Characterization of the Promoter Region of the Mouse Xist Gene

Proc. Natl. Acad. Sci. USA Vol. 92, pp. 12515-12519, December 1995 Genetics

Characterization of the promoter region of the mouse Xist gene (chloramphenicol acetyltransferase assay/cis factor/trans factor/X chromosome inactivation) NATHALIE PILLET*tt, CHRISTOPHE BONNYt, AND DANIEL F. SCHORDERET*t *Unit of Molecular Genetics, Division of Medical Genetics and tCentre Hospitalier Universitaire Vaudois, University of Lausanne, CH-1011 Lausanne, Switzerland Communicated by Stanley M. Gartler, University of Washington, Seattle, WA, September 8, 1995

ABSTRACT The mouse Xist gene is expressed exclusively mechanisms of X chromosome inactivation. Xist is located near from the inactive X chromosome and may be implicated in Xic and is expressed only from the inactive X chromosome in initiating X inactivation. To better understand the mecha- both human and mouse, suggesting an involvement in the nisms underlying the control of Xist expression, we investi- process of inactivation. Several lines of evidence suggest that gated the upstream regulatory region of the mouse Xist Xist expression may play a significant role in initiation of X promoter. A 1.2-kb upstream region of the Xist gene was inactivation. First, Xist transcripts can be seen for the first time sequenced and promoter activity was studied by chloramphen- at the four-cell stage (19, 20), before an inactive X chromo- icol acetyltransferase (CAT) assays after transfection in mu- some is detected in the trophectoderm. Second, this early Xist rine XX and XY cell lines. The region analyzed (-1157 to expression is imprinted with exclusive expression of the pa- +917) showed no in vitro sex-specific promoter activity. How- ternal allele consistent with nonrandom X inactivation in cells ever, a minimal constitutional promoter was assigned to a of extraembryonic lineage. Third, the Xist imprint, due to a region from -81 to +1, and a cis element from -41 to -15 differential paternal and maternal Xist methylation (21), is regulates promoter activity. We showed that a nuclear factor developmentally labile and the maternal Xist allele is expressed binds to an element located at -30 to -25 (TTAAAG). A in the egg cylinder embryo shortly before gastrulation. Last, second sequence at -41 to -15 does not act as an enhancer Kay et al. (20) suggested that the parental Xist imprint is lost and is unable to confer transcriptional activity to theXist gene at about the same time as the occurrence of the X chromosome on its own. A third region from -82 to -41 is needed for counting mechanism. Moreover, it has recently been shown correct expression. Deletion of the segment -441 to -231 is that Xist expression is not required for the maintenance of X associated with an increase in CAT activity and may represent inactivation in cell lines in which X inactivation is already a silencer element. established (22). The Xist gene has been cloned and sequenced (23, 24). The X chromosome inactivation occurs in female mammals to full-length 15-kb transcript is composed of 6 exons. The lack of transcriptionally inactivate one of the two X chromosomes, any significant open reading frame, as well as the nuclear resulting in dosage compensation, equivalent expression of X localization of the transcript, suggests that Xist acts as a chromosome-linked genes in XX females and XY males (1). structural RNA that interacts in cis with the chromosome from The X inactivation process involves three steps: initiation, which it is transcribed. Comparisons of mouse and human spreading, and maintenance (2). The initiation process is sequences reveal regions of considerable homology (repeats) dependent on a major cis-acting switch gene or X inactivation and conservation of the overall gene organization. center (Xic) (3). In diploid cells, one X chromosome remains To better understand the mechanisms underlying the con- active, while supernumerary X chromosomes are inactivated. trol ofXist gene expression, we have investigated the upstream One model is that some cellular mechanism counts the number regulatory region of the mouse Xist promoter. We here report of Xics so that one X chromosome escapes X inactivation (4, the identification of the minimal promoter and the character- 5). Alternatively, one single X chromosome may be imprinted ization of a regulatory element.§ to remain active by blocking its Xic, leaving the others to be inactivated by a general mechanism. The spreading step results MATERIALS AND METHODS but not in the cis-limited transcriptional inactivation of most, and cell lines were all, genes on the unmarked X chromosome(s). Once X inac- Cell Culture. The BALB/3T3 BLK/CL.4 tivation has occurred, it is stable and heritable, with mainte- grown in Dulbecco's minimal essential medium supplemented inactive state mitotic cell with 10% fetal calf serum, 2 mM L-glutamine, penicillin (100 nance of the throughout subsequent units/ml), and streptomycin (100 ,tg/ml) in a 5% C02/95% air divisions. DNA methylation at CpG-rich islands of some atmosphere. X-linked genes has been implicated in this maintenance step Transcription Reporter Constructs and Transfection Stud- (6-8). ies. The pBS-4844B construct of the mouse promoter from X inactivation first occurs in the extraembryonic trophec- -1157 to +917 was provided by S. Rastan (Medical Research toderm and primitive endoderm lineages and is imprinted, Council Clinical Research Center, Harrow, England). The with exclusive inactivation of the paternal X chromosome 4844B region was inserted into the Xba I site of the promot- (9-15). In the embryonic lineage, X inactivation occurs later, erless pCAT-Basic vector (Promega). Promoter deletional at around the time of gastrulation, and either the paternal or mutants were constructed by using convenient restriction sites the maternal X chromosome can be inactivated at random. Sac II, Xba I, and Hindlll and by PCR. All constructs were Thus, the imprint on the incoming X chromosome(s) must be sequenced in order to check for PCR-based mutations. BALB/ erased at some time between the blastocyst and egg cylinder 3T3 and BLK/CL.4 cells (1-2 x 105) were transiently trans- stages. The recent isolation of the Xist gene (X inactive specific transcript) (16-18) has stimulated some new concepts in the Abbreviations: CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility-shift assay; TBP, TATA binding protein. The publication costs of this article were defrayed in part by page charge 4To whom reprint requests should be sent at the t address. payment. This article must therefore be hereby marked "advertisement" in §The sequence reported in this paper has been deposited in the accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. U29341). 12515 Downloaded by guest on September 30, 2021 12516 Genetics: Pillet et al. Proc. Natl. Acad. Sci. USA 92 (1995) fected by liposome-mediated DNA transfection (DOTAP; pmol of competitor oligonucleotides to the binding reaction Boehringer Mannheim) using 5 ,ug of the construct. Relative mixture prior to the addition oflabeled probe. The gel was then transfection efficiency was determined by cotransfection with dried under vacuum at 80°C for 30 min and exposed to a Kodak a pSV/3-galactosidase reporter gene (pSV/j3-gal). After trans- X-Omat AR film. The binding conditions used with the purified fection, cells were incubated for 48 h, harvested, and then lysed TBP (TATA binding protein) were those described by Promega. in a lysis buffer (Promega). Extracts were heated for 10 min at 65°C to abolish endogenous deacetylating activity. After re- moval of cellular debris, protein concentrations were deter- RESULTS mined by the BCA protein assay (Pierce). Chloramphenicol Analysis oftheXist Gene Promoter. The mouseXist gene has acetyltransferase (CAT) assays were carried out using 30-100 been cloned and sequenced by Brockdorff et al. (23), who jig of cell extracts and butyrylated chloramphenicol was localized three distinct cap sites (+ 1, -61, and -82), with the separated on a TLC plate. The results were normalized by the main cap site being designated as +1. Different clones were value of galactosidase activity measured from the cotrans- obtained from this group, one of them including 1 kb fected pSV/,B-gal and were adjusted to the protein concentra- upstream and downstream of the main cap site. Using a tion of the cell extracts. Pharmacia LKB A.L.F. sequencer and the mung bean exonu- Preparation of Nuclear Extracts. BALB/3T3 and BLK/ clease III deletion system (Stratagene), we sequenced 1.2 kb CL.4 cells from 10-cm dishes were used for each preparation. from the upstream part of clone 4844B. Computer analysis of Nuclear extracts were prepared as described by Dent and this region revealed a TATA-like sequence at -40 bp up- Latchman (25). Briefly, cells were harvested by scraping, stream of the -82 cap site. A consensus CCAAT element was washed in cold phosphate-buffered saline, and incubated in found at -105 to -101. Several DNA motifs potentially five cell vol of buffer A [10 mM Hepes, pH 7.9/1.5 mM recognized by trans-acting factors were present. First, two MgCl2/10 mM KCl/0.5 mM dithiothreitol (DTT)/0.5 mM bidirectional E2F-recognized consensus sequences were local- phenylmethylsulfonyl fluoride (PMSF)] for 10 min at 4°C. ized from -206 to -197. The E2F transcription factor is Cells were collected by microcentrifugation, resuspended in 3 known to activate the c-myc protooncogene and other genes vol of buffer A, and homogenized after addition of Nonidet implicated in cell division. Second, an AP1 recognition site was P-40. The crude nuclei released were collected by microcen- present at -147. The AP1 transcription factor is known to trifugation and resuspended in 1 ml of buffer C [5 mM Hepes, stimulate many genes via phorbol esters. pH 7.9/26% (vol/vol) glycerol/1.5 mM MgCl2/0.2 mM Identification of the Upstream Regulatory Region of the EDTA/0.5 mM DTT/0.5 mM PMSF]. NaCl was added to a MouseXist Gene. The sex of several mouse fibroblast cell lines final concentration of 300 mM. Nuclei were incubated at 4°C was determined by PCR with primers specific to the Y for 30 min and clarified by microcentrifugation for 20 min. chromosome-linked Zfy gene and then Xist expression was Nuclear extracts were frozen on dry ice and stored at -70°C. examined in all cell lines by reverse transcription PCR. Sub- DNA Mobility-Shift Assay. Double-stranded oligonucleo- sequently, all experiments were performed with Xist express- tide probes and competitors were prepared by annealing ing XX BALB/3T3 and XYXist-negative BLK/CL.4 cell lines. complementary single-stranded oligonucleotides in a heating A region of the mouse promoter from -1157 to +917 was block. Probes were gel purified and end-labeled with [a-32p]- cloned into the eukaryotic expression vector pCAT/Basic and dCTP and the Klenow fragment. Typical mixtures (20 ,ul) for transiently transfected into XX and XY cell lines. As shown in in vitro binding reactions contained 1 ,g of poly(dI-dC), lx Fig. 2A, basal transcriptional activity, measured by CAT binding buffer (20 mM Hepes, pH 7.8/50 mM NaCl/1 mM assays, was higher for the mouse promoter in comparison to MgCl2/0.5 mM EDTA/0.5 mM 2-mercaptoethanol), 2-5 Ag of the promoterless vector pCAT/Basic. CAT activity was nor- cell nuclear extract protein, and 2 x 10-2 pmol of the 32p- malized to the protein content of the transfected cell extract labeled probe. The different probes used are described in Fig. and to the activity of the ,3-galactosidase expressed from 1. Reaction mixtures were incubated for 20 min on ice and cotransfected pSV/3-Gal reporter gene. analyzed by electrophoresis on a 4-6% native polyacrylamide The -82 to -1 Upstream Region of the Xist Gene Is gel at 4°C and 200 V for 2-3 h in 1 x Tris acetate/EDTA buffer Sufficient to Confer in Vitro Promoter Activity. To determine (TAE). Competition reactions were performed by adding 5-20 the minimal promoter, we created 5' and 3' deletion mutants

-107 -97 -87 -77 -67 mouse GTCCAATAAG ATGTCAGAAT TGCAATCTTT GTGGCCACTC CTCTTCTGGT-

-57 -47 -37 -27 -17 mouse CTCTCCGCCT TCAGCGCCGC GGATCAGTTA AAGGCGTGCA ACGGCTTGCT human CCT TCAGTTCTTA AAGCGCTGCA ATTCGCTGCT

-7 4 14 24 mouse CCAGCCATGT TTGCTCGTTT CCCGTGGATG TGCGGTTCTT human GCAGCCATAT TTCTTACTCT CTCGGGGCTG GAAGCTTCCT

GMSA1 (-41/-15) ccgcggatcagttaaaggcgtgcaacg GMSA2 ccgcggatcagttaaaggcgCATGGcg GMSA3 ccgcggatcagCCGGGAgcgtgcaacg GMSA4 (-25/-i) ggcgtgcaacggcttgctccagcca GMSA6 (-82/-33) tctttgtggccactcctcttctggtctctccgccttcagcgccgcggatc GMSA7 (-87/-58) tgcaatctttgtggccactcctcttctggt GMSA8 (-67/-36) ctcttctggtctctccgccttcagcgccgcgg TBP consensus sequence gcagagcatataaggtgaggtagga Heterologous sequence gcagtgaagcagggtgccgcccaagatcctggg FIG. 1. Sequence homology between mouse and humanXist promoter and sequence of the oligonucleotides used in electrophoretic mobility-shift assays (EMSAs). Downloaded by guest on September 30, 2021 Genetics: Pillet et al. Proc. Natl. Acad. Sci. USA 92 (1995) 12517

III |E1 pCAT/-1 lS7,+917_ pCAT/BasEi i i Il 0.00 0.20 0.40 0.60 0.80 1.00 CAT activity

'~ ~I ~ i ~ ~~pCAT/-1083,+20 i [M BLK/CL4 _ ~~~~~1 4- 0 BALEV3T3 X-C pCA3l/487,+20 -r_ N- pCAT/-6,+20

t pCAT/-441.+20

pCAT/-231.+20

pCATI/-182,+20

pCATr/-132,+20

CA CAT/42,+20 i i I i i i I

0.00 0.30 1.00 1.50 2.00 2.50 3.00 3.50 CAT activity

C = ~-EIA pCAT/-231,+20

I .. I.....R ..,. I t - pCAT/-231.-I II F~]pCAT/-231.,41 1 . .i. I 4 0.00 0.20 0.40 0.60 0.80 1.00 CAT activity

D Ir pCAT/-231,+20 (WT)

pCAT/-231,+20

|CAT | pCAT/Basic

_iI I t _ I 0.00 0.20 0.40 0.60 0.80 1.00 CAT activity

FIG. 2. (A) Promoter activity of the - 1159 to +917 Xist region studied by CAT assay. Both XX and XY cell lines were transfected with the large -1157 to +917 CAT construct. The same promoter activity was measured in XX and XY cell lines. (B) A silencer, located from -441 to -291, seems to repress the promoter activity in XX and XY cell lines. XX and XY cell lines were transfected with 5' deletion mutants from - 1038 to -82. These different deletions do not affect promoter activity except for the 210-bp deletion from -441 to -231, which results in an increase in promoter activity. (C) The -41 to - 1 element of the Xist promoter is necessary for transcriptional activity in XX as well as XY cell lines. XX and XY cell lines were transfected with three deletion mutants from +20 to -41. Deletion from - 1 to the Sac II site abolished all promoter activity in both cell types. (D) Mutation of the -30 to -25 TTAAAG sequence in the -231 to +20 region abolishes nearly all promoter activity. Mutation of the -30 to -25 TTAAAG into CCGGGA was produced in the -231 to +20 CAT construct and promoter activity was tested by CAT assay in XX and XY cell lines. In both cell lines, CAT activity was decreased. WT, wild type; MT, mutated construct.

from a -1157 to +20 subclone pCAT construct and BALB/ that removing nucleotides +20 to -1 caused little change in 3T3 and BLK/CL.4 cells were transiently transfected with activity. However, deleting nucleotides from -1 to the Sac II these constructs. Deletions from -1083 to -441 did not have site at position -41 abolished all promoter activity (Fig. 2C). any significant influence on the activity of the promoter. Characterization of the -41 to -1 Element. We then However, removing 210 nucleotides from -441 to -231 focused on the characterization of the region from -41 to -1. resulted in a 2- to 3-fold increase in promoter activity, sug- Comparison of the 40-bp DNA sequence with other known gesting the presence of a silencer element in this region. regulatory elements did not reveal any homology. Two oligo- Deleting 148 bp from -231 to -83 did not significantly change nucleotides were synthesized for EMSAs in order to investigate the promoter activity (Fig. 2B). We observed from 3' deletions sequence-specific interactions of nuclear transcription factors Downloaded by guest on September 30, 2021 12518 Genetics: Pillet et aL Proc. Natl. Acad. Sci. USA 92 (1995) with the -41 to -1 DNA sequence. Incubation of the radio- binding site and that this cis element was necessary to Xist labeled oligonucleotide called GMSA1 (-41 to -15) with promoter activity, we made a CAT construct mutated in the nuclear extracts prepared from BALB/3T3 and BLK/CL.4 -30 to -25 interval (TTAAAG -> CCGGGA) and trans- cells resulted in the formation of a DNA-protein complex with fected this construct into the XX and XY cells. Substitution of XX (Fig. 3A) and XY (data not shown) cell extracts. The the TTAAAG in the -231 to +20 sequence abolished nearly specificity of this complex formation was shown by competition all promoter activity when tested by CAT assays (Fig. 2D). We experiments with unlabeled homologous and nonspecific het- further tested a putative enhancer activity of GMSA1 by erologous oligonucleotides. These data suggest that the DNA subcloning it in front of the -231 to +20 Xist promoter in a binding protein is expressed in a constitutive manner. We did CAT construction. We observed no increase of CAT activity not observe any band shift when we used an oligonucleotide in either XX or XY cell lines (data not shown). If a TATA box were present in the sequence, it alone might from -25 to -1 (GMSA4) (data not shown). serve as a promoter. To test this idea, we subcloned GMSA1 Mutants were designed concentrating on those regions in into the eukaryotic expression vector pCAT/Basic, but we the -41 to -15 interval that were the same in both the mouse observed no induced CAT activity (data not shown). These and the human. As shown in Fig. 3A, the mutant oligonucle- results suggest that the -41 to -15 GMSA1 element is otide GMSA2 containing a 5-bp substitution (TGCAA -- necessary but not sufficient for transcriptional activity. CATGG) at the 3' extremity did not influence protein-DNA The -30 to -25 TTAAAG Sequence Is Not Recognized by complex formation. In contrast, the 6-bp substitution (TTA- TBP. According to its A+T-rich sequence and its localization, AAG -- CCGGGA) in the core element abolished the binding the TTAAAG binding site could be a TATA-like box recog- (GMSA3). To confirm that the TTAAAG sequence was the nized by TBP. In an EMSA in which the unlabeled TBP consensus sequence was used, we observed no inhibition of DNA-protein complex formation between the 27-bp oligonu- 4 \() 7 cleotide sequence of GMSA1 and the nuclear transcription factor (Fig. 3A). Absence of competition was also observed when the unlabeled GMSA1 was used as competitor in a binding reaction with TBP consensus sequence as radiolabeled probe (Fig. 3B). Incubation of radiolabeled GMSA1 with purified TBP (Promega) resulted in formation of a nonspecific DNA-protein complex that did not comigrate with the specific complex formed by purified TBP and radiolabeled TBP consensus sequence. In competition experiments using the radiolabeled TBP consensus sequence, we observed that unlabeled GMSA1 competed less efficiently than unlabeled TBP consensus sequence. These data suggest that the TTAAAG sequence can be recognized by a TBP but has a higher affinity for another yet unknown protein. Is There a Regulatory Element Present Between -82 and -42 That Interacts with the -41 to -15 Region to Produce Promoter Activity? We have just shown that the -41 to -15 element was necessary but not sufficient for promoter activity and that the downstream -15 to -1 element did not bind any ...A nuclear factor. We therefore studied the upstream -82 to -42 region by EMSA to determine whether this region contained sites that bound any nuclear proteins. Incubation of radiolabeled oligonucleotide GMSA6, encompassing the -82 to -33 element, with nuclear extracts resulted in formation of a specific DNA-protein complex. The same specific complex was strongly formed with the -87 to -58 GMSA7 oligonucleotide and only weakly with the -67 to -36 GMSA8 oligonucleotide. These results, together with the strong competition with the heterologous nonspecific competitor containing a CT element, suggest that the C+T-rich sequence located from -70 to -58 is also responsible for protein binding (data not shown).

DISCUSSION Identification of the Xist gene (23, 24) has given the field of X chromosome inactivation research a considerable boost. How- ever, the very unusual nature of the locus has raised many questions. Nevertheless, analysis of Xist could provide signif- FIG. 3. (A) EMSAs were performed using radiolabeled GMSA1 icant insights into the mechanism of X inactivation. Isolation oligonucleotide without (lane 1) and with (lane 2) nuclear extract of and characterization of cis and/or trans factors involved inXist XX cell lines. Competition reaction mixtures contained homologous regulation may reveal key elements in the control of X unlabeled GMSA1 (lane 3), heterologous nonspecific competitor (lane chromosome inactivation and possibly in the mechanism that 6), unlabeled GMSA2 (lane 4), GMSA3 (lane 5), and unlabeled TBP X are to remain consensus sequence (lane 7). (B) EMSAs were performed using determines how many chromosomes active. radiolabeled TBP consensus sequence without (lane 1) and with (lane As a prerequisite to the analysis o'f the promoter region, we 2) nuclear extract of XX cell lines. Competition reaction mixtures sequenced the 1.2-kb upstream region of the mouse Xist gene. contained unlabeled GMSA1 (lane 5), heterologous nonspecific com- Computer analysis revealed a TATA-like sequence at "40 bp petitor (lane 4), and unlabeled TBP consensus sequence (lane 3). upstream ofthe -82 cap site and a consensus CCAAT element Downloaded by guest on September 30, 2021 Genetics: Pillet et al. Proc. Natl. Acad. Sci. USA 92 (1995) 12519

at -105 to -101 (major initiation start site, + 1). Consensus using transient transfection of the CAT reporter gene. On the sequences recognized by the bidirectional trans-acting factors silent Xist allele, the fully methylated promoter may be packed E2F were localized from -206 to -197 and an AP1 recogni- with a methylated DNA binding protein, thus preventing tion site was present at -147. Using a series of CAT reporter interaction of transcription factors. constructs, we have localized the minimal promoter allowing murine expression in XX and XY cell lines to a region We thank Dr. S. Rastan for having kindly provided the Xist clones upstream of the major initiation start site and extending from and Dr. C. H. Sibley for her comments. This work was supported by -82 to -1. Analyzing this region further allowed determina- Grant 32-32323.91 from the Swiss National Science Foundation. tion of a major cis-acting regulatory element located at -41 to -1. This region is poorly conserved between mouse and 1. Lyon, M. F. (1961) Nature (London) 190, 373-374. human except for an identical hexamer TTAAAG at -30 to 2. Gartler, S. M. & Riggs, A. D. (1983) Annu. Rev. Genet. 17, 155-190. 3. Rastan, S. & Brown, S. D. M. (1990) Genet. Res. 56, 99-106. -25. EMSAs have shown that region -41 to -15 binds a 4. Rastan, S. (1983) J. Embryol. Exp. Morphol. 78, 1-22. protein complex. To determine more precisely whether this 5. Rastan, S. & Robertson, E. J. (1985) J. Embryol. Exp. Morphol. hexamer is the site of binding, a mutated construct in which all 90, 379-388. bases of the hexamer were changed was used. Indeed, muta- 6. Norris, D. P., Brockdorff, N. & Rastan, S. (1991) Mamm. Genome tions of this region abolish protein binding as seen by EMSA 1, 78-83. and decrease transcriptional activity by -60% in XY and 100% 7. Riggs, A. D. & Pfeiffer, G. D. (1992) Trends Genet. 8, 169-173. in XX cell lines. The TTAAAG cis element is unable to sustain 8. Hansen, R. S., Ellis, N. & Gartler, S. M. (1988) Mol. Cell. Biol. promoter activity on its own, suggesting that the upstream -82 8, 4692-4699. to -41 region also plays a role in the transcription activity of 9. Epstein, C. J., Smith, S., Travis, B. & Tucker, G. (1978) Nature Xist. In EMSAs with probes GMSA6, GMSA7, and GMSA8, (London) 274, 500-503. formation was observed on this 10. Kratzer, P. G. & Gartler, S. M. (1978) Nature (London) 274, specific DNA-protein complex 503-504. element. It is unknown at the present time exactly where this 11. Monk, M. & Kathuria, H. (1977) Nature (London) 270,599-601. factor binds and whether it interacts with the factor bound to 12. Monk, M. & Harper, M. I. (1978) J. Embryol. Exp. Morphol. 46, the TTAAAG element in order to produce transcriptional 53-64. activity. 13. Takagi, N. (1974) Exp. Cell Res. 86, 127-135. Although it is possible that, based on its A+T-rich sequence 14. Takagi, N., Wake, N. & Sasaki, M. (1978) Cytogenet. Cell Genet. and localization, the TTAAAG binding site is a TATA-like 20, 240-248. box recognized by TBP, we think that another protein is 15. West, J. D., Freis, W. I., Chapman, V. M. & Papaioannou, V. E. involved. Indeed, the absence of any competition between (1977) Cell 12, 873-882. GMSA1 and TBP oligonucleotides in gel-shift assays with 16. Brown, C. J., Ballabio, A., Rupert, J. L., Lafreniere, R. G., nuclear extract together with the fact that in gel-shift assays Grompe, M., Tonlorenzi, R. & Willard, H. F. (1991) Nature (London) 349, 38-44. with purified TBP GMSA1 is unable to form a specific 17. Brockdorff, N., Ashworth, A., Kay, J. F., Cooper, P., Smith, S., DNA-protein complex with purified TBP supports this hy- McCabe, V. M., Norris, D. P., Penny, G. D., Patel, D. & Rastan, pothesis. S. (1991) Nature (London) 351, 329-331. It seems clear from the results obtained that a region located 18. Borsani, G., Tonlorenzi, R., Simmler, M. C., Dandolo, L., Ar- between -82 and -1 is implicated in transcription of mouse naud, D., Capra, V., Grompe, M., Pizzuti, A., Muzni, D., Xist. It is interesting to note that a region upstream of this Lawrence, C., Willard, H. F., Avner, P. & Ballabio, A. (1991) promoter element extending from -441 to -231 acts as a Nature (London) 351, 325-329. silencer or repressor element as shown by a decrease in CAT 19. Kay, J. F., Penny, G. D., Patel, D., Ashworth, A., Brockdorff, N. activity when this element was present in constructs. Further & Rastan, S. (1993) Cell 72, 171-182. analyses are needed in order to evaluate possible interactions 20. Kay, G. F., Barton, S. C., Surani, M. A. & Rastan, S. (1994) Cell 77, 639-650. between these two elements. 21. Norris, D. P., Patel, D., Kay, J. F., Penny, G. D., Brockdorff, N., Several studies have established that CpG methylation Sheardown, S. A. & Rastan, S. (1994) Cell 77, 41-51. within the promoter of different genes prevents their tran- 22. Brown, C. J. & Willard, H. F. (1994) Nature (London) 368, scription (26-34). However, relatively few transcription factors 154-156. contain the dinucleotide CpG in their recognition site. More- 23. Brockdorff, N., Ashworth, A., Kay, J. F., McCabe, V. M., Norris, over, not all the CpGs containing transcription factors are D. P., Cooper, P., Swift, S. & Rastan, S. (1992) Cell 71, 515-526. prevented from binding to their site when the C is methylated. 24. Brown, C. J., Hendrich, B. D., Rupert, J. L., Lafreniere, R. G., So far, the model, in which a methylated CpG at a crucial Xing, Y., Lawrence, J. & Willard, H. F. (1992) Cell 71, 527-542. position of the binding site is seen as a genetic mutation by the 25. Dent, C. L. & Latchman, D. S. (1993) Transcription Factors: A transcription factors, is not satisfying. It is more likely that a Practical Approach (Oxford Univ. Press, New York). factor binding to methyl CpGs is responsible for transcription 26. Razin, A. & Riggs, A. D. (1980) Science 210, 604-616. 27. Jones, P. A. & Taylor, S. M. (1980) Cell 20, 85-93. repression. Interestingly, Zuccotti and Monk (35) recently 28. Mohandas, T., Sparkes, R. S. & Shapiro, L. J. (1981) Science 211, reported that at least three CpG sites located within our 393-396. defined minimal promoter region enter the zygote in different 29. Venolia, L., Gartler, S. M., Wassman, E. R., Yen, P., Mohandas, T. methylation status: unmethylated when originating from the & Shapiro, L. J. (1982) Proc. Natl. Acad. Sci. USA 79, 2352-2354. paternal X chromosome and fully methylated when from the 30. Vardimon, L., Kressmann, A., Cedar, H., Maechler, M. & maternal X chromosome. Doerfler, W. (1982) Proc. Natl. Acad. Sci. USA 79, 1073-1077. Several years ago, Bird and colleagues (36-38) showed that 31. Stein, R., Razin, A. & Cedar, H. (1982) Proc. Natl. Acad. Sci. USA methylated DNA is bound by nuclear proteins such as MeCP-1, 79, 3418-3422. which prevents transcription factors from interacting with the 32. Busslinger, M., Hurst, J. & Flaveli, R. A. (1983) Cell 34, 197-206. gene. In somatic tissues, the silent Xist allele on the active X 33. Keshet, I., Yisraeli, J. & Cedar, H. (1985) Proc. Natl. Acad. Sci. at the dinucleotides USA 82, 2560-2564. chromosome is fully methylated (19) CpG 34. Yisraeli, J., Frank, D., Razin, A. & Cedra, H. (1988) Proc. Natl. within the immediate promoter and the first 1.5 kb of exon 1. Acad. Sci. USA 85, 4638-4642. the expressed Xist allele on the inactive X chromosome is 35. Zuccotti, M. & Monk, M. (1995) Nat. Genet. 9, 316-320. characterized by a complete lack of methylation in this region. 36. Meehan, R. R., Lewis, J. D., McKay, S., Kleiner, E. L. & Bird, The Xist promoter may therefore be regulated by methylation. A. P. (1989) Cell 5, 499-507. If this were the case, it would explain why the minimal -82 to 37. Boyes, J. & Bird, A. (1991) Cell 64, 1123-1134. -1 promoter showed no sex-specific expression in experiments 38. Boyes, J. & Bird, A. (1992) EMBO J. 11, 327-333. Downloaded by guest on September 30, 2021