Novel Blocked-Cleavable Primers for Quantitative Detection of Nucleic Acid Sequences Using Rhpcr

Novel Blocked-Cleavable Primers for Quantitative Detection of Nucleic Acid Sequences Using rhPCR

Integrated DNA Technologies (IDT) has developed a novel method for the detection of nucleic acid sequences in a complex sample that has improved specificity and decreased background compared to traditional approaches. The method employs a variant of the polymerase chain reaction (PCR) that uses 3’-end blocked primers which cannot prime DNA synthesis. A cleavable RNA linkage is positioned near the 3’ end of the primer. Following hybridization to a complementary sequence, the terminal blocking group is removed by action of a thermostable RNase H2 enzyme. Importantly, the RNase H2 enzyme, which is simply added as a component of the PCR master mix, functions in real time during PCR. The unblocking reaction is exquisitely sensitive to correct base pairing and requires that the primer be in duplex form. The unblocking step is inhibited by the presence of a base mismatch in the vicinity of the cleavage site. Through this mechanism, the blocked primers provide improved specificity when compared to unmodified primers, resulting in reduced mispriming and eliminating primer-dimer formation. This allows for a greater number of PCR cycles to be run, giving the potential for increased sensitivity. The method is called RNase H–dependent PCR (rhPCR) [1]. rhPCR can be performed in both end-point and real-time modes. The assay can be run using a fluorescent intercalating detection method such as SYBR® Green I, or as a 5’ nuclease (aka “TaqMan” or “PrimeTime”) fluorescent probe assay. The basic reaction scheme is outlined in Figure 1.

Blocked-cleavable primers prevent PCR R R RNase H2 primer cleavage

Rp OH OH

rhPCR can use

standard 2-step OH or 3-step cycling pR DNA polymerase extends newly unblocked primers

KEY: R Cleavable RNA in primers R Blocked-cleavable primers OH Unblocked (activated) primers pR Cleavage fragment with 5 phos

Figure 1. “rhPCR” Reaction Scheme. Novel Blocked-Cleavable Primers for Quantitative Detection of Nucleic Acid Sequences Using rhPCR

Elimination of primer dimers

While careful selection of priming sites often prevents primer dimer formation, it is sometimes necessary to position primers in unfavorable locations and primer dimers can be a significant problem. An HCV amplicon was described that employed primers optimized to amplify viral nucleic acids across a broad spectrum of serotypes which was compromised by the formation of multiple primer dimer species (see Roche patent US06001611). Short primer dimer species dominated the reaction, effectively excluding amplification of the desired longer HCV product. This HCV system was employed to demon- strate the ability of rhPCR to eliminate primer-dimers. Amplification products made using HCV primers in PCR vs. rhPCR were visualized by gel electrophoresis. Standard PCR resulted mostly in formation of useless primer dimer products while rhPCR eliminated this problem and only the desired 242 bp HCV amplicon was seen. Results are shown in Figure 2 below. Working via a similar mechanism, blocked-cleavable primers can also reduce primer cross-reactivity in highly multiplexed assays.

Unmodified Primers Blocked-cleavable primers ST280A For: GCAGAAAGCGTCTAGCCATGGCGTTA GCAGAAAGCGTCTAGCCATGGCGTTAgTATG-x ST778AA Rev: GCAAGCACCCTATCAGGCAGTACCACAA GCAAGCACCCTATCAGGCAGTACCACAAgGCCT-x

Figure 2. Elimination of Primer-Dimers in an HCV Assay Using rhPCR. U – unmodified primers; B – blocked-cleavable primers. CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group).

Improved Performance of Multiplex Reactions

As discussed above, primer-dimers can cause significant problems, even in non-multiplex amplification reactions, and can ruin a complex reaction. The effects of primer-dimers are magnified in multiplex PCR because undesired primer–primer -in teractions make it difficult to mix multiple primers together while retaining the performance achieved when each reaction is run individually. Primer-dimers result in the appearance of nonspecific amplification products and reduced efficiency of the desired amplification reactions because reaction components/substrates are consumed by short primer-dimer amplicons, which replicate at higher efficiency than longer amplicons. Use of blocked-cleavable primers in rhPCR can significantly improve multiplex reaction performance.

Figure 3 shows the development of a 15-plex PCR assay (using 30 primers) visualized by gel electrophoresis. Individual reactions are efficient, each producing the single desired amplification product, but the same primers fail when combined as a 15-plex reaction. The multiplex reaction was rescued by converting to blocked-cleavable primers and rhPCR.

2 Multiplex 15 Amplicons

Figure 3. Blocked-Cleavable Primers Improve Multiplex PCR Performance. A 15-amplicon PCR was run as (1) 15 individual reactions and pooled (control); (2) a 15-plex rhPCR using blocked-cleavable primers; and (3) a 15-plex PC using standard, unmodified primers. [Image courtesy of Jenn Jakubowski, Syzygy Biotech.]

Improved Specificity: Discriminating Closely-Related Genes

Human tumors are often grown in immune-deficit rodent systems as a routine part of oncology research. The human tumor mass becomes infiltrated with rodent fibroblasts and endothelial cells. Even though sequences differ between these xeno- geneic orthologs, cross reactivity can be a significant problem, and sometimes the researcher is unaware of this cross-reactivity problem.

As a demonstration of the improved specificity of the rhPCR method, standard primers for a known human HRAS SYBR Green qPCR assay were used in RT-qPCR (55 cycles) with either human or rat cDNA. Despite what appears to be relatively large differences in sequence between species at the priming sites, the human primers misprimed and generated a “false positive” signal in the rat cDNA (ΔCq = 11; Figure 4A). The same primer sequences were converted to the blocked-cleavable primer format and were used with the same target cDNA samples. Using rhPCR, a correct “true positive” signal was observed using human cDNA and no amplification was detected using rat cDNA in the 55-cycle reaction (Figure 4B).

Figure 4. Improved Specificity of rhPCR. (A) Human HRAS primers were used in a SYBR® Green RT-qPCR (55 cycle) using either human or rat cDNA. (B) Alignment of human HRAS primer sequences with rat Hras. CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group)

3 Novel Blocked-Cleavable Primers for Quantitative Detection of Nucleic Acid Sequences Using rhPCR

Improved Specificity: SNP Detection

Single nucleotide polymorphisms (SNPs) are common and often correlate with important biological traits. The ability to accurately discriminate between different alleles is critical for modern diagnostics. A mismatch at or near the RNA base has a large effect on the ability of RNase H2 to cleave a blocked-cleavable primer and can be used as the basis for SNP discrimination. When designing the blocked-cleavable primer, position the SNP at the RNA base. Note that it is also important to know the location of any additional SNPs in your target gene to be sure that other polymorphisms, which can influence cleavage or priming efficiency (affect primer Tm), are not near the cleavage site.

As a demonstration of the improved SNP discrimination of the rhPCR method, primers specific for a known human SNP (rs4939827 in the SMAD7 gene) were used in a SYBR Green qPCR assay. Reactions were run for 45 cycles using 2 ng human genomic DNA homozygous “TT” or “CC” at this locus and either unmodified, traditional allele-specific PCR primers or blocked-cleavable rhPCR primers. Standard allele-specific primers resulted in mismatch discrimination of <2.0 cycles. Using the blocked-cleavable primers, discrimination of the rU:G (black curves) and rC:A (blue curves) mismatches were 12.6 and 12.1 cycles, respectively (Figure 5).

Allele-Specific PCR Primers Blocked-Cleavable Primers C-For: CAGCCTCATCCAAAAGAGGAAAC CAGCCTCATCCAAAAGAGGAAAcAGGA-x T-For: CAGCCTCATCCAAAAGAGGAAAT CAGCCTCATCCAAAAGAGGAAAuAGGA-x Rev: CTCACTCTAAACCCCAGCATT CTCACTCTAAACCCCAGCATTgTCTG-x

Where CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group); position of the SNP is underlined.

Figure 5. SNP Detection Using rhPCR. The data show greater discrimination of SNPs by blocked-cleavable primers.

4 As a further example of the utility of rhPCR in SNP discrimination, 31 different human genomic DNA samples from the Coriell repository were studied using the rs4939827/SMAD7 assay described in Figure 4. PCR was performed in real-time (45 cycles) and end-point (35 cycles) formats. In every case, the correct genotype (homozygous T/T, heterozygous T/C or homozygous C/C) was easily called (Figure 6).

A. B.

Figure 6. Real-Time and End-Point rhPCR Analysis of 31 Human Genomic DNA Samples at the rs4939827/SMAD7 Locus. (A). Cq values. (B) Fluorescence intensities.

Rare Allele Detection rhPCR is a form of “biased amplification”, which can be used for rare allele detection, one of the most demanding applications for PCR. An rhPCR SYBR Green qPCR assay was designed for the rs4939827 SNP in the SMAD7 gene (see Figures 4–6 above). Non-discriminatory, standard PCR primers were used for the control reactions. Allele detection was performed using rhPCR with new GEN2 blocked-cleavable primers (which show slightly improved SNP discrimination over the original GEN1 primer design).

A standard curve for quantification was made using known amounts of “C” allele DNA. For rare allele detection, genomic DNA representing 66,000 copies of the “T” allele was present in all reactions and 0, 6 (1:10,000), or 66 (1:1000) copies of “C” allele genomic DNA was spiked into each reaction mix. PCR and rhPCR were performed.

Using rhPCR, the presence of the “C” allele was easily detected when spiked into a background of competing “T” allele DNA at a 1:1000 ratio (ΔCq = 8).

Using rhPCR, the presence of the “C” allele was distinguished when spiked into a background of competing “T” allele DNA at a 1:10,000 ratio (ΔCq = 3).

Complete results are shown below in Table 1.

Copies of “T” Allele 0 0 0 66000 66000 66000 Copies of “C” Allele 66 6 0 66 6 0

Control PCR* (Cq) 32.2 35.9 >40 21.1 21.2 21.0

† C-Allele–Specific rhPCR (Cq) 31.4 34.6 >40 31.9 34.8 37.9

* Control PCR Primers † Blocked-Cleavable Primers rs4939827 For: CAGCCTCATCCAAAAGAGGAAA For rC: CAGCCTCATCCAAAAGAGGAAAcAxxA rs4939827 Rev: CTCACTCTAAACCCCAGCATT Rev : CTCACTCTAAACCCCAGCATT

Table 1. Rare Allele Detection Using rhPCR. CAGT = DNA, cagu = RNA, and x = C3 spacer (blocking group)

5 Novel Blocked-Cleavable Primers for Quantitative Detection of Nucleic Acid Sequences Using rhPCR

Designing Blocked-Cleavable Primers

IDT is continuing to develop new applications for rhPCR and make improvements to protocols and primer design. The cur- rent best practice of rhPCR involves two different designs of blocked-cleavable primers, GEN1 and GEN2. Different primer designs are recommended for different applications. GEN2 primers show higher specificity, but are slightly more expensive and require use of higher RNase H2 enzyme concentrations; therefore, in general, IDT recommends their use primarily for applications where the added specificity they confer is necessary (Table 2). The basic designs for GEN1 and GEN2 primers are shown in Figures 7 and 8.

GEN1 Blocked-Cleavable Primers GEN2 Blocked-Cleavable Primers Improving specificity of routine PCR Rare-allele detection Genotyping Multiplex reactions: 10–~100+ amplicons Reducing primer-dimer formation Multiplex reactions: 2–20 amplicons

Table 2. Recommended Uses for Specific Designs of Blocked-Cleavable Primers.

Figure 7. Design of GEN1 Blocked-Cleavable Primers.

Figure 8. Design of GEN2 Blocked-Cleavable Primers.

6 Summary: Key Features of the rhPCR Assay

• The assay uses two synthetic oligonucleotides, blocked-cleavable forward (“For”) and reverse (“Rev”) primers. • The assay uses two enzymes, a thermostable DNA polymerase and a thermostable RNase H2 (available from IDT at www.idtdna.com/order/kits.aspx?type=rnaseh2). • The assay can be performed in either end-point or real-time modes. • The assay is quantitative when run in real-time format. • Primers are non-functional prior to unblocking by RNase H2. • Unblocking is achieved via cleavage at a single RNA residue placed near the 3’ end of the primer. Cleavage removes the blocking group leaving a 3’-OH, resulting in a species capable of priming DNA synthesis. • PCR amplification does not begin until primer unblocking occurs, which is mediated by a thermostable enzyme at elevated temperature. The thermostable RNase H2 enzyme has minimal activity at room temperature, automatically conferring a “hot start” character to the reaction and eliminating the need for a “hot start” DNA polymerase. • Cleavage is sensitive to match/mismatch resulting in very high specificity for base sequence in this region. Accuracy is suitable for use in SNP discrimination and is superior to standard allele-specific PCR. • The assay is fully compatible with SYBR Green I dye or 5’ nuclease detection methods. • Applications/benefits of rhPCR èè Eliminate primer-dimer artifacts èè Improve performance of multiplex reactions èè Eliminate cross reactivity and amplification of related genes èè SNP discrimination èè Rare allele detection

References

1. Dobosy JR, Rose SD, et al. (2011) RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers. BMC Biotechnol, 11:80.