortase-catalyzed polymer conjugation strategy (85) was implemented with exendin to synthesize site-specific (C-terminal) and stoichiometric (1:1) exendin-C-POEGMA conjugates with precisely controlled molecular weights, low dispersity and an average overall yield of > 70%, which compares favorably to 10-20 % overall yield often seen in conventional PEGylation processes (34).

Two critical —and opposing— features of protein-polymer conjugates that are clearly illustrated by this study are the inverse relationship between conjugate MW and potency versus circulation duration. Up to a threshold, the MW of the conjugate is directly proportional to the circulation duration but inversely proportional to the receptor- binding activity of the biomolecule of interest. Among the tested MWs of EG9 conjugates, 54.6 kDa was identified as the optimal MW that best balances circulation extension and potency reduction. Exendin-C-POEGMA conjugates are remarkably effective in vivo, as they show up to 120 h of glucose control from a single low dose subcutaneous injection in a diabetic mouse model, which is 20 times longer than injection of the unmodified peptide. This prolonged duration of therapeutic effect significantly reduces the required administration frequency, a benefit critical to a disease whose treatment outcomes rely heavily on patient compliance.

4. Eliminating PEG Antigenicity of POEGMA Conjugates

4.1 Introduction

4.1.1 Immunogenicity and Antigenicity of PEG

Reports on the induction of anti-PEG antibodies in animals appeared as early as less than a decade after the introduction of protein PEGylation (130). Since then, numerous studies have been conducted in a variety of animal species to investigate the consequences and mechanisms of PEG immunogenicity in animal models (131).

However, the clinical impact of PEG immunogenicity remained unclear until more recent reports of anti-PEG antibody induction in patients treated with PEGylated agents.

In clinical trials of PEG-uricase for treating chronic refractory gout (39-41) and PEG- asparaginase for treating acute lymphoblastic leukemia (42), anti-PEG antibodies have markedly accelerated blood clearance and abrogated clinical efficacy of the drugs, and increased the risk and severity of infusion reactions. Circulating anti-PEG antibodies have also been found in individuals naïve to PEGylated materials, possibly induced by chronic exposure to PEG present in common consumer and food products (132, 133).

Incidence rates of pre-existing anti-PEG antibodies in treatment-naïve patients reported by several studies suggest a substantial increase in the prevalence of pre-existing anti-

PEG antibodies in the general population over the past three decades (131), although differences in detection methods used among the studies and likely improvement in the sensitivity of detection over the years should be kept in mind. High levels of pre-existing

anti-PEG antibodies in patients have recently resulted in two serious and one life- threatening first-exposure allergic reactions to a PEGylated RNA aptamer anticoagulant, which led to early termination of a clinical trial (43). It is thus of high clinical relevance to prescreen polymer conjugates of therapeutic peptides and proteins for antigenicity toward anti-PEG antibodies. Note that the terms “antigenicity” and “immunogenicity” here are not interchangeable. “Antigenicity” is defined herein as the reactivity of an antigen toward pre-existing antibodies in patients, whereas “immunogenicity” refers to the intrinsic ability of an antigen to generate antibodies in the body.

4.1.2 Motivation and Overview

Motivated by the increasing levels of pre-existing anti-PEG antibodies in the general population that can compromise the safety of PEGylated drugs, the reactivity of exendin-C-POEGMA conjugates toward pre-existing anti-PEG antibodies in patient plasmas was tested. We further demonstrated modulation and complete elimination of the anti-PEG antigenicity of exendin-C-POEGMA by reducing its side-chain length.

4.2 Materials and Methods

4.2.1 Anti-PEG ELISA

In the direct ELISA, each column of 8 wells of a 96-well microtiter plate (CoStar) were coated with Krystexxa® (PEG-uricase, Crealta Pharmaceuticals), ADA (Sigma-Tau

Pharmaceuticals), Adagen® (PEG-ADA, Sigma-Tau Pharmaceuticals), exendin

(Genscript), a 54.6 kDa EG9 exendin-C-POEGMA conjugate, a 55.6 kDa EG3 exendin-C-

POEGMA conjugate or BSA (Sigma Aldrich). The antigen solutions for plate coating were prepared in PBS to yield ~2 µg of unmodified peptide/protein or ~5 µg of

PEG/OEG in the case of polymer-modified antigens per well upon adding 50 µL to each well. The PEG/OEG contents of the polymer-modified antigens were calculated as follows: Krystexxa® consists of the tetrameric uricase enzyme (125 kDa total) with 10-11 lysine side-chain amino groups on each of its four subunits reacted with 10 kDa PEG p- nitrophenyl carbonate ester (28), giving a PEG content of ~76%. Adagen® consists of

ADA (40.8 kDa) with 11-17 of its side-chain amino groups on solvent-accessible lysines functionalized with 5 kDa monomethoxy succinyl PEG according to the manufacturer’s specifications (Sigma-Tau Pharmaceuticals). For our calculation, we assumed 14 PEG chains per Adagen® conjugate on average, giving ~60% PEG content. In the case of the exendin-C-POEGMA conjugates, subtracting the poly(methyl methacrylate) backbone

(~17% for EG9 POEGMA and ~37% for EG3 POEGMA) gives an OEG content of ~75% for the 54.6 kDa EG9 conjugate and ~58% for the 55.6 kDa EG3 conjugate. After overnight incubation of the coated plate at 4 °C, it was washed with PBS and all wells were blocked with 1% BSA in PBS. One patient plasma sample previously tested negative for PEG antibody and two that were tested positive were diluted 1:400 v/v in

1% BSA in PBS. The two positive patient plasma samples were from two different individuals that developed anti-PEG antibodies during a Phase II clinical trial of

Krystexxa®. Following another round of PBS washing, 100 µL of each diluted plasma

sample and 1% BSA in PBS were added to replicate wells of each antigen. The plate was then incubated at room temperature for 2 h. Wells were again washed with PBS and 100

µL of alkaline phosphatase-conjugated goat anti-human IgG (Sigma) diluted 1:5250 with

1% BSA in PBS was added to each well. After 1 h incubation at room temperature, wells were washed with PBS followed by Tris-buffered saline. Bound alkaline phosphatase was detected by incubating with p-nitrophenyl phosphate (Sigma) in accordance with the directions of the supplier. The phosphatase reaction was stopped by adding 50

µL/well of 10% NaOH, and the absorbance at 405 nm was measured on a plate reader

(Tecan Infinite M200 Pro, Tecan Austria).

In the competitive ELISA, a microtiter plate was coated with 50 µL of 100 µg/mL

Krystexxa® per well by overnight incubation at 4 °C. Various amounts of ADA,

Adagen®, exendin, a 54.6 kDa EG9 exendin-C-POEGMA conjugate, and a 55.6 kDa EG3 exendin-C-POEGMA conjugate were diluted with PBS to yield 0, 0.5, 2, 5, 10 and 20 µg of competing antigen per well upon adding 50 µL to each well. Dilutions of Adagen® and the exendin-C-POEGMA conjugates were prepared such that at each competing antigen concentration, similar PEG/OEG contents were compared as shown in Table 6.

The diluted competing antigens were mixed with equal volume of a patient plasma sample that tested positive for PEG antibody (diluted 1:200 v/v in 1% BSA in PBS) and incubated at 4 °C overnight. The following morning, after washing with PBS, all wells were blocked with 1% BSA in PBS. Wells were washed with PBS after blocking, and 100

µL of each concentration of the competing antigen-plasma mixtures was added in replicate wells. After incubation at room temperature for 2 h, alkaline phosphatase- conjugated IgG was added for colorimetric readout at 405 nm as described above.

Assays in Figures 15A and B were performed with n=3, while those in Figures 18A and

B were performed with n=5.

54.6 kDa EG9 55.6 kDa EG3 Adagen® exendin-C-POEGMA exendin-C-POEGMA Nominal Conjugate PEG Conjugate OEG Conjugate OEG (µg/well) (µg/well) (µg/well) (µg/well) (µg/well) (µg/well) (µg/well) 0.5 0.6 0.4 0.5 0.4 0.7 0.4 2 2.6 1.6 2.0 1.5 2.8 1.6 5 6.4 3.8 5.0 3.8 6.9 4.0 10 12.8 7.7 10.0 7.5 13.8 8.0

20 25.6 15.4 20.0 15.0 27.6 16.0

4.2.2 Circular Dichroism Spectroscopy

CD spectroscopy was performed on an Aviv Model 202 instrument with 1 mm quartz cells (Hellma) by scanning from 190 nm to 260 nm at 25°C with 1 nm steps and a

1 s averaging time. Samples were prepared in MilliQ water at 10 µM. The raw data was transformed into molar ellipticity per amino acid residue.

4.2.3 Synthesis of Exendin-C-PEG Conjugates

Exendin-C-PEG conjugates were synthesized using a modular polymer conjugation approach that our group recently developed (134). First, a chemically synthesized Gly3-N3 (available from the previous study (134)) moiety was installed exclusively at the C-terminus of exendin by sortase-catalyzed ligation to yield exendin-

C-N3. The reaction and purification of exendin-C-N3 were carried out following procedures described in Section 2.2.6. The installed N3 group was then utilized to enable near-quantitative conjugation of commercially available linear PEG end-functionalized with a dibenzocyclooctyl (DBCO) group via catalyst-free click chemistry. DBCO-PEG with nominal PEG MWs of 10, 20 and 30 kDa (Click Chemistry Tools) were chosen for conjugation to exendin-C-N3, which was carried out by incubating exendin-C-N3 with

DBCO-PEG at an N3/DBCO molar ratio of 1:5 in PBS at room temperature for 2 h without any catalyst or organic solvent. To remove any unreacted exendin-C-N3, the reaction mixture was incubated with DBCO-activated agarose beads (Click Chemistry

Tools) at an N3/DBCO molar ratio of 1:100 at room temperature for 2h. The excess

DBCO-polymer was removed by incubating with azide-activated agarose beads (Click

Chemistry Tools) at a molar DBCO/N3 ratio of 1:300 at room temperature for 4h. At each incubation step, the reaction mixture was continuously rotated to mix. The agarose beads were removed after each purification step by centrifugation at 21,000 ×g for 10 min.

4.2.4 In Vivo Fed Glucose Measurements

Fed blood glucose measurement studies of EG3 exendin-C-POEGMA conjugtes and their MW- and Rh-matching exendin-C-PEG conjugates were carried out following procedures described in Section 3.2.9. All conjugates were s.c. injected into mice at 25 nmol/kg. N=3 in Figure 19 and n=5 in Figure 20.

4.2.5 In Vivo Pharmacokinetics

Exendin, 54.6 kDa EG9, 55.6 kDa EG3 and 71.6 kDa EG3 exendin-C-POEGMA conjugates were fluorescently labeled with Alexa Fluor® 488 NHS ester (Thermo Fisher

Scientific) via their solvent accessible primary amines on lysine residues and the N- terminus, according to manufacturer’s protocol. Unreacted free fluorophore was removed using a ZebaSpin desalting column (Thermo Fisher Scientific). Mice were randomly divided into four groups (n=3). Animals were weighed before injection. Each group of mice received a single s.c. injection of one of the labeled samples at 75 nmol/kg

(45 nmol/kg fluorophore). 10 µL of blood samples were collected from the tail vein into

100 µL of a heparin solution (1kU/ml in PBS, Sigma Aldrich) at 40 s, 40 min, 2.5 h, 4.5 h,

8 h, 24 h, 48 h, 72 h, 96 h and 120 h after injection. Blood samples were centrifuged at 4

°C and 20,000 ×g for 10 min to extract the plasma for fluorescence reading at excitation

485 nm and emission 535 nm on a Victor multilabel plate reader (Perkin Elmer). Plasma concentrations of constructs as a function of time were fitted using a non-compartmental

analysis (PK Solutions 2.0, Summit Research Services) that characterizes the absorption and elimination phases of the profiles to derive the pharmacokinetic parameters.

4.2.6 Statistical analysis

Data are presented as mean ± SEM. Both direct and competitive anti-PEG ELISAs

(n=3) were analyzed using two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test to evaluate individual differences between exendin-C-POEGMA and the other groups for each plasma sample (direct) or antigen concentration (competitive).

Fed blood glucose measurements were analyzed as described in Section 2.2.11. A test was considered significant if the P value was less than 0.05. Statistical analyses were performed using Prism 6 (GraphPad software Inc.).

4.3 Results and Discussion

4.3.1 Antigenicity of EG9 Exendin-C-POEGMA Conjugates

The reactivity of the 54.6 kDa EG9 exendin-C-POEGMA conjugate to anti-PEG antibodies in plasma samples of patients previously treated with PEGylated proteins was tested using enzyme-linked immunosorbant assay (ELISA). In a direct ELISA, native exendin and the 54.6 kDa EG9 exendin-C-POEGMA conjugate were separately coated on a plate, along with adenosine deaminase (ADA) and bovine serum albumin

(BSA) as negative controls, and Krystexxa® (PEG-uricase) and Adagen® (PEG-ADA) as positive controls. Dilutions of antigens for plate coating were prepared to ensure similar amounts of unmodified peptide/protein or PEG/OEG contents in the case of polymer-

modified antigens. Coated wells were probed with diluent (1% BSA in PBS), an anti-PEG negative patient plasma sample, or one of two anti-PEG positive patient plasma samples, followed by binding with a secondary antibody conjugated to alkaline phosphatase for colorimetric readout by optical density (OD) at 405 nm. As shown in

Figure 15A, while the EG9 exendin-C-POGEMA conjugate did show a small amount of binding to anti-PEG antibodies in the positive plasma samples, the extent of binding is significantly less than those of the two PEGylated positive controls.

1.5 A **** ADA exendin A Diluent BB 1.5 **** ® Plasma 1 (-) Adagen EG9 exendin-C-POEGMA 1.0 **** Plasma 2 (+) ****

405 Plasma 3 (+) 1.0 OD

0.5 405

OD * * 0.5 * * * * * * 0.0 * * ® ® * * ADA BSA exendin Adagen Krystexxa 0.0 0 5 10 15 20 25 Competing antigen (ug)

EG9 exendin-C-POEGMA Antigen

Figure 15: Assessment of reactivity of an EG9 exendin-C-POEGMA conjugate toward anti-PEG antibodies in patient plasma samples. A) Direct ELISA probing native exendin, 54.6 kDa EG9 exendin-C-POEGMA conjugate, ADA, BSA, Krystexxa® (PEG- uricase) and Adagen® (PEG-ADA) with diluent, an anti-PEG negative patient plasma sample, or one of two anti-PEG positive plasma samples. B) Competitive ELISA, where various amounts of exendin, 54.6 kDa EG9 exendin-C-POEMGA, ADA and Adagen® were allowed to compete with Krystexxa® for binding with anti-PEG antibodies in a positive plasma sample. In both assays, the same unmodified peptide/protein content or similar PEG/OEG content in the case of polymer-modified samples per well were compared. See Methods section for details. Data were analyzed by two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test (n=3, ****P <0.0001) (88).

The result from direct ELISA was confirmed by a competitive ELISA, where

Krystexxa® was coated on wells to bind to anti-PEG antibodies in a positive plasma sample in competition with various amounts of native exendin, 54.6 kDa EG9 exendin-

C-POEGMA, ADA as negative control, and Adagen® as positive control. Similar

PEG/OEG contents of Adagen® and 54.6 kDa EG9 exendin-C-POEGMA were compared at all competing antigen concentrations. As can be seen in Figure 15B, at all tested concentrations, 54.6 kDa EG9 exendin-C-POEGMA showed significantly reduced antibody binding compared to Adagen®. These results led to the hypothesis that the reduced PEG antigenicity of the EG9 exendin-C-POEGMA conjugate is due to both the branched architecture and the short side-chain length of the conjugated POEGMA. As a minimum length of PEG is presumably needed for antibody recognition and binding

(130), we hypothesized that optimizing the side-chain OEG length may further reduce or possibly eliminate the antigenicity of POEGMA conjugates to anti-PEG antibodies.

4.3.2 Synthesis and Characterization of EG3 Exendin-C-POEGMA Conjugates

To test our hypothesis, we next synthesized exendin-C-POEGMA conjugates using OEGMA monomer with precisely 3 EG side-chain repeats as seen by LC/ESI-MS

(Figure 16A), as evidence in the literature suggests that the antigenic determinant of

PEG may be ~6-7 EG repeats (130). Due to the considerably lower water solubility of the

EG3 OEGMA monomer, polymerizations were carried out in 20 v/v% methanol in PBS.

A B 8 h 5.5 h 4.5 h 3 h 2.5 h

100

Normalized intensity (%) 25

0 12 14 16 18 20 22 24 26 Time (min)

C 8 h 5.5 h 4.5 h D 3 h 2.5 h

100

25 Normalized intensity (%)

0 12 14 16 18 20 22 24 Time (min)

E 30 F exendin 71.6 kDa EG3 conjugate 20

-10 ] molar ellipticity per residue *10^-3 θ [

-20 200 220 240 260 Wavelength (nm)

ATRP reaction mixtures of grafting EG9 POEGMA from exendin-C-Br carried out for 2.5 h, 3 h, 4.5 h, 5.5 h and 8 h, detected by UV-vis absorbance at 280 nm and RI. Signal from residual exendin-C-Br was too low to be detected due to its small size and low concentration. D) Coomassie-stained SDS-PAGE analysis of EG3 exendin-C- POEGMA conjugates purified by a single round of preparative SEC. Lane 1: marker, lanes 2-6: purified 20.1 kDa, 26.3 kDa, 42.7 kDa, 55.6 kDa and 71.5 kDa EG3 conjugates. E) Circular dichroism (CD) spectra of exendin and the 71.6 kDa EG3 exendin-C-POEGMA scanned at 10 µM. F) cAMP response of native exendin and EG3 exendin-C-POEGMA conjugates in BHK cells expressing the GLP-1R. EC50 values are summarized in Table 7 (88).

Table 7: Physical properties and biological activity of EG3 exendin-C- POEGMA conjugates. MWs and Ðs were determined by SEC-MALS. Rhs were measured by DLS. EC50 values were derived from cAMP response curves in Figure 16F. aCalculated from amino acid sequence. bDefault value due to unimolecular nature of the peptide (88).

Species/ Reaction Mw (Da) Mn (Da) Ð (Mw/ Mn) Rh (nm) EC50 (nM) Time (h)

exendin -- 4,186.6a 1.00b 2.2 ± 0.1 0.08 ± 0.01

2.5 21,700 20,100 1.08 2.9 ± 0.2 3.23 ± 0.14

3 27,400 26,300 1.04 3.3 ± 0.3 3.29 ± 0.27

4.5 46,100 42,700 1.08 4.3 ± 0.5 4.05 ± 0.05

5.5 60,600 55,600 1.09 4.8 ± 0.6 4.17 ± 0.31

8 82,700 71,600 1.16 5.4 ± 0.6 5.11 ± 0.24

EG3 conjugates of five different MWs were synthesized by varying ATRP reaction times, evident from the emergence of SEC peaks eluting at 17.2, 18.2, 19.0, 20.3 and 21.11 min detected by both UV-vis absorbance at 280 nm (Figure 16B) and RI

(Figure 16C). Integration of peak areas in the UV chromatograms showed that the conjugates constituted ~60% of the polymerization product on average. The relatively lower conjugation efficiency of the EG3 conjugates compared to their EG9 counterparts is speculated to be due to the lower water solubility of the EG3 OEGMA monomer, though such a yield is still well above what is typically achieved with conventional

PEGylation. SEC-MALS measurements showed that the synthesized EG3 exendin-C-

POEGMA conjugates had Mns ranging from 20.1 to 71.6 kDa with narrow dispersities

(Table 7). The conjugates were easily purified by a single round of preparative SEC

(Figure 16D) for further characterizations. Circular dichroism (CD) spectroscopy performed on exendin and the 71.6 kDa EG3 conjugate indicated that grafting EG3

POEGMA from exendin did not perturb the overall α-helical secondary structure of the peptide (Figure 16E). Assessment of conjugate potency by intracellular cAMP ELISA

(Figure 16F) revealed that similar to the EG9 conjugates, conjugation of EG3 POEGMA to the C-terminus of exendin caused an increase in the EC50 (Table 7), or a decrease in the receptor activation of the conjugates, though with a less pronounced MW- dependence.

exendin-C-PEG30k exendin-C-PEG20k A exendin-C-PEG30k exendin-C-PEG20k B exendin-C-PEG10k exendin-C-PEG10k 100 100

75 75

50 50

Normalized intensity (%) 25 25 Normalized intensity (%)

0 0 14 16 18 20 22 24 14 16 18 20 22 24 Time (min) Time (min)

C D

Species Mw (Da) Mn (Da) Ð (Mw/ Mn) Rh (nm) EC50 (nM)

exendin-C-PEG10k 15,900 15,600 1.02 3.1 ± 0.2 0.87 ± 0.24

exendin-C-PEG20k 25,900 25,100 1.03 4.7 ± 0.4 1.37 ± 0.16

exendin-C-PEG30k 33,400 32,400 1.03 5.4 ± 0.4 4.25 ± 0.45

To compare the POEGMA system with the current “gold standard” PEG, exendin-C-PEG conjugates were synthesized using a modular polymer conjugation approach that our group recently developed (134), where an azide functionality is installed exclusively at the C-terminus of exendin by sortase-catalyzed ligation, to enable near-quantitative conjugation of commercially available linear PEG end- functionalized with a dibenzocyclooctyl (DBCO) group via catalyst-free click chemistry.

Exendin-C-PEG conjugates with nominal PEG MWs of 10, 20 and 30 kDa were synthesized, evident from SEC peaks eluting ~ 17.0, 18.0 and 19.7 min (Figures 17A and

B). The exendin-C-PEG conjugates ran slightly higher than expected in SDS-PAGE. This retarded mobility phenomenon has been documented previously (26) and is presumably due to the more flexible and extended structure of linear PEG (Figure 17C). SEC-MALS measurements (Table 8) showed that the measured MWs of the exendin-C-PEG conjugates were in close agreement with their nominal MWs, and while the two higher

MW conjugates had somewhat bimodal MW distributions (Figures 17A and B), all three

conjugates had very narrow dispersities. In vitro cAMP responses of the exendin-C-PEG

conjugates (Figure 17D) showed a strong MW-dependent increase in EC50 values (Table

8), or decrease in receptor-activation activity, similar to the EG9 exendin-C-POEGMA

conjugates.

4.4.3 Antigenicity of EG3 Exendin-C-POEGMA Conjugates

**** ADA exendin A 2.0 B C **** D 2.0 Adagen® EG9 exendin-C-POEGMA Diluent **** Plasma 1 (-) EG3 exendin-C-POEGMA 1.5 **** Plasma 2 (+) A 1.5

405 Plasma 3 (+) 1.0 **** OD ** 405 1.0 0.5 * OD * * * * 0.5 * * * 0.0 * * * ® ® * * * * * ADA BSA * * * exendin 0.0 * * * Adagen * * Krystexxa 0 5 10 15 20 25 Competing antigen (ug)

EG9 exendin-C-POEGMAEG3 exendin-C-POEGMA Antigen

Figure 18: Assessment of reactivity of EG3 and EG9 exendin-C-POEGMA conjugates toward anti-PEG antibodies in patient plasma samples. A) Direct ELISA probing native exendin, 55.6 kDa EG3 and 54.6 kDa EG9 exendin-C-POEGMA conjugates, ADA, BSA, Krystexxa® (PEG-uricase) and Adagen® (PEG-ADA) with diluent, an anti- PEG negative patient plasma sample, or one of two anti-PEG positive plasma samples. B) Competitive ELISA, where various amounts of exendin, 55.6 kDa EG3 and 54.6 kDa EG9 exendin-C-POEMGA conjugates, ADA and Adagen® were allowed to compete with Krystexxa® for binding with anti-PEG antibodies in a positive plasma sample. In both assays, the same unmodified peptide/protein content or similar PEG/OEG content in the case of polymer-modified samples per well were compared. Data were analyzed by two-way ANOVA, followed by post hoc Dunnett’s multiple comparison test (n=5, **<0.01, ****P <0.0001) (88).

The reactivity of the 55.6 kDa EG3 exendin-C-POEGMA conjugate to anti-PEG antibodies in patient plasma samples was tested. The 54.6 kDa EG9 conjugate was included as a control to confirm the repeatability of the assays. Remarkably, both direct and competitive anti-PEG ELISAs (Figure 18) showed that reducing the side-chain length of the conjugated POEGMA down to 3 EG repeats completely eliminated the reactivity of the conjugate toward anti-PEG antibodies present in the patient plasma samples. It is speculated that the complete elimination of anti-PEG antigenicity of EG3

POEGMA has two potential molecular explanations. First, three ethylene glycol repeats may be shorter than the epitope recognized by anti-PEG antibodies, which is consistent with a pervious report that the antigenic determinant of PEG may be 6-7 repeat units

(130). Second, distributing PEG as oligomeric side-chains may create a “stacking effect” that hinders antibody access. Given that POEGMA is not currently present in any pharmaceutical or consumer product, it is reasonable to speculate that humans would not have any pre-existing antibodies to the polymer. Thus clinically, the lack of anti-PEG antigenicity of POEGMA conjugates is expected to translates to complete elimination of serious and sometimes life-threatening first-exposure allergic reactions in patients toward EG3 POEGMA conjugates of therapeutics and abrogation of accelerated blood clearance of the drug conjugates due to pre-existing anti-PEG antibodies in patients.

Note that these studies only address the anti-PEG antigenicity of POEGMA conjugates

of biologic drugs, while intrinsic immunogenicity, which is also a crucial aspect regarding the safety of this class of conjugates, will entail more extensive future studies.

4.4.4 In Vivo Efficacy of EG3 Exendin-C-POEGMA Conjugates

As the OEG side-chains on POEGMA are largely responsible for the “stealth” behavior of the polymer and its conjugates, alteration on the side-chain length may thus have an impact on the in vivo behavior of POEGMA conjugates. Therefore, we next investigated the in vivo efficacy of EG3 exendin-C-POEGMA. To see if any adjustment to the dose is needed, a dose-dependent study was first performed. The 71.6 kDa EG9 exendin-C-POEGMA conjugate was administered into mice (n=3) via a single s.c. injection at 25, 50 and 75, 150 and 250 nmol/kg mouse body weight, and an equivalent volume of PBS was injected as negative control. Interestingly, no apparent efficacy gain was observed with an increase in dose (Figure 19A, Table 9, unnormalized glucose profiles in Appendix Figure 25), in contrast to a very clear dose-dependence seen in the body weight profiles (Figure 19B). As the lowest tested dose of 25nmol/kg provided similar glucose-regulatory efficacy as the higher doses while resulting in significantly less acute body weight loss, the 25nmol/kg dose was maintained for subsequent in vivo efficacy studies of EG3 exendin-C-POEGMA conjugates.

PBS 75nmol/kg 10 25nmol/kg 150 nmol/kg PBS 75nmol/kg 175 50nmol/kg 250nmol/kg 25nmol/kg 150 nmol/kg 5 50nmol/kg 250nmol/kg 150

125 0

100 -5 75 Weight (% change) (% Weight -10 50 Plasma glucose baseline) (% Plasma 25 -15 -24 0 24 48 72 96 120 -24 0 24 48 72 96 120 Time (h) Time (h)

Figure 19: Assessment of in vivo dose-dependent efficacy of EG3 exendin-C- POEGMA. A) Overlaid normalized blood glucose levels of fed mice (n=3) measured before and after a single s.c. injection of a 71.6 kDa EG3 exendin-C-POEGMA conjugate at 25, 50, 75, 150, 250 nmol/kg or PBS control of equivalent volume administered at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h prior to and immediately before injection. B) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point.

Dosage (nmol/kg) Time (h) 25 50 75 150 250 1 *** **** *** **** 3 **** **** **** **** **** 6 * 24 **** *** **** **** **** 48 ** ** ** **** ** 72 ** * 96 *

175 A 175 PBS 26.3 kDa EG3 B PBS exendin-C-PEG10k 150 150

125 125

100 * 100 * ** * 75 * * 75 * * * * 50 50 ** * * * Plasma glucose baseline) (% Plasma *

Plasma glucose baseline) (% Plasma * * 25 25 * -24 0 24 48 72 96 -24 0 24 48 72 96 Time (h) Time (h) 175 C 175 PBS 55.6 kDa EG3 D PBS exendin-C-PEG20k 150 150

125 125

100 100 * * * 75 ** * * 75 * ** * * * * * 50 * 50 * * ** * Plasma glucose baseline) (% Plasma * Plasma glucose baseline) (% Plasma ** * * ** * * 25 25 * -24 0 24 48 72 96 120 -24 0 24 48 72 96 120 Time (h) Time (h) 175 PBS exendin-C-PEG30k E 175 PBS 71.6 kDa EG3 F 150 150

125 125

100 100 * * * 75 * 75 * * * * * ** * * * * 50 50 * * * *

Plasma glucose baseline) (% Plasma * Plasma glucose baseline) (% Plasma * * * 25 25 -24 0 24 48 72 96 -24 0 24 48 72 96 Time (h) Time (h) 26.3 kDa EG3 exendin-C-PEG10k G 175 PBS H 10 55.6 kDa EG3 exendin-C-PEG20k 26.3 kDa EG3 exendin-C-PEG10k 71.6 kDa EG3 exendin-C-PEG30k 150 55.6 kDa EG3 exendin-C-PEG20k 5 PBS 71.6 kDa EG3 exendin-C-PEG30k H 125 0 100 -5 75

Weight (% change) (% Weight -10 50 Plasma glucose baseline) (% Plasma 25 -15 -24 0 24 48 72 96 120 -24 0 24 48 72 96 120 Time (h) Time (h) Figure 20: Assessment of in vivo efficacy of EG9 exendin-C-POEGMA and exendin-C- PEG conjugates of various MWs. Blood glucose levels in fed mice (n=5) were

measured before and after a single s.c. injection of A, C, E) 26.3 kDa, 55.6 kDa and 71.6 kDa EG9 exendin-C-POEGMA conjugates and B, D, F) exendin-C-PEG conjugates with nominal PEG MWs of 10, 20 and 30 kDa, compared to PBS control. All conjugates were injected at 25 nmol/kg and PBS was injected at equivalent volume at t= 0 h. Blood glucose levels were normalized to the average glucose levels measured 24 h and immediately before injection. Data were analyzed by repeated measures two-way analysis of variance (ANOVA), followed by post hoc Dunnett’s multiple comparison test. F) Glucose profiles in A-F overlaid for comparison. G) Overlaid weight profiles for all treatment and control groups. Weights are reported as % change from 0 h time point. Glucose and weights at 120 h were only measured for the PBS, 55.6 kDa EG3 exendin-C-POEGMA, and exendin-C-PEG20k groups.

EG3 exendin-C-POEGMA exendin-C-PEGa Time (h) 26.3 kDa 55.6 kDa 71.6 kDa 10 kDa 20 kDa 30 kDa 1 **** **** **** **** **** **** 4 * ** **** **** **** 8 ** * **** **** **** 24 *** **** ** **** **** **** 48 ** * **** **** 72 * ** ** ** ** 96 **

Next, the in vivo efficacy of EG3 exendin-C-POEGMA conjugates was assessed and compared to that of exendin-C-POEGMA conjugates. As linear PEG and EG3

POEGMA have considerably different Rhs at the same MW, the PEG MWs were selected

to have three Rh-matching conjugate pairs: 26.3 kDa EG3 exendin-C-POEGMA (3.3 nm) vs. exendin-C-PEG10k (3.1 nm), 55.6 kDa EG3 exendin-C-POEGMA (4.8 nm) vs. exendin-

C-PEG20k (4.7 nm), and 71.6 kDa EG3 exendin-C-POEGMA (5.4 nm) vs. exendin-C-

PEG30k (5.4 nm); and one MW-matching conjugate pair: 26.3 kDa EG3 exendin-C-

POEGMA vs. exendin-C-PEG20k (25.1 kDa). All conjugates were administered into fed mice (n=3) via a single s.c. injection at 25 nmol/kg mouse body weight, with PBS of equivalent volume serving as control and fed glucose levels were monitored at various time points post-injection. As can be seen from the glucose profiles in Figure 20A-G

(unnormalized glucose profiles in Appendix Figure 26), EG3 exendin-C-POEGMA conjugates and exendin-C-PEG conjugates have very different glucose profiles in mice.

The exendin-C-PEG conjugates exhibited distinct “peak and valley” effect typical of parenterally administered drugs. An apparent increase in therapeutic duration from exendin-C-PEG10k to exendin-C-PEG20k suggests that the renal clearance of exendin-C-

PEG is somewhere between Mn ~ 15 and 25 kDa. In contrast, the EG3 exendin-C-

POEGMA conjugates gave much more flat and “depot-like” profiles with lower magnitude of glucose reduction. The weight profiles (Figure 20H) were in overall agreement with the blood glucose profiles. The 55.6 kDa EG3 conjugate slightly outperformed the 26.3 and 71.6 kDa conjugates, providing up to 96 h of significant glucose reduction compared to PBS control, while the two higher MW exendin-C-PEG conjugates provided up to 72 h of glucose reduction (Table 10). While the lower

therapeutic magnitude of the EG3 exendin-C-POEGMA conjugates leaves room from further improvement, it may already be beneficial for some disease types such as enzyme deficiencies. Additionally, the lack of a “peak and valley” feature often associated with parenterally administered drugs is desirable as it can eliminate unwanted side effects.

4.4.5 Pharmacokinetics of Exendin-C-POEGMA Conjugates

To further confirm the prolonged circulation of exendin-C-POEGMA conjugates and to seek answers to the distinctly different therapeutic profiles of the EG3 conjugates, a pharmacokinetics study was performed. Exendin, the 54.6 kDa EG9, 55.6 kDa EG3 and

71.6 kDa EG3 conjugates were fluorescently labeled with Alexa Fluor® 488 NHS ester via their solvent-accessible amines on lysine residues and the N-terminus. Two MWs of the

EG3 conjugate were tested as the EG3 and EG9 conjugates have different Rhs at the same

MW. The MWs were chosen such that the 54.6 kDa EG9 conjugate has similar MW as the

55.6kDa EG3 conjugate and similar Rh as the 71.6 kDa EG3 conjugate (Tables 3 and 7).

The labeled samples were injected s.c. into mice (n=3) at 75 nmol/kg (45 nmol/kg fluorophore) and blood samples were collected at various time points for up to 120 h for fluorescence quantification to determine the plasma concentration of the samples. The plasma concentration-time courses (Figure 21) were analyzed using a non- compartmental fit characterizing the absorption and elimination phases of the pharmacokinetic profiles to approximate parameters including absorption half-life (t1/2a),

elimination half-life (t1/2e), maximum plasma concentration (Cmax), time to attain Cmax, and AUC, as shown in Table 11.

70 54.6 kDa EG9 55.6 kDa EG3 exendin 70 71.6 kDa EG3 60 60 50 50 40 40 30 30 20 20 10 10 Plasma concentration (nM) concentration Plasma 0 (nM) concentration Plasma 0 0 4 8 12 16 20 24 0 24 48 72 96 120 Time (h) Time (h)

Figure 21: Plasma concentration as a function of time post s.c. injection of exendin and exendin-C-POEGMA conjugates. A) Exendin and B) exendin-C-POEGMA conjugates (54.6 kDa EG9, 55.6 kDa EG3 and 71.6 kDa EG3) were fluorescently labeled with Alexa Fluor® 488 and injected into mice (n=3) s.c. at 75 nmol/kg (45 nmol/kg fluorophore). Blood samples were collected via tail vein at various time points for fluorescence quantification. Data were analyzed using a non-compartmental fit (solid lines) to derive the pharmacokinetic parameters shown in Table 11 (88).

Species t1/2a (h) t1/2el (h) Cmaxa (nM) tmaxa (nM) AUCb (h*nM)

exendin 0.7±0.1 1.7±0.2 37.1±3.8 1.78±0.1 217.5±36.5

54.6 kDa EG9 6.2±0.5 42.4±2.9 56.4±3.9 20.1±0.4 4795.5±440.7

55.6 kDa EG3 7.6±0.7 61.2±5.0 44.0±2.7 28.5±2.3 4775.0±482.9

71.6 kDa EG3 9.0±1.7 61.5±3.2 37.7±5.0 32.4±3.9 4411.2±499.6

After s.c. injection, unmodified exendin had a very short residence time in circulation, with a rapid absorption phase (t1/2a = 0.7±0.1 h) and a short terminal elimination phase (t1/2el = 1.7±0.2 h). In contrast, the exendin-C-POEGMA conjugates tested increased the absorption time by ~ 9 to 13-fold, with the two EG3 conjugates taking longer than the EG9 conjugate to absorb into circulation. Similarly, the 54.6 kDa

EG9 conjugate prolonged the elimination phase of exendin by ~ 25-fold, while the two

EG3 conjugates afforded a bigger increase of ~36-fold. These differences in the pharmacokinetics resulted in ~ 20-fold increase in AUC for the conjugates compared to unmodified exendin, indicating that conjugation of POEGMA to the C-terminus of exendin significantly enhanced the cumulative exposure of the peptide in circulation.

While the Cmaxs of the two EG3 conjugates were smaller than that of the EG9 conjugate, consistent with the lower magnitude of glucose reduction seen for the EG3 conjugates in the fed blood glucose studies (Figure 20), the AUCs of the three tested conjugates were comparable given the longer absorption and elimination half-lives of the EG3 conjugates. This finding is consistent with the more flat and steady glucose profiles of the EG3 conjugates. It is speculated that the relatively higher hydrophobicity of EG3

POEGMA may cause its conjugates to remain in the s.c. space or lodge in other tissues during their course in circulation for more extended periods of time, thus creating a depot-like effect.

4.4.5 Conclusion

Exendin-C-POEGMA conjugate with ~9 side-chain EG repeats exhibits significantly lower reactivity toward patient-derived anti-PEG antibodies than two FDA- approved PEGylated drugs, and reducing the side-chain length to 3 EG repeats completely eliminates PEG antigenicity. These results demonstrate that the architecture of PEG appended to a biologic drug plays an important role in modulating its antigenicity. Given that PEGylation remains the most widely used technology clinically to extend the half-life and improve the bioavailability of biologic drugs, a method to tackle the emerging problem of antigenicity of PEG by modulation of its architecture — from linear to branched—provides a new approach to solve this problem.

In vivo efficacy study shows that the decrease in polymer side-chain length does not significantly compromise the therapeutic efficacy of the conjugates, as EG3 exendin-

C-POEGMA conjugates provide up to 96 h of significant glucose reduction in fed mice and the glucose profiles lack the undesirable “peak and valley” effect typically seen with parenteral administration. However, the relatively lower therapeutic magnitude associated with the EG3 POEGMA conjugates can benefit from further optimization, which is discussed in more detail in the Future Directions section.

Collectively, these results establish POEGMAlation as a next-generation

PEGylation technology that is highly useful for improving the pharmacological performance of therapeutic biomolecules, while providing a timely solution to the

100

increasing levels of pre-existing anti-PEG antibodies in the general population that is compromising the safety and efficacy of FDA-approved PEGylated drugs and hindering the progress of those in clinical and pre-clinical development.

101

5. Future Directions

While these results are promising, a deeper understanding of the mechanism of action, efficacy and safety of exendin-C-POEGMA conjugates, particularly the EG3 variants, is necessary for clinical translation. Future studies will measure insulin release, investigate the in vivo biodistribution of the conjugates, and assess long-term therapeutic indicators such as glycated albumin, hemoglobin A1c (HbA1c), and pancreatic β-cell proliferation to reveal the long-term therapeutic potential of exendin-C-POEGMA conjugates.

More work also remains to be done to further optimize the POEGMAlation technology. Given the expected inverse relationship between POEGMA side-chain length and anti-PEG antigenicity vs. therapeutic efficacy, a systematic optimization of the side-chain length could be useful to identify the optimal side-chain length that abolishes anti-PEG antigenicity while maximizing therapeutic efficacy. Aside from the side-chain length, the chemistry of the polymer can also be varied in an effort to further enhance the therapeutic efficacy of POEGMA conjugates. For example, the monomers used in this study are methoxy-terminated on the side-chain and have a methacrylic backbone. It is speculated that using hydroxyl-terminated and/or acrylic monomers may increase the overall hydrophilicity of POEGMA conjugates and thus further improve the magnitude and duration of their therapeutic effect. Certainly the extent to which these variations can be made depends on the availability of precisely defined monomers.

102

The in vitro anti-PEG ELISAs performed in this study only address the anti-PEG antigenicity issue of POEGMA conjugates. Future assessment of the intrinsic immunogenicity of POEGMA conjugates, by in vivo studies such as measuring pharmacokinetics and antibody titers after repeated injections, is essential to understand the long-term safety of this class of conjugates. These studies should include proper controls for the “LPET(G)n” motif in conjugates synthesized using the sortase-catalyzed polymer conjugation approach, to elucidate the immunogenic implication of this motif.

Additionally, recent studies suggest that hydroxy-terminated PEG may generate less intense immune responses than methoxy-terminated PEG, which is used in all currently

FDA-approved PEGyated drugs (135, 136). A side-by-side comparison of the immunogenicity of POEGMA conjugates containing methoxy- vs. hydroxy-terminated side-chains may thus be useful. Given the complexity of the issue of immunogenicity and the possible variability in immune responses across species, these studies will likely need to be carried out in multiple animal models.

103

Appendix

B 400 PBS 50nmol/kg 25nmol/kg 85nmol/kg

300

200 Blood glucose (mg/dl) 100

-24 0 24 48 72 96 120 Time (h)

A 175 B 350 PBS PBS exendin 150 exendin 300

125 250

100 200

75 150

50 Blood Glucose (mg/dL)100 Plasma glucose baseline) (% Plasma 25 50 -24 0 24 48 72 96 120 -24 0 24 48 72 96 120 Time (h) Time (h)

104

B 350 PBS 25.4 kDa EG9 54.6 kDa EG9 97.2 kDa EG9 300 155.0 kDa EG9

250

200

150 Blood glucose (mg/dL) 100

50 -24 0 24 48 72 96 120 144 Time (h)

25nmol/kg 75nmol/kg 150 nmol/kg 350 50nmol/kg 250nmol/kg

300

250

200

Blood glucose 150(mg/dl)

100 -24 0 24 48 72 96 120 Time (h)

Figure 25: Overlaid un-normalized blood glucose profiles of fed mice (n=3) measured before and after receiving a single s.c. injection of a 71.6 kDa EG3 exendin-C- POEGMA conjugate at 25, 50, 75, 150, 250 nmol/kg or PBS control at equivalent volume injected at t= 0 h.

105

26.3 kDa EG3 exendin-C-PEG10k 400 55.6 kDa EG3 exendin-C-PEG20k 350 71.6 kDa EG3 exendin-C-PEG30k PBS 300

250

200

150 Blood glucose (mg/dl) 100

50 -24 0 24 48 72 96 120 Time (h)

106

References

1. B. Leader, Q. J. Baca, D. E. Golan, Protein therapeutics: a summary and pharmacological classification. Nat. Rev. Drug Discov. 7, 21-39 (2008).

2. D. J. Craik, D. P. Fairlie, S. Liras, D. Price, The future of peptide-based drugs. Chem. Biol. Drug Des. 81, 136-147 (2013).

3. P. Vlieghe, V. Lisowski, J. Martinez, M. Khrestchatisky, Synthetic therapeutic peptides: science and market. Drug Discov. Today 15, (2010).

4. P. J. Carter, Introduction to current and future protein therapeutics: a protein engineering perspective. Experimental cell research 317, 1261-1269 (2011).

5. T. J. Peters, Serum albumin. Adv. Protein Chem. 37, 161-245 (1985).

6. M. Awai, E. B. Brown, Studies of the metabolism of I-131-labeled human transferrin. J. Lab. Clin. Med. 61, 363-396 (1963).

7. M. Werle, A. Bernkop-Schnurch, Strategies to improve plasma half life time of peptide and protein drugs. Amino Acids 30, 351-367 (2006).

8. A. K. Banga, Therapeutic Peptides and Proteins - Formulation, Processing, and Delivery Systems. (CRC Press, Boca Raton, FL, 2015).

9. P. Caliceti, F. M. Veronese, Pharmacokinetic and biodistribution properties of poly(ethylene glycol)-protein conjugates. Adv. Drug Deliv. Rev. 55, 1261-1277 (2003).

10. S. Mitragotri, P. A. Burke, R. Langer, Overcoming the challenges in administering biopharmaceuticals: formulation and delivery strategies. Nat. Rev. Drug Discov. 13, 655-672 (2014).

107

11. D. K. Malik, S. Baboota, A. Ahuja, S. Hasan, J. Ali, Recent advances in protein and peptide drug delivery systems. Curr. Drug Deliv. 2, 141-151 (2007).

12. N. Jawahar, S. N. Meyyanathan, Polymeric nanoparticles for drug delivery and targeting: a comprehensive review. Int. J. Health Allied Sci. 1, 217-223 (2012).

13. S. Kontos, J. A. Hubbell, Drug development: longer-lived proteins. Chem. Soc. Rev. 41, 2686-2695 (2012).

14. P. Yousefpour, A. Chilkoti, Co-opting biology to deliver drugs. Biotechnol. Bioeng. 111, 1699-1716 (2014).

15. D. M. Czajkowsky, J. Hu, Z. Shao, R. J. Pleass, Fc-fusion proteins: new developments and future perspectives. EMBO Mol. Med. 4, 1015-1028 (2012).

16. F. M. Veronese, G. Pasut, PEGylation, successful approach to drug delivery. Drug. Discov. Today 10, 1451-1458 (2005).

17. T. L. Hendrickson, V. de Crecy-Lagard, P. Schimmel, Incorporation of nonnatural amino acids into proteins. Annu. Rev. Biochem. 73, 147-176 (2004).

18. Y. Cai, L. Wei, L. Ma, X. Huang, A. Tao, Z. Liu, W. Yuan, Long-acting preparations of exenatide. Drug Des. Dev. Ther. 7, 963-970 (2013).

19. A. J. Almeida, E. Souto, Solid lipid nanoparticles as a drug delivery system for peptides and proteins. Adv. Drug Deliv. Rev. 59, 478-490 (2007).

20. L. W. Kleiner, J. C. Wright, Y. Wang, Evolution of implantable and insertable drug delivery systems. J. Control. Release 181, 1-10 (2014).

21. R. R. Henry, J. Rosenstock, D. K. Logan, T. R. Alessi, K. Luskey, M. A. Baron, Randomized trial of continuous subcutaneous delivery of exenatide by ITCA 650 versus twice-daily exenatide injections in Metformin-treated type 2 diabetes. Diabet. Care 36, 2559-2565 (2013).

108

22. J. H. Prescott, S. Lipka, S. Baldwin, N. F. Shppard, H. M. Maloney, J. Coppeta, B. Yomtov, M. A. Staples, J. T. J. Santini, Chronic, programmed polypeptide delivery from an implanted, multireservoir microchip device. Nat. Biotechnol. 24, 437-438 (2006).

23. B. L. Osborn, H. S. Olsen, B. Nardelli, J. H. Murray, J. X. Zhou, A. Garcia, et. al., Pharmacokinetic and pharmacodynamic studies of a human serum albumin- interferon-alpha fusion protein in cynomolgus monkeys. J. Pharmacol. Exp. Ther. 303, 540-548 (2002).

24. M. Swierczewska, K. C. Lee, S. Lee, What is the future of PEGylated therapies? Expert Opinion. Emerging Drus 20, 531-536 (2015).

25. A. Abuchowski, J. R. McCoy, N. C. Palczuk, T. van Es, F. F. Davis, Effect of covalent attachment of polyethylene glycol on immunogenicity and circulating life of bovine liver catalase. J. Biol. Chem. 252, 3582-1586 (1977).

26. A. Abuchowski, T. van Es, N. C. Palczuk, F. F. Davis, Alteration of immunological properties of bovine serum albumin by covalent attachment of polyethylene glycol. J. Biol. Chem. 252, 3578-3581 (1977).

27. P. Zhang, F. Sun, S. Liu, S. Jiang, Anti-PEG antibodies in the clinic: current issues and beyond PEGylation. J. Control Release, (2016).

28. S. N. S. Alconcel, A. S. Baas, H. D. Maynard, FDA-approved poly(ethylene glycol)–protein conjugate drugs. Polym. Chem. 2, 1442-1448 (2011).

29. K. Knop, R. Hoogenboom, D. Fischer, U. S. Schubert, Poly(ethylene glycol) in drug delivery: pros and cons as well as potential alternatives. Angew. Chem. Int. Ed. 49, 6288-6308 (2010).

30. S. Parveen, S. K. Sahoo, Nanomedicine - Clinical applications of polyethylene glycol conjugated proteins and drugs. Clin Pharmacokinet 45, 965-988 (2006).

109

31. M. A. Gauthier, H. Klok, Peptide/protein–polymer conjugates: synthetic strategies and design concepts. Chem. Commun., 2591-2611 (2008).

32. Y. Qi, A. Chilkoti, Protein–polymer conjugation—moving beyond PEGylation. Curr. Opin. Chem. Biol. 28, 181-193 (2015).

33. V. Gaberc-Porekar, I. Zore, B. Podobnik, V. Menart, Obstacles and pitfalls in the PEGylation of therapeutic proteins. Curr. Opin. Drug Discov. Devel. 11, 242-250 (2008).

34. Y. S. Youn, D. H. Na, K. C. Lee, High-yield production of biologically active mono-PEGylated salmon calcitonin by site-specific PEGylation. J. Control. Release 117, 371-379 (2007).

35. Y. Qi, A. Chilkoti, Growing polymers from peptides and proteins: a biomedical perspective. Polym. Chem. 5, 266-276 (2014).

36. C. D. Conover, L. Lejeune, K. Shum, C. Gilbert, R. G. Shorr, Physiological effect of polyethylene glycol conjugation on stroma-free bovine hemoglobin in the conscious dog after partial exchange transfusion. Artif. Organs. 21, 369-378 (1997).

37. A. Bendele, J. Seely, C. Richey, G. Sennello, G. Shopp, Short Communication: Renal Tubular Vacuolation in Animals Treated with Polyethylene-Glycol- Conjugated Proteins. Toxicol. Sci. 42, 152-157 (1998).

38. C. Conover, L. Lejeune, R. Linberg, K. Shum, R. G. Shorr, Transitional vacuole formation following a bolus infusion of PEG-hemoglobin in the rat. Art. Cells, Blood Subs., and Immob. Biotech. 24, 599-611 (1996).

39. N. J. Ganson, S. J. Kelly, E. Scarlett, J. S. Sundy, M. S. Hershfield, Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase. Arthritis Res. Ther. 8, R12-R22 (2006).

110

40. M. S. Hershfield, N. J. Ganson, S. J. Kelly, E. L. Scarlett, D. A. Jagger, J. S. Sundy, Induced and pre-existing anti-polyethylene glycol antibody in a trial of every 3- week dosing of pegloticase for refractory gout, including in organ transplant recipients. Arthritis Res. Ther. 16, R63 (2014).

41. J. S. Sundy, N. J. Ganson, E. Scarlett, C. D. Rehrig, W. Huang, M. S. Hershfield, Pharmacokinetics and pharmacodynamics of intravenous PEGylated recombinant mammalian urate oxidase in patients with refractory gout. Arthritis Rheum. 56, 1021-1028 (2007).

42. J. K. Armstrong, G. Hempel, S. Koling, L. S. Chan, T. Fisher, H. J. Meiselman, G. Garratty, Antibody against poly(ethylene glycol) adversely affects PEG- asparaginase therapy in acute lymphoblastic leukemia patients. Cancer 110, 103- 111 (2007).

43. N. J. Ganson, T. J. Povsic, B. A. Sullenger, T. H. Alexander, S. L. Zelenkofske, J. M. Sailstad, C. P. Rusconi, M. S. Hershfield, Pre-existing anti-PEG antibody linked to first-exposure allergic reactions to Pegnivacogin, a PEGylated RNA aptamer. J. Allergy Clin. Immunology 137, 1610-1613 (2016).

44. M. Hamidi, A. Azadi, P. Rafiei, Pharmacokinetic Consequences of PEGylation. Drug Deliv. 13, 399-409 (2006).

45. R. Duncan, Polymer Conjugates as Anticancer Nanomedicine. Nat. Rev. Cancer 6, 688-701 (2006).

46. T. Shimoboji, E. Larenas, T. Fowler, A. S. Hoffman, P. S. Stayton, Temperature- induced switching of enzyme activity with smart polymer-enzyme conjugates. Bioconjugate Chem. 14, 517-525 (2003).

47. K. L. Heredia, D. Bontempo, T. Ly, J. T. Byers, S. Halstenber, H. D. Maynard, In situ preparation of protein-“smart” polymer conjugates with retention of bioactivity. J. Am. Chem. Soc. 127, 16955-16960 (2005).

111

48. D. Bontempo, H. D. Maynard, Streptavidin as a Macroinitiator for Polymerization: in situ Protein-Polymer Conjugate Formation. J. Am. Chem. Soc. 127, 6508-6509 (2005).

49. C. Boyer, V. Bulmus, J. Liu, T. P. Davis, M. H. Stenzel, C. Barner-Kowollik, Well- defined protein-polymer conjugates via in situ RAFT polymerization. J. Am. Chem. Soc. 129, 7145-7154 (2007).

50. P. De, M. Li, S. R. Gondi, B. S. Sumerlin, Temperature-regulated activity of responsive polymer-protein conjugates prepared by grafting-from via RAFT polymerization. J. Am. Chem. Soc. 130, 11288-11289 (2008).

51. J. Nicolas, V. San Miguel, G. Mantovani, D. M. Haddleton, Fluorescently Tagged Polymer Bioconjugates from Protein Derived Macroinitiators. Chem. Commun. 45, 4697-4699 (2006).

52. R. M. Broyer, G. N. Grover, H. D. Maynard, Emerging synthetic approaches for protein-polymer conjugations. Chem. Commun., 2212-2226 (2011).

53. B. S. Sumerlin, Proteins as Initiators of Controlled Radical Polymerization: Grafting from via ATRP and RAFT. ACS Macro Lett. 1, 141 (2012).

54. B. S. Lele, H. Murata, K. Matyjaszewski, A. J. Russell, Synthesis of uniform protein-polymer conjugates. Biomacromolecules 6, 3380-3387 (2005).

55. J. P. Magnusson, S. Bersani, S. Salmaso, C. Alexander, P. Caliceti, In situ growth of side-chain PEG polymers from functionalized human growth hormone-a new technique for preparation of enhanced protein-polymer conjugates. Bioconjugate Chem. 21, 671-678 (2010).

56. J. Liu, V. Bulmus, D. L. Herlambang, C. Barner-Kowollik, M. H. Stenzel, T. P. Davis, In situ formation of protein–polymer conjugates through reversible addition fragmentation chain transfer polymerization. Angew. Chem. Int. Ed. 46, 3099-3103 (2007).

112

57. J. C. Peeler, B. F. Woodman, S. Averick, S. J. Miyake-Stoner, A. L. Stokes, K. R. Hess, K. Matyjaszewski, R. A. Mehl, Genetically encoded initiator for polymer growth from proteins. J. Am. Chem. Soc. 132, 13575-13577 (2010).

58. S. Averick, C. Bazewicz, B. F. Woodman, A. Simakova, R. A. Mehl, K. Matyjaszewski, Protein-polymer hybrids: conducting ARGET ATRP from a genetically encoded cleavable ATRP initiator. Eur. Polym. J. 49, 2919-2924 (2013).

59. J. Y. Axup, K. M. Bajjuri, M. Ritland, B. M. Hutchins, C. H. Kim, S. A. Kazane, R. Halder, J. S. Forsyth, A. F. Santidrian, K. Stafin, Y. Lu, H. Tran, A. J. Seller, S. L. Biroc, A. Szydlik, J. K. Pinkstaff, F. Tian, S. C. Sinha, B. Felding-Habermann, V. V. Smider, P. G. Schultz, Synthesis of site-specific antibody-drug conjugates using unnatural amino acids. Proc. Natl. Acad. Sci. 109, 16101-16106 (2012).

60. W. H. Zhang, G. Otting, C. J. Jackson, Protein engineering with unnatural amino acid. Curr. Opin. Struct. Biol. 23, 581-587 (2013).

61. W. Gao, W. Liu, J. A. Mackay, M. R. Zalutsky, E. J. Toone, A. Chilkoti, In situ growth of a stoichiometric PEG-like conjugate at a protein’s N-terminus with significantly improved pharmacokinetics. Proc. Natl. Acad. Sci., 15231-15236 (2009).

62. W. Gao, W. Liu, T. Christensen, M. R. Zalutsky, A. Chilkoti, In situ growth of a PEG-like polymer from the C terminus of an intein fusion protein improves pharmacokinetics and tumor accumulation. Proc. Natl. Acad. Sci. 107, 16432-16437 (2010).

63. B. Le Droumaguet, J. Nicolas, Recent advances in the design of bioconjugates from controlled/living radical polymerization. Polym. Chem. 1, 563-598 (2010).

64. T. Pintauer, K. Matyjaszewski, Atom transfer radical addition and polymerization reactions catalyzed by ppm amounts of copper complexes. Chem. Soc. Rev. 37, 1087-1097 (2008).

113

65. J.-S. Wang, K. Matyjaszewski, Controlled/"living" radical polymerization. Atom transfer radical polymerization in the presence of transition-metal complexes. J. Am. Chem. Soc. 117, 5614-5615 (1995).

66. Z. Zhang, S. Chen, Y. Chang, S. Jiang, Surface grafted sulfobetaine polymers via atom transfer radical polymerization as superlow fouling coatings. J. Phys. Chem. B 110, 10799-10804 (2006).

67. J.-S. M. Wang, K., Controlled/"living" radical polymerization: halogen atom transfer radical polymerization promoted by a Cu(I)/Cu(II) redox process. Macromolecules 28, 7901-7910 (1995).

68. W. Tang, Y. Kwak, W. Braunecker, V. Tsarevsky N., M. L. Coote, K. Matyjaszewski, Understanding atom transfer radical polymerization: effect of ligand and initiator structures on the equilibrium constants. J. Am. Chem. Soc. 130, 10702-10713 (2008).

69. K. Matyjaszewski, H.-J. Paik, P. Zhou, S. J. Diamanti, Determination of activation and deactivation rate constants of model compounds in atom transfer radical polymerization. Macromolecules 34, 5125-5131 (2001).

70. W. Tang, N. V. Tsarevsky, K. Matyjaszewski, Determination of equilibrium constants for atom transfer radical polymerization. J. Am. Chem. Soc. 128, 1598- 1604 (2006).

71. K. Matyjaszewski, J. Xia, Atom Transfer Radical Polymerization Chem. Rev. 101, 2921-2990 (2001).

72. K. Matyjaszewski, W. A. Braunecker, N. V. Tsarevsky, A. Gennaro, Deactivation efficiency and degree of control over polymerization in ATRP in protic solvents. Macromolecules 42, 6348-6360 (2004).

73. K. Matyjaszewski, N. V. Tsarevsky, T. Pintauer, Macromolecules 37, 9768-9778 (2004).

114

74. S. Averick, A. Simakova, S. Park, D. Konkolewicz, A. J. D. Magenau, R. A. Mehl, K. Matyjaszewski, ATRP under biologically relevant conditions: grafting from a protein. ACS Macro. Lett. 1, 6-10 (2012).

75. A. Simakova, S. E. Averick, D. Konkolewicz, K. Matyjaszewski, Aqueous ARGET ATRP. Macromolecules 45, 6371-6379 (2012).

76. M. W. Popp, J. M. Antos, H. L. Ploegh, Site-specific labeling via sortase-mediated transpeptidation. Curr. Protoc. Protein Sci. 56, 15.13.11-15.13.19 (2009).

77. M. K. M. Leung, C. E. Hagemeyer, A. P. R. Johnston, C. Gonzales, M. M. J. Kamphuis, K. Ardipradja, G. K. Such, K. Peter, F. Caruso, Bio-click chemistry: enzymatic functionalization of PEGylated capsules for targeting applications. Angew. Chem. Int. Ed. 51, 7132-7136 (2012).

78. U. Ilangovan, H. Ton-That, J. Iwahara, I. Schneewind, R. T. Clubb, Structure of sortase, the transpeptidase that anchors proteins to the cell wall of Staphylococcus aureus. Proc. Natl. Acad. Sci. 98, 6056-6061 (2001).

79. J. M. Antos, G. M. Miller, G. M. Grotenbreg, H. L. Ploegh, Lipid modification of proteins through sortase-catalyzed transpeptidation. J. Am. Chem. Soc. 130, 16338- 16343 (2008).

80. M. W. Popp, S. K. Dougan, T. Chuang, E. Spooner, H. L. Ploegh, Sortase- catalyzed transformations that improve the properties of cytokines. Proc. Natl. Acad. Sci. 108, 3169-3174 (2011).

81. Z. Wu, X. Guo, Q. Wang, B. M. Swarts, Z. Guo, Sortase A-catalyzed transpeptidation of glycosylphosphatidylinositol derivatives for chemoenzymatic synthesis of GPI-anchored proteins. J. Am. Chem. Soc. 132, 1567- 1571 (2010).

82. H. Mao, S. A. Hart, A. Schink, B. A. Pollok, Sortase-mediated protein ligation: a new method for protein engineering. J. Am. Chem. Soc. 126, (2004).

115

83. H. W. Ma, M. Wells, T. P. Beebe, A. Chilkoti, Surface-initiated atom transfer radical polymerization of oligo(ethylene glycol) methyl methacrylate from a mixed self-assembled monolayer on gold. Adv. Mater. 16, 640-648 (2006).

84. D. E. Meyer, A. Chilkoti, Purification of recombinant proteins by fusion with thermally-responsive polypeptide. Nat. Biotechnol. 14, 1112-1115 (1999).

85. Y. Qi, M. Amiram, W. Gao, D. G. McCafferty, A. Chilkoti, Sortase-catalyzed initiator attachment enables high yield growth of a stealth polymer from the C terminus of a protein. Macromol. Rapid Commun. 34, 1256-1260 (2013).

86. A. Keller, A. I. Nesvizhskii, E. Kolker, R. Aebersold, Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 74, 5383-5392 (2002).

87. J. Boekhorst, M. W. de Been, M. Kleerebezem, R. J. Siezen, Genome-wide detection and analysis of cell wall-bound proteins with LPxTG-like sorting motifs. J. Bacteriol. 187, 4928-4934 (2005).

88. Y. Qi, A. Simakova, X. Li, N. J. Ganson, K. M. Luginbuhl, I. Özer, W. Liu, M. S. Hershfield, K. Matyjaszewski, A. Chilkoti, A C-terminal PEG-like brush polymer conjugate of exendin-4 reduces blood glucose for up to five days and eliminates PEG antigenicity. Nat. Biomed. Eng. Accepted, (2016).

89. N. V. Tsarevsky, T. Pintauer, K. Matyjaszewski, Deactivation efficiency and degree of control over polymerization in ATRP in protic solvents. Macromolecules 37, 9768-9778 (2004).

90. W. Burchard, M. Schmidt, W. H. Stockmayer, Information on polydispersity and branching from combined quasi-elastic and integrated scattering. Macromolecules 13, 1265-1272 (1980).

91. W. Burchard, in Light scattering: principles and development, W. Brown, Ed. (Oxford University Press, New York, 1996), chap. 13.

116

92. Y. Li, Recombinant production of antimicrobial peptides in Escherichia coli: a review. Protein Express. Purif. 80, 260-267 (2011).

93. J. J. Bellucci, J. Bhattacharyya, A. Chilkoti, A noncanonical function of sortase enables site-specific conjugation of small molecules to lysine residues in proteins. Angew. Chem. Int. Ed. 54, 441-445 (2015).

94. L. Chen, D. J. Magliano, P. Z. Zimmet, The worldwide epidemiology of type 2 diabetes mellitus--present and future perspectives. Nature reviews. Endocrinology 8, 228-236 (2012).

95. N. P. Hays, P. R. Galassetti, R. H. Coker, Prevention and treatment of type 2 diabetes: current role of lifestyle, natural product and pharmacological interventions. Pharmaco. Ther. 118, 181-191 (2008).

96. G. M. Reaven, Role of insulin resistance in human disease. Diabetes 37, 1595-1607 (1988).

97. S. E. Kahn, R. L. Prigeon, D. K. McCulloch, E. J. Boyko, R. N. Bergman, M. W. Schwartz, J. L. Neiging, W. K. Ward, J. C. Beard, J. P. Palmer, Quantification of the relationship between insulin sensitivity and β-cell function in human subjects: evidence for a hyperbolic function. Diabetes 42, 1663-1672 (1993).

98. S. E. Kahn, M. E. Cooper, S. Del Prato, Pathophysiology and treatment of type 2 diabetes: perspectives on the past, present, and future. Lancet 383, 1068-1083 (2014).

99. P. A. Halban, K. S. Polonsky, D. W. Bowden, M. A. Hawkens, C. Ling, K. Mather, A. C. Powers, C. J. Rhodes, L. Sussel, G. C. Weir, β-cell failure in type 2 diabetes: postulated mechanisms and prospects for prevention and treatment. Diabet. Care 37, 1751-1758 (2014).

100. A. J. Scheen, Pathophysiology of type 2 diabetes. Acta. Clin. Belg. 58, 335-341 (2003).

117

101. L. L. Nielsen, Incretin mimetics and DPP-IV inhibitors for the treatment of type 2 diabetes. Drug Discov. Today 10, 703-710 (2005).

102. W. L. Bennett, N. M. Maruthur, S. Singh, J. B. Segal, L. M. Wilson, R. Chatterjee, S. S. Marinopoulos, M. A. Puhan, P. Panasinghe, L. Block, W. K. Nicholson, S. Hutfless, E. B. Bass, S. Bolen, Comparative effectiveness and safety of medications for type 2 diabetes: an update including new drugs and 2-drug combinations. Ann. Intern. Med. 154, 602-613 (2011).

103. A. Quaseem, L. L. Humphrey, D. E. Sweet, M. Starkey, P. Shekelle, Oral pharmacologic treatment of type 2 diabetes mellitus: a clinical practice guideline from the american college of physicians. Ann. Intern. Med. 156, 218-231 (2012).

104. M. Stumvoll, B. J. Goldstein, T. W. van Haeften, Type 2 Diabetes: Principles of Pathogenesis and Therapy. Lancet 365, 1333-1346 (2009).

105. R. A. Defronzo, From the triumvirate to the ominous octet: A new paradigm for the treatment of type 2 diabetes mellitus. Diabetes 58, 773-795 (2009).

106. C. J. Nolan, P. Damm, M. Prentki, Type 2 diabetes across generations: from pathophysiology to prevention and management. Lancet 378, (2011).

107. L. F. Meneghini, Intensifying Insulin Therapy: What Options Are Available to Patients with Type 2 Diabetes? The American Journal of Medicine 126, S28-S37 (2013).

108. J. A. Lovshin, D. J. Drucker, Incretin-based therapies for type 2 diabetes mellitus. Nat. Rev. Endocrinol. 5, 262-269 (2009).

109. J. J. Holst, The Physiology of Glucagon-Like Peptide 1. Physiol. Rev. 87, 1409-1439 (2007).

110. J. J. Holst, T. Vilsboll, F. Deacon, The incretin system and its role in type 2 diabetes mellitus. Mol. Cell. Endocrinol. 297, 127-136 (2009).

118

111. P. L. Brubaker, D. J. Drucker, Minireview: Glucagon-like peptides regulate cell proliferation and apoptosis in the pancreas, gut, and central nervous system. Endocrinology 145, 2653-2659 (2004).

112. A. J. Garber, Incretin effects on β-cell function, replication, and mass. Diabet. Care 34, S258-263 (2011).

113. G. P. Fadini, A. Avogaro, Cardiovascular effects of DPP-4 inhibition: beyond GLP-1. Vascul. Pharmacol. 55, 10-16 (2011).

114. J. F. Todd, B. S. R., Incretins and other peptides in the treatment of diabetes. Diabet. Med. 24, 223-232 (2007).

115. M. B. Davidson, G. Bate, P. Kirkpatrick, Exenatide. Nat. Rev. Discov. 4, 713-714 (2005).

116. L. L. Nielsen, A. A. Young, D. G. Parkes, Pharmacology of exenatide (synthetic exendin-4): a potential therapeutic for improved glycemic control of type 2 diabetes. Regul. Pept. 117, 77-88 (2003).

117. K. Matyjaszewski, Atom transfer radical polymerization (ATRP): current status and future perspectives. Macromolecules 45, 4015-4039 (2012).

118. W. Jakubowski, K. Matyjaszewski, Activators regenerated by electron transfer for atom-transfer radical polymerization of (meth)acrylates and related block copolymers. Angew. Chem. Int. Ed. 45, 4482-4486 (2006).

119. W. M. Jakubowski, K.; Matyjaszewski, K., Macromolecules, 39-45 (2006).

120. Y.-D. Liao, J.-C. Jeng, C.-F. Wang, S.-C. Wang, S.-T. Chang, Removal of N- terminal methionine from recombinant proteins by engineered E. coli methionine aminopeptidase. Prot. Sci. 13, 1802-1810 (2004).

119

121. J. R. McDaniel, J. A. Mackay, F. G. Quiroz, A. Chilkoti, Recursive directional ligation by plasmid reconstruction allows rapid and seamless cloning of oligomeric genes. Biomacromolecules 11, 944-952 (2010).

122. D. J. Drucker, M. A. Nauck, The incretin system: glucagon-like peptide-1 receptor agonists and dipeptidyl peptidase-4 inhibitors in type 2 diabetes. Lancet 368, 1696-1705 (2006).

123. L. L. Baggio, Q. L. Huang, T. J. Brown, D. J. Drucker, A recombinant human glucagon-like peptide (GLP)-1- albumin protein (Albugon) mimics peptidergic activation of GLP-1 receptor-dependent pathways coupled with satiety, gastrointestinal motility, and glucose homeostasis. Diabetes 53, 2492-2500 (2004).

124. S. Goutelle, M. Maurin, F. Rougier, X. Barbaut, L. Bourguignon, M. Ducher, P. Maire, The Hill equation: a review of its capabilities in pharmacological modelling. Fundam. Clin. Pharmacol. 22, 633-648 (2008).

125. R. S. Surwit, C. M. Kuhn, C. Cochrane, J. A. McCubbin, M. N. Feinglos, Diet- induced type II diabetes in C57BL/6J mice. Diabetes 37, 1163-1167 (1988).

126. M. S. Winzell, B. Ahren, The high-fat diet-fed mouse: a model for studying mechanisms and treatment of impaired glucose tolerance and type 2 diabetes. Diabetes 53, S215-S219 (2004).

127. R. Goke, H.-C. Fehmann, T. Linn, H. Schmidt, M. Krause, J. Eng, B. Goke, Exendin-4 is a high potency agonis and truncated exendin-(9-39)-amide an antagonist at the glucagon-like peptide 1-(7-36)-amide receptor of insulin- secreting b-cells. J. Biol. Chem. 268, 19650-19655 (1993).

128. C. M. Mack, C. X. Moore, C. M. Jodka, S. Bhavsar, J. K. Wilson, J. A. Hoyt, J. L. Roan, J. L. Vu, K. D. Laugero, D. G. Parkes, A. A. Young, Antiobesity action of peripheral exenatide (exendin-4) in rodents: effects on food intake, body weight, metabolic status and side-effect measures. Int. J. Obes. 30, 1332-1340 (2006).

120

129. S. E. Kanoski, L. W. Rupperecht, S. M. Fortin, B. C. De Jonghe, M. R. Hayes, The role of nausea in food intake and body weight suppression by peripheral GLP-1 receptor agonists, exendin-4 and liraglutide. Neuropharmacology 62, 1916-1927 (2012).

130. A. W. Richter, E. Akerblom, Antibodies against polyethylene glycol produced in animals by immunization with monomethoxy polyethylene glycol modified proteins. Int. Arch. Allergy Appl. Immunol. 70, 124-131 (1983).

131. Q. Yang, S. K. Lai, Anti-PEG immunity: emergence, characteristics, and unaddressed questions. WIREs Nanomed. Nanobiotechnol. 7, 655-677 (2015).

132. A. W. Richter, E. Akerblom, Polyethylene glycol reactive antibodies in man: titer distribution in allergic patients treated with monomethoxy polyethylene glycol modified allergens or placebo, and in healthy blood donors. Int. Arch. Allergy Appl. Immunol. 74, 36-39 (1984).

133. R. P. Garay, R. El-Gewely, J. K. Armstrong, G. Garratty, P. Richette, Antibodies against polyethylene glycol in healthy subjects and in patients treated with PEG- conjugated agents. Expert Opinion. Drug Deliv. 9, 1319-1323 (2012).

134. Y. Pang, J. Liu, Y. Qi, X. Li, A. Chilkoti, A modular method for the high-yield synthesis of site-specific protein–polymer therapeutics. Angew. Chem. Int. Ed., (2016).

135. M. G. P. Saifer, L. D. Williams, M. A. Sobczyk, S. J. Michaels, M. R. Shermin, Selectivity of binding of PEGs and PEG-like oligomers to anti-PEG antibodies induced by methoxyPEG-proteins. Mol. Immunol. 57, 236-246 (2014).

136. M. R. Sherman, L. D. Williams, M. A. Sobczyk, S. J. Michaels, M. G. P. Saifer, Role of the methoxy group in immune responses to mPEG-protein conjugates. Bioconjugate Chem. 23, 485-499 (2012).

121

Biography

Yizhi (Stacey) Qi was born on May 27, 1988 in Yixing, Jiangsu, P.R. China. She graduated magna cum laude from Case Western Reserve University in December of 2009, with a B.S. in Biomedical Engineering (BME) and a minor in Japanese. At CASE, Stacey worked in the laboratory of Dr. Anirban Sen Gupta on the development of polymeric micelle formulations of photosensitizers for photodynamic therapy of cancer.

In 2010, Stacey joined the laboratory of Dr. Ashutosh Chilkoti in the Department of Biomedical Engineering at Duke University to begin her graduate study. Her research focused on developing a generally applicable polymer conjugation technology that improves upon the current “gold standard” PEGylation technology, and implementing it with the peptide therapeutic, exendin-4, for type 2 diabetes therapy. En route to a

Ph.D., Stacey received an M.S. in BME in May of 2013. During her time at Duke, Stacey was a James B. Duke fellow (2010-2014) and a Lewis Siegel fellow at the Center for

Biomolecular and Tissue Engineering (CBTE, 2011-2013). She was presented with two poster awards at the BME departmental retreat and CBTE annual Kewaunee event in

2013 and the CBTE student service award in 2014. In the summer of 2014, Stacey also received a RISE Professional fellowship from the German Academic Exchange Services

(DAAD) to do a three-month internship at BASF in Ludwigshafen, Germany.

Stacey’s work at Duke helped secure several translational grants, produce two patent applications and the following publications:

122

1. Y. Qi, A. Simakova, X. Li, N. J. Ganson, K. M. Luginbuhl, I. Özer, W. Liu, M. S. Hershfield, K. Matyjaszewski, A. Chilkoti, A brush-polymer conjugate of exendin-4 reduces blood glucose for up to five days and eliminates poly(ethylene glycol) antigenicity. Nat. Biomed. Eng. Accepted (2017).

2. Y. Pang*, J. Liu*, Y. Qi*, X. Li, A. Chilkoti, A modular method for the high-yield synthesis of site-specific protein–polymer therapeutics. Angew. Chem. Int. Ed., DOI: 10.1002/ange.201604661 (2016). *Contributed equally, VIP paper.

3. Y. Qi, M. Amiram, W. Gao, D. G. McCafferty, A. Chilkoti, Sortase-catalyzed initiator attachment enables high yield growth of a stealth polymer from the C terminus of a protein. Macromol. Rapid Commun. 34, 1256-1260 (2013).

4. Y. Qi, A. Chilkoti, Protein–polymer conjugation—moving beyond PEGylation. Curr. Opin. Chem. Biol. 28, 181-193 (2015).

5. Y. Qi, A. Chilkoti, Growing polymers from peptides and proteins: a biomedical perspective. Polym. Chem. 5, 266-276 (2014).

6. S. Bhattacharjee, W. Liu, W.-H. Wang, I. Weitzhandler, X. Li, Y. Qi, J. Liu, Y. Pang, D. F. Hunt, A. Chilkoti, Site-specific zwitterionic polymer conjugates of a protein have long plasma circulation. ChemBioChem 16, 2451-2455 (2015).

7. J. Liu, W. Liu, I. Weitzhandler, J. Bhattacharyya, X. Li, J. Wang, Y. Qi, S. Bhattacharjee, A. Chilkoti, Ring-opening polymerization of prodrugs: a versatile approach to prepare well-defined drug-loaded nanoparticles. Angew. Chem. Int. Ed. 54, 1002-1006 (2014).

123