Expression of the Gastrin Gene in the Normal Human Colon and Colorectal Adenocarcinoma1

[CANCER RESEARCH 53. 2919-2926, June 15. 1993] Expression of the Gastrin Gene in the Normal Human Colon and Colorectal Adenocarcinoma1

Gene G. Finley, Raymond A. Koski, Mona F. Melhem, James M. Pipas, and Arnold I. Meisler2

Departments of Medicine Â¡C.G. F., A. I. M.] and Pathology Â¡M.F. M.Â¡.University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; Department of Biological Sciences Â¡J.M. P.I, University of Pittsburgh, Pittsburgh, Pennsylvania 15260: Molecular ami Cellular Biology Department Â¡R.A. KJ, Amgen, Inc., Thousand Oaks. California 9I32Ãœ

ABSTRACT in colorectal cancers and normal mucosa. For example, proliferation factors may be produced by the sparse but ubiquitous neuroendocrine Gastrin, produced in the G-cells of the gastric antrum and regulating cells dispersed throughout the gastrointestinal tract (9-11). Pericryptal acid secretion in the stomach, also acts as a trophic factor in the gas fibroblasts located in the lamina propria adjacent to the crypt (12) or trointestinal tract. Because of its possible role in colon cell proliferation even lymphoid cells diffusely present throughout the intestine (13) and differentiation, evidence for its presence in normal colorectal mucosa and adenocarcinoma was sought. Utilizing tumors and matched normal may be sources of growth and differentiation factors. Gastrin, a peptide hormone produced by the G-cells of the gastric mucosa from 26 patients, mature gastrin and progastrin were studied by immunohistochemistry. In normal colonie mucosa! crypts, occasional cells antrum, was initially thought to control only acid secretion by the stained concordantly for gastrin, progastrin, and chromogranin A, sug stomach. The structure of the peptide and its mRNA and genomic gesting that they are of neuroendocrine origin. Adenomatous polyps sequence have been established (14, 15). In recent years it has been stained neither for gastrin nor chromogranin A. In 22 of 23 adenocarci- suggested that gastrin might also function as a trophic factor for the nomas, more than 50% of tumor cells stained for gastrin and progastrin. entire gastrointestinal mucosa. This role is clearly separable from its The expected gastrin transcript was demonstrable by polymerase chain effect on acid secretion and is summarized in recent reviews (3, 16, reaction and RNase protection in tumors and by polymerase chain reac 17). tion in normal mucosa. Its identity was confirmed by sequencing the Gastrin expression has been detected in colon cancer cell lines (18, polymerase chain reaction product. A larger transcript containing Intron II was present in both cancers and normal mucosa but was barely dis 19). Most of the gastrin studies on colon carcinoma cell lines tested cernible in the gastric antrum. Aberrant expression of gastrin may con the effects of adding gastrin to medium and assessing cell proliferation tribute to deregulated proliferation of many colorectal carcinomas. (18, 20-23). The results have varied. In a recent study, four different human colon cancer cell lines were tested for growth stimulation by added pentagastrin and only one showed growth stimulation (24). INTRODUCTION Such experiments are difficult to interpret. Since gastrin or an ana The treatment of disseminated colorectal cancer is unsatisfactory logue is usually added to the medium, lack of a proliferative response and patients with this disease almost invariably succumb. Over the may indicate that the peptide does not act as an effector for prolifer years a wide variety of antineoplastic chemotherapeutic agents, sur ation, that the receptor for gastrin is absent, or that the cells are already gical procedures, and radiation therapy has been utilized therapeuti- producing gastrin. Quantitative PCR measurements detected gastrin cally with only modest success in stabilizing the disease, without clear mRNA in several colon cancer cell lines (25). evidence that life has been consistently prolonged. These modalities Whether gastrin is involved in the pathogenesis and progression of have been reviewed recently (1). While investigative work in these colon cancer remains unclear. Watson et al. (26), using flow cytomet- areas continues, the advances in cell and molecular biology present ric detection with an anti-gastrin 17 antibody, demonstrated the pres opportunities for developing alternative therapies. An array of prolif ence of intracellular gastrin in 6 of 28 human colorectal tumors. In eration-promoting peptides appears to play a crucial role in the growth these tumors, more than 20% of the cells stained positively. The and differentiation of the normal colon. Selective inhibition of one or gastrin peptide and gastrin-like intermediates have also been found in more of these may provide a novel and effective mode of treatment. neural tumors (27, 28), pituitary tumors (29), gastrinomas (30), lung Growth factors mediating cell proliferation within particular organs tumors (31), and certain endocrine tumors (32, 33). Conflicting data may be identified in tumors removed from these organs. Tumors have been published as to whether blood levels of gastrin are elevated obtained at surgery are readily available, often in relatively large in colorectal cancer (34. 35). amounts for direct study or for establishing cell lines which can Limited data are available to support a role for gastrin as a positive facilitate identification of growth factors. Thus, from colorectal can growth stimulus for colorectal carcinoma in vivo and these have been cers and cell lines derived from them, mRNAs encoding a variety of reviewed (17). In this report, we provide additional evidence that growth promoting peptides have been identified, including TGF-a3 gastrin may be an effector for proliferation, and perhaps differentia and -ÃŸ,EOF, gastrin, insulin-like growth factors I and II, PDGF, and tion, in both normal colon and colorectal tumors. We demonstrate that fibroblast growth factor (2-4). Moreover, receptors such as c-erbB-\, progastrin and gastrin are present in neuroendocrine cells of normal c-erbB-2, the PDGF receptor, and the insulin-like growth factor I colorectal mucosa and that colorectal tumors comprise cells that com receptor have been shown to be present, suggesting the existence of monly express gastrin. autocrine loops (5-8). Paracrine stimulation may also promote growth

MATERIALS AND METHODS Received 8/18/92: accepted 4/12/93. The costs of publication of this article were defrayed in part by the payment of page Immunohistochemistry. Human colorectal surgical specimens were fixed charges. This article must therefore be hereby marked advertisement in accordance with in formalin, embedded in paraffin, and cut into 4-/xm sections. Representative 18 U.S.C. Section 1734 solely to indicate this fact. 1Supported in part by a Merit Review Grant from the Veterans Administration and by samples of normal mucosa and tumors were evaluated by routine pathological Amgen. Inc. studies and these samples were also stained with an indirect immunoperoxidase - To whom requests for reprints should be addressed at VA Medical Center, University method (36) using Vectastain Elite ABC Kits (Vector Laboratories. Burlin- Drive C. Pittsburgh. PA 15240. game. CA) with 3,3'-diaminobenzidine substrate and Mayer's hematoxylin *The abbreviations used are: TGF. transforming growth factor; cDNA. complementary DNA: PCR. polymerase chain reaction: EOF. epidermal growth factor; PDGF. platelet- counterstain. Polyclonal rabbit anti-human progastrin antibody (Cambridge derived growth factor. Research Biochemicals, Wilmington. DE) directed against the peptide Ser-Ala- 2919

Glu-Asp-Glu-Asn (amino acids 96-101 of preprogastrin) was used at a 1:2000 RNase A and Tl. The resultant products were analyzed on a denaturing dilution. This peptide is cleaved off progastrin during normal processing and is polyacrylamide/urea gel. not present in biologically active G-34 and G-17 gastrins. Polyclonal rabbit anti-human gastrin-17 antibody and polyclonal normal rabbit IgG were ob tained from DAKO (Carpenteria, CA) and monoclonal antibody against chro- RESULTS mogranin A was obtained from Boehringer Mannheim Biochemicals (India Immunohistochemical Demonstration of Gastrin and Progas napolis, IN). These were used as recommended by the manufacturers. Sections of paraffin-embedded gastric antrum were obtained from DAKO and used as trin in Colorectal Adenocarcinoma and Normal Mucosa. The hu positive controls. man preprogastrin peptide comprises 101 amino acids including: a 19 RNA Preparation and Northern Analysis. Tumors and normal tissues amino acid NH2-terminal signal peptide sequence; a 37 amino acid were obtained from patients undergoing surgery for colorectal carcinoma. The spacer region; a sequence containing the major bioactive forms of mucosa of normal colon was stripped from the underlying muscular layer by gastrin (gastrin 34 and gastrin 17); and a COOH-terminal flanking blunt dissection. Nonnecrotic specimens of tumor were used in their entirety. peptide (Fig. 1). The molecule undergoes extensive posttranslational Admixture with mononuclear cells was minimal for normal mucosa but vari processing (42) to yield: (a) progastrins extended beyond glycine at able for tumors, certainly less than one-third of the cells in tumor specimens. COOH-terminus; (b) glycine-extended progastrins, the immediate Tissue was rapidly frozen in liquid nitrogen for later use. Whole cellular RNA precursors of mature gastrins; and (c) amidated, biologically active was prepared by centrifugaron of guanidine isothiocyanate homogenates gastrins in which the COOH-terminal phenylalanine residue is ami- through a CsCI cushion according to methods described by Chirgwin el al. (37). RNA was enriched for polyadenylated message by oligodeoxythymidylic dated using glycine as the amide donor. In gastrins and progastrins, acid-cellulose column chromatography. tyrosine 87 has variable degrees of sulfation (43). In the gastric Detailed descriptions of denaturing agarose gel electrophoresis, transfer to antrum and duodenum about 50% of the gastrin molecules are sul- Gene Screen membranes (Dupont NEN, Boston, MA), fixation by UV cross- fated. The antibodies used in this study include rabbit anti-human linking, prehybridization, probe labeling, hybridization, stringency washes, gastrin-17 and anti-progastrin antibodies directed against different and autoradiography have been reported (38). The probe used for these studies. regions of the gastrin primary translation product (Fig. 1). pHG529, a full length gastrin cDNA clone, was kindly provided by Dr. Jens Previous gastrointestinal immunohistochemical studies localized Vuust (University Aarhus, Denmark) (14). The entire plasmid was radiolabeled gastrin and progastrin to gastric antrum G-cells and duodenal neu- by nick translation to a specific activity of IO8-IO9 cpm//j,g. roendocrine cells (44, 45). Consistent with these reports, we find Polymerase Chain Reaction. First strand cDNA was prepared from oli strong immunohistochemical staining of gastric antrum G-cells with godeoxythymidylic acid-primed whole cellular RNA from tumor and normal both anti-gastrin and anti-progastrin antibodies (Fig. 2). This staining tissues using Moloney Murine Leukemia Virus reverse transcriptase (Gibco BRL, Gaithersburg, MD). This cDNA was used as a template in PCR. Gastrin is absent when a negative control rabbit IgG antibody is used (data not cDNA was amplified from base 4 to 288 with gastrin specific primers (forward shown). primer: G[GAATTC]CAGCGACTATGTGTGTATGTG; reverse primer: C- In normal colonie mucosa, serial 4-ju.m sections demonstrate that |GGATCC]ACTGCGGCGGCCGAAGTCCAT). Brackets indicate EcoRl- occasional crypt cells stain concordantly for gastrin (Fig. 3a) and (GAATTC) and flc/mHHGGATCC) restriction sites inserted into the 5' ends of progastrin (data not shown). Staining is mostly cytoplasmic and was the primers to facilitate cloning. Reaction conditions were as follows: 5-10 ng absent when nonimmune rabbit IgG was used as a negative control of reverse transcribed cDNA prepared from whole cellular RNA or 5-20 pg of antibody. In Fig. 3, b and c, successive sections were stained for linearized plasmid DNA; 50 mm KC1; 1-2 m.MMgCI2; 10 mm Tris-HCl, pH 8.3; gastrin and human chromogranin A, a neuroendocrine marker, sug 0.02% gelatin; 200 JHMeach deoxynucleotide triphosphate; 1 ^M each deoxy- gesting that the cells containing gastrin are of neuroendocrine origin. nucleotide triphosphate; I JJ.Meach primer; 2.5 units Taq polymerase (Perkin Elmer Cetus, Norwalk, CT). The thermal cycler was programmed as follows: All cells which stained for gastrin also stained for chromogranin A. denaturation, 94Â°Cfor 1 min; reannealing, 50Â°Cfor 1 min; extension, 72Â°Cfor but the converse is not true. All normal mucosa studied were from 1 min. The reaction were carried out for 40 cycles and the products were patients who had a neoplasm somewhere in the colon or rectum. The directly analyzed on \% agarose, 3% Nu-Sieve (FMC Bioproducts, Rockland, specimens were at least 5 cm from the border of the tumor. We have ME), in 1 x TAE buffer (40 mm Tris-acetate-1 mm EDTA) and stained with not yet had an opportunity to study normal colon from a normal ethidium bromide. Because of the sensitivity inherent in the PCR reaction, patient. great care was taken to avoid contamination of the colon specimens with In contrast to the infrequent staining of normal colorectal mucosal gastrin PCR products (39). cells, we found that in 22 of 23 colorectal adenocarcinomas, more than Analysis of PCR Products. For Southern hybridization, PCR products 80% of the tumor cells stained for gastrin (Table 1). Of these 23 were separated in agarose gels, denatured, and blotted onto Gene Screen Plus tumors, 20 were also stained for progastrin and all of these were filters. Hybridization conditions and stringency washes were as previously positive. As in the case of normal mucosa, there was concordant reported (38). Gastrin cDNA plasmid pHG529 was used as a hybridization probe. Autoradiograms were typically exposed overnight at -70Â°C, using Du cellular staining for gastrin and progastrin in the same cells. Fig. 4 pont intensifying screens and Kodak X-OMAT AR film. shows a typical example of a colonie tumor stained for gastrin and The major PCR products from colon tumor and normal mucosa were gel progastrin. Staining is predominantly cytoplasmic. Virtually every purified and cloned into M13 mp 8 and 9. Recombinant plaques detected by tumor cell stains, but the intensity of staining may vary between color selection were isolated. DNA sequencing of the cloned PCR products tumors and within a given tumor. In Fig. 4Â«,the staining is diffuse and was carried out using the dideoxy method described by Sanger (40) with uniform throughout as is true for the progastrin staining shown in Fig. Sequenase Version II (U.S. Biochemicals, Cleveland, OH). 4b. This was not always the case, and in some tumors the pattern of Kihonuclea.se Protection Analysis. The probe used for these experiments staining was more heterogeneous. In these tumors some cells did not was derived from the 299 bp amplified gastrin fragment generated by PCR. stain at all and variation in staining intensity was seen from one sector This PCR product was purified, restricted with Â¿.VuRIand H. 2920

5' end of mRNA 67 nucleotides

from the initiating AUG. 30 5'- GÃ•.GAATTC]CAG CGA CTA TGT GTG TAT GTG- 3' - forward primer Human mRNA 5' AUG CAG CGA CUA UGU GUG UAU GUG CUG AUC UUU GCA CUG GCU CUG

Human protein Met Gin Arg Leu Cys Val Tyr ValSignal Leu Peptlda lie Phe Ala Leu Ala Leu

Hind III 90 GCC GCC UUC UCU GAA GCU UCU UGG AAG CGC CGC UCC CAG CAG CCA GAU GCA CCC UUA GGU ACA

Ala Ala Phe Ser. Glu Ala Ser Trp Lys Pro Arg Ser Gin Gin Pro Asp Ala Pro Leu Gly Thr

120 150 GGG GCC AAC AGG GAG CUG GAG CUA CCC UGG CUG GAG CAG CAG GGC CCA GCC UCU CAU CAU CGA AGG

Gly Ala Asn Arg Asp Leu Glu Leu Pro Trp Leu Glu Gin Gin Gly Pro Ala Ser His His | Arg Arg| Introni II 129 nucleotides

180 21C CAG CUG GGA CCC CAG GGU CCC CCA CAC CUC GUG GCA G&C CCG UCC AAG AAG CAG GGA CCA UGG

Gin Leu Gly Pro Gin Gly Pro Pro His Leu Val Ala Asp Pro Ser Lys Lys I (pin) Gly Pro Trp

240 reverse primer- 3'- TAC CTG AAG CCG GCG GCG TCA [CCTAGG]C - 5' CUG GAG GAA GAA GAA GAA GCC UAU GGA UGG AUG GAG UUC GGC CGC CGC AGU GCU GAG

(Leu) Ou) (Glu) (GIÃ™)(Glu) (GIÃ™) Ala fryrj Gly Trp (Met) Asp Phe Gly [ Arg Arg | Ser Ala Glu

â€¢Gastrin-17- ^X V Progastrln PeptldÂ« Hind III 330 GAU GAG AAC UAA CAA UCC UAG AACCAAGCUUCAGAGCCUAGCCACCUCCCACCCCACUUCAGCCCUGUCCCCUG

Asp Glu Asn STOP STOP

405 AAAAACUCAUCAAA AUAAA CUAGUUUCCAGUGGAUC AAAAAA 3 '

poly A Fig. l. Human gastrin cDNA sequence. Oligonucleotide primers are shown with brackets indicating restriction enzyme recognition sites added to facilitate cloning, Â¿VijRl- IGAATTC]. ÃŸamHI[GGATCC]. HindÃ¬Ã¬lrestrictionsites in the native sequence are indicated, ÃŸfur.v.dibasic processing sites for trypsin-like proteases which cleave the preprogastrin. The circlet!amino acids in the gastrin-17 sequence are homologous to the region surrounding tyrosine 3I5 in polyoma virus middle T-antigen. The tyrosine residue in gastrin-17 {double circle) K the site of sull'ation and in \-iiro phosphorylation.

Because of a lack of chromogranin A staining in tumors, we ex To further characterize the colonie gastrin PCR products, the 299- amined staining for chromogranin A and gastrin in six adenomatous and 428-base pair DNAs from colonie mucosa and from a colon polyps. These polyps varied in size from less than I cm to more than adenocarcinoma were gel purified, cloned into M13 mp 8 and 9, and 2 cm. No evidence of positive staining was detected (data not shown). sequenced. This revealed the 299-base pair fragment to be identical in Normal mucosa stains for chromogranin A and gastrin. polyps stain sequence to the published gastrin cDNA sequence (14). The longer for neither, and the tumors we examined stained positively for gastrin cDNA was also encoded by the human gastrin gene but contained the and negative for chromogranin A. As is evident from Table I. gastrin 129-base pair Intron II sequence indicated in Fig. 1. This larger staining correlated neither with the degree of tumor differentiation nor product apparently is amplified from unspliced gastrin mRNA present Dukes stage. Normal mucosa directly adjacent to tumors showed no in colonie mucosa and tumors but largely absent from gastric antrum. evidence of increased staining (data not shown). It is unlikely to be due to genomic DNA contamination of the colonie Polymerase Chain Reaction of Gastrin mRNA Transcripts in RNA used to prepare cDNA for PCR since the RNA used as a target Adenocarcinoma and Normal Mucosa. Ten tumors and their in PCR failed to produce any visible product without reverse tran matched normal mucosa were assayed for gastrin mRNA by PCR. The scription. predicted gastrin cDNA PCR product based on the primers used was Direct Detection of Gastrin mRNA in Colon Tumors by Ribo- 299 base pairs (Fig. I ). In fact, PCR amplified a 299-base pair prod nuclease Protection. Despite numerous attempts. Northern blot anal uct, as well as a larger 428-base pair product from all 20 colorectal ysis of colorectal carcinomas and normal mucosal tissue utilizing up specimens (Fig. 5). The larger product could barely be detected in to 20 ju,gof whole cellular RNA fai led to reveal the presence of gastrin cDNA reverse transcribed from gastric antrum and not at all in cloned mRNA although the transcript was easily demonstrable in RNA pre gastrin cDNA, nor from RNA samples that were not reverse tran pared from the gastric antrum (Fig. 7). scribed (Fig. 5; data not shown). The yield of the 299-base pair PCR Ribonuclease protection assays provide considerably more sensi product is consistently higher from tumor tissue than from matched tivity in detecting mRNA than Northern hybridization analysis (41) normal mucosa (Figs. 5 and 6). To confirm that the PCR reaction and are more quantitative than PCR amplification. Four colorectal products from the colon were indeed gastrin related, they were sub tumors were assayed for the presence of gastrin mRNA by this meth jected to Southern blot analysis shown in Fig. 6. These results indicate od. Ten /ig of polyadenylated mRNA were used from each specimen. that gastrin-related mRNAs are present in both normal and neoplastic For two of these tumors, sufficient corresponding normal mucosa was colonie tissue. available to provide RNA for the assay. Neither of the normal mucosal 2921

Fig. 2. Immunohistochemical staining of the normal gastric antral mucosa ( X400). a, staining with anti-gastrin antibody, b, same tissue stained with anii-progastrin antibody showing identical staining pattern to a. samples showed a protected band, but two of the tumors contained physiologically active cholecystokinin octapeptide, also produced in detectable message (Fig. 8). the gastrointestinal tract. This is of concern since the gastrin antibody we have utilized cross reacts with cholecystokinin (46). DISCUSSION The coincident staining for gastrin and chromogranin A in normal colonie mucosa strongly suggests that gastrin expression in colonie Our results support the conclusion that gastrin is present in normal crypts is restricted to neuroendocrine cells (28). In the common co- colonie mucosa and in colorectal tumors. The concordant staining for Ionic neoplasms, adenomatous polyps and adenocarcinomas. the gastrin and progastrin in the same cells allows us to infer gastrin former stain neither for gastrin nor chromogranin A while the latter synthesis in situ. Moreover, the presence of the progastrin hexapeptide stain for gastrin but frequently not for chromogranin A. This suggests SAEDEN (amino acids 96-101) serves to distinguish gastrin from the that increased gastrin expression occurs at a late stage in malignant r.--A â€¢% â€¢â€¢â€¢......

< .

Fig. 3. Immunohistochemical staining of normal colonie mucosa ( X 4(X)). a, colonie mucosa stained Â£â€¢â€¢ with anti-gastrin antibody showing occasional cell staining positively, b and c. consecutive sections .;< stained with anti-gastrin and anti-chromogranin A antibodies, respectively. The coincident staining â€¢â€¢â€¢ pattern suggests that the gastrin-containing cells are kJlHiÂ« if 7 â€¢â€¢Mâ€¢â€¢ of neuroendocrine origin (see text). â€¢KsKWi,' 3Ã„ :A

2922

Table I Expression of gas tri n and progast rin in colorÃ©ela!cancers

PatientCIC2C3C4C5C7C8C9CIOC13C16C18C19C20C2IC22C23C24C26C27C28C29C30C31C32C33DukesstageBlBlBlBlB2B2B2B2B2B2B2B2B2B2B2B2C2C2C2DDDDDDDPathology"MWDAMWDAMWDAWDAMWDAMWDAMWDAMWDAMWDAMWDAMWDAWDAMWDAMWDAMWDAWDAMWDAMWDAWDAWDAPDAMWDAWDAPDAPDAMWDAGastrin''0Tr-ND2+1+Tr-3+3+ND3+1+

+R3+1+1+1+ND3+2+Tr]

+2+3+3++4+3+3+2+4+1 causeA&W:>60MA&W:24MA&W:>60MA&W:>60MR:45MR:11MD:9MD:PD:44MD:PD:23MD:18MD:13MD:18MD:PD:6MD:16MD:6MD:49M

+Tr-2+ND2+1+-2+1+-2+2+ -Tr -2+Tr-3+1

-2ND3+ -3+2+2+

-3+2+ -3+ND1+-2+1

-2+ B -Tr-3+ +NDND2+

-Tr-2+ +3+3+Progastrin'1T-3+ND3+Clinical'D:37MA&W:>60MD:56MD:57MA&W:35MD:45MD:unrelated -Tr-2+1

" WDA. well differentiated adenocarcinoma: MWDA. moderately well differentiated udenocarcinoma: PDA. poorly differentiated adenocarcinoma. h Intensity of stained cells, in different areas of the tumor section on a scale of 0 (negative) to 4+. ND. not done. ' D. dead; A&W, alive and well; R. relapse; P. perioperative death within 6 weeks of surgery; M. months. transformation of colonie epithelial cells. This observation further suggests that the origin of the adenomatous polyp is not from neuroendocrine cells. Finally, PCR-detection of gastrin mRNA in normal mucosa and colorectal adenocarcinomas, much more abundant in the latter than in the former, and sequencing of the PCR products provides additional evidence for gastrin expression in these tissues. The ribonuclease protection assay confirms this conclusion. Gastrin gene expression is regulated by multiple mechanisms. The gastrin promoter contains negative and positive elements to which fra/u-acting protein factors bind (47, 48). TGF-a, EGF (9) and gas trointestinal peptides such as somatostatin (49, 50) and bombesin/ gastrin releasing peptide (51) appear to be mediators of gastrin tran scription and release in the gastric antrum. TGF-a. which is expressed in most colorectal carcinomas (52) may promote gastrin gene expres sion in these tumor cells. It is also clear that gastrin mRNA processing is altered in the colon and colonie tumors since the large PCR product from unspliced gastrin mRNA precursors is barely detectable in the Fig. 4. Immunohistochemical staining of adenocarcinomas (X 400). a, moderately well antrum. Colorectal tumor cells, although the majority contain gastrin, differentiated adenocarcinoma of the colon (patient C13) stained with the anti-gastrin antibody showing cytoplasmic homogeneous staining in all tumor cells. A rare interstitial have low levels of gastrin mRNA. In contrast, the gastric antrum, fibroblast is also positive, b, consecutive section of the same tumor stained with anti- while comprising about 30% G-cells (53), produces enough gastrin progastrin. Note the identical staining pattern within the same tumor, c. negative control, mRNA to be seen on Northern analysis. The accumulation of gastrin a consecutive section to that seen in a and b. Only rare nonspecific positively is seen in in tumor cells suggests more efficient gastrin mRNA translation interstitial inflammatory cell with normal rabbit IgG antibody. and/or less efficient secretion of gastrin than in G-cells. The precise role of gastrin in colorectal cancer remains unclear. Table 1 shows that most adenocarcinomas contain gastrin immunore- gastrin strongly suggest a role for gastrin in the growth of normal active protein irrespective of Dukes stage, morphology, or clinical colonie mucosa (16, 17) which can be abrogated using a gastrin outcome. Further, gastrin staining does not correlate with patient age, antagonist, proglumide (54. 55). tumor size, or location. It is unlikely that an intestinal hormone as Colon tumor cell studies support an autocrine growth mediating physiologically active as gastrin occurs in 22 of 23 colorectal tumors role for gastrin. Hoosein. et al. (18) showed that the HCT116 colon by chance alone and exerts no effect on tumor cell growth. Gastrin cancer cell line contained mRNA that hybridized to a gastrin-specific may act in a permissive capacity, necessary but insufficient for tumor probe, although the transcripts were much longer than those antici development and progression. In the normal colon it seems likely that pated for gastrin mRNA. In another study. Baldwin, et al. (19) con the neuroendocrine cells, acting in a paracrine manner, release gastrin vincingly demonstrated gastrin mRNA in the human Okajima and and other peptides that play a role in the proliferation and differenti HCT116 cell lines. Recently, they have demonstrated gastrin mRNA ation of adjacent crypt cells. Studies using exogenously administered in seven additional cell lines (25). Moreover, both proglumide and 2923

Fig. 5. Gastrin PCR products from colorectal tissues, a. Lane I, positive control; PCR product from the linearized plasmid pHG529 which contains the full length human gastrin cDNA. This lane demonstrates the predicted 299-base pair hand (middle arrow). Lanes 2 and 3, duplicate lanes demonstrating the amplification products from u human colon carcinoma cDNA. There is a prominent hand at 299 hase pairs (middle arrow) and a weaker hand about 428 hase pairs in length (top arrow]. The larger product was not seen in the positive control. Lane 4, negative control; no added template DNA. h, PCR products from normal colonie mucosa. IMHCÂ¡,positive control; PCR product from the lineari/ed plasmid pHG529 which contains the full length human gastrin cDNA. This lane demonstrates the predicted 299-base pair band. Lane 2, negative control; no added template DNA. lÂ¿mes3 and 4. duplicate lanes demonstrating the amplification products from normal colonie mucosal cDNA. There are products of 299 and about 428 base pairs in length. The larger product was not seen in the positive control (Â¡MueI ). In both a and h a primer dimer band is visible at the bottom of the gel (bottom arrow).

1 8

Fig. 6. Southern blot analysis of gastrin PCR products from three adenocarcinomas and matched normal mucosa. Lane I, gastric mucosal cDNA, approximately 1 ng utilized as a target in the PCR reaction. Note predominate signal at 299 base pairs (bottom arrow) and faint signal at 428 base pairs (lop arrow). Â¡Mne2, positive PCR control utili/ing of 20 pg of linearized gastrin cDNA plasmid (pHG529), demonstrating the single 299-base pair product. IMHC3, normal mucosa showing predominately the 428-base pair product. The 299-hase pair fragment is poorly seen; iMne 4, adcnocareinoma from patient whose normal mucosa is shown in Lane 3. The signals from both the 299- and 428-base pair fragment are easily seen. IÂ¿me5 and 6, normal mucosa and tumor, respectively, from a patient. Signals from both products are easily seen in both tissues. Lane 7 and fi, normal mucosa and tumor, respectively from a patient. The 299-base pair product is poorly seen in the normal mucosa and the 428-base pair product is poorly seen in the tumor Lanes 3-fi utilized approximately 5 ng of cDNA for each amplification reaction. Ten % of the amplified product was run on the gel in each instance (Lanes 1-8). 2924

Fig. 7. Northern blot probed with gastrin cDNA. Lane I, 20 /Â¿gofwhole cellular RNA from normal mucosa (patient C20). No detectable signal is visible here. iMne 2: 20 /Agof whole cellular RNA from adenocarcinoma (patient C20). No detectable signal is visible here. bine 3, 20 ng of whole cellular RNA from the gastric tundus. A faint signal representing the gastrin message is visible. Lane 4. 3 (ig of whole cellular RNA from the gastrin antrum. Arnt\\: an intense signal. Approximate size of message is 470 nucleotides. anti-gastrin antibodies inhibit the growth of the HCT116 colon tumor cell line in a concentration-dependent manner (18. 56). Fig. 8. RNase protection assay. Lane 1, 1 ng of synthetic gastrin sense RNA; Lane 2. It seems likely that gastrin in the stomach, and possibly in the colon, tRNA negative control. Lanes .ÃŽ-5.three different tumor samples, each containing 10 u.g acts as an autocrine or paracrine peptide growth factor. The canine of polyadenylated RNA. Two of the tumors display a 285-base pair protected fragment of parietal cell gastrin receptor has recently been cloned and character gastrin mRNA (tirnnv). ized (57). It appears to be a seven-transmembrane-segment receptor with significant homology to members of the ÃŸ-adrenergicfamily of tor tyrosine kinases (61 ). When the tyrosine in this polyoma middle T G-protein-coupled receptors. Interaction of this gastrin receptor trans- sequence is phosphorylated in vivo, the protein associates with and activates pp60l SIVas well as associating with phosphatidylinositol fected into COS-7 cells with gastrin results in phosphatidylinositol 3-kinase (61 ). We have clearly shown that most, if not all. colorectal hydrolysis and calcium mobilization suggesting a role for the receptor in signal transduction (57). The recently cloned human CCKB recep tumors contain increased levels of src activity (62). Moreover, the tor, which appears to be identical or highly homologous to the antral corresponding gastrin tyrosine can be phosphorylated by the activated gastrin receptor, also contains seven regions of hydrophobic residues EGF receptor in vitro (63). We suggest that known signal transduction corresponding to transmembrane domains of G-coupled receptors pathways culminating in cell division may be activated by intracell- (58). Homology of human CCKB and the canine gastrin receptor is ular gastrin in colorectal tumors. Although speculative, it is not in greater than 90proteins phosphorylated in response to EGF which the effector molecule associates with its receptor within the (65). We are currently assessing the role of somatostatin analogues in suppressing gastrin-mediated growth of colon cancer cell lines. secretory compartment of the cell, are by now well established. A notable example of this is in the action of PDGF and its oncogene counterpart, v-sis (59). Alternatively, gastrin may associate intracel- REFERENCES lularly with molecules known to be involved in the signal transduction 1. Kane. M. J. Coloreclal cancer, part I and 2. Semin. Oncol.. 18: 3I5^Â»9I, 1991. process. Baldwin (60) made the intriguing observation that the amino 2. Tahara. E. Growth factors and oncogenes in human gastrointestinal carcinomas. J. Cancer Res. Clin. Oncol.. 116: 121-131, 1990. acid sequence of human gastrin has homology to a carboxy-terminal 3. Burgess. A. W., and Si/eland. A. M. Growth factors and the gut. J. Gastroenterol. region of the transforming middle T-antigen of polyoma virus that Hepatol. (Australia). 5: 10-21. 1990. 4. Tricoli. J. V.. Rail. L. B.. Kara Kousis. P., Herrera. L., Petrelli. N. J.. Bell. G. I., and contributes to cell transformation. The homologous middle T region Shows. T. B. Enhanced levels of insulin-like growth factor messenger RNA in human contains the sequence EEEEEYMPM, while the corresponding region colon carcinomas and liposarcomas. Cancer Res., 46: 6169-6173, 1986. in gastrin contains the sequence EEEEEAYGWM. These regions of 5. Yasui. W.. Sumiyoshi. H.. Hata. J.. Kameda. T.. Ochiai. A., and Tahara. E. Expression of epidermal growth factor receptor in gastric and colon carcinoma. Cancer Res.. 4fi: polyoma middle T protein and gastrin (Fig. I ) are also homologous to 137-141. 1988. the consensus phosphatidylinositol 3-kinase binding domain of recep- 6. D'Emilia. J.. Bulovas. K.. D'Ercole. K.. Steele. G.. and Summerhoges. I. C. Expres-

2925

sion of the c-erhB-2 gene product ut diffÃ©rentstagesof neoplastic progression in the colorectal neoplasia. Dis. Colon Recium. 31: 716-717. 1988. colon. Oncogene. 4: 1233-1239. 1989. 36. Hsu. S. M.. Raine, L., and Fanger. H. Use of avidin-biolin-peroxidase complex (ABC) 7. Ito. M., Yoshidu. K.. Kyo, E.. Ayhan. A., Nakayama. H.. Yasui. W.. Ito. H., and Tahara. in immunoperoxidase techniques: a comparison betweenABC and unlabeled antibody E. Expression of several growth factors and their receptor genes in human colon (PAP) procedures. J. Hislochem. Cylochem., 29: 577-580. 1981. carcinomas. Virchow Archiv. B. Cell Pathol.. 5V: 173-178. 1990. 37. Chirgwin, J. M.. Przybyla. A. E.. MacDonald. R. J.. and Rutter. W. J. Isolation of 8. Guo, Y. S.. Naragon, S.. Yallampalli. C.. and Singh. P.Characterization of insulin-like biologically active ribonucleic acid from sources enriched in ribonuclease. Biochem growth factor I receptor in human colon cancer. Gastroenterology. 102: 1101-1108. istry, 18: 5294-5299, 1979. 1992. 38. Finley. G. G.. Schulz. N. T., Hill. S. A.. Geiser, J. R.. Pipas. J. M., and Meisler. A. I. 9. Godley. J. M.. and Brand. S. J. Regulation of the gastrin promoter by epidermal Expresssion of ihe mvc gene family in differenl stages of human colorectal cancer. growth factor and neuropeptides. Proc. Nati. Acad. Sci. USA. 86: 3036-3040. 1989. Oncogene. 4: 963-971. 1989. 10. Chejfec, G.. Capella. C.. Solcia, E.. Wellington. J.. and Gould. V. E. Amphicrine cells. 39. Ausubel. F. M.. Breni. R.. Kingston. R E.. Moore, D. D.. Seidman, J. G.. Smith. J. dysplasias and neoplasias. Cancer (Phila.). 56: 2683-2690. 1985. A., and Strahl. K. (eds.) Chapter 15. The polymerase chain reaction. In: Current 11. Jansson,D.. Gould. V. E-, G(xÂ»ch,G.T.. et al. Immunohistochemical analysis of colon Protocols in Molecular Biology. Suppl. 9. pp. Ã•5.3.6-15.3.7.New York: John Wiley carcinomas applying exocrine and neuroendocrine markers. Acta Pathol. Microhiol. and Sons. 1989. Immunol. Scand.. 96: 1129-39. 1988. 40 Sanger. F.. Nicklen, S.. and Coulson. A. R. DNA sequencing with chain terminating 12. Akashi. M.. Yamato. K., and Koeffler. H. P.Hematopoietic growth factors: regulation inhibitors. Proc. Nail. Acad. Sci. USA. 74: 5463-5467. 1977. of production. In: R. Mertelsmann and F. Herrmann (eds.). Hematopoietic Growth 41. Berk. A. J.. and Sharp. P.A. Sizing and mapping of early adenovirus mRNAs by gel Factors in Clinical Applications, pp. 41-61. New York: Marcel Dekker. Inc.. 1990. electrophoresis of SI endonuclease-digesied hybrids. Cell. 12: 721-732. 1977. 13. Riecken. E. O., Stallmach. A.. Zcitz. M.. Schulzke. J. D.. Merge, H., and Gregor, M. 42. Bardram. L.. Hilsted. L.. and Rehfeld. J. F. Progastrin expression in mammalian Growth and transformation of small intestinal mucosa: importance of connective pancreas. Proc. Nail. Acad. Sci. USA. 87: 298-302. 1990. tissue gut associated lymphoid tissue and gastrointestinal regulatory peptides. Gut. 43. Anderson, B. Measurement of occurrence of sulfated gastrins. Scand. J. Clin. Lab. 30: 1630-1640. 1989. Invest. Suppl., 168: 5-24, 1984. 14. Boel. E., Vuust. J.. Norris. F.. et al. Molecular cloning of human gastrin cDNA: 44. Sjolund. K.. Sanden. G.. Hakanson. R.. and Sundler. F. Endocrine cells in human evidence of evolution of gastrin by gene duplication. Proc. Nati. Acad. Sci. USA. 80: inteslines: an immunocytochemical study. Gastroenterology. 85: 1120-1123. 1983. 2866-2869. 1983. 45. HarÃ¡.M., Varndell. I. M.. Bishop. A. E., et al. Expression of the C-lerminal flanking 15. Wiborg. O., Berglund, L.. Boel. E., Norris. F.. Norri. K., Rehfeld. J. F.. Marcker. K. peptide of human progastrin in human gastroduodenal mucosa.G-cell hyperplasia and A., and Vuust. J. Structure of a human gastrin gene. Proc. Nati. Acad. Sci. USA. 8l: islet cell lumors producing gasirin. Mol. Cell Probes. /: 95-108, 1987. 1067-1069. 1984. 46. Dakopatts Specification Sheet. Rabbit Anti-Human Gastrin. 16. Johnson. L. R. Regulation of gastrointestinal mucosa! growth. Physiol. Rev.. 68: 47. Wang. T. C.. and Brand. S. J. Islet cell-specific regulatory domains in Ihe gastrin 456-501, 1988. promoter contains adjacent positive and negative DNA elements. J. Biol. Chem.. 26: 17. Mulholland, M. W., and Debas. H. T. Physiology and pathophysiology of gastrin: a 8908-8914. 1990. review. Surgery (St. Louis). 10): 135-147. 1988. 48. Merchant. J. L.. Demediek. B.. and Brand. S. J. A GC-rich element confers epidermal 18. Hoosein. N. M.. Kiener. P.A.. Curry. R. C.. and Brattain. M. G. Evidence for autocrine growih faclor responsiveness lo transcription from the gastrin promoter. Mol. Cell. stimulation of cultured colon tumor cells by a gastrin-cholecystokinin-like peptide. Biol.. //: 2686-2696. 1991. Exp. Cell Res.. 186: 15-21. 1990. 49. Wolfe, M. M.. Reel. G. M.. and McGuigan, J. E. Inhibition of gastrin release by 19. Baldwin. G. S.. Casey. A.. Matanadiotis, T.. McBride, K.. Sizeland. A. M.. and somatostatin in cultured rat antral mucosa. J. Clin. Invest.. 72: 1586-1593. 1983. Thumwood. C. M. PCR cloning and sequenceof gastrin mRNA from carcinoma cell 50. Karnik. P.S., Monahan. S. J.. and Wolfe. M. M. Inhibition of gastrin gene expression lines. Biochem. Biophys. Res. Commun., 170: 691-697, 1990. by somatosialin. J. Clin. Invest., 83: 367-372, 1989. 20. Sirinek, K. R., Levine. B. A., and Mayer, M. P.Pentagastrin stimulates in \-itn>growth 51. Varner. A. A.. Modlin. I. M.. and Walsh, J. H. High potency of bombesin for of normal and malignant human colon epithelial cells. Am. J. Surg.. 149: 35-39. 1985. stimulation of human gastrin release and gastric acid secretion. Regul. Pepi. /: 21. Kusyk. C. J., McNiel. N. O.. and Johnson, L. R. Stimulation of growth of a colon 289-296. 1981. cancer cell line by gastrin. Am. J. Physiol.. 251: G597-G601. 1986. 52. Ciardiello. F.. Kim. N.. Saeki. T.. Dono, R.. Persico, M. G., Plowman. G. D.. Garri 22. Watson. S. A., Durrani. L. G., Crosbie. J. D., and Morris. D. L. The in vitro growth gues. J.. Radke. S.. Todaro. G. J., and Salomon. D. S. Differential expression of responseof primary colorÃ©ela!andgastric cancer cells to gastrin. Int. J. Cancer, 43: epidermal growth factor-related proteins in human colorectal tumors. Proc. Nati. 692-696. 1989. Acad. Sci. USA. 88: 7792-7796. 1991. 23. Smith, J. P.. and Solomon. T. E. Effects of gastrin. proglumide and somatosialin on 53. Owen. D. Normal histology of the stomach. Am. J. Surg. Pathol.. 10: 48-61. 1986. growth of human colon cancer. Gastroenterology. 95: 1541-1548. 1989. 54. Johnson. L. R.. and Gulhrie. P. D. Proglumide inhibilion of Ihe trophic action of 24. Eggstein. S.. Imdahl. A.. Kohler. M.. Waibel. M., and Farthmann. E. H. Influence of pentagaslrin. Am. J. Physiol.. 246: G62-G66. 1984. gastrin, gastrin receptor blockcrs. epidermal growth factor, and difluoromethylomi- 55. Beauchamp. R. D.. Townsend. C. M.. Singh. P.. Glass. E. J.. and Thompson, J. C. cells.thine onJ. Cancer the growth Res. and Clin. the Oncol.. activity 'll7: of ornithine37-42, 1991. decarboxylase of colon carcinoma Proglumide. a gasirin receptor antagonist, inhibits growth of colon cancer and en hances survival in mice. Ann. Surg., 202: 303-309, 1985. 25. Baldwin. G. S.. and Zhang. Q. X. Measurement of gastrin and transforming growth 56. Hoosein. N. M.. Kiener. P. A.. Curry. R. C.. Rovali. L. C.. McGilbra. D. K.. and factor-a messenger RNA levels in colonie carcinoma cell lines by quantilalive poly- Bratlain. M. G. Anliproliferalive effects of gastrin receptor antagonists and antibodies merase chain reaction. Cancer Res., 52: 2261-2267, 1992. to gastrin on human colon cancer cell lines. Cancer Res., 48: 7179-7183. 1988. 26. Watson. S. A.. Durant. L. G.. Wencyk. P. M.. Watson. A. L.. and Morris. D. L. 57. Kopin, A. S.. Lee. Y. M.. McBride. E. W.. Miller. L. J.. Lu. M., Lin, H-Y.. Kolakowski. Intracellular gastrin in human gastrointestinal tumor cells. J. Nail. Cancer. Inst.. 83: L. F.. and Beinborn, M. Expression cloning and characterizaiion of the canine parietal 866-871, 1991. cell gastrin receptor. Proe. Nati. Acad. Sei. USA. 89: 3605-3609. 1992. 27. Rehfeld. J. F., vanSolinge. W. W.. Tos. M., and Thomson. J. Gastrin. cholecystokinin 58. Pisegna. J. R.. de Weerth, A.. Huppi. K.. and Wank, S. A. Molecular cloning of the and their precursors in acoustic neuromas. Brain Res.. 530: 235-238. 1990. human brain and gastric Cholecyslokinin receptor: structure, functional expression and 28. Bevan. J. S.. Asa. S. L.. Rossi. M. L.. Esiri. M. M.. Adams. C. B., and Burke. C. W. chromosomal localization. Bioehem. Biophys. Res. Commun.. I8V: 296-303. 1992. Incasellar gangliocytoma containing gastrin and growih hormone-releasing hormone 59. Browder. T. M.. Dunbar. C. E., and Nienhuis. A. W. Privale and public auUKrine loops associatedwith a growth hormone secreting piluilary adenoma. Clin. Endocrino!.. 30: in neoplastic cells. Cancer Cells. /: 9-17. 1989. 213-224, 1989. 60. Baldwin. G. S. Gastrin and the transforming protein of polyoma virus have evolved 29. Bardram. L., Lindholm. J.. and Rehfeld. J. F. GaMrin in pituitary tumors. Acia from a common ancestor. FEBS Leu.. 137: 1-5. 1982. Endocrino!., 115: 419-422, 1987. 6l. Caniley. L. C.. Auger. K. R.. Carpenter. C., et al. Oncogenes and signal transduction. 30. Wolfe. M. M., and Jensen. R. T. Zollinger-Ellison syndrome. N. Engl. J. Med., 317: Cell. 64: 281-302. 1991. 1200-1209. 1987. 62. Cartwrighi. C. A., Kamps. M. P.. Meisler. A. !.. Pipas. J.. and Eckharl. W. pp60l"-" 31. Rehfeld. J. F., Bardram. L.. and Hilsied. L. Gastrin in human bronchogenic carcino activation in human colon carcinoma. J. Clin. Invest., 83: 2025-2033. 1989. mas: constant expression but variable pnx'essing of gastrin. Cancer Res.. 49: 2840- 63. Baldwin. G. S.. Knesel. J.. and Monckton. J. M. Phosphorylation of gaslrin-17 by 2843. 1989. epidermal growth faclor-slimulated tyrosinc kinase. Nature (Lond.l. 301: 435â€”137. 32. Bardram. L.. Hilsted, L., and Rehfeld. J. F. Cholecyslokinin. gastrin and precursors in 1983. pheochromocytomas. Acia Endocrino!., 120: 479-484, 1989. 64. Dy, D. Y. Whitehead. R. H.. and Morris. D. L. SMS20I.995 inhibits in \tini and in 33. Fabri. R. J., Gower. W. R.. Weber. C.. and Tuttle. S. Hypcrparathyroid glands contain VMYÃ•growthof human colon cancer. Cancer Res.. 52: 917-923. 1992. G-17 and G-34 gastrin. J. Surg. Res.. 41: 333-337. 1986. 65. Lee, M. T., Liebow. C.. Kamer, A. R.. and Schally, A. V. Effects of epidermal growth 34. Smith, J. P..Wood. J. G.. and Solomon, T. E. Elevated gastrin levels in patients with factor and analogues of luteinizing hormone-releasing hormone and somatostatin on colon cancer or adenomatous polyps. Dig. Dis. Sci.. 34: 171-174. 1989. phosphorylalion and dephosphorylalion of lyrosine residues of specific protein sub- 35. Suzuki. H.. Malsumoto. K.. and Terashima. H. Serum levels of gastrin in patients with slrales in various tumors. Proc. Nati. Acad. Sci. USA. XX: 1656-1660. 1991.

2926

Gene G. Finley, Raymond A. Koski, Mona F. Melhem, et al.

Cancer Res 1993;53:2919-2926.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/53/12/2919

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/53/12/2919. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.