Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST-CNRS

Case Report Section

A first case of adult secondary acute myeloid leukemia with the recurrent KMT2A-GAS7 fusion Hend Chaker, Josée Héber Quebec Leukemia Cell Bank, Hôpital Maisonneuve-Rosemont, Montréal, Canada. Department of Medicine, Université de Montréal, Montréal, Canada. [email protected] [email protected]

Published in Atlas Database: April 2018

Online updated version : http://AtlasGeneticsOncology.org/Reports/t1117q23p13ChakerID100096.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70486/04-2018-t1117q23p13ChakerID100096.pdf DOI: 10.4267/2042/70486 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2019 Atlas of Genetics and Cytogenetics in Oncology and Haematology Abstract Cyto-Pathology Case report on a first case of adult secondary acute Classification myeloid leukemia with the recurrent KMT2A-GAS7 fusion. Phenotype Acute myeloid leukaemia, not otherwise specified Clinics (WHO 2008). Immunophenotype Age and sex HLADR: 20%, CD117: 93%, CD34: 10%, CD33: 71 years old at diagnosis of acute myeloid leukemia 50%, CD13: 95%, CD36: 30%, CD56: 13%, CD14: (AML) in December 2006.male patient. 6%, CD15: 7%, CD7: 21%, CD3: 2%, CD10: 3%, Previous history CD19: 0%, CD20: 6%. Preleukemia Chronic myeloproliferative neoplasm : Primary myelofibrosis was diagnosed in 2005. The Survival patient was treated with Hydroxyurea from January 2005 to March 2007; no previous malignancy; no Date of diagnosis inborn condition of note 12-2006 Organomegaly Treatment Hepatomegaly , splenomegaly , no enlarged lymph Palliative care: treatment with Hydroxyurea nodes , no central nervous system involvement Complete remission: no Treatment related death: no Blood Status Dead WBC: 32.4 X 109/l Last follow up HB: Not available 03-2007 Platelets: Not available Survival Blasts: 70% 3months Bone marrow: Not performed

Atlas Genet Cytogenet Oncol Haematol. 2019; 23(8) 246 A first case of adult secondary acute myeloid leukemia with Chaker H, Hébert J the recurrent KMT2A-GAS7 fusion

Karyotype Sample: Blood Culture time: 24-48 (unstimulated 24h and 48h cultures) Banding: GTG Results 46,XY,t(11;17)(q23;p13)[21]

Other molecular cytogenetics technics FISH (Fluorescent In Situ Hybridization); VYSIS Figure. 2. Fluorescence in situ hybridization (FISH) LSI MLL Dual-color, Break-apart rearrangement analysis of the t(11;17) positive cells. (A) FISH with the probe (Abbott Molecular Inc., Des Plaines, IL). BAC LSI MLL dual-color, break-apart rearrangement probe showing the MLL rearrangement. The fusion signal is (Bacterial artificial ) probe RP11- located on the normal chromosome 11, the green signal, 952P13 covering the GAS7 centromeric part of the probe, is detected on the derivative (http://genome.ucsc.edu) chromosome der(11) and the red signal, telomeric part of the probe, is detected on the derivative chromosome Other molecular cytogenetics results der(17). (B) FISH with RP11-952P13 probe showing FISH experiments were performed on metaphasic rearrangement of GAS7. A normal signal is detected on and interphasic cells with the commercial MLL , and a split signal is visualized on both derivative der(17) and der(11). probe. Analysis showed a KMT2A/MLL rearrangement in 98% of 200 interphasic nuclei and confirmed the t(11;17) translocation (Figure 2A). FISH analysis with the RP11-952P13 BAC probe revealed a GAS7 rearrangement. Hybridization signals on metaphasic chromosomes were detected on normal chromosome 17 and on derivative chromosomes 11 and 17 (Figure 2B). Other Molecular Studies Technics: RNA extraction, RT-PCR and standard sequencing Primers: -KMT2A forward primer:

5'ACCACTCCTAGTGAGCCCAAGAAA 3' Figure. 3. Analysis of the KMT2A-GAS7 transcripts. (A) located in KMT2A exon 7 PCR products obtained by Reverse-Transcriptase -GAS7 reverse primer: Polymerase Chain Reaction (RT-PCR). M, 1Kb DNA 3'TGGTCTCATTGGTGGTCGTGTTGA5' located marker; lane 1, KMT2A/MLL-GAS7 cDNA fragments generated by KMT2A-FW-exon7 and GAS7-RV-exon2-3 in GAS7 exon 2-3. primers. Arrows indicate the two 300bp and 220bp amplified KMT2A-GAS7 transcripts. (B) Chromatogram showing partial nucleotide sequences of the two KMT2A- GAS7 transcripts. The arrows indicate the breakpoints of the KMT2A/MLL-GAS7 fusion. Results: Two KMT2A-GAS7 fusion transcripts were detected (Figure 3A). Sequence analysis of these transcripts revealed an in-frame fusion between KMT2A exon 8 and GAS7 exon 2 for the predominant transcript (transcript 1), and KMT2A exon 7 and GAS7 exon 2 for the second transcript (transcript 2) (Figure 3B).

Other Findings Figure 1. GTG-banded Karyotype. GTG-banded The t(11;17)(q23;p13) translocation generates a karyotype of leukemic cells showing the t(11;17)(q23;p13) translocation. Arrows indicate the derivative chromosomes KMT2A/MLL-GAS7 in-frame fusion transcript der(11) and der(17). which encodes a putative chimeric .

Atlas Genet Cytogenet Oncol Haematol. 2019; 23(8) 247

A first case of adult secondary acute myeloid leukemia with Chaker H, Hébert J the recurrent KMT2A-GAS7 fusion

Figure 4. Schematic representation of KMT2A, GAS7 and the predicted KMT2A-GAS7 fusion . The predicted KMT2A-GAS7 chimeric protein contains AT-Hook domains (ATH1-3), speckled nuclear localization1,2 (SNL1,2) and DNA methyltransferase (MT) domains followed by full-length GAS7 containing WW domain and F-bar dimerization module with FCH domain and Coiled coil region. Abbreviations: SET (Su(var)3-9, Enhancer-of-zeste, Trithorax) domain with histone H3K4 methyltransferase activity, FCH: FER-CIP4 Homology . The N-terminal region of the KMT2A protein died 3 months after the diagnosis of AML. including the AT-hooks, speckled nuclear This specimen was sequenced (RNA sequencing) as localization signals 1 and 2 motifs, and DNA part of the Leucegene project (Nature Genet 2015). methyltransferase domains, is fused to almost the entire GAS7 protein, containing WW domain and F- References bar dimerization module with a FER-CIP4 Chessells JM, Harrison CJ, Kempski H, Webb DK, Homology (FCH) domain and a coiled coil region Wheatley K, Hann IM, Stevens RF, Harrison G, Gibson BE. domain (Figure 4). The predicted GAS7 domains are Clinical features, cytogenetics and outcome in acute based on NCBI search for conserved domains within lymphoblastic and myeloid leukaemia of infancy: report from coding nucleotide sequences. the MRC Childhood Leukaemia working party. Leukemia. 2002 May;16(5):776-84 (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi). Lavallée VP, Baccelli I, Krosl J, Wilhelm B, Barabé F, Gendron P, Boucher G, Lemieux S, Marinier A, Meloche S, Hébert J, Sauvageau G. The transcriptomic landscape and Comments directed chemical interrogation of MLL-rearranged acute myeloid leukemias. Nat Genet. 2015 Sep;47(9):1030-7 This case represents the first case of adult leukemia associated to the KMT2A-GAS7 fusion. GAS7 is a Megonigal MD, Cheung NK, Rappaport EF, Nowell PC, Wilson RB, Jones DH, Addya K, Leonard DG, Kushner BH, rare recurrent fusion partner of KMT2A. To our Williams TM, Lange BJ, Felix CA. Detection of leukemia- knowledge, only two cases with this fusion have associated MLL-GAS7 translocation early during been reported in the literature, in pediatric and infant chemotherapy with DNA topoisomerase II inhibitors. Proc leukemias. The first case was identified in a 14-year- Natl Acad Sci U S A. 2000 Mar 14;97(6):2814-9 old boy with a therapy-related AML, after DNA Panagopoulos I, Lilljebjörn H, Strömbeck B, Hjorth L, topoisomerase II inhibitor treatment for a Olofsson T, Johansson B. MLL/GAS7 fusion in a pediatric neuroblastoma. The patient died 4 months after case of t(11;17)(q23;p13)-positive precursor B-cell acute lymphoblastic leukemia. Haematologica. 2006 diagnosis (Megonigal MD et al, 2000). The second Sep;91(9):1287-8 case was identified in a 15-month-old girl with a de Stark B, Vogel R, Cohen IJ, Umiel T, Mammon Z, Rechavi novo B-cell acute lymphoblastic leukemia. This G, Kaplinsky C, Potaznik D, Dvir A, Yaniv Y. Biologic and patient was in remission 14 months after diagnosis cytogenetic characteristics of leukemia in infants. Cancer. (Panagopoulos I et al, 2006). Additionally, the 1989 Jan 1;63(1):117-25 translocation t(11;17)(q23;p13) was reported, without molecular characterization, in few studies This article should be referenced as such: (Chessells JM et al, 2002 and Stark B et al, 1989). Chaker H, Hébert J. A first case of adult secondary acute The adult patient described here was treated with a myeloid leukemia with the recurrent KMT2A-GAS7 fusion.. Atlas Genet Cytogenet Oncol Haematol. 2019; palliative approach because of comorbidities and he 23(8):246-248.

Atlas Genet Cytogenet Oncol Haematol. 2019; 23(8) 248