Functional Characterization of Magnaporthe Oryzae Effectors in the Infective Process of Rice Thesis Presented in Partial Fulfil

Home , Magnaporthaceae, Magnaporthe, Pyricularia

Functional Characterization of Magnaporthe oryzae Effectors in the Infective

Process of Rice

Thesis

Presented in Partial Fulfillment of the Requirement for the Degree Master of Science in

the Graduate School of The Ohio State University

Oscar Burbano-Figueroa, B.Sc.

Graduate Program in Plant Pathology

The Ohio State University

2011

Thesis Committee:

Dr. Thomas Mitchell, Advisor

Dr. Anne E. Dorrance

Dr. Guo-Liang Wang Copyright by

Oscar Burbano-Figueroa

2011 ABSTRACT

Rice is one of the three most important food crops of the world with an increasing worldwide production during the last decade. One of the major constraints in rice production is rice blast disease caused by the fungus Magnaporthe oryzae. During the last decade, the genomic sequence of rice and this pathogen were completed allowing the computational prediction of genes. The bio-molecular function of these predicted genes are largely unknown. M. oryzae genes MGG00194 and MGG03356 were identified as putative effectors of host defense using a protoplast transient expression system.

Effectors are predicted to be secreted in the Blast Interfatial Complex in a specific spatiotemporal pattern, secreted during the development of the invasive hyphae or at least during the late stage of appresorium formation and penetration prior to interfacing with the plant cell. Consequently, the aim of this work was to determine how the putative effectors MGG_00194 and MGG_03356 are involved in the pathogenic process using in- planta secretion and functional analysis. M. oryzae strains that were transformed to constitutively express these genes were obtained and the effect of this condition on vegetative growth and pathogenicity was evaluated. Our results suggest that overexpression of MGG_03356 allows the pathogen to evade the host hypersensitive response possibly via degradation of pectin in the cell wall and consequently decreasing the mechanical sensing of the pathogen. Fluorescent expression patterns of these genes using GFP-tagged proteins in transformant strains were obtained in specific pathogen

ii race-cultivar/species interactions. Even when two different strategies for homologous recombination were used, no deletion mutants were obtained.

iii Dedication

Dedicated to Maria del Carmen Figueroa, for her love and patience during all these years

" Handeln ist leicht, Denken ist schwer, nach dem Gedanken handeln unbequem"

— Johann Wolfgang von Goethe

iv ACKNOWLEDGEMENTS

I wish to thank my advisor, Dr. Thomas Mitchell, for giving me the opportunity, intellectual support, encouragement and freedom for working in my thesis during the last two years.

I am very grateful to Dr. Anne Dorrance and Dr. Guo-Liang Wang, members of my Academic Committee, for his constructive critics during the development of my research and writing of this manuscript.

I wish to thank my friends in Columbus and Athens for the unforgettable moments: Yuki, Sara, Marcela, Wanda, Aneta, Carola, Fiorela, Huaso, Jesus, Evelyn, Gautam, Norman, Fernanda, Amy, Veronica, Maria, Nun, Chan Ho. Thanks to Gautam, Nun and Chan Ho for their invaluable help, encourage and discussion during the development of my experiments.

I would like to thank my family for all of their love and faith: Jazmin, Paola, Milena, Javier, John, Diego, Julia, Carlos, Juan Carlos, Patricia, Jonathan, Marcos and my grandparents. Thanks to Milena for all the time we spent together during the nights of winter.

Finally, I like to thank to Fulbright-LASPAU and COLCIENCIAS for the financial and academic support during these years and Universidad de Nariño, the place where this adventure began. A special thank to Luz Stela Lagos Mora for her invaluable help and encouragement during the first beginning of this process.

v VITA

1994…………………………………Colegio Centro de Integracion Popular, Pasto, Nariño, Colombia

2004………………………………....B.Sc. Biology minor Microbiology Universidad de Nariño

2006…………………………………Assistant Researcher Empresa Metropolitana de Aseo, EMAS SA ESP

2006-2008…………………………..Teaching/Researcher Assistant Department of Biology, University of Nariño

2008-present…………………………Graduate Research Associate Department of Plant Pathology, The Ohio State University

FIELDS OF STUDY

Major Field: Plant Pathology

vi TABLE OF CONTENTS

ABSTRACT...... ii VITA ...... vi LIST OF TABLES ...... ix LIST OF FIGURES ...... x CHAPTER 1: Literature Review ...... 1 BACKGROUND ...... 1 Magnaporthe oryzae...... 2 Effectors...... 5 Defense responses of the plant...... 8 Mechanosensing capacity of the plant cell wall...... 11 LIST OF REFERENCES...... 15 CHAPTER 2: Functional characterization of Magnaporthe oryzae effectors in the infective process of rice ...... 22 INTRODUCTION ...... 22 MATERIALS AND METHODS ...... 25 Fungal strains, growth conditions and transformation...... 25 Plasmids and DNA manipulations...... 25 Assays for growth, sporulation, appresoria formation and plant infection...... 26 RESULTS AND DISCUSSION...... 27 M. oryzae transformation...... 27 Pathogenicity assays...... 28 Localization pattern...... 29 Knockout mutants...... 29 LIST OF REFERENCES...... 37 CHAPTER 3: Overexpression of MGG_03356 modifies virulence of Magnaporthe oryzae isolates...... 40 INTRODUCTION ...... 40 MATERIALS AND METHODS ...... 43 Fungal strains and transformation...... 43 Infection assays.)...... 43 RESULTS...... 45 DISCUSION ...... 47

vii LIST OF REFERENCES...... 63 BIBLIOGRAPHY...... 66 Appendix A: Magnaporthe oryzae strains and transformants ...... 75 Appendix B: Rice Leaf Sheath Assay...... 84 Appendix C: Distribution of Infection Stages for Overexpression and Native Expression of MGG_03356 in Different Host-Pathogen Interactions ...... 86 Appendix D: Distribution of Infection Stages for Overexpression and Native Expression of MGG_03356 in Different Host-Pathogen Interactions ...... 88 Appendix E: Evaluation of Pathogenicity of KJ201 and CHNOS Strains Expressing Constitutively MGG_03356 over Transgenic Rice Plants Expressing the Resistance Genes Pi2 and Pi9...... 93

viii LIST OF TABLES

Table 2.1. Number of transformant colonies obtained from multiple transformation experiments using multiple knockout constructs. Only filamentous colonies were included while abortive small hyg resistantant colonies not were included. The split marker method and single insert construct strategy were used for 70-15 and KJ201, while only the single insert strategy was used for Guy11-Δku80………………………………32

Table 2.2. Sporulation intensity rates (conidias / cm2 leaf surface) for KJ201 overexpression mutants in spray inoculation assays……………………………………..33

Table 3.1. Description of the virulence of the M. oryzae backgrounds over rice cultivars harboring different alleles for the Pi2/Pi9 locus. S: susceptible, R: resistant……………53

Table A.1. Description of all the M. oryzae backgrounds used in this research…………81

Table A. 2. Description of primers used for amplification of gene regions used for vector construction and transformants screening……………………………………….……….82

Table A.3. Sporulation rates for native and overexpression mutants MGG_03356 and wild types in V8 media at 5 days. No significant differences were observed………….…….83

Table A.4. Relative lesion area (lesion area / leaf lesion) for KJ201 overexpression mutants in whole plant assays……………………………………………………………83

Table E.5. Disease score of native and constitutive expression of MGG_03356 KJ201 and CHNOS on transgenic Pi2-Nipponbare and isogenic Pi2 plants. * denotes significant differences between the medians of experiments. Medium disease severity was calculated using at least 10 leaves after one week post-inoculation. Rating scale: 0 = asymptomatic, 1 = pinhead-sized brown specks; 2 = 1.5mm spots; 3= 2-3mm spots; 4= elliptical spots longer than 3mm; 5 = coalescing lesions………………………………………………...95

ix LIST OF FIGURES

Figure 1.1. The plant cell wall is a structural complex network of carbohydrates and proteins. This network has a continuum with the plasma membrane and the cytoskeleton. Pectin fibers are the main component of this matrix that allow communication between the structural components of the cell wall and diverse external/internal cytoplasmic proteins (Humphrey, Bonetta, and Goring 2007)………………………………………...14

Figure 2.1. Inoculation assay of KJ201 transformants constitutively expressing MGG_00194 and MGG_003356. Constitutive expression of the genes was under control of the ribosomal promoter 27 (P27). Cultivars with different levels of resistance were used. Nipponbare is the most susceptible cultivar and 75-1-127 exhibits a high resistance. A. Infected leafs. B. Relative lesion area for each interaction…………………………...34

Figure 2.2. Native expression of MGG_00194 fused with eGFP. A. Right panel, bright field images. Left panel, green fluorescent images. Representative images of independent transformants at different times post inoculation. B. Negative image of MGG_00194 expression. Fluorescent spots are associated to BIC structure and tips of hyphae. ap: appresorium, f: fluorescent spot………………………………………………………….36

Figure 3.1. Overexpression of MGG_03356 driven by P27 promoter in the M. oryzae strains CHNOS, PO6-6 and KJ201 . Left column, bright field images and green fluorescent images were merged. Middle column, green fluorescent images. Right column, autofluorescent and green fluorescent images were merged. cs, conidial septa……………………………………………………………………………………...53

Figure 3.2. Native expression of MGG_03356 in PO6-6 infecting Nipponbare A. 1st panel, bright field images and green fluorescent images were merged. Panel 2, green fluorescent images. Panel 3, autofluorescent and green fluorescent images were merged. B. Negative of MGG_03356 expression pattern. ap: appresorium, f: fluorescent spot associated to appresorium………………………………………………………………..54

Figure 3.3. Percentage distribution of infection stages for overexpression and native expression of MGG_03356 under different host-pathogen interactions. Rice cultivars used are the susceptible cultivar Nipponbare, and 2 resistant isogenic lines harboring different orthologous resistant genes in the locus Pi2/9: C101A51 harboring the resistant gene Pi2 and 75-1-127 harboring Pi9……………………………………………………55

x describes the constitutive (C) and native (N) condition of MGG_03356 expression. The last term describe the rice cultivar infected. For panels A to D, ROS production was detected using DAB. ROS production was detected in the stages 0, 6, 7 and 6’. A, stage 0 (SO) are showed for different interactions. B, stages 1 to 3 show scarce hyphal growth. Citoplasmic granulation is evident in S1, but ROS production is absent. Invasive hyphae in S2 and S3 do not have the characteristic globose appearance and contains cytoplasmic vacuoles. C, stages 4 to 6 describe different levels of growth. Massive growth is visible in the susceptible cultivar Nipponbare, being examples of compatible interactions D, stages 7 showing different levels of vesicular ROS. S7 KJ201 C Pi9 shows intense ROS vesiculation in primary infected cell and in neighboring colonized cells (stage 6’). The last two panels show intense vesiculation limited to the primary infected cell with different levels of growth. ap, appressorium; v, fungal vacuoles; ih, invasive hyphae; bv, brown vesicles. E. Aniline accumulation during infection of Pi2 plants by PO6-6 strains. ……………………………………………………………………………………………56

Figure 3.5. Structure of the gene MGG_03356 in Magnaporthe oryzae, M. poae and G. graminis………………………………………………………………………………….62

Figure A.1. Description of transformation constructs. A. Single insert construct. B. Split marker strategy. Primers direction: 5’ 3’. 3’ 5’. A and B were used in knockout transformations. C. Native and overexpression constructs. Hygromycin B gene under the control of ToxA promoter………………………………………………………………..78

Figure A.2. Description of primers location. A. MGG_00194. Length of the showed fragment 4456 bp. B. MGG_03356. Length of the showed fragment 4131 bp. Upstream and downstream regions showed are 1500 bp long. Primers localization and graphics were obtained using Pdraw (Acaclone software)………………………………………...79

Figure B.1. Leaf sheath assay protocol. A. Tip rack containing rice leaf sheaths inoculated with M. oryzae spores. B. Trimming of inoculated rice sheaths for microscopic observation (Mosquera-Cifuentes 2007)…………………………………………………85

Figure C.1. Percentage distribution of infection stages for overexpression and native expression of MGG_03356 under different host-pathogen interactions…………………87

Figure D.1. Drop inoculation assay of native and constitutive mutants expressing MGG_03356. No difference was observed between wild type strains and their respective native transformants. KJ201 on Nipponbare, and CHNOS on Nipponbare and Pi2 was able to cause expanding lesions. Circular brownish areas limited to the inoculated drop were characteristic of PO6-6 native transformants and CHNOS overexpression transformants infecting Nipponbare and Pi2 plants. KJ201 native and overexpression transformants on Pi2 and PO6-6 overexpression transformants on Nipponbare and Pi2 exhibit small dark punctual lesions. Wild type and native/overexpression transformants of all backgrounds showed small dark almost imperceptible lesions when they were infecting leaves of Pi9 cultivar. A. Images of infected leafs without staining showing lesions provoked by transformants expressing the gene MGG_03356 natively and

xi constitutively. B. Negative images of infected leafs. Three week old plants were used for drop inoculation assay (Berruyer et al. 2006)……………………………………………89

Figure D.2. Microscopy of drop inoculation assay. 4X bright field images of chlorophyll cleared rice leaves using alcoholic lactophenol. Lactophenol trypan blue was used for staining fungal structures. Mycelia and spores are visible in the interaction between KJ201 native transformants and Nipponbare…………………………………………….91

Figure E.1. Percentage of infection stages of KJ201 MGG_03356 overexpression mutants on transgenic Pi2-Nipponbare and isogenic Pi2 cultivars at 36 hpi…………….94

xii CHAPTER 1

Literature Review

BACKGROUND

Rice is one of the three most important food crops of the world and the main staple food for nearly a half of the world’s population (Von Braun 2007). Its production is concentrated in Asia (90%) in subsistence agriculture farms with the grain destined for local consumption and only 4% exported to international markets (Khush and

Toenniessen 1991). Fifty percent of the production area is located in China and India.

One of the main limitations in production is rice blast disease caused by the fungus

Magnaporthe oryzae. Annual rice losses caused by this fungus during 90’s had been estimated at 35% of the worldwide production (Oerke and Dehne 2004). In West Africa, the largest area of African production, this pathogen is the main constraint to production with yield losses ranging from 3-77%. The fungus is able to infect plants at all stages of growth and development in both upland and lowland rice production systems. Lowland rice produced in temperate and subtropical climates of Asia are highly susceptible to the pathogen, while tropical upland areas are susceptible only under irrigation (Nutsugah et al. 2008).

During the last decade, the genomic sequence of rice (Yu et al. 2002; Goff et al.

2002) and this pathogen (Dean et al. 2005) were completed allowing the computational identification of genes. Unfortunately, the biomolecular function of these predicted genes

1 are largely unknown. In the pathogen, some of these predicted genes are related to the infection process and, considering the economic value of this crop, it is important to elucidate their role in disease development and progression. Of special importance are genes involved in host associations called effectors.

Magnaporthe oryzae. Magnaporthe is a genus included in the family

Magnaporthacae. This family includes unitunicate, perithecial ascomycetes (Cannon and

Kirk 2007). Its taxonomic definition is obscure and there is not agreement in the genera included. The most recent edition of Dictionary of the Fungi includes 13 genera and 93 species (Kirk et al. 2008). Gaeumannomyces and Magnaporthe species are the most well- known and economically important members of this family (Talbot 2003; Freeman and

Ward 2004). One member of each one of these genera are considered fungal pathogenic models having considerable genetic and genomic information available, which include the necrotroph Gaeumannomyces graminis, the causal agent of take-all, the most devastating root disease of wheat worldwide; and the biotroph Magnaporthe oryzae

(anamorph: Pyricularia oryzae) which causes rice blast (Talbot 2003; Freeman and Ward

2004; Thongkantha et al. 2009)

M. oryzae belongs to the M. grisea species complex. This cryptic complex includes at least two biological species with a high degree of host specificity: M. oryzae associated to rice and local weeds common in farmer’s fields (Filippi and Prabhu 2001;

Urashima et al. 2004; Couch et al. 2005). M. grisea can associate with different cereals including wheat, rye, barley, and pearl millet (Couch and Kohn 2002) and is responsible of severe outbreaks on wheat in Brazil with yield losses over 50% (Viji et al. 2001;

Farman 2002; Strange and Scott 2005).

2 The infection cycle of Magnaporthe begins with the attachment of the conidiospore to the leaf surface, the spore germination or germinal tube formation and the formation of a specialized structure that allows the fungus to penetrate the plant cells, the appressorium (Tucker and Talbot 2001; Talbot 2003; Xu et al 2007). The germination tube is able to recognize hydrophobic surfaces (appressorium can be formed in non-host leaves and hydrophobic synthetic surfaces) and differentiate into appressorium (Gilbert et al 1996).This structure is able to produce high turgor pressure (~ 8MPa) used for pushing a small penetration peg in the appressorium base across the host cuticle and cell wall, entering the first cell (Ribot et al. 2008). Fungus recognition occurs in this cell accompanied by a series of collateral events: actin cytoskeleton reorganization (Xu et al

1998), vesicle movement and callose apposition (Kankanala et al 2007). Different levels of peroxide production are detected in the first infected cell even in compatible interactions. Resistant cultivar and incompatible interactions show rapid responses with high levels of peroxide production (Vergne et al. 2007). Inside the plant cell, the fungus develops a specialized globulous structure, the invasive hyphae, with a diameter (~5mm) more than two times that of the vegetative mycelia diameter (Staiger, and Hamer 1998;

Balhadère et al 1999; Urban et al 1999; Kankanala et al 2007).The first cell is completely colonized and in a matter of time using the plasmodesmata, the surrounding cells are infected. While these new infected cells are alive, the first cell at this moment is unable to plasmolize and consequently is considered dead (Ribot et al. 2008)

M. oryzae is a hemibiotrophic pathogen which uses living cells as a nutrient source. This ability is not dependent on previous penetration steps and is specific to compatible interactions between a pathogen strain and a susceptible cultivar. In fact, the

3 compatible interactions are hemibiotrophic, because as has been demonstrated in

Magnaporthe and other fungi, the fungus invades the cell biotrophically and later changes to a necrotrophic phase (Mosquera et al. 2009). During the biotrophic phase, the fungus is able to grow inside of the plant cytoplasm wrapped inside plant cell membrane.

Similar to other fungi, this specialized structure, invasive hyphae, is surrounded by the invaginated plant plasma membrane. In this two-membrane space, a suite of proteins are secreted which include effectors. How the fungus establishes itself inside the host cell without affecting that cell’s viability is still unknown. In other fungi, a specialized structure, the haustoria, is used during the biotrophic growth, but in the case of

Magnarpothe this structure is replaced by specialized hyphae. Although it has been demonstrated that the invasive hyphae secretes specific effectors during the biotrophic invasion, there is not a complete understanding or characterization of the molecular process involved in its development (Panstruga 2003; Perfect and Green 2001; Shan and

Goodwin 2004; Mendgen and Hahn 2002).

In the case of M. oryzae, four highly-expressed effectors, as well previously characterized efectors AVR-Pita1 and PWL, were detected on the invasive hyphae and the intermembranal space between the fungus and plant membrane (Mosquera et al. 2009).

Mosquera et al. show that MGG_11610.6 is related with cell wall crossing points and presumably involved in cell-to-cell movement using plasmodesmata. They also showed the remaining 3 effectors were secreted into the Blast Interfacial Complex (BIC), a structure containing complex lamella membranes and vesicles (Khang et al. 2008). A similar rearrangement of the membrane and a plant-nucleus migration has been reported for other biotrophic interactions (Shan and Goodwin 2004). AVR-Pita1 and PWL exhibit

4 a specific pattern being accumulated in BIC and within the fungus-plant interspace around the hyphal junction cells (Mosquera et al. 2009). In contrast, MGG_11610.6 synthesis is defined by multiple spots dispersed along the hyphae. This differentiation of patterns may be considered evidence of differentiation of function and the processes which these genes are involved. Recently, it was demonstrated that PWL2 and BAS1 were translocated into the cytoplasm of invaded rice cells and even across neighboring cells possibly via plasmodesmata (Khang et al. 2010). Fluorescent tagged versions of these proteins containing a nuclear localization signal were used to concentrate and magnify the signal. These proteins were concentrated in the host nucleus and were visible up to four cell lawyers away from the primary infected cell. This is evidence of an anticipation mechanism of host control by the pathogen prior to the physical invasion.

Effectors. Effectors are biologically defined as genic products able to produce a recognizable phenotype for the pathogen only when they interact with hosts (Hogenhout et al. 2009). Consequently, they are only functional in the interface with the host or inside the cell host. Under all other circumstances, allelic variants of their coding genes or differential levels of expression do not have an evident phenotypic effect on the pathogen

(Hogenhout et al. 2009; Dawkins 1999). Some effector genes have been identified through genomic mining based on the presence of a signal peptide and non-homologous resemblance to housekeeping genes (Kamoun 2007). This definition is a continuation of the extended phenotype concept proposed by Dawkins (Dawkins 1999), where some genes, “parasitic genes”, are able to exert genetic action at distance and manipulate the host. A specific observed extended-phenotype is the result of multiple gene interactions.

In plant pathology, the definition of effectors generally includes all pathogen proteins and

5 small molecules that alter host-cell structure and function (virulence factors, toxins, avirulence factors and elicitors) (Schneider and Collmer 2010). This definition is clear and unambiguous, without the contradictory definitions of virulence factors previously used to describe molecules involved in pathogenicity; it considers inherent variability associated to the pathogen (races and isolates), host (cultivars) and environmental factors.

An effector can be involved in infection (virulence factors or toxins) in a specific pathosystem or trigger a defense response (avirulence factor or elicitors) in a different host-pathogen model (Hogenhout et al. 2009).

A less inclusive definition of effectors for animal and plant pathosystems had been proposed. This definition does not include toxins as effectors. Toxins are able to exert their function when they are in contact with living cells while effectors need transport machinery to deliver them. This classification shows clearly other characteristic biochemical properties of these two kinds of molecules. Toxins have a single biochemical activity and a single cellular target (Galán 2009). An effector requires other factors or transport machinery to exert their function and usually is not indispensable and functionally redundant. From an action-mode point of view, effectors are able to manipulate the host cell maximizing the resources obtained from an interaction, while toxins conduct an irreversible destruction of the host cell (Alfano 2009). This last definition only considers virulence and avirulence factors as effectors.

The first bacterial and fungal avirulence factors/effectors were cloned more than two decades ago (Staskawicz et al 1984; van Kan et al 1991; De Witt et al. 2009) while oomycete Avr genes where only cloned during the last decade (Shan et al. 2004; Rairdan and Moffett 2007). Effectors of M. oryzae, Avr-Pita, Avr1-CO39, the PWL family and

6 ACE1, had been identified by map based cloning (De et al. 2009; Oliva et al. 2010). Avr-

Pita is an effector widely distributed in the M. grisea complex exhibiting high polymorphism related with various size deletion products, point mutations and transposon insertions (Zhou et al. 2007; Jia et al. 2009). The AVR1-CO39 gene is only present in M. oryzae, and is absent in most isolates that infect domesticated rice. This absent is caused by deletions and rearrangements associated with repetitive elements. It is assumed that this effector is envolved in pathogenicity of wild grass species (Tosa et al.

2005). PWL effectors are encoded by the Pwl (pathogenicity towards weeping lovegrass) gene family. These genes code for small glycine-rich secreted proteins that confer specific pathogenic activity on weeping lovegrass and finger millet, but not on rice (Kang et al. 1995; van der Does and Rep 2007). The ACE1 virulence factor is a hybrid enzyme with polyketide synthase and nonribosomal peptide synthetase activity (Bohnert et al.

2004). It is involved in the biosynthesis of a secondary metabolite with virulence activity.

ACE1 is expressed during the appressorium formation but its expression is not regulated by the signaling pathways related to this process (Fudal et al. 2007).

It was expected that the genome sequence of the first draft of M. oryzae should accelerate the discovery of new effectors considering that more than 25 resistant genes were discovered in rice based on similar genomic sequencing. However, only the resequencing of a field isolate, Ina168, and the establishment of PCR polymorphism- phenotypic associations allowed the discovery of three new effectors: Pex22, Pex31, and

Pex33. These effectors are small secreted proteins with approximately a hundred aminoacids (Yoshida et al. 2009).

Genomic sequencing of oomycetes and fungi has allowed the prediction of

7 hundreds of thousands of putative coding sequences. Some of these represent small proteins with an identifiable signal peptide, two characteristics considered typical of effectors. Additionally these genes do not have homology to basal metabolic

(housekeeping) genes (Hogenhout et al. 2009; Kamoun 2007). Effectors of oomycetes and apicomplexans, members of the kingdom Chromalveolate, contain an extra signal motif, RXLR or RxLxE/D/Q, which allows the effector to move from the apoplast to the host cytoplasm. No similar motif has been found in the fungi, or in any of the members of the Opisthokonta or Fungi/Metazoa kingdom (Haldar et al. 2006).

Defense responses of the plant. A pathogen must be able to overcome a complex multilevel system of defense developed over time by the plant. This multilevel system includes preformed barriers and induced defenses triggered by pathogen recognition

(Jones and Takemoto 2004; Chisholm et al. 2006). Preformed barriers include structural barriers such as the waxy cuticle and preformed antimicrobial compounds, as well as, secondary metabolites concentrated in the outer cell layers of plant organs. Some preformed antimicrobial compounds are produced in a constitutive manner and many of them are only activated during tissue damage or pathogens attack (Mansfield 1983).

These preformed constitutive compounds are called phytoanticipins while their inducible counterparts are called phytoalexins (Osbourn 1996; Morrissey and Osbourn 1999).

Constitutive plant compounds with reported antifungal activity include phenols and phenolic glycosides, unsaturated lactones, sulphur compounds, saponins, cyanogenic glycosides, glucosinolates, 5-alkylated resorcinols and dienes (Grayer and Kokubun

2001; García-Olmedo et al. 2001). Saponins, cyanogenic glycosides, and glucosinolates are the most studied (Osbourn 1996).

8 Induced defenses triggered by pathogen recognition include two levels: 1) recognition of pathogen structural components and 2) recognition of effector proteins

(Jones and Dangl 2006). Structural essential components of pathogens (and microbes) recognized by plants and animals are called pathogen-associated molecular patterns

(PAMPs) (Zipfel and Felix 2005). PAMPs include flagellin, lipopolysaccharides (LPS) and elongation factor Tu (EF-Tu) from Gram-negative bacteria and chitin, β-glucans and ergosterol from fungi (Ingle et al. 2006; Kunze et al. 2004). Different PAMPs are used to signal the same class of microbes in animal infection. PAMP recognition by cell-surface receptors induces PAMP-triggered immunity (PTI). PTI is considered the main mechanism of plant response during an unsuccessful infection by a non-adapted pathogen or a non-host resistance response (Mishina and Zeier 2007).

Evolution allows specific races within a pathogen species to overcome PTI. New aggressive pathogens can loose/acquire new molecules or modified preexisting ones that allowed them to evade or suppress plant defense. These new molecules were called virulence factors and later refered to as effectors (Abramovitch and Martin 2004; Alfano and Collmer 2004; Chang et al. 2004; Nuernberger and Lipka 2005). Plants populations have evolved against many of these virulent pathogen populations by producing plant resistance (R) genes which are able to recognize race-specific AVR factors or effectors

(Abramovitch and Martin 2004; Chang et al. 2004; Espinosa and Alfano 2004; D.A.

Jones and Takemoto 2004). This race/cultivar-specific resistance is the basis of the gene- for-gene hypothesis first proposed by (Flor 1971). This theory states that a host-pathogen interaction is determined by complementary recognition of pathogen Avr genes and plant resistance R genes (Gabriel and Rolfe 1990; Prell and Day 2001). This layer of defense

9 has been termed effector-triggered immunity (ETI), and involves direct or indirect recognition of pathogen-effector proteins by plant R proteins. Most plant R proteins contain conserved nucleotide binding site (NB) domains coupled to leucine-rich repeat

(LRR) domains (NB-LRR domains). These proteins confer resistance to a wide variety of pathogens and insects; and are associated to a HR (Rairdan and Moffett 2007). When the

Avr gene or R gene pair is missing the disease develops (Jones and Takemoto 2004). PAM non-host resistance and AVR-cultivar specific resistance are complementary defense mechanisms of plant innate immunity in coevolution with pathogen populations

(Espinosa and Alfano 2004; Nuernberger and Lipka 2005).

The concept of gene-for-gene interaction or its equivalent in effector terms: one pathogen effector-one host effector target model has recently been extended for the experimental view that a single effector may have multiple host targets usually involved in the plant defense response. This type has been called the operative effector targets

(OT) (van der Hoorn and Kamoun 2008). In a susceptible reaction, the interaction of the pathogen effector- host target results in the suppression of the defense response and allows the colonization of the host. Additionally in resistant plants, this interaction results in the hypersensitive response (Hogenhout et al. 2009). Recognition of this interaction can be directed via the effector or can be undirected via recognition of a manipulated effector target. If this target effector is involved in host defense, this recognition system is referred as the Guard Model (GM). However, if the effector target is a decoy designed for trapping the effector without a direct role in the defense response, it is called the Decoy

Model (DM). In the GM and DM, the expression of respective R gene and its effector target (guardee or decoy) are required for pathogen recognition. However, in absence of

10 the R gene, only in the GM the alteration of the effector target results in advantage for the pathogen while in the DM there is no advantage for the pathogen (van der Hoorn and

Kamoun 2008).

Mechanosensing capacity of the plant cell wall. The plant cell wall is a structural complex network of carbohydrates and proteins involved in different aspects of plant development. Defective mutants and drugs interfering in the production of cellulose, pectin, hemicellulose, lignin, or cell wall and cell surface proteins, facilitated the determination of roles for these cell wall compounds above their structure function

(Humphrey et al. 2007). Mutant physiology provides clues about a central regulatory network involved in monitoring and control of the performance and integrity of the cell wall (Somerville et al. 2004). Altered disease or abiotic stress response mutants contain mutations in genes involved in cell wall biosynthesis (Pilling and Höfte 2003), unexpected genetic interactions between different cell wall polymers (Bosca et al., 2006;

Diet et al., 2006; Gille et al., 2009) and nonadditive genetic interactions between cell wall defects and second site mutations in regulatory loci (Seifert et al., 2004; He´maty et al.,

2007; Xu et al., 2008; Hamann et al., 2009). Considering previous information obtained from the model organism Sacharomyces cerevisae, it is expected that plant cells are able to sense the cell wall polymer structure and the mechanical performance possibly via turgor pressure (Levin 2005). Integral membrane proteins activated by signals of this sensing mechanism may trigger a downstream activation of pathways related with other cellular functions and consequently interfering with them (Humphrey et al. 2010).

The cell wall is the first cellular contact point with most pathogens. Several experiments demonstrate great stimuli responsiveness. If an invasive pathogen can be

11 detected before its contact with the host-cytoplasm, its ingress can be anticipated, its invasion stopped and the cellular damage minimized (Seifert and Blaukopf 2010). For example, oligogalacturonides released by enzymatic degradation of the cell wall during a pathogen attack can trigger a defense response and usually the concomitant reaction is callose deposition (Casasoli et al. 2007; Field 2009). However this reaction can also be induced by the cellulose synthase inhibitor, dichlobenil (Nickle and Meinke 1998).

Considering these observations, callose deposition is a mechanism related with the sense of cell wall integrity, more than exclusively related with pathogen defense. In contrast, callose synthase defective mutants exhibit an increase in their pathogen resistance via salicylic-acid pathway activation and reduction in the papilla formation (Jacobs et al.

2003; Nishimura et al. 2003). Papilla are the result of callose deposition: a mix of (1-3)-

β-D-glucan, minor amounts of other polysaccharides, phenolic compounds, reactive oxygen intermediates, and proteins produced during a microbial attack, presumably a physical barrier against the pathogen (Jacobs et al. 2003). It was proposed that callose deposition is an induced response acting as a negative regulator controlling cell damage associated to the defense response. Environmental factors detected by the cell wall include wind, touch and gravity, resulting in elaborated responses such as thigmotropism, reaction formation and gravitropism (Humphrey et al. 2007).

This mechanosensing apparatus based on the cell wall is facilitated by elaborated networks in the cell wall-membrane-cytoplasm continuum (Braam 2005; Telewski 2006;

Kasprowicz et al. 2009). In mammals, the molecules involved in mechanosensing are the integrins. Integrins are connected to the extracellular matrix or neighboring cells, and inside the cell cytoplasm they are linked by actin and microtubules to the cytoskeleton

12 constituting an intercellular framework. Extracellular proteins containing the characteristic RGD (arg-gly-asp) motif are able to interact and activate integrins (Hynes

2002). However, despite the fact that fungi and plants do not have true mammalian integrin homologues (Kasprowicz et al. 2009), RGD peptides are able to induce different plant responses including the disruption of Hechtian strands (Mellersh and Heath 2001;

Humphrey et al 2007)1. The Hechtian strands are discrete bodies linking cell wall and plasma membrane associated to actin filaments and microtubules. It has been demonstrated that during a fungal infection, treatment with RGD peptides is able to decrease the defense responses allowing a successful fungal penetration and increasing the intracellular pathogen growth (Mellersh and Heath 2001). Pathogen effectors containing the RGD motif produce a similar effect. There is no evidence of how RGD proteins and their receptors in the plasma membrane are able to alter the mechanosensing function of the cell wall (Hématy et al. 2009).

There is proof of plasma membrane anchored kinases able to sense damage to the cell wall via their extracellular domain. These proteins are called wall associated kinases

(WAK) and belong to the RLK protein family (He, et al. 1996). WAK1 is one of these proteins. Its extracellular domain resembles the epidermal growth factor motif and this is covalently linked to the pectin fraction of the cell wall (Wagner and Kohorn 2001) where it binds to polygalacturonic acid (PGA) and (OGA) in a calcium-dependant manner

(Decreux and Messiaen 2005). WAK1 is highly expressed during pathogen infection and salicylic acid treatment. WAK22, homolog of WAK1, is able to confer broad spectrum

1 It is not known how integrity or mechanical differences in the plant cell wall might be perceived, nor is it currently known how signalling pathways leading to either stress responses or compensatory adjustments might be elicited. Taking cues from what has been learned in other systems, in particular Saccharomyces cerevisiae, the simplest explanation could be that some receptor or cell wall sensor could provide the primary signal which would feed into multiple signal transduction pathways.

13 resistance to Fusarium species (Diener and Ausubel 2005). Data support the idea that pectin integrity is monitored by a specific class of WAKs that is related to the plant defense response. In general terms, all the WAK-like proteins are highly similar in their cytoplasmic domain but differ in their receptor extracellular domain. Besides pectin, other WAKs are able to bind to glycine-rich proteins (Verica et al. 2003), influence plant development, with one of them, THE1, being involved in monitoring cellulose integrity

(Hématy et al. 2007). Other RLKs that differ from WAKs contain lectin extracellular- domains. There is some evidence that they are involved in cell wall monitoring during pathogen intrusion (Gouget et al. 2006; Diener and Ausubel 2005).

14 LIST OF REFERENCES

Abramovitch, R. B., and G. B. Martin. 2004. Strategies used by bacterial pathogens to suppress plant defenses. Current Opinion in Plant Biology 7, no. 4: 356-364. Alfano, J. R. 2009. Roadmap for future research on plant pathogen effectors. Molecular plant pathology 10, no. 6: 805-813. Alfano, J. R., and A. Collmer. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Phytopathology 42, no. 1: 385. Balhadère, P. V., A. J. Foster, and N. J. Talbot. 1999. Identification of pathogenicity mutants of the rice blast fungus Magnaporthe grisea by insertional mutagenesis. Molecular Plant-Microbe Interactions 12, no. 2: 129-142. Berruyer, R., S. Poussier, P. Kankanala, G. Mosquera, and B. Valent. 2006. Quantitative and qualitative influence of inoculation methods on in planta growth of rice blast fungus. Phytopathology 96, no. 4: 346-355. Bohnert, H. U., I. Fudal, W. Dioh, D. Tharreau, J. L. Notteghem, and M. H. Lebrun. 2004. A putative polyketide synthase/peptide synthetase from Magnaporthe grisea signals pathogen attack to resistant rice. The Plant Cell Online 16, no. 9: 2499. Braam, J. 2005. In touch: plant responses to mechanical stimuli. New Phytologist 165, no. 2: 373-389. Cannon, P. F., and P. M. Kirk. 2007. Fungal families of the world. CABI Publishing. Casasoli, M., I. Meliciani, F. Cervone, G. De Lorenzo, and B. Mattei. 2007. Oligogalacturonide-induced changes in the nuclear proteome of Arabidopsis thaliana. International Journal of Mass Spectrometry 268, no. 2-3: 277-283. Chang, J.H., A.K. Goel, S.R. Grant, and J.L. Dangl. 2004. Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Current opinion in microbiology 7, no. 1: 11-18. Chisholm, S. T., G. Coaker, B. Day, and B. J. Staskawicz. 2006. Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, no. 4: 803-814. Couch, B. C., I. Fudal, M. H. Lebrun, D. Tharreau, B. Valent, P. Van Kim, J. L. Nottéghem, and L. M. Kohn. 2005. Origins of host-specific populations of the blast pathogen Magnaporthe oryzae in crop domestication with subsequent expansion of pandemic clones on rice and weeds of rice. Genetics 170, no. 2: 613. Couch, B. C., and L. M. Kohn. 2002. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 94, no. 4: 683. Dawkins, R. 1999. The extended phenotype: The long reach of the gene. Oxford University Press, USA.

15 De, Wit, Jgm Pierre, R. Mehrabi, B. Van Den, A. Harrold, and I. Stergiopoulos. 2009. Fungal effector proteins: past, present and future. Molecular plant pathology 10, no. 6: 735-747. Dean, R. A., N. J. Talbot, D. J. Ebbole, M. L. Farman, T. K. Mitchell, M. J. Orbach, M. Thon, R. Kulkarni, J. R. Xu, and H. Pan. 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434, no. 7036: 980-986. Decreux, A., and J. Messiaen. 2005. Wall-associated kinase WAK1 interacts with cell wall pectins in a calcium-induced conformation. Plant and Cell Physiology 46, no. 2: 268. Diener, Andrew C, and Frederick M Ausubel. 2005. Resistance to Fusarium oxysporum1, a dominant Arabidopsis disease-resistance gene, is not race specific. Genetics 171, no. 1: 305. van der Does, H. C., and M. Rep. 2007. Virulence genes and the evolution of host specificity in plant-pathogenic fungi. Molecular Plant-Microbe Interactions 20, no. 10: 1175-1182. Espinosa, A., and J. R. Alfano. 2004. Disabling surveillance: bacterial type III secretion system effectors that suppress innate immunity. Cellular Microbiology 6, no. 11: 1027-1040. Farman, M. L. 2002. Pyricularia grisea isolates causing gray leaf spot on perennial ryegrass (Lolium perenne) in the United States: Relationship to P. grisea isolates from other host plants. Phytopathology 92, no. 3: 245-254. Field, R. A. 2009. Oligosaccharide Signalling Molecules. Plant-derived Natural Products: 349-359. Filippi, M. C., and A. S. Prabhu. 2001. Phenotypic virulence analysis of Pyricularia grisea isolates from Brazilian upland rice cultivars. Pesquisa Agropecuária Brasileira 36: 27-35. Flor, H. H. 1971. Current status of the gene-for-gene concept. Annual Review of Phytopathology 9, no. 1: 275-296. Freeman, J., and E. Ward. 2004. Gaeumannomyces graminis, the take all fungus and its relatives. Molecular Plant Pathology 5, no. 4: 235-252. Fudal, I., J. Collemare, H. U. Bohnert, D. Melayah, and M. H. Lebrun. 2007. Expression of Magnaporthe grisea avirulence gene ACE1 is connected to the initiation of appressorium-mediated penetration. Eukaryotic cell 6, no. 3: 546. Gabriel, D. W., and B. G. Rolfe. 1990. Working models of specific recognition in plant- microbe interactions. Annual Review of Phytopathology 28, no. 1: 365-391. Galán, J. E. 2009. Common themes in the design and function of bacterial effectors. Cell host & microbe 5, no. 6: 571-579. García-Olmedo, F., P. Rodríguez-Palenzuela, A. Molina, J. M. Alamillo, E. López- Solanilla, M. Berrocal-Lobo, and C. Poza-Carrión. 2001. Antibiotic activities of peptides, hydrogen peroxide and peroxynitrite in plant defence. FEBS letters 498, no. 2-3: 219-222. Gilbert, R. D., A. M. Johnson, and R. A. Dean. 1996. Chemical signals responsible for appressorium formation in the rice blast fungus Magnaporthe grisea. Physiological and Molecular Plant Pathology 48, no. 5 (May): 335-346. doi:doi: DOI: 10.1006/pmpp.1996.0027. Goff, S. A., D. Ricke, T. H. Lan, G. Presting, R. Wang, M. Dunn, J. Glazebrook, A.

16 Sessions, P. Oeller, and H. Varma. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296, no. 5565: 92. Gouget, A., V. Senchou, F. Govers, A. Sanson, A. Barre, P. Rouge, R. Pont-Lezica, and H. Canut. 2006. Lectin receptor kinases participate in protein-protein interactions to mediate plasma membrane-cell wall adhesions in Arabidopsis. Plant physiology 140, no. 1: 81. Grayer, R. J., and T. Kokubun. 2001. Plant-fungal interactions: the search for phytoalexins and other antifungal compounds from higher plants. Phytochemistry 56, no. 3: 253-263. Haldar, K., S. Kamoun, N. L. Hiller, S. Bhattacharje, and C. Van Ooij. 2006. Common infection strategies of pathogenic eukaryotes. Nature Reviews Microbiology 4, no. 12: 922-931. He, Z. H., M. Fujiki, and B. D. Kohorn. 1996. A cell wall-associated, receptor-like protein kinase. Journal of Biological Chemistry 271, no. 33: 19789. Hématy, K., C. Cherk, and S. Somerville. 2009. Host-pathogen warfare at the plant cell wall. Current opinion in plant biology 12, no. 4: 406-413. Hématy, K., P. E. Sado, A. Van Tuinen, S. Rochange, T. Desnos, S. Balzergue, S. Pelletier, J. P. Renou, and H. Höfte. 2007. A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Current Biology 17, no. 11: 922-931. Hogenhout, S. A., R. A. L. Van der Hoorn, R. Terauchi, and S. Kamoun. 2009. Emerging concepts in effector biology of plant-associated organisms. Molecular Plant- Microbe Interactions 22, no. 2: 115-122. van der Hoorn, R. A. L., and S. Kamoun. 2008. From guard to decoy: a new model for perception of plant pathogen effectors. The Plant Cell Online 20, no. 8: 2009. Humphrey, T. V., D. T. Bonetta, and D. R. Goring. 2007. Sentinels at the wall: cell wall receptors and sensors. New Phytologist 176, no. 1: 7-21. Hynes, R. O. 2002. Integrins:: Bidirectional, Allosteric Signaling Machines. Cell 110, no. 6: 673-687. Ingle, R. A., K. J. Denby, . ., and M. Carstens. 2006. PAMP recognition and the plant- pathogen arms race. Bioessays 28, no. 9: 880-889. Jacobs, A. K., V. Lipka, R. A. Burton, R. Panstruga, N. Strizhov, P. Schulze-Lefert, and G. B. Fincher. 2003. An Arabidopsis callose synthase, GSL5, is required for wound and papillary callose formation. The Plant Cell Online 15, no. 11: 2503. Jia, Y., X. Wang, S. Costanzo, and S. Lee. 2009. Understanding the Co-evolution of the Rice Blast Resistance Gene PI-TA and Magnaporthe oryzae Avirulence Gene AVR-PITA. Advances in Genetics, Genomics and Control of Rice Blast Disease: 137-147. Jones, D.A., and D. Takemoto. 2004. Plant innate immunity-direct and indirect recognition of general and specific pathogen-associated molecules. Current opinion in immunology 16, no. 1: 48-62. Jones, J., and J. Dangl. 2006. The plant immune system. Nature 444, no. 7117: 323-329. Kamoun. 2007. Groovy times: filamentous pathogen effectors revealed. Current opinion in plant biology 10, no. 4: 358-365. van Kan, J. A. L., G. Van den Ackerveken, and P. De Wit. 1991. Cloning and characterization of cDNA of avirulence gene avr9 of the fungal pathogen

17 Cladosporium fulvum, causal agent of tomato leaf mold. Mol. Plant-Microbe Interact 4: 52-59. Kang, S., J. A. Sweigard, . ., and B. Valent. 1995. The PWL host specificity gene family in the blast fungus Magnaporthe grisea. MPMI-Molecular Plant Microbe Interactions 8, no. 6: 939-948. Kankanala, P., K. Czymmek, and B. Valent. 2007. Roles for rice membrane dynamics and plasmodesmata during biotrophic invasion by the blast fungus. The Plant Cell Online 19, no. 2: 706. Kasprowicz, A., D. Kierzkowski, M. Maruniewicz, M. Derba-Maceluch, E. Rodakowska, P. Zawadzki, A. Szuba, and P. Wojtaszek. 2009. Mechanical Integration of Plant Cells. Plant-Environment Interactions: 1-20. Khang, C., R. Berruyer, S. Park, P. Kankanala, K. Czymmek, S. Kang, and B. Valent. 2008. Blast Interfacial Complex, a novel in planta structure that accumulates effector proteins of rice blast fungus Magnaporthe oryzae. Phytopathology 98, no. 6. Khang, C. H., R. Berruyer, M. C. Giraldo, P. Kankanala, S. Y. Park, K. Czymmek, S. Kang, and B. Valent. 2010. Translocation of Magnaporthe oryzae effectors into rice cells and their subsequent cell-to-cell movement. The Plant Cell Online 22, no. 4: 1388. Khush, G. S., and G. H. Toenniessen. 1991. Rice biotechnology. CABI. Kirk, P. M., P. F. Cannon, D. W. Minter, and J. A. Stalpers. 2008. Dictionary of the Fungi. 10. Wallingford: CABI. Kunze, G., C. Zipfel, S. Robatzek, K. Niehaus, T. Boller, and G. Felix. 2004. The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. The Plant Cell Online 16, no. 12: 3496. Levin, D. E. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiology and molecular biology reviews 69, no. 2: 262. Mansfield, J. W. 1983. Antimicrobial compounds. Biochemical plant pathology: 237-265. Mellersh, D. G., and M. C. Heath. 2001. Plasma membrane-cell wall adhesion is required for expression of plant defense responses during fungal penetration. The Plant Cell Online 13, no. 2: 413. Mendgen, K., and M. Hahn. 2002. Plant infection and the establishment of fungal biotrophy. Trends in plant science 7, no. 8: 352-356. Mishina, T. E., and J. Zeier. 2007. Pathogen associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in Arabidopsis. The Plant Journal 50, no. 3: 500-513. Morrissey, J.P., and A.E. Osbourn. 1999. Fungal Resistance to Plant Antibiotics as a Mechanism of Pathogenesis. Microbiol. Mol. Biol. Rev. 63, no. 3: 708-724. Mosquera, G., M. C. Giraldo, C. H. Khang, S. Coughlan, and B. Valent. 2009. Interaction transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as biotrophy- associated secreted proteins in rice blast disease. The Plant Cell Online 21, no. 4: 1273. Mosquera-Cifuentes, Gloria. 2007. Analysis of the interaction transcriptome during biotrophic invasion of rice by the blast fungus, Magnaporthe oryzae. Nickle, T. C., and D. W. Meinke. 1998. A cytokinesis defective mutant of Arabidopsis (cyt1) characterized by embryonic lethality, incomplete cell walls, and excessive

18 callose accumulation. The Plant Journal 15, no. 3: 321-332. Nishimura, M. T., M. Stein, B. H. Hou, J. P. Vogel, H. Edwards, and S. C. Somerville. 2003. Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301, no. 5635: 969. Nuernberger, T., and V. Lipka. 2005. Non-host resistance in plants: new insights into an old phenomenon. Molecular Plant Pathology 6, no. 3: 335-345. Nutsugah, S.K., J.K. Twumasi, Y Chipili, and S Sreenivasaprasad. 2008. Diversity of the rice blast pathogen in Ghana and strategies for resistance management. Plant Pathology Journal 7, no. 1: 109-113. Oerke, E. C., and H. W. Dehne. 2004. Safeguarding production--losses in major crops and the role of crop protection. Crop Protection 23, no. 4: 275-285. Oliva, Ricardo, Joe Win, Sylvain Raffaele, Laurence Boutemy, Tolga O. Bozkurt, Angela Chaparro-Garcia, Maria Eugenia Segretin, et al. 2010. Recent developments in effector biology of filamentous plant pathogens. Cellular Microbiology 12, no. 6: 705-715. Osbourn, A. E. 1996. Preformed antimicrobial compounds and plant defense against fungal attack. The Plant Cell 8, no. 10: 1821. Osbourn, A.E. 1996. Preformed antimicrobial compounds and plant defense against fungal attack. The Plant Cell 8, no. 10: 1821. Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Current Opinion in Plant Biology 6, no. 4: 320-326. Perfect, S. E., and J. R. Green. 2001. Infection structures of biotrophic and hemibiotrophic fungal plant pathogens. Molecular Plant Pathology 2, no. 2: 101- 108. Pilling, E., and H. Höfte. 2003. Feedback from the wall. Current opinion in plant biology 6, no. 6: 611-616. Prell, H. H., and P. R. Day. 2001. Plant-fungal pathogen interaction: a classical and molecular view. Springer Verlag. Rairdan, G., and P. Moffett. 2007. Brothers in arms? Common and contrasting themes in pathogen perception by plant NB-LRR and animal NACHT-LRR proteins. Microbes and Infection 9, no. 5: 677-686. Ribot, C., J. Hirsch, S. Balzergue, D. Tharreau, J. L. Nottéghem, M. H. Lebrun, and J. B. Morel. 2008. Susceptibility of rice to the blast fungus, Magnaporthe grisea. Journal of plant physiology 165, no. 1: 114-124. Schneider, D. J., and A. Collmer. 2010. Studying Plant-Pathogen Interactions in the Genomics Era: Beyond Molecular Koch's Postulates to Systems Biology. Phytopathology 48, no. 1: 457. Seifert, G. J., and C. Blaukopf. 2010. Irritable walls: the plant extracellular matrix and signaling. Plant Physiology 153, no. 2: 467. Shan, and P. Goodwin. 2004. Monitoring host nuclear migration and degradation with green fluorescent protein during compatible and incompatible interactions of Nicotiana tabacum with Colletotrichum species. Journal of Phytopathology 152, no. 8 9: 454-460. Shan, W., M. Cao, D. Leung, and B. M. Tyler. 2004. The Avr1b Locus of Phytophthora sojae Encodes an Elicitor and a Regulator Required for Avirulence on Soybean Plants Carrying Resistance Gene Rps 1b. Molecular Plant-Microbe Interactions

19 17, no. 4: 394-403. Somerville, C., S. Bauer, G. Brininstool, M. Facette, T. Hamann, J. Milne, E. Osborne, A. Paredez, S. Persson, and T. Raab. 2004. Toward a systems approach to understanding plant cell walls. Science 306, no. 5705: 2206. Staskawicz, B. J., D. Dahlbeck, and N. T. Keen. 1984. Cloned avirulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max (L.) Merr. Proceedings of the National Academy of Sciences of the United States of America 81, no. 19: 6024. Strange, R. N., and P. R. Scott. 2005. Plant disease: a threat to global food security. Phytopathology 43. Talbot, N. J. 2003. On the trail of a cereal killer. Annu. Rev. Microbiol 57: 177-202. Telewski, Frank W. 2006. A unified hypothesis of mechanoperception in plants. Am. J. Bot. 93, no. 10: 1466-1476. Thongkantha, S., R. Jeewon, D. Vijaykrishna, S. Lumyong, E. H. C. McKenzie, and K. D. Hyde. 2009. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species, Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Divers 34: 157-173. Tosa, Y., J. Osue, Y. Eto, H. S. Oh, H. Nakayashiki, S. Mayama, and S. A. Leong. 2005. Evolution of an avirulence gene, AVR1-CO39, concomitant with the evolution and differentiation of Magnaporthe oryzae. Molecular Plant-Microbe Interactions 18, no. 11: 1148-1160. Tucker, S. L., and N. J. Talbot. 2001. Surface attachment and prepenetration stage development by plant pathogenic fungi. Annual Review of Phytopathology 39, no. 1: 385-417. Urashima, A. S., N. A. Lavorent, A. C. P. Goulart, and Y. R. Mehta. 2004. Resistance spectra of wheat cultivars and virulence diversity of Magnaporthe grisea isolates in Brazil. Fitopatologia Brasileira 29: 511-518. Urban, M., T. Bhargava, and J. E. Hamer. 1999. An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease. The EMBO Journal 18, no. 3: 512-521. Vergne, E., E. Ballini, S. Marques, B. Sidi Mammar, G. Droc, S. Gaillard, S. Bourot, R. DeRose, D. Tharreau, and J. L. Nottéghem. 2007. Early and specific gene expression triggered by rice resistance gene Pi33 in response to infection by ACE1 avirulent blast fungus. New Phytologist 174, no. 1: 159-171. Verica, J. A., L. Chae, H. Tong, P. Ingmire, and Z. H. He. 2003. Tissue-specific and developmentally regulated expression of a cluster of tandemly arrayed cell wall- associated kinase-like kinase genes in Arabidopsis. Plant physiology 133, no. 4: 1732. Viji, G., B. Wu, S. Kang, W. Uddin, and D. R. Huff. 2001. Pyricularia grisea causing gray leaf spot of perennial ryegrass turf: Population structure and host specificity. Plant Disease 85, no. 8: 817-826. Von Braun, J. 2007. The world food situation: new driving forces and required actions. Intl Food Policy Res Inst. Wagner, T. A., and B. D. Kohorn. 2001. Wall-associated kinases are expressed throughout plant development and are required for cell expansion. The Plant Cell Online 13, no. 2: 303. Xu, J. R., C. J. Staiger, and J. E. Hamer. 1998. Inactivation of the mitogen-activated

20 protein kinase Mps1 from the rice blast fungus prevents penetration of host cells but allows activation of plant defense responses. Proceedings of the National Academy of Sciences of the United States of America 95, no. 21: 12713. Xu, J. R., X. Zhao, and R. A. Dean. 2007. From genes to genomes: a new paradigm for studying fungal pathogenesis in Magnaporthe oryzae. Advances in genetics 57: 175-218. Yoshida, K., H. Saitoh, S. Fujisawa, H. Kanzaki, H. Matsumura, K. Yoshida, Y. Tosa, I. Chuma, Y. Takano, and J. Win. 2009. Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. The Plant Cell Online 21, no. 5: 1573. Yu, J., S. Hu, J. Wang, G. K. S. Wong, S. Li, B. Liu, Y. Deng, L. Dai, Y. Zhou, and X. Zhang. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, no. 5565: 79. Zhou, Y. Jia, P. Singh, J. C. Correll, and F. N. Lee. 2007. Instability of the Magnaporthe oryzae avirulence gene AVR-Pita alters virulence. Fungal Genetics and Biology 44, no. 10: 1024-1034. Zipfel, C., and G. Felix. 2005. Plants and animals: a different taste for microbes? Current opinion in plant biology 8, no. 4: 353-360.

21 CHAPTER 2:

Functional characterization of Magnaporthe oryzae effectors in the infective process

of rice

INTRODUCTION

Rice is one of the three most extensive crops in the world with an annual production for 2007 of 645 millions tons (Oerke and Dehne 2004). The yield of this crop has steadily increased during the last decade. However, rice producing areas in Asian and

African countries still face hunger and extreme poverty with increasing environmental deterioration (Khush 2005). Recent advances in rice-genomics have the potential to facilitate higher yields than previously reported with minimal environmental impact.

However, one of the major problems in rice production is the pathogen Magnaporthe oryzae (Khush and Toenniessen 1991). During the last decade, the genomic sequence of rice (Goff et al. 2002; Yu et al. 2002) and this pathogen (Dean et al. 2005) were completed allowing the computational identification of genes. Some of these genes are involved in rice infection and have been characterized using different approaches (Khang et al. 2008; Chen et al. 2009; Terauchi et al. 2009; Khang et al. 2010). Identifying and functionally characterizing the set of genes affecting pathogenicity, including effectors that function in the host-pathogen interaction, remains a major goal.

Effector genes are specifically expressed by the pathogen under the defined spatio-temporal conditions that occur during the infection process. Cytological observations have allowed researchers to visualize specific aspects of the infection process and analyze expression patterns of some of these pathogen effectors (Kankanala

22 et al. 2007; Kankanala 2007). These observations elucidated that the M. oryzae-rice cell interaction is conducted at the interface between the fungal and plant cell membranes.

Previously, several studies of biotrophic pathogens (Panstruga 2003; O’Connell and

Panstruga 2006; Perfect and Green 2001) and symbionts (Harrison 2005) had demonstrated that effectors are secreted into this intercellular space and not into the cytoplasm. Furthermore, it was determined that this fungus is able to move between cells using plasmodesmata. Genes involved in the development of invasive hyphae were identified as those differentially expressed during rice infection using laser capture microarray technology (Mosquera et al. 2009). This was accomplished by first developing a method for recovering RNAs from hyphae growing in first layer of infected plant cells. By performing a comparative analysis between these RNAs and those from vegetative mycelia, Mosquera et al (2009) identified 58 candidate effectors. Three different kinds of expression patterns were identified by analyzing four effectors associated to a previously identified intercellular space (Kankanala et al. 2009). Pattern expression of these putative effectors is currently being determined with the aim of characterizing the Blast Interfacial Complex and understanding which genes are involved in the biotrophic growth of M. oryzae.

Previous expression profiling work identified putative genes with no-established function that were highly expressed during the late-development stages of infection, where the invasive hypha is the predominant specialized structure (Mosquera et al. 2009).

MGG_00194 and MGG_03356 are two genes that fit this description. They have no homology with other effector proteins and were identified as elicitors of cell death using a rice protoplast transient expression system (Wang et al. 2009). Both putative genes

23 exhibit a signal peptide domain and were highly upregulated during the course of barley and rice infection. MGG_00194 is a putative homolog of the conserved fungal protein rds1, previously reported in Schizosaccharomyces cerevisae. This is an adenine- repressible gene regulated by glucose, ammonium, phosphate, carbon dioxide and temperature and is presumably involved in cellular stress responses (Ludin et al. 1995).

This homology is apparent considering that nitrogen-carbon starvation is presumed during the early biotrophic phase of infection. MGG_03356 does not have a clear recognized homolog to any other gene.

The aim of this work was to determine how the putative effectors MGG_00194 and MGG_03356 are involved in the infection process of M. oryzae in rice using in- planta secretion and functional analyses. M. oryzae transformants constitutively expressing these genes were created and the effect of this condition in vegetative growth and plant pathogenicity was evaluated. Hygromycin split marker and single insert constructs were used for gene deletion but no knockout mutants obtained. The hypothesis of this work is that if these proteins are effectors, changes in their expression will have an effect on virulence when the pathogen is infecting cultivars with varying levels of resistance.

24 MATERIALS AND METHODS

Fungal strains, growth conditions and transformation. M. oryzae strains 70-15,

KJ201, and ΔKu70 Guy11 were used in this study and described in the Appendix A.

ΔKu70 Guy11 was used exclusively for knockout transformations using a single insert construct. Protoplasts were obtained from liquid cultures grown at 25oC for 3-7 days.

Mycelia were harvested by filtering through 1 layer of Miracloth (Calbiochem, CA,

USA), suspend with 20% sucrose and washed. The cell wall was eliminated using lysing enzyme (1-5 g/mL) (Glucanex, Sigma Chemical Co.), in 20% sucrose for 2 hours at room temperature. Protoplasts were collected through 4 layers of Miracloth followed by centrifugation for 15 minutes at 4800g, at 4oC. The pellet was suspended in 1X STC buffer (1.2M sorbitol, 10mM Tris hydrochloride, pH 8.0, 10mM CaCl2) at 5 X

107cells/mL and stored in aliquots of 200uL at -80oC. For transformation, aliquots were mixed with 5 ug of plasmid DNA or 10 μL of PCR product and the protoplasts regenerated for 6 hours before selection (Choi et al. 2009). Transformants were selected on TB3 agar (0.3% yeast extract, 0.3% casamino acids, 1% glucose, 20% sucrose (w/v), and 0.8% agar powder) containing 200ppm hygromycin. Transformation plates were incubated for 5-9 days at 23oC in the dark. Primary transformants were transferred to new

TB3 plates supplemented with hygromycin (0.2 mg/mL) and purified via single-conidia isolation (conidia germination in water agar, 24h). Dried sporulating colonies of wild- type and transformants were stored at -20oC.

Plasmids and DNA manipulations. Constitutive expression constructs were created by PCR amplification of the ribosomal protein 27 promoter, eGFP coding sequence, and the ORFs of each gene. These were fused and cloned into the expression

25 vector pCB1636 (Hygr) (Sweigard et al. 1997). Three independent constitutive expression transformants were selected and purified by single-conidia isolation. Native expression constructs were obtained by cloning PCR products of the ORF plus 1Kb upstream into plasmid PCB1636 containing eGFP. Hygromycin-resistant transformants were screened for fluorescence intensity and confirmed by PCR. Six native expression transformants were selected and purified by single-conidia isolation.

Gene deletion constructs were obtained by fusion PCR of 1kb upstream of the

ORF, the hygromycin resistance gene, and 1Kb downstream of the ORF and cloning in pGXT (Chen, P. Songkumarn, et al. 2009). Split marker constructs were obtained by cloning of downstream and upstream 1 Kb regions in the plasmids pHY and pYG respectively. pHY was obtained by cloning of 5’ fragment of the hygromycin phosphotransferase gene (hph) with primers HYG-F/HY-R and pYG by cloning of the 3’ fragment using primers YG-F/HYG-R (Jeong et al. 2007). Full description of primers and vectors is provided in Appendix A.

Assays for growth, sporulation, appresoria formation and plant infection.

Fungal growth and sporulation, appressorium formation, plant infection and sheath assay technique were performed as previously described (DeZwaan et al. 1999; Kim et al.

2005; Mosquera-Cifuentes 2007). Growth rate was measured daily on complete media agar (0.6% yeast extract, 0.6% casamino acids, 1% sucrose (w/v), and 1.8% agar powder). Conidia harvested from 1-week-old V8 juice agar were used for quantification of germination, conidiation and appressorium formation, and infection assays (Park et al.

2004; Xu et al. 1997). Fluorescent expression patterns for 70-15 and KJ201 strains were evaluated in leaf sheaths of the rice cultivar Nipponbare and barley (Appendix B).

26 For plant infection assays, pots with ten seedlings of 3-week old rice of the rice cultivars Nipponbare, C101A51 (Pi2) and 75-1-127 (Pi9) (Liu et al. 2002) were sprayed with 10 mL of conidial suspensions of 105 conidia/mL in 0.25% gelatin solution.

Inoculated plant were kept in darkness for 24 hours and incubated during six days more in growth chamber (32oC and 95% humidity) (Kim et al. 2005). Lesion and leaf areas were estimated using the software Scion (Scion Corp., Frederick, MD) from digital pictures. Relative disease area was calculated as the ratio lesion area / leaf area. Small fragments of diseased leaves were put in 1 mL of destillated water and vortexed. Finally the conidiospore concentration was estimated using a hematocymeter. Conidiation intensity was calculated as the number of conidiospores per cm2 of lesion area.

RESULTS AND DISCUSSION

M. oryzae transformation. The genes MGG_00194 and MGG_03356 were previously identified as small secreted proteins able to elicit cell death and consequently were considered putative effectors (Wang et al. 2009). Each gene was fused to eGFP and controlled by either its native promoter or the constitutive ribosomal promoter and transformed into M. oryzae line 70-15. However, the M. oryzae 70-15 strain and derived transformants showed an overall weak level of colonization on the susceptible rice cultivar Nipponbare. During sheath assays, the host cell was infected, but showed extensive cytoplasmic granulation during colonization, and was accompanied by an intense autofluorescence. In whole-plant experiments, lesions caused by this strain and derived transformants did not resemble sporulating expanding lesions caused by field isolates. Considering the low rate of successful colonization by 70-15 in whole-plant

27 assay experiments, an alternative strain was selected. Strain KJ201 was transformed with the constitutive and native expression vectors. No differences were found between the wild-type and its derivative transformants for radial growth, conidiation, germination and appressorium formation (Appendix A).

Pathogenicity assays. Three independent mutants were obtained for KJ201

MGG_03356::GFP under the constitutive ribosomal promoter. All three isolates showed a significant difference in lesion area values in a whole-plant pathogenicity assays on isogenic Pi2 resistant plants. The over expression strains caused lesions in Pi2 plants similar to those caused by wild type KJ201 on the susceptible rice cultivar Nipponbare.

Expanding lesions on the Pi2 rice cultivar was observed for all 3 independent overexpression mutants and 3 biological replications. This is significance as KJ201 wild type was not able to cause lesions in Pi2. The MGG_00194::GFP overexpression mutants also showed a significant increased in lesion area in Pi2 plants (bigger specks and lesions), but not to the extent of the MGG_03356::GFP overexpression lines. No lesions were obtained by transformants overexpressing either gene on resistant Pi-9 plants

(Figure 2.1). Additional experiments were developed for MGG_03356 to investigate this observation further and are presented in Chapter 3.

KJ201 and overexpression mutants were able to infect Nipponbare leaf sheaths as determined by healthy globulous invasive hyphae growing profusely before moving to the next cell. KJ201 wild-type in Pi2 plants showed an intense autofluorescence reaction surrounding appressorium, neighboring cells, and infected host cell accompanied by cytoplasmic granulation across the host cell with little or no fungal growth.

Overexpression of MGG_00194::GFP did not show any visible difference in leaf sheath

28 as compared with the wild-type. No growth or autofluorescent surrounding appressorium were visible. The MGG_03356 overexpression did show cytological differences during infection of Pi2 leaf sheath as is described in Chapter 3. Reduced growth accompanied by an intense vesiculation was observed for all transformants and wild type isolates infecting

Pi-9 plants.

Localization pattern. Fluorescent tagged MGG_03356 under the control of the native promoter did not show a distinguishable signal in the backgrounds KJ201 and 70-

15. However, a specific and reproducible GFP expression pattern was observed for transformants under native control of MGG_00194 in the 70-15 background infecting barley. MGG_00194 native expression in the first 24hpi is associated with the cell membrane and septa and at 36-48hpi the expression is associated with the hyphal tips as they move to the neighboring cells (Figure 2.2).

Knockout mutants. In this study no viable knockout mutants for these genes were obtained using two different strategies (Appendix A). Single knockout insert using the M. oryzae strains 70-15, KJ201 and ΔKu70 Guy11 protoplasts did not generate homologous recombination mutants. Ku70 is a gene essential for non-homologous end joining (NHEJ) of DNA double-strand breaks. Its knockout condition increases the frequency of targeted gene replacement in fungi (Hefferin and Tomkinson 2005). Use of purified or unpurified

PCR products of knockout constructs produced a high number of abortive colonies compared with similar amounts of plasmid DNA. Abortive colonies are small hygromycin resistant colonies that are unable to form expanded filamentous colonies.

These are commonly reported in fungal transformation experiments (Rogers et al. 2004).

They were absent in control transformation experiments where no DNA was included.

29 Time variations of incubation did not affect the recovery of filamentous colonies but affected the development of abortive mutants, with longer incubation times (> 6 hours) increasing the number of abortive colonies. Only a fraction of filamentous mutants of

ΔKu70 Guy11 were recovered compared with 70-15 and KJ201 transformations under the same experimental conditions. The second strategy used was the split marker system

(Appendix A). In transformation experiments using that system a low number of abortive colonies and an increasing number of filamentous transformants were obtained (Kück and Hoff 2010). However, all the resulting filamentous colonies did not show homologous insertion of the hygromycin construct.

In conclusion, two putative effectors were characterized and evidence of their effector quality was obtained. For MGG_00194, a fluorescent expression patterns were visible for the interaction between the native transformant 70-15 and barley plants, a highly susceptible surrogate host. Under those conditions, healthy fungal cells were able to produce a detectable signal. The fluorescence expression pattern suggests a sustained production of this protein (until 72 hpi) and a preferential accumulation of this protein in the BIC and tips of hyphae moving across cells. MGG_03356 native promoter transformants did not show an identifiable expression pattern. Whole plant assay experiments showed that constitutive expression of MGG_03356 in the KJ201 strain increases the virulence of the pathogen as measured by significantly larger lesion sizes.

Additional experiments described in chapter 3 offer a hypothesis explaining the basis of this observation. Specifically, these lesions represent a hyper or delayed spreading HR response. To evaluate this possibility, we evaluated spore production by these lesions as evidence that fungus can complete its life cycle (Table 2.2). Those data show KJ201

30 overexpressing MGG_03356 is able to sporulate in Pi2 resistant plants, however at a significant reduced level. No effect in pathogenicity for constitutive expression of

MGG_00194 was detected.

In all, over one thousand transformants were generated for each effector construct with no deletion mutants obtained (Table 2.1). This inability to obtain a knockout transformant can be explained by gene lethality or inaccessible locus. A knockout transformant is not obtained when the function of the gene is essential for cell development and differentiation. Presence of repetitive sequences surrounding the gene, extensive DNA methylation, or heterochromatin associated to the locus can also obstruct access by foreign DNA and impede transformation.

31 Background Strains Colonies tested MGG_00194 MGG_03356 70-15 ~1000 ~1000 KJ201 ~1000 ~1000 Guy11-Δku80 0 50

32 P27:MGG_00194 Wild type P27:MGG_O3356 Cultivars Value SD Value SD Value SD

Nipponbare 1 x 105 32146 8 x 104 30551 5 x 104 20000 C101A51 (Pi2) 0 0 0 0 2 x 103 1607 75-1-127 (Pi9) 0 0 0 0 0 0

Table 2.2. Sporulation levels (conidias / cm2 leaf surface) for KJ201 overexpression mutants in spray inoculation assays.

33 A.

Continued

34 Figure 2.1 continued B.

35 A.

ap f ap f

36 LIST OF REFERENCES

Chen, S., M. Gowda, R. C. Venu, P. Songkumarn, C. H Park, M. Bellizzi, D. J Ebbole, and G. L Wang. 2009. Isolation and Functional Analysis of Putative Effectors from Magnaporthe oryzae Using Integrated Genomic Approaches. Advances in Genetics, Genomics and Control of Rice Blast Disease: 93-103. Chen, S., P. Songkumarn, J. Liu, and G. L. Wang. 2009. A versatile zero background T- vector system for gene cloning and functional genomics. Plant physiology 150, no. 3: 1111. Choi, J., Y. Kim, S. Kim, J. Park, and Y. H Lee. 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genetics and Biology 46, no. 3: 243-254. Dean, R. A., N. J. Talbot, D. J. Ebbole, M. L. Farman, T. K. Mitchell, M. J. Orbach, M. Thon, R. Kulkarni, J. R. Xu, and H. Pan. 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434, no. 7036: 980-986. DeZwaan, T. M., A. M. Carroll, B. Valent, and J. A. Sweigard. 1999. Magnaporthe grisea pth11p is a novel plasma membrane protein that mediates appressorium differentiation in response to inductive substrate cues. The Plant Cell Online 11, no. 10: 2013. Goff, S. A., D. Ricke, T. H. Lan, G. Presting, R. Wang, M. Dunn, J. Glazebrook, A. Sessions, P. Oeller, and H. Varma. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296, no. 5565: 92. Guo-Liang Wang, Pattavipha Songkumarn, and Songbiao Chen. 2009. MGG_00194 and MGG_03356 are elicitors of cell-death. Personal communication Harrison, M. J. 2005. Signaling in the arbuscular mycorrhizal symbiosis. Microbiology 59, no. 1: 19. Hefferin, M. L., and A. E. Tomkinson. 2005. Mechanism of DNA double-strand break repair by non-homologous end joining. DNA repair 4, no. 6: 639-648. Jeong, J. S, T. K Mitchell, and R. A Dean. 2007. The Magnaporthe grisea snodprot1 homolog, MSP1, is required for virulence. FEMS microbiology letters 273, no. 2: 157-165. Kankanala, P. 2007. Cell biology and gene expression profiling during the early biotrophic invasion by the rice blast fungus Magnaporthe oryzae. Kankanala, P., K. Czymmek, and B. Valent. 2007. Roles for rice membrane dynamics and plasmodesmata during biotrophic invasion by the blast fungus. The Plant Cell Online 19, no. 2: 706. Kankanala, P., G. Mosquera, C. H. Khang, G. Valdovinos-Ponce, and B. Valent. 2009. Cellular and Molecular Analyses of Biotrophic Invasion in Rice Blast Disease. Advances in Genetics, Genomics and Control of Rice Blast Disease: 83-91. Khang, C., R. Berruyer, S. Park, P. Kankanala, K. Czymmek, S. Kang, and B. Valent. 2008. Blast Interfacial Complex, a novel in planta structure that accumulates

37 effector proteins of rice blast fungus Magnaporthe oryzae. Phytopathology 98, no. 6. Khang, C. H., R. Berruyer, M. C. Giraldo, P. Kankanala, S. Y. Park, K. Czymmek, S. Kang, and B. Valent. 2010. Translocation of Magnaporthe oryzae effectors into rice cells and their subsequent cell-to-cell movement. The Plant Cell Online 22, no. 4: 1388. Khush, G. S. 2005. What it will take to feed 5.0 billion rice consumers in 2030. Plant molecular biology 59, no. 1: 1-6. Khush, G. S., and G. H. Toenniessen. 1991. Rice biotechnology. CABI. Kim, S., I. P. Ahn, H. S. Rho, and Y. H. Lee. 2005. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Molecular microbiology 57, no. 5: 1224-1237. Kück, U., and B. Hoff. 2010. New tools for the genetic manipulation of filamentous fungi. Applied microbiology and biotechnology 86, no. 1: 51-62. Liu, G., G. Lu, L. Zeng, and G. L Wang. 2002. Two broad-spectrum blast resistance genes, Pi9 (t) and Pi2 (t), are physically linked on rice chromosome 6. Molecular Genetics and Genomics 267, no. 4: 472-480. Ludin, K. M., N. Hilti, and M. E. Schweingruber. 1995. Schizosaccharomyces pombe rds1, an adenine-repressible gene regulated by glucose, ammonium, phosphate, carbon dioxide and temperature. Molecular and General Genetics MGG 248, no. 4: 439-445. Mosquera, G., M. C. Giraldo, C. H. Khang, S. Coughlan, and B. Valent. 2009. Interaction transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as biotrophy- associated secreted proteins in rice blast disease. The Plant Cell Online 21, no. 4: 1273. Mosquera-Cifuentes, Gloria. 2007. Analysis of the interaction transcriptome during biotrophic invasion of rice by the blast fungus, Magnaporthe oryzae. O’Connell, R. J., and R. Panstruga. 2006. Tete a tete inside a plant cell: establishing compatibility between plants and biotrophic fungi and oomycetes. New Phytologist 171, no. 4: 699-718. Oerke, E. C., and H. W. Dehne. 2004. Safeguarding production--losses in major crops and the role of crop protection. Crop Protection 23, no. 4: 275-285. Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Current Opinion in Plant Biology 6, no. 4: 320-326. Park, G., K. S. Bruno, C. J. Staiger, N. J. Talbot, and J. R. Xu. 2004. Independent genetic mechanisms mediate turgor generation and penetration peg formation during plant infection in the rice blast fungus. Molecular microbiology 53, no. 6: 1695-1707. Perfect, S. E., and J. R. Green. 2001. Infection structures of biotrophic and hemibiotrophic fungal plant pathogens. Molecular Plant Pathology 2, no. 2: 101- 108. Rogers, C. W., M. P. Challen, J. R. Green, and J. M. Whipps. 2004. Use of REMI and Agrobacterium mediated transformation to identify pathogenicity mutants of the biocontrol fungus, Coniothyrium minitans. FEMS microbiology letters 241, no. 2: 207-214. Sweigard, J. A., F. Chumley, A. Carroll, L. Farrall, and B. Valent. 1997. A series of vectors for fungal transformation. Fungal Genetics Newsletter: 52-53.

38 Terauchi, R., J. Win, S. Kamoun, H. Matsumura, H. Saitoh, H. Kanzaki, K. Yoshida, M. Shenton, T. Berberich, and S. Fujisawa. 2009. Searching for Effectors of Magnaporthe oryzae: A Multi-Faceted Genomics Approach. Advances in Genetics, Genomics and Control of Rice Blast Disease: 105-111. Xu, J. R., M. Urban, J. A. Sweigard, and J. E. Hamer. 1997. The CPKA gene of Magnaporthe grisea is essential for appressorial penetration. Molecular Plant- Microbe Interactions 10, no. 2: 187-194. Yu, J., S. Hu, J. Wang, G. K. S. Wong, S. Li, B. Liu, Y. Deng, L. Dai, Y. Zhou, and X. Zhang. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, no. 5565: 79.

39 CHAPTER 3:

Overexpression of MGG_03356 modifies virulence of Magnaporthe oryzae isolates

INTRODUCTION

Magnaporthe oryzae is a biotrophic pathogen, which uses living cells as a nutrient source during the early steps of infection. This ability is not dependent on previous penetration steps and is specific to compatible interactions between a pathogen strain and a susceptible cultivar (O’Connell and Panstruga 2006; Mosquera-Cifuentes 2007). These compatible interactions are also hemibiotrophic, the fungus invades the cell biotrophically and later changes to a necrotrophic phase (Kankanala 2007). During the biotrophic phase, the fungus is able to grow inside of the plant cell cytoplasm wrapped inside plant cell membrane. Similar to other fungi, this specialized structure, called invasive hyphae, is surrounded by the invaginated plant plasma membrane. In this two- membrane space are secreted a suite of proteins which include effectors (Khang et al.

2008). How the fungus establishes itself inside the host cell without affecting cell viability is still unknown, but a hyphal differentiation process does occur during this period. The thin filamentous hypha, characteristic of the vegetative stage, transforms to bulbous invasive hypha, characteristic of compatible interactions (Mosquera et al. 2009).

Although it has been demonstrated that this specialized invasive hyphae (IH) secretes specific effectors during the biotrophic invasion, there is not a complete understanding or characterization of the molecular process involved in its development (Panstruga 2003;

40 Perfect and Green 2001; Shan and Goodwin 2004; Mendgen and Hahn 2002).

In the case of M. oryzae, four new highly-expressed effectors and the well recognized efectors AVR-Pita1 and PWL were detected on the invasive hyphae and the intermembranal space between the fungus and plant membranes (Valent et al. 2009). One of these effectors, MGG_11610, is related with cell wall crossing points and presumably involved in the cell-to-cell movement using plasmodesmata. The remaining three effectors (MGG_04795, MGG_09693, and MGG_10914) are all secreted into the Blast

Interfacial Complex (BIC), a structure containing complex lamella membranes and vesicles (Mosquera et al. 2009). AVR-Pita1 and PWL exhibit a specific pattern of expression when they are accumulated in BIC and within the fungus-plant interspace around the hyphal junction cells (Mosquera et al. 2009). In contrast, MGG_11610 expression is located at multiple sites dispersed along the hyphae. This variety of patterns could be considered evidence of alternate functions that these proteins participate in.

Recently, PWL2 and BAS1 were shown to be translocated into the cytoplasm of invaded rice cells and even across neighboring cells possibly via plasmodesmata (Khang et al.

2010). Fluorescent tagged versions of these proteins containing a nuclear localization signal were used to concentrate and magnify the signal. These proteins were concentrated in the host nucleus and visible far up to four cell lawyers away from the primary infected cell. This is evidence of an anticipation mechanism of host control by the pathogen prior to the physical invasion (Khang et al. 2010).

Previous work identified novel genes, highly expressed during rice infection with effector-like functions (Mosquera et al. 2009; Khang et al. 2010). MGG_03356 was highly expressed during inoculation of barley (45.1 fold) and rice (3.3 fold) as well as

41 during carbon starvation (7 fold) (Wang et al. 2009). This gene codes for a small protein with a secretion signal with no homology to any previous known protein. Additionally, it was identified as a putative effector experimentally as being able to produce cell death when transiently expressed in rice protoplasts and modifies virulence in a whole-plant infection experiments as described in Chapter 2.

The objective of this work was to determine how the overexpression of this putative effector affects pathogenicity at a cytological level in compatible and incompatible interactions of M. oryzae and rice. The hypothesis was that quantitative effects on infection development by the constitutive expression of this gene can be observed during the host-pathogen interaction on rice lines with different levels of compatibility. In a full compatible interaction, the redundancy of virulence mechanisms resulting in optimal infection obscure any effect associated to the overexpression of just one single effector gene. Our results suggest that this effector, when expressed in a constitutive manner, allows the pathogen to evade the host HR response possibly via degradation of the pectin in the cell wall and consequently decreasing the mechanical sensing of the pathogen attack.

42 MATERIALS AND METHODS

Fungal strains and transformation. M. oryzae strains with different levels of growth and virulence were used for these experiments and described in Table 3.1.

Protoplasts obtained from the M. oryzae KJ201, PO6-6 and CHNOS strains were transformed using expression plasmids for MGG_03356 (Kim et al. 2005; Choi et al.

2009). ::MGG_03356:EGFP 2 transformants were obtained by cloning of the promoter (1 kb upstream fragment), and coding sequence into pCB1636. ::MGG_03356:mRFP was obtained from Dr. Farman, M.L. (University of Kentucky). The overexpression plasmid

P27:MGG_03356:EGFP were constructed by PCR amplifying the M. oryzae ribosomal protein 27 (P27) promoter, eGFP coding sequence, and the coding sequence of

MGG_03356. These were cloned to the pCB1636 (Hygr) plasmid (Sweigard et al. 1997).

Positive transformants were identified like hygromycin resistant colonies. Incorporation of the ::MGG_03356:GFP construct into the native transformants were verified by PCR and five of them were selected for further studies. Because overexpression positive transformants exhibited similar fluorescence patterns with different levels of brightness, those transformants with the highest fluorescence level were chosen. Three independent overexpression transformants for each strain were selected and purified by single-conidia isolation.

Infection assays. Rice cultivars Nipponbare, C101A51 (Pi2) and 75-1-127 (Pi9) were used for infection assays (Liu et al. 2002). Leaf sheath inoculations were performed using 3-4 week old rice plants. Sheath pieces (>3cm) were placed in Petri dishes with wet tissues in tip racks to avoid contact with the wet tissue and to keep the main vein

2 :: Double colon states for coding sequence under the control of its own native promoter.

43 horizontal at the bottom (Appendix B) . A spore suspension (105 spores/mL in 0.25% gelatin) was injected in the upper end of the sheath using a 200uL pipette. At 12-hours intervals, 2cm pieces were removed and cleaned using paper tissue to remove growing mycelia. Segments were trimmed, beginning with the removal of main vein and opening of the sheath by separation of the confluent tissue. Then, the sheaths were laid flat on a microscope slide with the internal layer facing the slide surface and the remaining layers were eliminated to obtain only a single-cell layer (Appendix B). Fixation and staining of rice sheath were performed as previously described (Kim et al. 2005). Samples were incubated in lactophenol (25oC, 1hour) and transferred into 0.01% aniline blue (1hour) and destained with lactophenol (Dietrich et al. 1994). For diaminobenzidine staining, samples were incubated in 1mg/ml DAB solution (pH 3.8) for 8 hours and destained with clearing solution (ethanol:acetic acid = 94:4, v/v) for 1 hour (Chi et al. 2009).

For the quantitative analysis of infection, at least a hundred infection points were observed microscopically 36hpi and classified into eight categories from 0 to 7 following the developmental stages scale below described. Additionally two more categories were included for neighboring cells colonized by the pathogen growing in the primary infected cell: 5’ and 6’.

0. HR-like reaction. ROS production detected by DAB staining

1. No penetration: appressoria formed but failed to penetrate epidermal cells. Callose accumulation restricted to appresoria

2. Restricted: primary infection hyphae were restricted within dead host cells. Callose accumulation detected by aniline-blue

3. Dichotomous hyphae

44 4. Extensive growth in the infected cell

5. Developed primary hyphae growing extensively in neighboring cells.

6. ROS production associated to tips of developed hyphae in primary infected cells

7. Extensive ROS production (vesicles) in primary infected cells

5’. Secondary infected cells

6’ Secondary infected cells with ROS production in the hyphal tips

RESULTS

An overexpression cassette was created where the MGG_03356 coding region was placed behind the constitutive ribosomal protein promoter and fused with GFP. A second cassette was created using the MGG_03356 native promoter (1Kb upstream of the

ORF), and the coding region fused to eGFP. These constructs were used for protoplast transformation of M. oryzae isolates KJ201, PO6-6 and CHNOS. These isolates were selected based on their varying virulence across rice cultivars used (Table 3. 1).

Additionally KJ201 was selected by its high rate of growth, sporulation and virulence on rice cultivar Nipponbare. Transformants containing each construct will be referred as constituve and native respectfully. During the vegetative stage, MGG_003356 overexpression was preferentially localized to the conidial septa with faint expression in the mycelia. This pattern differs from the unfused GFP overexpression pattern where the protein is accumulated in cytoplasm of mycelia and conidia cells (Figure 3.1). Expression of this GFP or mRFP tagged gene under the control of the native promoter was only visible during the infection of the Nipponbare cultivar by the strain PO6-6

::MGG_03356:eGFP. This expression pattern was temporally limited to 24 hpi and spatially restricted to surrounding area of the appressorium with no relation to any

45 specific structure (Figure 3.2.)

Cytological evaluations of M. oryzae strains constitutively expressing

MGG_03356 as compared to wild type strains infecting sheaths of rice cultivars with different levels of resistance were obtained. Figure 3.3 shows the results of the of pathogenicity experiments testing the effect constitituve expression of MGG_03356 in multiple M. oryzae backgrounds infecting the rice cultivars Nipponbare, C101A51(Pi2), and 75-1-127(Pi9) (Appendix C). Representative images of each scored stage is described in the Material and Methods section and shown in Figure 3.4. KJ201 overexpression transformants were able to infect Nipponbare plants as determined by healthy globose invasive hyphae growing profusely before moving to the next cell (stage 5). KJ201 in Pi2 plants showed an intense autofluorescence reaction surrounding appressorium, neighboring cells, and initially infected cell accompanied by cytoplasmic granulation across the cell with little (stage 1) or no fungal growth (stage 0). This condition is indicative of a HR. However, for overexpression transformants during infection of Pi2, granulation was limited to immediately under the appressorium. Invasive hyphae showed a high degree of growth across the cells without a well defined necrosis in the initially infected cell. Later stages in infection (60 hpi) showed extensive vertical growth and proliferation. No growth or autofluorescent surrounding appressorium was visible.

Reduced growth accompanied by an intense vesiculation (stage 7) was observed in

MGG_03356::GFP infecting Pi-9 plants. In contrast, the predominant reaction in the wild-type is a HR response (stage 0).

Similar behavior was found using the PO6-6 background. No differences were observed in Nipponbare for either native or overexpressing transformants. However a

46 difference was observed in Pi2 and Pi9 leaf sheaths. Overexpression of this gene allows the fungus overcome the host resistance and colonize the plant cell. PO6-6 wild type is able to penetrate Pi2 cells but the growth is usually stopped before the hyphae can differentiate in globose form. Intense vesiculation is not observed when PO6-6 is attacking Pi9, and the penetrating hypha is able to grow and differentiate.

Overexpression CHNOS mutants in Nipponbare and Pi2 show a high degree of vesiculation accompanied by a reduced colonization of secondary cells compared with the wild type. This effect is highly dramatic during the infection of Pi2 plants, where overexpression mutants exhibited advanced vesiculation in primary infected cells and a low number of secondary colonized cells accompanied with vesiculation as well ROS production assayed using DAB. Callose accumulation was observed frequently in Pi2 plants infection when the fungus moved across the cell wall (Figure 3.4, Panel E.).

DISCUSION

MGG_03356 was identified as putative effector based on bioinformatics and experimental evidence. It was annotated as a small protein (~300 aminoacids) containing a signal peptide and was highly upregulated during stress condition and rice infection (Dean, unpublished data). Its transient expression in rice protoplasts showed that it was able to elicit cell death. However, its role during infection was unknown. Our results provide clues about the role of this gene during the Magnaporthe-rice interaction.

Previous experiments showed that the overexpression of this gene does not modify growth, sporulation, appressorium formation or germination rates but whole-plant experiments and drop-inoculation experiments (Appendix D) showed that it can alter lesion size and infection phenotypes. The PO6-6 P27:MGG_03356:GFP fluorescent

47 expression pattern (Figure 3.2) suggests that this gene is expressed during the early stages of the infection and is related with the appressorium formation and penetration of the host cells.

Sheath assay experiments using different M. oryzae backgrounds with different levels of virulence against rice-cultivars with varying levels of resistance shows that the constitutive expression of this gene during an incompatible interaction allows the pathogen to evade/overcome the initial HR response and move to later stages of infection.

The exception to this trend was the MGG_03356 CHNOS overexpression mutant infecting Pi9 while KJ201 and PO6-6 overexpression mutants do not show a high level of virulence. They were able to overcome the initial HR response but unable to progress to later stages of infection. One of the most dramatic effects on pathogenicity was observed during the infection of Pi2 plants by the KJ201 overexpression mutants. The wild type is not able to progress past stage 0 (HR-like reactions), but overexpression mutants are able to reach compatible interactions (stage 5) and colonize surrounding cells (stage 5’)

(Figures 3.3 and 3.4-Panels C-D). Similar effect was observed in a previous whole-plant infection experiment where the lesion size produced by the overexpression mutants on

C101A51(Pi2) plants was similar to those produced by KJ201 wild-type on Nipponbare plants (fully compatible interaction).

We hypothesized that MGG_03356 was in fact Avr-Pi2. Incompatible isolates overexpressing MGG_03356 broke the Pi2 resistance in transgenic Nipponbare rice cultivar harboring Pi2 resistant gene, but the effect in the transgenic line was not similar in intensity to the effect in the C101A51(Pi2) isogenic line (Appendix E). The genetic and molecular evidence do not support this hypothesis. Different linkage segregation

48 maps and two full genome sequences are available allowing an estimate of the localization of the possible locus for a predicted AVR-Pi2 gene. Localization of the reported microsatellite markers and RFLPs (Feng et al. 2007) in the Magnaporthe genome assembly 6 and 7 show localization of AVR-Pi2 to chromosome 6, while the localization of MGG_03356 is chromosome 4.

Synteny block analysis using the homology search program Pattern Hunter (Ma et al. 2002) of chromosome 4 allows finding similar regions containing the gene in the related fungus M. poae and Gaeumannomyces graminis var. tritici. A closer look reveals isoforms of this gene. The M. poae isoform contains 2 exons with different biochemical domains assigned. Exon 1 resembles a pectin-lyase like domain and exon 2 a ricin B lectin. G. graminis contains an isoform without exon 2 and with an additional exon (exon

4 with a non-recognizable biochemical domain) not present in M. oryzae or M. poae.

Ricin B lectin is a domain reported able to bind terminal galactose residues on the cell surfaces. The pectin lyase motif (Yadav et al. 2009; Yadav et al. 2009) is common to these three pathogens in this locus (Figure 3.5) and may play an important role in the infective process (Rogers et al. 2000; Cotoras and Silva 2005; Reignault et al. 2008).

How does the overexpression of a pectin-lyase gene lead to a decrease in the initial HR response of the host? During the last decades the presumed passive function of the plant cell wall has changed to a dynamic role in conjunction with the plasma membrane and the cytoskeleton. The plant cell wall is able to perceive changes related with plant development or external factors. MCA1, a calcium channel protein, is able to sense mechanical stress (Nakagawa et al. 2007), and previously described receptors are able to respond to polysaccharide fragments or pathogen elicitors (Humphrey et al. 2007).

49 Some include direct interactions with matrix polymers and proteins of the cell wall in a similar manner as integrin proteins in mammals. Integrins are receptors able to detect variations related with its neighboring cells and the extracellular matrix (ECM). They are able to play important roles in cell signaling and pathogen detection. Integrins are also able to detect a breakout of the extracellular matrix and transfer this signal to the cytosol

(Hématy et al. 2009). In the case of plants, evidence of similar integrins-like proteins able to sense mechanical distortions in cytoskeleton or cell wall has been reported (Telewski

2006). Apoplastic domains of these proteins are embedded in the plant ECM or interact directly with the ECM components. Cytoplasmic domains interact directly or indirectly with the cytoskeleton and the signal travels downstream using different circuits. These proteins include receptor-like kinases with different extracellular domains: wall- associated kinases (WAKs), proline-rich extensin-like receptor kinases and carbohydrate- binding motif kinases. It has been demonstrated that WAKs are embedded in the pectin matrix of cell wall (Anderson et al. 2001). On the other hand, in animal cells, integrins are responsive to peptides containing the RGD (Arg-Gly-Asp) motif. Treatment with

RGD peptides of cell plants affects different processes including gravisensing, the plasmolytic cycle, growth and differentiation, cytoplasmic streaming, formation of

Hechtian strands, and the plant defense response to fungal infection (Hématy et al. 2009).

These last two processes are important in our case. Hechtian strands are contact points between the cell wall and the plasma membrane, containing actin filaments and microtubles. This is evidence of its role in the signal transduction from the cell wall into the cytoplasm. Decrease of these Hechtian strands during the chickpea invasion by the rust fungus Uromyces vignae resulted in a concomitant decreasing of ROS reactions or

50 cell wall appositions (Mellersh and Heath 2001). Additionally, pectin is strongly attached to the wall associated kinases (WAK). One member of this family, WAK1 is involved in pathogenesis and it has been detected in pea, tobacco and maize (Decreux and Messiaen

2005). Orthologs of WAK1 are present in rice, poplar, grapevine, sorghum and

Brachypodium.

A hypothetical mechanism can explain how the overexpression of this pectin lyase gene allows the pathogen to evade the initial host recognition and delay the HR response, producing the differences observed in pathogenicity. Overexpression of the pectin lyase coded by MGG_03356 gene overexpression mutants may break the pectin layer of the cell wall and avoid the mechanical sensory of cell-wall integrity via WAK1 or

Hechtian strands. A decreasing number of Hechtian strands decrease the possibility of triggering HR mechanisms: ROS and cell wall depositions (callose), but does not interfere with later mechanisms of control against the pathogen. The fluorescence pattern exhibited by the strain PO6-6 expressing a GFP-tagged version of this gene under its native promoter offers more evidence for this hypothesis. MGG_03356 is preferentially expressed in the early stages of infection during the penetration of the plant cell.

Previous studies have been demonstrated that differences in pathogenicity or infection phenotypes in host-pathogen interactions can be explained by or related to delayed HR responses (Vleeshouwers et al. 2000; Kruger et al. 2003; Tufan et al. 2009).

A study of Blumeria graminis infecting the isogenic line of barley Pallas harboring different powdery mildew resistant (PM-R) genes found that all infection phenotypes observed can be classified in fast, intermediate or slow-acting responses (Kruger et al.

2003). During a fast response, no development of the fungus is allowed and is mediated

51 by an intense HR response and/or entrance resistance (this study suggests that for this specific response callose accumulation). Intermediate infection phenotype allows a poor growth of the pathogen while slow acting response allowed robust hyphal growth with its growth at 72 hpi similar to the wild type. Intermediate and slow response infection phenotypes showed different levels and timing for the HR response and defense response genes expression. Kruger et al (2003) proposed that variation of time periods for the HR response is mediated by interactions of a single resistant gene affecting a complex network of accumulative signals that control the HR response. A similar hypothesis is proposed by this research where the overexpression of the MGG_03356 effector is able to delay the recognition of the pathogen decreasing the accumulation of defense signals and delaying but not suppressing the HR response.

In conclusion, we characterized a novel effector possibly involved in the reduction of the mechanical sensing of infection via pectin degradation. Considering that its overexpression does not produce an observable phenotype during the vegetative stage,

MGG_03356 can be considered a true effector in the biological definition. Phenotypes linked to overexpression or knockout condition were only evident during the host- pathogen interaction. Additional evidence showing enhanced pectin-lyase enzymatic activity by overexpression transformants compared with wild type or native transformants are required to support this hypothesis.

52 Virulence on cultivars Isolates Origen Nipponba Pi2 Pi9 re C101A51 75-1-127 Additional description Highest rate of growth, sporulation KJ201 Korea S R R and Nipponbare virulence

PO6-6 Philippines S R R

Virulent on cultivars harboring Pi2 CHNOS China S S R resistant gene

Table 3.1. Description of the virulence of the M. oryzae backgrounds over rice cultivars harboring different alleles for the Pi2/Pi9 locus (Liu et al. 2002). S: susceptible, R: resistant.

53 Figure 3.1. Overexpression of MGG_03356 driven by P27 promoter in the M. oryzae strains CHNOS, PO6-6 and KJ201 . Left column, bright field images and green fluorescent images were merged. Middle column, green fluorescent images. Right column, autofluorescent and green fluorescent images were merged. cs, conidial septa.

54 A.

f ap

55 Figure 3.3. Percentage distribution of infection stages for overexpression and native expression of MGG_03356 under different host-pathogen interactions. Rice cultivars used are the susceptible cultivar Nipponbare, and 2 resistant isogenic lines harboring different orthologous resistant genes in the locus Pi2/9: C101A51 harboring the resistant gene Pi2 and 75-1-127 harboring Pi9.

56 Continued

Figure 3.4. Infection stages of Magnaporthe oryzae at 36hpi. S0 to S7 defines different stages of infection development described in Material and Methods and Figure 3.3. The second term corresponds to the Magnaporthe background used and the third one describes the constitutive (C) and native (N) condition of MGG_03356 expression. The last term describe the rice cultivar infected. For panels A to D, ROS production was detected using DAB. ROS production was detected in the stages 0, 6, 7 and 6’. A, stage 0 (SO) are showed for different interactions. B, stages 1 to 3 show scarce hyphal growth. Citoplasmic granulation is evident in S1, but ROS production is absent. Invasive hyphae in S2 and S3 do not have the characteristic globose appearance and contains cytoplasmic vacuoles. C, stages 4 to 6 describe different levels of growth. Massive growth is visible in the susceptible cultivar Nipponbare, being examples of compatible interactions D, stages 7 showing different levels of vesicular ROS. S7 KJ201 C Pi9 shows intense ROS vesiculation in primary infected cell and in neighboring colonized cells (stage 6’). The last two panels show intense vesiculation limited to the primary infected cell with different levels of growth. ap, appressorium; v, fungal vacuoles; ih, invasive hyphae; bv, brown vesicles. E. Aniline accumulation during infection of Pi2 plants by PO6-6 strains.

57 Figure. 3.4 continued

Continued

58 Figure 3.4 continued

Continued

59 Figure 3.4 continued

Continued

60 Figure 3.4 continued

Continued

61 G. graminis

M. poae

M. oryzae

0 200 400 600 800 1000 1200 1400 Pares de bases

Exon 1 Exon 2 Exon 3

Figure 3.5. Structure of the gene MGG_03356 in Magnaporthe oryzae, M. poae and G. graminis.

62 LIST OF REFERENCES

Anderson, C. M., T. A. Wagner, M. Perret, Z. H. He, D. He, and B. D. Kohorn. 2001. WAKs: cell wall-associated kinases linking the cytoplasm to the extracellular matrix. Plant Molecular Biology 47, no. 1: 197-206. Berruyer, R., S. Poussier, P. Kankanala, G. Mosquera, and B. Valent. 2006. Quantitative and qualitative influence of inoculation methods on in planta growth of rice blast fungus. Phytopathology 96, no. 4: 346-355. Chen, S., P. Songkumarn, J. Liu, and G. L. Wang. 2009. A versatile zero background T- vector system for gene cloning and functional genomics. Plant physiology 150, no. 3: 1111. Chi, M. H., S. Y. Park, S. Kim, and Y. H. Lee. 2009. A novel pathogenicity gene is required in the rice blast fungus to suppress the basal defenses of the host. PLoS Pathog 5: e1000401. Choi, J., Y. Kim, S. Kim, J. Park, and Y. H Lee. 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genetics and Biology 46, no. 3: 243-254. Cotoras, M., and E. Silva. 2005. Differences in the initial events of infection of Botrytis cinerea strains isolated from tomato and grape. Mycologia 97, no. 2: 485. Decreux, A., and J. Messiaen. 2005. Wall-associated kinase WAK1 interacts with cell wall pectins in a calcium-induced conformation. Plant and Cell Physiology 46, no. 2: 268. Dietrich, R. A, T. P Delaney, S. J Uknes, E. R Ward, J. A Ryals, and J. L Dangl. 1994. Arabidopsis mutants simulating disease resistance response. Cell 77, no. 4: 565- 577. Feng, S. J., J. H. Ma, F. Lin, L. Wang, and Q. H. Pan. 2007. Construction of an electronic physical map of Magnaporthe oryzae using genomic position-ready SSR markers. Chinese Science Bulletin 52, no. 24: 3346-3354. Guo-Liang Wang, Pattavipha Songkumarn, and Songbiao Chen. 2009. MGG_00194 and MGG_03356 are elicitors of cell-death. Personal communication Hématy, K., C. Cherk, and S. Somerville. 2009. Host-pathogen warfare at the plant cell wall. Current opinion in plant biology 12, no. 4: 406-413. Humphrey, T. V., D. T. Bonetta, and D. R. Goring. 2007. Sentinels at the wall: cell wall receptors and sensors. New Phytologist 176, no. 1: 7-21. Kankanala, P. 2007. Cell biology and gene expression profiling during the early biotrophic invasion by the rice blast fungus Magnaporthe oryzae. Khang, C., R. Berruyer, S. Park, P. Kankanala, K. Czymmek, S. Kang, and B. Valent. 2008. Blast Interfacial Complex, a novel in planta structure that accumulates effector proteins of rice blast fungus Magnaporthe oryzae. Phytopathology 98, no. 6. Khang, C. H., R. Berruyer, M. C. Giraldo, P. Kankanala, S. Y. Park, K. Czymmek, S.

63 Kang, and B. Valent. 2010. Translocation of Magnaporthe oryzae effectors into rice cells and their subsequent cell-to-cell movement. The Plant Cell Online 22, no. 4: 1388. Kim, S., I. P. Ahn, H. S. Rho, and Y. H. Lee. 2005. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Molecular microbiology 57, no. 5: 1224-1237. Kruger, W. M., L. J. Szabo, and R. J. Zeyen. 2003. Transcription of the defense response genes chitinase IIb, PAL and peroxidase is induced by the barley powdery mildew fungus and is only indirectly modulated by R genes. Physiological and Molecular Plant Pathology 63, no. 3: 167-178. Liu, G., G. Lu, L. Zeng, and G. L Wang. 2002. Two broad-spectrum blast resistance genes, Pi9 (t) and Pi2 (t), are physically linked on rice chromosome 6. Molecular Genetics and Genomics 267, no. 4: 472-480. Ma, B., J. Tromp, and M. Li. 2002. PatternHunter: faster and more sensitive homology search. Bioinformatics 18, no. 3: 440. Mellersh, D. G., and M. C. Heath. 2001. Plasma membrane-cell wall adhesion is required for expression of plant defense responses during fungal penetration. The Plant Cell Online 13, no. 2: 413. Mendgen, K., and M. Hahn. 2002. Plant infection and the establishment of fungal biotrophy. Trends in plant science 7, no. 8: 352-356. Mosquera, G., M. C. Giraldo, C. H. Khang, S. Coughlan, and B. Valent. 2009. Interaction transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as biotrophy- associated secreted proteins in rice blast disease. The Plant Cell Online 21, no. 4: 1273. Mosquera-Cifuentes, Gloria. 2007. Analysis of the interaction transcriptome during biotrophic invasion of rice by the blast fungus, Magnaporthe oryzae. Nakagawa, Y., T. Katagiri, K. Shinozaki, Z. Qi, H. Tatsumi, T. Furuichi, A. Kishigami, M. Sokabe, I. Kojima, and S. Sato. 2007. Arabidopsis plasma membrane protein crucial for Ca2+ influx and touch sensing in roots. Proceedings of the National Academy of Sciences 104, no. 9: 3639. O’Connell, R. J., and R. Panstruga. 2006. Tete a tete inside a plant cell: establishing compatibility between plants and biotrophic fungi and oomycetes. New Phytologist 171, no. 4: 699-718. Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Current Opinion in Plant Biology 6, no. 4: 320-326. Perfect, S. E., and J. R. Green. 2001. Infection structures of biotrophic and hemibiotrophic fungal plant pathogens. Molecular Plant Pathology 2, no. 2: 101- 108. Reignault, P., O. Valette-Collet, and M. Boccara. 2008. The importance of fungal pectinolytic enzymes in plant invasion, host adaptability and symptom type. European Journal of Plant Pathology 120, no. 1: 1-11. Rogers, L. M, Y. K Kim, W. Guo, L. González-Candelas, D. Li, and P. E Kolattukudy. 2000. Requirement for either a host-or pectin-induced pectate lyase for infection of Pisum sativum by Nectria hematococca. Proceedings of the National Academy of Sciences of the United States of America 97, no. 17: 9813. Shan, and P. Goodwin. 2004. Monitoring host nuclear migration and degradation with

64 green fluorescent protein during compatible and incompatible interactions of Nicotiana tabacum with Colletotrichum species. Journal of Phytopathology 152, no. 8 9: 454-460. Sweigard, J. A., F. Chumley, A. Carroll, L. Farrall, and B. Valent. 1997. A series of vectors for fungal transformation. Fungal Genetics Newsletter: 52-53. Telewski, Frank W. 2006. A unified hypothesis of mechanoperception in plants. Am. J. Bot. 93, no. 10: 1466-1476. Tufan, H. A, G. R.D McGrann, A. Magusin, J. B Morel, L. Miché, and L. A Boyd. 2009. Wheat blast: histopathology and transcriptome reprogramming in response to adapted and nonadapted Magnaporthe isolates. New Phytologist 184, no. 2: 473- 484. Valent, B., C. H. Khang, M. C. Giraldo, G. Mosquera, R. Berruyer, P. Kankanala, M. Yi, K. Czymmek, and S. Park. 2009. The biotrophic interfacial complex and effector translocation during rice blast disease. Phytopathology 99, no. 6. Vleeshouwers, V. G.A.A, W. van Dooijeweert, F. Govers, S. Kamoun, and L. T Colon. 2000. The hypersensitive response is associated with host and nonhost resistance to Phytophthora infestans. Planta 210, no. 6: 853-864. Yadav, P. K., V. K. Singh, S. Yadav, K. D.S Yadav, and D. Yadav. 2009. In silico analysis of pectin lyase and pectinase sequences. Biochemistry (Moscow) 74, no. 9: 1049- 1055. Yadav, S., P. K Yadav, D. Yadav, and K. D.S Yadav. 2009. Pectin lyase: a review. Process Biochemistry 44, no. 1: 1-10.

65 BIBLIOGRAPHY

Abramovitch, R. B., and G. B. Martin. 2004. Strategies used by bacterial pathogens to suppress plant defenses. Current Opinion in Plant Biology 7, no. 4: 356-364. Alfano, J. R. 2009. Roadmap for future research on plant pathogen effectors. Molecular plant pathology 10, no. 6: 805-813. Alfano, J. R., and A. Collmer. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Phytopathology 42, no. 1: 385. Anderson, C. M., T. A. Wagner, M. Perret, Z. H. He, D. He, and B. D. Kohorn. 2001. WAKs: cell wall-associated kinases linking the cytoplasm to the extracellular matrix. Plant Molecular Biology 47, no. 1: 197-206. Balhadère, P. V., A. J. Foster, and N. J. Talbot. 1999. Identification of pathogenicity mutants of the rice blast fungus Magnaporthe grisea by insertional mutagenesis. Molecular Plant-Microbe Interactions 12, no. 2: 129-142. Berruyer, R., S. Poussier, P. Kankanala, G. Mosquera, and B. Valent. 2006. Quantitative and qualitative influence of inoculation methods on in planta growth of rice blast fungus. Phytopathology 96, no. 4: 346-355. Bohnert, H. U., I. Fudal, W. Dioh, D. Tharreau, J. L. Notteghem, and M. H. Lebrun. 2004. A putative polyketide synthase/peptide synthetase from Magnaporthe grisea signals pathogen attack to resistant rice. The Plant Cell Online 16, no. 9: 2499. Braam, J. 2005. In touch: plant responses to mechanical stimuli. New Phytologist 165, no. 2: 373-389. Cannon, P. F., and P. M. Kirk. 2007. Fungal families of the world. CABI Publishing. Casasoli, M., I. Meliciani, F. Cervone, G. De Lorenzo, and B. Mattei. 2007. Oligogalacturonide-induced changes in the nuclear proteome of Arabidopsis thaliana. International Journal of Mass Spectrometry 268, no. 2-3: 277-283. Chang, J.H., A.K. Goel, S.R. Grant, and J.L. Dangl. 2004. Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Current opinion in microbiology 7, no. 1: 11-18. Chen, S., M. Gowda, R. C. Venu, P. Songkumarn, C. H Park, M. Bellizzi, D. J Ebbole, and G. L Wang. 2009. Isolation and Functional Analysis of Putative Effectors from Magnaporthe oryzae Using Integrated Genomic Approaches. Advances in Genetics, Genomics and Control of Rice Blast Disease: 93-103. Chen, S., P. Songkumarn, J. Liu, and G. L. Wang. 2009. A versatile zero background T- vector system for gene cloning and functional genomics. Plant physiology 150, no. 3: 1111. Chi, M. H., S. Y. Park, S. Kim, and Y. H. Lee. 2009. A novel pathogenicity gene is required in the rice blast fungus to suppress the basal defenses of the host. PLoS Pathog 5: e1000401. Chisholm, S. T., G. Coaker, B. Day, and B. J. Staskawicz. 2006. Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, no. 4:

66 803-814. Choi, J., Y. Kim, S. Kim, J. Park, and Y. H Lee. 2009. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genetics and Biology 46, no. 3: 243-254. Cotoras, M., and E. Silva. 2005. Differences in the initial events of infection of Botrytis cinerea strains isolated from tomato and grape. Mycologia 97, no. 2: 485. Couch, B. C., I. Fudal, M. H. Lebrun, D. Tharreau, B. Valent, P. Van Kim, J. L. Nottéghem, and L. M. Kohn. 2005. Origins of host-specific populations of the blast pathogen Magnaporthe oryzae in crop domestication with subsequent expansion of pandemic clones on rice and weeds of rice. Genetics 170, no. 2: 613. Couch, B. C., and L. M. Kohn. 2002. A multilocus gene genealogy concordant with host preference indicates segregation of a new species, Magnaporthe oryzae, from M. grisea. Mycologia 94, no. 4: 683. Dawkins, R. 1999. The extended phenotype: The long reach of the gene. Oxford University Press, USA. De, Wit, Jgm Pierre, R. Mehrabi, B. Van Den, A. Harrold, and I. Stergiopoulos. 2009. Fungal effector proteins: past, present and future. Molecular plant pathology 10, no. 6: 735-747. Dean, R. A., N. J. Talbot, D. J. Ebbole, M. L. Farman, T. K. Mitchell, M. J. Orbach, M. Thon, R. Kulkarni, J. R. Xu, and H. Pan. 2005. The genome sequence of the rice blast fungus Magnaporthe grisea. Nature 434, no. 7036: 980-986. Decreux, A., and J. Messiaen. 2005. Wall-associated kinase WAK1 interacts with cell wall pectins in a calcium-induced conformation. Plant and Cell Physiology 46, no. 2: 268. DeZwaan, T. M., A. M. Carroll, B. Valent, and J. A. Sweigard. 1999. Magnaporthe grisea pth11p is a novel plasma membrane protein that mediates appressorium differentiation in response to inductive substrate cues. The Plant Cell Online 11, no. 10: 2013. Diener, Andrew C, and Frederick M Ausubel. 2005. Resistance to Fusarium oxysporum1, a dominant Arabidopsis disease-resistance gene, is not race specific. Genetics 171, no. 1: 305. Dietrich, R. A, T. P Delaney, S. J Uknes, E. R Ward, J. A Ryals, and J. L Dangl. 1994. Arabidopsis mutants simulating disease resistance response. Cell 77, no. 4: 565- 577. van der Does, H. C., and M. Rep. 2007. Virulence genes and the evolution of host specificity in plant-pathogenic fungi. Molecular Plant-Microbe Interactions 20, no. 10: 1175-1182. Espinosa, A., and J. R. Alfano. 2004. Disabling surveillance: bacterial type III secretion system effectors that suppress innate immunity. Cellular Microbiology 6, no. 11: 1027-1040. Farman, M. L. 2002. Pyricularia grisea isolates causing gray leaf spot on perennial ryegrass (Lolium perenne) in the United States: Relationship to P. grisea isolates from other host plants. Phytopathology 92, no. 3: 245-254. Feng, S. J., J. H. Ma, F. Lin, L. Wang, and Q. H. Pan. 2007. Construction of an electronic physical map of Magnaporthe oryzae using genomic position-ready SSR markers.

67 Chinese Science Bulletin 52, no. 24: 3346-3354. Field, R. A. 2009. Oligosaccharide Signalling Molecules. Plant-derived Natural Products: 349-359. Filippi, M. C., and A. S. Prabhu. 2001. Phenotypic virulence analysis of Pyricularia grisea isolates from Brazilian upland rice cultivars. Pesquisa Agropecuária Brasileira 36: 27-35. Flor, H. H. 1971. Current status of the gene-for-gene concept. Annual Review of Phytopathology 9, no. 1: 275-296. Freeman, J., and E. Ward. 2004. Gaeumannomyces graminis, the take all fungus and its relatives. Molecular Plant Pathology 5, no. 4: 235-252. Fudal, I., J. Collemare, H. U. Bohnert, D. Melayah, and M. H. Lebrun. 2007. Expression of Magnaporthe grisea avirulence gene ACE1 is connected to the initiation of appressorium-mediated penetration. Eukaryotic cell 6, no. 3: 546. Gabriel, D. W., and B. G. Rolfe. 1990. Working models of specific recognition in plant- microbe interactions. Annual Review of Phytopathology 28, no. 1: 365-391. Galán, J. E. 2009. Common themes in the design and function of bacterial effectors. Cell host & microbe 5, no. 6: 571-579. García-Olmedo, F., P. Rodríguez-Palenzuela, A. Molina, J. M. Alamillo, E. López- Solanilla, M. Berrocal-Lobo, and C. Poza-Carrión. 2001. Antibiotic activities of peptides, hydrogen peroxide and peroxynitrite in plant defence. FEBS letters 498, no. 2-3: 219-222. Gilbert, R. D., A. M. Johnson, and R. A. Dean. 1996. Chemical signals responsible for appressorium formation in the rice blast fungus Magnaporthe grisea. Physiological and Molecular Plant Pathology 48, no. 5 (May): 335-346. doi:doi: DOI: 10.1006/pmpp.1996.0027. Goff, S. A., D. Ricke, T. H. Lan, G. Presting, R. Wang, M. Dunn, J. Glazebrook, A. Sessions, P. Oeller, and H. Varma. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296, no. 5565: 92. Gouget, A., V. Senchou, F. Govers, A. Sanson, A. Barre, P. Rouge, R. Pont-Lezica, and H. Canut. 2006. Lectin receptor kinases participate in protein-protein interactions to mediate plasma membrane-cell wall adhesions in Arabidopsis. Plant physiology 140, no. 1: 81. Grayer, R. J., and T. Kokubun. 2001. Plant-fungal interactions: the search for phytoalexins and other antifungal compounds from higher plants. Phytochemistry 56, no. 3: 253-263. Guo-Liang Wang, Pattavipha Songkumarn, and Songbiao Chen. 2009. MGG_00194 and MGG_03356 are elicitors of cell-death. Personal communication. Haldar, K., S. Kamoun, N. L. Hiller, S. Bhattacharje, and C. Van Ooij. 2006. Common infection strategies of pathogenic eukaryotes. Nature Reviews Microbiology 4, no. 12: 922-931. Harrison, M. J. 2005. Signaling in the arbuscular mycorrhizal symbiosis. Microbiology 59, no. 1: 19. He, Z. H., M. Fujiki, and B. D. Kohorn. 1996. A cell wall-associated, receptor-like protein kinase. Journal of Biological Chemistry 271, no. 33: 19789. Hefferin, M. L., and A. E. Tomkinson. 2005. Mechanism of DNA double-strand break repair by non-homologous end joining. DNA repair 4, no. 6: 639-648.

68 Hématy, K., C. Cherk, and S. Somerville. 2009. Host-pathogen warfare at the plant cell wall. Current opinion in plant biology 12, no. 4: 406-413. Hématy, K., P. E. Sado, A. Van Tuinen, S. Rochange, T. Desnos, S. Balzergue, S. Pelletier, J. P. Renou, and H. Höfte. 2007. A receptor-like kinase mediates the response of Arabidopsis cells to the inhibition of cellulose synthesis. Current Biology 17, no. 11: 922-931. Hogenhout, S. A., R. A. L. Van der Hoorn, R. Terauchi, and S. Kamoun. 2009. Emerging concepts in effector biology of plant-associated organisms. Molecular Plant- Microbe Interactions 22, no. 2: 115-122. van der Hoorn, R. A. L., and S. Kamoun. 2008. From guard to decoy: a new model for perception of plant pathogen effectors. The Plant Cell Online 20, no. 8: 2009. Humphrey, T. V., D. T. Bonetta, and D. R. Goring. 2007. Sentinels at the wall: cell wall receptors and sensors. New Phytologist 176, no. 1: 7-21. Hynes, R. O. 2002. Integrins:: Bidirectional, Allosteric Signaling Machines. Cell 110, no. 6: 673-687. Ingle, R. A., K. J. Denby, . ., and M. Carstens. 2006. PAMP recognition and the plant- pathogen arms race. Bioessays 28, no. 9: 880-889. Jacobs, A. K., V. Lipka, R. A. Burton, R. Panstruga, N. Strizhov, P. Schulze-Lefert, and G. B. Fincher. 2003. An Arabidopsis callose synthase, GSL5, is required for wound and papillary callose formation. The Plant Cell Online 15, no. 11: 2503. Jeong, J. S, T. K Mitchell, and R. A Dean. 2007. The Magnaporthe grisea snodprot1 homolog, MSP1, is required for virulence. FEMS microbiology letters 273, no. 2: 157-165. Jia, Y., X. Wang, S. Costanzo, and S. Lee. 2009. Understanding the Co-evolution of the Rice Blast Resistance Gene PI-TA and Magnaporthe oryzae Avirulence Gene AVR-PITA. Advances in Genetics, Genomics and Control of Rice Blast Disease: 137-147. Jones, D.A., and D. Takemoto. 2004. Plant innate immunity-direct and indirect recognition of general and specific pathogen-associated molecules. Current opinion in immunology 16, no. 1: 48-62. Jones, J., and J. Dangl. 2006. The plant immune system. Nature 444, no. 7117: 323-329. Kamoun. 2007. Groovy times: filamentous pathogen effectors revealed. Current opinion in plant biology 10, no. 4: 358-365. van Kan, J. A. L., G. Van den Ackerveken, and P. De Wit. 1991. Cloning and characterization of cDNA of avirulence gene avr9 of the fungal pathogen Cladosporium fulvum, causal agent of tomato leaf mold. Mol. Plant-Microbe Interact 4: 52-59. Kang, S., J. A. Sweigard, . ., and B. Valent. 1995. The PWL host specificity gene family in the blast fungus Magnaporthe grisea. MPMI-Molecular Plant Microbe Interactions 8, no. 6: 939-948. Kankanala, P. 2007. Cell biology and gene expression profiling during the early biotrophic invasion by the rice blast fungus Magnaporthe oryzae. Kankanala, P., K. Czymmek, and B. Valent. 2007. Roles for rice membrane dynamics and plasmodesmata during biotrophic invasion by the blast fungus. The Plant Cell Online 19, no. 2: 706. Kankanala, P., G. Mosquera, C. H. Khang, G. Valdovinos-Ponce, and B. Valent. 2009.

69 Cellular and Molecular Analyses of Biotrophic Invasion in Rice Blast Disease. Advances in Genetics, Genomics and Control of Rice Blast Disease: 83-91. Kasprowicz, A., D. Kierzkowski, M. Maruniewicz, M. Derba-Maceluch, E. Rodakowska, P. Zawadzki, A. Szuba, and P. Wojtaszek. 2009. Mechanical Integration of Plant Cells. Plant-Environment Interactions: 1-20. Khang, C., R. Berruyer, S. Park, P. Kankanala, K. Czymmek, S. Kang, and B. Valent. 2008. Blast Interfacial Complex, a novel in planta structure that accumulates effector proteins of rice blast fungus Magnaporthe oryzae. Phytopathology 98, no. 6. Khang, C. H., R. Berruyer, M. C. Giraldo, P. Kankanala, S. Y. Park, K. Czymmek, S. Kang, and B. Valent. 2010. Translocation of Magnaporthe oryzae effectors into rice cells and their subsequent cell-to-cell movement. The Plant Cell Online 22, no. 4: 1388. Khush, G. S. 2005. What it will take to feed 5.0 billion rice consumers in 2030. Plant molecular biology 59, no. 1: 1-6. Khush, G. S., and G. H. Toenniessen. 1991. Rice biotechnology. CABI. Kim, S., I. P. Ahn, H. S. Rho, and Y. H. Lee. 2005. MHP1, a Magnaporthe grisea hydrophobin gene, is required for fungal development and plant colonization. Molecular microbiology 57, no. 5: 1224-1237. Kirk, P. M., P. F. Cannon, D. W. Minter, and J. A. Stalpers. 2008. Dictionary of the Fungi. 10. Wallingford: CABI. Kruger, W. M., L. J. Szabo, and R. J. Zeyen. 2003. Transcription of the defense response genes chitinase IIb, PAL and peroxidase is induced by the barley powdery mildew fungus and is only indirectly modulated by R genes. Physiological and Molecular Plant Pathology 63, no. 3: 167-178. Kück, U., and B. Hoff. 2010. New tools for the genetic manipulation of filamentous fungi. Applied microbiology and biotechnology 86, no. 1: 51-62. Kunze, G., C. Zipfel, S. Robatzek, K. Niehaus, T. Boller, and G. Felix. 2004. The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. The Plant Cell Online 16, no. 12: 3496. Levin, D. E. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiology and molecular biology reviews 69, no. 2: 262. Liu, G., G. Lu, L. Zeng, and G. L Wang. 2002. Two broad-spectrum blast resistance genes, Pi9 (t) and Pi2 (t), are physically linked on rice chromosome 6. Molecular Genetics and Genomics 267, no. 4: 472-480. Ludin, K. M., N. Hilti, and M. E. Schweingruber. 1995. Schizosaccharomyces pombe rds1, an adenine-repressible gene regulated by glucose, ammonium, phosphate, carbon dioxide and temperature. Molecular and General Genetics MGG 248, no. 4: 439-445. Ma, B., J. Tromp, and M. Li. 2002. PatternHunter: faster and more sensitive homology search. Bioinformatics 18, no. 3: 440. Mansfield, J. W. 1983. Antimicrobial compounds. Biochemical plant pathology: 237-265. Mellersh, D. G., and M. C. Heath. 2001. Plasma membrane-cell wall adhesion is required for expression of plant defense responses during fungal penetration. The Plant Cell Online 13, no. 2: 413. Mendgen, K., and M. Hahn. 2002. Plant infection and the establishment of fungal

70 biotrophy. Trends in plant science 7, no. 8: 352-356. Mishina, T. E., and J. Zeier. 2007. Pathogen associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in Arabidopsis. The Plant Journal 50, no. 3: 500- 513. Morrissey, J.P., and A.E. Osbourn. 1999. Fungal Resistance to Plant Antibiotics as a Mechanism of Pathogenesis. Microbiol. Mol. Biol. Rev. 63, no. 3: 708-724. Mosquera, G., M. C. Giraldo, C. H. Khang, S. Coughlan, and B. Valent. 2009. Interaction transcriptome analysis identifies Magnaporthe oryzae BAS1-4 as biotrophy- associated secreted proteins in rice blast disease. The Plant Cell Online 21, no. 4: 1273. Mosquera-Cifuentes, Gloria. 2007. Analysis of the interaction transcriptome during biotrophic invasion of rice by the blast fungus, Magnaporthe oryzae. Nakagawa, Y., T. Katagiri, K. Shinozaki, Z. Qi, H. Tatsumi, T. Furuichi, A. Kishigami, M. Sokabe, I. Kojima, and S. Sato. 2007. Arabidopsis plasma membrane protein crucial for Ca2+ influx and touch sensing in roots. Proceedings of the National Academy of Sciences 104, no. 9: 3639. Nickle, T. C., and D. W. Meinke. 1998. A cytokinesis defective mutant of Arabidopsis (cyt1) characterized by embryonic lethality, incomplete cell walls, and excessive callose accumulation. The Plant Journal 15, no. 3: 321-332. Nishimura, M. T., M. Stein, B. H. Hou, J. P. Vogel, H. Edwards, and S. C. Somerville. 2003. Loss of a callose synthase results in salicylic acid-dependent disease resistance. Science 301, no. 5635: 969. Nuernberger, T., and V. Lipka. 2005. Non-host resistance in plants: new insights into an old phenomenon. Molecular Plant Pathology 6, no. 3: 335-345. Nutsugah, S.K., J.K. Twumasi, Y Chipili, and S Sreenivasaprasad. 2008. Diversity of the rice blast pathogen in Ghana and strategies for resistance management. Plant Pathology Journal 7, no. 1: 109-113. O’Connell, R. J., and R. Panstruga. 2006. Tete a tete inside a plant cell: establishing compatibility between plants and biotrophic fungi and oomycetes. New Phytologist 171, no. 4: 699-718. Oerke, E. C., and H. W. Dehne. 2004. Safeguarding production--losses in major crops and the role of crop protection. Crop Protection 23, no. 4: 275-285. Oliva, Ricardo, Joe Win, Sylvain Raffaele, Laurence Boutemy, Tolga O. Bozkurt, Angela Chaparro-Garcia, Maria Eugenia Segretin, et al. 2010. Recent developments in effector biology of filamentous plant pathogens. Cellular Microbiology 12, no. 6: 705-715. Osbourn, A. E. 1996. Preformed antimicrobial compounds and plant defense against fungal attack. The Plant Cell 8, no. 10: 1821. Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic pathogens. Current Opinion in Plant Biology 6, no. 4: 320-326. Park, G., K. S. Bruno, C. J. Staiger, N. J. Talbot, and J. R. Xu. 2004. Independent genetic mechanisms mediate turgor generation and penetration peg formation during plant infection in the rice blast fungus. Molecular microbiology 53, no. 6: 1695-1707. Perfect, S. E., and J. R. Green. 2001. Infection structures of biotrophic and hemibiotrophic fungal plant pathogens. Molecular Plant Pathology 2, no. 2: 101-

71 108. Pilling, E., and H. Höfte. 2003. Feedback from the wall. Current opinion in plant biology 6, no. 6: 611-616. Prell, H. H., and P. R. Day. 2001. Plant-fungal pathogen interaction: a classical and molecular view. Springer Verlag. Rairdan, G., and P. Moffett. 2007. Brothers in arms? Common and contrasting themes in pathogen perception by plant NB-LRR and animal NACHT-LRR proteins. Microbes and Infection 9, no. 5: 677-686. Reignault, P., O. Valette-Collet, and M. Boccara. 2008. The importance of fungal pectinolytic enzymes in plant invasion, host adaptability and symptom type. European Journal of Plant Pathology 120, no. 1: 1-11. Ribot, C., J. Hirsch, S. Balzergue, D. Tharreau, J. L. Nottéghem, M. H. Lebrun, and J. B. Morel. 2008. Susceptibility of rice to the blast fungus, Magnaporthe grisea. Journal of plant physiology 165, no. 1: 114-124. Rogers, C. W., M. P. Challen, J. R. Green, and J. M. Whipps. 2004. Use of REMI and Agrobacterium mediated transformation to identify pathogenicity mutants of the biocontrol fungus, Coniothyrium minitans. FEMS microbiology letters 241, no. 2: 207-214. Rogers, L. M, Y. K Kim, W. Guo, L. González-Candelas, D. Li, and P. E Kolattukudy. 2000. Requirement for either a host-or pectin-induced pectate lyase for infection of Pisum sativum by Nectria hematococca. Proceedings of the National Academy of Sciences of the United States of America 97, no. 17: 9813. Schneider, D. J., and A. Collmer. 2010. Studying Plant-Pathogen Interactions in the Genomics Era: Beyond Molecular Koch's Postulates to Systems Biology. Phytopathology 48, no. 1: 457. Seifert, G. J., and C. Blaukopf. 2010. Irritable walls: the plant extracellular matrix and signaling. Plant Physiology 153, no. 2: 467. Shan, and P. Goodwin. 2004. Monitoring host nuclear migration and degradation with green fluorescent protein during compatible and incompatible interactions of Nicotiana tabacum with Colletotrichum species. Journal of Phytopathology 152, no. 8 9: 454-460. Shan, W., M. Cao, D. Leung, and B. M. Tyler. 2004. The Avr1b Locus of Phytophthora sojae Encodes an Elicitor and a Regulator Required for Avirulence on Soybean Plants Carrying Resistance Gene Rps 1b. Molecular Plant-Microbe Interactions 17, no. 4: 394-403. Somerville, C., S. Bauer, G. Brininstool, M. Facette, T. Hamann, J. Milne, E. Osborne, A. Paredez, S. Persson, and T. Raab. 2004. Toward a systems approach to understanding plant cell walls. Science 306, no. 5705: 2206. Staskawicz, B. J., D. Dahlbeck, and N. T. Keen. 1984. Cloned avirulence gene of Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max (L.) Merr. Proceedings of the National Academy of Sciences of the United States of America 81, no. 19: 6024. Strange, R. N., and P. R. Scott. 2005. Plant disease: a threat to global food security. Phytopathology 43. Sweigard, J. A., F. Chumley, A. Carroll, L. Farrall, and B. Valent. 1997. A series of vectors for fungal transformation. Fungal Genetics Newsletter: 52-53.

72 Talbot, N. J. 2003. On the trail of a cereal killer. Annu. Rev. Microbiol 57: 177-202. Telewski, Frank W. 2006. A unified hypothesis of mechanoperception in plants. Am. J. Bot. 93, no. 10: 1466-1476. Terauchi, R., J. Win, S. Kamoun, H. Matsumura, H. Saitoh, H. Kanzaki, K. Yoshida, M. Shenton, T. Berberich, and S. Fujisawa. 2009. Searching for Effectors of Magnaporthe oryzae: A Multi-Faceted Genomics Approach. Advances in Genetics, Genomics and Control of Rice Blast Disease: 105-111. Thongkantha, S., R. Jeewon, D. Vijaykrishna, S. Lumyong, E. H. C. McKenzie, and K. D. Hyde. 2009. Molecular phylogeny of Magnaporthaceae (Sordariomycetes) with a new species, Ophioceras chiangdaoense from Dracaena loureiroi in Thailand. Fungal Divers 34: 157-173. Tosa, Y., J. Osue, Y. Eto, H. S. Oh, H. Nakayashiki, S. Mayama, and S. A. Leong. 2005. Evolution of an avirulence gene, AVR1-CO39, concomitant with the evolution and differentiation of Magnaporthe oryzae. Molecular Plant-Microbe Interactions 18, no. 11: 1148-1160. Tucker, S. L., and N. J. Talbot. 2001. Surface attachment and prepenetration stage development by plant pathogenic fungi. Annual Review of Phytopathology 39, no. 1: 385-417. Tufan, H. A, G. R.D McGrann, A. Magusin, J. B Morel, L. Miché, and L. A Boyd. 2009. Wheat blast: histopathology and transcriptome reprogramming in response to adapted and nonadapted Magnaporthe isolates. New Phytologist 184, no. 2: 473- 484. Urashima, A. S., N. A. Lavorent, A. C. P. Goulart, and Y. R. Mehta. 2004. Resistance spectra of wheat cultivars and virulence diversity of Magnaporthe grisea isolates in Brazil. Fitopatologia Brasileira 29: 511-518. Urban, M., T. Bhargava, and J. E. Hamer. 1999. An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease. The EMBO Journal 18, no. 3: 512-521. Valent, B., C. H. Khang, M. C. Giraldo, G. Mosquera, R. Berruyer, P. Kankanala, M. Yi, K. Czymmek, and S. Park. 2009. The biotrophic interfacial complex and effector translocation during rice blast disease. Phytopathology 99, no. 6. Vergne, E., E. Ballini, S. Marques, B. Sidi Mammar, G. Droc, S. Gaillard, S. Bourot, R. DeRose, D. Tharreau, and J. L. Nottéghem. 2007. Early and specific gene expression triggered by rice resistance gene Pi33 in response to infection by ACE1 avirulent blast fungus. New Phytologist 174, no. 1: 159-171. Verica, J. A., L. Chae, H. Tong, P. Ingmire, and Z. H. He. 2003. Tissue-specific and developmentally regulated expression of a cluster of tandemly arrayed cell wall- associated kinase-like kinase genes in Arabidopsis. Plant physiology 133, no. 4: 1732. Viji, G., B. Wu, S. Kang, W. Uddin, and D. R. Huff. 2001. Pyricularia grisea causing gray leaf spot of perennial ryegrass turf: Population structure and host specificity. Plant Disease 85, no. 8: 817-826. Vleeshouwers, V. G.A.A, W. van Dooijeweert, F. Govers, S. Kamoun, and L. T Colon. 2000. The hypersensitive response is associated with host and nonhost resistance to Phytophthora infestans. Planta 210, no. 6: 853-864. Von Braun, J. 2007. The world food situation: new driving forces and required actions. Intl Food Policy Res Inst.

73 Wagner, T. A., and B. D. Kohorn. 2001. Wall-associated kinases are expressed throughout plant development and are required for cell expansion. The Plant Cell Online 13, no. 2: 303. Xu, J. R., C. J. Staiger, and J. E. Hamer. 1998. Inactivation of the mitogen-activated protein kinase Mps1 from the rice blast fungus prevents penetration of host cells but allows activation of plant defense responses. Proceedings of the National Academy of Sciences of the United States of America 95, no. 21: 12713. Xu, J. R., M. Urban, J. A. Sweigard, and J. E. Hamer. 1997. The CPKA gene of Magnaporthe grisea is essential for appressorial penetration. Molecular Plant- Microbe Interactions 10, no. 2: 187-194. Xu, J. R., X. Zhao, and R. A. Dean. 2007. From genes to genomes: a new paradigm for studying fungal pathogenesis in Magnaporthe oryzae. Advances in genetics 57: 175-218. Yadav, P. K., V. K. Singh, S. Yadav, K. D.S Yadav, and D. Yadav. 2009. In silico analysis of pectin lyase and pectinase sequences. Biochemistry (Moscow) 74, no. 9: 1049- 1055. Yadav, S., P. K Yadav, D. Yadav, and K. D.S Yadav. 2009. Pectin lyase: a review. Process Biochemistry 44, no. 1: 1-10. Yoshida, K., H. Saitoh, S. Fujisawa, H. Kanzaki, H. Matsumura, K. Yoshida, Y. Tosa, I. Chuma, Y. Takano, and J. Win. 2009. Association genetics reveals three novel avirulence genes from the rice blast fungal pathogen Magnaporthe oryzae. The Plant Cell Online 21, no. 5: 1573. Yu, J., S. Hu, J. Wang, G. K. S. Wong, S. Li, B. Liu, Y. Deng, L. Dai, Y. Zhou, and X. Zhang. 2002. A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296, no. 5565: 79. Zhou, Y. Jia, P. Singh, J. C. Correll, and F. N. Lee. 2007. Instability of the Magnaporthe oryzae avirulence gene AVR-Pita alters virulence. Fungal Genetics and Biology 44, no. 10: 1024-1034. Zipfel, C., and G. Felix. 2005. Plants and animals: a different taste for microbes? Current opinion in plant biology 8, no. 4: 353-360.

74 Appendix A: Magnaporthe oryze strains and transformants

75 Protoplast Generation from Magnaporthe grisea Protoplasts were obtained from the strains described below (Table 4. 1) using previously reported protocols. Briefly, mycelia between 3-6 days old were grown in complete media (CM) broth at 25oC in dark conditions. These mycelia was mashed and filtered through 2 layers of cheese cloth to obtain small pieces of hyphae. The resulting filtrate was used to inoculate a new CM broth flask and incubated 24 hours at 25 oC. These mycelia were harvested using miracloth (1 layer), washed with a 20% sucrose solution three times, deposited in falcon tubes and weighted. One gram of mycelia were resuspended in 5 mL of 20% sucrose (22um) filter-sterile solution containing 200 mg of lysing enzymes from Trichoderma harzianum (L1412, Sigma, St. Louis, Missouri, USA) and volume up to 20 mL using sucrose 20%. Mycelia were incubated at room- temperature with slow shaking for 1.5 hours. In this point, digestion of the cell wall was observed under the microscope and if it was necessary digestion time extended 0.5 or 1 hour until hyphal cells have converted to spheroplasts. Protoplasts were collected by filtering through 4 layers of miracloth followed by centrifugation for 15min at 5,000 rpm, 4C. The pellet was resuspended with 5ml 1X STC by pipetting and centrifuged and resuspended again. Protoplast concentration was adjusted to 5*107 cells/mL. Aliquots of 200 uL in 1.5 mL Eppendorf tubes were stored at -80C.

Transformation Five ug of plasmid DNA or 10 uL of PCR product was mix with 2 volumes of 2X STC and add in 15 mL cap tube containing 200 uL of ice-thawed protoplasts (5*107 cells/mL). This solution was gently shake and incubated at room temperature for 10 minutes. 1 mL PTC (2X STC plus 2X PEG) was gently added using the tube walls. This solution was mixed and incubated at room temperature. After 20 minutes, 3 mL of TB3 broth was added and incubated at room temperature by gentle shaking during 6 h. Regenerated protoplasts was mixed with TB3 (agar concentration 8%, temperature 40C) containing 200 ug/mL of hygromycin B and plated. One week after incubation at 22C in dark conditions, filamentous colonies were transferred to TB3 solid media supplemented with hygromycin.

DNA manipulations Constitutive expression constructs were created by PCR amplification of the ribosomal protein 27 promoter, eGFP coding sequence, and the ORFs of each gene using the primers identified with the MGG number gene (194 or 3356) and OF (forward) or OR (reverse). These were fused and cloned into the plasmid expression pCB1636 (Hygr) (Sweigard et al. 1997). Three independent transformants were selected and purified by single-conidia isolation and used for phenotypic analysis. Native expression constructs were obtained by cloning PCR products of the ORF and upstream region into plasmid PCB1636 containing eGFP (Table 4.2). Gene deletion constructs were obtained by fusion PCR of 1kb upstream using the primers designed UF and UR, the hygromycin resistance gene in 3’5’ sense, and 1Kb downstream fragments using the primers designed DF and DR and posterior cloning in pGXT (Chen, P. Songkumarn, et al. 2009). Split marker constructs were obtained by cloning of downstream and upstream 1 Kb regions in the plasmids pHY and pYG respectively. pHY was obtained by cloning of 5’ fragment of the hygromycin

76 phosphotransferase gene (hph) with primers HYG-F/HY-R and pYG by cloning of the 3’ fragment using primers YG-F/HYG-R (Table 4.2). Positive transformants were identified like hygromycin resistant colonies. Incorporation of the GFP-tagged protein under the control of the native promoter were verified by PCR using the primer UF and GFPr. Knockout mutants were screened using primer UF and Hyg1F. No knockout mutants were obtained. No differences in vegetatige growth were observed between constitutive, native expression transformants and wild type (Table 4.3)

Medium and chemical solutions used during transformation.

Complete media (CM) broth: 6 g of yeast extract / L, 6 g of casamino acid / L, and 10 g of sucrose / L.

1X STC: Solution used for washing protoplast, resuspending protoplast, and storing protoplast in 200 l aliquotus. Add 20 g of sucrose (20% final concentration), 5 mL of 50mM Tris-HCl (pH8.0) and 0.735 g of CaCl2 (F.W 147) ( 50mM CaCl2, final concentration) and distillated water up to 100 mL of final volume.

2 PEG 8000 (3350): Stored in aliquots of 500 l. Preparation: 4 g of PEG are dissolved (microwave for 5 seconds) into 1 mL of distillated water in 15 mL tube and volume adjusted up to 5 mL.

PTC: (40% Polyethylene glycol 3350 in STC, 1ml added). 0.5 ml of 2 STC were mixed with 0.5 ml of 2 PEG.

TB3 broth: Used for protoplast regeneration during transformation of M. oryzae. Concentrations: 0.3% Yeast extract, 0.3 % Casamino acid, 1.0 % Glucose and 20% Sucrose.

TB3 agar medium: 0.8% agar concentration was used for first selection of mutants supplemented with hygromycin B. Each tube containing an independent transformation was mixed with 100 mL of TB3 0.8% agar and supplemented with 400 l of hygromycin B (final concentration 50 mg/ml).

77 C.

78 A.

Continued

Figure A.2. Description of primers location. A. MGG_00194. Length of the showed fragment 4456 bp.

79 Figure 4. 2 continued

B. MGG_03356. Length of the showed fragment 4131 bp. Upstream and downstream regions showed are 1500 bp long. Primers localization and graphics were obtained using Pdraw (Acaclone software).

80 Virulence on cultivars Isolates Origen Pi2 Pi9 Nipponbare C101A51 75-1-127 Additional description Domesticated strain obtained by 70-15 Multiple RS S S multiple crosses in laboratory. No present in the field Highest rate of growth and KJ201 Korea S R R sporulation Philippi PO6-6 S R R nes CHNOS China S S R Infection at citological level produce French wided hyphae. These are considered Guy11 S R R Guiana typical of highly compatible interactions

Table A.1. Description of all the M. oryzae backgrounds used in this research.

81 Oligonucleotide for Primer MGG_00194 ID Sequence 194 SF84 TMP084 CGGGGACCTGGTTTTCTTAT 194 UR85 TMP085 GTGGCAAACCCACCATTATC 194 UR86 TMP086 GCACAGGTACACTTGTTTAGAGAGAGGCTTGCTTGGTTTTCTG 194 OF74 TMP074 ATGGCTCCCAGAAGCACACTT 194 ORFm702 TMP702 GACTGGTAGTCAAAGTCGCT 194 OR2 TMP075 TGCCAGCCTGGTACACAGCCAAAGC 194 DF87 TMP087 CCTTCAATATCATCTTCTGTCGAGTTGGTGTGTTGTGGCAGAT 194 DR61 TMP061 GGTAACCCCCAGTCCGTATT 194 DF58 TMP058 GTTGGTGTGTTGTGGCAGAT 194 GFPF72 TMP072 TGGCCAGCCTGGTACACA 194 DFEcoRI TMP796 GGAATTCGTTGGTGTGTTGTGGCAGAT 194 DREcoRV TMP797 GGATATCGGTAACCCCCAGTCCGTATT

Oligonucleotide for Primer MGG_03356 ID Sequence 3356 SF83 TMP083 CGCACACAACTCACCAGTCT 3356 UF62 TMP062 AAGGACGTCGACACCATTTC 3356 UR63 TMP063 GCACAGGTACACTTGTTTAGAGAATATGCTCCGCCTTGTTGAG 3356 OF76 TMP076 CATGGCTCGCTTCACCTCGCTC 3356 OR77 TMP077 TGCAAAGGGCTCGCTGTCCATT 3356 DF64 TMP064 CCTTCAATATCATCTTCTGTCGATCTCGCTCGCTGCCTATTAT 3356 DR65 TMP065 CCAGGGGCGTGTATACTCAT 3356 GFPF73 TMP073 CGCGCGAGGACTCTCACAAG 3356 DFEcoRV TMP798 GGATATCTCTCGCTCGCTGCCTATTAT 3356 DRXhoI TMP799 GCTCGAGCCAGGGGCGTGTATACTCAT

Oligonucleotide Primer Gral. use ID Sequence HygBF TMP001 CGACAGAAGATGATATTGAAGG HygBR TMP002 CTCTAAACAAGTGTACCTGTGC Hyg1F TMP003 TCAGCTTCGATGTAGGAGGG Hyg2R TMP004 TTCTACACAGCCATCGGTCC M13F TMP005 TTG TAA AAC GAC GGC CAG M13R TMP006 CAG GAA ACA GCT ATG ACC GFPF TMP010 AAAATGGTGAGCAAGGGCGAGGA GFPR TMP011 CCAAGCTTATCATCATGCAACATG

Table A. 2. Description of primers used for amplification of gene regions used for vector construction and transformants screening.

82 Sporulation rate (Spores/cm2) KJ201 PO6-6 CHNOS 70-15 Wild type 693367 125202 154734 25185 1 631313.131 41380.1884 42441.2189 78130.4257 Native 2 816028.891 175070.028 17139.723 44563.2799 transformants 3 954927.426 12732.3657 86811.5841 86811.5841 1 917791.359 28647.8228 28937.1947 14468.5974 Overexpression 2 734559.558 3183.09142 11368.1836 31830.9142 transformants 3 759044.877 41380.1884 111408.2 31830.9142

Table A.3. Sporulation rates for native and overexpression mutants MGG_03356 and wild types in V8 media at 5 days. No significant differences were observed.

P27:MGG_00194 Wild type P27:MGG_O3356 Cultivars Value SD Value SD Value SD

Nipponbare 0.80 0.09 0.93 0.09 0.77 0.06 C101A51 (Pi2) 0.26 0.09 0.09 0.04 0.92 0.03 75-1-127 (Pi9) 0.07 0.05 0.00 0.00 0.00 0.00

Table A.4. Relative lesion area (lesion area / leaf lesion) for KJ201 overexpression mutants in whole plant assays.

83 Appendix B: Rice Leaf Sheath Assay

84 A

85 Appendix C: Distribution of Infection Stages for Overexpression and Native Expression of MGG_03356 in Different Host-Pathogen Interactions

86 100%

80%

7 6 60% 5 4 3 2 40% 1 0

20%

0% KJ201 PO6-6 CHNOS KJ201 PO6-6 CHNOS KJ201 PO6-6 CHNOS

Nipponbare Pi-2 Pi-9

100%

80%

7 6 60% 5 4 3 2 40% 1 0

20%

0% KJ201 PO6-6 CHNOS KJ201 PO6-6 CHNOS KJ201 PO6-6 CHNOS

Nipponbare Pi-2 Pi-9

Figure C.1. Percentage distribution of infection stages for overexpression and native expression of MGG_03356 under different host-pathogen interactions.

87 Appendix D: Distribution of Infection Stages for Overexpression and Native Expression of MGG_03356 in Different Host-Pathogen Interactions

88 A.

Continued

89 Figure 4.5 continued

90 Figure D.2. Microscopy of drop inoculation assay. 4X bright field images of chlorophyll cleared rice leaves using alcoholic lactophenol. Lactophenol trypan blue was used for

91 staining fungal structures. Mycelia and spores are visible in the interaction between KJ201 native transformants and Nipponbare

Drop inoculations experiments showed differential responses of the pathogen attacking susceptible and resistant cultivars altering the infection phenotype expected for the wild type. KJ201 MGG_03356 overexpression transformants showed in Pi2 plants darker lesions than its wild type. Extended incubation (two weeks) allows mycelia development and spore formation from lesions caused by the overexpression mutant. Its wild type produced small lesion unable to sporulate during extended incubation. PO6-6 overexpression and native transformants infected Nipponbare and Pi2-C101A51 producing different of lesions. Overexpression transformants produced brown dark areas limited to the drop inoculation area while the native transformants produced a small black lesion that resemble those produced by KJ201 on Pi2 plants. Under the microscope (4X), lesions produced by overexpression mutants are observed as well defined black spots following the veins while lesions produced by native mutants are extended brown lesions. CHNOS was expected to be able to infect Nipponbare and Pi2 plants, forming sporulating expanding lesions. Lesions caused by its overexpression mutant in Nipponbare and Pi2 are non-expanding, sporulating and brown resembling host cell death. Native transformants exhibit a lower number of brownish cells.

92 Appendix E: Evaluation of Pathogenicity of KJ201 and CHNOS Strains Expressing Constitutively MGG_03356 over Transgenic Rice Plants Expressing the Resistance Genes Pi2 and Pi9.

93 Growth HR-like reaction Stage 6 (Vesiculation)

Figure E.1. Percentage of infection stages of KJ201 MGG_03356 overexpression mutants on transgenic Pi2-Nipponbare and isogenic Pi2 cultivars at 36 hpi.

94 Median disease severity Nipponbare Nipponbare Pi2 C101A51 Pi2 Isolates Native Constitutive Native Constitutive Native Constitutive KJ201 4.25 4 0.5 2.75* 1 4.75* CHNOS 1.5 1 1 1.5 0 0

Table E.1. Disease score of native and constitutive expression of MGG_03356 KJ201 and CHNOS on transgenic Pi2-Nipponbare and isogenic Pi2 plants. * denotes significant differences between the medians of experiments. Medium disease severity was calculated using at least 10 leaves after one week post-inoculation. Rating scale: 0 = asymptomatic, 1 = pinhead-sized brown specks; 2 = 1.5mm spots; 3= 2-3mm spots; 4= elliptical spots longer than 3mm; 5 = coalescing lesions.