DOCSLIB.ORG

Structure of Epiphytic Bacterial Communities of Weeds T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure of Epiphytic Bacterial Communities of Weeds T ISSN 0026-2617, Microbiology, 2017, Vol. 86, No. 2, pp. 257–263. © Pleiades Publishing, Ltd., 2017. Original Russian Text © T.G. Dobrovol’skaya, K.A. Khusnetdinova, N.A. Manucharova, A.V. Golovchenko, 2017, published in Mikrobiologiya, 2017, Vol. 86, No. 2, pp. 247–254. EXPERIMENTAL ARTICLES Structure of Epiphytic Bacterial Communities of Weeds T. G. Dobrovol’skaya*, K. A. Khusnetdinova, N. A. Manucharova, and A. V. Golovchenko Faculty of Soil Science, Lomonosov Moscow State University, Moscow, Russia *e-mail: [email protected] Received June 15, 2016 Abstract⎯Dynamics of the taxonomic structure of epiphytic bacterial communities of the rhizosphere and phyllosphere of seven weed species was studied. The major types of isolated organisms were identified using phenotypic and molecular biological approaches. Dispersion analysis revealed that the ontogenesis stage and plant organ were the factors with the greatest effect on the taxonomic structure of the communities. The dom- inant microorganisms of weeds were similar to those of cultivated plants. The minor components revealed in the spectra of bacterial communities of weeds belonged to poorly studied genera of chemolithotrophic pro- teobacteria. Keywords: epiphytic bacteria, taxonomic structure, weeds, ontogenesis stages, plant organs, ecological niche DOI: 10.1134/S0026261717020072 At the current stage of development of agricultural cal importance and serves as a model object in plant science, the concept of struggling with weed plants is genomics. The taxonomic composition of epiphytic being replaced by a different paradigm, which implies bacterial communities associated with this plant was management of the weed component of agrophyto- close to those described for other weed and medicinal cenoses (Zakharenko, 2000). In the countries of plants. The authors established that bacterial epi- northern Europe, especially in Ireland, a common phytes colonizing the leaves and roots of A. thaliana practice is targeted planting of herbs along field mar- belonged to the genera Pseudomonas, Sphingomonas, gins (Marshall and Moonen, 2002). The variety of Flavobacterium, Massilia, Rhizobim, and Variovorax. A plants that are grown at field margins includes not only research group from Colombia (Kremer et al., 1990) forest species (such as violet or ivy), but also ruderal isolated rhizobacterial communities associated with ones, e.g., creeping thistle or cleavers; they partially seven weed species. Among all the isolated strains, 11 protect the crops from mechanical damage that can occur at the field edge, as well as from wind and dust. to 42% were fluorescent pseudomonads. Other bacte- Moreover, such grass margins serve as habitats for use- ria commonly isolated from the surface of weed roots ful pollinating insects. belonged to the taxa Erwinia herbicola, Alcaligenes spp., and spp. Canadian microbiolo- Bacterial populations of epiphytic complexes of Flavobacterium weed plants are poorly studied. The available publica- gists investigated six weed species as potential sources tions from different groups worldwide that we are of growth-stimulating rhizobacteria in agrocenoses going to discuss below analyzed the genus-level taxo- (Sturz et al., 2001). Many of these plants were also nomic composition of epiphytic bacterial communi- medicinal: spurrey, sawthistle, Italian ryegrass, couch ties associated with weed plants, but did not consider grass. The most commonly isolated bacteria belonged their dynamics in the course of plant development. to the genera Bacillus, Arthrobacter, Stenotro- Mukhtar et al., (2010) identified epiphytic and endo- phomonas, Acinetobacter, and Pseudomonas. These phytic bacteria associated with four weed species: field bacteria stimulated the growth of potato plants, bindweed, sun spurge, pyrethrum, and lamb’s quar- increasing the weight of shoots and roots. Thus, the ters. In contrast to other similar studies, this work did authors cited above believe that bacterial communities not detect any Pseudomonas or Arthrobacter strains of weed plants are worth thorough investigation from among epiphytic bacteria, but identified members of both the ecological and agrobiological positions. the genera Burkholderia, Acidovorax, Enterobacter, Klebsiella, Peptococcus, and Kurthia. A study from the The goal of the present work was to investigate the United States (Bodenhausen et al., 2013) investigated dynamics of the taxonomic structure of epiphytic bac- epiphytic bacterial communities of thale cress (Arabi- terial communities associated with different organs of dopsis thaliana). This unique weed known as an astro- weed plants in the course of their ontogenesis in differ- naut and a miner plant is also of considerable ecologi- ent ecological niches. 257 258 DOBROVOL’SKAYA et al. MATERIAL AND METHODS 5-days-old cultures. The abundance of bacteria was expressed as colony-forming units per 1 g substrate. Research subjects. The study was conducted on the The genus attribution of the isolated bacterial cultures Chashnikovo Educational and Experimental plot of was established based on their morphological, cul- the Lomonosov University Center of Soil Science and tural, and chemotaxonomic traits using the Bergey’s Ecology located in the Solnechnogorsk district of Manual of Systematic Bacteriology and the guidelines Moscow oblast. The study concerned bacterial com- proposed by Lysak et al. (2003). In addition, genus munities associated with weed plants: shepherd’s identification employed diagnostic systems that deter- purse (Capsella bursa-pastoris), spear saltbush (Atri- mine the biochemical traits of bacteria: the ability to plex patula), brittlestem hempnettle (Galeopsis tetra- utilize sodium citrate, sodium malonate, glucose, lac- hit), field sowthistle (Sonchus arvensis), yellow bed- tose, mannitol, sucrose, inositol, sorbitol, arabinose, straw (Galium verum), bittercress (Barbarea vulgaris), or maltose, the production of indol, hydrogen sulfide, and bishop’s weed (Aegopodium podagraria). All these acetylmethylcarbinol (Voges-Proskauer test), the weed plants are apophytes: representatives of the local activity of urease, β-galactosidase, ornithine and flora that have spread from their natural habitats into lysine decarboxylases, arginine dehydrolase, or phe- the territories modified by human agricultural activity nylalanine deaminase. (arable lands and pasture grounds). Taxonomic composition of proteobacteria was The same plants species were collected in the cen- determined by molecular analysis of the 16S rRNA ter and at the edge of the experimental field, as well as genes, which involved isolation of DNA from pure in the neighboring mixed forest. Weed specimens were bacterial cultures, and subsequent amplification and collected at the stages of shooting (June 08, 2013), sequencing of the relevant gene fragments. flowering (July 27, 2013), and seed production (August 25, 2013). The study considered microbial DNA isolation. Total DNA was isolated from phyl- communities isolated from plant leaves, flowers, and losphere and rhizosphere samples, as well as from pure roots, as well as from the underlying soil. microbial cultures using a PowerSoil DNA Isolation Kit (MO BIO, United States) with modifications The soil of the test field was sod-podzolic, well cul- described by Manucharova et al. 2008). tivated, middle loamy, on clay loam mantle seated on PCR primers and DNA sequencing. PCR amplifi- red brown loamy moraine. The soil had the following cation and subsequent sequencing of the 16S rRNA characteristics: pH 6.5; humus content, 4.7%; K2O gene fragments were performed using a universal content, 6.7 mg/100 g soil, and P2O5 content, primer system (Manucharova et al., 2008; Edwards 98 mg/100 g soil. et al., 1989). In the mixed forest predominated by hardwood tree Phylogenetic analysis. Preliminary analysis of the species, the soil was sod-podzolic, loamy, on clay obtained 16S rRNA gene sequences was performed loam mantle seated on fluvioglacial sands. The soil using the software service of the GenBank database had the following characteristics: pH 3.95; humus (http://www.ncbi.nlm.nih.gov/blast). content, 2.02%; K2O content, 0.37 mg/100 g soil; Next, the sequences were aligned and edited using P2O5 content, 4.6 mg/100 g soil. the BioEdit software (http://jwbrown.mbio.ncsu.edu/ Treatment of samples and isolation of bacterial cul- BioEdit/bioedit.html). Phylogenetic trees were con- tures. Weed leaves, roots, and flowers were chopped structed using the neighbor-joining algorithm (NJ) with scissors, and 1-g substrate aliquots, as well as 1-g with the MEGA 4 software. The tree significance was soil samples were placed in flasks with 100 mL sterile assessed by bootstrap support analysis with 1000 alter- water. Samples were shaken on a Vortex to induce native trees (Thompson et al., 1994). The newly microbial desorption, the liquid phase was separated obtained gene sequences were deposited into Gen- by centrifugation (5000 rpm, 5 min), and the abun- Bank under individual accession numbers. dance and composition of the released bacterial com- munities were determined by plating. Bacteria were RESULTS AND DISCUSSION plated in five replicates from 105–108 dilutions on solid glucose-peptone-yeast medium (g/L): peptone, 0.5; Altogether, we analyzed 118 specimens of weed glucose, 0.5; yeast extract, 0.5; casein hydrolysate, 0.5; plants, including leaves, roots, and flowers collected at agar, 10; chalk, 5; water, to 1 L. The medium was sup- different stages of plant development. The abundance plemented
Load more

Recommended publications
  • Metaproteogenomic Insights Beyond Bacterial Response to Naphthalene
    ORIGINAL ARTICLE ISME Journal – Original article Metaproteogenomic insights beyond bacterial response to 5 naphthalene exposure and bio-stimulation María-Eugenia Guazzaroni, Florian-Alexander Herbst, Iván Lores, Javier Tamames, Ana Isabel Peláez, Nieves López-Cortés, María Alcaide, Mercedes V. del Pozo, José María Vieites, Martin von Bergen, José Luis R. Gallego, Rafael Bargiela, Arantxa López-López, Dietmar H. Pieper, Ramón Rosselló-Móra, Jesús Sánchez, Jana Seifert and Manuel Ferrer 10 Supporting Online Material includes Text (Supporting Materials and Methods) Tables S1 to S9 Figures S1 to S7 1 SUPPORTING TEXT Supporting Materials and Methods Soil characterisation Soil pH was measured in a suspension of soil and water (1:2.5) with a glass electrode, and 5 electrical conductivity was measured in the same extract (diluted 1:5). Primary soil characteristics were determined using standard techniques, such as dichromate oxidation (organic matter content), the Kjeldahl method (nitrogen content), the Olsen method (phosphorus content) and a Bernard calcimeter (carbonate content). The Bouyoucos Densimetry method was used to establish textural data. Exchangeable cations (Ca, Mg, K and 10 Na) extracted with 1 M NH 4Cl and exchangeable aluminium extracted with 1 M KCl were determined using atomic absorption/emission spectrophotometry with an AA200 PerkinElmer analyser. The effective cation exchange capacity (ECEC) was calculated as the sum of the values of the last two measurements (sum of the exchangeable cations and the exchangeable Al). Analyses were performed immediately after sampling. 15 Hydrocarbon analysis Extraction (5 g of sample N and Nbs) was performed with dichloromethane:acetone (1:1) using a Soxtherm extraction apparatus (Gerhardt GmbH & Co.
    [Show full text]
  • A Novel Bacterial Thiosulfate Oxidation Pathway Provides a New Clue About the Formation of Zero-Valent Sulfur in Deep Sea
    The ISME Journal (2020) 14:2261–2274 https://doi.org/10.1038/s41396-020-0684-5 ARTICLE A novel bacterial thiosulfate oxidation pathway provides a new clue about the formation of zero-valent sulfur in deep sea 1,2,3,4 1,2,4 3,4,5 1,2,3,4 4,5 1,2,4 Jing Zhang ● Rui Liu ● Shichuan Xi ● Ruining Cai ● Xin Zhang ● Chaomin Sun Received: 18 December 2019 / Revised: 6 May 2020 / Accepted: 12 May 2020 / Published online: 26 May 2020 © The Author(s) 2020. This article is published with open access Abstract Zero-valent sulfur (ZVS) has been shown to be a major sulfur intermediate in the deep-sea cold seep of the South China Sea based on our previous work, however, the microbial contribution to the formation of ZVS in cold seep has remained unclear. Here, we describe a novel thiosulfate oxidation pathway discovered in the deep-sea cold seep bacterium Erythrobacter flavus 21–3, which provides a new clue about the formation of ZVS. Electronic microscopy, energy-dispersive, and Raman spectra were used to confirm that E. flavus 21–3 effectively converts thiosulfate to ZVS. We next used a combined proteomic and genetic method to identify thiosulfate dehydrogenase (TsdA) and thiosulfohydrolase (SoxB) playing key roles in the conversion of thiosulfate to ZVS. Stoichiometric results of different sulfur intermediates further clarify the function of TsdA − – – – − 1234567890();,: 1234567890();,: in converting thiosulfate to tetrathionate ( O3S S S SO3 ), SoxB in liberating sulfone from tetrathionate to form ZVS and sulfur dioxygenases (SdoA/SdoB) in oxidizing ZVS to sulfite under some conditions.
    [Show full text]
  • A Genomic Perspective on a New Bacterial Genus and Species from the Alcaligenaceae Family, Basilea Psittacipulmonis
    UC Irvine UC Irvine Previously Published Works Title A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis. Permalink https://escholarship.org/uc/item/0f60f7jm Journal BMC genomics, 15(1) ISSN 1471-2164 Authors Whiteson, Katrine L Hernandez, David Lazarevic, Vladimir et al. Publication Date 2014-03-01 DOI 10.1186/1471-2164-15-169 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Whiteson et al. BMC Genomics 2014, 15:169 http://www.biomedcentral.com/1471-2164/15/169 RESEARCH ARTICLE Open Access A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis Katrine L Whiteson1,5*, David Hernandez1, Vladimir Lazarevic1, Nadia Gaia1, Laurent Farinelli2, Patrice François1, Paola Pilo3, Joachim Frey3 and Jacques Schrenzel1,4 Abstract Background: A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results: Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp.
    [Show full text]
  • Abundance and Potential Contribution of Gram-Negative Cheese Rind Bacteria from Austrian Artisanal Hard Cheeses
    Animal Science Publications Animal Science 2-2-2018 Abundance and potential contribution of Gram-negative cheese rind bacteria from Austrian artisanal hard cheeses Stephan Schmitz-Esser Iowa State University, [email protected] Monika Dzieciol University of Veterinary Medicine, Vienna Eva Nischler University of Veterinary Medicine, Vienna Elisa Schornsteiner University of Veterinary Medicine, Vienna Othmar Bereuter See next page for additional authors Follow this and additional works at: https://lib.dr.iastate.edu/ans_pubs Part of the Bacteriology Commons, Environmental Microbiology and Microbial Ecology Commons, and the Food Microbiology Commons The complete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ ans_pubs/524. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Animal Science at Iowa State University Digital Repository. It has been accepted for inclusion in Animal Science Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Abundance and potential contribution of Gram-negative cheese rind bacteria from Austrian artisanal hard cheeses Abstract Many different Gram-negative bacteria have been shown to be present on cheese rinds. Their contribution to cheese ripening is however, only partially understood until now. Here, cheese rind samples were taken from Vorarlberger Bergkäse (VB), an artisanal hard washed-rind cheese from Austria. Ripening cellars of two cheese production facilities in Austria were sampled at the day of production and after 14, 30, 90 and 160 days of ripening. To obtain insights into the possible contribution of Advenella, Psychrobacter, and Psychroflexus ot cheese ripening, we sequenced and analyzed the genomes of one strain of each genus isolated from VB cheese rinds.
    [Show full text]
  • A Genomic Perspective on a New Bacterial Genus and Species From
    Whiteson et al. BMC Genomics 2014, 15:169 http://www.biomedcentral.com/1471-2164/15/169 RESEARCH ARTICLE Open Access A genomic perspective on a new bacterial genus and species from the Alcaligenaceae family, Basilea psittacipulmonis Katrine L Whiteson1,5*, David Hernandez1, Vladimir Lazarevic1, Nadia Gaia1, Laurent Farinelli2, Patrice François1, Paola Pilo3, Joachim Frey3 and Jacques Schrenzel1,4 Abstract Background: A novel Gram-negative, non-haemolytic, non-motile, rod-shaped bacterium was discovered in the lungs of a dead parakeet (Melopsittacus undulatus) that was kept in captivity in a petshop in Basel, Switzerland. The organism is described with a chemotaxonomic profile and the nearly complete genome sequence obtained through the assembly of short sequence reads. Results: Genome sequence analysis and characterization of respiratory quinones, fatty acids, polar lipids, and biochemical phenotype is presented here. Comparison of gene sequences revealed that the most similar species is Pelistega europaea, with BLAST identities of only 93% to the 16S rDNA gene, 76% identity to the rpoB gene, and a similar GC content (~43%) as the organism isolated from the parakeet, DSM 24701 (40%). The closest full genome sequences are those of Bordetella spp. and Taylorella spp. High-throughput sequencing reads from the Illumina-Solexa platform were assembled with the Edena de novo assembler to form 195 contigs comprising the ~2 Mb genome. Genome annotation with RAST, construction of phylogenetic trees with the 16S rDNA (rrs) gene sequence and the rpoB gene, and phylogenetic placement using other highly conserved marker genes with ML Tree all suggest that the bacterial species belongs to the Alcaligenaceae family.
    [Show full text]
  • ORIGINAL ARTICLE Metaproteogenomic Insights Beyond Bacterial Response to Naphthalene Exposure and Bio-Stimulation
    The ISME Journal (2013) 7, 122–136 & 2013 International Society for Microbial Ecology All rights reserved 1751-7362/13 www.nature.com/ismej ORIGINAL ARTICLE Metaproteogenomic insights beyond bacterial response to naphthalene exposure and bio-stimulation Marı´a-Eugenia Guazzaroni1,9,11, Florian-Alexander Herbst2,9,Iva´nLores3,9, Javier Tamames4,9, Ana Isabel Pela´ez3, Nieves Lo´pez-Corte´s1, Marı´a Alcaide1, Mercedes V Del Pozo1, Jose´ Marı´a Vieites1, Martin von Bergen2,5, Jose´ Luis R Gallego6, Rafael Bargiela1, Arantxa Lo´pez-Lo´pez7, Dietmar H Pieper8, Ramo´n Rossello´-Mo´ra7, Jesu´ sSa´nchez3,10, Jana Seifert2,10 and Manuel Ferrer1,10 1Department of Biocatalysis, Institute of Catalysis, CSIC, Madrid, Spain; 2Department of Proteomics, UFZ-Helmholtz-Zentrum fu¨r Umweltforschung GmbH, Leipzig, Germany; 3A´rea de Microbiologı´a, IUBA, Facultad de Medicina, Universidad de Oviedo, Oviedo, Spain; 4CSIC, Centro Nacional de Biotecnologı´a, Madrid, Spain; 5Department of Metabolomics, UFZ-Helmholtz-Zentrum fu¨r Umweltforschung GmbH, Leipzig, Germany; 6IUBA, A´rea de Prospeccio´n e Investigacio´n Minera, Universidad de Oviedo, Mieres, Spain; 7IMEDEA (CSIC-UIB), Esporles, Spain and 8Helmholtz Zentrum fu¨r Infektionsforschung–HZI, Braunschweig, Germany Microbial metabolism in aromatic-contaminated environments has important ecological implications, and obtaining a complete understanding of this process remains a relevant goal. To understand the roles of biodiversity and aromatic-mediated genetic and metabolic rearrangements, we conducted ‘OMIC’ investigations in an anthropogenically influenced and polyaromatic hydrocarbon (PAH)-contaminated soil with (Nbs) or without (N) bio-stimulation with calcium ammonia nitrate, NH4NO3 and KH2PO4 and the commercial surfactant Iveysol, plus two naphthalene-enriched communities derived from both soils (CN2 and CN1, respectively).
    [Show full text]
  • Kinetic Enrichment of S During Proteobacterial Thiosulfate Oxidation
    Author version: Appl. Environ. Microbiol., vol.79(14); 2013; 4455-4464 Kinetic enrichment of 34S during proteobacterial thiosulfate oxidation and the conserved role of SoxB in S-S bond breaking Masrure Alama, Prosenjit Pynea, Aninda Mazumdarb, Aditya Peketib and Wriddhiman Ghosha* a, Department of Microbiology, Bose Institute, P-1/12, C. I. T. Scheme VII- M, Kolkata - 700 054, India b, Gas Hydrate research Group, Geological Oceanography, National Institute of Oceanography, Dona Paula, Goa – 403 004, India * Correspondence: Email: [email protected] / [email protected] Phone: 91-033-25693246 Fax: 91-33-23553886 Running Title : 34S enrichment during bacterial thiosulfate oxidation Key Words : Chemolithotrophy, thiosulfate oxidation, Proteobacteria, 34S enrichment, S-S bond breaking, SoxB, proteomics. ABSTRACT During chemolithoautotrophic thiosulfate oxidation the phylogenetically-diverged proteobacteria Paracoccus pantotrophus, Tetrathiobacter kashmirensis and Thiomicrospira crunogena rendered steady enrichment of 34S in the end product sulfate, with overall fractionation ranging between -4.6‰ and +5.8‰. Fractionation kinetics of T. crunogena was essentially similar to that of P. pantotrophus, albeit the former had a slightly higher magnitude and rate of 34S enrichment. In case of T. kashmirensis, the only significant departure of its fractionation curve from that of P. pantotrophus was observed during the first 36 h of thiosulfate-dependent growth, over which tetrathionate-intermediate formation is completed and sulfate production starts. Almost identical 34S enrichment rates observed during the peak sulfate-producing stage of all the three processes indicated the potential involvement of identical S-S bond-breaking enzymes. Concurrent proteomic analyses detected the hydrolase SoxB (which is known to cleave terminal sulfone groups from SoxYZ-bound cysteine S-thiosulfonates as well as cysteine S-sulfonates in P.
    [Show full text]
  • Download (PDF)
    Table S1 - Weight of cockroach gut sections with and without parasitic nematodes (La, Leidynema appendiculatum ; Free, nematode-free; Hd, Hammerschmidtiella diesingi ; Tb, Thelastoma bulhoesi ). Host Nematode Gut section Average (mg) Standard dev. Foregut 18.93 17.00 La Midgut 12.33 0.80 Hindgut 37.67 44.45 Periplaneta fuliginosa Foregut 13.17 5.86 Free Midgut 32.47 21.97 Hindgut 11.13 6.70 Hd and Tb 16.07 6.26 Periplaneta americana LaHindgut 18.53 8.62 Free 20.75 6.58 1 Table S2 - List of primers used in this study. Bold region highlighted in 16S V3-V4 region primers indicate the Illumina overhang adapter sequences. Primers (5’-3’) Leidynema appendiculatum specific primer based in D2D3 region Forward GCTGGTTGCCAGGCTCTACTAC Reverse CCGCACCACCGCAGGCCAGCAT Hammerschmidtiella diesingi specific primer based in D2D3 region Forward TGGCTGGATGGCTGTACTACTG Reverse GCATCATCAGACGAGCCAACAC Thelastoma bulhoesi specific primer based in D2D3 region Forward GCTCATGTTGCTGACTGCTTCC Reverse GCACCACCAAACGGGCTAACGC 16S V3-V4 region Forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG Reverse GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC 2 Table S3 - Characteristics of 16S rRNA gene amplicons from Periplaneta fuliginosa and P. americana with and without parasitic nematodes (La, Leidynema appendiculatum ; Hd, Hammerschmidtiella diesingi ; Tb, Thelastoma bulhoesi ) Libraries Accession Gut Section # Raw Pairs % Trimmed Pairs % Joined Pairs % Cleaned Pairs Mean Length Pyrotags1 L1976 SRR3178367 Foregut 106,610 99.72 71.79 70.47 420 70819 L1977
    [Show full text]
  • The Digestive and Defensive Basis of Carcass Utilization by the Burying Beetle and Its Microbiota
    ARTICLE Received 1 Oct 2016 | Accepted 7 Mar 2017 | Published 9 May 2017 DOI: 10.1038/ncomms15186 OPEN The digestive and defensive basis of carcass utilization by the burying beetle and its microbiota Heiko Vogel1,*, Shantanu P. Shukla1,2,*, Tobias Engl2,3, Benjamin Weiss2,3, Rainer Fischer4, Sandra Steiger5, David G. Heckel1, Martin Kaltenpoth2,3 & Andreas Vilcinskas6 Insects that use ephemeral resources must rapidly digest nutrients and simultaneously protect them from competitors. Here we use burying beetles (Nicrophorus vespilloides), which feed their offspring on vertebrate carrion, to investigate the digestive and defensive basis of carrion utilization. We characterize gene expression and microbiota composition in the gut, anal secretions, and on carcasses used by the beetles. We find a strict functional compartmentalization of the gut involving differential expression of immune effectors (antimicrobial peptides and lysozymes), as well as digestive and detoxifying enzymes. A distinct microbial community composed of Firmicutes, Proteobacteria and a clade of ascomycetous yeasts (genus Yarrowia) is present in larval and adult guts, and is transmitted to the carcass via anal secretions, where the yeasts express extracellular digestive enzymes and produce antimicrobial compounds. Our results provide evidence of potential metabolic cooperation between the host and its microbiota for digestion, detoxification and defence that extends from the beetle’s gut to its nutritional resource. 1 Department of Entomology, Max Planck Institute for Chemical Ecology, D-07745 Jena, Germany. 2 Max Planck Institute for Chemical Ecology, Research Group Insect Symbiosis, D-07745 Jena, Germany. 3 Department for Evolutionary Ecology, Johannes Gutenberg University, D-55128 Mainz, Germany. 4 Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), D-52074 Aachen, Germany.
    [Show full text]