Genetic analysis of cold tolerance in Drosophila
albomicans.
Kotoha Isobe
Department of Biological Sciences
Tokyo Metropolitan University
2014 CONTENTS
Page GENERAL INTRODUCTION ...... 1
LITERATURE CITED...... 4
Part I: Cold tolerance and metabolic rate increased by cold acclimation in Drosophila albomicans from natural populations 7
SUMMARY...... 8
INTRODUCTION 9
MATERIALS AND METHODS 13
RESULTS...... 19
DISCUSSION 25
LITERATURE CITED 34
TABLES...... 42
FIGURES 47
MENTARY 53
Part II: ansgenic analysis for identification of Drosophila albomicans genes response to cold acclimation 63
SUMMARY...... 64
INTRODUCTION 65
MATERIALS AND METHODS 68
RESULTS...... 74
DISCUSSION 79
LITERATURE CITED 85
TABLES...... 92
FIGURES 95
SUPPLEMENTARY 105
GENERAL DISCUSSION 109
LITERATURE CITED.... 113
ACKNOWLEDGEMENTS 115 GENERAL INTRODUCTION
Organisms inhabit various environments on the earth and have acquired characters that are needed to adapt to their living environment. Natural selection plays a central role in the acquisition process of such adaptive characters (Darwin, 1859), which is often referred to as adaptive evolution. Adaptive evolution is an important aspect of the evolution of organisms influenced by various environmental factors such as temperature, intensity of ultraviolet light, microbiota, etc. (e.g., Tanaka and Nei, 1989; Jablonskia and
Chaplinb, 2000; Bonduriansky, 2001 for review). An objective of evolutionary genetics is to provide a genetic basis of adaptive evolution.
In contrast to endothermic organisms, which have thermoregulatory systems to adjust their physiological conditions and functions, such as energy utilization, growth, reproduction, and locomotion, in response to changes in ambient temperature (Bullock,
1955; Johnston et al., 1996; Angilletta et al., 2002), in ectothermic organisms, physiological conditions are strongly influenced by the environmental temperature
(Guschina and Harwood, 2006 for review). A correlation between distribution boundary in latitude and low temperature tolerance is frequently reported in many species
(Stevens, 1992; Addo-Bediako et al., 2000; Hoffmann et al., 2003 for review), whereas there no such association is seen between latitude and high temperature tolerance in insect species (Addo-Bediako et al., 2000). Therefore, it is suggested that in ectothermic organisms, low temperature adaptation plays an important role in determining their habitat. However, in most of these reports on thermal adaptation, the authors examined adaptive traits already fixed in the populations. Therefore, it is still unclear how gene
1 and/or gene expression changes by natural selection have contributed to the adaptive evolution. It is important to study on-going adaptive evolution, which will bring a new prospect for better understanding the mechanisms of environmental adaptation by organisms at the molecular level.
A fruit fly species, Drosophila albomicans belonging to the D. nasuta subgroup, had a wide geographic distribution in Southeast Asia until late 1980's (Kitagawa et al.,
1982) but has expanded the distribution to Japanese archipelago in the temperate regions recently (Mikasa, 1991; Chen et al., 1994; Fujino et al., 2006; Hoshina et al.,
2007), whereas its closely related species of the D. nasuta subgroup have stayed in the tropics or subtropics. This distribution expansion suggests the possibility that D. albomicans is in the process of adaptive evolution. According to Dobzhansky (1950), adaptation to lower temperatures especially in winter, is required for distribution expansion of Drosophila species from a subtropical to temperate zone. Therefore, it is likely that D. albomicans has undertaken an increase in cold tolerance to adapt to the lower temperature environment during the course of the in distribution expansion. In addition, it has been reported that cold acclimation that enhances the cold tolerance is one of the important factors in insects (Salt, 1961). Therefore, the molecular mechanism of cold acclimation response is a key to understand the cold adaptation of D. albomicans from tropical or subtropical habitats to temperate climate zone.
In this thesis, for better understanding the molecular mechanisms of evolutionary adaptation of organisms, I investigated whether the distribution expansion of D. albomicans is attributable to adaptive evolution of cold tolerance and cold acclimation response, and their molecular mechanisms. In Part I, I examined the phenotypic variation in cold tolerance and cold acclimation response between geographical
2 populations of D. albomicans as well as between D. albomicans and its closely related
species, and found that there were differences in the cold tolerance between the
geographical populations of D. albomicans. I also found that the cold acclimation had a
significantly strong effect on the cold tolerance. In addition, I detected a strong positive
correlation between the cold tolerance change and the metabolic rate change in response
to the cold acclimation, suggesting their strong physiological association by shared
genetic factors.
In Part II, using a transcriptome analysis and transgenic technique in D.
melanogaster, I searched for the genes involved in the cold acclimation response to
investigate the molecular mechanism of the cold tolerance improved by the cold
acclimation. As the result, I found that Sdr and CG14153 genes, whose expression
levels were significantly altered in response to the cold acclimation in D. albomicans,
functioned in the transgenic D. melanogaster flies to improve the cold tolerance.
3 LITERATURE CITED
Addo-Bediako, A., Chown, S. L., and Gaston, K. J. (2000) Thermal tolerance, climatic
variability and latitude. Proc. Biol. Sci. 267, 739-745.
Angilletta, M. J., Niewiarowski, P. H., and Navas, C. A. (2002) The evolution of
thermal physiology in ectotherms. J. Therm. Biol. 27, 249-268.
Bonduriansky, R. (2001) The evolution of male mate choice in insects: A synthesis of
ideas and evidence. Biol. Rev. Camb. Philos. Soc. 76, 305-339.
Bullock, T. H. (1955) Compensation for temperature in the metabolism and activity of
poikilotherms. Biol. Rev. 30, 311-342.
Chen, W., Zhang, J., Geng, Z., and Zhu, D. (1994) Invasion of Drosophila albomicans
into Shanghai and areas nearby and a study on its mitochondrial DNA
polymorphism. Yi Chuan Xue Bao 21, 179-187.
Darwin, C. (1859) On the origin of species by means of natural selection. John Murray,
London.
Dobzhansky, T. (1950) Evolution in the Tropics. Am. Sci. 38, 209-221
Fujino, Y., Beppu, K., and Nakamura, H. (2006) Stratification of the Drosophilid
assemblage in the research forest of AFC, Shinshu University. Bulletin Shinshu
University Alpine Field Center 4, 47-55.
Guschina, I. A., and Harwood, J. L. (2006) Mechanisms of temperature adaptation in
poikilotherms. FEBS Lett. 580, 5477-5483.
4 Hoffmann, A. A., Sorensen, J. G., and Loeschcke, V. (2003) Adaptation of Drosophila
to temperature extremes: bringing together quantitative and molecular approaches. J.
Therm. Biol. 28, 175-216.
Hoshina, H., Yamada, C., Uomi, H., and Terashima, M. (2007) Actual distribution of
Drosophila (Drosophila) albomicans Duda, 1924 (Diptera: Drosophilidae) in Fukui
pref., Honshu, Japan. Bulletin of The Fukui City Museum of Natural History 54,
79-82.
Jablonskia, N. G., and Chaplinb, G. (2000) The evolution of human skin coloration. J.
Hum. Evol. 39, 57-106.
Johnston, I. A., and Bennett, A. F. (1996) Animals and temperature: Phenotypic and
evolutionary adaptation. Cambridge University Press, Cambridge.
Kitagawa, 0., Wakahama, K. I., Fuyama, Y., Shimada, T., Takanasi, E., Hatsumi, M.,
Uwabo, M., and Mita, Y. (1982) Genetic studies of the Drosophila nasuta subgroup,
with notes on distribution and morphology. Jan. J. Genet. 57, 113-141.
Mikasa, K. (1991) A statistical analysis of seasonal fluctuations of population size in
Drosophila populations near human habitation at Himeji city. J. Arts Sci. Meikai
University 3, 8-18.
Salt, R. W. (1961) Principles of insect cold-hardiness. Annu. Rev. Entomol. 6, 55-74.
Stevens, G. C. (1992) The elevational gradient in altitudinal range: an extension of
Rapoport's latitudinal rule to altitude. Am. Nat. 140, 893-911.
Tanaka, T., and Nei, M. (1989) Positive darwinian selection observed at the
5 variable-region genes of immunoglob ulins. Mol. Biol. Evol. 6, 447-459.
6 Part I
Cold tolerance and metabolic rate increased by cold acclimation in Drosophila albomicans from natural
populations
7 SUMMARY
Cold acclimation is one of the important factors in temperature adaptation for insects needing to make rapid adjustment to the seasonal temperature changes in their living environment. In a fruit fly species, Drosophila albomicans, which has a tropical origin and currently has a wide geographic distribution extended into Asian temperate regions, cold tolerance in terms of survival time at 1 °C of adult flies reared at 25 °C was substantially improved by a cold acclimation at 20 °C for several days. Examining
29 isofemale lines from widely distributed natural populations, I observed a substantial variation in their acclimation response. However, the acclimation response was not necessarily stronger in the strains from the recently colonized temperate regions. A significantly stronger acclimation response was detected in male flies of the temperate strains when compared to those of the tropical strains. D. albomicans also showed stronger cold tolerance compared to its closely related species belonging to the D. nasuta subgroup. Among these strains, I detected a strong positive correlation between the cold tolerance change and the metabolic rate change upon the cold acclimation, suggesting their strong physiological association regulated by common genetic factors, which may have been the target of natural selection for the temperature adaptation. The response to deacclimation and reacclimation suggested that a systematic change in gene expressions is the main molecular mechanism for the cold acclimation to have effects on the cold tolerance and metabolic rate changes.
8 INTRODUCTION
Cold tolerance is a critical trait in insects whose activity and survival are directly affected by changes in their environmental temperature (Lee and Denlinger, 2010). In
Drosophila, species distributed in relatively colder locations usually show higher cold tolerance compared to those distributed in relatively warmer locations. This tendency is consistent with the concept of environmental adaptation and is often observed in geographic populations within a single species (Hoffmann et al., 2003 for review).
These facts clearly indicate that cold tolerance is one of the key factors affecting fitness of insects, enabling them to withstand conditions in their environment.
To cushion the impact of seasonal temperature fluctuation, the capacity for adjusting physiological condition to the temperature changes is thought to be an important part of cold tolerance. Many insects respond to an exposure to a cooler temperature than usual for several days and enhance their cold tolerance in preparation for the anticipated subsequent temperature changes. Such phenomenon is called acclimation and is observed as an improved survival rate in a cold temperature (say —0 °C) after experiencing a mildly lower temperature than the usual living temperature (Salt, 1961).
Rako and Hoffmann (2006) classified this type of plastic response into three categories: "rearing acclimation" as a continuous response to a lower temperature than the optimal living temperature during the course of development (e.g., Ohtsu et al., 1999), "cold acclimation" as a response to a moderately low temperature for a few days to several weeks (e.g., Goto, 2000; Bubliy et al., 2002) and "rapid cold hardening," as a rapid response to a sub-lethal temperature for a very short time from a few minutes to hours
(e.g., Czajka and Lee, 1990). Since the seasonal temperature fluctuation is relatively
9 mild in the temperate regions, the cold acclimation is likely to be an effective strategy for insects like Drosophila to adapt to temperature changes in their habitats.
Changes in lipid composition of cell membrane have been identified as a molecular mechanism underlying the rearing acclimation and the rapid cold hardening in insects
(Ohtsu et al., 1998; Lee et al., 2006; Overgaard et al., 2008), whereas changes in metabolic rate are thought to be a mechanism for the cold acclimation. For instance,
Berrigan (1997) showed that D. melanogaster flies reared at 18 °C had a higher respiration rate (metabolic rate) at 15 °C compared to the flies reared at 25 °C or 29 °C.
Terblanche et al. (2005) showed that metabolic rate of a tsetse fly species, Glossina morsitans morsitans, reared at 24 °C was increased after experiencing 19 °C for 10 days.
Using its closely related species, Glossina pallidipes, Terblanche and Chown (2006) measured the critical thermal minima (CTmin) defined as the temperature, at which loss of coordinated muscle function is observed in a gradually decreasing temperature condition (-0.25 °C/min), and reported that the flies acclimatized at 21 °C had a lower
CTmin with a higher metabolic rate compared to the control flies reared at 25 °C. These studies suggested that there is a connection between cold acclimation and metabolic rate.
In general, metabolic rate decreases as the ambient temperature decreases in ectothermic animals including Drosophila (Fleming and Miguel, 1983; Berrigan and
Partridget, 1997; Oikawa et al., 2006), and this tendency is regarded as a response to temperature changes (e.g., Gillooly et al., 2001). However, in the studies with
Drosophila and the tsetse fly species mentioned above (Berrigan, 1997; Terblanche et al., 2005; Terblanche and Chown, 2006), significant effects of the rearing temperature on the response to temperature changes were also suggested. The connection between
10 cold tolerance and metabolic rate was also suggested in studies of D. melanogaster mutants. A mutant of dystroglycan gene, atsugari, which causes an increase in mitochondrial oxidative metabolic rate, showed a higher cold tolerance (Takeuchi et al.,
2009). Similarly, a dopamine transporter-defective mutant, fumin, showed a higher metabolic rate and a higher cold tolerance (Ueno et al., 2012). These observations suggest that the cold tolerance of flies is improved by the increased metabolic rate.
Another approach to examine if the elevation of metabolic rate is a major response to the cold acclimation would be to analyze intraspecific variations of cold tolerance and of the metabolic rate and see if they have a correlation. It is also intriguing to see if they parallel each other in response to the cold acclimation. For this purpose,
Drosophila albomicans belonging to the D. nasuta subgroup is particularly suitable, because this species had a wide geographic distribution in Southeast Asia until late
1980's (Kitagawa et al., 1982) and has expanded the distribution to the Japanese archipelago in the temperate regions recently (Mikasa, 1991; Chen et al., 1994; Fujino et al., 2006; Hoshina et al., 2007), whereas other closely related species of the D. nasuta subgroup have stayed in the tropics or subtropics. This suggests the possibility that D. albomicans has a wider variation in cold tolerance to be able to distribute from the tropics to the temperate regions. Therefore, it is an intriguing question to ask whether the distribution expansion of D. albomicans has been accompanied by an increase in cold tolerance with an increase in metabolic rate upon cold acclimation.
In this study, I first investigate the basic thermal physiology, i.e. cold tolerance and acclimation response, of D. albomicans in comparison to that of its closely related species in the D. nasuta subgroup and also to that of D. melanogaster, a well-studied canonical model species. Then, to explore the possibility that the metabolic rate change
11 caused by the cold acclimation is responsible for the higher cold tolerance in Drosophila,
I analyze the effects of cold acclimation on the cold tolerance and on the metabolic rate using geographic populations of D. albolnicans. I examined whether there is a strong
association between the cold tolerance and the metabolic rate changes in response to the
cold acclimation. This study could be a step forward in understanding molecular
mechanisms of evolutionary adaptation to thermal environment by organisms.
12 MATERIALS AND METHODS
Fly strains
Twenty-nine strains of Drosophila albomicans were originally collected from 23 localities in 1979-1992 by Kitagawa et al. (1982), each of which was established from a single inseminated female as an isofemale line and has been maintained by sib-mating in a small mass culture with the standard cornmeal medium (containing 90 g cornmeal,
100 g glucose, 40 g dead beer-yeast and 8 g agar in 1 litter water) at 20 °C under constant light condition before use. The abbreviation of the strain names and their collection sites and years are described in Supplementary Table Si. Its closely related species belonging to the D. nasuta subgroup, i.e., 13 strains of D. nasuta, 4 strains each of D. kepulauana, D. kohkoa, D. sulfurigaster bilimbata and D. pallidifrons, and 3 strains each of D. s. albostrigata and D. pulaua, were also used (Supplementary Table
S2). In addition, a wild type strain (Canton S) of D. melanogaster was maintained at
25 °C in otherwise the same condition as the D. albomicans strains. To reduce epigenetic effects, if any, all the fly strains were cultured at 25 °C on the standard corn-meal medium for at least 3 consecutive generations before all the experiments.
Categorization of geographic populations
To investigate the cold tolerance of D. albomicans with regard to the temperature condition of their habitat, I categorized 23 collection sites of the D. albomicans strains into 3 temperature zones according to the lowest monthly mean temperature and the lowest monthly mean of daily minimum temperature obtained from World
Meteorological Organization, Central Weather Bureau, or Japan Meteorological Agency
13 dependent on the location of each collection site. The detailed information on the meteorological data is described in Supplementary Tables S1 and S2.
The lowest monthly mean temperature and the lowest monthly mean of daily minimum temperature from all the collection sites were plotted on a scatter diagram
(Fig. 1). The two measurements as indicators of winter severity showed a high correlation with each other (Spearman's r = 0.98, P < 10-15). However, since the latter on the x-axis showed a discontinuous distribution, the collection sites were categorized into 3 temperature zones separated by the intervals indicated by the dotted lines. As the result, the criteria for the 3 temperature zones became as follows. Temperature Zone 1: the lowest monthly mean of daily minimum temperature —5- 5 °C, Temperature Zone
2: the lowest monthly mean of daily minimum temperature 5 - 20 °C, and Temperature
Zone 3: the lowest monthly mean of daily minimum temperature 20 - 25 °C.
Temperature Zone 1 consists of the newly colonized populations in Japan and China since 1980s (Supplementary Table 51). It should be noted that the populations in
Temperature Zone 3 are unlikely to regularly experience temperature below 20 °C even in the coldest month of a year.
Genetic analysis of cold tolerance in D. albomicans
To investigate the genetics of the cold tolerance in D. albomicans, I conducted a reciprocal crossing experiment between the WL1 and X108 strains. Virgin females and males were collected from within 2 hours after eclosion without using anesthesia and kept at 25 °C for 4-7 days. Ten females and ten males were placed in the same vial with the standard cornmeal medium and transferred to a new fresh vial every two days during
14 days after eclosion. The crossing experiment was conducted at 25 °C and F1 hybrids
14 were reared at 25 °C before the experiments.
Cold acclimation and deacclimation
Female flies were separated from males within 48 hours after eclosion without using anesthesia. For the cold acclimation, 20 - 60 flies were put in a vial with fresh medium and kept at 15 °C or 20 °C for 7 days (designated as "25/15" or "25/20", respectively).
The non-acclimatized control flies were kept in 25 °C for the same period (designated as "25/25"). Flies of WL1 and Canton S strains were acclimatized at both 15 °C and
20 °C, and flies of other 28 D. albomicans strains and the F1 hybrids of WL1 and X108 strains were acclimatized at 20 °C.
Experiments for deacclimation were performed under 3 different temperature schemes. (1) Flies reared at 20 °C for at least 3 consecutive generations were kept in
25 °C for 7 days (designated as "20/25"), whereas the control flies were kept in 20 °C for the same period (designated as "20/20"). For this condition, I used 8 D. albomicans strains: X108, WL1, I0M2, NG3, YAK1, TAK2, KKU202 and KKU204. (2) Flies reared in 25 °C were exposed to 20 °C for 3 days and then placed back into 25 °C for 4 days (designated as "25/20/25"). The control flies reared at 25 °C were exposed to
20 °C for 3 days and subsequently another 4 days. WL1 and X108 strains were used for this condition. (3) Flies reared at 20 °C were exposed to 25 °C for 3 days and then placed back into 20 °C for 4 days (designated as "20/25/20"). The control flies reared at
20 °C were exposed to 25 °C for 3 days and subsequently another 4 days. WL1 and
X108 strains were used for this condition.
15 Measurement of cold tolerance
To examine the cold tolerance of flies, I measured the survival rate of flies after exposed to 1 °C for various time lengths and drew the survival curve against the exposure time. I used the 29 strains and the F1 hybrids of WL1 and X108 strains in D. albomicans, 8 strains of D. nasuta (TNR34, K31, K33, M34, SS95, C2, C3 and MYS1) and Canton S strain of D. melanogaster for this purpose. For each strain, 20 individuals were transferred into a glass vial (15 mm diameter and 105 mm long) containing 2 ml of a sugar agar medium [10 % sucrose; 1 % agar; 1 % butyl parahydroxybenzoate] and kept in an incubator, in which air temperature was regulated to be 1 ± 0.5 °C for the period of 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 36 or 48 hours. To measure the actual air temperature in the incubator during the experiment, I used temperature data loggers
(Thermochron G type) and collected temperature data. After each period of 1 °C exposure, the air temperature was programed to become 20 °C in approximately 25 minutes. Then, I counted the number of survivors after 48 hours, following Rako and
Hoffmann (2006). If a fly stood on its legs and walk, I identified the fly as a survivor.
For each time length and sex, the survival rate measurement was independently replicated 5 times. The number of time points varied among experiments as the survival rate varied among strains. The time point at which 50 % of flies died (50% lethal time:
LT50) or 25% flies died (25% lethal time: LT25) was estimated by the logistic regression analysis implemented in R version 2.13.0 software (R Development Core
Team).
The cold tolerance was compared between D. albomicans and its closely related species within the D. nasuta subgroup in terms of the survival rate after 16 hour exposure to 1 °C. The survival rate was examined for each sex reared at 25 °C with or
16 without the cold acclimation for 36 strains from 7 species in total (Supplementary Table
S2). I used 20 individuals for each experiment which was replicated 5 times.
Measurement of metabolic rate
Following Hulbert et al. (2004), I measured metabolic rate in terms of the consumption of O2 of flies at 7 days after the eclosion for 10 D. albolnicans strains:
X108, SWB101, KM3, HNZ12, WL1, NG3, KMT21, KKU202, TAK502 and SMT503 and for 8 D. nasuta strains: TNR34, K31, K33, M34, SS95, C2, C3 and MYS1. I assembled a respiration chamber connecting a plastic syringe of 1 ml size containing a small amount of CO2 absorber (Soda lime, Wako) to a 50 Ill micropipette via a plastic adaptor and a short rubber tube. For this experiment, only male flies were used, because they have smaller body size variation irrespective of their reproductive state. I placed 20 flies in the syringe body and inserted the plunger to close the respiration chamber. I then placed the respiration chamber on a flat plate in a water bath filled with ice-cold water for at least 1 hour to equilibrate the flies' respiration rate and put 4 µl of ink into the micropipette at the tip. Finally, I measured the movement of the ink corresponding to the oxygen consumption at every 1 hour over the next 3 hours. The measurements for the acclimatized flies and for the control flies were conducted simultaneously in the same water bath with an empty chamber to control unknown effects from ambient temperature, pressure, etc. Each set of the measurement were replicated 30 times independently to obtain the average and the variance.
The metabolic rate at 20 °C was also measured for the acclimatized flies and the control flies of WL1 and X108 strains. In this case, the oxygen consumption was measured at every 30 minutes over 3 to 4 hours after the equilibration for 1 hour. The
17 measurement was replicated 30 times. An empty chamber was also prepared for each replicate as the control.
18 RESULTS
Cold tolerance and cold acclimation response of Drosophila
The survival rate curves obtained from male and female flies with the 7 day cold acclimation at 15°C or 20°C are shown in Figs. 2A-B for D. albomicans (WL1) and
Figs. 2C-D for D. melanogaster (Canton S). They reveal substantial variations in the cold tolerance and the response to the cold acclimation between males and females within the same species and between the species. The overall cold tolerance of D. melanogaster was substantially higher than that of D. albomicans regardless of the fact that the flies were acclimatized or not. Another distinct between-species difference was in the acclimation response to different temperatures. For D. albomicans, the acclimation at 15 °C made almost the same (males) or only slightly better (females) effect compared to the acclimation at 20 °C (Figs. 2A-B), whereas the flies acclimatized at 15 °C had a higher survival rate than those acclimatized at 20 °C in both sexes in D. melanogaster (Figs. 2C-D). This result suggests that the effective temperature for the cold acclimation is different between D. albomicans and D. melanogaster: 20 °C is sufficient to induce a full acclimation response in D. albomicans whereas lower temperature is more effective in D. melanogaster.
The effective time length of the cold acclimation for D. albomicans was measured by the survival rate at 1 °C for 14 hours (X108 and YAK) or 16 hours (WL1 and
KKU204) after various time lengths of cold acclimation at 20°C. Although the response to the different time lengths of cold acclimation varied among the strains, its maximum was reached within 4-5 days in all the strains (Supplementary Fig. S1). Based on this result, I determined the acclimation condition to be at 20 °C for 7 days throughout the
19 experiments in order to induce the full acclimation response. ANOVA showed that the survival time at 1 °C for acclimatized flies was significantly longer than that for non-acclimatized flies and that the survival time of males was significantly longer than that of females regardless of whether the flies were acclimatized or not (Supplementary
Table S3).
Geographic variation of cold tolerance in D. albomicans and its closely related species
To examine whether adaptation to the cooler climate in the temperate regions was involved in the distribution expansion of D. albomicans, I investigated the variation of cold tolerance among the geographic populations. I compared the 50% lethal time
(LT50) at 1 °C among D. albomicans strains from different temperature zones (Figs.
3A-B). The expected adaptation scenario that the cold tolerance is higher in the regions with severe winter was observed but the magnitude was rather small. A marginally significant difference among the zones was detected in non-acclimatized male flies by one-way ANOVA (F2,26= 4.03, P = 0.03), whereas the difference was not significant in female flies (F2,26= 1.50, P = 0.24) (Figs. 3A-B). The significant difference in the male flies was attributed to the difference between Temperature Zones 1 and 3 by Tukey's
HSD test (P < 0.05) (Fig. 3A).
The responses to the cold acclimation by D. albomicans strains from different temperature zones were also compared. I used the 25% lethal time (LT25) rather than
LT50 to compare the cold tolerance after cold acclimation at 20 °C, because 4 out of 28 strains showed survival rates higher than 50% at the 24-hour point when the experiment was terminated (Supplementary Table S4). Strains from colder locations tend to have a
20 higher tolerance to cold temperature upon the cold acclimation, although the tendency was not strong. Again, the difference was detected only in male flies by one-way
ANOVA (Fig. 3C, F2,26 = 3.31, P = 0.05) and the significant difference was detected between Temperature Zones 1 and 3 (P < 0.05 by Tukey's HSD test). The difference was not significant in female flies (Fig. 3D, F2,26= 2.67, P = 0.09).
The cold tolerance was also compared between D. albomicans and 7 its closely related species mostly distributed in the tropics and subtropics (Supplementary Table
S2) in terms of the survival rate after incubation at 1 °C for 16 hours. The D. albomicans strains from Zones 1 and 2 showed the highest cold tolerance both in the acclimatized ("25/20") and the non-acclimatized ("25/25") flies of both sexes (Fig. 4).
The cold tolerance of the D. albomicans strains from Zone 3 was comparable to that of the closely related species in both of the acclimatized and non-acclimatized flies.
Effect of cold acclimation on metabolic rate in D. albomicans
To investigate the effect of the cold acclimation on metabolism of flies, the metabolic rate was measured in terms of oxygen consumption in ice-cold water (ca.
0 °C) for 10 D. albornicans strains (Table 1). A marginally significant increase in the metabolic rate upon the cold acclimation was observed in 8 of the 10 strains (P < 0.05 in the sign test), suggesting that the metabolic rate was affected by the cold acclimation to some extent. When the metabolic rate was measured at 20 °C for WL1 and X108 strains as the representatives showing respectively the maximum and minimum acclimation responses in the cold tolerance at 0 °C, they also showed a large and small acclimation response, respectively (Supplementary Fig. S2). In this case, however, since the flies were not immobilized in such warm temperature, the resting state metabolic
21 rate was unable to be obtained separately from the active state metabolic rate.
Nevertheless, the metabolic rate of the acclimatized flies was higher than that of the control flies with a statistical significance in WL1 (Supplementary Fig. S2, t = 2.38, df =
58, P < 0.05). By contrast, the difference was negligible in X108 (Supplementary Fig.
S2, t = 1.57, df = 58, P > 0.10).
Association between cold tolerance and metabolic rate
If the metabolic rate is closely associated with the cold tolerance, it is expected that
LT50 becomes greater as the metabolic rate increases. However, as shown in Fig. 5A, there was no clear correlation between LT50 and the metabolic rate either for the acclimatized flies (Spearman's r = 0.24, P > 0.1) or for the non-acclimatized control flies (Spearman's r = 0.28, P > 0.1). However, Fig. 5B showed a significant positive correlation between the change in the cold tolerance and the change in the metabolic rate upon the cold acclimation (Spearman's r = 0.93, P < 0.001). These results suggest that the metabolic rate may not be a major factor of determining the cold tolerance per se, although they have a shared physiological background affected by the cold acclimation.
To examine the plasticity of the acclimatized physiological state, I performed the deacclimation experiments. To examine the effect of deacclimation on the cold tolerance, I first used the flies reared at 20 °C and then exposed to 25 °C for 7 days. The pairwise t-test showed that the LT50 values from the deacclimatized flies were significantly lower than those from the control acclimatized flies in both males (t = 7.65, df = 7, P < 0.01) and females (t = 3.32, df = 7, P < 0.05) (see Table 2). This suggests that the increase in the temperature from 20 to 25 °C causes a relaxation of the effect of the
22 cold acclimation. The largest reduction in LT50 by the deacclimation was observed in
WL1, one of the strains that showed the highest response to the cold acclimation (Table
1; Supplementary Table S4). The effect of the deacclimation is consistent when flies were reared at 25 °C and then acclimatized at 20 °C (Table 3). Table 4 shows that the reduction in the metabolic rate by the deacclimation was highly significant in WL1
(0.194 vs. 0.131, t = 3.65, df = 58, P < 0.001) and in X108 (0.143 vs. 0.119, t = 2.85, df
= 58, P < 0.01). When flies were reared at 25 °C and acclimatized at 20 °C, the reduction by the subsequent deacclimation was also highly significant in WL1 (0.221 vs.
0.158, t = 4.74, df = 58, P < 0.001) but not in X108 (0.145 vs. 0.165, t = 1.25, df = 58, P
> 0.20).
I further used a reacclimation scheme, 20/25/20 (reared at 20 °C, deacclimatized at
25 °C and reacclimatized at 20 °C). The reacclimatized flies showed longer LT50 values compared to the control flies in both WL1 and X108 (Table 3). The difference in LT50 is larger in WL1 than in X108. The metabolic rate of the reacclimatized flies was also increased significantly in WL1 (Table 4; 0.131 vs. 0.185, t = 3.14, df = 58, P < 0.01) but not in X108 (Table 4; 0.119 vs. 0.123, t = 0.44, df = 58, P > 0.60). In all the schemes for temperature changes, the resulted changes in the metabolic rate paralleled the changes in the cold tolerance.
Effect of cold acclimation on metabolic rate in D. nasuta
As well as D. albomicans, Fig. 6A shows that there was no clear correlation between
LT50 and the metabolic rate either for the acclimatized flies (Spearman's r = 0.01, P >
0.1) or for the non-acclimatized control flies (Spearman's r = 0.16, P > 0.1) in D. nasuta.
In contrast with D. albomicans, there was no clear correlation between the change in the
23 cold tolerance and the change in the metabolic rate upon the cold acclimation
(Spearman's r = 0.35, P > 0.1) in D. nasuta (Fig. 6B). Although the number of strains is smaller in D. nasuta, the effect of the cold acclimation on the metabolic rate was not actually strong. This suggests that the increase in the metabolic rate is not necessarily associated with the improvement in the cold tolerance in D. nasuta.
Genetic analysis of cold tolerance and metabolic rate in response to cold acclimation in D. albomicans
A crossing experiment was conducted between the high (WL1) and low (X108) cold tolerance strains. The acclimatized flies showed longer LT50 values than the control flies in the F1 individuals from both types of reciprocal cross; the cold acclimation improved the survival time at 1 °C by ten hours. The acclimatized flies of the F1 hybrid also showed the increased respiration rate by 16% (Table 5). The difference in the respiration rate was statistically significant in both types of reciprocal cross: t = 2.33, df
= 58 and P < 0 .05 when WL1 strain is the maternal parent and t = 2.01, df = 58 and P <
0.05 when X108 strain is the maternal parent (Table 5). Such improvement in the cold tolerance and increase in the metabolic rate in response to the cold acclimation observed in the F1 hybrid were similar to the acclimation responses observed in the high cold tolerance parental strain (WL1) but not in the low cold tolerance parental strain (X108).
24 DISCUSSION
Cold adaptation of D. albomicans
Drosophila albomicans is a widely distributed species originated from the tropics in
Southeast Asia (Kitagawa et al., 1982). In Drosophila species, the ability to overwinter is a critical factor to limit their geographical distribution (Kimura, 1988; Kimura, 2004).
Therefore, an expected trend is that strains collected from colder areas have a higher cold tolerance. This trend was observed in D. albomicans, although the difference in cold tolerance among the strains from the three temperature zones was not very large
(Fig. 3) as reported for other Drosophila species as well (Kimura, 2004). This may be partly due to frequent migrations throughout their distribution range. In this regard, a strain from Taihsan, China, was noteworthy since the lowest monthly mean of daily minimum temperature of the collection site is —4.70 °C (Supplementary Table S4).
Since this species unlikely overwinters in such temperature condition, wind likely carried those flies from a distant location. Therefore, this strain was possibly established from a migrant from a warmer location, suggesting that adaptation to local thermal environment could be obscured by seasonal migration in comparative studies among geographic populations.
Alternatively, my results suggest that the acclimation response was not a critical factor for this species during the recent colonization in Japan and China (Temperature
Zone 1). Nevertheless, the comparison among closely related species revealed that the D. albomicans strains from the subtropics to the temperate regions (Temperature Zone 1 and 2) showed a higher cold tolerance than its closely related species belonging to the D. nasuta subgroup distributed in the tropics and subtropics irrespective of their experience
25 of the cold acclimation (Fig. 4). This implies that the distribution expansion of D. albomicans is likely attributed to the intraspecific variation including the strains that have a high cold tolerance and a strong acclimation response. It is noteworthy that D. pallidifrons, which is the most ancestral species in the D. nasuta subgroup (Wakahama et al., 1983; Suzuki et al., 1990), showed a relatively high cold tolerance after the cold acclimation (Fig. 4). This implies that D. albomicans may have retained the ability to respond the cold acclimation from the ancestral species, whereas many of the closely related species have lost it. Such preadapted trait is likely a critical factor for this species to have the potential of expanding its distribution to colder regions. In either case, my results suggest that the ability to adapt to temperature fluctuations varies among species and among strains and that D. albomicans has the best ability in the D. nasuta subgroup.
It might be worth discussing the effects of in-lab artificial selection during the long-term maintenance of the strains used in this study. Every wild strain used was originated from a single inseminated female fly so that at each locus there might be genetic variations among four (or more by multiple mating) alleles carried by the ancestral female in her eggs and the sperms that fertilized the eggs. Since all the strains have been propagated by sib-mating, there has been no other source of genetic variation except mutations newly occurred during the last thirty years, which is considered to be too short for the mutations to generate de novo genetic variation. Because of this small extent of genetic variation due to the small number of original alleles within a strain, the effects of in-lab selection should be largely restricted as selection does not operate without genetic variation. Therefore, it is unlikely that the observed differences in the cold tolerance and acclimation response were largely influenced by the effects of in-lab
26 artificial selection during the long-term maintenance of the strains.
In contrast to the small difference among geographic populations, there was a drastic difference in cold tolerance between D. albomicans and a cosmopolitan species,
D. melanogaster. The latter showed a much higher cold tolerance than the former in all the tested temperature conditions (Fig 2). Cosmopolitan species are generally considered to have higher tolerances to various environmental stresses such as heat, cold, and desiccation (Levins, 1969; Parsons and McDonald, 1978; Stanley et al., 1980;
Jenkins and Hoffmann, 1999). For example, Jenkins and Hoffmann (1999) showed that three cosmopolitan species, D. melanogaster, D. simulans and D. immigrans, were more tolerant of cold than D. serrata that is distributed in the subtropics and tropics of eastern
Australia. This is consistent with my observation of differences between D. albomicans and D. melanogaster. Furthermore, the level of acclimation response to different temperature conditions differed between these species. When flies were acclimatized at
15 °C or 20 °C, the effect was very similar for D. albomicans (Figs. 2A-B), whereas the acclimation at 15 °C was more effective than that at 20 °C for D. melanogaster (Figs.
2C-D).
In the previous studies on the effects of acclimation on cold tolerance using D. melanogaster, the acclimation temperature was set between 11-15°C. For example,
Goto (2000) showed that the half lethal temperature (temperature that kills half of the individuals for 24 hours) was 1 °C for the adult flies with an acclimation at 15 °C for 1 day, whereas it was 3 °C for those without acclimation. Bubliy et al. (2002) showed that when flies reared at 25 °C were acclimatized at 11 °C for 5 days before an exposure to
0 °C for 24 hours, the survival rate of the acclimatized flies was about 5-7 times higher than that of the control flies. Rako and Hoffmann (2006) showed that cold acclimatized
27 flies at 12 °C after reared at 19 °C had lower mortality after a cold shock at —5 °C or
—2 °C. Compared to the acclimation responses of D. melanogaster described in these studies, my results showed that a full acclimation response was induced in D. albomicans at much higher temperature. This suggests that the response to a slightly cooler temperature (20 °C) is important for D. albomicans in its habitat in the temperate regions.
There was another notable difference observed between D. melanogaster and D. albomicans. In D. albomicans, male flies showed a higher cold tolerance than female flies with a few exceptions (Figs. 2A-B; Supplementary Table S4). This tendency was observed irrespective of their experience of cold acclimation. Such between-sex difference was not very clear in D. melanogaster (Figs. 2C-D) or in other species belonging to the D. nasuta subgroup. However, the previous studies on D. melanogster and other species (D. takahashii, D. lutescens, D. triauraria, D. trapezifrons, D. watanabei, D. simulans, D. auraria and D. immigrans) showed that female flies tend to have a higher cold tolerance than male flies (Kimura, 1982; Goto and Kimura, 1998;
Goto et al., 2000; Bubliy et al., 2002; Kojima and Kimura, 2003), although Kimura
(1982) reported that the sex showing higher cold tolerance was dependent on the acclimation temperature in D. lutescens. Therefore, the observed between-sex difference in the cold tolerance of D. albomicans was rather exceptional among Drosophila species and may be reflecting some physiological traits specific to this species.
Metabolic rate and cold acclimation
In this study, there was no correlation found between cold tolerance and metabolic rate among different strains (Fig. 5A). This is consistent with Oikawa et al. (2006)
28 showing no significant correlation between mass-adjusted oxygen consumption and thermal tolerance among 28 species belonging to Drosophila and its related genera.
This may be because cold tolerance is a complex trait influenced by various factors such as presence of cryoprotective agents, antifreeze proteins, ice-nucleating proteins and heat-shock proteins and modified condition of cell membrane (Chown and Nicolson,
2004, for review; Lee and Denlinger, 2010; Michaud and Denlinger, 2010; Kostal,
2010; Chown and Sinclair, 2010; Huey, 2010; Overgaard et al., 2010; Storey and Storey,
2012). Differences in genetic background for these factors likely cause diversities in cold tolerance among strains and dispel the correlation with metabolic rate, which is also a complex physiological trait influenced by various factors.
By contrast, I found a significant positive correlation between the increase in cold tolerance and the increase in metabolic rate upon the cold acclimation among different strains of D. albomicans (Fig. 5B). In this case, influence of the differences in genetic background was expected to be canceled out by subtracting the value for the control flies from that for the acclimatized flies and the effect of cold acclimation should be successfully extracted. This result supports the hypothesis that the changes in metabolic rate and the changes in cold tolerance are involved in common physiological processes.
Similar metabolic rate changes upon cold acclimation have been shown by previous studies using D. melanogaster flies. For instance, Berrigan (1997) showed that the flies developed at 29 °C had a lower mass-specific metabolic rate than the flies with cold-acclimation at 18 °C. Overgaard et al. (2008) reported that the flies reared at 25 °C had a lower cold tolerance compared to the control flies acclimated at 20 °C. Although these studies were designed to examine the effect of the rearing temperature rather than the acclimation, I clearly showed in this study that the effect of rearing temperature is
29 mostly overridden by the temperature experienced at the adult stage using the deacclimation and reacclimation experiments. Therefore, their results can be interpreted as the response to the lower temperature experienced at the adult stage rather than the rearing temperature. In addition, using a tsetse fly species, Glossina pallidipes,
Terblanche et al. (2005) showed that the flies developed at 19 °C had a higher metabolic rate than those at 24 °C and 29 °C when measured at either 20 °C, 24 °C, 28 °C or 32°C.
Furthermore, Terblanche and Chown (2006) directly showed that both cold tolerance and metabolic rate became higher in response to cold acclimation at the adult stage as shown in this study for Drosophila species.
In this study, the results from the cross experiment between a high cold tolerance strain and a low cold tolerance strain suggested that the responses of the cold acclimation on the cold tolerance and on the metabolic rate are governed by (a) dominant genetic factor(s). In 1932, H.J. Muller proposed a classification of mutations, which is widely quoted today (Muller, 1932). He classified mutations into five basic groups, amorph, hypomorph, hypermorph, antimorph and neomorph. Amorph, hypomorph, and hypermorph represent quantitative changes to a pre-existing wild type character, antimorph represents mutual antagonistic interaction with wild type and neomorph represents a new phenotype not fully antagonized by wild type. In general, it is considered that amorph showing no gene function and hypomorph showing reduced gene function are almost always recessive (Hawley and Walker, 2003). Therefore, the genes relating to the cold acclimation response do not match these two categories. In dominant mutations, antimorph acts in opposition to normal gene activity, neomorph gains a new gene function and hypermorph increases normal gene function (Hawley and
Walker, 2003). Phenotype of hypermorph is similar to, but greater than, the wild-type
30 phenotype and the cold acclimation response is consistent with this category. Wilkie
(1994) described that the majority of mutations are recessive and dominance demands special explanation. He stated that it is not surprising if most dominant mutations are relating to critical rate limiting steps of metabolic pathways or causing qualitatively altered function, especially when structural or controlling/signaling proteins are involved. Therefore, it is likely that the genes involved in the cold acclimation response on the cold tolerance are the genes controlling a critical limiting step of metabolic pathways or regulating such genes.
Molecular responses to cold acclimation
Since the combinations of different acclimation forms, i.e., rapid cold hardening
(RCH), cold acclimation and rearing acclimation, resulted in cumulative effects on cold tolerance in Drosophila melanogaster, Colinet and Hoffmann (2012) suggested that the underpinning mechanisms for the different acclimation forms are at least partially independent. It has been known that RCH results in changes in cell membrane composition and fluidity of insect cells (Overgaard et al., 2005; Lee et al., 2006), increase in glycerol production (Lee et al., 1987), and changes in expression of several genes (Li and Denlinger, 2008; Colinet and Hoffmann, 2012). However, Sinclair et al.
(2007) showed that the expression of five genes previously known to have effects on cold tolerance did not change at RCH but did change later during the recovery from low temperature in Drosophila melanogaster. In flesh fly, Sarcophaga bullata, no transcripts were differentially expressed following two hours of RCH (Teets et al.,
2012). Recently, Teets et al. (2013) reported that calcium signaling was triggered by
RCH in insect tissues in absence of stimulation by nerves and/or hormones. These
31 studies suggested that changes in gene expression are not a major driver of RCH. On the other hand, the rapid response observed in RCH was not observed in the response to the cold acclimation, which took at least a few days in this study (Supplementary Fig. S1).
Therefore, it can be reasonably assumed that RCH and the cold acclimation have an essential difference in their underlying molecular mechanisms.
As the effect of rearing acclimation, Overgaard et al. (2008) reported the changes in cell membrane phospholipid composition likely controlled by some genes. However, it has been also shown that certain environmental stresses, e.g., nutrition, ultraviolet light, ionizing radiation, vinclozolin and heat, create heritable epigenetic `memories' (Seong et al., 2012 for review). Seong et al. (2011) showed that when embryos were exposed to a heat stress over multiple generations, the resulted defective chromatin state was maintained over multiple successive generations but gradually returned to the normal state. They found that this epigenetic effect was the underlying molecular mechanism responsible for the stress tolerance. Such effects of the long term rearing acclimation over generations are clearly different from the effects of the cold acclimation, which are easily canceled by the deacclimation for a few days (Table 3; Table4). Therefore, there must be some differences in the underlying molecular mechanism between the rearing acclimation and the cold acclimation. It should be noted that in my study flies were reared at least three consecutive generations in the same temperature as that at the beginning of each experiment to reduce the epigenetic effects of the rearing acclimation.
Similar to the cold acclimation response observed in this study, increase in metabolic rate and increase in cold tolerance were induced by changes in gene expression level in D. melanogaster mutants such as atsugari and fumin (Takeuchi et al.,
2009; Ueno et al., 2012). While the altered gene expressions occurring in the transgenic
32 flies were permanent, similar changes in gene expression might occur in response to environmental temperature changes in wild type flies. I hypothesize that this is a plausible mechanism of the cold acclimation to improve the cold tolerance. Actually, it was reported that Smp30 (Dca), which was most likely to be involved in cold adaptation, was up-regulated during the cold acclimation at 15 °C for a few days in D. melanogaster after reared at 25 °C (Goto, 2000). Furthermore, my deacclimation and reacclimation experiments showed that the effects of the cold acclimation were plastic but experiencing a lower or higher temperature for at least a few days was needed to alter the acclimatized or non-acclimatized state of flies (Table 3; Table 4). These results suggest that the molecular mechanism of cold acclimation is a systematic change in gene expressions. Therefore, to investigate the molecular mechanism of the cold acclimation, it is important to search for genes whose expression is altered during cold acclimation and examine their phenotypic effect on cold tolerance by artificially altering the expression level. These experiments will shed light on the molecular mechanisms of cold tolerance to help our understanding evolutionary adaptation to thermal environment by organisms.
33 LITERATURE CITED
Berrigan, D. (1997) Acclimation of metabolic rate in response to developmental
temperature in Drosophila melanogaster. J. Therm. Biol. 22, 213-218.
Berrigan, D., and Partridget, L. (1997) Influence of temperature and activity on the
metabolic rate of adult Drosophila melanogaster. Comp. Biochem. Physiol. A
Physiol. 118, 1301-1307.
Bubliy, 0. A., Riihimaa, A., Norry, F. M., and Loeschcke, V. (2002) Variation in
resistance and acclimation to low-temperature stress among three geographical
strains of Drosophila melanogaster. J. Therm. Biol. 27, 337-344.
Chen, W., Zhang, J., Geng, Z., and Zhu, D. (1994) Invasion of Drosophila albomicans
into Shanghai and areas nearby and a study on its mitochondrial DNA
polymorphism. Yi Chuan Xue Bao 21, 179-187.
Chown, S. V., and Nicolson, S. W. (2004) Insect physiological ecology: mechanisms
and patterns. Oxford University Press, New York.
Chown, S. L., and Sinclair, B. J. (2010) The macrophysiology of insect cold-hardiness.
In: Low Temperature Biology of Insects (eds.: R. E. Lee and D. L. Denlinger), pp.
191-222. Cambridge University Press, New York.
Colinet, H., and Hoffmann, A. A. (2012) Comparing phenotypic effects and molecular
correlates of developmental, gradual and rapid cold acclimation responses in
Drosophila melanogaster. Funct. Ecol. 26, 84-93.
Czajka, M. C., and Lee, R. E. (1990) A rapid cold-hardening response protecting against
34 cold shock injury in Drosophila melanogaster. J. Exp. Biol. 148, 245-254.
Fleming, J. E., and Miguel, J. (1983) Effects of temperature on the metabolic rate of
young and old Drosophila. Experientia 39, 267-268.
Fujino, Y., Beppu, K., and Nakamura, H. (2006) Stratification of the Drosophilid
assemblage in the research forest of AFC, Shinshu University. Bulletin Shinshu
University Alpine Field Center 4, 47-55.
Gillooly, J. F., Brown, J. H., West, G. B., Savage, V. M., and Charnov, E. L. (2001)
Effects of size and temperature on metabolic rate. Science 293, 2248-2251.
Goto, S. G. (2000) Expression of Drosophila homologue of senescence marker
protein-30 during cold acclimation. J. Insect Physiol. 46, 1111-1120.
Goto, S. G., and Kimura, M. T. (1998) Heat- and cold-shock responses and temperature
adaptations in subtropical and temperate species of Drosophila. J. Insect Physiol. 44,
1233-1239.
Goto, S. G., Kitamura, H. W., and Kimura, M. T. (2000) Phylogenetic relationships and
climatic adaptations in the Drosophila takahashii and montium species subgroups.
Mol. Phylogenet. Evol. 15, 147-156.
Hawley, R. S., and Walker, M. (2003) Mutation. In: Advanced Genetic Analysis:
Finding Meaning in a Genome, pp. 1-31. Blackwell publishing, Oxford.
Hoffmann, A. A., Sorensen, J. G., and Loeschcke, V. (2003) Adaptation of Drosophila
to temperature extremes: bringing together quantitative and molecular approaches. J.
Therm. Biol. 28, 175-216.
35 Hoshina, H., Yamada, C., Uomi, H., and Terashima, M. (2007) Actual distribution of
Drosophila (Drosophila) albomicans Duda, 1924 (Diptera: Drosophilidae) in Fukui
pref., Honshu, Japan. Bulletin of The Fukui City Museum of Natural History 54,
79-82.
Huey, R. B. (2010) Evolutionary physiology of insect thermal adaptation to cold
environments. In: Low Temperature Biology of Insects (eds.: R. E. Lee and D. L.
Denlinger), pp. 223-241. Cambridge University Press, New York.
Hulbert, A. J., Clancy, D. J., Mair, W., Braeckman, B. P., Gems, D., and Partridge, L.
(2004) Metabolic rate is not reduced by dietary-restriction or lowered insulin/IGF-1
signaling and is not correlated with individual lifespan in Drosophila melanogaster.
Exp. Gerontol. 39, 1137-1143.
Jenkins, N. L., and Hoffmann, A. A. (1999) Limits to the southern border of Drosophila
serrata: cold resistance, heritable variation, and trade-offs. Evolution 53, 1823—
1834.
Kimura, M. T. (1982) Inheritance of cold hardiness and sugar contents in two closely
related species, Drosophila takahashii and D. lutescens. Jan. J. Genet. 57, 575-580.
Kimura, M. T. (1988) Adaptations to temperate climates and evolution of overwintering
strategies in the Drosophila melanogaster species group. Evolution 42, 1288-1297.
Kimura, M. T. (2004) Cold and heat tolerance of drosophilid flies with reference to their
latitudinal distributions. Oecologia 140, 442-449.
Kitagawa, 0., Wakahama, K. I., Fuyama, Y., Shimada, T., Takanasi, E., Hatsumi, M.,
Uwabo, M., and Mita, Y. (1982) Genetic studies of the Drosophila nasuta subgroup,
36 with notes on distribution and morphology. Jan. J. Genet. 57, 113-141.
Kojima, K., and Kimura, M. T. (2003) Life history adaptations and stress tolerance of
four domestic species of Drosophila. Entomological Science 6, 135-142.
Kostal, V. (2010) Cell structural modifications in insects at low temperatures. In: Low
Temperature Biology of Insects (eds.: R. E. Lee and D. L. Denlinger), pp. 116-140.
Cambridge University Press, New York.
Lee, R. E., Chen, C. P., and Denlinger, D. L. (1987) A rapid cold-hardening process in
insects. Science 238, 1415-1417.
Lee, R. E., Damodaran, K., Shu-Xia, Y., and Lorigan, A. (2006) Rapid cold-hardening
increases membrane fluidity and cold tolerance of insect cell. Cryobiology 52, 459—
463.
Lee, R. E., and Denlinger, D. L. (2010) Rapid cold-hardning: ecological significance
and underpinning mechanisms. In: Low Temperature Biology of Insects (eds.: R. E.
Lee and D. L. Denlinger), pp. 35-58. Cambridge University Press, New York.
Levins, R. (1969) Thermal acclimation and heat resistance in Drosophila species. The
Am. Nat. 103, 483-499.
Li, A., and Denlinger, D. L. (2008) Rapid cold hardening elicits changes in brain
protein profiles of the flesh fly, Sarcophaga crassipalpis. Insect Mol. Biol. 5, 565—
572.
Michaud, M. R., and Denlinger, D. L. (2010) Genomics, proteomics and metabolomics:
finding the other players in insect cold-tolerance. In: Low Temperature Biology of
37 Insects (eds.: R. E. Lee and D. L. Denlinger), pp. 91-115. Cambridge University
Press, New York.
Mikasa, K. (1991) A statistical analysis of seasonal fluctuations of population size in
Drosophila populations near human habitation at Himeji city. J. Arts Sci. Meikai
University 3, 8-18.
Muller, H. J. (1932) Further studies on the nature and causes of gene mutations. Proc.
6th int. Congr. Gen., 1, 213-255.
Ohtsu, T., Katagiri, C., and Kimura, M. T. (1998) How Drosophila species acquire cold
tolerance; Qualitative changes of phospholipids. Eur. J. Biochem. 252, 608-611.
Ohtsu, T., Katagiri, C., and Kimura, M. T. (1999) Biochmical aspects of climatic
adaptations in Drosophila curviceps, D. immigrans and D. albomicans (Diptera:
Drosophilidae). Environmental Entomology 28, 968-972.
Oikawa, A., Mori, N., and Kimura, M. T. (2006) Comparison of oxygen consumption in
drosophilid flies from different climates. Entomological Science 9, 347-354.
Overgaard, J., Sorensen, J. G., and Loeschcke, V. (2010) Genetic variability and
evolution of cold-tolerance. In: Low Temperature Biology of Insects (eds.: R. E. Lee
and D. L. Denlinger), pp. 276-296. Cambridge University Press, New York.
Overgaard, J., Sorensen, J. G., Petersen, S. 0., Loeschcke, V., and Holmstrup, M. (2005)
Changes in membrane lipid composition following rapid cold hardening in
Drosophila melanogaster. J. Insect Physiol. 51, 1173-1182.
38 Overgaard, J., Tomcala, A., Sorensen, J. G., Holmstrup, M., Krogh, P. H., imek, P., and
Kogtal, V. (2008) Effects of acclimation temperature on thermal tolerance and
membrane phospholipid composition in the fruit fly Drosophila melanogaster. J.
Insect Physiol. 54, 619-629.
Parsons, P. A., and McDonald, J. (1978) What distinguishes cosmopolitan and endemic
Drosophila species? Cell. Mol. Life Sci. 34, 1445-1446.
R Development Core Team, "R: A language and environment for statistical computing",
R Foundation for Statistical Computing, Vienna, Austria, 2008.
Rako, L., and Hoffmann, A. A. (2006) Complexity of the cold acclimation response in
Drosophila melanogaster. J. Insect Physiol. 52, 94-104.
Salt, R. W. (1961) Principles of insect cold-hardiness. Annu. Rev. Entomol. 6, 55-74.
Seong, K. H., Li, D., Shimizu, H., Nakamura, R., and Ishii, S. (2011) Inheritance of
stress-induced, ATF-2-dependent epigenetic change. Cell 145, 1049-1061.
Seong, K. H., Maekawa, T., and Ishii, S. (2012) Inheritance and memory of
stress-induced epigenome change: roles played by the ATF-2 family of transcription
factors. Genes Cells 17, 249-263.
Sinclair, B. J., Gibbs, A. G., and Roberts, S. P. (2007) Gene transcription during
exposure to, and recovery from, cold and desiccation stress in Drosophila
melanogaster. Insect Mol. Biol. 16, 435-443.
Stanley, S. M., Parsons, P. A., Spence, G. E., and Weber, L. (1980) Resistance of species
of the Drosophila melanogaster subgroup to environmental extremes. Aust. J. Zool.
39 28, 413-421.
Storey, K. B., and Storey, J. M. (2012) Insect cold hardiness: metabolic, gene, and
protein adaptation. Can. J. Zool. 90, 456-475.
Suzuki Y. M., Kitagawa 0., and Wakahama K. I. (1990) Chromosomal analysis and
phylogenetic relationships in the Drosophila nasuta subgroup. I. Phylogenetic
relationships within the Drosophila sulfrigaster species complex. Genetica 80, 53—
66.
Takeuchi, K., Nakano, Y., Kato, U., Kaneda, M., Aizu, M., Awano, W., Yonemura, S.,
Kiyonaka, S., Mori, Y., Yamamoto, D., et al. (2009) Changes in temperature
preferences and energy homeostasis in dystroglycan mutants. Science 323, 1740—
1743.
Teets, N. M., Peyton, J. T., Ragland, G. J., Colinet, H., Renault, D., Hahn, D. A., and
Denlinger, D. L. (2012) Combined transcriptomic and metabolomic approach
uncovers molecular mechanisms of cold tolerance in a temperate flesh fly. Physiol.
Genomics 44, 764-777.
Teets, N. M., Yi, S. X., Lee, R. E., and Denlinger, D. L. (2013) Calcium signaling
mediates cold sensing in insect tissues. Proc. Natl. Acad. Sci. 110, 9154-9159.
Terblanche, J. S., and Chown S. L. (2006) The relative contributions of developmental
plasticity and adult acclimation to physiological variation in the tsetse fly, Glossina
pallidipes (Diptera, Glossinidae). J. Exp. Biol. 209, 1064-1073.
Terblanche, J. S., Klok, C. J., and Chown S. L. (2005) Temperature-dependence of
metabolic rate in Glossina morsitans morsitans (Diptera, Glossinidae) does not vary
40 with gender, age, feeding, pregnancy or acclimation. J. Insect Physiol. 51, 861-870.
Ueno, T., Tomita, J., Kume, S., and Kume, K. (2012) Dopamine modulates metabolic
rate and temperature sensitivity in Drosophila melanogaster. PLoS ONE 7, e31513.
Wakahama, K. I, Shinohara. T., Hatsumi. M., Uchida, S., and Kitagawa. O. (1983)
Metaphase chromosome configuration of the immigrans species group of
Drosophila. Jan. J. Genet. 57, 315-326.
Wilkie, A. 0. (1994) The molecular basis of genetic dominance. J. Med. Genet. 31, 89—
98.
41 Table 1
The 50% lethal time (LT50) and metabolic rate measurements for 10 D. alb omzcans strains without or with cold acclimation LT50 (hours) Metabolic rate (µl /mg.hour) ± S.E.
Strain male female male
25/25 25/20 25/25 25/20 25/25 25/20
X108 10.66 12.29 9.08 10.56 0.171 (±0.03) 0.145 (±0.02)
SWB101 9.81 17.57 6.22 13.73 0.170 (±0.02) 0.185 (±0.03)
KM3 11.67 20.21 8.36 20.49 0.124 (+0.01) 0.156 (+0.01)
HNZ 12 13.52 20.18 10.73 16.72 0.146 (±0.02) 0.141 (±0.03)
WL1 7.86 23.34 5.33 17.98 0.162 (+0.02) 0.221 (±0.02)
NG3 15.63 24.55 13.38 22.20 0.129 (±0.02) 0.148 (±0.02)
KMT21 9.68 18.70 10.41 18.48 0.159 (±0.01) 0.191 (±0.02)
KKU202 11.41 20.74 10.60 20.66 0.135 (+0.01) 0.183 (+0.01)
TAK502 8.52 19.17 6.58 15.01 0.166 (±0.01) 0.201 (±0.01)
SMT503 15.52 19.27 10.16 19.83 0.180 (±0.02) 0.159 (+0.01)
42 Table 2 The 50% lethal time (LT50) for 8 D. albomicans strains without or with deacclimation LT50 - Half Lethal Time (hours)
Strain maleb female'
20/20 20/25 20/20 20/25
X108 17.49 13.55 15.24 9.49
WL1 > 24.00a 10.47 22.13 9.45
I0M2 > 24.00a 15.52 20.69 12.64
NG3 > 24.00a 20.13 > 24.00a 15.14
YAK1 23.60 22.73 22.04 15.36
TAK2 20.14 16.50 15.56 10.87
KKU202 > 24.00a 19.64 > 24.00a 17.65
KKU204 19.73 18.62 17.70 13.13 a Survival rate larger than 50% at the 24 hour time point. b Pairwise t test shows a significant difference between 20/20 and 20/25 (t = 7.65 ,df=7,P<0.01). c Pairwise t test shows a significant difference between 20/20 and 20/25 (t = 3.32 ,df=7,P<0.05).
43 Table 3 The 50% lethal time (LT50) for two D. albomicans strains with deacclimation or reacclimation
Deacclimation Reacclimation
Strain 25/20/20a 25/20/25 20/25/25b 20/25/20
WL1 male 23.34 11.28 10.47 > 24.00`
female 17.98 5.93 9.45 20.08
X108 male 12.29 8.58 11.21 12.22
female 10.56 6.54 8.91 9.7 'Data from 25/20 in Table 1 bData from 20/25 in Table 2 cSurvival rate larger than 50% at the 24 hour time point .
44 Table 4
Metabolic rate (mean ±S.E.) of two D. albomicans strains experiencing various temperature conditions
Strain 25/25/25a 25/20/20b 25/20/25 20/20/20 20/25/25 20/25/20
WL1 0.162 (+ 0.02) 0.221 (+ 0.02) 0.158 (+ 0.03) 0.194 (+ 0.03) 0.131 (± 0.01) 0.185 (+
X108 0.171 (± 0.03) 0.145 (± 0.02) 0.165 (± 0.03) 0.143 (± 0.01) 0.119 (± 0.01) 0.123 (± 0.01) aData from 25/25 in Table 1 bData from 25/20 in Table 1
45 Table 5 The 50% lethal time (LT50) and metabolic rate for F1 hybrids between WL1 and X108 strains of D. albomicans
LT50 (hours) Metabolic rate (µl /mg.hour) ± S.E.
Strain male female male
25/25 25/20 25/25 25/20 25/25 25/20
WL1a 7.86 23.34 5.33 17.98 0.162 (±0.02) 0.221 (±0.02)
X108b 10.66 12.29 9.08 10.56 0.171 (±0.03) 0.145 (±0.02)
WY XXe F1 9.78 21.68 8.08 18.23 0.134 (±0.01) 0.157 (±0.01)
XYXWe F1 8.46 18.80 8.39 17.30 0.147 (±0.01) 0.162 (±0.01) aData from WL1 in Table 1 bData from X108 in Table 1
46 30
c, 25 ,, , Er 20 ,,,—.; i4 ,_, 15 O cd 10
5 O 0
-5 -5 0 5 10 15 20 25
Lowest monthly mean of daily minimum temperature ((C)
Fig. 1. Correlation between the lowest monthly mean of daily minimum temperature and the lowest monthly mean temperature in 23 collection sites of the D. albomicans strains used in this study (Spearman's r = 0.98, P < 10-15).Dotted lines indicate where three temperature zones were divided.
47 (A) D. albomicans male(C) D. melanogaster male 100% ..A14, .
z c,
•^^1t*7150%15013/0fit VI'!L...... =Z%.%.*
0% ------0. % ...... A...... 5 15 25 35 45 5 15 25 35 45 Time exposed to 1 °C (hours)Time exposed to 1 °C (hours) 100%k(B) D. albomicans female(D) D. nnelanogaster female n‘ ~50°loi1;.49CI 50°~o? 1"..t‘ Ai. % . 10 0%0% 35 455 15 2535 45 Time55100%•••A•••....,,A•.._At exposed to 1 °C (hours) Time exposed to 1 °C (hours)
Fig. 2. Survival rate at 1 QC for male (A) and female (B) flies of the D. albomicans
WL1 strain, and for male (C) and female (D) flies of the D. melanogaster Canton S strain after the cold acclimations at 15 QC (dotted line) or 20 QC (broken line). Solid line represents the curve for the non-acclimatized control flies. The error bars indicate the standard errors.
48 (A) Non-acclimatized male (B) Non-acclimatized female 201 20
15 I I 15
t.. 10 10
5 5 in UIf) E•
0 0 12 3 123 Temperature Zones Temperature Zones
(C) Acclimatized male (D) Acclimatized female
20 20
15 15 a t.. 10 10
in tn 5 5 E• H
0 0 123123 Temperature ZonesTemperature Zones
Fig. 3. The 50 % lethal time at 1 QC(LT50) for non-acclimatized male (A) and female
(B) flies and the 25 % lethal time at 1 QC (LT25) for acclimatized male (C) and female
(D) flies of D. albomicans. The asterisks indicate a statistical significance of the difference between temperature zones 1 and 3 (Tukey's HSD P < 0.05). The error bars indicate the standard errors.
49 (A) Non-acclimatized
100% 1
°L) 40%
G: r—,
G?
c:
0% 1 ^I ^I ^--r1I ^I ^I - ^T, -- -- 1 — 1 1 Zone 1 Zone 2 Zone 3~o-~a5~``~~°~a~roa~aN ...z~
I. aibomicansN" ~d'Sr4,~' 4. ,:y 4.Cr
(B) Acclimatized 100% -
N=12 N=13 N=4 N=4N=13 N=4 N=3 N=4N=3 N=4
(CD") c: II
s0%- CD CI tI1 I -i iili Zone 1 Zone 2 Zone 3o-~ar\a~~ ii,i1
~. aibomicansC'4.9.ry'+•o N. 4''Sr4'4'
Fig. 4. The survival rates (+1 SE) of non-acclimatized (A) and acclimatized (B) male
(filled bar) and female (open bar) flies at 1 °C for 16 hours for D. albomicans
populations from 3 temperature zones and its closely related species in the D. nasuta
subgroup. N denotes the number of strains involved in the populations or species.
50
I ( )
0.25 ©6.
et 0.20
0.15
0.10
0.05
0.00 0 5 10 15 20 25 LT5O (hours) ( . ) :0.06
4:: 0.00 • •II
i -0.02 •
W -0.04 • 0 2 4 6 8 10 12 14 16 18
A LT50 (hours)
Fig. 5. Relationship between metabolic rate and the 50% lethal time (LT50) at 1 QC
of the non-acclimatized flies (open circle) and the acclimatized flies (filled circle) for 10
D. albomicans strains (A) and relationship between the metabolic rate change and LT50
change upon the cold acclimation, where black, grey and white marks indicate the
strains from Temperature Zones 1, 2 and 3, respectively (B). I 51 ( )
0.25 6 G o^l 0.20
0.15
0.10
0.05
0.00 0 5 10 15 20
LTD (hours) (B)
0.04 L G
A 0.02 E
A 6 0.00
.ICI 76 -0 .02 i Am 4 W
-0.04 4 0 2 4 6 8 10 12 14 16
A LT 50 (hours)
Fig. 6. Relationship between metabolic rate and the 50% lethal time (LT50) at 1 QC
of the non-acclimatized flies (open circle) and the acclimatized flies (filled circle) for 8
D. nasuta strains (A) and relationship between the metabolic rate change and LT50
change upon the cold acclimation, where grey and white marks indicate the strains from
Temperature Zones 2 and 3, respectively (B).
52
Ia Supplementary Table Si Collection sites, years, lowest monthly mean temperature and temperature zones for 29 D. albomicans strains used in the present study.
Collection lowest monthly mean Temperature Area Abbreviation Collection site year temperature (( C) Zone
b Southeast Asia X3 Kuala Lumpur, Malaysia 1979 27.30 3 b X86 Kuala Lumpur, Malaysia 1979 27.30 3 b X108 Kuala Lumpur, Malaysia 1979 27.30 3 b Y57 Penang, Malaysia 1979 27.70 3 b 21 CNX66 Chiangmai, Tailand 1982 .80 2
MMY1 Maymyo, Myanmar 1982 e 20.95 2
SWB101 Shwebo, Myanmar 1982 e 20.95 2
SWB105 Shwebo, Myanmar 1982 e 20.95 2 b China SZ40 Shenzhen, China 1988 14.50 2 b KM3 Kunming, China 1988 8.30 1 4 b HNZ 12 Hangzhou, China 1991 .50 1 b SNH1 Shanghai, China 1991 4.10 1 d TSN3 Taihsan, China 1991 -0 .60 1
Taiwan KT23 Kenting, Taiwan 1977 e 21.05 2 f GZL1 Guantzling, Taiwan 1991 16.95 2
WL1 Wulai, Taiwan 1977 16.40g 2
53 Supplementary Table Si continued h Japan I0M2 Iriomote-jima, Japan 1978 17.70 2 h 1 ISG98-2 Ishigaki j ima, Japan 1989 7.95 2 h NG3 Nago, Japan 1978 16.15 2 h AMM101 Amami-oshima, Japan 1987 14.60 2 h 11 YAK1 Yaku-shima, Japan 1982 .30 2 h a KMT21 Kumamoto, Japan 1990 5.55 1 h a KKU202 KiiKatuura, Japan 1991 6.10 1 h 6 a KKU204 KiiKatuura, Japan 1991 .10 1 h a KKU210 KiiKatuura, Japan 1991 6.10 1 h TAK2a Takamatsu, Japan 1992 5.25 1 h a TAK502 Takamatsu, Japan 1991 5.25 1 h HRS401a Hiroshima, Japan 1991 5.65 1 h a SMT503 Hyougo, Japan 1991 5.30 1
a Populations where inhabitation was confirmed after the late 1980s. b Data from World Meteorological Organization (1971-2000, except for CNX66, KM3 and SNH1 (1961-1990)).
e Temperature data of Mandalay from World Meteorological Organization (1961-1990) was used.
d Temperature data of Jinan from World Meteorological Organization (1971-2000) was used.
e Temperature data of Hengchun from Central Weather Bureau (1981-2010) was used.
f Temperature data of Chiayi from Central Weather Bureau (1981-2010) was used. gT emperature data of Yilan from Central Weather Bureau (1981-2010) was used. h Data from Japan Meteorological Agency (1981-2010).
54 Supplementary Table S2 Collection sites, years, lowest monthly mean temperature and temperature zones for strains of the species closely related species of D. albomicans used in the present study.
Collection lowest monthly mean Temperature Species Subsp ecies Abbreviation Collection site year temperature (QC) Zone
D. nasuta RE319 Reunion Islands, France 1988
TNR34 Antananarivo, Madagascar 1971 10.3c 2 d 20 K31 Mombasa, Kenya 1971 .3 3 d 20 K33 Mombasa, Kenya 1971 .3 3 d 20 K34 Mombasa, Kenya 1971 .3 3
BZV1 Brazzaville, Congo 1985
M34 Mahe', Seychelles 1979 23.9e 3
SS95 Mahe', Seychelles 1988 23.9e 3
C2 Kandy, Sri Lanka 1979 c 18.4 2
C3 Kandy, Sri Lanka 1979 c 18.4 2
MYS 1 Mysore, India 1981 16.3c 2
VNS46 Varanasi, India 1981 8.8 2
F217 Varanasi, India 1979 8.8 2
D. kepulauana U36 Miri, Malaysia 1979 23.1c 3 b 3122BTN d 23 Bandar Seri Begawan, Brunei .0 3 f R48 PPS Palawan, Philippines 1979 23.5 3 f 23 R121 Palawan, Philippines 1979 .5 3
55
c a Supplementary Table S2 continued
C D. kohkoa W48 Singapore 1979 23.1 3
C V75 Kunching, Malaysia 1979 22.9 3 b UTPPS f Palawan, Philippines 23.5 3
g RGN 107 Rangoon, Myanmer 1981 17.9 2 h D. pulaua WAU 18 Wau, Papua New Guinea 1981 22.3 3 h WAU30 Wau, Papua New Guinea 1981 22.3 3 C T102 Kota Kinabaru, Malaysia 1979 22.9 3
D. sulfrigaster albostrigata NN25 Nakhon Nayok, Thailand 1977 20.8 3
f Q44 Los Banos, Philippines 1979 23.5 3 C MDL7 Mandaley, Myanmer 1982 13.3 3
bilimbata TBU5 Tongatapu, Tonga 1981
C NAN 128 Nadi, Fiji 1981 18.3 2
PPG73 Pago Pago, American Samoa 1981 22.6 3
GUM78 Guam, U.S.A. 1981
D. pallidifrons PNI2 Ponape, Caroline Islands 1981
PNI8 Ponape, Caroline Islands 1981
PNI14 Ponape, Caroline Islands 1981
PNI75 Ponape, Caroline Islands 1981 a Stock obtained from CNRS. b Stock obtained from University of Texas. C Data from World Meteorological Organization (1961 -1990, except for TNR34, U36, V75 and T102 (1971-2000), MYS1 (1901-2000) and VNS46 and
56 F217 (1952-2000)).
d Data from World Meteorological Organization (collection years not specified) Temperature data of Victoria from World Meteorological Organization was used (1971-1990). Temperature data of Metro Manila from World Meteorological Organization was used (1971-2000). gT emperature data of Yangon from World Meteorological Organization was used (1961-1990). Temperature data of Lae City from World Meteorological Organization was used (1973-1992). Temperature data of Bangkok from World Meteorological Organization was used (1961-1990). Temperature data of Apia from World Meteorological Organization was used (1971-2000).
57
e Supplementary Table S3 The results of three-way analysis of variance for LT50 among each zone. Zone 3 (lowest monthly mean of daily minimum temperature: 25 °C - 20 °C)
Source SS df MS F p-value F boundaries sex 9.011 1 9.011 20.089 0.021 10.128 acclimation 214.711 1 214.711 478.660 0.000 10.128 strain 20.801 3 6.934 15.457 0.025 9.277 acclimationX sex 2.048 1 2.048 4.565 0.122 10.128 acclimationxstrain 47.008 3 15.669 34.932 0.008 9.277 strainX sex 1.791 3 0.597 1.331 0.410 9.277 acclimationxsexx strain 1.346 3 0.449 total 296.716 15
Zone 2 (lowest monthly mean of daily minimum temperature: 20 °C - 5 °C)
Source SS df MS F p-value F boundaries sex 62.391 1 62.391 23.818 0.000 4.667 acclimation 1466.783 1 1466.783 559.951 0.000 4.667 strain 245.782 13 18.906 7.218 0.001 2.577 acclimationxsex 1.695 1 1.695 0.647 0.436 4.667 acclimationx strain 116.913 13 8.993 3.433 0.017 2.577 strainX sex 48.351 13 3.719 1.420 0.268 2.577 acclimationx sexx strain 34.053 13 2.619 total 1975.968 55
Zone 1 (lowest monthly mean of daily minimum temperature: 5 °C - -5 °C)
Source SS df MS F p-value F boundaries sex 33.770 1 33.770 20.706 0.001 4.965 acclimation 825.332 1 825.332 506.062 0.000 4.965 strain 171.610 10 17.161 10.522 0.000 2.978 acclimationx sex 8.578 1 8.578 5.260 0.045 4.965 acclimationx strain 69.944 10 6.994 4.289 0.015 2.978 strainX sex 28.659 10 2.866 1.757 0.194 2.978 acclimationX sexX strain 16.309 10 1.631 total 1154.202 43
58 Supplementary Table S4 Collection site, its latitude, lowest monthly mean temperature and lowest monthly mean of daily minimum temperature and 50% and 25% lethal times (LT50 and LT25) of 29 D. albomicans strains used in the present study.
lowest monthly mean female male
Strain Collelation Site Latitude (°) of daily minimum 25/25 25/20 25/25 25/20
temperature (°C) LT50 LT50 LT25 LT50 LT50 LT25
X3 Kuala Lumpur, Malaysia 3.139 22.50 6.27 16.04 12.52 7.27 17.54 13.38
X86 Kuala Lumpur, Malaysia 3.139 22.50 4.55 13.32 9.90 5.99 16.81 13.53
X108 Kuala Lumpur, Malaysia 3.139 22.50 9.08 10.56 7.91 10.66 12.29 10.10
Y57 Penang, Malaysia 5.263 23.60 9.60 16.03 13.58 8.71 18.15 14.71
CNX66 Chiangmai, Tailand 18.796 14.20 8.56 > 24.00a 18.58 10.76 > 24.00a 19.75
KT23 ken-ting, Taiwan 22.000 17.80 8.65 18.45 13.43 12.68 20.98 16.42
MMY1 Maymyo, Myanmar 22.034 13.30 4.98 19.97 16.43 9.53 20.66 16.86
SZ40 Shenzhen, China 22.543 10.00 9.52 23.20 19.36 10.91 22.44 18.87
SWB101 Shwebo, Myanmer 22.570 13.30 6.22 13.73 10.70 9.81 17.57 13.84
SWB 105 Shwebo, Myanmer 22.570 13.30 6.56 13.74 9.99 4.00 18.18 14.11
GZL1 Guantz-ling, Taiwan 23.485 12.10 7.26 17.78 15.18 7.77 16.22 14.51
WL1 Wulai, Taiwan 24.693 13.40 5.33 17.98 13.92 7.86 23.34 20.56
I0M2 Iriomotejima, Japan 24.334 15.50 11.12 14.42 10.63 12.64 17.06 13.37
ISG98-2 Ishigakijima, Japan 24.334 16.10 8.08 19.45 12.17 13.88 23.93 19.20
KM3 Kun-ming, China 25.038 1.50 8.36 20.49 14.73 11.67 20.21 16.73
NG3 Nago, Japan 26.586 13.00 13.38 22.20 16.57 15.63 > 24.00a 18.75
AMM101 Amamioshima, Japan 28.250 11.80 6.91 18.08 13.82 11.02 21.22 17.57
59 Supplementary Table S4 continued
HNZ12 Hangzhou, China 30.274 1.00 10.73 16.72 13.55 13.52 20.18 17.04
YAK1 Yakushima, Japan 30.371 8.40 7.66 23.42 15.95 9.36 18.02 10.76
SNH1 Shang-hai, China 31.230 0.50 8.63 > 24.00a 21.83 13.40 > 24.00a 23.81
KMT21 Kumamoto, Japan 32.803 0.80 10.41 18.48 15.47 9.68 18.70 16.16
TAK2 Takamatsu, Japan 34.343 1.20 3.16 16.51 11.88 10.77 20.02 16.93
TAK502 Takamatsu, Japan 34.343 1.20 6.58 15.01 10.92 8.52 19.17 16.50
HRS401 Hiroshima, Japan 34.3 85 1.70 11.61 17.55 14.95 12.71 16.61 14.67
SMT503 Hyougo, Japan 34.691 1.90 10.16 19.83 15.77 15.52 19.27 16.18
KKU202 Katuura, Japan 35.152 2.50 10.60 20.66 16.97 11.41 20.74 17.58
KKU204 Katuura, Japan 35.152 2.50 10.22 14.72 11.48 12.09 16.51 12.54
KKU210 Katuura, Japan 35.152 2.50 8.83 16.43 13.22 11.65 18.02 15.78
TSN3 Taihsan, China 36.192 -4 .7 14.12 > 24.00a 18.54 14.25 > 24.00a 20.85 aSurvival rate larger than 50% at the 24 hour time point.
60 (A) ce
100% -- 4 ..---4----+---- - 80% - fr„- ~i 44~ 1r °-,60°l% -I^ .... cuI CI40% - I
r I, •• • • •20%'/410 ••
'0%• 01 2 3 4 56 7 Length of acclimation treatment at 20 °C (days) (B) ?
100% •- G ~- 80% - __. c't r ~-r..a',~~~+~`~-+ z'60% - re
E40% - r~~~~~ %di -^~/ ffi ,?20% F'
con 0% 40 • •-~ 0 1 2 3 4 5 6 7 Length of acclimation treatment at 20 °C (days)
Supplementary Fig. Si. Survival rate of male (A) and female (B) flies after 14
-hour (X108 and YAK) or 16-hour (WL1 and KKU204) cold treatment at 1 QC with various length (day) of acclimation at 20 C. The dotted line, broken line and solid line with filled circles show the curves for the strains WL1, YAK1 and KKU204, respectively. The solid line with open circles show that for the X108 strain. The error bars indicate the standard errors.
61
o *
1.4 1 1 T I1 N.S. :1.2 , 1 nia 1
0.8
60.6 • Non-acclimatized •^yt)
.0 0.4 O Acclimatized cl 1 y1 W 2
0 WL1 X108
Supplementary Fig. S2. Metabolic rate at 20 °C in WL1 and X108 strains.
Acclimatized flies (filled bar) had significantly high metabolic rate than
non-acclimatized flies (open bar) in WL1 strain (t = 2.384, df = 28, P < 0.05), whereas
the difference was not significant in X108 strain (t = 1.565, df = 28, P > 0.1). The error
bars indicate the standard errors.
62
0 Part II
Transgenic analysis for identification of Drosophila
albomicans genes response to cold acclimation
63 SUMMARY
Cold acclimation is one of the strategies for insects to adjust their physiological condition to the temperature changes. It is thought to be an important factor of cold tolerance to adapt to seasonal temperature changes. In a fruit fly species, Drosophila albomicans, which has extended its geographic distribution from tropical to temperate regions during late 1980's, temperate populations have a higher cold tolerance in terms of survival time at 1 °C of adult flies than tropical populations and the response to cold acclimation is an important factor of the higher cold tolerance. Using the RNA-seq method, I found that the expression level was altered by the cold acclimation in many genes. To examine the effect of these genes on the cold tolerance, I over-expressed or knock-downed several of these genes in D. melanogaster Ga14/UAS transgenic strains.
The cold tolerance was improved when Sdr was over-expressed or CG14153 was knock-downed. Furthermore, it was clarified that the over-expression of Sdr had the effect only when it was over-expressed in glial cells, where the gene is expressed in normal flies. These results suggest that Sdr and CG14153 were involved in the improvement of the cold tolerance upon the cold acclimation in D. albomicans.
Nevertheless, when D. melanogaster was acclimatized and the cold tolerance was improved, the expression levels of the two genes were not altered. This suggests that the two genes are not necessarily essential for cold tolerance and there are separate molecular bases having a potential to improve the cold tolerance independently among
Drosophila species.
64 INTRODUCTION
Cold tolerance is one of the key factors that determine the fitness of insects whose activity and survival are constantly affected by the environmental temperature (Lee and
Denlinger, 2010). In Drosophila, many studies have reported that species distributed in relatively colder locations usually show higher cold tolerance (reviewed in Hoffmann et al., 2003). For example, Kimura and Beppu (1993) compared the cold tolerance as survival time at 1.5 °C among three species: D. curviceps collected in highland temperate zone, D. immigrans collected in lowland temperate zone and D. albomicans collected in subtropical zone. They showed that D. curviceps had the highest tolerance and D. albomicans had the lowest tolerance, which was consistent with the difference in the temperature environment among their distributions. The similar tendencies were shown in other Drosophila species as well (e.g. Goto and Kimura, 1998; Ohtsu et al.,
1999; Goto et al., 2000; Gibert et al., 2001; Kimura 2004).
Drosophila albomicans belonging to the D. nasuta subgroup had a wide geographic distribution in the tropical and subtropical Southeast Asia until late 1980's (Kitagawa et al., 1982) but has expanded the distribution to the Japanese archipelago in the temperate regions recently (Mikasa, 1991; Chen et al., 1994; Fujino et al., 2006; Hoshina et al.,
2007), whereas its closely related species of the D. nasuta subgroup have stayed in the tropics or subtropics. In my current study (Part I), I found that D. albomicans had a higher cold tolerance in terms of the survival time at 1 °C than its closely related species of the D. nasuta subgroup. In addition, I showed that this cold tolerance of adult flies of
D. albomicans was largely improved by a cold acclimation for several days at 20 °C, which was 5 °C lower than the rearing temperature. In this context, D. albomicans
65 provides an excellent opportunity for studying the mechanism of cold tolerance for organisms to adapt to a cold temperature environment. It is particularly suitable for studying the genetic and physiological mechanisms of the cold acclimation response to enhance the cold tolerance.
Cold acclimation is a phenomenon shown in many insect species including those belonging to Drosophila; an exposure to a non-lethal cooler temperature than usual enhances the cold tolerance in preparation for the anticipated subsequent severe cold temperature. The nature of this acclimation response is complex. In previous studies, it was classified to be different forms in terms of temperature, time and developmental stages; i.e., rearing acclimation (e.g. Czajka and Lee, 1990; Ohtsu et al., 1999), rapid cold hardening (Overgaard et al., 2005; Lee et al., 2006; Overgaard et al., 2008) and cold acclimation (Goto, 2000; Bubliy et al., 2002). Although the combinations of the different acclimation forms resulted in cumulative effects on the cold tolerance in D. melanogaster, Colinet and Hoffmann (2012) suggested that the underpinning mechanisms of the different acclimation forms were at least partially independent. The acclimation condition at 20 °C for a few days of D. albomicans is categorized to be the cold acclimation according to Rako and Hoffmann's (2006) definition. With respect to this acclimation form, Smp30 (Dca) was reported to be up-regulated during the cold acclimation at 15 °C for a few days in D. melanogaster after being reared at 25 °C
(Goto, 2000). Using the microarray technique to search for the genes associated with cold tolerance, Vesala et al (2012) showed that expression level was changed in 14 genes in D. virilis and in 18 genes in D. montana by the cold acclimation at 5 °C for 6 days. These observations suggest that the molecular mechanism of the cold acclimation response is a systematic change in gene expression. Therefore, to investigate the
66 molecular mechanism of the cold acclimation response, it is suitable to search for genes whose expression is altered during the cold acclimation and examine their phenotypic effects on cold tolerance by artificially altering their expression level.
In this study, to investigate the molecular mechanisms of the cold acclimation response, which was shown to enhance the cold tolerance of D. albomicans (Part I), I searched for genes whose expression levels were altered by the cold acclimation, as the candidates of the genes responsible for improving the cold tolerance in D. albomicans, using RNA-seq and RT-qPCR methods. Then, for some of the candidate genes obtained,
I over-expressed or knocked-down them using the Ga14/UAS transgenic strains of D. melanogaster to examine their phenotypic effect of the expression level changes on the cold tolerance.
67 MATERIALS AND METHODS
Fly strains
Three wild strains of Drosophila albomicans, WL1, SNH1 and KKU204 were originated from adult flies collected in Wulai in Taiwan, Shanghai in China and
KiiKatuura in Japan, respectively. Each strain was established from a single inseminated female as an isofemale line and has been maintained as a small mass culture with standard corn-meal medium at 20 °C under constant light condition before use. In addition, the wild type strains of D. melanogaster, Canton 5, Oregon R, and A135
(collected from Aomori in Japan) were maintained at 25 °C in otherwise the same condition as the D. albomicans strains. To control for epigenetic effects, all the fly strains were cultured at 25 °C on the standard corn-meal medium for at least three consecutive generations before all the experiments. Then, adult flies were separated according to their sex within 48 hours after eclosion without using anesthesia. Therefore, they were not necessarily virgin.
Alteration of gene expression was achieved by using the Ga14/UAS system in D. melanogaster (Brand and Perrimon, 1993). The UAS strains (Toba et al., 1999),
UAS-Lip3 (no. 201450), UAS-pepck (no. 202117), UAS-Prx2540-2 (no. 203812),
UAS-Sirup (no. 206343), UAS-CG1887-(1) (no. 200492), UAS-CG1887-(2) (no.
204917) and UAS-Sdr (no. 206122) were obtained from Drosophila Genetic Resource
Center (DGRC, http://kyotofly.kit.jp/cgi-bin/stocks/index.cgi). The RNAi strains,
UAS-IR-CG14153 (III)-1 (no. 14153R-3) and UAS-IR-CG14153 (III)-2 (no. 14153R-2) were obtained from NIG-FLY stock center (http://www.shigen.nig.ac.jp/fly/nigfly/).
Two RNAi strains, in which the transgene was inserted in different positions in third
68 chromosome, were used for CG14153. The Actin-Gal4 strain (Ito et al., 1997) was used to drive the ubiquitous over-expression of the UAS strains or to knock-down of the
RNAi strains. In addition, the Gal4 strains, Repo-Gal4 (BL7415), Cg-Gal4 (BL7011),
Elav-Gal4 (BL8765) and Mef2-Gal4 (BL27390) were obtained from Bloomington
Drosophila Stock Center (http://flystocks.bio.indiana.edu/) to drive tissue specific over-expression of UAS-Sdr in glial cells, fat body, muscle and neuron, respectively. All the strains were maintained at 25 °C before experiments. To examine the gene expression level and the cold tolerance, 7 days old flies were used. To control for genetic background effects, the same Gal4 driver line was crossed to yw or w1118strain, from which the UAS or RNAi strains were originated, respectively, and the gene expression level and cold tolerance of the F1 hybrid were compared to those of the F1 hybrid of the corresponding Ga14 and UAS/RNAi strains.
Measurement of cold acclimation and cold tolerance
For the experiments using wild strains, 20 - 60 flies were put in a vial with fresh medium and kept at 20 °C for 7 days for D. albomicans or at 15 °C for 4 days for D. melanogaster to make the acclimatized condition. For the non-acclimatized control flies as well as transgenic mutant flies, 20 - 60 flies were put in a vial with fresh medium and kept at 25 °C for 7 days.
To examine the cold tolerance of flies, the survival rate after exposed to 1 °C for 16 or 24 hours was measured. For each strain, 20 individuals were transferred into a glass vial (15 mm diameter and 105 mm long) containing 2 ml of sugar agar medium [10 % sucrose; 1 % agar; 1 % butyl parahydroxybenzoate] and kept in an incubator, in which air temperature was regulated to be 1 ± 0.5 °C for the period of 16 or 24 hours and then
69 programed to become 20 °C. To measure the actual air temperature in the incubator during the experiment, temperature data loggers (Thermochron G type) were used.
Finally, the number of survivors was counted 48 hours after the end of cold treatment at
1 °C. If a fly stood on its legs and walked, the fly was identified as a survivor. I used 20 individuals for each experiment, which was replicated 5 times and 15 times for wild strains and transgenic mutant strains, respectively.
RNA-seq analysis
For the RNA-seq analysis, only the flies of D. albomicans WL1 strain, for which the cold acclimation response was confirmed by measuring cold tolerance, were used.
Total RNA was extracted from 10 male adult flies by the acid-guanidinium phenol-chloroform (APGC) method (Chomczynski and Sacchi 1987) and subsequently purified by using silica-gel particles based on the method of Boom et al. (1999) as follows.
Live adult flies were homogenized with a plastic pestle in a 1.5 ml tube with 500 µl of solution D [4 M guanidium thiocyanate; 0.75 M sodium citrate; 0.45 % s-lauryl sarcosinate]. Then 10 p1 of silica-gel suspension [Wakocil 5SIL (Wako) : 0.01 N HC1 =
1 : 1] was mixed with the homogenate and incubated at room temperature for 5 minutes with a brief vortex every 1 minute to absorb the genomic DNA onto the silica-gel particles. The mixture was then centrifuged by 12,000 rpm for 1 minute at room temperature. The supernatant was transferred to a new tube and 50 pi of 2 M Sodium
Acetate (pH 4.0), 500 p1 of water-saturated Phenol and 150 µl of
Chloroform-Isoamylalchol mixture (Chloroform : Isoamylalchol = 24 : 1) were added and mixed thoroughly. After stored on ice for 15 minutes, the mixture was centrifuged
70 by 10,000 rpm for 20 minutes at 4 °C. The aqueous phase was transferred to a new tube and a half volume of ethanol and 10111of silica gel suspension were mixed. The mixture was incubated at room temperature for 5 minutes with a brief vortex every 1 minute, centrifuged by 12,000 rpm for 1 minute, and the supernatant was discarded. The precipitated silica-gel particles were washed with 500 p1 of the wash buffer [10 mM
Tris-HC1 (pH 7.5); 100 mM NaCl; 80 % Ethanol] twice by resuspension and centrifugation. The finally resulting pellet of the silica-gel particles were dried up at room temperature and the total RNA was eluted from the silica-gel particles with 50 µl of TE [10 mM Tris-HC1 (pH 8.0); 0.1 mM EDTA] by incubation at 70 °C for 5 minutes.
After a centrifugation at 12,000 rpm for 30 seconds, the supernatant containing the total
RNA was transferred to a new tube and stored at —80 °C until further use.
The RNA-seq of the cDNA was performed by TAKARA BIO INC using an Illumina
GAIIx sequencer. Each sequence read obtained was queried against the D. albomicans cDNA database previously constructed from 454 FLX reads, using the local BLAST program (Altschul et al. 1990). To estimate the expression level of each gene, the total number of reads to hit the gene in the BLAST search was counted. To calibrate the difference in transcript length among different genes, the number of reads obtained was then standardized to be the number of reads per kilobase of exon per million mapped reads (RPKM) (Mortazavi et al. 2008) as follows.
RPKM = Number of reads / Total number of reads / Transcript length (kilobase) x
1,000,000
Quantitative reverse transcription PCR (RT-qPCR)
For the RT-q PCR analysis, only the flies of WL1, KKU204 and SNH1 strains of D.
71 albomicans and CS, OR, A135 strains of D. melanogaster, for which the cold acclimation response was confirmed by measuring cold tolerance, were used.
Total RNA was obtained by the same method for the RNA-seq analysis as described above. The first-strand cDNA was synthesized from 1 jig of the total RNA by using
Superscript III First-Strand Synthesis System (Invitrogen, North America) according to the manufacturer's instructions as follows. First, to inactivate residual genomic DNA, the total RNA solution was treated with 1 U DNase I (Invitrogen) in 10 µl of 200 mM
Tris-HC1 (pH 8.4), 20 mM MgCl2, 500 mM KC1 at room temperature for 20 minutes.
The DNA digestion was terminated by adding 1 Ill of 25 mM EDTA and incubated at
65 °C for 10 minutes. Then, 0.5 µl of 100 µM oligo-(dT)15 primer (5'-
TTTTTTTTTTTTTTT -3'), 1 'al of 10 mM dNTP mix and 4 µl of DW were mixed and incubated at 65 °C for 5 minutes and placed on ice more than 2 minutes. Finally, 4 ill of
5x first-strand buffer (250 mM Tris-HC1 pH 8.3, 375 mM KC1, 15 mM MgC12), 1 µl of
0.1 M DTT, 3 Ill of DW and 200 U SuperScript III Reverse Transcriptase (Invitrogen) were added. The reaction mixture of 20 Ill volume in total was incubated at 50 °C for 50 minutes and the reverse transcription was terminated by incubation at 85 °C for 5 minutes. The same reaction without reverse transcriptase was conducted as the negative control for genomic DNA. The RT-qPCR was performed on the Thermal Cycler Dice
Real Time System (TAKARA BIO INC).
To compare the acclimation effect on gene expression between the acclimatized flies and the control flies, the relative expression ratio was calculated for 11 genes (Lip3,
Pepck, CG12374, Prx, Sirup, CG1887, Sdr, CG14153, Lsp2, tim and CG16762). To verify gene expression changes in the transgenic flies, the relative expression ratio was calculated between the transgenic and control flies for 6 genes (Lip3, Pepck, Prx, Sirup,
72 Sdr and CG14153). The primer set for each gene was designed with the aid of Oligo
Analyzer version 1.0.3 (Kuulasmaa, 2002) and Oligo Explorer version 1.1.2
(Kuulasmaa, 2002) programs (Supplementary Tables 1 and 2). Ribosomal protein L32 gene (RpL32) was used as an internal control gene and the relative expression ratio of each gene to RpL32 was calculated by the standard curve method (Larionov et al., 2005).
The gene expression level was measured with three biological and two technical replications.
Measurement of metabolic rate
To measure the metabolic rate of flies, only male flies were used, because they had smaller body size variation irrespective of their reproductive state. Following Hulbert et al. (2004), the metabolic rate was measured in terms of the consumption of O2 of flies 7 days after the eclosion. I assembled respiration chambers by connecting a 1 ml plastic syringe containing a small amount of CO2 absorber (Soda lime, Wako) to a 50 Ill micropipette via a plastic adaptor and a short rubber tube (Supplemental Fig. 1). In each syringe body, 20 flies were placed and then the plunger was inserted to close the respiration chamber. The respiration chambers were placed on a flat plate in a water bath filled with ice-cold water for at least 1 hour to equilibrate the flies' respiration rate and then 4 p1 of ink was put on the tip of the micropipette. Then, the movement of the ink corresponding to the oxygen consumption was measured at every 1 hour over the next 3 hours. The measurements for the transgenic flies and for the control flies were conducted simultaneously in the same water bath with an empty chamber to control for unknown effects from ambient temperature, pressure, etc. Each set of the measurement was replicated 30 times independently to obtain the average and variance.
73 RESULTS
Summary of RNA-seq analysis
The cDNA sequence data were obtained from 31,946,508 and 32,991,841 reads for the acclimatized flies and the non-acclimatized flies of D. albomicans, respectively, by using an Illumina GAIIx sequencer. After removing sequence reads with low quality value under 20, the remaining reads were BLAST searched against the D. albomicans cDNA database obtained in the previous study (unpublished). As the result, the total numbers of reads hit were 16,971,674 and 16,043,908 for the acclimatized flies and the non-acclimatized flies, respectively.
Comparing the RPKM values between the acclimatized flies and the non-acclimatized flies, I found that the transcription level was increased by the cold acclimation in 53 genes by at least 2.5 times. Table 1 is the list of the 53 genes.
Similarly, Table 2 is the list of the 23 genes whose expression level was decreased by less than two fifth. These genes are considered to be the candidates involved in the improvement of the cold tolerance by the cold acclimation.
Acclimation effect on candidate genes in D. albomicans and D. melanogaster
There were 7 out of the 53 genes, for which the GS strains were available for artificial over-expression, whereas there were 4 out of the 23 genes, for which RNAi strains were available for knock-down gene expression. Using RT qPCR, I confirmed the expression level of these 7 plus 4 genes, since the result of the RNA-seq experiment performed only once was subject to a sampling error. To compare the effect of cold acclimation on gene expression between D. albomicans and D. melanogaster, the
74 expression level of these genes was measured for D. melanogaster as well as D. albomicans. However, the temperature of 15 °C was employed for the cold acclimation of D. melanogaster, whereas it was 20 °C for D. albomicans. This was because the effective temperature for the cold acclimation was different between the two species as described in Part I. The effective time length for the cold acclimation was fixed to be 1 day for D. albomicans WL1 and KKU204 strains as described in Part I. On the other hand, the effective time lengths for the cold acclimation of SNH1 strain of D. albomicans and CS, OR and A135 strains of D. melanogaster were measured by the survival rate after 24 hours at 1 °C with various time lengths of cold acclimation at
20 °C (D. albomicans) or 15 °C (D. melanogaster). As the result, it was found that
SNH1 strain needed 7 days and CS, OR and A 13 5 strains needed 4 days to obtain the maximum effect of the cold acclimation (Fig. 1). In D. melanogaster, the effective time length of the cold acclimation was essentially the same among the three strains, whereas there was substantial difference among strains in D. albomicans; SNH1 needed much longer cold acclimation time than WL1 and KKU204 strains.
In D. albomicans WL1 strain, the gene expression changes upon the cold acclimation shown by the RT-qPCR were similar to those shown by the RNA-seq (Figs.
2A-B). The gene expression level was significantly up-regulated in Lip3, Pepck,
Prx2540-2, Sirup, CG1887 and Sdr, and down-regulated in CG14153 upon the cold acclimation. In KKU204 strain, the gene expression level was significantly up-regulated in four genes (Lip3, Pepck, Sirup and CG1887) and down-regulated in CG14153 and tim (Figs. 2C-D). In SNH1 strain, the gene expression level was significantly down-regulated in three genes, CG14153, tim and CG16762 (Figs. 2E-F). Therefore, the gene expression level of CG14153 was down-regulated in all three D. albomicans
75 strains. In D. melanogaster, no significant change was observed in either of the genes in
CS strain (Figs. 3A-B) but one gene (CG14153) in OR strain and two genes (CG12374 and Prx2540-2) in A135 strain (Figs. 3C-F) were significantly up-regulated. Although the expression of CG14153 was up-regulated in A135 strain, it was down-regulated in D. albomicans. These result suggested that the genes whose expression level was changed by the cold acclimation in D. albomicans had almost no effect via the cold acclimation in D. melanogaster.
Gene expression and cold tolerance in transgenic mutant strains
To examine the effect of the 6 genes that were significantly up-regulated (Lip3,
Pepck, Prx2540-2, Sirup, CG1887 and Sdr) or down-regulated (CG14153) upon the cold acclimation in D. albomicans WL1 strain, I over-expressed or knock-downed these genes in D. melanogaster Ga14/UAS transgenic strains.
As the results, the expressions of Sdr and CG1887 were significantly increased in the Actin-Ga14/UAS-Sdr flies (t = 5.72, df = 4, P < 0.001) and the
Actin-Ga14/UAS-CG1887-(2) flies (t = 4.55, df= 4, P < 0.01), respectively, as compared to their negative control Actin-Gal4/yw flies (Fig. 4). The expression of CG14153 was significantly decreased in the Actin-Ga14/UAS-IR-CG14153(III)-1 (t = 13.19, df= 4, P <
0.001) and Actin-Ga14/UAS-IR-CG14153(III)-2 (t = 10.24, df = 4, P < 0.001) flies compared to the Actin-Ga14/w1118 flies (Fig. 4). These results indicated that the expressions of these three genes were actually altered by Ga14/UAS system. On the other hand, the expressions of Lip3, Pepck, Prx2540-2 and Sirup were not significantly different between the transgenic and control flies (Fig. 4).
The survival rate after 24 hours at 1 °C was not significantly different between the
76 Actin-Ga14/UAS-CG1887-(2) and Actin-Ga14/yw flies (Fig. 5A, t = 0.36, df = 28, P >
0.05). In contrast, the Actin-Ga14/UAS-Sdr flies showed a higher survival rate (80 %) compared to the Actin-Ga14/yw flies (37 %) (Fig. 3B). The difference was statistically significant (t = 5.12, df = 28, P < 0.001). In addition, the survival rates of the
Actin-Ga14/ UAS-IR-CG14153(III)-1 (64 %) and Actin-Ga14/UAS-IR-CG14153(III)-2
(69 %) flies were significantly higher than the Actin-Ga14/w1118flies (20 %) : t = 7.53, df
= 28 , P < 0.001 and t = 7.21, df = 28, P < 0.001, respectively (Fig. 3C). No significant difference in the survival rate was observed in other transgenic strains (Supplemental
Fig. 2). These results showed that the over-expression of Sdr and the knock-down of
CG14153 had the effect on the cold tolerance.
To examine the effect of the Sdr over-expression in details, I used Repo-Ga14,
Cg-Ga14, Elav-Gal4 and Mef2-Ga14, in addition to Actin-Ga14, to induce their corresponding tissue specific overexpression of Sdr in glial cells, fat body, muscle and neuron, respectively. In D. melanogaster, it was reported that Sdr encoded a secreted decoy of InR (insulin-like receptor), which was a negative regulator of insulin signaling predominantly expressed in glial cells and its product was secreted into the hemolymph
(Okamoto et al., 2013). I examined whether this tissue specificity was important for the effect of Sdr on the cold tolerance. The survival rate of the Repo-Ga14/UAS-Sdr flies was significantly higher than the Repo-Ga14/yw flies (t = 5.02, df = 28, P < 0.001), whereas other Gal4 lines (Cg-Ga14, Elav-Gal4 and Mef2-Gal4) did not make significant differences in the cold tolerance between UAS-Sdr and its negative control line yw (Fig.
6). It was suggested that the over-expression of Sdr had the effect on cold tolerance when over-expressed in glial cells, where Sdr is expressed in wild type flies.
77 Metabolic rate in transgenic mutants
To examine whether the 3 genes (CG1887, Sdr and CG14153), whose expression alteration had significant effects on the cold tolerance, had effect on the metabolic rate, I measured the metabolic rate at 0 °C for the corresponding transgenic flies. The metabolic rate at 0 °C was not different between the Actin-Ga14/UAS-CG1887-(2) and
Actin-Ga14/yw flies (t = 1.679, df = 58, P > 0.05) (Fig 7A) and between the
Actin-Ga14/UAS-Sdr and Actin-Ga14/yw flies (t = 0.405, df= 58, P > 0.05) (Fig 7B). In addition, there was no difference in the metabolic rate between Actin-Ga14/
UAS-IR-CG14153(III)-1 and Actin-Ga14/w1118flies (t = 0.492, df = 58, P > 0.05) (Fig.
7C).
78 DISCUSSION
Gene expression response to cold acclimation in D. albomicans
In this study, the cold tolerance of D. melanogaster was significantly improved by the over-expression of Sdr, whose expression was increased upon cold acclimation in D. albomicans, and by knock-down of CG14153, whose expression was decreased upon the cold acclimation in D. albomicans (Fig. 4). Nevertheless, the expressions of these two genes were not significantly altered in D. melanogaster upon the cold acclimation, whereas the cold tolerance was substantially improved (Figs. 3A-F). From these results, it was suggested that the two genes, Sdr and CG14153, had ability to improve the cold tolerance but actually functioned to improve the cold tolerance as the response to the cold acclimation only in D. albomicans. This implies that the improved cold tolerance by the cold acclimation in D. melanogaster was attributable to other genes. At any rate, the effect of Sdr and CG14153 on the cold tolerance predicted by their gene expression pattern in D. albomicans was experimentally verified in the transgenic mutant lines in D. melanogaster.
It was reported in D. melanogaster that Sdr, whose product (SDR) was a secreted decoy of InR (insulin-like receptor), functioned as a negative regulator of insulin signaling (Okamoto et al., 2013). In general, insulin in hemolymph is known to govern various physiological functions including gluconeogenesis, glycolysis and lipid metabolism, etc. by binding to insulin receptors on cell membrane (e.g., Pessin and
Saltiel, 2000; Saltiel and Kahn, 2001; Puigserver et al., 2003; Xu et al., 2011). Okamoto et al. (2013) suggested that SDR controlled insulin/insulin-like growth factor signaling
(IIS) in peripheral tissues, showing that SDR bound to Drosophila insulin-like peptide
79 (Dlip) in hemolymph as a "decoy receptor" to inhibit the binding of Dlip to the genuine receptors on the cell membrane, which resulted in body growth inhibition. If IIS is inhibited by the overexpression of SDR, gluconeogenesis is expected to be stimulated to increase glucose level in blood. In insects, including Drosophila, it is known that the concentration of sugars (such as trehalose and glucose) is increased under cold temperature and during the rapid cold hardening to avoid freezing, because it functions as a cryoprotectant in the blood (e.g., Storey and Storey, 1991; Overgaard et al., 2007;
Michaud and Denlinger, 2010; Kostal et al., 2011). However, because the temperature condition of the cold acclimation is milder than that of the rapid cold hardening, glucose in the blood might play a separate role such as an energy source. It was reported that insects needed mobilization of energy reserves when being faced with stress (Arrese and
Soulages, 2010). It was also reported that the transcription of Sdr was detected in surface glia in CNS and midgut muscles (Okamoto et al., 2013), which is consistent with the fact observed in this study that the over-expression of Sdr in glial cells improved the cold tolerance, but not in muscle, fat body and neuron (Fig. 6). These observations suggest that the over-expression of Sdr in glial cells was essential for improving the cold tolerance, although the effect of Repo-Gal4 was not so strong compared to those of Actin-Gal4. This suggests the possibility that the expression in other tissues also contributed to the cold tolerance or the level of over-expression was higher with Actin-Gal4 than Repo-Gal4.
Unlike Sdr, the function of CG14153 has not been characterized yet. The amino-acid sequences of CG14153 have not been highly conserved among 10 out of 12
Drosophila species, in which the intact sequence of CG14153 was found in the genome sequence already available (Drosophila 12 Genomes Consortium 2007). By contrast,
80 although the expression of CG1887 was increased by the cold acclimation in D. albomicans, the over-expression of this gene in D. melanogaster did not affect cold tolerance (Fig 5A). This suggests the possibility that CG1887 is involved in the cold tolerance of D. albomicans but not in that of D. melanogaster or that even in D. albomicans, the increased expression by the cold acclimation was a side effect of other genes involved in the cold tolerance.
In Part I, I found a significant positive correlation between the increase in cold tolerance and that in metabolic rate upon cold acclimation. However, in this study, there was no significant change in the metabolic rate found with alteration of the gene expression level in the transgenic lines (Figs. 7A-C), which suggests that the cold tolerance can be improved without the increase in the metabolic rate.
Difference in the mechanism of cold acclimation response between species
The results in this study suggested that the expression of the seven genes was changed by the cold acclimation in D. albomicans but was not changed in D. melanogaster (Fig. 2 and Fig. 3). On the other hand, the expression of HSP 23, 40 and
70, Frost and Starvin, which was known to be changed by the cold acclimation in D. melanogaster (Colinet and Hoffmann, 2012), was not changed in D. albomicans (Table
1 and Table 2). These results suggest that the genes involved in the cold acclimation response are different between D. albomicans and D. melanogaster. Furthermore, the expression of 27 genes whose expression level was changed upon the cold acclimation in either D. virilis or D. montana (Vesala et al., 2012) was not changed in D. albomicans
(Tables 1 and 2), whereas 5 genes showed similar expression changes between D. virilis and D. montana out of 14 (increased in 8 and decreased in 6) and 18 (increased in 11
81 and decreased in 7) genes in D. virilis and D. montana, respectively (Vesala et al., 2012).
This may be because of the closer phylogenetic relationship of these two species compared to the phylogenetic relationship of D. albomicans and D. melanogaster (van der Linde et al., 2010). Therefore, one should consider the possibility that there are few common genes involved in the improvement of cold tolerance upon the cold acclimation among the species belonging to the genus Drosophila. Bing et al. (2011) showed that the expression of Frost was increased during the recovery at 22 °C for 1 hour from exposure at 0 °C for 2 hours in seven species of the melanogaster group, whereas it was not changed in D. willistoni, which is not belonging to the melanogaster group, although the cold tolerance in their study was defined in terms of the recovery from the cold exposure rather than the survival rate. These observations suggest that although the cold tolerance as a physiological trait is shared by distantly related species, only a few common genes are related to the same physiological trait among closely related species. A similar tendency was shown with respect to Dca (smp-30) gene, which is a candidate gene relating to the cold acclimation response.
In the previous studies, the autosomal Dca was shown to be up-regulated upon a one-day cold acclimation at 15 °C in D. melanogaster (Goto, 2000). Clowers et al.
(2010) found variations in the non-coding region of Dca significantly associated with cold tolerance and concluded that Dca was one of the most credible candidate genes responsible for cold tolerance in D. melanogaster belonging to the subgenus
Sophophora. However, Arboleda-Bustos and Segarra (2011) indicated that there was no
Dca in the species of the subgenus Drosophila. They suggested that Dca arose by a gene duplication of the ancestral regucalcin gene after the split of the subgenera
Sophophora and Drosophila. Therefore, it is impossible for Dca to be responsible for
82 cold tolerance in the subgenus Drosophila. In addition, it was not clear whether the regucalcin gene was associated with the cold tolerance and/or the cold acclimation. In this study, no significant change in the transcription level of the regucalcin gene upon the cold acclimation was detected in D. albomicans belonging to the subgenus
Drosophila (Table 1 and 2). Vesala et al. (2012) showed that the expression level of the regucalcin gene was changed by the cold acclimation at 5 °C for 6 days neither D. virilis nor D. montana. Moreover, Reis et al. (2011) showed that the expression of the regucalcin gene was not changed by cold shock in D. americana and D. melanogaster either.
Although the cold tolerance was improved after the cold acclimation for a few days in both D. albomicans and D. melanogaster, the temperature that brought the full acclimation response was different (Part I). In this study, it was also found that the time length required for the cold acclimation was different between the two species (Fig. 1).
These results suggest that the condition of drawing the maximum acclimation response differs between species. Moreover, there was a variation in the time required for the maximum acclimation response among D. albomicans strains (Fig. 1A). Interestingly, two strains (WL1 and KKU204) showing a similar pattern of cold acclimation response on the cold tolerance (Fig. 1A) showed a similar change in the gene expression pattern
(Figs. 2A-D), whereas SNH1 showed substantial differences in the acclimation responses on the cold tolerance and on the gene expression pattern (Figs. 2E-F). This suggests that the difference in the gene expression pattern caused the difference in the cold tolerance in response to the cold acclimation.
In conclusion, I confirmed experimentally that Sdr and CG14153 had ability of improving of cold tolerance upon cold acclimation in D. melanogaster, using
83 over-expression and knock-down of the genes, respectively, in the transgenic mutant strains. However, there were variations in the gene expression pattern in response to the cold acclimation between strains as well as between D. albomicans and D. melanogaster. These observations suggest that D. albomicans and D. melanogaster have a common physiological trait, i.e., the improved cold tolerance upon cold acclimation, acquired in their evolutionary processes but in different ways in its molecular basis.
84 I. ITE RATURE CITED
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local
alignment search tool. J. Mol. Biol. 215, 403-10.
Arboleda-Bustos, C. E., and Segarra, C. (2011) The Dca gene involved in cold
adaptation in Drosophila lnelanogaster arose by duplication of the ancestral
regucalcin gene. Mol. Biol. Evol. 28, 2185-2195.
Arrese, E. L., and Soulages, J. L. (2010) Insect fat body: energy, metabolism, and
regulation. Annu. Rev. Entomol. 55, 207-225.
Bing, X., Zhang, J., and Sinclair, B. J. (2012) A comparison of Frost expression among
species and life stages of Drosophila. Insect Mol. Biol. 21, 31-39.
Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-van Dillen, P. M., and
van der Noordaa, J. (1990) Rapid and simple method for purification of nucleic
acids. J. Clin. Microbiol. 28, 495-503.
Brand, A. H., and Perrimon, N. (1993) Targeted gene expression as a means of altering
cell fates and generating dominant phenotypes. Development 118, 401-15.
Bubliy, 0. A., Riihimaa, A., Norry, F. M., and Loeschcke, V. (2002) Variation in
resistance and acclimation to low-temperature stress among three geographical
strains of Drosophila nielanogaster. J. Therm. Biol. 27, 337-344.
Chen, W., Zhang, J., Geng, Z., and Zhu, D. (1994) Invasion of Drosophila albomicans
into Shanghai and areas nearby and a study on its mitochondrial DNA
polymorphism. Yi Chuan Xue Bao 21, 179-187.
85 Chomczynski, P., and Sacchi, N. (1987) Single-Step Method of RNA Isolation by Acid
Guanidinium Thiocyanate-Phenol-Chloroform Extraction. Anal. Biochem. 162,
156-159.
Clowers, K. J., Lyman, R. F., Mackay, T. F. C., and Morgan, T. J. (2010) Genetic
variation in senescence marker protein-30 is associated with natural variation in
cold tolerance in Drosophila. Genet. Res. 92, 103-113.
Colinet, H., and Hoffmann, A. A. (2012) Comparing phenotypic effects and molecular
correlates of developmental, gradual and rapid cold acclimation responses in
Drosophila melanogaster. Funct. Ecol. 26, 84-93.
Czajka, M. C., and Lee, R. E. (1990) A rapid cold-hardening response protecting against
cold shock injury in Drosophila melanogaster. J. Exp. Biol. 148, 245-254.
Drosophila 12 Genomes Consortium. (2007) Evolution of genes and genomes on the
Drosophila phylogeny. Nature 450, 203-218.
Fujino, Y., Beppu, K., and Nakamura, H. (2006) Stratification of the Drosophilid
assemblage in the research forest of AFC, Shinshu University. Bulletin Shinshu
University Alpine Field Center 4, 47-55.
Gibert, P., Moreteau, B., Petavy, G, Karan, D., and David, J. R. (2001) Chill-coma
tolerance, a major climatic adaptation among Drosophila species. Evolution 55,
1063-1068.
Goto, S. G., and Kimura, M. T. (1998) Heat- and cold-shock responses and temperature
adaptations in subtropical and temperate species of Drosophila. J. Insect Physiol. 44,
1233-1239.
86 Goto, S. G. (2000) Expression of Drosophila homologue of senescence marker
protein-30 during cold acclimation. J. Insect Physiol. 46, 1111-1120.
Goto, S. G., Kitamura, H. W., and Kimura, M. T. (2000) Phylogenetic relationships and
climatic adaptations in the Drosophila takahashii and montium species subgroups.
Mol. Phylogenet. Evol. 15, 147-156.
Hoffmann, A. A., Sorensen, J. G., and Loeschcke, V. (2003) Adaptation of Drosophila
to temperature extremes: bringing together quantitative and molecular approaches. J.
Therm. Biol. 28, 175-216.
Hoshina, H., Yamada, C., Uomi, H., and Terashima, M. (2007) Actual distribution of
Drosophila (Drosophila) albomicans Duda, 1924 (Diptera: Drosophilidae) in Fukui
pref., Honshu, Japan. Bulletin of The Fukui City Museum of Natural History 54,
79-82.
Hulbert, A. J., Clancy, D. J., Mair, W., Braeckman, B. P., Gems, D., and Partridge, L.
(2004) Metabolic rate is not reduced by dietary-restriction or lowered insulin/IGF-1
signaling and is not correlated with individual lifespan in Drosophila melanogaster.
Exp. Gerontol. 39, 1137-1143.
Kimura, M. T. (2004) Cold and heat tolerance of drosophilid flies with reference to their
latitudinal distributions. Oecologia 140, 442-449
Kimura, M. T., and Beppu, K. (1993) Climatic adaptations in the Drosophila immigrans
species group: seasonal migration and thermal tolerance. Ecol. Entomol. 18, 141—
149
Ito, K., Awano, W., Suzuki, K., Hiromi, Y., and Yamamoto, D. (1997) The Drosophila
87 mushroom body is a quadruple structure of clonal units each of which contains a
virtually identical set of neurones and glial cells. Development 124, 761-71.
Kitagawa, 0., Wakahama, K. I., Fuyama, Y., Shimada, T., Takanasi, E., Hatsumi, M.,
Uwabo, M., and Mita, Y. (1982) Genetic studies of the Drosophila nasuta subgroup,
with notes on distribution and morphology. Jan. J. Genet. 57, 113-141.
Kogtal, V., Korbelova, J., Rozsypal, J., Zahradnickova, H., Cimlova, J., Tomcala, A.,
and imek, P. (2011) Long-term cold acclimation extends survival time at 0°C and
modifies the metabolomic profiles of the larvae of the fruit fly Drosophila
melanogaster. PLoS One 6, e25025.
Kuulasmaa, T. (2002) Oligo Analyzer.
http://www.softpedia.com/get/Science-CAD/Oligo-Analyzer.shtml
Kuulasmaa, T. (2002) Oligo Explorer.
http://www.softpedia.com/get/Science-CAD/Oligo-Explorer.shtml
Larionov, A., Krause, A., and Miller, W. (2005) A standard curve based method for
relative real time PCR data processing. BMC Bioinformatics 6.
Lee, R. E., Damodaran, K., Shu-Xia, Y., and Lorigan, A. (2006) Rapid cold-hardening
increases membrane fluidity and cold tolerance of insect cell. Cryobiology 52, 459—
463.
Lee, R. E., and Denlinger, D. L. (2010) Rapid cold-hardning: ecological significance
and underpinning mechanisms. In: Low Temperature Biology of Insects (eds.: R. E.
Lee and D. L. Denlinger), pp. 35-58. Cambridge University Press, New York.
88 Michaud,M. R., and Denlinger,D. L. (2010) Genomics,proteomics and metabolomics:
finding the other players in insect cold-tolerance.In: Low Temperature Biology of
Insects (eds.: R. E. Lee and D. L. Denlinger),pp. 91-115. CambridgeUniversity Press, New York.
Mikasa, K. (1991) A statistical analysis of seasonal fluctuationsof population size in
Drosophila populations near human habitation at Himeji city. J. Arts Sci. Meikai
University3, 8-18.
Mortazavi,A., Williams,B. A., McCue,K., Schaeffer,L., and Wold,B. (2008) Mapping
and quantifyingmammalian transcriptomes by RNA-Seq.Nat. Methods 5, 621-8.
Ohtsu, T., Katagiri, C., and Kimura, M. T. (1999) Biochmical aspects of climatic
adaptations in Drosophila curviceps,D. immigrans and D. albomicans (Diptera:
Drosophilidae).Environmental Entomology 28, 968-972
Okamoto,N., Nakamori,R., Murai,T., Yamauchi,Y., Masuda,A., Nishimura,T.. (2013)
A secreted decoy of InR antagonizes insulin/IGF signaling to restrict body growth in
Drosophia. Genes Dev. 27, 87-97.
Overgaard, J., Malmendal, A., Sorensen, J. G., Bundy, J. G., Loeschcke, V., Nielsen, N.
C., and Holmstrup, M. (2007) Metabolomic profiling of rapid cold hardening and
cold shock in Drosophila melanogaster. J. Insect Physiol. 53, 1218-1232.
Overgaard, J., Sorensen, J. G., Petersen, S. 0., Loeschcke, V., and Holmstrup, M. (2005)
Changes in membrane lipid composition following rapid cold hardening in
Drosophila melanogaster. J. Insect Physiol. 51, 1173-1182.
89 Overgaard, J., Tomcala, A., Sorensen, J. G., Holmstrup, M., Krogh, P. H., imek, P., and
Kogtal, V. (2008) Effects of acclimation temperature on thermal tolerance and
membrane phospholipid composition in the fruit fly Drosophila melanogaster. J.
Insect Physiol. 54, 619-629.
Pessin, J. E., and Saltiel, A. R. (2000) Signaling pathways in insulin action: molecular
targets of insulin resistance. J. Clin. Invest, 106, 165-169.
Puigserver, P., Rhee, J., Donovan, J., Walkey, C. J., Yoon, J. C., Oriente, F., Kitamura, Y,
Altomonte, J., Dong, H., Accili, D., and Spiegelman, B. M. (2003) Insulin-regulated
hepatic gluconeogenesis through FOXO 1-PGC-1 alpha interaction. Nature 29, 550—
555.
Rako, L., and Hoffmann, A. A. (2006) Complexity of the cold acclimation response in
Drosophila melanogaster. J. Insect Physiol. 52, 94-104.
Reis, M., Vieira, C. P., Morales-Hojas, R., Aguiar, B., Rocha, H., Schlotterer, C., and
Vieira, J. (2011) A comparative study of the short term cold resistance response in
distantly related Drosophila species: the role of regucalcin and frost. PLoS One 6,
e25520.
Saltiel, A. R., and Kahn, C. R. (2001) Insulin signalling and the regulation of glucose
and lipid metabolism. Nature 414, 799-806.
Storey, K. B., and Storey, J. M. (1991) Biochemistry of cryoprotectants. In: Insects at
Low Temperature (eds.: R. E. Lee and D. L. Denlinger), pp. 64-93. Chapman and
Hall, New York and London.
Toba, G., Ohsako, T., Miyata, N., Ohtsuka, T., Seong, K. H., and Aigaki, T. (1999) The
90 gene search the gene search system. A method for efficient detection and rapid
molecular identification of genes in Drosophila melanogaster. Genetics 151, 725—
37. van der Linde, K., Houle, D., Spicer, G. S., and Steppan, S. J. (2010) A
supermatrix-based molecular phylogeny of the family Drosophilidae. Genet. Res.
(Camb) 92, 25-38.
Vesala, L., Salminen, T. S., Laiho, A., Hoikkala, A., and Kankare, M. (2012) Cold
tolerance and cold-induced modulation of gene expression in two Drosophila virilis
group species with different distributions. Insect Molecular Biology 21, 107-118.
Xu, X., Gopalacharyulu, P., Seppanen-Laakso, T., Ruskeepaa, A. L., Aye, C. C.,
Carson, B. P., Mora, S., Oresic, M., and Teleman, A. A. (2011) Insulin signaling
regulates fatty acid catabolism at the level of CoA activation. PLoS Genet. 8,
e1002478.
91 Table 1
List of the 53 genes, for which acclimatized flies showed the expression level at no less than 2.5 times compared to non-acclimatized flies.
RPKM D. melanogaster Fold Molecular function homolog change Non-acclimatized Acclimatized
Lip3 1 13 8.51 triglyceride lipase
Jon25Bi 11 80 7.24 serine-type endopeptidase
CG17374 3 17 6.46 fatty acid synthase
Jon25Biii 10 65 6.28 endopeptidase
Jon66Ci 27 165 6.18 serine-type endopeptidase
Jon25Bii 10 59 6.15 serine-type endopeptidase
Jhe 4 24 6.13 juvenile-hormone esterase
CG8952 19 116 6.08 serine-type endopeptidase
Pepck * 95 562 5.93 phosphoenolpyruvate carboxykinase (GTP)
Jon99Cii 12 71 5.76 serine-type endopeptidase
CG11796-PA 80 427 5.31 4-hydroxyphenylpyruvate dioxygenase
Jon66Cii 26 135 5.11 serine-type endopeptidase
CG16758 28 145 5.10 purine-nucleoside phosphorylase
CG11796-PB 33 165 5.01 4-hydroxyphenylpyruvate dioxygenase
CG42269 1 3 5.00 secondary active organic cation transmembrane transporter
CG6295 35 173 4.94 triglyceride lipase
CG5150 5 24 4.70 alkaline phosphatase
CG6271 10 47 4.67 triglyceride lipase
CG12116 11 49 4.43 sepiapterin reductase
Jon44E 4 19 4.39 serine-type endopeptidase
Acpl 3 12 4.02 structural constituent of adult chitin-based cuticle
CG12374 * 92 354 3.86 metallocarboxypeptidase
Prx2540-2 * 38 145 3.79 thioredoxin peroxidase
CG7916 67 248 3.70 unknown
LysD 10 34 3.44 lysozyme
kni 4 13 3.26 transcription factor
CG4734 5 16 3.18 unknown
CG4847 166 525 3.17 cysteine-type endopeptidase
92 Table 1 continued
Jon99Fi 11 35 3.16 serine-type endopeptidase
Sirup 25 79 3.14 unknown
CG1544 3 9 3.11 oxoglutarate dehydrogenase (succinyl-transferring)
CG8997 144 437 3.03 unknown
CG1887 3 10 3.01 scavenger receptor
CG6910 89 262 2.93 inositol oxygenase; iron ion binding
Sdr 10 30 2.89 insulin-like growth factor receptor
Npc2d 27 78 2.86 sterol binding
CG4020 16 44 2.72 fatty-acyl-CoA reductase (alcohol-forming) ste24c 4 12 2.71 metalloendopeptidase
Jon65Aiv 248 671 2.71 serine-type endopeptidase
Cht9 13 35 2.70 chitinase
CG16758 112 296 2.65 purine-nucleoside phosphorylase
Amyrel 20 53 2.64 cation binding; alpha-amylase etc
SpdS 16 41 2.64 spermidine synthase
aay 70 184 2.64 phosphoserine phosphatase etc Jhehl 34 88 2.63 juvenile hormone epoxide hydrolase etc
CG6839 5 14 2.62 metal ion binding; hydrolase; nucleic acid binding
Oat 30 77 2.60 ornithine-oxo-acid transaminase etc
CG1544 5 13 2.57 oxoglutarate dehydrogenase (succinyl-transferring) etc
LysC 3 7 2.57 lysozyme
Cypl2dl p 30 77 2.55 oxidoreductase; electron carrier etc
U3-55K 4 11 2.55 mRNA binding; U3 snoRNA binding
Tk 24 61 2.54 receptor binding; neuropeptide hormone
CG32483 8 21 2.50 serine-type carboxypeptidase
*: a gene investigated by RT -qPCR .
93 Table 2 List of the 23 genes, for which acclimatized flies showed the expression level at no more than two fifth compared to non-acclimatized flies.
RPKM D. melanogaster Fold Molecular function homolog change Non-acclimatized Acclimatized alpha-Est2 103 18 0.17 carboxylesterase
CG14153 * 23 5 0.22 unknown
Lsp2 * 11 3 0.23 nutrient reservoir
CG6426 98 24 0.25 lysozyme
CG11889 66 17 0.26 transferring phosphorus-containing groups
protein binding; transcription factor binding; protein tim-PJ * 63 17 0.26 heterodimerization
Gld 13 3 0.27 glucose dehydrogenase
CG14191 290 80 0.28 unknown
CG11878 172 51 0.30 transferring phosphorus-containing groups
Mtk 24 7 0.30 unknown
CG16762 * 106 33 0.31 unknown
CG5172 42 13 0.32 unknown eloF-PA 30 10 0.34 fatty acid elongase activity
CG10513 105 37 0.35 transferase
protein binding; transcription factor binding; protein tim-PK 106 37 0.35 heterodimerization prc 8 3 0.35 unknown
CG30280-PB 10 4 0.36 unknown.
protein binding; transcription factor binding; protein tim-PE 47 17 0.37 heterodimerization
CG30281 185 71 0.38 unknown.
CG30280-PC 25 9 0.39 unknown.
CG14963 45 17 0.39 unknown.
CG13422 350 138 0.39 carbohydrate binding
MtnC 118 48 0.40 metal ion binding
*: a gene that was investigated by RT qPCR .
94 (A) 100%
0 T-^ 80% ct 1 1 0 1 .r 60% CD ri...- —_—WL1 ct 1 — ` KKLT2 04 ,1- 40% 1 I SNH1 11 L ill t 20% a VI 1 I
0% 0 1 2 3 4 5 6 7 Length of acclimation treatment at 20 °C (d ays)
(B) 100%• --- • •• A%•--••~ 4 80% /isk%w40 /11°'+....41r)—" - f •/ 60%l• •f•!oic —0— Cs Gi •/ - - OR 40%/ —0- A135 .... *4 • 20% Con
0% I------I 0 1 2 3 4 5 6 7 Length of acclimation treatment at 15 °C (days)
Fig. 1. Survival rate at 1 °C with various length of acclimation at 20 °C after 16-hour
(WL1 and KKU204) or 24-hour (SNH1) exposure to 1 °C in D. albomicans (A) and
survival rate at 1 °C with various length of acclimation at 15 °C after 24-hour cold
treatment at 1 °C in D. melanogaster (B). The data for WL1 and KKU204 are from Part
I of this thesis. The error bars indicate the standard errors.
95
1 (A) D. albomicaras WL 1 upregulated (B) D. alboranicansWL 1 daw-nreaulated 10 10
C 4
v C, ~C v 1 1 c~ N
tit 1 ~~ E a Z 6 1/41/45 C.? 0.1 0.1
C) (D) D. albomicans KKU204 upregulated D. albomieans KKU204 downregulated 10 10
1 1
t.` it 1 ') C. c§\. 0.1 0.1
(E) (F) D. albomicans SNH 1 upregulated D. albornicans SNH 1 downregulated 10 10 N.S. * 4.0 i 1 HH 1 4.0
0.1 Tti ti t-) I la
6
0.1 0.01
96
E' Fig. 2. Normalized expression levels measured by RT-qPCR for genes whose expression levels were increased (A, C and E) or decreased (B, D and F) upon the cold acclimation in D. albomicans detected by RNA-seq. Asterisk indicates a statistical significance by pairwise t-test without multiple test correction (*: P < 0.05; **: P < 0.01,
N.S.: P > 0.05). Error bar indicates a standard error based on three independent biological replicates.
97 (A) D. rnelanagaster CS strain (B) D. relanogaster CS strain 10 10
C 4
0. CO 1 1
Titb c~ N E 0 Z C.~
0.1 0.1
(C) (D) D. melanogaster OR strain D. melanogaster OR strain 10 10
cot cot
X 1 1
TICN
0.1 0.1
(E) (F) D. melanogasterA135 strain D. melanogasterA135 strain 10 10
0
l 1
N Z7~ 4\ C.~
0.1 0.1
98
E Fig. 3. Normalized expression levels measured by RT-qPCR for genes whose expression levels were increased (A, C and E) or decreased (B, D and F) upon the cold acclimation D. melanogaster detected by RNA-seq. Asterisk indicates a statistical significance by pairwise t-test without multiple test correction (*: P < 0.05; **: P < 0.01,
N.S.: P > 0.05). Error bar indicates a standard error based on three independent biological replicates.
99 100 N.S. N.S. N.S. N.S. N.S. * **
T
10 0 Q Q 6 L X T 1 i-iii-T1 _~ii
S 1 T J E i. 0 0.1 1I
0.01
*r 7 7
V 7
Fig. 4. Normalized expression levels of 8 candidate genes in transgenic mutant flies
measured by RT qPCR. The genes whose expression level was significantly increased or
decreased by cold acclimation in D. albolnicans WL1 strain were represented by filled
box or open boxes, respectively. Asterisk indicates a statistical significance by t-test
without multiple test correction (*: P < 0.05, * * : P < 0.01; * * * : P < 0.001, N. S.: P >
0.05). Error bar indicates a standard error based on three independent biological
replicates.
100
G (A) cj 100%
80% 1 1
° 60%
I. 40%
20%
0%
Actin-Gal44'w Actin- Gal4IUAS-CG188 7- (2)
(B) 1 1 U 100%
-4•)80% st 0 Q60% w E „ 40% •720laTi
a r4 0%
Actin-Ga144'w Actin-Gal4!UAS-Sdr
(C)
c) 100%
80% CI 0 ,60% aCP -s E ,,, 40% ITII
.7., 20%
Con0%
Actin-Gal4Iwrrrs Actin-Ga14/ Actin-Gal4/ UAS-IR- UAS-IR- CG14153(III)-1 CG14153(III)-2
101
a0 Fig.5. The survival rates at 1 °C for 24 hours for CG1887(A) and Sdr (B) over-expressed flies and CG14153(C) knockdown flies. The asterisk indicates a statistical significance by t-test without multiple test correction (***: P < 0.001, N.S.: P
> 0.05). Error bar indicates a standard error.
102 60% II 50%
0 N.S. N.S. N.S.
40% I I I I I I
0 30%
20%
10%
0%
-, -, c-? c- .1 z cl c it it it z ,Th,, 0 it 1..7 . z 7t. c Ci i ,,...HY'aL7 its
0 E=1.1 q 477
Fig.6. The survival rates at 1 °C for 24 hours for flies in which Sdr was
over-expressed in various tissues and for their negative control flies. The Ga14 lines
used for the tissue specific over-expression were Repo-Gal4 (glial cells), Elav-Gal4
(neuron), Mef2-Gal4 (muscle) and Cg-Gal4 (fat body). Asterisk indicates a statistical
significance by t-test without multiple test correction (***: P < 0.001, N.S.: P > 0.05).
Error bar indicates a standard error.
103
T Q 0.25
O(A) 0.2 E a 0.15 a.) st 6 0 .1 Q O f0.05 aj 0 ------i Act-Gal4/ywActin-Ga14/UAS-CG1887-(2)
Q 0.25 s 0 .20 01 E S. 0.15
a) 60.10
Q0.05
0.00 ------Actin-Gal4fywActin-Gal4/UAS-Sdr
r-,:L. 0.25 - (C) = 0 .20 -
. 0.15 - I I
60.10 -
U G 0.05 - a7 0.00 .------, Actin-Gal4Iw1118 Actin-Ga14/ UAS-IR- CG14153(III)-1
Fig. 7. The metabolic rate at 0 °C was measured for Sdr (A) and CG1887 (B)
over-expressed flies and CG14153 (C) knockdown flies. Error bar in dicates a standard
error.
104
~G Q Supplementary Table Si PCR primers used for RT-qPCR for D. albomicans
Gene Primer sequence (5' a 3')
RpL32 forward CGGATCGTTATGCTAAGTTGTCGC
reverse TGTTGGGCATCAGGTATTGGC
Lip3 forward GCCCAGCAATAAGTTCAAGCAG
reverse CGGAATCGTAGCCACCAATC
Pepck forward* GAGCTCATTGAACAAAGCAAAATTA
reverse GAGTTGACATCGCCATAGGAAG
CG123 74 forward TGCCAGCGGGTTATTGAACTAC
reverse AGAAGCCAAATGTGCCCTTATC
Prx2540-2 forward AAATCGTGGGTTGTGCTCTTCTC
reverse CACTTCGTATTCCGCTTGGC
Sirup forward GCAGATGGGCAAACAAGTGA
reverse TTCGGTAGGTGTCTTGGGTTCC
CG1887 forward GTGCGTGATTTTCGTGACTTTG
reverse GCTTGATGGCGGGTGTTAG
Sdr forward CGAACTGGTGGATATAAAAGAGCC
reverse TAGCGACATCAACGGTGTGG
CG14153 forward AATGTGCCAGGCTACTTTTACCC
reverse ACCAATGCGAACGATTTGC
Lsp2 forward AAGGGCGGTCAGGTGTATCA
reverse CGAAGGGCAAAGCATCCA timless forward AGTAAATGCAATCAGCGAACGG
reverse GCCCAAGCCCTCGTCATC
CG16762 forward AAGGTTCTAACAACACCATTTCCACG
reverse CAAGTCAATGAGGCGATAGCG
105 Supplementary Table S2 PCR primers used for RT-qPCR for D. melanogaster
Gene Primer sequence (5' a 3')
RpL32 forward TCGGATCGATATGCTAAGCTG
reverse TCGATCCGTAACCGATGTTG
Lip3 forward CAGGATTTGGGCATAGAGATGTG
reverse GATGTGCTCAAGGAGTTCGTAGTC
Pepck forward* GAGCTCATTGAACAAAGCAAAATTA
reverse GTCAGCAAATCCACATTTCCATA
CG123 74 forward TATGTCGTTTCGGGAGCTGC
reverse TCGGTGATCTGGTTGGAGG
Prx2540-2 forward ACGTTGACGAGATTCTGAGGAC
reverse TCTTCATCGGTGACAGTGGG
Sirup forward CAAATGGGCAAACAAGTGAGC
reverse TGCGCGTCTTTGGTTCC
CG1887 forward GTGCGTGATTTTCGTGACTTTG
reverse GCTTGATGGCGGGTGTTAG
Sdr forward ATGACAACTGGCTGATGGACG
reverse ATGATATTCGGTTCTGGTGAGGG
CG14153 forward CGTCGAGCTGGCTATGTGC
reverse GATTGAGCGTAGTTGGATGTGGTAA
Lsp2 forward GGGTCTGGTGCGTCTCTTCTA
reverse CGGCGTACACGAACAACTG timless forward AGTAAATGCAATCAGCGAACGG
reverse GCCCAAGCCCTCGTCATC
CG16762 forward GGGCTCCAACAACACTGTCTC
reverse CACTCGGTAGCGTTCCTCCA An asterisk (*) indicates the sequence of Pepck gene primer is same with D. albomicans and D. melanogaster.
106 (A) The movement of ink A small of Soda lime = oxygen consumption (CO2 absorber) <------> — i
1 ml plastic syringe Rubber tube Plastic adaptor 50 gl micropipette 4 gl of ink
(B)
Supplementary Fig. Si. (A) Diagram of the respiration chamber for measuring metabolic rate. (B) Photograph of the metabolic rate measurement in ice-cold water.
107 60%
50%
0 40% C3 O' 30% 0 a) A' CI
20%
t 10%
0%
Actin-Ga14/yw Actin-Ga14/ Actin-G(114/ Actin-Ga14/ Actin-G(114/ UAS-L p3 UAS-Pepck UAS-Prx2540-2 UAS-Sirup
Supplementary Fig. S2. The survival rates at 1 °C for 24 hours for
Actin-Ga14/UAS-Lip3, Actin-Ga14/UAS-Pepck, Actin-Ga14/UAS-Prx2540-2,
Actin-Ga14/UAS-Sirup and Act-Ga14/yw. Error bar indicates a standard error.
108
C GENERAL DISCUSSION
In this thesis, I concluded that the improvement of cold tolerance in response to the cold acclimation contributed to the distribution expansion of D. albomicans to the temperate zone and changes in expression levels of many genes were associated with the cold acclimation response in its molecular mechanism. Using transgenic strains of D. melanogaster, I further verified that the alteration in expression level had effect on the cold tolerance for two genes.
It has been reported that cold tolerance is related to the distribution of insects including Drosophila (e.g. Hoffmann et al., 2003 for review). The previous studies revealed that the cold acclimation is one of the factors to improve the cold tolerance
(Rako and Hoffmann, 2006) and the molecular mechanism of the cold acclimation response was investigated (e.g. Goto, 2000; Vesala et al., 2012). However, it is still unclear whether the improvement of cold tolerance by the cold acclimation is related to the distribution of species, although Bubliy et al. (2002) showed that the effect of the cold acclimation was stronger in European populations of D. melanogaster as compared to Moroccan population. Therefore, my result that the variation in cold acclimation between intraspecific populations of D. albomicans and between D. albomicans and its closely related species provides insights into adaptation of organisms to low temperature environment (Part I).
Since the hypothesis that changes in gene regulatory system have an important role in adaptive evolution was proposed by Wilson et al. (1974), it has been an important subject to find the gene regulatory changes linking to adaptive characters. Indeed, many studies have identified gene expression changes that underlie phenotypic evolution of
109 adaptive character; e.g. butterfly eyespots on the wings, beak morphology in Darwin's
Finches, melanization in Drosophila and color pattern in beech mice (Beldade et al.,
2002; Abzhanov et al., 2004; Abzhanov et al., 2006; Rebeiz et al., 2009; Manceau et al.,
2011). The results of RNA-seq and RT qPCR analyses in this study also suggested that the gene expression changes were involved in the improvement of cold tolerance in D. albomicans. Moreover, the experiments with transgenic lines of D. melanogaster revealed that these changes in gene expression actually had an effect on the cold tolerance. These observations are consistent with the previous studies and contribute to better understanding the molecular mechanisms of evolutionary adaptation to thermal environment by organisms (Part II).
In Part I, I found that the improvement of cold tolerance paralleled the increase in metabolic rate upon cold acclimation in D. albomicans. Such increase in metabolic rate induced by cold acclimation is observed not only in insects such as Glossina and
Drosophila (e.g., Terblanche et al., 2005; Takeuchi et al., 2009) but also in fishes (e.g.
Itoi et al., 2003; Guderley, 2004). However, the transgenic strains of D. melanogaster, in which the gene expression changes caused by the cold acclimation were simulated, showed that the increase in metabolic rate did not necessarily accompany the improvement of cold tolerance (Part II). This provides a new perspective on the relationship of metabolic rate and cold acclimation, suggesting that the mechanism of cold tolerance is a complex trait influenced by various factors, such as ion homeostasis, changes in sugar concentrations and modified condition of cell membrane other than the metabolic rate (e.g., Chown and Nicolson, 2004; Kostal et al., 2007; Kostal, 2010; Lee and Denlinger, 2010; Michaud and Denlinger, 2010). In the results of the RNA-seq analysis, there were no particular biological processes over-represented among the
110 genes whose expression levels were changed by the cold acclimation. This suggests that the cold acclimation has effects on various biological processes.
There are two alternative possibilities to explain the observed improvement of cold tolerance without increase in metabolic rate. One is that the improvement of cold tolerance and the increase in metabolic rate are caused by independent mechanisms but they are triggered in parallel by the cold acclimation. Another is that there is a common factor affecting both phenomena in a gene network but both Sdr and CG14153 detected in this study are involved in only improving the cold tolerance downstream of the common factor in the gene regulation network. Further investigations are required to clarify the relationship between the cold tolerance and the metabolic rate by examining the effects on the cold tolerance and the metabolic rate in many genes, whose expression levels are altered in response to the cold acclimation. If (a) gene(s) having effects on both cold tolerance and metabolic rate, the former possibility is supported.
However, it is difficult to determine whether they are totally independent. Unless all genes in the genome are examined, the possibility of common factor in the gene regulation network remains. Therefore, to clarify the dependency of cold tolerance and metabolic rate, analyzing the gene regulation network and functions of these candidate genes is important.
In conclusion, the changes in gene expression in response to the cold acclimation were most likely responsible for the improved cold tolerance, as one of the mechanisms of adaptive evolution to the low-temperature environment, and had a significant effect on the distribution expansion of D. albomicans. It is also worthwhile to note that such molecular mechanism to improve cold tolerance upon cold acclimation varies among different species even within the genus Drosophila, which represents complexity and
111 flexibility of evolution of physiological traits by gene expression changes.
112 LITERATURE CITED
Abzhanov, A., Kuo, W. P., Hartmann, C., Grant, B. R., Grant, P. R., and Tabin, C. J.
(2006) The calmodulin pathway and evolution of elongated beak morphology in
Darwin's finches. Nature 442, 563-567.
Abzhanov, A., Protas, M., Grant, B. R., Grant P. R., and Tabin, C. J. (2004) Bmp4 and
morphological variation of beaks in Darwin's Finches. Science 305, 1462-1465.
Beldade, P., Brakefield, P. M., and Long, A. D. (2002) Contribution of Distal-less to
quantitative variation in butterfly eyespots. Nature 415, 315-318.
Bubliy, 0. A., Riihimaa, A., Norry, F. M., and Loeschcke, V. (2002) Variation in
resistance and acclimation to low-temperature stress among three geographical
strains of Drosophila melanogaster. J. Therm. Biol. 27, 337-344.
Chown, S. V., and Nicolson, S. W. (2004) Insect physiological ecology: mechanisms
and patterns. Oxford University Press, New York.
Goto, S. G. (2000) Expression of Drosophila homologue of senescence marker
protein-30 during cold acclimation. J. Insect Physiol. 46, 1111-1120.
Guderley, H. (2004) Metabolic responses to low temperature in fish muscle. Biol. Rev.
Camb. Philos. Soc. 79, 409-427.
Hoffmann, A. A., Sorensen, J. G., and Loeschcke, V. (2003) Adaptation of Drosophila
to temperature extremes: bringing together quantitative and molecular approaches. J.
Therm. Biol. 28, 175-216.
113 Itoi, S., Kinoshita, S., Kikuchi, K., and Watabe, S. (2003) Changes of carp FoF1-ATPase
in association with temperature acclimation. Am. J. Physiol. Regul. Integr. Comp.
Physiol. 284, 153-163
Kogtal, V. (2010) Cell structural modifications in insects at low temperatures. In: Low
Temperature Biology of Insects (eds.: R. E. Lee and D. L. Denlinger), pp. 116-140.
Cambridge University Press, New York.
Kostal, V., Renault, D., Mehrabianova, A., and Bastl, J. (2007) Insect cold tolerance and
repair of chill-injury at fluctuating thermal regimes: role of ion homeostasis. Comp.
Biochem. Physiol. A Mol. Integr. Physiol. 147, 231-8.
Lee, R. E., and Denlinger, D. L. (2010) Rapid cold-hardning: ecological significance
and underpinning mechanisms. In: Low Temperature Biology of Insects (eds.: R. E.
Lee and D. L. Denlinger), pp. 35-58. Cambridge University Press, New York.
Manceau, M., Domingues, V. S., Mallarino, R., and Hoekstra, H. E. (2011) The
developmental role of Agouti in color pattern evolution. Science 331, 1062-1065.
Michaud, M. R., and Denlinger, D. L. (2010) Genomics, proteomics and metabolomics:
finding the other players in insect cold-tolerance. In: Low Temperature Biology of
Insects (eds.: R. E. Lee and D. L. Denlinger), pp. 91-115. Cambridge University
Press, New York.
Rako, L., and Hoffmann, A. A. (2006) Complexity of the cold acclimation response in
Drosophila melanogaster. J. Insect Physiol. 52, 94-104.
114 Rebeiz, M., Pool, J. E., Kassner, V. A., Aquadro, C. F., and Carroll, S. B. (2009)
Stepwise modification of a modular enhancer underlies adaptation in a Drosophila
population. Science 326, 1663-1667.
Storey, K. B., and Storey, J. M. (2012) Insect cold hardiness: metabolic, gene, and
protein adaptation. Can. J. Zool. 90, 456-475.
Takeuchi, K., Nakano, Y., Kato, U., Kaneda, M., Aizu, M., Awano, W., Yonemura, S.,
Kiyonaka, S., Mori, Y., Yamamoto, D., et al. (2009) Changes in temperature
preferences and energy homeostasis in dystroglycan mutants. Science 323, 1740—
1743.
Terblanche, J. S., Klok, C. J., and Chown S. L. (2005) Temperature-dependence of
metabolic rate in Glossina morsitans morsitans (Diptera, Glossinidae) does not vary
with gender, age, feeding, pregnancy or acclimation. J. Insect Physiol. 51, 861-870.
Vesala, L., Salminen, T. S., Laiho, A., Hoikkala, A., and Kankare, M. (2012) Cold
tolerance and cold-induced modulation of gene expression in two Drosophila virilis
group species with different distributions. Insect Molecular Biology 21, 107-118.
Wilson, A. C., Maxson, L. R., and Sarich, V. M. (1974) Two types of molecular
evolution. Evidence from studies of interspecific hybridization. Proc. Natl. Acad.
Sci. USA 71, 2843-2847.
115