Molecular Mechanisms of Nuclear Receptor COUP-TFII Action in the Regulation of Amhr2 and Identification of Additional Target Genes in MA-10 Leydig Cells

Molecular mechanisms of nuclear receptor COUP-TFII action in the regulation of Amhr2 and identification of additional target genes in MA-10 Leydig cells

Thèse

Samir Mehanovic

Doctorat en médecine moléculaire Philosophiæ doctor (Ph. D.)

Québec, Canada

Molecular mechanisms of nuclear receptor COUP-TFII action in the regulation of Amhr2 and identification of additional target genes in MA-10 Leydig cells

Thèse

Samir Mehanovic

Doctorat en médecine moléculaire

Philosophiae doctor (Ph.D.)

Sous la direction de :

Jacques J. Tremblay, directeur de recherche

Robert S. Viger, codirecteur de recherche

Résumé

On estime qu'environ 5 millions d'hommes américains souffrent de taux de testostérone réduits ou d'hypogonadisme. Chez les hommes, les cellules de Leydig sont les principales productrices de testostérone et d'insuline-like 3, deux hormones essentielles à la différenciation sexuelle masculine, aux fonctions reproductives et à la santé globale de l’homme. Les facteurs de transcription sont des protéines qui régulent la transcription des gènes en se liant à des séquences d'ADN spécifiques. Le facteur de transcription “chicken ovalbumin upstream promoter type 2” (COUP-TFII) est un facteur de transcription qui appartient à la superfamille des récepteurs nucléaires. Dans le testicule, COUP-TFII est exprimé dans les cellules se différenciant en cellules de Leydig adulte (ALCs) pleinement fonctionnelles et joue un rôle majeur dans leur différenciation et leur fonction. La synthèse des stéroïdes est réduite dans des cellules de Leydig appauvries en COUP-TFII, ce qui suggère que ce facteur joue un rôle important dans la stéroïdogenèse. Cependant, le mécanisme d'action de COUP-TFII dans les cellules de Leydig demeuraient largement méconnus.

Dans cette thèse, une analyse des données de puces à ADN de cellules MA-10 Leydig appauvries en COUP-TFII a été effectuée afin d’identifier le rôle global de ce facteur dans les cellules de Leydig. Cette étude a permis d’identifier 262 gènes différentiellement exprimés, notamment Hsd3b1, Cyp11a1, Prlr, Pdgfra, Shp, Ear1, Amhr2, Fdx1, Inha et Gsta3. De plus, l’étude du promoteur proximal d’Amhr2 par des études de gène rapporteur a permis de démontrer que COUP-TFII est recruté au promoteur proximal d’Amhr2 et coopère avec SP1 et GATA4 afin de réguler son expression. Les résultats présentés dans cette thèse fournissent une meilleure compréhension du mécanisme d'action de COUP-TFII dans les cellules de Leydig, et des preuves supplémentaires renforçant l'importance du récepteur nucléaire COUP-TFII dans la stéroïdogenèse, l'homéostasie androgénique, la défense cellulaire et la différenciation des cellules de Leydig.

Abstract

It is estimated that about 5 million American men have low testosterone levels, hypogonadism, and infertility problems. Leydig cells are the primary producers of testosterone and insulin-like 3 hormones in males, both essential for male sex differentiation, reproductive roles, and overall health. Transcription factors are proteins that bind to various DNA sequences to control DNA transcription. Chicken ovalbumin upstream promoter- transcription factors II (COUP-TFII) belongs to the steroid/thyroid hormone nuclear receptor superfamily of transcription factors. COUP-TFII is expressed in the cells that give rise to fully functional steroidogenic Adult Leydig cells in the testis and plays an important role in their function and differentiation. Steroid synthesis is reduced in COUP-TFII-depleted Leydig cells, suggesting that this protein plays a vital role in steroidogenesis. However, the mechanisms of action of COUP-TFII in Leydig cells were largely unknown.

The analysis of microarray data from COUP-TFII-depleted MA-10 Leydig cells identified 262 differentially expressed genes, including Hsd3b1, Cyp11a1, Prlr, Pdgfra, Shp, Ear1, Amhr2, Fdx1, Inha, and Gsta3. Anti-Müllerian hormone (AMH), which is expressed in Sertoli cells, is essential for the regression of the Müllerian ducts during male embryonic development. In Leydig cells, AMH signals through the anti-Müllerian hormone type II receptor (AMHR2). In male mammals, mutations affecting AMH or AMHR2 expression cause Persistent Müllerian Duct Syndrome (PMDS), characterized by infertility, inguinal hernias, cryptorchidism, and reduced serum testosterone levels. COUP-TFII was found to cooperate with specificity protein 1 (SP1) and GATA-binding factor 4 (GATA4) in the regulation of the Amhr2 promoter using reporter promoter assays.

COUP-TFII and GATA4 were found to be recruited to the same region of the Amhr2 gene via chromatin immunoprecipitation assay (ChIP), further strengthening their cooperative roles in the regulation of this gene. Furthermore, COUP-TFII and GATA4 were found to associate in the Leydig cells molecularly. The results presented in this thesis provide a better understanding of the mechanism of COUP-TFII action in Leydig cells, and additional evidence strengthening the importance of COUP-TFII in steroidogenesis, androgen homeostasis, cellular defense, and differentiation.

iii

Table of contents

Résumé ...... ii Abstract ...... iii Table of contents ...... iv List of figures ...... xi List of tables ...... xiii List of Abbreviations ...... xiv Summary of dissemination activities and awards ...... xvi Acknowledgments ...... xx Avant-propos ...... xxi General introduction ...... 1 0.1 Mammalian gonads and the development of the male reproductive system ...... 1 0.1.1 The bipotential gonad ...... 3 0.1.2 Male sex determination ...... 3 0.1.3 Sertoli cells ...... 3 0.1.4 Testis cord formation ...... 4 0.1.5 Interstitial compartment ...... 4 0.1.6 Leydig cells ...... 5 0.1.7 Fetal Leydig cells (FLCs) ...... 5 0.1.7.1 Origin and embryonic development ...... 5 0.1.7.2 Factors involved the regulation of FLC differentiation ...... 8 0.1.8 Adult Leydig cells (ALCs) ...... 10 0.1.8.1 Origins of ALCs ...... 11 0.1.8.2 Differentiation of ALCs ...... 11 0.1.8.2.1 Stem Leydig Cells (SLCs) ...... 12 0.1.8.2.2 Progenitor Leydig cells (PLCs) ...... 12 0.1.8.2.3 Immature Leydig cells (ILCs) ...... 13 0.1.8.2.4 Adult Leydig cells (ALCs) ...... 13 0.1.8.2.4.1 Available murine model Leydig cell lines ...... 13 0.1.8.3 Factors regulating adult Leydig cell differentiation ...... 15 0.1.8.3.1 Hippo signaling...... 15 0.1.8.3.2 Desert hedgehog (DHH) ...... 15 0.1.8.3.3 Platelet-derived growth factor (PDGF) ...... 16

0.1.8.3.4 Anti-Müllerian hormone (AMH) and its receptor in Leydig cell differentiation and function ...... 16 0.1.8.3.4.1 Regulation of the Leydig cell function by AMH/AMHR ...... 17 0.1.8.3.4.2 Expression of AMHR2 ...... 19 0.1.8.3.4.3 Regulation of Amhr2 promoter activity ...... 19 0.1.8.3.5 Hypothalamic-pituitary-gonadal (HPG) axis and LH ...... 21 0.1.8.3.6 Androgen receptor (AR) ...... 22 0.1.8.3.7 GATA4 ...... 22 0.1.9 Steroidogenesis in Leydig cells ...... 24 0.1.9.1 Sources of cholesterol for androgen synthesis...... 25 0.1.9.2 Activation of the steroidogenesis ...... 26 0.1.9.2.1 Classical LH-PKA signaling pathway ...... 26 0.1.9.2.2 Calcium-dependent regulation of steroidogenesis ...... 29 0.1.9.3 Repression of steroidogenesis in Leydig cells ...... 30 0.1.9.3.1 Phosphodiesterases (PDEs) and AMP-Activated Protein Kinase (AMPK) ...... 30 0.1.9.3.2 PKA-dependent repression ...... 31 0.1.9.3.3 β-arrestin and receptor internalization ...... 31 0.1.9.4 Other factors involved in the regulation of steroidogenesis ...... 32 0.2 Transcription factors ...... 33 0.2.1 Nuclear receptors ...... 34 0.2.2 A brief history of NR ...... 36 0.2.3 Homology of nuclear receptor domains ...... 36 0.2.3.1 A/B Domains: AF-1 ...... 37 0.2.3.2 C Domain: DNA-binding domain (DBD) ...... 37 0.2.3.3 D Domain: Hinge ...... 38 0.2.3.4 E Domain: Ligand binding domain (LBD) ...... 38 0.2.3.5 F Domain ...... 38 0.2.4 Classification of nuclear receptors ...... 39 0.2.5 Subclass 1 – Nuclear receptor 1 ...... 39 0.2.5.1 Subclass 2 – Nuclear receptor 2 ...... 40 0.2.5.2 Subclass 3 – Nuclear receptor 3 ...... 40 0.2.5.3 Subclass 4 – Nuclear receptor 4 ...... 40 0.2.5.4 Subclass 5 – Nuclear receptor 5 ...... 41 0.2.5.5 Subclass 6 – Nuclear receptor 6 ...... 41

0.2.5.6 Subclass 7 – Nuclear receptor 0 ...... 41 0.2.6 Classification of nuclear receptors based on their mechanism of action ...... 42 0.2.6.1 Type 1 Nuclear receptors ...... 43 0.2.6.2 Type 2 Nuclear receptors ...... 44 0.2.6.3 Type 3 Nuclear receptors ...... 44 0.2.6.4 Type 4 Nuclear receptors ...... 44 0.3 Identification of the chicken ovalbumin upstream promoter transcription factor (COUP-TF) family of transcription factors ...... 45 0.3.1 Expression patterns and roles of the members of the COUP-TF group ...... 46 0.3.1.1 COUP-TFI distribution ...... 46 0.3.1.2 COUP-TFII distribution ...... 47 0.3.1.2.1 Distribution in rodents ...... 48 0.3.1.5.1 Inactivation of COUP-TFII in mouse models ...... 50 0.3.1.5.2 Expression patterns in humans ...... 51 0.3.1.3 COUP-TFIII expression patterns ...... 53 0.3.2 Structure of COUP-TFII ...... 53 0.3.2.1 COUP-TFII A/B domain: AF-1 ...... 54 0.3.2.2 COUP-TFII C domain: DNA-binding domain (DBD) ...... 54 0.3.2.3 COUP-TFII D domain: Hinge ...... 56 0.3.2.4 COUP-TFII ligand-binding domain (LBD) ...... 56 0.3.2.5 COUP-TFII F domain ...... 57 0.3.2.5.1 Human COUP-TFII isoforms ...... 57 0.3.2.6 The modulators of the COUP-TFII activity ...... 58 0.3.2.7 Mechanism of DNA sequence recognition and binding by COUP-TFs ...... 61 0.3.2.7.1 COUP-TFII response elements ...... 61 0.3.2.7.2 COUP-TF-dependent transcriptional activation ...... 63 0.3.2.7.3 COUP-TF-mediated transcriptional repression ...... 64 0.3.3 Transcriptional, post-transcriptional, post-translational regulation of COUP-TFII ...... 64 0.4 Hypothesis and objectives ...... 66 1 Chapter 1. Identification of novel genes and pathways regulated by the orphan nuclear receptor COUP-TFII in mouse MA-10 Leydig cells ...... 67 1.1 Chapter introduction ...... 67 1.2 Résumé...... 69 1.3 Abstract ...... 70

1.4 Introduction ...... 71 1.5 Materials and methods ...... 73 1.5.1 Expression and reporter plasmids ...... 73 1.5.2 Cell culture ...... 73 1.5.3 siRNA-mediated depletion of COUP-TFII, RNA isolation, Microarray and RT-qPCR ...... 73 1.5.4 Microarray data processing ...... 74 1.5.5 Gene ontology and motif prediction ...... 75 1.5.6 Accession number ...... 75 1.5.7 Cell transfections and luciferase assays ...... 75 1.5.8 Western blots ...... 76 1.5.9 Statistical analyses ...... 76 1.6 Results ...... 77 1.6.1 Validation of siRNA-mediated reduction of COUP-TFII expression in MA-10 Leydig cells ...... 77 1.6.2 Microarray analysis ...... 77 1.6.3 Biological processes affected by COUP-TFII ...... 78 1.6.4 Validation of microarray results via qPCR ...... 79 1.6.5 Motif discovery ...... 80 1.6.6 COUP-TFII activates the mouse Gsta3 promoter ...... 80 1.7 Discussion ...... 82 1.7.1 COUP-TFII regulates transcription of multiple genes involved in Leydig cell steroidogenesis and HPG axis homeostasis ...... 82 1.7.2 COUP-TFII and Leydig cell proliferation and differentiation ...... 85 1.7.3 COUP-TFII, a dual regulator of steroidogenesis...... 85 1.8 Acknowledgments ...... 86 1.9 Conflict of interest ...... 86 1.10 Author contributions ...... 86 1.11 Data availability ...... 86 1.12 Funding ...... 86 1.13 Figures ...... 87 1.14 Tables ...... 92 1.15 References ...... 103 2 Chapter 2. The nuclear receptor COUP-TFII regulates Amhr2 gene transcription via a GC-rich promoter element in mouse Leydig cells ...... 109 2.1 Chapter introduction ...... 109

vii

2.2 Résumé...... 111 2.3 Abstract ...... 112 2.4 Introduction ...... 113 2.5 Materials and Methods ...... 115 2.5.1 Plasmids ...... 115 2.5.2 Cell Culture, Transfections, and Reporter Assays ...... 115 2.5.3 siRNA Transfection and RT-qPCR ...... 116 2.5.4 Protein Purification and Western Blots ...... 116 2.5.5 Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR) assay ...... 117 2.5.6 DNA Pull-down Assay ...... 118 2.5.7 Statistical Analyses ...... 118 2.6 Results ...... 119 2.6.1 COUP-TFII regulates Amhr2 gene transcription in Leydig cells ...... 119 2.6.2 COUP-TFII-dependent activation of the Amhr2 promoter does not require SF1 regulatory elements ...... 119 2.6.3 An intact GC-rich sequence is essential for COUP-TFII-dependent activation of the Amhr2 promoter ...... 120 2.6.4 COUP-TFII binds to the GC-rich sequence ...... 121 2.6.5 COUP-TFII cooperates with SP1 on the Amhr2 promoter ...... 122 2.7 Discussion ...... 124 2.7.1 Identification of COUP-TFII as new regulator of Amhr2 expression in Leydig cells ...... 124 2.7.2 Mechanisms of COUP-TFII action on the Amhr2 promoter ...... 125 2.8 Disclosure summary ...... 128 2.9 Funding ...... 128 2.10 Acknowledgments ...... 128 2.11 Data Availability ...... 128 2.12 Figures ...... 129 2.13 Tables ...... 141 2.14 References ...... 143 3 Chapter 3. COUP-TFII cooperates with GATA4 to regulate Amhr2 transcription in mouse MA-10 Leydig cells ...... 149 3.1 Chapter introduction ...... 149 3.2 Résumé...... 151 3.3 Abstract ...... 152

viii

3.4 Introduction ...... 153 3.5 Materials and methods ...... 155 3.5.1 Microarray data analyses ...... 155 3.5.2 Plasmids and luciferase promoter assays ...... 156 3.5.3 Chromatin immunoprecipitation (ChIP)-qPCR assay ...... 156 3.5.4 Co-immunoprecipitation (Co-IP) assays ...... 158 3.5.5 Statistical analyses ...... 159 3.6 Results ...... 160 3.6.1 Identification of genes commonly regulated by COUP-TFII and GATA4 ...... 160 3.6.2 COUP-TFII and GATA4 cooperate on the Amhr2 promoter in Leydig cells...... 161 3.6.3 A functional GC-box is essential for COUP-TFII and GATA4 cooperation ...... 161 3.6.4 GATA4 is recruited to the proximal region of the mouse Amhr2 promoter ...... 162 3.6.5 COUP-TFII and GATA4 interact in MA-10 Leydig cells ...... 163 3.6.6 COUP-TFII also cooperates with GATA6, but not with GATA1 or GATA3 ...... 163 3.7 Discussion ...... 164 3.7.1 COUP-TFII and GATA4: a novel partnership in Leydig cells ...... 164 3.8 Disclosure summary ...... 167 3.9 Funding ...... 167 3.10 Acknowledgments ...... 167 3.11 Figures ...... 168 3.12 Tables ...... 175 3.13 References ...... 179 4 Chapter 4 General discussion ...... 182 4.1 Implications of COUP-TFII-dependent activation of Amhr2 ...... 182 4.1.1 COUP-TFII activates the Amhr2 promoter specifically in Leydig cell lines and may require an interacting partner or a ligand ...... 182 4.1.2 Indirect regulation of Leydig cell function by COUP-TFII ...... 184 4.1.3 COUP-TFII regulation of AMH-dependent cancers ...... 186 4.2 A novel role for COUP-TFII, GATA4, and SP1 in the regulation of the mouse Amhr2 promoter ... 186 4.2.1 COUP-TFII binds to a GC-box region in vitro ...... 186 4.2.2 Proposed mechanism of COUP-TFII, GATA4, and SP1 action in the regulation of Amhr2 promoter activity in Leydig cells ...... 188 General conclusion...... 190 COUP-TFII in Leydig cells: a deeper understanding of its functions and molecular mechanisms of action 190

Future perspectives ...... 194 Testicular Dysgenesis Syndrome (TDS) ...... 194 References ...... 196 Appendix A ...... 234

List of figures

Figure 0.1 Human testis and mouse seminiferous tubules...... 2

Figure 0.2 Fetal and adult Leydig cell development and differentiation...... 7

Figure 0.3 Proposed AMH/AMHR2/ALK3 signaling pathway in Leydig cells...... 18

Figure 0.4 Schematic representation of the mouse Amhr2 promoter...... 20

Figure 0.5 Schematic representation of the hypothalamic-pituitary-gonadal (HPG) axis...... 21

Figure 0.6 Key steroidogenic steps involved in testosterone production...... 25

Figure 0.7 Schematic representation of classical LH-PKA steroidogenesis in Leydig cells...... 28

Figure 0.8 Schematic representation of the nuclear receptor domains...... 37

Figure 0.9 Schematic representation of four types of nuclear receptors based on mode of action...... 42

Figure 0.10 Amino acid comparison of members of the human COUP-TFs...... 47

Figure 0.11 Expression of COUP-TFII during mouse and human testes development...... 49

Figure 0.12 Organization of human COUP-TFII...... 55

Figure 1.1 COUP-TFII was depleted in MA-10 Leydig cells using small interfering RNA (siRNA)...... 87

Figure 1.2 Microarray analysis revealed differentially expressed genes in COUP-TFII-depleted MA-10 Leydig cells...... 88

Figure 1.3 Depletion of COUP-TFII in MA-10 Leydig cells affects genes involved in biological pathways related to steroidogenesis...... 89

Figure 1.5 COUP-TFII activates the mouse Amhr2 and Gsta3 promoters in MA-10 Leydig cells...... 91

Figure 2.1 COUP-TFII regulates mouse Amhr2 gene transcription in MA-10 Leydig cells...... 129

Figure 2.2 COUP-TFII does not require the SF1 elements to activate the Amhr2 promoter...... 131

Figure 2.3 The COUP-TFII responsive element is located within the proximal Amhr2 promoter region...... 132

Figure 2.4 COUP-TFII binds to the -67/-34 Amhr2 promoter region in vitro and is recruited to the proximal region of the gene...... 134

Figure 2.5 The AGGACA sequence within the -67/-34 region is not required for COUP-TFII binding and activation of the Amhr2 promoter...... 135

Figure 2.6 The COUP-TFII response element is located within -45 bp to -34 bp of the Amhr2 promoter...... 136

Figure 2.7 An intact GC-rich sequence is required for the COUP-TFII-mediated activation of the -67 bp Amhr2 promoter...... 137

Figure 2.8 COUP-TFII binds to the -67/-34 bp Amhr2 region...... 138

Figure 2.9 COUP-TFII and SP1 cooperate to activate the Amhr2 promoter...... 139

Figure 2.10 Proposed model for the COUP-TFII-dependent activation of the Amhr2 promoter in MA-10 Leydig cells...... 140

Figure 3.1 Data analysis reveal commonly regulated genes in GATA4- and in COUP-TFII-depleted MA-10 Leydig cells...... 168

Figure 3.2 COUP-TFII cooperates with GATA4 to activate the mouse -1486/+77 bp Amhr2 promoter...... 169

Figure 3.3 COUP-TFII cooperates with GATA4 to activate the mouse Amhr2 promoter in MA-10 Leydig cells but not in CV-1 fibroblasts cells...... 170

Figure 3.4 GATA4 is recruited to the proximal promoter region of the Amhr2 gene in MA-10 Leydig cells. ... 171

Figure 3.5 GATA4 and COUP-TFII interact in MA-10 Leydig cells...... 172

Figure 3.6 COUP-TFII cooperates with GATA4 and GATA6 but not with GATA1 and GATA3 on the Amhr2 promoter...... 173

Figure 4.1 Proposed model for the COUP-TFII/GATA4 regulation of the mouse Amhr2 promoter...... 189

Figure A1 COUP-TFII depletion in MA-10 Leydig cell line using CRISPR/Cas9 gene editing techniques...... 234

xii

List of tables

Table 0.1 Table of human nuclear receptors, gene name, and their ligands ...... 35

Table 0.2 COUP-TFII modulators ...... 59

Table 0.3 Partial list of genes regulated by COUP-TF showing sequences of the response elements...... 62

Table 1.1 Oligonucleotides used in this study...... 92

Table 1.2 Top 50 downregulated genes...... 94

Table 1.3 Top 20 impaired biological processes...... 95

Table 1.4 Enriched pathways from differentially expressed genes...... 96

Table 1.5 List of genes chosen for further validation ...... 99

Table 1.6 Results of the in silico promoter analyses...... 100

Table 2.1 Oligonucleotides used in this study...... 141

Table 3.1 Complete list of the differentially expressed genes in MA-10 cells depleted of COUP-TFII and GATA4...... 175

Table 3.2 The predicted GATA response element locations and sequences in -500/+50bp of the selected promoters...... 178

xiii

List of Abbreviations

ALCs Adult Leydig cells

AMHR2 Anti-Müllerian hormone receptor type 2

COUP-TFI Chicken ovalbumin promoter transcription factor I/NR2F1

COUP-TFII Chicken ovalbumin promoter transcription factor II/NR2F2

DBD DNA binding domain

DR Direct repeat

ChIP Chromatin immunoprecipitation assays

CV-1 Green monkey kidney fibroblast cell line

FLCs Fetal Leydig cells

FSH Follicle-stimulating hormone

GATA4 GATA Binding Protein 4

GnRH Gonadotropin releasing hormone

GSTA3 Glutathione S-transferase, alpha 3 hCG Human chorionic gonadotrophin

HRE Hormone response element

ILCs Immature Leydig cells

INSL3 insulin-like hormone 3

IR Inverted repeat

KO Knockout

LBD Ligand binding domain

LH Luteinizing hormone

LHCGR Luteinizing hormone/choriogonadotropin receptor

MA-10 Mouse MA-10 Leydig cell line

NR Nuclear receptors

NRE Nuclear response element

xiv

PLCs Progenitor Leydig cells

SF-1 Steroidogenic factor 1 siRNA Small interfering RNA

SLCs Stem Leydig cells

SP1 Specific protein 1

SRY Sex-determining region Y

STAR Steroidogenic acute regulatory protein

TF Transcription factor

Summary of dissemination activities and awards

Oral presentations:

Mehanovic S, Viger RS, Tremblay JJ, " Synergistic cooperation between nuclear receptor NR2F2 and GATA4 regulate expression of the mouse Amhr2 gene in MA-10 Leydig cells ", Réseau Québécois en reproduction, Québec, Canada, November 2019.

Mehanovic S, Mendoza-Villarroel R, Viger RS, Tremblay JJ, "Nuclear receptor COUP-TFII cooperates with GATA4 to regulate expression of the mouse Amhr2 and Star genes in MA- 10 Leydig cells", Journée annuelle de la recherche de CRDSI, Québec, Canada, May 2019

Mehanovic S, Mendoza-Villarroel R, Tremblay JJ, "The Nuclear Receptor COUP-TFII regulates Amhr2 Promoter in Mouse MA-10 and MLTC-1 Leydig Cells", Réseau Québécois en reproduction, St-Hyacinthe, Canada, November 2017.

Mehanovic S, Mendoza-Villarroel R, Tremblay J.J, "The Amhr2 Promoter is a Novel Target for the Nuclear Receptor COUP-TFII In Mouse Leydig Cells", Society for the Study of Reproduction, Washington DC., USA, June 2017 and Journées de la recherche CHU de Québec – Université Laval, Québec, Canada, May 2017 (oral presentation).

Poster presentations:

Mehanovic S, Mendoza-Villarroel R, Viger RS, Tremblay JJ, "Identifying Novel Targets for the Nuclear Receptor COUP-TFII in MA-10 Leydig Cells", Réseau Québécois en reproduction, Montréal, Canada, novembre 2018 et Journées de la recherche CHU de Québec - Université Laval, Québec, Canada, May 2019.

Mehanovic S, Mendoza-Villarroel R, Viger RS, Tremblay JJ, "A GC‐rich element is required for COUP‐TFII‐dependent activation of the Amhr2 promoter in mouse Leydig cells", Journée annuelle de la recherche de CRDSI, Québec, Canada, May 2018.

xvi

Publications:

Mehanovic, S., R. E. Mendoza-Villarroel, R. S. Viger and J. J. Tremblay (2019). "The Nuclear Receptor COUP-TFII Regulates Amhr2 Gene Transcription via a GC-Rich Promoter Element in Mouse Leydig Cells." J Endocr Soc 3(12): 2236-2257

Awards:

RQR, Best poster presentation (3rd place), 100 CAD, November 2018.

Département d’obstétrique, gynécologie et reproduction, Best poster presentation (1st place), 1250 CAD, May 2018.

CRDSI, Bourse À la poursuite de l’excellence, 2000 CAD, October 2017.

CRDSI Travel Award to attend SSR 2017, 500 CAD, June 2017.

RQR Travel Award to attend SSR 2017, 250 CAD, June 2017.

Society for the Study of Reproduction "Larry Ewing Memorial Trainee Travel Fund (LEMTTF) grant", 100 $, June 2017.

Fondation CHU de Quebec "Bourse de formation Desjardins pour la recherche et l'innovation", 15000 CAD, November 2016.

xvii

This thesis is dedicated to my son, the only human who is my teacher in life. You have made me stronger, better, determined in ways that I could have never imagined. Your dad “superhero” loves you to the moon and back and around the world. Volim te srce moje.

xviii

“Seek patience and passion in equal amounts. Patience alone will not build the temple. Passion alone will destroy walls.” ~Maya Angelou~

xix

Acknowledgments

I would like to thank my research director Dr. Jacques J. Tremblay, for providing this life- changing opportunity that helped me reach my most outstanding professional achievement. Without being hired in his laboratory, the work presented in this thesis would have never seen the light. Additionally, I would like to extend my thanks to my research co-director Dr. Robert S. Viger, who helped me expand the project and steer it into a fascinating new direction. I was fortunate to have two great advisors whose scientific knowledge and expertise helped shape my research skills and made me a better scientist.

Next, I thank my thesis committee members, Dr. Sylvie Breton, Dr. Claude Robert, and Dr. Alexandre Boyer, for their critical review of my work presented in this thesis.

Also, I would like to thank Francis Bergeron for helping me settle in the lab, having extensive discussions regarding this project, and reading my project proposal and this thesis. Next, I want to thank Dr. Janice L. Bailey for participating in my preliminary Ph.D. exam and the exit seminar.

I would like to take this opportunity to acknowledge Dr. Marit Nilsen-Hamilton, who was my previous major professor at Iowa State University and who inspired me to explore my curiosity in scientific research. Additionally, I would like to thank Dr. Judhajeet Ray for helping me troubleshoot some of the technical issues at the beginning of my Ph.D. study.

Also, many thanks to all previous and current colleagues, friends, and the department faculty for making my time at Laval University a wonderful experience. Finally, I want to thank my close and extended family, who believed in and helped me complete Ph.D. degree.

Avant-propos

This thesis is written in manuscript format, with three articles presented in Chapters 1-3. In 2019, the paper in Chapter 2 was published in the Journal of the Endocrine Society. The contributions of each author and the article status are noted at the beginning of each chapter (Chapter introduction). Dr. Jacques J. Tremblay and Dr. Robert S. Viger assisted in correcting those articles and making suggestions for the work in this thesis.

xxi

General introduction

Hormones are chemical signaling messengers that are generated by specialized cells and released into the bloodstream. The glands, such as the hypothalamus, pituitary gland, thyroid gland, parathyroid gland, pancreas, adrenal glands, pineal gland, and the sex-specific gonads (e.g., testis and ovaries) are responsible for hormone synthesis. Steroid hormones are produced by a process called steroidogenesis (described in section 0.1.9), and they can be classified as mineralocorticoids (e.g., aldosterone, corticosterone, and cortisol), glucocorticoids (e.g., corticosterone), androgens (e.g., testosterone, dihydrotestosterone, and androstenedione), and estrogens (e.g., estradiol), and progestins (e.g., progesterone) (reviewed in Holst et al., 2004). In male mammals, postnatal testosterone production is essential for the initiation and maintenance of spermatogenesis and the development of male secondary characteristics.

There is growing concern over the rapid decline in testosterone levels of the adult male population in Northern America (Lokeshwar et al., 2020; Travison et al., 2007; Vigen et al., 2013) and Europe (Andersson et al., 2007). Life-threatening diseases such as atherosclerosis, metabolic syndrome, and diabetes have been linked to testosterone deficiency and are more prevalent in sub-fertile males (Rezanezhad et al., 2019; Salam et al., 2012). Furthermore, improper concentrations of testosterone can have adverse effects, such as hypogonadism, depression, loss of muscle, and infertility (reviewed in Jia et al., 2015). Infertility affects about 50 % of couples in Canada, and about half of those are contributed to the male factor (reviewed in Chung and Brock, 2011).

0.1 Mammalian gonads and the development of the male reproductive system The mammalian testes serve two essential functions for adequate male reproductive health, and those are the production of sperm and androgens (Fig. 0.1A). The testes are two oval- shaped organs enclosed in an epidermal sac, called the scrotum, hanging outside of the male body. They are separated into compartments called the lobules, each made of seminiferous tubules (Fig. 0.1A). These lobules are surrounded by a fibrous envelope called tunica

albuginea. The sperm, produced in the seminiferous tubules, travels through the rete testes toward the head of the epididymis via ductus deferens. The sperm matures in the epididymis before ejaculation (Fig. 0.1A).

Figure 0.1 Human testis and mouse seminiferous tubules. (A) Diagram of the adult human testicle. Adapted from (https://basicmedicalkey.com/the-male-reproductive-system-2/). (B) The immunohistochemistry image is taken from adult mouse testis showing cross seminiferous tubules. Staining of Leydig cells (LC) was demonstrated using an anti-STAR antibody (brown staining). EC, endothelial cell; IT, interstitium; PTC, peritubular myoid cell; SC, Sertoli cell; BL, blood vessel; ST, seminiferous tubule. The image is reproduced with permission from (Martin, 2016) (License number 4882650465643).

The area between the seminiferous tubules, the interstitial region, contains androgen- producing cells called Leydig cells (Fig. 0.1B). Inadequate androgen synthesis during embryonic male development leads to defects in testicular descent into the scrotum. Undescended testes or cryptorchidism affect 1-3 % of newborns and leads to defects in spermatogenesis and infertility in adulthood (reviewed in Chung and Brock, 2011). The mammalian gonadal development is a highly complex process driven by the sex chromosomes. The presence of the Y chromosome initiates the development of the male reproductive system.

0.1.1 The bipotential gonad The first distinct morphological visible presence of the bipotential gonads occurs at embryonic day (E) 9.5 in mice and between gestational weeks (GW) 3 to 4 in humans. The bipotential gonads arise from within the urogenital ridge of the differentiating mesoderm, which is enveloped by the surrounding mesonephric tissue anterior to the mesonephric and paramesonephric ducts (reviewed in Makela et al., 2019; Svingen and Koopman, 2013). The formation of the gonads can be characterized as the final destination for migrating primordial germ cells (PGCs). At the bipotential gonadal stage, there is no morphological difference between XX and XY embryos.

0.1.2 Male sex determination In mice at E10.5, the bipotential gonad predetermined female fate is blocked when expression of the sex-determining region Y (Sry) gene (from Y chromosome) is driven by several key transcription factors, such as steroidogenic factor 1 (SF1, SF-1, also called Ad4BP, encoded by the Nr5a1 gene), GATA4, and Wilms' tumor 1 (WT1) (reviewed in Makela et al., 2019). In male mammals, expression of SRY results in the development of two unique gonadal compartments: testis cords and the interstitium. The testis cords eventually develop into the seminiferous tubules (Fig. 0.1). Sufficient levels of SRY are necessary to activate the critical downstream gene SRY-box transcription factor 9 (Sox9) that is responsible for the differentiation of Sertoli cells (reviewed in Koopman, 1999).

0.1.3 Sertoli cells Under the action of SRY, a group of cells located in the genital ridge gives rise to pre-Sertoli cells. It is well accepted that Sertoli cells are the first specified somatic cell type in the developing testis (reviewed in Makela et al., 2019). Sertoli cells serve as a physical barrier to protect gonocytes from retinoic acid-driven meiosis, and their aggregation around PGCs forms the cords (reviewed in Makela et al., 2019). The formation of Sertoli cells and their sufficient number is crucial for the maintenance of testis development and inhibition of the ovarian pathway (reviewed in Makela et al., 2019). Using single-cell RNA sequencing (siRNA-seq) techniques, researchers discovered that a uniform population of SF1-positive somatic progenitor cells gives rise to interstitial (Leydig) and supporting (Sertoli) cells in gonads (Stevant et al., 2018).

Sertoli cells produce all necessary factors involved in fetal Leydig cell differentiation, testis cord formation, germ cell differentiation, and Müllerian duct regression. Transcription factors SOX9, SRY, and SF1, regulate expression of doublesex and mad-3 related transcription factor 1 (Dmrt1) gene involved in the maintenance of Sertoli cell identity and along with fibroblast growth factor 9 (FGF9) suppression of the ovarian pathway (reviewed in Makela et al., 2019). More precisely, Sry starts a “feed-forward regulatory loop” between Sox9 and Fgf9 which diminishes transcription of wingless-related MMTV integration site 4 (Wnt4), a female promoting gene, under the influence of the upregulated FGF9. Furthermore, DMRT1 represses the transcription of an ovarian-driving transcription factor, forkhead box L2 (Foxl2), resulting in the repression of ovarian pathways (reviewed in Huang et al., 2017).

0.1.4 Testis cord formation The formation of testis cords is considered a defining event in testis differentiation (reviewed in Svingen and Koopman, 2013). The testis cords are unique tubular structures responsible for storing and nurturing germ cells. Migration of mesenchymal cell from the coelomic epithelium and Sertoli cells regulate the testis cord formation (reviewed in Makela et al., 2019). In mice, testis cord formation starts at E12 and is completed by E13.5 (reviewed in Makela et al., 2019).

Sertoli cell-produced growth factors, such as FGF9 and platelet-derived growth factor (PDGF), are implicated in testis cord formation (reviewed in Svingen and Koopman, 2013). The peritubular myoid cells (PMCs) and an extracellular matrix provide a protective barrier around the testis cords. Due to limited space and crowding, both cell types guide testis cord elongation and coiling (reviewed in Makela et al., 2019).

0.1.5 Interstitial compartment An immunohistological image of a cross-section of the mouse testis is shown in Figure 0.1B (Martin, 2016). The image shows the interstitial testicular space defined as the region between the seminiferous tubules (Fig. 0.1B, encircled in black ink). It is composed of macrophages, blood vessels, nerves, stem Leydig cells giving rise to fetal Leydig cells, peritubular myoid cells, fibroblasts, stem Leydig cells committed to the adult Leydig cell lineage, and pericytes (Fig. 0.1B) (Martin, 2016).

0.1.6 Leydig cells Leydig cells or interstitial cells were first reported in 1850 by a German zoologist Franz Von Leydig and named after him (Leydig, 1850). They were described as a group of cells surrounding the seminiferous tubules (Leydig, 1850). About 50 years later, two French scientists suggested that these cells produce chemicals essential for the development of the male secondary characteristics (Bouin and Ancel, 1903). In the 1950s, advances in biochemical analyses allowed the identification of a steroidogenic enzyme, hydroxy-delta-5- steroid dehydrogenase, 3 beta- and steroid delta-isomerase (HSD3B), in Leydig cells (Wattenberg, 1958). Currently, it is textbook knowledge that Leydig cells produce the insulin‐like 3 (INSL3) hormone as well as androgens (testosterone, dihydrotestosterone, and androstenedione). It is believed that INSL3 levels are more reliable than testosterone levels to assess the health status of the adult Leydig cell population (reviewed in Bay and Andersson, 2011).

There are two distinct testosterone-producing periods during mammalian male development, fetal and postnatal (Ye et al., 2017). Androgens produced during fetal development are necessary for masculinization of male embryos, induction of Wolffian duct differentiation, and the second phase of testicular descent. Postnatally, androgens are essential for sexual development, including facial and body hair growth, increased muscle development and genital growth, spermatogenesis, increased sweat and scent glands, and emotional and mental development. In mammals, two distinct Leydig cell populations, fetal Leydig cells (FLCs) and adult Leydig cells (ALCs), are found in the fetal and adult testis, respectively (Roosen- Runge and Anderson, 1959).

0.1.7 Fetal Leydig cells (FLCs) 0.1.7.1 Origin and embryonic development FLCs are necessary for the sex differentiation of the male fetus during embryonic development. In rodents, FLCs produce androstenedione (O'Shaughnessy et al., 2000), INSL3 (Agoulnik, 2007), inhibin and activin (Majdic et al., 1997). Androgens produced by FLCs are essential for differentiation of the Wolffian duct and the masculinization of neurons in the fetal brain. INSL3 regulates the first phase, the trans-abdominal phase, of testicular descent (reviewed in Ivell et al., 2014). Activin is necessary for testis cord formation and

Sertoli cell proliferation (Archambeault and Yao, 2010). In the mammalian testis, a dedicated cell population, fetal stem Leydig cells, give rise to functional FLCs (Fig. 0.2A). In mice, the differentiation process from the stem fetal Leydig cells to FLCs starts around embryonic day E12.5. This process is morphologically characterized by a change in shape from a unique spindle-shape morphology to a more rounded shape as the embryonic development progresses (Fig. 0.2A).

The origins of stem FLCs can be traced to adrenal-gonadal primordium, mesonephros, genital ridge, neural crest cells, and coelomic epithelium (reviewed in Griswold and Behringer, 2009). The main limitation to identifying their origins is the lack of FLC-specific markers. Some of the genes expressed in these progenitor cells can be used as potential genetic markers, including Sf1 (Stevant et al., 2018), chicken ovalbumin upstream promoter- transcription factor II (Coup-tfii, described in section 0.3) (Kilcoyne et al., 2014), Pdgfr1 (Brennan et al., 2003), Wt1 (Liu et al., 2016), Tcf21 (Shen et al., 2020) and Wnt5 (Ademi et al., 2020). Elegant cell tracing experiments show the existence of at least three WT1+ cell populations in the mouse gonad at E10.5 that give rise to Sertoli cells and FLCs (Liu et al., 2016). These cell populations can be grouped into HES1- pre-Sertoli cells, HES1+ interstitial progenitor cells, and HES1- interstitial progenitor cells (Liu et al., 2016). At E12.5, the expression of WT1 disappears in these cell populations that give rise to the interstitial progenitor pools. The inactivation of Wt1 in a mouse model results in Sertoli cells to FLCs transition between E14.5 and E15.5 (Zhang et al., 2015), suggesting that WT1 plays a crucial role in the establishment of the interstitial progenitor pool. In another cell lineage tracing study, the pool of progenitor cells giving rise to the majority of FLCs expresses Wnt5a from E11.5 (Ademi et al., 2020). Single-cell -omics technologies, such as single-cell RNA (scRNA-seq) and DNA (scDNA-seq) sequencing, are applied to provide more information regarding cell differentiation, the emergence of the cell lineages, and cell diversity in gonads (reviewed in Estermann and Smith, 2020). By use of transgenic mouse (Nr5a1-Gfp) models, results from the scRNA-seq experiment show that a multipotent homogeneous NR5A1+ cell population gives rise to pre-Sertoli cells and FLCs from E11.5 onward (Stevant et al., 2018). This finding refutes the idea of SCs to FLC transformation and the existence of three different cell populations giving rise to FLCs and SCs. The evidence from these studies suggests that the origins of stem FLCs remain to be fully understood.

Figure 0.2 Fetal and adult Leydig cell development and differentiation. (A) Differentiation of rodent fetal Leydig cells (FLC). (B) Differentiation of adult Leydig cells (ALCs). Embryonic (E) and postnatal (P) time course (days) in rats are indicated below the image. The image was adapted with permission from (Martin, 2016) (License number 4882650455643). Indicated are the proliferation factors, steroidogenic genes expressed, and transcription factors.

Even though FLCs express some steroidogenic cell markers (e.g., steroid 17-alpha- hydroxylase/17,20 lyase (CYP17A1), 3 beta-hydroxysteroid dehydrogenase/Delta 5-->4- isomerase type 1 (HSD3B1)), they are unable to synthesize testosterone because they lack the steroidogenic enzyme 17β-hydroxysteroid dehydrogenase type III (HSD17B3)

(O'Shaughnessy et al., 2000). HSD17B3 is responsible for the transformation of androstenedione to testosterone ((O'Shaughnessy et al., 2000) and reviewed in Griswold and Behringer, 2009). Androstenedione, produced by FLC, is secreted and taken up by the partner Sertoli cells, which express HSD17B1 (Hakkarainen et al., 2018) and HSD17B3 (O'Shaughnessy et al., 2000), and further process it into testosterone. More recent data show that the global inactivation of Hsd17b3 does not affect fertility and testosterone production in mice, suggesting an alternative mechanism driving steroidogenesis independent of this enzyme (Rebourcet et al., 2020). Peak intratesticular testosterone levels in the developing rodent testes are observed at E18 (O'Shaughnessy et al., 1998). Testosterone produced by the fetal testes regulates the second phase (the inguino-scrotal phase) of testicular descent into the scrotum, masculinization of the fetal embryo and brain, differentiation of the Wolffian duct, and development of the male genital tract (reviewed in Smith and Walker, 2014; Wen et al., 2016).

Some FLCs persist postnatally in the testis and can comprise up to 20% of the total Leydig cells (reviewed in Wen et al., 2016). In adult males, the contribution to overall testosterone production by FLCs is negligible compared to ALCs (reviewed in Wen et al., 2016).

0.1.7.2 Factors involved the regulation of FLC differentiation The differentiation process from the stem fetal Leydig cells to mature and functional FLCs is tightly regulated by several Sertoli cell-secreted factors (reviewed in Wen et al., 2011). Some of those are: cytokine KIT ligand (KITL) (Manova et al., 1990), anti-Müllerian hormone (AMH, described in section 0.1.8.3.4) (Rouiller-Fabre et al., 1998), desert hedgehog (DHH) (Yao et al., 2002), platelet-derived growth factor A (PDGFA) (Brennan et al., 2003) and microRNA miR-140-5p/140-3p (Rakoczy et al., 2013) (Fig. 0.2A).

The Hedgehog factors consist of three members: DHH, Sonic Hedgehog, and Indian Hedgehog. In mouse testis, Sertoli cells start secreting DHH at embryonic day E11.5 (Bitgood and McMahon, 1995) and continuous expression is detected in adults (reviewed in Ye et al., 2017). Inactivation of Dhh reduces the number of FLCs (Yao et al., 2002). DHH exerts its action via the Patch receptor (PTCH1) located on the membrane of Leydig cells,

which mediates its effects via a member of the Gli-Kruppel family of transcription factor, GLI1 ((Barsoum and Yao, 2011) and reviewed in Franco and Yao, 2012).

PDGF, produced by Sertoli cells, is a dimeric glycoprotein composed of either two A subunits (PDGFA), two B subunits (PDGFB), or one of each (PDGFAB) (Brennan et al., 2003). PDGF proteins exert their effects through platelet-derived growth factor receptor α or β (PDGFRA or PDGFRB), which are found in all LCs lineages (reviewed in Ye et al., 2017). In rodents, PDGFA and its receptor are essential for proper FLC differentiation (Brennan et al., 2003). Additionally, inactivation of the PDGFRA results in disruption of the vasculature and testis cord formation (Brennan et al., 2003).

It is worth mentioning species similarities and differences in the mechanism of action of two closely related hormones in FLC function, luteinizing hormone (LH) and human chorionic gonadotrophin (hCG). The anterior pituitary produces LH, and the placenta generates hCG. In humans, both hormones exert their actions via an identical transmembrane receptor called the lutropin-choriogonadotropic hormone receptor (LHCGR) (reviewed in Ascoli et al., 2002). In human fetal testis, the expression of LHCGR mRNA is detected at gestational week (GW) 11 (Fowler et al., 2009). LH levels in the human fetal testes remain relatively low during the first trimester (Fowler et al., 2009). Although the LH levels remain low, the expression of placental hCG is at an all-time high at GW11-13 and coincides with high fetal testosterone levels during the same period (Fowler et al., 2009). A decrease in hCG levels is observed past GW13 and positively correlates with fetal testosterone levels (Fowler et al., 2009). This is further supported by naturally occurring inactivating mutations of LH-B and LHCGR in human patients (reviewed in Latronico and Arnhold, 2012; Themmen and Huhtaniemi, 2000). Furthermore, the masculinization process of the human male embryos occurs normally in patients having defects in LHB (Valdes-Socin et al., 2004). However, the mutations disrupting LHCGR expression result in FLC hypoplasia, impairment of FLC function, and abnormal sex development (reviewed in Latronico and Arnhold, 2012). These observations suggest that the placental hCG regulates human FLCs function and differentiation.

Unlike humans, rodents do not produce placental hCG, and the development of FLCs and their function appears to be LH-independent (reviewed in Teerds and Huhtaniemi, 2015). In

rodents, evidence demonstrates that FLCs produce androgens at E13, and their function appears unaffected in the absence of circulating LH (O'Shaughnessy et al., 1998). In mice, the Lhb mRNA is detected at E16.5 (Japon et al., 1994). Furthermore, data from the mouse knockout models in either Lhb (Ma et al., 2004) or Lhcgr (Zhang et al., 2001) show normal masculinization at birth and proper FLCs differentiation and function. These studies suggest that functional LH and LHCGR are not required for the development of FLCs in mice (Ma et al., 2004; Zhang et al., 2004).

Transcription factors play crucial roles in FLC differentiation including SF1 (Luo et al., 1994) and GATA4 (Bielinska et al., 2007; Ketola et al., 1999; Viger et al., 1998). In mice, inactivation of Sf1 inhibits adrenal and gonadal development suggesting roles in forming the steroidogenic tissues (Luo et al., 1994). Although heterozygous Sf1(+/-) mice have an initial delay in expressing the steroidogenic enzymes, expression of those genes is restored (Park et al., 2005), suggesting involvement of one or more compensatory mechanisms. Inactivation of Gata4 in developing embryonic mouse testis results in failure of FLC development (Bielinska et al., 2007), while conditional knockout in early testis development (E10.5) leads to an inhibition of male gonad development and a reduction in the expression level of FLCs markers (Manuylov et al., 2011). Some of the other transcription factors involved in FLC differentiation and proliferation are GATA6 (Ketola et al., 1999), homeobox protein ARX (Miyabayashi et al., 2013), homeobox factor LHX9 (DeFalco et al., 2011; Miyabayashi et al., 2013), homeobox protein PBX1 (Schnabel et al., 2003), and WT1 (Wen et al., 2014).

0.1.8 Adult Leydig cells (ALCs) After birth and through adulthood, the ALCs produce androgens and INSL3. Unlike the FLCs, ALCs are fully capable of producing testosterone on their own. ALCs have epithelioid and polygonal cytological features. An eosinophilic shape characterizes their cytoplasm, and they have euchromatic round eccentric nuclei with the peripheral distribution. The human ALCs contain several cytoplasmic Reinke crystals (Kozina et al., 2011), which may negatively correlate to their diminishing steroidogenic capacity in sub-fertile males.

0.1.8.1 Origins of ALCs The origins of the progenitor cells giving rise to the ALC population can be traced to the undifferentiated spindle shape fibroblast-like mesenchymal cells, peritubular, fetal Leydig cells, and uncharacterized interstitial cells (reviewed in Mendis-Handagama and Ariyaratne, 2001; Svechnikov et al., 2010; Teerds and Huhtaniemi, 2015). Most of the current knowledge about the origins of the ALCs comes from the use of mouse models. More recently, sophisticated methods, such as scRNAseq and cell lineage tracing, allow us to better understand the origin of these cells. Initially, it was believed that the fetal enhancer region found in the Sf1 gene stimulates gene expression in FLCs and not ALCs (Shima et al., 2012). However, inactivation of this region results in complete loss of FLCs and ALCs (Shima et al., 2018), suggesting that FLCs could be the primary source of ALC lineages or that FLCs and ALCs share a common unidentified precursor. It has also been proposed that some fully functional FLCs can dedifferentiate postnatally and may serve as a cell lineage for ALCs (Shima et al., 2018). Like for the development of FLCs, the interstitial WT1+/HES+ cell population found at E10.5 gives rise to the non-steroidogenic interstitial cell pool, which postnatally differentiates into ALCs (Liu et al., 2016). This cell population expresses GLI1+ at E12.5 under the influence of DHH (Liu et al., 2016). Results from scRNAseq analyses suggest that the majority of ALCs originate from Wnt5a+ progenitors (Ademi et al., 2020). In another study, results from cell lineage tracing show that over half the ALCs originate from Nestin+ perivascular cells, such as vascular smooth muscle and pericytes (Kumar and DeFalco, 2018). This pool of progenitor cells appears to be tightly regulated by NOTCH- maintained crosstalk between epithelial cells and the vasculature (Kumar and DeFalco, 2018).

0.1.8.2 Differentiation of ALCs In mammals, the ALC-committed population undergoes three to four transformation steps in a time-dependent manner to complete the process (Fig. 0.2B). The ALC-committed interstitial cells are referred to as stem Leydig cells (SLCs). The differentiation of SLCs into ALCs is quite a unique process, where the cells undergo distinct stages characterized by the expression of different transcription factors, steroidogenic enzymes and their products, and cellular shapes.

0.1.8.2.1 Stem Leydig Cells (SLCs) SLCs are characterized by spindle-shaped fibroblasts look-like morphology, having few mitochondria and no lipid droplets (Shan et al., 1993). These cells express Leydig cell markers, such as Nestin (Davidoff et al., 2004), PDGFRα (Ge et al., 2006) and Notch (Stanley et al., 2011). Although SLCs have no steroidogenic activity per se, they do express key transcription factors involved in the regulation of steroidogenesis, such as GATA4, COUP- TFII, and the androgen receptor (AR) (reviewed in Martin, 2016).

0.1.8.2.2 Progenitor Leydig cells (PLCs) The next transformational stage from the SLC pool is their differentiation into progenitor Leydig cells (PLC) (Fig. 0.2B). In rodents, steroidogenically active PLCs are detected between postnatal day P14 to P21, and their main steroidogenic product is androsterone (Ge and Hardy, 1998). The differentiation of SLCs into PLCs is regulated by DHH, fibroblast growth factor type 2 (FGF2), epidermal growth factor (EGF), and PDGFα (reviewed in Martin, 2016; Teerds and Huhtaniemi, 2015). Additionally, prolactin (PRL) (Dombrowicz et al., 1992), LH (Guo et al., 2013), and AMH (Racine et al., 1998) are responsible for the development of PLCs. Unlike SLCs, PLCs produce key steroidogenic enzymes/proteins (STAR, CYP11A1, CYP17A1, and HSD3B1) and LHCGR (reviewed in Teerds and Huhtaniemi, 2015) (Fig. 0.2B). Even though these cells express some of the steroidogenic enzymes and proteins, PLCs cannot produce testosterone due to lack of HSD17B3 (Ge and Hardy, 1998).

Interestingly, in primates, including humans, an additional Leydig cell transformational stage occurs postnatally between 0 to 1 year of age (reviewed in Kurtoglu and Bastug, 2014). The SLCs differentiate into neonatal Leydig cells (NLCs), which are responsible for testosterone production right after birth during the so-called “mini-puberty” period ((Forest et al., 1973) and reviewed in Kurtoglu and Bastug, 2014). Numerous studies suggest that the testosterone peak observed postnatally is responsible for imprinting various cell types in the kidneys and prostate (reviewed in Svechnikov et al., 2010), and genital organ development, and spermatogenesis (reviewed in Becker and Hesse, 2020). Furthermore, this mini-puberty is necessary for proper masculinization of the brain leading to sexual orientation and development of male cognitive functions (reviewed in Kurtoglu and Bastug, 2014). Defects

in the postnatal testosterone surge may be linked to a higher incidence of autism during early infancy (reviewed in Becker and Hesse, 2020).

0.1.8.2.3 Immature Leydig cells (ILCs) In rodents, PLCs undergo several proliferation cycles before being characterized as immature Leydig cells (ILCs) (reviewed in Teerds and Huhtaniemi, 2015). ILCs are detected in rodents postnatally between P28 and P56 (Fig. 0.2B). These cells transform from spindle shape to round shape and contain more lipid droplets (which serve as cholesterol storage) (Shan et al., 1993) (Fig. 0.2B). Since ILCs produce higher levels of CYP11A1, HSD3B1, and CYP17A1, they are steroidogenically more active than PLCs, and their main product is androstanediol and other 5-reduced androgens (Ge and Hardy, 1998). These cells express low levels of HSD17B3 and can therefore only produce limited amount of testosterone (Ge and Hardy, 1998). Their proliferative capabilities are limited to one cycle before they differentiate into ALCs (reviewed in Ye et al., 2017).

0.1.8.2.4 Adult Leydig cells (ALCs) The final step in the transformational process occurs between ILCs into fully functional mature testosterone-producing ALCs and is regulated by LH and insulin-like growth factor 1 (IGF-1) (Fig. 0.2B). At this time point in mammals, maximum Leydig cell testosterone production is reached (Ye et al., 2017). In rodents, ALCs are detected around P49-56. They produce high levels of steroidogenic enzymes (e.g., CYP11A1, HSD3B1, CYPA17A1, and HSD17B3). Mature ALCs are characterized by a round shape, a large nucleus, numerous mitochondria, and lipid droplets (Fig. 0. 2B) (Shan et al., 1993).

0.1.8.2.4.1 Available murine model Leydig cell lines There is no reliable human Leydig cell line available for research purposes. However, several murine Leydig cell lines are widely used and well-accepted as representative models for the study of Leydig cell regulation and function, including MA-10, R2C, MLTC-1, TM3, BLTK1 (reviewed in Engeli et al., 2018; Zirkin and Papadopoulos, 2018). These immortalized cell lines offer low-cost alternatives to primary Leydig cells and the use of animal models. Model Leydig cell lines, MA-10 and MLTC-1, originated from a mouse Leydig cell tumor. The MA-10 Leydig cell line was immortalized in 1980 (Ascoli, 1981) and

MLTC-1 in 1982 (Rebois, 1982). Both cell lines, MA-10 and MLTC-1, respond to stimulation by LH, hCG, forskolin (FSK), and cAMP to induce steroidogenesis and produce steroid hormones (MA-10; progesterone, MLTC1; testosterone).

The MA-10 Leydig cell line is most extensively used, and crucial in understanding numerous aspects of Leydig cell function. Since MA-10 cells express high levels of 5α-reductase, which is only present in immature Leydig cells of the adult population, they are considered ILCs. Despite its wide use, there are significant differences between MA-10 cells and normal Leydig cells. One of the most important differences is that this cell line does not produce the functional steroidogenic enzyme CYP17A1, which is essential for the subsequent conversion of progesterone into testosterone (Ascoli, 1981). Thus, the main steroid produced by the MA- 10 cell line is progesterone (Ascoli, 1981; Engeli et al., 2018). Due to this defect, the MA-10 cells are an adequate cell model to study the mechanisms in the early steps of steroidogenesis. Another difference of this cell line compared to the wild type is the expression of the LHCGR. Initially, the MA-10 cell line produced LHCGR at comparable levels to the wild type (Ascoli, 1981). However, over a decade later, the LHCGR levels were dramatically reduced and barely detectable (reviewed in Ascoli, 2007; Hirakawa et al., 2002). Additionally, the morphology and proliferation rate of these cells changed as well (reviewed in Ascoli, 2007; Hirakawa et al., 2002). Hirakawa et al. speculated that these changes might be due to endocrine disruptors present in the culture serum and the coating used on the tissue culture plasticware (Hirakawa et al., 2002). The loss of LHCGR by the MA-10 cells is an excellent example of how vulnerable these cells are to environmental contaminants, indicating that further research into their function is warranted. When MA-10 cells are cultured on the gelatin-coated dishes, the issues with morphology and proliferation are reversed (Hirakawa et al., 2002). However, it did not increase LHCGR levels (Hirakawa et al., 2002). To overcome this limitation, successful attempts were performed by transiently transfecting MA-10 cells with the human LHCGR expression vectors (Hirakawa et al., 2002). The progesterone production of these transfected cells increased by about 20-fold when stimulated by hCG (Hirakawa et al., 2002). Upon stimulation by FSK and cAMP, MA-10 cells respond and produce progesterone and 17OH-progesterone (Engeli et al., 2018). These two chemicals provide an alternative method to overcome the defect in the signaling via LHCGR and stimulation of steroidogenesis.

0.1.8.3 Factors regulating adult Leydig cell differentiation Many signaling factors that regulate the FLC differentiation are also crucial for the ALCs. These include paracrine molecules, endocrine hormones, and transcription factors, such as IGF1, thyroid hormone, leukemia inhibitory factor (LIF), KIT and its ligand, transforming growth factor-beta, DHH, AMH, LH, PDGF, fibroblast growth factor 2 (FGF2), Hippo signaling, LH, androgen receptor (AR), NUR77, SF1, and GATA4 (reviewed in Martin, 2016; Martin and Tremblay, 2010; Teerds and Huhtaniemi, 2015; Tremblay, 2015). The PLCs and ILCs express IGF1 and its receptor, and IGF1 is implicated in the regulation of Leydig cell differentiation (Hu et al., 2010). In the mouse ALCs, thyroid hormone stimulates steroidogenesis by regulating the expression of Star and Lhcgr (Manna et al., 2001). A cytokine LIF and its receptor are required for the ALCs differentiation (Mauduit et al., 2001). KIT and its ligand are implicated in steroidogenesis (Rothschild et al., 2003) and SLCs proliferation (Liu et al., 2017). TGF1, secreted by Sertoli cells, affects the proliferation of SLCs (Li et al., 2016) and PLCs (Khan et al., 1992) and inhibits steroidogenesis (Lin et al., 1987; Park et al., 2014). All Leydig cell lineages express Fgf2 (Ge et al., 2005), a member of the heparin-binding growth family, and it stimulates the proliferation of SLCs (Li et al., 2016).

0.1.8.3.1 Hippo signaling During embryonic and postnatal development, the Hippo signaling pathway plays a vital role in cell fate determination, differentiation, and proliferation (reviewed in Piccolo et al., 2014). Yes-associated protein (YAP) and WW-containing transcription regulator 1 (WWTR1, also known as TAZ) are downstream components of the Hippo signaling pathway (reviewed in Varelas, 2014). Both YAP and TAZ are present in Leydig cells at P0 and P70 after birth (Levasseur et al., 2017). Inactivation of Yaz and Taz affects Sertoli cell differentiation in mice but does not affect ALC development and steroidogenesis (Levasseur et al., 2017). The presence of YAP/TAZ in Leydig cells justifies further research into the functions of Hippo signaling in these cells.

0.1.8.3.2 Desert hedgehog (DHH) Similar to the FLCs, the cell lineages committed to the ALC path express PTCH1, and DHH- PTCH1 signaling is essential for their proliferation and differentiation (Li et al., 2016).

Downstream targets of PTCH1 include Sf1 and Cyp11a1, both essential for Leydig cell function and differentiation (Yao et al., 2002). Inactivation of the Dhh gene in the mouse results in the complete absence of ALCs (Clark et al.), indicating its importance for their differentiation. In humans, mutations affecting DHH result in the loss of ALCs, low testosterone levels, and various forms of differences of sex development (DSD) due to the loss of DHH-PTCH1 signaling (Neocleous et al., 2019; Paris et al., 2017; Werner et al., 2015).

0.1.8.3.3 Platelet-derived growth factor (PDGF) Pdgfra mRNA, encoding the receptor PDGFRA, is detected in Leydig cells from adult mouse testis and in several Leydig cell lines (Bergeron et al., 2011). Furthermore, knockout of the gene encoding the ligand Pdgfa in mice results in delayed ALCs differentiation and defects in spermatogenesis (Gnessi et al., 2000). The transcription factors specificity protein 1 (SP1) and specificity protein 3 (SP3) were found to regulate the expression of Pdgfra in mouse Leydig cell lines (Bergeron et al., 2011).

0.1.8.3.4 Anti-Müllerian hormone (AMH) and its receptor in Leydig cell differentiation and function Anti-Müllerian hormone (AMH) is a 125 kDa glycoprotein composed of two unequal domains and belongs to the transforming growth factor-beta (TGFβ) family of proteins. AMH is mostly produced by Sertoli cells in the testis and by granulosa cells in the ovary (reviewed in Josso et al., 2001). This glycoprotein is mainly recognized for its role in the regression of the Müllerian ducts during male development (Josso et al., 1998). Without the actions of AMH, the Müllerian ducts develop into the fallopian tubes, uterus, and upper vagina (reviewed in Behringer, 1994). The actions of AMH on target tissues are conveyed through a heterodimeric receptor composed of the anti-Müllerian hormone type 2 receptor (AMHR2) and a type 1 receptor. In Leydig cells, evidence suggest that the activin receptor- like kinase 3 (ALK3) acts as type 1 receptor (Lee et al., 1999; Mishina et al., 1996; Wu et al., 2012).

In humans and rodents, there is a reciprocal relationship between AMH and testosterone levels throughout lives (Lee et al., 1996). AMH plays a role in the differentiation of mesenchymal stem cells into Leydig cells (Racine et al., 1998). In human males, mutations

causing an imbalance in AMH or AMHR2 expression result in persistent Müllerian duct syndrome (PMDS), infertility, inguinal hernias, cryptorchidism, Leydig cell hyperplasia, and low testosterone levels (Gujar et al.; Picard et al., 2017). In male mice, inactivation or disruption of either AMH or AMHR2 results in the retention of Müllerian ducts, partial testosterone deficiency, seminiferous tubule atrophy, infertility, and Leydig cell hyperplasia (Mishina et al., 1996; Wu et al., 2005).

0.1.8.3.4.1 Regulation of the Leydig cell function by AMH/AMHR As mentioned in the previous section, AMH signaling is conveyed via a dimeric complex composed of AMHR2 and ALK3 (Wu et al., 2012). The proposed AMH/AMHR2/ALK3 signaling model is depicted in Figure 0.3. When AMH binds to the outer membrane domain of the AMHR2, a receptor complex forms in which AMHR2 phosphorylates and activates ALK3 (Fig. 0.3) (Wrana et al., 1994; Wu et al., 2012). When ALK3 is stimulated, it associates and phosphorylates cytosolic receptors mothers against decapentaplegic homolog 1/5 (SMAD1/5) (Gouedard et al., 2000; Pangas et al., 2008) (Fig. 0.3). Inactivation of Smad1Smad5 results in the formation of Leydig cell tumors in mice (Pangas et al., 2008), implicating both receptors in Leydig cell function and development. Activated SMAD1/5 form a heteromeric complex with SMAD4 and translocate to the nucleus, where they control gene transcription in Leydig cells (Fig. 0.3). Since AMH downstream effects prevent PKA- induced CYP17A1 expression (Laurich et al., 2002), PKA may be one of the direct targets of the SMAD4-SMAD1/5 complex (Fig. 0.3). Inactivation of Smad4 in mice causes testicular dysgenesis but does not affect Leydig cell activity, meaning that AMH transduction can also be mediated in a SMAD4-independent manner (Archambeault and Yao, 2014).

Overexpression of AMH reduces the mRNA levels of several steroidogenic enzymes such as Cyp11a1, Cyp17a1, and Hsd3b1, supporting the model (Fig. 0.3) (Racine et al., 1998). In a Leydig cell line, combination of AMH and cAMP resulted in increased Star mRNA levels and progesterone concentration, suggesting a role in steroidogenesis (Laurich et al., 2002). Furthermore, AMH prevents protein kinase A (PKA)-induced expression of CYP17A1 (Laurich et al., 2002). Conditional knockout of Alk3 in mice results in reduced mRNA levels of Cyp11a1, Star, Hsd3b6, and Hsd17b3 and increased expression of androgen converting enzymes (3-HSD and SRD5A2) (Wu et al., 2012).

Figure 0.3 Proposed AMH/AMHR2/ALK3 signaling pathway in Leydig cells. ProAMH dissociates, and mature AMH binds to the extracellular domain of AMHR2. This interaction results in the formation of a heterodimeric complex with ALK3. When the receptors are activated, they phosphorylate SMAD1/5, which bind to SMAD4 and translocate into the nucleus. The SMAD1/5- SMAD4 complex inhibits transcription of the steroidogenic enzyme and the PKA catalytic subunit. AMH, anti-Müllerian hormone; AMHR2, anti-Müllerian hormone type 2 receptor; ALK3, activin receptor-like kinase 3; PKA, protein kinase A; SMAD1/5, mothers against decapentaplegic homolog 1/5; SMAD4, mothers against decapentaplegic homolog 4; CREB, cAMP-response element-binding protein; Red circle, phosphorylation of a protein.

0.1.8.3.4.2 Expression of AMHR2 The AMH/AMHR2 signaling pathway is involved in the regulation of steroidogenesis and maturation in Leydig cells (Lee, 1999 #34). The Amhr2 mRNA and protein have been found in primary FLCs, rodent Leydig cell lines, and PLCs that give rise to ALCs (Mendis- Handagama et al. 2006; Teixeira et al. 1999). The Amhr2 mRNA was found in abundance in isolated rat PLCs and ILCs, implying a role for AMH/AMHR2 signaling in testis development (Lee et al. 1999).

0.1.8.3.4.3 Regulation of Amhr2 promoter activity Very little is known regarding the regulation of Amhr2 gene expression in human, mouse, and rat cell lines. In granulosa cells, bone morphogenic proteins 4 and 15 (Pierre et al., 2016) and noncoding RNA (lncRNA-Amhr2) enhance the activation of the Amhr2 promoter (Kimura et al., 2017). The human AMHR2 promoter is activated and bound by steroidogenic factor-1 (SF1) (de Santa Barbara et al.). Furthermore, the AMHR2 promoter is transactivated by GnRH via early growth response-1 (EGR1) in murine LβT2 gonadotrope cells (Garrel et al. 2019), implicating the importance of the AMH/AMHR2 signaling in the pituitary gland as well. Evidence suggests that in chicken male embryos, AMHR2 expression is regulated by DMRT1 (Cutting et al., 2014).

The mouse Amhr2 promoter was found to be a direct target of Wilms' tumor protein (WT1) during mouse early gonadal development, sex determination, and particularly Müllerian duct regression (Fig. 0.4) (Klattig et al., 2007). The mouse -1486/+77 bp Amhr2 promoter is depicted in (Fig. 0.4). This promoter has two nuclear response elements (NREs, section 0.2.3.2) recognized by SF1 (Teixeira et al., 1999), unlike its human counterpart (de Santa Barbara et al., 1998) which only has one. SF1 activates the mouse Amhr2 promoter (Teixeira et al., 1999), and synergistically cooperates with catenin beta-1(CTNNB1)-T-cell factor/lymphoid enhancer factor (TCF/LEF) to regulate Amhr2 transcription in HeLa cells (Fig. 0.4) (Hossain and Saunders, 2003). Mutation of both SF1 elements reduces basal promoter activity (Teixeira et al., 1999). Results from functional studies in R2C cells, a Leydig cell line, identified the presence of an unknown DNA-binding region located between -99 to -91 bp (ACCCACCTCT) of the mouse Amhr2 promoter is required for maximal SF1- dependent activation (Fig. 0.4) (Teixeira et al., 1999). No study has reported which

transcription factor might be involved in recognizing this unknown binding region. Results from footprinting analyses of the mouse Amhr2 promoter incubated with R2C nuclear proteins show that a GC-box was protected from DNase I digestion (Teixeira et al., 1999), suggesting an interaction with a transcription factor. This transcription factor is most likely a member of the specificity proteins (SP) family of transcription factors. SP1 belongs to a family of ubiquitous transcription factors that can drive gene expression by binding to the GC boxes located in promoter regions of target genes (Li et al., 2004). GATA4 activates the Amhr2 promoter in Leydig cell lines via two GATA elements (Fig. 0.4) (Bergeron et al., 2015). Considering previous research, which highlights the importance of AMH/AMHR2 signaling in Leydig cell differentiation and steroidogenesis, and the limited knowledge of Amhr2 transcriptional regulation, further investigation in the regulation of Amhr2 expression is substantiated.

Figure 0.4 Schematic representation of the mouse Amhr2 promoter. The binding sites for different transcription factors are shown.

0.1.8.3.5 Hypothalamic-pituitary-gonadal (HPG) axis and LH The hypothalamic-pituitary-gonadal (HPG) axis is one of the primary regulators of Leydig cell differentiation and function (Fig. 0.5). The HPG axis is separated into three main components, hypothalamus, pituitary gland, and gonads. The hypothalamus produces gonadotropin-releasing hormone (GnRH), which acts on gonadotrope cells located within the master endocrine gland called the pituitary via a G-protein-coupled receptor (GnRHR). The pituitary gland, subdivided into anterior, intermediate, and posterior lobes, is responsible for the secretion of many hormones. The anterior pituitary contains gonadotrope cells in which the products from three genes (Cga, Lhb, and Fshb) are responsible for assembling the functional LH and follicle-stimulating hormone (FSH) dimeric glycoproteins.

Figure 0.5 Schematic representation of the hypothalamic-pituitary-gonadal (HPG) axis. Designed by Artoria 2e5-Own work, CC BY 3.0, adapted from https://commons.wikimedia.org/w/index.php?curid=81460023.

Sufficient levels of LH and FSH are essential for healthy reproductive functions in mammals. In males, LH stimulates the production of androgens in Leydig cells via LHCGR, a G-

protein-coupled membrane receptor luteinizing hormone/choriogonadotropin receptor (Pierce and Parsons, 1981), and is required for ALC development (Zhang et al., 2004). In females, LH causes ovulation and signals follicle cells to produce progesterone (reviewed in Andersen and Ezcurra, 2014). FSH activates spermatogenesis by regulating Sertoli cell function (reviewed in Plant and Marshall, 2001), and in females causes growth of the ovarian follicle and stimulates follicle cells to produce estrogens and progesterone (Fig. 0.5) (Kumar et al., 1997).

Furthermore, inactivation of Lhb does not affect the commitment of the progenitor cells into the ALC lineage (Ma et al., 2004). In Lhcgr knockout mice, PLCs develop from SLCs normally (Zhang et al., 2004). Inactivation of Lhb in mice results in smaller testes, infertility, a lower number of ALCs, and hypogonadism (Ma et al., 2004), suggesting defects in the development of ALCs. Furthermore, the global inactivation of GnRH in mice results in hypogonadism (Mason et al., 1986) demonstrating that both CGA and LHB subunits are essential for proper stimulation of LHCGR.

0.1.8.3.6 Androgen receptor (AR) All ALC lineages, Sertoli cells, and peritubular cells express the androgen receptor (NR3C4, AR) (Bremner et al., 1994). Even though AR was found in each stage of LC development, its levels were highest in ILCs, suggesting a role in the final stage of Leydig cell maturation (Bremner et al., 1994). This conclusion seems to be supported by the results from AR mutant mice which show a reduction in differentiation and lower Leydig cell numbers (Murphy et al., 1994). Using a global GnRH and Ar knockout mouse model, it was found that LH/AR signaling is required for the proper development of Leydig cells and expression of steroidogenic enzymes (O’Shaughnessy et al., 2019).

0.1.8.3.7 GATA4 The GATA family of factors in vertebrates consists of six members named GATA1 to 6, and they belong to the zinc finger class of transcription factors. Members of the GATA family regulate gene expression by binding to (A/T=W)GATA(A/G=R) consensus sequences found in gene promoter regions. All six members play crucial roles in eukaryotic development and differentiation. GATA 1/2/3 are mainly expressed in hematopoietic cell lineages and blood

stem cells, while GATA 4/5/6 are implicated in the organogenesis of several endoderm- derived tissues (reviewed in Tremblay et al., 2018).

GATA4 is found in testes and ovaries and is implicated in the differentiation of the mammalian gonads (reviewed in Viger et al., 1998). In mice, GATA4 is detected in the coelomic epithelial region of the genital ridge at ~E10 (Hu et al., 2013).The conditional inactivation of GATA4 in XX or XY embryos blocks the formation of the genital ridge (Hu et al., 2013). Haploinsufficiency of GATA4 affects testis cord morphology, Sertoli cell function and may cause sex-reversal in the mouse XY embryos (Bouma et al., 2007). Due to its abundance in gonadal somatic cells, it is considered one of the earliest gonadal markers. In the rodent fetal testis, GATA4 is found in pre-Sertoli, Sertoli cells, FLCs, fibroblast-like interstitial cells, and the cell lineages giving rise to ALCs (reviewed in Viger et al., 1998). After gonadal differentiation, GATA4 continues to be highly expressed in most gonadal somatic cell lineages in both sexes like Sertoli cells, Leydig cells, stem Leydig cells, theca, granulosa, and luteal cells (reviewed in Viger et al., 1998).

In the primary mouse Leydig cells and cell lines, GATA4 regulates the expression of genes implicated in sex determination (Sf1, Sox9, Dmrt1, Lim homeobox protein 9 (Lhx9)), peptide hormone production (Inha, Inhba, Amh), GnRH signaling (Fshr, Lhcgr), steroidogenesis (Star, Cyp11a1, Cyp17a1, Amhr2), and glycolysis ((hexokinase 1 (Hk1), glucose phosphate isomerase 1 (Gpi1), phosphofructokinase (Pfkp), phosphoglycerate mutase 1 (Pgam1)) (Bergeron et al., 2015; Schrade et al., 2015). However, the conditional knockout of Gata4 in mice does not affect Leydig cell differentiation in the fetal and the adult testis (reviewed in De Giorgio et al., 2019). One possible explanation for this result is that other GATA members, such as GATA6, may compensate for the loss of GATA4. Indeed, Leydig cells also express GATA6 (Ketola et al., 1999; Robert et al., 2002). Furthermore, a double Gata4/Gata6 knockout mouse model results in disruption of testicular development and reduction in the number of fetal Leydig cells (Padua et al., 2015), suggesting possible interchangeable roles of these transcription factors. Likely, GATA4 and GATA6 can molecularly interact with the common transcriptional partners in Leydig cells, and many remain unknown. Therefore, identifying them would help decipher the compensatory mechanism.

0.1.9 Steroidogenesis in Leydig cells As mentioned previously, the Leydig cells of the adult testis produce testosterone (T) via a multi-step process called steroidogenesis. There are four main steroid-catalyzing enzymes involved in T synthesis from cholesterol. Those are CYP11A1, HSD3B1, CYP17A1, and HSD17B3 (Fig. 0.6) (reviewed in Zirkin and Papadopoulos, 2018). The rate-limiting step in steroidogenesis is regulated by the steroidogenic acute regulatory protein (STAR) and involves the transport of cholesterol from the cytosol into the mitochondria (Clark et al., 1994). In the mitochondria, cholesterol is converted into pregnenolone by CYP11A1 and exported to the endoplasmic reticulum for further modifications (reviewed in Tremblay, 2015; Zirkin and Papadopoulos, 2018). Next, pregnenolone is converted into progesterone by HSD3B1, to androstenedione by CYP17A1, and finally to testosterone by HSD17B3 (Fig. 0.6). Testosterone is exported out of Leydig cells, mostly via passive diffusion, and acts on target cells and tissues expressing the androgen receptor (AR). Recent data suggests that testosterone release from the Leydig cells into the bloodstream is mediated by the multidrug and toxic compound extrusion (MATE) transporters (Goda et al., 2017).

Figure 0.6 Key steroidogenic steps involved in testosterone production. Cholesterol is translocated (dashed line) via STAR to the inner mitochondrial membrane, where it is transformed into pregnenolone by CYP11A1. The pregnenolone is then translocated (dashed line) into the endoplasmic reticulum, where it is transformed to progesterone by HSD3B1. Then, HSD17B3 catalyses the conversion of androstenedione to testosterone, which is then transformed to dihydrotestosterone by SRD5A1/2. Furthermore, AKR1C14 can convert dihydrotestosterone into 3α- diol. Cholesterol sources are identified.

Under certain conditions, testosterone is metabolically transformed into dihydrotestosterone (DHT), a more potent androgen, by one of the two 5α-reductase enzymes (SRD5A1 and SRD5A2) (reviewed in Eik-Nes, 1975). DHT and dihydroprogesterone (DHP) can be further transformed into the less potent steroids 3α-diol and allopregnanolone, respectively, by the enzyme 3α-hydroxysteroid dehydrogenase type 1 (AKR1C14) (Fig. 0.6). Interestingly, administration of 3α-diol is associated with a reduction of anxiolytic effects and an improvement in cognitive behavior (Frye et al., 2008).

0.1.9.1 Sources of cholesterol for androgen synthesis Leydig cells synthesize testosterone from bioavailable cholesterol stored in the plasma membrane, lipid droplets, lipoproteins (LDL or HDL), or de novo biosynthesis from acetyl-

CoA (Fig. 0.6) (reviewed in Zirkin and Papadopoulos, 2018). Intracellular cholesterol levels are maintained by several transcription factors, including sterol-regulatory element-binding proteins (SREBPs) (reviewed in Brown and Goldstein, 1997). Functions of SREBPs in Leydig cells are facilitated by the SREBP cleavage-activating protein (SCAP) and insulin- inducible genes (Insigs) (Shimizu-Albergine et al., 2016). Once cholesterol levels are high, cholesterol binds SCAP scaffolded by INSIG, and the SCAP-SREBP complex is held in the endoplasmic reticulum membrane. When cholesterol levels are low, the SCAP-SREBP complex is transported to the Golgi, where SREBP is cleaved. The SREBP N-terminal enters the nucleus, binds to the sterol-regulatory elements (SRE) found in the target genes, and regulates transcription of genes involved in cholesterol synthesis (Horton et al., 2003; Shimizu-Albergine et al., 2016). One of its downstream targets is the hormone sensitive lipase (Hsl) enzyme (Shimizu-Albergine et al., 2016), which hydrolyzes cholesterol from cholesteryl ester storage. HLS was considered a rate-limiting step for providing cholesterol in steroidogenesis (Shimizu-Albergine et al., 2012). However, the use of HSL-deficient cell clones showed that the release of cholesterol from storage is not the main cause of steroidogenesis, and that cholesterol used for steroidogenesis rather comes from de novo biosynthesis (Shimizu-Albergine et al., 2016).

0.1.9.2 Activation of the steroidogenesis 0.1.9.2.1 Classical LH-PKA signaling pathway Activation of steroidogenesis in ALCs is regulated by the pulsatory release of LH from the anterior pituitary gland. In hormone-stimulated signal transduction, LH binds to the extracellular hormone-binding domain of the LHCGR, a member family of G-protein coupled receptors (GPCRs) (Fig. 0.7A). hCG is a heterodimeric glycoprotein produced by the placenta after fetus implantation and stimulates steroidogenesis by binding to LHCGR (reviewed in Ascoli et al., 2002). When the rat and pig LHCGRs were overexpressed in green monkey fibroblast cell lines (COS1, COS7, and COS7a), hCG bound these receptors with similar affinities (Ji and Ji, 1991; Tsai-Morris et al., 1990; VuHai-LuuThi et al., 1992). Upon stimulation by LH or hCG, a series of downstream pathways and proteins are activated, leading to increased production of androgens (Fig 0.7A).

LHCGRs belong to the rhodopsin-like G protein-coupled receptors (GPCRs) family, also known as seven-transmembrane receptors (7TMRs) (Menon and Menon, 2012). 7TMRs belong to the largest class of cell surface receptors with over 800 members in the human genome (reviewed in Gacasan et al., 2017). The molecular size of LHCGR is around 75 kDa and is composed of two units: an extracellular hormone-binding domain and a transmembrane/cytoplasmic domain (Ascoli et al., 2002; Dufau, 1998). LHCGR is found mainly in gonadal tissues, more specifically in Leydig and ovarian cells, but there is growing evidence suggesting that it is also present in other non-reproductive tissues, albeit at lower levels (reviewed in Ascoli et al., 2002). Without proper LHCGR function in human gonadal tissues, adult Leydig cells fail to differentiate, and ovulation does not occur in females (reviewed in Ascoli et al., 2002).

Figure 0.7A shows LH (red circles) or hCG (green circles) binding to the extracellular hormone-binding domain of LHCGR (blue cylinders embedded in the membrane). The receptor then goes through a conformational change promoting interaction with heterotrimeric G-proteins (Gαβγ) (reviewed in Vilardaga et al., 2010). Dissociation of Gα from the heterotrimeric complex causes downstream effectors to be activated. An example is an activation of the cyclic adenosine-monophosphate (cAMP) dependent pathway through interaction with adenyl cyclase (Fig 0.7A) (Dufau et al., 1977; Moger, 1991).

The second messenger cyclic AMP (cAMP) is involved in almost every major cellular function, including metabolism, transcription, growth, and apoptosis. The intracellular concentration of cAMP is elevated when cells are treated with epinephrine, and this was first reported and demonstrated by Nobel Prize winner Dr. Sutherland in 1958 (Sutherland and Rall, 1958). cAMP is produced by conversion of ATP by adenylyl cyclase (AC). At least 10 ACs isoforms (AC1-10) have been reported to date, and their expression levels differ throughout the body (reviewed in Pierre et al., 200)). Isoforms AC3, AC5, AC6, AC7, AC8, and AC10 are found in testes (reviewed in Pierre et al., 2009). Inactivation of AC10 in mice results in infertility in both males and females (reviewed in Pierre et al., 2009).

Figure 0.7 Schematic representation of classical LH-PKA steroidogenesis in Leydig cells. (A) Luteinizing hormone (LH) or human chorionic gonadotropin (hCG) binds luteinizing hormone/choriogonadotropin receptor (LHCGR) on the membrane activating a cascade of event leading to the expression of steroidogenic genes. AC, adenylyl cyclase; PKA, Protein Kinase A. (B) Negative regulators of steroidogenesis. PDE, phosphodiesterases; AMPK, AMP kinase.

In Leydig cells, one of the downstream cAMP targets is protein kinase A (PKA) (reviewed in Hansson et al., 2000). PKA is a tetramer that consists of two regulatory and two catalytic

subunits represented by orange boxes and circles (Fig. 0.7A). Upon binding of cAMP (green stars) to the regulatory subunits of PKA, dissociation of catalytic subunits occurs (reviewed in Hansson et al., 2000). These catalytic subunits (or activated PKA) translocate into the nucleus and regulate the expression of numerous transcription factors implicated in steroidogenesis, including those that facilitate cholesterol availability, conversion, and transport into mitochondria (Shimizu-Albergine et al., 2012).

0.1.9.2.2 Calcium-dependent regulation of steroidogenesis In mammals, calcium-dependent signaling is involved in regulating numerous biological processes, such as cell division, differentiation, migration, reproduction, and development (reviewed in Berridge et al., 1998; Stewart and Davis, 2019). Our cells spend tremendous amounts of energy to keep and maintain a well-balanced intracellular concentration of calcium. In Leydig cell lines, a surge in intracellular calcium concentration increases Star expression via signaling of the downstream nuclear receptor NUR77 (encoded by Nr4a1) (Abdou et al., 2013). Two significant mechanisms are responsible for an increase in intracellular calcium concentration. One is a direct influx of calcium through voltage- dependent calcium channels located throughout the plasma membrane (Costa and Varanda, 2007). The second is the release of calcium from the intracellular storages (endoplasmic reticulum) downstream of LHCGR signaling (Costa and Varanda, 2007).

Once LH binds to LHCGR, the receptor catalyzes the change of GDP to GTP on the Gα subunit, which causes the Gα subunit to dissociate from the trimeric unit and to activate phospholipase C (PLC). PLC hydrolyzes membrane-bound phosphatidylinositol 4,5- biphosphate (PIP2) into inositol 1,4,5-triphosphate (IP3) and 1,2 diacylglycerol (DAG) (Jo et al., 2005). More recently, calretinin, a calcium-binding protein, was found to participate in the regulation of steroidogenesis via the PLC-calcium pathway (Xu et al., 2018). The two products, DAG and IP3, are secondary intracellular messengers responsible for the intracellular release of calcium from the endoplasmic reticulum. DAG activates protein kinase C (PKC), independently from IP3, to increase the cell response to calcium (Jo et al., 2005).

The binding of IP3 with calcium near the N-terminal region of IP3 receptors (IP3R) on the endoplasmic reticulum (ER) results in a conformational change in the IP3R transmembrane domain which opens up the channel allowing calcium to be released from the ER. The released calcium can bind to calmodulin and activate CAMKI. In the next step, CAMKI phosphorylates proteins leading to increased steroidogenesis (Martin et al., 2008). The exact targets of CAMKI in Leydig cells remain to be identified. In addition, IP3 acts as the inhibitor of the sarcoendoplasmic reticulum (SER) calcium transport ATPase (SERCA), which is responsible for the transport of calcium to SER from cytosol once the intracellular concentration of calcium is too high, thus preventing SERCA action (reviewed in Prole and Taylor, 2019).

0.1.9.3 Repression of steroidogenesis in Leydig cells In addition to testosterone suppressing LH release via the negative feedback loop (Fig. 0.5), other pathways for terminating steroidogenesis exist.

0.1.9.3.1 Phosphodiesterases (PDEs) and AMP-Activated Protein Kinase (AMPK) cAMP activated signaling is directly terminated by hydrolysis of cAMP to 5’-AMP through a class of enzymes called phosphodiesterases (PDEs) (Fig. 0.7B). To date, 11 families of PDEs have been reported and characterized. Their substrates can be either cAMP, cGMP, or both, and they convert those substrates into 5’-AMP and 5’-GMP (reviewed in Epstein, 2017). Even though some PDEs can convert both substrates, their substrate affinities are significantly different. This leads to the notion that certain PDEs (i.e., PDE10) within the same cell can degrade either substrate depending on the concentration of that substrate. PDEs can function as a diffusion barrier, as a cAMP sink, and as a sequestered compartmental concentration barrier. It was proposed that in Leydig cells, PDE8A and PDE8B control conversion of cAMP in distinct compartments, and they are major regulators of basal steroidogenesis (Shimizu-Albergine et al., 2012). Furthermore, PDE8A can regulate this process with one or more PDE4As in a highly synergistic manner (Shimizu-Albergine et al., 2012).

When the ratio of ATP to AMP is not balanced, AMP activates AMP-activated protein kinase (AMPK) to promote the restoration of energy by converting ADP to ATP (Fig 0.7B)

(reviewed in Hardie, 2011). AMPK is a heterotrimeric protein consisting of alpha, beta, and gamma subunits and is found in virtually every cell. AMPK regulates glucose uptake in the heart, hypothalamus, and skeletal muscle but inhibits fatty acid synthesis in adipose tissue and the liver (reviewed in Hardie, 2011). If the catabolic function of AMPK fails due to enormous energy consumption, another enzyme, adenylate kinase, can convert ADP to 5’- AMP, resulting in activation of AMPK (reviewed in Hardie, 2011). AMPK is expressed in Leydig cells (reviewed in Nguyen, 2017), where it was found to inhibit cAMP-induced steroidogenesis by repressing key regulators of steroidogenesis, including Star and Nr4a1 (NUR77) (Abdou et al., 2014). In addition, it was suggested that AMPK might be involved in the regulation of STAR protein activity by phosphorylating protein targets involved in the regulation of Star (Abdou et al., 2014).

0.1.9.3.2 PKA-dependent repression In addition to phosphorylation of many target proteins that regulate cellular functions, PKA is also capable of phosphorylating adenylyl cyclase (AC) and therefore preventing cAMP production and terminating the stimulatory signal. There is a naturally occurring PKA inhibitor called protein kinase inhibitor peptide (PKI) expressed in Leydig cells (Ascoli et al., 2002). PKI contains a pseudo-substrate sequence for PKA. In rodents, three PKI isoforms exist and are designated alpha, beta, and gamma. Their expression levels vary within the body. Generally, upon cAMP-mediated dissociation of PKA subunits, PKI binds the free catalytic units of PKA, inactivating them and mediating their nuclear exit via a nuclear exit signal (NES) sequence. In the MA-10 Leydig cell line, there is evidence that hCG-induced phosphorylation of ERK1/2 via activation of LHCGR is reduced by 50% when cells overexpress an active form of PKI (Hirakawa and Ascoli, 2003).

0.1.9.3.3 β-arrestin and receptor internalization A common characteristic of the GPCRs is the attenuation or desensitization of the signal due to continuous receptor stimulation. One way to terminate the signal is to reduce the number of receptors at the plasma membrane. The reduction of the receptors is achieved through endocytosis (reviewed in Gurevich and Gurevich, 2019). The desensitization of GPCRs is a two-step process. Upon agonist binding to the receptor, the G-protein-coupled receptor kinase (GRK) phosphorylates the carboxyl-terminal of the receptor located inside of the

plasma membrane (reviewed in Gurevich and Gurevich, 2019). The following step is the grouping of arrestin adaptors from the cytosol to the phosphorylated receptor and linking the receptor to numerous signaling pathways. In porcine ovarian follicles, β-arrestin1 binds to the GRK-phosphorylated LHCGR, mediating its desensitization (Mukherjee et al., 1999). The same group reported that β-arrestin binds non-phosphorylated LHCGR, although with lower affinity (Mukherjee et al., 1999). In Leydig cells, phosphorylated LHCGR are internalized through clathrin-mediated pathways and degraded in lysosomes (Ghinea et al., 1992). The recycling/degradation process depends on how the receptor was activated, pH of the ligand/receptor complex, and ligand concentration. Another role of β-arrestin-mediated internalization involves ubiquitylation of GPCRs through an E3 ligase associated with β- arrestin (reviewed in Tian et al., 2014). Once the GPCR is internalized, it is dephosphorylated or de-ubiquitylated, and the receptor can be either recycled back to the membrane surface or degraded through lysosomal degradation.

0.1.9.4 Other factors involved in the regulation of steroidogenesis It has been well demonstrated that circulating hormones, growth factors, and proinflammatory cytokines such as transforming growth factor-β (TGFβ), insulin-like growth factor-1 (IGF-1), interleukin-1 (IL-1), are modulators of steroidogenesis (Fig. 0.7). Activated and internalized TGFβ can scaffold SMAD anchor for receptor activation (SARA) to phosphorylate SMAD2/3, thus promoting signaling through transcriptional regulation by SMAD complexes (Kaivo-oja et al., 2006). In mouse Leydig cells, TGFβ acts through its receptor by recruiting SMAD3 to physically interacts with NUR77 and inhibits its binding to the promoter of target genes (Park et al., 2014).

In the case of insulin resistance, low testosterone indicates a defect in the HPG axis. Using the mouse TM3 Leydig cell line, it was demonstrated that treatment with the proinflammatory cytokines TNFα, IL1β, and IL6 resulted in a significant decrease in testosterone production and cell viability (Leisegang and Henkel, 2018). Along with this, administration of IL6 prolonged suppression of testosterone levels in healthy men (reviewed in Bornstein et al., 2004).

0.2 Transcription factors An important challenge in molecular biology to explain the existence and improve the wellness of humankind revolves around interpreting the genetic material (DNA). The composition of any organism is determined by species-specific genetic information, which is coded in their DNA using only four nucleotides (A, G, T, C). The transcription of DNA into RNA molecules is a complex and highly regulated process that involves several steps. These multi-step processes are coordinated by regulatory proteins and other molecules in time-specific and/or ligand-dependent manners. Transcription factors (TFs) are proteins involved in the regulation of DNA transcription by binding to specific DNA sequences located in the gene regulatory regions called promoters. Due to their essential roles in gene regulation, transcription factors are considered “master regulators” or “gatekeepers” of gene transcription (reviewed in Lambert et al., 2018). Genetic mutations affecting TF expression/activity or gene promoter sequences result in many diseases and syndromes, including cancers, defects in autoimmunity, developmental disorders, metabolic syndrome, cardiovascular diseases, and infertility (reviewed in Izumi, 2016; Lee and Young, 2013; Venkatesh et al., 2014; Villard, 2004).

The interaction between transcription factors and their cognate elements regulates the assembly of the RNA polymerase machinery, hence gene transcription. Generally, these TF cognate elements are composed of 6-12 base pairs referred to as “motifs” (Badis et al., 2009; Loots et al., 2002). Transcription factors can bind directly to their specific motifs or interact with another DNA-bound transcription factor, making gene transcription a highly complex and tightly regulated process. In addition to the presence of motifs in the gene regulatory regions, the molecular interactions between transcription factors and their motifs depend on the DNA environment, characterized by genome integrity, nucleosome assembly, DNA shape, and DNA plasticity (Dror et al., 2016; Seldeen et al., 2009).

The human genome consists of over 1600 transcription factors grouped into more than 35 TF families (reviewed in Lambert et al., 2018). By the 1980s, the major TF families were described based on their DNA binding motifs: C2H2-zinc fingers (ZF), basic helix-loop-helix (bHLH), basic leucine zipper (bZIP), and unclassified (not assigned to any family) (reviewed in Johnson and McKnight, 1989).

0.2.1 Nuclear receptors The work presented in this thesis focuses on a transcription factor (TF) belonging to a large family called the nuclear receptor superfamily. This superfamily was not part of the original group of characterized transcription factors. Initially, the “classical” nuclear receptors were considered steroid/ligand regulated superfamily of transcription factors, with some exceptions (reviewed in Mazaira et al., 2018; Mullican et al., 2013; Sever and Glass, 2013). The exception to the definition of a nuclear receptor is knowledge of nuclear receptor natural ligands. At present, sequencing of the human genome has identified 49 genes that code for at least 75 nuclear receptors (Robinson-Rechavi et al., 2001), making them the sixth-largest characterized TF family (reviewed in Lambert et al., 2018). It is a popular belief that the activity of nuclear receptors is regulated by their ligands. The ligands for nuclear receptors are compounds structurally related to fatty acids, cholesterol, lipophilic hormones, vitamins, antibiotics, xenobiotics, and synthetic drugs (reviewed in Sladek, 2011). However, ligands have only been identified for approximately half of the nuclear receptors (Table 0.1). The nuclear receptors which do not have ligands identified are called orphan nuclear receptors (reviewed in Mullican et al., 2013). The members of the chicken ovalbumin upstream promoter‐transcription factor (COUP-TF) group are considered orphan nuclear receptors, and the main focus of the present thesis work is on the chicken ovalbumin upstream promoter‐transcription factor type II (COUP-TFII, also knowns as ARP1, COUPTFB). If and when a ligand for an orphan nuclear receptor is identified, then the designation of that nuclear receptor is changed from orphan to adopted orphan. An example of an adopted orphan nuclear receptor is the retinoic X receptor (RXR) that is activated by 9-cis-retinoic acid (reviewed in Evans and Mangelsdorf, 2014).

Table 0.1 Table of human nuclear receptors, gene name, and their ligands

Sub- Official Common name Abbreviation Ligand class name 1 NR1A1 Thyroid hormone receptor‐α TRα Thyroid hormones NR1A2 Thyroid hormone receptor‐β TRβ Thyroid hormones NR1B1 Retinoic acid receptor‐α RARα Retinoic acids NR1B2 Retinoic acid receptor‐β RARβ Retinoic acids NR1B3 Retinoic acid receptor‐γ RARγ Retinoic acids NR1C1 Peroxisome proliferator‐activated receptor‐α PPARα Fatty acids NR1C2 Peroxisome proliferator‐activated receptor‐β PPARβ Fatty acids NR1C3 Peroxisome proliferator‐activated receptor‐γ PPARγ Fatty acids NR1D1 Reverse‐Erb‐α REV‐ERBα Heme NR1D2 Reverse‐Erb‐β REV‐ERBβ Heme NR1F1 Retinoic acid‐related orphan‐α RORα Sterols NR1F2 Retinoic acid‐related orphan‐β RORβ Sterols NR1F3 Retinoic acid‐related orphan‐γ RORγ Sterols NR1H2 Liver X receptor‐β LXRβ Oxysterols NR1H3 Liver X receptor‐α LXRα Oxysterols NR1H4 Farnesoid X receptor‐α FXRα Bile Acids NR1H5 Farnesoid X receptor‐β FXRβ Orphan NR1I1 Vitamin D receptor VDR 1α,25‐dihydroxy vitamin D3 NR1I2 Pregnane X receptor PXR Endobiotics and xenobiotics NR1I3 Constitutive androstane receptor CAR Xenobiotics 2 NR2A1 Hepatocyte nuclear Factor‐4‐α HNF4α Fatty acids NR2A2 Hepatocyte nuclear Factor‐4‐γ HNF4γ Fatty acids NR2B1 Retinoid X receptor‐α RXRα 9‐Cis retinoic acid NR2B2 Retinoid X receptor‐β RXRβ 9‐Cis retinoic acid NR2C1 Testicular Receptor 2 TR2 Orphan NR2C2 Testicular Receptor 4 TR4 Orphan NR2E1 Tailless homolog orphan receptor TLX Orphan NR2E3 Photoreceptor‐cell‐specific nuclear receptor PNR Orphan NR2F1 Chicken ovalbumin upstream promoter‐ COUP‐TFI Orphan transcription factor I NR2F2 Chicken ovalbumin upstream promoter‐ COUP‐TFII Orphan transcription factor II NR2F6 Chicken ovalbumin upstream promoter‐ COUP‐TFIII Orphan transcription factor III 3 NR3A1 Estrogen receptor‐α ERα Estrogens NR3A2 Estrogen receptor‐β ERβ Estrogens NR3B1 Estrogen‐related receptor‐α ERRα Orphan NR3B2 Estrogen‐related receptor‐β ERRβ Orphan NR3B3 Estrogen‐related receptor‐γ ERRγ Orphan NR3C1 Glucocorticoid receptor GR Glucocorticoids NR3C2 Mineralocorticoid receptor MR Mineralocorticoids and glucocorticoids NR3C3 Progesterone receptor PR Progesterone NR3C4 Androgen receptor AR Androgens 4 NR4A1 Nerve growth Factor 1B NUR77 Orphan NR4A2 Nurr‐related Factor 1 NURR1 Orphan

NR4A3 Neuron‐derived orphan Receptor 1 NOR‐1 Orphan 5 NR5A1 Steroidogenic Factor 1 SF‐1 Phospholipids NR5A2 Liver receptor Homolog‐1 LRH‐1 Phospholipids 6 NR6A1 Germ cell nuclear factor GCNF Orphan 7 NR0B1 Dosage‐sensitive sex reversal‐adrenal DAX1 Orphan hypoplasia congenital critical region on the X chromosome, Gene 1 NR0B2 Small heterodimer partner SHP Orphan

0.2.2 A brief history of NR The interest and research into nuclear receptors started in the 1960s with the biochemical description of the estrogen receptors by Dr. Elwood Jensen (Jensen, 1962; Jensen and Jacobson, 1960; Jensen et al., 2010) which were called estrophilins at that time. By administrating tritium-labeled estradiol to immature female rats, Dr. Jensen demonstrated a rapid uptake of the labeled steroid by the kidneys and liver and prolonged retention in the uterus and vagina that resulted in uterine growth. These tissues most likely do not contain any estrogen metabolizing enzymes therefore suggesting that a protein (later named nuclear receptor) could bind estrogen. Further work confirmed that the administered labeled estrogens were not metabolized and remained intact in those target tissues (Jensen, 1962; Jensen and Jacobson, 1960). The concept was then born that the steroid binding to an unknown protein was able to influence its function. When this ground-breaking work was first presented at the IV International Congress of Biochemistry in Vienna (1958), the whole concept was not well accepted by the scientific community (reviewed in Mazaira et al., 2018). About 20 years later, the subcloning of the human glucocorticoid receptor (GR) (Hollenberg et al., 1985) and estrogen receptor (ER) (Green et al., 1986) was achieved, and the nuclear receptor concept was well accepted within the scientific community, and they were considered a transcription factor superfamily.

0.2.3 Homology of nuclear receptor domains Before discussing the classification of nuclear receptors, the structure of their protein domains needs to be mentioned to better understand their mechanism of action. In general, nuclear receptors share a similar primary protein structure (Fig. 0.8). Their primary structure is composed of five to six protein domains (domains A-F). Each domain has a specific function necessary for nuclear receptor action (Fig. 0.8). These domains are ligand-

independent activation domain (A/B domain), a highly conserved zinc finger DNA-binding domain (DBD) (C domain), a flexible hinge region that may contain nuclear localization sequence (NLS) (D domain), a ligand-binding domain (LBD) (E domain), and an undefined C-terminus (F domain) (reviewed in Bain et al., 2007; Giguere, 1999).

0.2.3.1 A/B Domains: AF-1 The A/B domain is located in the N-terminal portion of nuclear receptors (Fig. 0.8, light green box). Since the A/B region mediates the ligand-independent activation of gene expression by nuclear receptors, it is referred to as Activation Function 1 (AF-1). These A/B domains have the least percent of sequence similarity within the nuclear receptor family due to the significant difference in the number of amino acids. The number of amino acids ranges between 23 aa for the vitamin D receptor (VDR) to 600 aa for the mineralocorticoid receptor (MR).

Figure 0.8 Schematic representation of the nuclear receptor domains. The key regions of nuclear receptors are shown. Letters N and C represent N and C protein termini, respectively.

0.2.3.2 C Domain: DNA-binding domain (DBD) Generally, nuclear receptor family members tend to recognize and bind to an identical motif located in promoter regions (reviewed in Pawlak et al., 2012; Rastinejad et al., 2013), with some exceptions. The DNA motifs recognized by nuclear receptors (referred to as hormone response element (HRE)/nuclear response element (NRE), or simply response element (RE)) are variants of an AGGTCA sequence (reviewed in Germain et al., 2006) All nuclear receptors, except the nuclear receptors belonging to subclass 7 (lacks DBD), (Table 0.1), have a significantly conserved DBD and LDB which allows them to recognize and bind to similar HREs in their target genes (reviewed in (awlak et al., 2012; Rastinejad et al., 2013).

0.2.3.3 D Domain: Hinge The nuclear receptor hinge region is located between the DBD and LBD (Fig. 0.8, gray box). This region is very flexible, allowing many different conformations of the tertiary structure of the nuclear receptors and interactions with other transcription factors. The hinge region may contain a short sequence rich in basic amino acids called the nuclear localization signal (NLS). NLS is essential for the nuclear translocation/localization of nuclear receptors (Fig. 0.8). Additionally, the hinge region can be involved in tethering activities (reviewed in Pawlak et al., 2012). The tethering mechanism is an indirect association of a nuclear receptor with a target gene via an interaction with another DNA-bound transcription factor rather than directly binding to its NRE (reviewed in Glass and Saijo, 2010). One example is the glucocorticoid receptor, which is frequently observed to regulate DNA transcription indirectly by interacting with the activator protein 1 (AP1) transcription factor (reviewed in De Bosscher and Haegeman, 2009).

0.2.3.4 E Domain: Ligand binding domain (LBD) Nuclear receptors have a high percentage of amino acid similarity in the LBD but lower than in the DBD (Fig. 0.8, dark green box). The primary structure of the LBD is very similar within the NR family and contains a specific helix α 12 (AF2) (reviewed in De Bosscher et al., 2020; Mullican et al., 2013). The AF2 helix found in this region is involved in the regulation of nuclear receptor activity and is also called the ligand-dependant activation domain. The primary function of the LBD is to bind a ligand causing the nuclear receptor to undergo a conformational change and dimerize with other nuclear receptors (e.g., RXR), TFs, and cofactors (reviewed in De Bosscher et al., 2020). Another common characteristic of nuclear receptor LBDs is the presence of a ligand-binding pocket, a place where the ligand interacts/resides (reviewed in De Bosscher et al., 2020; Mullican et al., 2013).

0.2.3.5 F Domain Certain nuclear receptors have an understudied F domain with variable sequences and poorly understood functions (Fig. 0.8). The F-domain may be vital for nuclear receptor functions because removing it alters their activity and dimerization potential (reviewed in Patel and Skafar, 2015).

0.2.4 Classification of nuclear receptors Nuclear receptors can be classified based on their sequence homology, mechanism of action, or ligand binding properties (reviewed in Weikum et al., 2018). However, each classification of nuclear receptors has its limitations. In this brief introduction, the main focus will be given to the classifications based on sequence homology and the mechanism of action. Based on ligand binding properties, nuclear receptors can be subdivided into three classes: hormone, metabolic, and orphan nuclear receptors (reviewed in Gadaleta and Magnani, 2014).

Official nomenclature for nuclear receptors was needed due to the large number of reported nuclear receptors creating huge classification problems. Based on sequence homology and phylogenetic tree, human nuclear receptors were divided into 7 subclasses (Table 0.1) (Nuclear Receptors Nomenclature, 1999) (reviewed in Giguere, 1999). The subclass, official names, common names, abbreviations, and ligands are provided in Table 0.1. Members within the same subclass share at least 80-90% identity in the DBD and 40-60% in the LBD (Nuclear Receptors Nomenclature, 1999). Official names are written as NRXYZ, where X (Arabic numerals) represents subclass, Y (capital letters) corresponds to a group, and Z (Arabic numerals) identifies a member within a group (reviewed in Germain et al., 2006). In this thesis, the official nomenclature will be used the first time a nuclear receptor is mentioned, but afterward, they will be referred to by their common names and abbreviations for the sake of simplicity and ease of recognition.

0.2.5 Subclass 1 – Nuclear receptor 1 This group contains the largest number of nuclear receptors, including thyroid hormone receptors (NR1A1/THRα and NR1A2/THRβ), retinoic acid receptors (NR1B1/RARα, NR1B2/RARβ, and NR1B3/RARγ), peroxisome proliferator‐activated receptors (NR1C1/PPARα, NR1C2/PPARβ, and NR1C2/PPARγ), liver X receptors (NR1H3/LXRα and NR1H2/LXRβ), farnesoid X receptor (NR1H4/FXRα and NR1H5/FXRβ), vitamin D receptor (NR1I1/VDR), pregnane X receptor (NR1I2/PXR) and constitutive androstane receptor (NR1I3/CAR). The majority of the nuclear receptors in subclass 1 are activated by steroid derivatives or lipophilic compounds, including thyroid hormones (T3 and T4), retinoic acid retinoids (e.g., 9-cis-retinoic acid, all-trans-retinoic acid), fatty acids (e.g., unsaturated

fatty acids, prostaglandins), xenobiotics (e.g., acetaminophen, clotrimazole), bile acids, and sterols.

0.2.5.1 Subclass 2 – Nuclear receptor 2 This nuclear receptor subclass has 11 members, seven of which are orphan nuclear receptors (nuclear receptors with no known ligands) (Table 0.1). In this group, we have hepatocyte nuclear factor-4 receptors (NR2A1/HNFα and NR2A2/HNFγ), retinoid X receptors (NR2B1/RXRα and NR2B1/RXRβ), testicular receptors (NR2C1/TR2 and NR2C2/TR4), and members of the COUP-TF group (NR2F1/COUP-TFI, NR2F2/COUP-TFII, and NR2F6/COUP-TFIII). In this subclass, RXRs, activated by 9-cis-RA, are of great importance as they are capable of forming heterodimers with other nuclear receptors from different subclasses, such as VDR, TRs, and RARs (reviewed in Mangelsdorf and Evans, 1995). Although the members of the COUP-TF group are considered orphans nuclear receptors, fatty acids were demonstrated to bind to them in vitro (reviewed in Weikum et al., 2018). However, it is unclear if fatty acids can bind to and activate COUP-TFs in vivo (reviewed in Weikum et al., 2018). Potential COUP-TFII ligands will be discussed later (section 0.3.2.6).

0.2.5.2 Subclass 3 – Nuclear receptor 3

Included in this subclass of nuclear receptors are estrogen receptors (NR3A1/ER and NR3A2/ER), androgen receptor (NR3C1/AR), glucocorticoid receptor (NR3C2/GR), and mineralocorticoid receptor (NR3C3/MR). The nuclear receptors in this subclass are activated by estrogens (mainly 17-estradiol or E2), glucocorticoids (cortisol in humans and corticosterone in rodents), mineralocorticoids (aldosterone), progesterone (P4), and androgens (testosterone and dihydrotestosterone/ DHT) (Table 0.1).

0.2.5.3 Subclass 4 – Nuclear receptor 4 This group contains orphan nuclear receptors that are essential for numerous biological functions, including neural development and maintenance (Table 0.1) (reviewed in Olivares et al., 2015). The three members of this subclass are considered orphan nuclear receptors and include nerve growth factor induced-B (NR4A1/NFG1-B), nurr‐related factor 1(NR4A2/NURR1), and neuron‐derived orphan receptor 1 (NR4A3/NOR-1). Among them, NURR1 may be a true orphan since its ligand-binding pocket within the LBD is filled with

hydrophobic amino acids preventing ligand binding (Wang et al., 2003). Furthermore, NURR1 is a prime example of a nuclear receptor that may not be ligand-activated as its function might be regulated by the cell-specific co-regulators and the signals regulating its cellular expression levels (Munoz-Tello et al., 2020).

0.2.5.4 Subclass 5 – Nuclear receptor 5 This group contains only two orphan nuclear receptors: steroidogenic factor 1 (NR5A1/SF1) and liver receptor homolog-1 (NR5A2/LRH1) (Table 0.1.). Both of these nuclear receptors are essential for the development of many organs and are involved in metabolism (reviewed in Weikum et al., 2018). This class of nuclear receptors was found to be activated by the phospholipids (Sablin et al., 2009). Phosphatidylcholines are principal components of the cellular lipid bilayer membranes. Mutations rearranging the LBD of SF1 resulted in a lower affinity for phosphatidylcholine and compromised its transcriptional activity in the regulation of known target genes, such as steroidogenic acute regulatory gene (Star) (Sablin et al., 2009).

0.2.5.5 Subclass 6 – Nuclear receptor 6 Germ cell nuclear factor (NR6A1/GCNF) is the only member of this family. GCNF is best known for its role in germ cell differentiation and is essential for embryonic survival (Table 0.1) (reviewed in Zechel, 2005).

0.2.5.6 Subclass 7 – Nuclear receptor 0 A major characteristic of nuclear receptors in this subclass is the lack of a DNA binding domain (DBD) (Table 0.1) (reviewed in Germain et al., 2006; Weikum et al., 2018). As mentioned previously, the DBD is essential for binding to NREs located in the gene regulatory regions. This group has only two members: the dosage‐sensitive sex reversal‐ adrenal hypoplasia congenital critical region on the X chromosome, gene 1 (NR0B1/DAX1), and the short heterodimeric partner (NR0B2/SHP). It appears that these members regulate gene expression by interacting directly with the LBD of other NRs (reviewed in Weikum et al., 2018). It was reported that DAX1, known for its essential roles in adreno-gonadal development, inhibits the transcriptional activity of SF1, LXRα, and other nuclear receptors

by competing for and interacting with common co-activators ((Ito et al., 1997; Nedumaran et al., 2010) and reviewed in Lalli, 2014).

0.2.6 Classification of nuclear receptors based on their mechanism of action The majority of nuclear receptors regulate gene expression by binding to half-sites (NRE) of the consensus sequence AGGTCA located in the promoter regions of their target genes (reviewed in Everett and Lazar, 2013). Some NREs consists of two half-sites separated by a nucleotide spacer of different lengths and oriented in either direct (DR), inverted (IR), or everted (ER) repeat (Fig 0.9) (reviewed in Everett and Lazar, 2013).

Figure 0.9 Schematic representation of four types of nuclear receptors based on mode of action. (A) Type 1 nuclear receptors are found in the cytoplasm and are bound by heat shock protein (HSP). The nuclear receptors are stimulated and released by the chaperones after being bound by a ligand (green circles) and translocated into the nucleus, where they bind to DNA as everted repeats (ER) to control transcription. (B) Nuclear receptors of type 2 are present in the nucleus, bound to co-

repressors (red circles). The co-repressor is released as the ligands bind, and nuclear receptors recruit co-activators (blue ovals). These nuclear receptors regulate gene transcription by forming heterodimers with RXR and binding to DRs, IRs, or ERs. (C) Type 3 nuclear receptors regulate gene expression in the same way as Type 2 nuclear receptors do, with the exception that they bind to DNA as homodimers. (D) Type 4 nuclear receptors function similarly to Type 2 members, except that they control transcription as monomers by binding to DNA half-sites. The model was inspired by (Weikum et al., 2018).

Once nuclear receptors are activated, their primary function seems to orchestrate gene regulation through interaction with co-factor proteins (co-activators and co-repressors). At present, at least 200 co-factors have been reported (reviewed in McKenna et al., 1999). The nuclear receptors recruit co-activators that scaffold histone acetyltransferases or histone methyltransferases to clear up chromatin for the transcriptional machinery and RNA polymerase II (reviewed in McKenna et al., 1999). As mentioned previously, nuclear receptors can repress transcription by interacting with co-repressors and recruiting histone deacetylases which will close up chromatin and inhibit transcription (reviewed in McKenna et al., 1999).

Even though the classification of nuclear receptors based on sequence homology is helpful to understand nuclear receptor evolution, it is nonetheless insufficient to determine the exact molecular mechanism of gene regulation by these transcription factors. To better understand and possibly predict how nuclear receptors regulate gene expression, they can also be classified based on their mechanism of action into four types (Fig. 0.9) (reviewed in Weikum et al., 2018).

0.2.6.1 Type 1 Nuclear receptors The nuclear receptors that belong to the Type 1 class reside in the cytoplasm and are associated with heat shock proteins (HSP) (Fig. 0.9A). Nuclear receptors in this group are the mineralocorticoid receptor (MR), glucocorticoid receptor (GR), estrogen receptor (ER), and androgen receptor (AR) (reviewed in Rastinejad et al., 2013). These nuclear receptors are activated by steroid hormones such as estrogens (estradiol-17β), tamoxifen, androgens, progesterone, and corticoids (reviewed in Sever and Glass, 2013). Upon activation by a ligand, these nuclear receptors undergo a conformational change and dissociate from HSP, allowing them to translocate into the nucleus. In the nucleus, they tend to bind as homodimers

to inverted repeats separated by three nucleotides (IR3) located in the gene promoter regions. GR, AR, MR, and PR bind the consensus sequence AGAACA, while ER recognizes AGGTCA (reviewed in Germain et al., 2006).

0.2.6.2 Type 2 Nuclear receptors Regardless of the ligand-binding state, the majority of nuclear receptors belong to the type 2 group reside in the nucleus (Fig. 0.9B). Generally, these members are bound to co-repressors. Once they are ligand-activated, the co-repressors are released and replaced with co-activators resulting in recruitment of the transcriptional complex (reviewed in Sever and Glass, 2013). The Type 2 members can bind (AGGTCA) to either direct, inverted, or everted repeats, making them the most versatile and unpredictable NRs to study in terms of mechanism of action. In this group, we find COUP-TFs and RXR. Another characteristic of these NRs is that they bind to NREs as heterodimers, usually with retinoid X receptors (RXRs). Type 2 NRs that can heterodimerize with RXR include COUP-TFs, PPARs, VDR, LXR, FXR, NURR-1, and TR (reviewed in Mangelsdorf and Evans, 1995). These findings are supported by the 3D crystal structure of RXR interacting with RAR as a heterodimer, demonstrating the stabilization of the RXR protein structure (LBD) when associated with another nuclear receptor ((Bourguet et al., 2000) and reviewed in Rastinejad et al., 2013).

0.2.6.3 Type 3 Nuclear receptors The members of this category have a mechanism of action that is similar to the Type 2 members. However, the nuclear receptors in this group tend to bind DR consensus sequences as homodimers (Fig. 0.9C). Some of the members found in this group include COUP-TFs, TR2, RAR, and RXR (reviewed in Weikum et al., 2018).

0.2.6.4 Type 4 Nuclear receptors Type 4 nuclear receptors are known to bind a single NRE as monomers to regulate gene expression (Fig. 0.9D) (reviewed in Weikum et al., 2018). They are located in the nucleus, and once they are ligand-activated, they bind to DNA. Some of the well-studied examples of nuclear receptors found in this group are SF1, NURR1, LRH-1, and NUR77. In order to bind to DNA, these nuclear receptors require additional nucleotides in the 5’ region of the HRE (AGGTCA). Some examples of the specific NREs bound by these nuclear receptors are:

TCAAGGTCA (recognized by SF1) (Ueda et al., 1992), and AAAGGTCA (recognized by NUR77/NURR1) (Mangelsdorf et al., 1995; Murphy et al., 1996).

However, the classification of nuclear receptors presented above appears to be simplistic and outdated. The view on the mode of action of nuclear receptor has shifted substantially in recent years. The main challenge and limitation to this classification is that it does not consider that nuclear receptors can associate and cooperate with members of other transcription factor families and can bind to non-NREs. Therefore, it would be beneficial to start implementing these additional mechanisms into the main four types.

0.3 Identification of the chicken ovalbumin upstream promoter transcription factor (COUP-TF) family of transcription factors In this thesis, my research investigation is focused on the mechanisms of action and roles of the chicken ovalbumin upstream promoter transcription factor type II (COUP-TFII/NR2F2) in the Leydig cells. Members of the COUP-TF group of transcription factors belong to the nuclear receptor subclass 2, group F (NR2F_). The subclass NR2F_ consists of three identified members: COUP-TFI (NR2F1, EAR3), COUP-TFII, and COUP-TFIII (NR2F6, EAR2). COUP-TFs were originally isolated from HeLa cells in the 1980s (Wang et al., 1987), and they were found to cooperate with non-DNA binding transcription factor S300- II/TFIIB to regulate chicken ovalbumin gene expression in the chicken oviduct (Sagami et al., 1986). Another group sub-cloned the human COUP-TFI gene and named it EAR-3 (Miyajima et al., 1988). In 1991, the human COUP-TFII gene was identified based on cDNA sequence comparison to COUP-TFI (Wang et al., 1991). Independently in the same year, COUP-TFII was identified as a regulator of the apolipoprotein A1 regulator protein (ARP1) gene from a placental library (Ladias and Karathanasis, 1991). COUP-TFI and COUP-TFII have been implicated in numerous biological processes, such as angiogenesis and organogenesis, and many cellular functions, such as cell differentiation, cell survival, and cell migration (reviewed in Ashraf et al., 2019; Lin et al., 2011). COUP-TFIII has been implicated in the fine-tuning of the adaptive immunity and circadian system (Hermann- Kleiter et al., 2008; Warnecke et al., 2005).

0.3.1 Expression patterns and roles of the members of the COUP-TF group 0.3.1.1 COUP-TFI distribution COUP-TFI is mostly expressed in the central and peripheral nervous cell systems and is involved in neural development (reviewed in Tang et al., 2006). Inactivation of Coup-tfi in the mouse results in defects of the central nervous system leading to death (reviewed in Polvani et al., 2019; Tsai and Tsai, 1997; Yang et al., 2017a). The hCOUP-TFI (P10589) protein is the largest of all three members and consists of 423 amino acids (UniProt, 2021). In terms of conservation, amino acid sequence comparison between hCOUP-TFII and hCOUP-TFI revealed 86% similarity (Fig. 0.10A).

Figure 0.10 Amino acid comparison of members of the human COUP-TFs. (A) The phylogenic tree depicts the evolutionary relationship of the hCOUP-TFs. The number of amino acids, as well as the percentage of similarities, are shown. (B) Multiple sequence alignment of the human COUP-TFs. The red letters represent the DNA binding domain (DBD); the green letters represent the ligand- binding domain (LBD); the asterisks indicate consensus residues. The phylogenic tree and multiple sequence protein alignments were performed using Clustal Omega web tool https://www.ebi.ac.uk/Tools/msa/clustalo/ (Sievers et al., 2011).

0.3.1.2 COUP-TFII distribution The gene coding for COUP-TFII is located on chromosome 7 in mice and chromosome 15 in humans. The mouse and hCOUP-TFII proteins consist of 414 amino acids (aa) (Fig. 0.10A) and are 100% identical (Qiu et al., 1996). In mice, COUP-TFII is found in the adrenal gland, ovary, lung, testes, epididymis, seminal vesicles, and anterior prostate (Qin et al.,

2008). Because COUP-TFII is present in many organs and tissues, it is implicated in the regulation of the expression of multiple genes associated with physiological and developmental processes like metabolic homeostasis, organogenesis, angiogenesis, energy metabolism, and adipogenesis (reviewed in Lin et al., 2011).

0.3.1.2.1 Distribution in rodents COUP-TFII is found in the mesenchymal component of several developing organs, and it regulates organ development through governing the molecular pathways involved in mesenchymal-epithelial cell interactions. In mice, COUP-TFII is detected at E8.5 in the visceral mesoderm, myocardium surrounding sinus venous, and mesoderm of umbilical veins (Pereira et al., 1999). At E9, it is found in the mesenchyme of umbilical veins, notochord, hindbrain, somite, and common atrium. Furthermore, COUP-TFII is detected in the mesenchyme of the foregut, midgut, hindgut, septum, and hepatic primordium (Pereira et al., 1999). At E9.5, COUP-TFII is detected in lateral plate mesoderm and continuously present in somites (Pereira et al., 1999). By E12.5, COUP-TFII is found in developing muscle tissues of both fore and hind limbs and in other mesenchymal tissues (Lee et al., 2004). COUP-TFII remains detectable in many organs in adult mice, including the uterus, testes, liver, stomach, mammary gland, kidney, prostate, heart, lung, and brain (reviewed in Lin et al., 2011).

In mouse testis, COUP-TFII is detected in these non-steroidogenic stem Leydig cells at E14.5, E18.5, and E19.5 (Fig. 0.11A, first column) (Mendoza-Villarroel et al., 2014b). In the mouse testis at E19.5 (Fig. 0.11A, second column, first image), COUP-TFII does not co- localize with the steroidogenic enzyme CYP11A1 (an established Leydig cell marker) at the time when fetal steroidogenic activity is at its zenith (Mendoza-Villarroel et al., 2014b). COUP-TFII is detected at postnatal day P0-36 (Fig. 0.11A, first column) and co-localizes with CYP11A1 at P36 (Fig. 0.11A, second column, second image), suggesting COUP-TFII as a marker for cells committed to the adult Leydig cell lineages. COUP-TFII is found in the immature Leydig cell lines MA-10 and MLTC-1(Mendoza-Villarroel et al., 2014b). Apart from being found in Leydig cells, COUP-TFII is also detected in some peritubular and myoid cells (Mendoza-Villarroel et al., 2014b), so it is not a suitable Leydig cell-specific marker.

Figure 0.11 Expression of COUP-TFII during mouse and human testes development. (A) Expression of COUP-TFII (brown staining) from mouse testis from embryonic day E14.5 to postnatal day P36 (first column). Double immunohistochemistry image from mouse testis at E19.5 and P36 (second column). Blue staining indicates CYP17A1. Solid arrowheads point to interstitial and arrow to peritubular cells. IS, interstitium; ST, seminiferous tubules. Image reproduced from (Mendoza- Villarroel et al., 2014b) with permission (license number 4886570748222). (B) Immunohistochemistry of human testis during development showing expression patterns COUP-TFII (brown staining) and CYP11A1 (brown staining) from the gestational week (GW) 9 to adult. Steroidogenic Leydig cells were visualized using an anti-CYP11A1 antibody. Black arrowheads point towards LCs. Immunohistochemistry images for COUP-TFII (first column) and CYP11A1 (second column). Image reproduced with permission from (Lottrup et al., 2014) (License number 4962221173866).

0.3.1.5.1 Inactivation of COUP-TFII in mouse models Heterozygous Coup-tfii (Coup-tfii+/-) mice appear smaller in size, sub-fertile (Pereira et al., 1999), and have less white adipose tissue (Li et al., 2009), suggesting essential roles in gonadal embryogenesis, fertility, and metabolism in both sexes. Zhao et al. reported that the global inactivation of Coup-tfii in female mice resulted in the retention of Wolffian ducts suggesting a role in eliminating male reproductive primordial structures (Zhao et al., 2017). In males, the Wolffian ducts give rise to the epididymis, seminal vesicles, and vas deferens. Conditional inactivation of Coup-tfii in females results in infertility due to an imbalance of progesterone levels which leads to failure of the embryo to implant (Kurihara et al., 2007), suggesting the essential roles in steroidogenesis.

Global inactivation of Coup-tfii in mice is lethal; homozygous knockout mice all die at embryonic day E10.5 due to improper angiogenesis, vein formation, and heart defects (Pereira et al., 1999). It is reported that the growth of mutant COUP-TFII mice is retarded at E9.5, and severe hemorrhage is observed in the brain and heart (Pereira et al., 1999). This could be explained by the fact that COUP-TFII was found to regulate the expression of angiopoietin-1 directly (ANG1) in cultured endothelial cells (Pereira et al., 1999). ANG1 is a ligand involved in signaling pathways regulating vascular morphogenesis (reviewed in Hanahan, 1997), explaining the effects observed in Coup-tfii knock-out mice.

To overcome COUP-TFII lethality in the mouse models, a time-dependent global ablation of COUP-TFII (Cre-ErTM(+/-)Coup-tfiiflox/flox) model was generated (Qin et al., 2008). COUP- TFII ablation was achieved by administrating multiple injections of tamoxifen between P14- P18. Mice were euthanized at P90, and the protein levels (COUP-TFII) were quantified by Western blotting. The expression of COUP-TFII was successfully reduced in adrenal, ovary, testes, epididymis, seminal vesicles, and anterior prostate (Qin et al., 2008). However, COUP-TFII expression was not reduced in the lungs, suggesting potential issues with the tamoxifen administration (Qin et al., 2008). This mouse model uncovered essential roles for COUP-TFII in Leydig cell differentiation and male fertility (Qin et al., 2008). Prepubertal ablation of COUP-TFII in this mouse model resulted in smaller testes, hypogonadism, Leydig cell hyperplasia, infertility, and a decrease in serum testosterone, presumably due to defect in Leydig cell function and their improper differentiation (Qin et al., 2008). The mRNA

expression of the steroidogenic genes, Hsd3b1, Cyp11a1, and Cyp17a1, was reduced in these mice (Qin et al., 2008), implicating the COUP-TFII role in their transcriptional regulation.

Going back to the inducible mouse model described above, immunohistochemical analysis of the interstitial region from these mice revealed Leydig cells hyperplasia due to arrested Leydig cell differentiation at the progenitor stage (Qin et al., 2008). Testosterone administration to the mutant mice did not reverse Leydig cell hyperplasia, suggesting an essential role for COUP-TFII in the initial Leydig cell differentiation from the stem to the progenitor stage (Qin et al., 2008). Lin et al. concluded that COUP-TFII plays a role in progenitor Leydig cell differentiation and is not essential for the maintenance of the adult Leydig cell population ((Qin et al., 2008) and reviewed in Lin et al., 2011). Additionally, ablation of COUP-TFII when the Leydig cell differentiation process is complete did not affect adult Leydig cell function and spermatogenesis at least in 120 days-old mice (Qin et al., 2008), suggesting COUP-TFII is not essential for the maintenance of ALC differentiated function. However, there is no noticeable difference in the number of Leydig cells between COUP-TFII-deficient mice at P14 and wild-type mice at P21. Therefore, it is very likely that the inactivation of COUP-TFII affected Leydig cell differentiation between the immature and adult stages and not the progenitor stage as reported (Qin et al., 2008).

Nevertheless, a functional COUP-TFII is essential for the maturation of the adult population of Leydig cells (Qin et al., 2008). However, the Leydig cell differentiation stage at which COUP-TFII is essential remains to be established to fully understand the differentially expressed genes affected by COUP-TFII ablation. As mentioned, COUP-TFII is also expressed in other organs, such as the hypothalamus, which could affect the Leydig cell differentiation and function and this needs to be considered. Therefore, there is a need for a mouse model that would allow the inactivation of Leydig cell-specific genes (e.g., Coup-tfii). Finally, there is no mice where COUP-TFII has been inactivated at later time points (older mice) to determine the impact of COUP-TFII inactivation on aged adult Leydig cells.

0.3.1.5.2 Expression patterns in humans Less information is available regarding COUP-TFII expression pattern in human embryo development. However, by analyzing specific COUP-TFII gene mutations in humans, a few

conclusions can nonetheless be drawn regarding the roles of COUP-TFII. Naturally occurring mutations inactivating hCOUP-TFII, causing a premature stop codon in the COUP-TFII protein, resulted in testis formation in 46XX children (Bashamboo et al., 2018). Additionally, mutations affecting the expression of functional hCOUP-TFII in male children result in overall global developmental delay, dimorphic facial features, and congenital heart defects (CHD) (Qiao et al., 2018; Upadia et al., 2018). Sequencing data from CHD patients uncovered many missense mutations (Al Turki et al., 2014). Functional promoter analyses using mutated hCOUP-TFII constructs demonstrated a significant alteration of the activity in the regulation of NGFI-A and ApoB target genes (Al Turki et al., 2014). Turki et al. suggested that the missense mutations most likely affect the ligand-binding properties of COUP-TFII (Al Turki et al., 2014).

As previously mentioned, the mouse and human COUP-TFII protein are 100% identical. The global COUP-TFII knockout mouse models revealed essential roles for COUP-TFII in embryonic development (especially cardiovascular development), resulting in early embryonic death (Pereira et al., 1999). However, human mutations causing a premature stop codon in COUP-TFII did not result in death. It would be interesting to generate a mouse model expressing these COUP-TFII mutants and examine their effects on mouse embryonic development, including gonadogenesis. This potential new mouse model could serve as an alternative to the previously described inducible (Cre-ERTM(+/-)Coup-tfiiflox/flox) model (Qin et al., 2008), and possibly some of the issues associated with tamoxifen induction may be avoided.

In the human testis, COUP-TFII is detected in the interstitial compartment at gestational weeks 9 and 10 (GW9 and GW10), but not at GW15 (Fig. 0.11B, first column) (Lottrup et al., 2014). Lottrup et al. reported that COUP-TFII expression is not detected in fetal Leydig cells (Lottrup et al., 2014), which correlates with the mouse expression data (Mendoza- Villarroel et al., 2014b). Unfortunately, Lottrup et al. did not perform co- immunohistochemistry with steroidogenic cell markers to validate their conclusion (Lottrup et al., 2014). Leydig cells from both populations (fetal and adult) were detected using CYP11A1, a Leydig cell-specific marker (Fig. 0.11B, second column). In humans, FLCs containing CYP11A1 are detected at GW10 (Fig. 0. 11B, second column) (Lottrup et al.,

2014). Contrary to this finding, another group reported that hCOUP-TFII co-localizes with hHSD3B1, another Leydig cell-specific marker, mainly during the first trimester, but the expression and co-localization diminishes at later stages (van den Driesche et al., 2012). However, it appears that hCOUP-TFII is abundant (high signal) in cells surrounding fetal Leydig cells (van den Driesche et al., 2012). Therefore, the signal intensity from those surrounding cells could have interfered with the interpretation of the data that COUP-TFII was present in fetal Leydig cells. After birth, hCOUP-TFII continues to be detected on day one and day 90 (Fig. 0.11B, first column) (Lottrup et al., 2014). Increased hCOUP-TFII levels are observed in the testis interstitium in young adolescents at 14 years of age (Fig. 0.11B, first column) (Lottrup et al., 2014). hCOUP-TFII continues to be detected in the adult Leydig cell population stage at all adult Leydig cell differentiation stages (Fig. 0.11B, first column) (Lottrup et al., 2014).

0.3.1.3 COUP-TFIII expression patterns hCOUP-TFIII, the third COUP-TF family member, is composed of 404 amino acids (UniProt, 2021) and shares only 64% sequence similarity to hCOUP-TFII (Fig. 0.10A). From the phylogenetic tree, it can be seen that COUP-TFIII is related to the other two members, and it diverged at some point during evolution (Fig. 0.10A). This suggests that all three members may share the same, yet to be identified, common ancestor gene. Alternatively, COUP-TFIII needs to be re-classified as it may share higher sequence homology with some other nuclear receptors. Unlike COUP-TFI and COUP-TFII null mice, deletion of COUP- TFIII does not affect overall health ((Warnecke et al., 2005) and reviewed in Hermann- Kleiter and Baier, 2014). Despite a healthy appearance, Coup-tfiii null mice manifest developmental defects in the forebrain, affecting circadian rhythm and nociception (Warnecke et al., 2005). COUP-TFIII mRNA is highly detected in hematopoietic cells and functions in adaptive immunity, lipid metabolism, and cancer progression (reviewed in Hermann-Kleiter and Baier, 2014).

0.3.2 Structure of COUP-TFII In the following sections, the structural and functional characteristics of COUP-TFII will be described. To better understand how COUP-TFII functions, each domain needs to be explained. This information is critical when studying interactions between COUP-TFII and

other transcription factors (such as GATA4). Amino acid sequence comparison of hCOUP- TFs reveals a high sequence homology in the DNA-binding (DBD, highlighted in red) and ligand-binding domains (LBD, highlighted in green) (Fig. 0.10B).

0.3.2.1 COUP-TFII A/B domain: AF-1 The AF-1 domain of COUP-TF is rich in proline and glutamine residues and is considered the ligand-independent activating domain. Within the hCOUP-TF subfamily of nuclear receptors, hCOUP-TFI has the most extended A/B domain (82 amino acids) compared to hCOUP-TFII (75 amino acids) and hCOUP-TFIII (52 amino acids) (Fig. 0.10B). Deleting AF-1 from COUP-TFII reduces the COUP-TFII-dependent transcriptional activity by about 50% (Kruse et al., 2008), suggesting its importance for optimal COUP-TFII activity.

0.3.2.2 COUP-TFII C domain: DNA-binding domain (DBD) Members of the hCOUP-TF nuclear receptors share the highest percent similarity within their DNA-binding domain (Fig. 0.10B, letters highlighted in red). A graphical representation of the hCOUP-TFII is shown in Figure 0. 12B. Generally, nuclear receptor DBDs have two zinc fingers characterized by P, D, T, and A boxes. COUP-TF family members have P and D boxes, both essential for DNA-binding specificity. The DNA binding domain of hCOUP- TFII consists of 79 amino acids (UniProt, 2021), and it contains two zinc finger motifs (Fig. 0.12B and C). The COUP-TFII DBD is located between residues 76 and 155 (red box). The primary protein structure shows two zinc fingers bound by zinc atoms and stabilized by four cysteines each (Figure 0.12C, dark circles). The stabilization of the first zinc fingers causes the surface of the P-box region (CEGCKS) to be accessible (Fig. 0.12C) allowing binding to the major groove of the DNA (Fig. 0.12D). The wireframe model shows the tertiary structure of COUP-TFII DBD bound to a half-site of a DR1 element (AGCTTCAGGTCAGAGGTCAGAGAGCT) (Fig. 0.12D). The amino acids lysine (K) and serine (S), part of the P-box, are known to form hydrogen bonds with guanine (G) bases (Luscombe et al., 2001), thus bind to the GG bases found in the major groove of the NREs (Fig. 0.12D). Based on this, it can be concluded that GGTC represents a core-binding sequence and strongly interacts with the first zinc finger element (P-box). The binding of the zinc atom to the second zinc finger stabilizes the D-box (PANRN), which makes contact with

the minor groove of the DNA (Fig. 0. 12D). The illustrated COUP-TFII-NRE interaction model correlates well with in vitro results (Fig. 0. 12D) (Cooney et al., 1992).

Figure 0.12 Organization of human COUP-TFII. (A) Crystal structure of the human COUP-TFII ligand-binding domain (LBD). The orange arrow points to the ligand-binding pocket. The image was taken from (Kruse et al., 2008) (This is an open-access article distributed under the terms of the Creative Commons Attribution License). (B) Schematic representation of hCOUP-TFII (P24468) showing the location of its domains. The amino acid residues that are post-translationally modified

are indicated below the diagram. Red-colored letters represent phosphorylation and orange ubiquitination. (C) The amino acid sequence of the hCOUP-TFII DNA binding domain (DBD) showing two zinc (Zn) fingers. Blue circles represent the zinc atoms, and the four cysteines (C) residues are shaded in blue. The amino acids that compose the P-box and D-box are boxed. (D) Predicted interaction of the DBD of hCOUP-TFII with a half site of DR1. The tertiary structure of the human COUP-TFII DBD was modeled using Protein Homology/analogy Recognition Engine V 2.0 (Phyre2) (Kelley et al., 2015) and superimposed over RXRα structure. The structure was visualized using IcmJS - JavaScript 3D Molecular Viewer available at http://www.molsoft.com/activeicmjs.html. The two zinc atoms (blue circles) are involved in the stabilization of the DBD. The double-helical secondary structure of the direct repeat (DR1) response element (AGCTTCAGGTCAGAGGTCAGAGAGCT) was generated using DNA sequence to structure web tool available at http://www.scfbio-iitd.res.in/software/drugdesign/bdna.jsp# and visualized via Molegro molecular viewer (Molexus IVS, Denmark).

The sequences GGTCA is generally considered a standard COUP-TF family NRE, and it was demonstrated that COUP-TFI and II have the same affinity for NRE element in vitro (Cooney et al., 1992). Based on the sequence similarities of the DBD, the COUP-TF members should recognize and bind to the same consensus sequence in vitro. Although COUP-TFI and II have high percent similarities in their DBD and LBD, they differ in the A/B domain, suggesting different mechanisms of action. Therefore, they may interact with different partners (e.g., TFs, co-factors) and it would be challenging to measure their affinity for NRE in vivo.

0.3.2.3 COUP-TFII D domain: Hinge In hCOUP-TFII, the hinge region spans residues 155 to 213 (Fig. 0.12B). Deleting amino acids 144 to 210 resulted in the accumulation of hCOUP-TFII in the cytoplasm, suggesting that this region contains a nuclear localization sequence (NLS) (Achatz et al., 1997). In addition, the COUP-TFII hinge region was found to be responsible for protein-protein interactions with Friend of GATA2 (FOG2) in the regulation of the human atrial natriuretic factor (ANF) gene (Kumarasamy et al., 2015).

0.3.2.4 COUP-TFII ligand-binding domain (LBD) Deletion constructs of hCOUP-TFII revealed that the AF2 helix within the LBD is essential for its transcriptional activity (Kruse et al., 2008). The crystal structure of the COUP-TFII LBD is shown in Figure 0.12A, and it can be seen that helix α 12 (residues 395-399, AF2, red helix) folds inside the ligand-binding pocket (orange arrow). In the same figure, it can be

seen that helix α 10 (blue helix) wraps inward around the ligand-binding pocket, suggesting that only a small ligand with high affinity is capable of penetrating the ligand-binding pocket and causing the conformational change necessary to activate the LBD. The inaccessibility of the ligand-binding pocket due to its small size suggests that members of the COUP-TF family may be true orphans (no ligand). However, disruption of the ligand-binding pocket results in reduced COUP-TFII-dependent activation of human NGFI-A by about 30-50 fold (Kruse et al., 2008), suggesting that an intact ligand-binding pocket is necessary for its full activity. The same group proposed that COUP-TFII homodimerization and interaction with co- activators require an intact aa sequence LXXLL (L-lysine, X-any amino acid) in helix α 10 (Kruse et al., 2008). Using classical luciferase promoter assays, COUP-TFII was found to cooperate with steroid receptor coactivator-1 SRCs members (1-3) and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) in the activation of human NGFI-A (Kruse et al., 2008). The functional cooperation between COUP-TFII and SRCs might be result of their molecular interaction in vivo (Kruse et al., 2008), but this has yet to be verified.

0.3.2.5 COUP-TFII F domain The experimental evidence suggests that the F-domain is not essential for hCOUP-TFII transcriptional activity (Achatz et al., 1997; Kruse et al., 2008) as deletion of this domain (residues 399-414) does not affect its transcriptional activity (Achatz et al., 1997; Kruse et al., 2008).

0.3.2.5.1 Human COUP-TFII isoforms Interestingly in humans, alternative splicing produces five COUP-TFII mRNA transcripts in differentiating embryonic stem cells (hESCs) (Rosa and Brivanlou, 2011). Two of the reported transcripts generate identical wild-type hCOUP-TFII protein, transcribed from an identical transcription start site (TSS). The only difference between the two transcripts is the size of the 5’ and 3 UTR regions (Rosa and Brivanlou, 2011). The other three transcripts are transcribed from different TSSs, generating shorter protein-coding sequences (CDS). The translation of these three transcripts produces proteins lacking the A/B domain and DBD (Rosa and Brivanlou, 2011). The expression of the three truncated isoforms and their modes of action remains to be fully understood. Although these truncated COUP-TFII isoforms lack

the DBD, the fact that they do include the AF-1 and LBD domains suggests that they may be able to indirectly control gene transcription by sequestering other nuclear receptors, including RXR. Furthermore, these truncated hCOUP-TFII isoforms might behave similarly to subclass 0 nuclear receptors (NR0). In addition to the wild-type mRNA, one of these shorter Coup-tfii mRNA variants is detected in mice. (Yamazaki et al., 2013). The presence of these isoforms in mice can be confirmed by comparing their protein levels to wild-type protein levels.

0.3.2.6 The modulators of the COUP-TFII activity Members of the COUP-TF subfamily are considered orphan nuclear receptors because their natural ligand remains unknown. Because of the small size of their ligand-binding pocket, members of the COUP-TF subfamily may be true orphans. There are only a handful of reports demonstrating that certain compounds can alter the function of COUP-TFII (Table 0.2) (Kruse et al., 2008; Le Guevel et al., 2017; Wang et al., 2020). The chemical structures, molecular weight, and reported biochemical properties are shown in Table 0.2. The reported chemicals capable of modifying COUP-TFII activity are 9-cis-retinoic acid (9-cis RA), all- trans retinoic acid (ATRA), 4-methoxynaphthalen-1-ol, COUP-TFII inhibitor A1 (CIA1), and CIA2. The molecular weight (MW) of the compounds ranges from 174.196 to 365.878 g/mol, implying that the size of the compounds that can fit into the ligand-binding pocket varies significantly. Like nuclear receptor ligands, those compounds are very hydrophobic since they are made up of benzene ring derivatives. (Table 0.2). The proposed compounds should have small carbon side chains to fit within the ligand-binding pocket to prevent steric hindrance. However, the two natural compounds (9-cis RA and ATRA) have long and rigid side chains suggesting that steric hindrance within the ligand-binding pocket may not be an issue. The three synthetic compounds (4-methoxynaphthalen-1-ol, CIA1, and CIA2) differ in their chemical properties due to their side chains. CIA1 and CIA2 have rather bulky side chains composed of benzene rings compared to 4-methoxynaphthalen-1-ol. The chemical properties of these five compounds suggest that the LBD is highly discriminatory in the type of ligands it can accommodate within its ligand-binding pocket. Since the properties of these compounds have not been thoroughly investigated to the degree required to meet the nuclear receptor ligand requirements, it is more fitting to refer to them as modulators rather than ligands. A modulator/ligand must be found endogenously and have some physiological

activity on the nuclear receptor, such as binding the ligand-binding pocket to induce conformational change to mediate an action to be considered a nuclear receptor ligand.

Table 0.2 COUP-TFII modulators

Name Structure Biochemical Reference properties 9‐cis-retinoic acid (9- EC50=17 µM (Kruse et al., 2008) cis-RA) MW=300.435

All-trans-retinoic acid EC50=28 µM (Kruse et al., 2008) (ATRA) MW=300.435

4-methoxynaphthalen- IC50=100 µM (Le Guevel et al., 2017) 1-ol MW=174.196

CIA2 2.8 µM (Wang et al., 2020)

MW=315.390

CIA1 3.2µM (Wang et al., 2020)

MW=365.878

Supplementing 9-cis-RA or ATRA to the culture media “activates” COUP-TFII and results in higher activation of NGFI-A promoter in a COS-7 fibroblast-derived cell line (Kruse et al., 2008). However, the authors did not consider that by adding excessive quantities, RA could activate pathways upstream of COUP-TFII. It was proposed that RA binds to the COUP- TFII ligand-binding pocket, increasing interaction with co-activators like SRC-1 (Kruse et al., 2008). COUP-TFII-dependent activation and cooperation with SRC-1 of the NGFI-A promoter are reduced when transfection experiments are performed using charcoal-treated serum in the culture media (Kruse et al., 2008). Subjecting culture serum to charcoal treatment is a widely used technique to strip/deplete hormone levels (e.g., testosterone, progesterone), enzymes, vitamins, molecules, and other compounds (Cao et al., 2009) to a

certain extent. Kruse et al. findings point to the existence of one or more natural ligands for COUP-TFII, which could influence its activity (Kruse et al., 2008).

Nevertheless, the higher affinity interactions (6-10X) between COUP-TFII and SRC-3-1 peptide (acts a cofactor) were observed in vitro via protein-protein binding assays in the presence of RA (Kruse et al., 2008). Kruse et al. also observed that this association with RA is concentration-dependent. It is still unknown whether RA promotes COUP-TFII homodimerization rather than increasing its affinity for SRC-1, as they concluded (Kruse et al., 2008). However, the effective concentrations (EC50) of 9-cis-RA and ATRA resulting in higher affinities between COUP-TFII and SRC-3 were determined to be 17 and 26 µM, respectively (Kruse et al., 2008). The high EC50 values may be due to steric hindrance causing poor binding of these compounds. In men, plasma circulating RA concentrations range between 4.5 to 5.5 nM (Soderlund et al., 2002), making RA unlikely COUP-TII ligands. A structurally similar compound to RA may have a higher affinity for the ligand- binding pocket, but this has yet to be discovered.

The three other compounds were reported to inhibit COUP-TFII transcriptional activity (Table 0.2). It was found that inactivation of COUP-TFII by (4-methoxynaphthalen-1-ol) reduces Cyp7a1mRNA levels (a COUP-TFII target gene) in hepatoma cells (HepG2) (Le Guevel et al., 2017). This result is most likely due to a decrease in the recruitment of COUP- TFII to the Cyp7a1 promoter, as demonstrated by ChIP assays (Le Guevel et al., 2017). The mode of inactivation was most likely through destabilization of the LBD, resulting in degradation and/or aggregation of COUP-TFII (Le Guevel et al., 2017). The CIA1 and CIA2 were demonstrated to bind to COUP-TFII and to inhibit COUP-TFII-dependent activation of the human NGFI-A promoter, most likely by disrupting interactions with other transcription factors (Wang et al., 2020). Although the cellular toxicity of CIA1 and CIA2 has not been investigated, the compounds might be a very efficient means of reducing COUP-TFII activity instead of other approaches ((i.e., siRNA-directed depletion). It still remains to be determined if the derivatives of the proposed modulators (except 9-cis-RA and ATRA) could already be present in the cells and act as natural ligands to a certain extent. It is still uncertain if the proposed COUP-TFII inhibitors (with the exception of RAs) are found in cells and function as natural ligands in any way.

0.3.2.7 Mechanism of DNA sequence recognition and binding by COUP-TFs 0.3.2.7.1 COUP-TFII response elements Members of the COUP-TF family tend to bind to direct repeat variants of the consensus

AGGTCAN(1-14)AGGTCA sequence. These sites happen to be response elements for other nuclear receptors, such as PPAR, TR, VDR, and RAR (reviewed in Park et al., 2003). More specifically, the DNA binding domain of COUP-TF binds to purine residues within the major groove of the DNA (Tsai et al., 1987). In addition to binding to the direct repeat (DR) elements, members of the COUP-TF subgroup can bind to inverted (IR) and everted (ER) consensus repeats, as well as to single NREs (Table 0.3). Table 0.3 lists the NRE, gene name, sequence and orientation, and the references.

Table 0.3 Partial list of genes regulated by COUP-TF showing sequences of the response elements.

Response Gene Sequence of the responsive element Reference Element DR0 Rat Oxytocin TGACCTTGACCC (Burbach et al., 1994) DR0 Rat Hemopexin AGACTTTGACCT (Satoh et al., 1994) DR0 Mouse Insl3 GAGCCTCGACCT (Mendoza-Villarroel et al., 2014a) DR0 CYP11B2 CAGCCTTGACCT (Kurihara et al., 2005) DR0 Chicken TGTCAAAGGTCA (Pastorcic et al., 1986) ovalbumin upstream gene DR1 Mouse Oct4 GGGCCAGAGGTCA (Schoorlemmer et al., promoter 1994) DR1 Mouse GTGTCACAGGTCA (Liu and Teng, 1992) lactoferrin DR1 Mouse Star CATCCTTGACCCT (Mendoza-Villarroel et al., 2014b) Half-site LHB TGACCTGTG (Zheng et al., 2010) DR2 CYIIIB TGACCCGCTGACCT (Chan et al., 1992) DR2 APOB CCGCGGGAAACCTGGAAAACG (Achatz et al., 1997) DR6 bovine CYP17 AAGTCAAGGAGAAGGTCA (Bakke and Lund, 1995) IR1 HEY2 GCGTCATTGATCT (Aranguren et al., 2013) ER14 Acyl Coenzyme TGACCTTTCTCTCCGGGTAAAGGTGA (Carter et al., 1994) A dehydrogenase

As mentioned previously, regulation of gene transcription by NRs can be classified into four types (Fig. 0.9). Generally, members of the COUP-TF subfamily fall into the Type 2 group, where the nuclear receptor interacts with RXR to regulate gene expression. However, for members of the COUP-TF subfamily, the type of regulation is not that predictable as they can behave as members of Type 3 (nuclear receptor homodimers binding to direct repeats) and Type 4 (binds a single NRE). Due to the high amino acid sequence similarity, the mode of gene regulation by the COUP-TF subfamily members may be very similar, if not identical.

The members of the COUP-TF subclass can bind to DNA as homodimers or heterodimers with other transcription factors, including nuclear receptor RXR. RXR recognizes the standard response element NRE, and COUP-TF members can interact with RXR to regulate gene expression by binding to NRE repeats separated by 0 to 14 nucleotides and oriented as DRs, ERs, and IRs (reviewed in Tsai and Tsai, 1997). A partial list of COUP-TF regulated genes is provided in Table 0.3, demonstrating the unpredictability of response elements recognized and making it an extremely challenging task to predict functional response elements in silico. COUP-TF members were found to regulate expression of the rat oxytocin, rat hemopexin, mouse Insl3, human CYP11B2, and chicken ovalbumin upstream gene promoters via DR0 elements. The mouse Oct4, mouse lactoferrin, and mouse Star promoters are activated via DR1 elements. The actin gene CyIIIb and human APOB are activated via DR2 elements, and the bovine CYP17 promoter via a DR6 element. An example of COUP- TF regulating gene expression via an IR element is the human HEY2 gene. COUP-TFs are known to bind as homodimers and regulate acyl coenzyme A dehydrogenase gene via an ER14 motif. Additionally, COUP-TF regulates expression of the human LHB gene via a half- site, acting as a Type 4 nuclear receptor (binds a single NRE). Generally, the sequence of the response elements is located within a proximal promoter region; it is therefore widely common to perform in silico analyses to identify and predict motifs within gene promoters that can be bound by nuclear receptors.

0.3.2.7.2 COUP-TF-dependent transcriptional activation Members of the COUP-TF family can act as molecular activators or repressors (Park et al., 2003). Three activation mechanisms have been proposed: 1) direct activation by binding to a DNA response element, 2) acting as a co-accessory factor for other transcription factors, and 3) indirect activation via other DNA-bound factors, such as SP1 (Park et al., 2003; Pipaon et al., 1999).

Some early indications suggest that COUP-TFII can bind directly to the GC-rich regions (non-NRE) in cooperation with SP1 (Qin et al., 2014). In the report describing this finding, the conclusion was based on chromatin immunoprecipitation assays (ChIP) alone (Qin et al., 2014), demonstrating only recruitment, not direct binding to DNA. As a result, this issue remains unanswered.

0.3.2.7.3 COUP-TF-mediated transcriptional repression Molecular transcriptional repression by COUP-TFs is achieved through active-repression (direct binding to NRE), passive repression (competition for NRE occupancy which may overlap with a motif for another TF), or trans-repression (sequestering the transcription factor RXR via LBD) (Leng et al., 1996; Park et al., 2003). Results from transient transfections using human APOB promoter constructs as a model, demonstrated that hCOUP-TFII protein domains involved in passive and active repression are not the same (Achatz et al., 1997). COUP-TFII passively represses transcription by interacting with other transcription factors, preventing them from binding to NREs, suggesting that COUP-TFII DBD is unnecessary for this type of repression. The interaction of COUP-TFII with other transcription factors depends on helix 10 (residues 360-372) (Kruse et al., 2008), implying that the LBD is needed for passive repression. Functional analysis using hCOUP-TFII deletants revealed that aa 210- 414 are essential for COUP-TFII active repression, while the DBD and residues 19-399 for trans-repression (Achatz et al., 1997). The active repression model states that DNA-bound COUP-TFII interacts with corepressors, such as N-CoR and SMRT, and prevents assembly of the transcriptional complex. COUP-TFs can compete with other nuclear receptors that heterodimerize with RXR for binding to the response element.

0.3.3 Transcriptional, post-transcriptional, post-translational regulation of COUP- TFII Regulation of COUP-TFII expression occurs transcriptionally, post-translationally (reviewed in Litchfield and Klinge, 2012) and post-transcriptionally (Rosa and Brivanlou, 2011). In mouse Leydig cells, inactivation of GATA4 results in decreased Coup-tfii mRNA levels (Bergeron et al., 2015). More recently, microRNAs (miRNAs) capabilities to regulate directly and indirectly COUP-TFII expression have drawn a lot of attention as miRNAs can be used for therapeutic treatments of some cancers (Rosa and Brivanlou, 2011; Yun and Park, 2020).

It was demonstrated that a 1.6 kb fragment of the Coup-tfii promoter is upregulated by administration of 9-cis-RA, suggesting that RAR and/or RXR may be involved in its transcriptional regulation (Qiu et al., 1996). Mouse Coup-tfii promoter activity is regulated by the erythroblast transformation specific (ETS) family of transcription factors (Petit et al.,

2004). POU4F3, a member of the POU family of transcription factors, was found to directly regulate Coup-tfii (Tornari et al., 2014). The level of Coup-tfii mRNA is also regulated by insulin and high glucose concentrations in hepatocytes (Perilhou et al., 2008). Furthermore, Sonic hedgehog (SHH), a hedgehog family member, was found to increase Coup-tfii mRNA levels in rodent cancer cells and astrocytes (Krishnan et al., 1997; Li et al., 2013). Given the importance of DHH in Leydig cell development (Clark et al., 2000), it may be worthwhile to explore the role of DHH in the regulation of Coup-tfii expression in these cells.

Some nuclear receptors are post-translationally modified by phosphorylation, ubiquitylation, or sumoylation (reviewed in Anbalagan et al., 2012). There is a lack of information available on COUP-TFII post-translational modifications. Several hCOUP-TFII phosphorylation sites, including threonine 39 (T39) (Bian et al., 2014), threonine 51 (T51) (Bian et al., 2014), and tyrosine 348 (Y348), as well as a ubiquitylation site at lysine (K389) (Lumpkin et al., 2017; Wagner et al., 2011), are identified in the PhosphoSitePlus database (Fig. 0.12B) (Hornbeck et al., 2015). These findings suggest that those residues within the A/B and LBD domains are needed for COUP-TFII to function properly. However, confirmation of these post- translational modifications in Leydig cells or Leydig cell lines is needed.

0.4 Hypothesis and objectives COUP-TFII is an essential regulator of ALC development in mice and was found to activate steroidogenesis by regulating the expression of Star (Mendoza-Villarroel et al., 2014b; Qin et al., 2008). Furthermore, COUP-TFII was found to cooperate with the MEF2 transcription factor to activate the expression of the steroidogenic enzyme encoding gene Akr1c14 in MA- 10 Leydig cells (Di-Luoffo et al., 2016). In silico analyses of the Hsd3b1, Cyp11a1, and Cyp17a1 promoters revealed the presence of potential COUP-TF response elements suggesting that they may be directly regulated by COUP-TFII (van den Driesche et al., 2012). COUP-TFII is important for the differentiation and function of ALCs and defining its target genes is essential to understanding its function in these cells. The hypothesis underpinning this thesis was that the nuclear receptor COUP-TFII is involved in the regulation of key genes governing Leydig cell differentiation and function. Previous results from our laboratory have shown that androgen production in a COUP-TFII-depleted model Leydig cells (MA-10, MLTC-1) is dramatically reduced (Mendoza-Villarroel et al., 2014b). The experimental work presented in this thesis aimed to decipher how COUP-TFII functions in Leydig cells.

The first objective was to identify novel COUP-TFII target genes and COUP-TFII-dependent biological pathways using a comprehensive in silico analysis of high-throughput transcriptomic data obtained from COUP-TFII-depleted MA-10 Leydig cells. The results from this investigation are presented in Chapter 1.

The results from the first objective uncovered numerous target genes affected by COUP-TFII in Leydig cells, and one of those genes is Amhr2. The second objective was to determine the mechanism of COUP-TFII action in the regulation of the mouse Amhr2 gene in MA-10 Leydig cells. The results from this study are presented in Chapter 2.

Finally, the third objective was to investigate novel cooperation between COUP-TFII and members of the GATA family of transcription factors in the regulation of Amhr2 gene transcription in a steroidogenic cell line. The results from this investigation are presented in Chapter 3.

1 Chapter 1. Identification of novel genes and pathways regulated by the orphan nuclear receptor COUP-TFII in mouse MA-10 Leydig cells

1.1 Chapter introduction In the general introduction of the thesis, I highlighted and argued the importance of investigating the mechanism of COUP-TFII action in Leydig cells. In this chapter, I addressed objective one.

Authors contributions: Raifish E. Mendoza-Villarroel performed the microarray assays, the initial data analysis, and sets of experiments (siRNA depletion, RNA isolation, RT-qPCR) for Hsd3b1 and Inha. Philippe Talbot contributed to RT-qPCR results for Gsta3 by repeating sets (6x) of experiments (siRNA depletion, RNA isolation, RT-qPCR). I performed extensive microarray data analysis, all luciferase assays (including cloning of the promoters), sets of experiments (siRNA depletion, RNA isolation, RT-qPCR) for other genes (Star, Prlr, Amhr2, Lhcgr, Cyp11a1, Pde8a, Scarb1, Gsta3, Nr0b2, Pdgrfa).

Status of the manuscript: Submitted to Biology of Reproduction in January 2021.

Identification of novel genes and pathways regulated by the orphan nuclear receptor COUP-TFII in mouse MA-10 Leydig cells1

Samir Mehanovic1, Raifish E. Mendoza-Villarroel1, Philippe Talbot1, Robert S. Viger1,2 and Jacques J. Tremblay 1,2

1 Reproduction, Mother and Child Health, Centre de recherche du centre hospitalier universitaire de Québec—Université Laval, CHUL Room T3-67, Québec City, Québec, Canada, G1V 4G2.

2 Centre for Research in Reproduction, Development and Intergenerational Health, Department of Obstetrics, Gynecology, and Reproduction, Faculty of Medicine, Université Laval, Québec City, Québec, Canada, G1V 0A6

Running title: Novel COUP-TFII-regulated genes in Leydig cells

Summary sentence: An in-depth high-throughput transcriptomic analysis of COUP-TFII- depleted Leydig cells reveals novel gene pathways and networks regulated by this orphan nuc

Keywords: Nuclear receptor, COUP-TFII, NR2F2, Steroidogenesis, Leydig cells, Transcriptomics, Gsta3lear receptor.

Disclosure statement: The authors have nothing to disclose.

1.2 Résumé Chez les hommes, les cellules de Leydig sont responsables de la production de testostérone et d'insuline-like 3 (INSL3), hormones essentielles à la différenciation sexuelle et aux fonctions de reproduction. Les facteurs de transcription II en amont de l'ovalbumine de poulet (COUP-TFII/NR2F2) appartiennent à la superfamille des récepteurs nucléaires des hormones stéroïdes / thyroïdiennes. Dans le testicule, COUP-TFII est exprimé et joue un rôle majeur dans la fonction et la différenciation des cellules destinées à se différencier en cellules de Leydig adultes stéroïdogènes pleinement fonctionnelles. La production de stéroïdes dans les cellules de Leydig appauvries en COUP-TFII est diminuée, indiquant un rôle important dans la stéroïdogenèse. Jusqu'à présent, seule quelques gènes cibles ont été identifiés pour COUP- TFII dans les cellules de Leydig. Pour fournir de nouvelles informations sur le rôle de COUP- TFII dans les cellules de Leydig, nous avons effectué des analyses de micropuce de cellules de Leydig MA-10 appauvries en COUP-TFII. Les données du micropuce ont révélé 262 gènes différentiellement exprimés dans des cellules MA-10 appauvries en COUP-TFII impliqués entre autres dans la biosynthèse des lipides, le métabolisme des lipides, le développement des gonades mâles et la stéroïdogenèse. Les gènes dont l’expression diminue dans les cellules MA-10 Leydig appauvries en COUP-TFII incluent: Hsd3b1, Cyp11a1, Prlr, Pdgfra, Shp/Nr0b2, Ear1 /Nr1d1, Fdx1, Inha et Gsta3. Nous avons validé les données des puces à ADN pour certains gènes par RT-qPCR. De plus, nous avons identifié le gène Gsta3 comme cible directe pour COUP-TFII. Nos données fournissent des preuves supplémentaires renforçant l'importance de COUP-TFII dans la stéroïdogenèse, l'homéostasie des androgènes, la défense cellulaire et la différenciation dans les cellules de Leydig

1.3 Abstract In males, Leydig cells are the main producers of testosterone and insulin-like 3 (INSL3), two hormones essential for sex differentiation and reproductive functions. Chicken ovalbumin upstream promoter-transcription factors I (COUP-TFI/NR2F1) and COUP-TFII (NR2F2) belong to steroid/thyroid hormone nuclear receptor superfamily of transcription factors. In the testis, COUP-TFII is expressed and plays a role in the differentiation of cells committed to give rise to fully functional steroidogenic adult Leydig cells. Steroid production has also been shown to be diminished in COUP-TFII-depleted Leydig cells, indicating an important functional role in steroidogenesis. Until now, only a handful of target genes have been identified for COUP-TFII in Leydig cells. To provide new information into the mechanism of action of COUP-TFII in Leydig cells, we performed microarray analyses of COUP-TFII- depleted MA-10 Leydig cells. We identified 262 differentially expressed genes in COUP- TFII-depleted MA-10 cells. Many of the differentially expressed genes are known to be involved in lipid biosynthesis, lipid metabolism, male gonad development, and steroidogenesis. We validated the microarray data for a subset of the modulated genes by RT-qPCR. Downregulated genes included Hsd3b1, Cyp11a1, Prlr, Shp/Nr0b2, Fdx1, Scarb1, Inha and Gsta3. Finally, analysis of the Gsta3 gene promoter showed that at least one the downregulated genes is potentially a new direct target for COUP-TFII. These data provide new evidence that further strengthens the important nature of COUP-TFII in steroidogenesis, androgen homeostasis, cellular defense, and differentiation in mouse Leydig cells.

1.4 Introduction The chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII/NR2F2) belongs to a subfamily of COUP-TF nuclear receptors. COUP-TFII is expressed in various cell types and tissues (reviewed in Lin et al., 2011; Polvani et al., 2019; Tsai and Tsai, 1997; Wu et al., 2016). Global inactivation of Coup-tfii in mice causes severe hemorrhaging and ultimately death due to defects in angiogenesis and heart development (Pereira et al., 1999). Tissue-specific inactivation of Coup-tfii in stomach, uterus, limbs, skeletal muscle, and endothelial cells uncovered additional essential roles for COUP-TFII in cell differentiation, cell function, and organogenesis (Kurihara et al., 2007; Lee et al., 2004; Lee et al., 2017; Petit et al., 2007; Takamoto et al., 2005; You et al., 2005). In humans, genetic mutations in COUP-TFII that disrupt COUP-TFII protein levels lead to forms of congenital heart abnormalities (Upadia et al., 2018; Wang et al., 2019) and disrupted testis formation in XX children (Bashamboo et al., 2018).

COUP-TFII has been detected in interstitial and peritubular cells of the human testis at the embryonic, neonatal, juvenile, and adult stages of development (Harpelunde Poulsen et al., 2019; Lottrup et al., 2014). In the mouse testis, COUP-TFII is also found in testicular interstitial cells throughout ontogeny (Mendoza-Villarroel et al., 2014b). Located in the interstitial space within the testis, Leydig cells produce two hormones, Insulin-like 3 (INSL3) and androgens, including testosterone. Although INSL3 and androgens are essential for the development and function of the male reproductive system during both fetal and postnatal life, two distinct populations of Leydig cells are responsible for the production of these hormones during these periods: the fetal Leydig cells (FLC) and the adult Leydig cells (ALC) (reviewed in Shima, 2019). In mammals, ALC differentiation is characterized by four stages: stem, progenitor, immature and mature stage (reviewed in Chen et al., 2010). COUP-TFII was found to be present specifically in Leydig cells of the ALC population at all differentiation stages (Mendoza-Villarroel et al., 2014b). Using an inducible time-dependent Coup-tfii knockout model, Qin et al found that in the absence of COUP-TFII, ALC differentiation was arrested at the progenitor stage leading to Leydig cell hypoplasia, decreased serum testosterone levels, and increased circulating luteinizing hormone (LH) (Qin et al., 2008).

Generally, COUP-TFII regulates gene expression by binding as monomer, homodimer and heterodimer with RXR to a nuclear receptor response element (NRE) containing the core sequence AGGTCA (reviewed in Polvani et al., 2019). In mouse Leydig cells, COUP-TFII was found to contribute to steroidogenesis by activating Star gene expression through a direct repeat 1 (DR1) element in its promoter (Mendoza-Villarroel et al., 2014b). In mouse Leydig cells, COUP-TFII has also been reported to activate the transcription of the gene Insulin-like 3 (Insl3) through a DR0 element (Mendoza-Villarroel et al., 2014a), 3α‐hydroxysteroid dehydrogenase enzyme type 1 (Hsd3a1, Akr1c14) via DR7 element (Di-Luoffo et al., 2016), and anti-Müllerian hormone receptor type 2 (Amhr2) via GC-rich element (Mehanovic et al., 2019).

To expand our knowledge of the mechanism of action of COUP-TFII in Leydig cells, we used small interfering RNAs (siRNAs) to knock down COUP-TFII levels in MA-10 Leydig cells followed by transcriptomic analysis. Detailed microarray analyses of COUP-TFII- depleted MA-10 Leydig cells identified new COUP-TFII-dependent genes, which provide us with a better understanding of how COUP-TFII controls testosterone levels and therefore steroid production in Leydig cells.

1.5 Materials and methods 1.5.1 Expression and reporter plasmids The mouse Amhr2 (-1486/+74 bp and -34/+74 bp), Gsta3 (-2068/+38 bp and -76/+38 bp), and Inha (-683/+41 bp) reporter constructs were described previously (Di-Luoffo et al., 2015; Mehanovic et al., 2019). The -1923/+112 bp mouse Hsd3b1 promoter fragment was PCR amplified from mouse genomic DNA using the primer set listed in Table 1.1. The PCR amplicon was gel extracted, enzyme digested, and cloned into a Xho I/Kpn I digested modified pXP1 luciferase reporter vector (Tremblay and Viger, 1999). The mouse -21/+38 bp Gsta3 promoter construct was PCR amplified from the -76/+38 bp Gsta3 plasmid using PfuUltra High-Fidelity DNA Polymerase AD (Agilent Technologies, California, USA) following the manufacturer’s instructions with the primer set listed in Table 1.1. The mouse COUP-TFII expression vector was generated by subcloning the coding sequence into pcDNA3.1 (Invitrogen Canada, Ontario, Canada) as previously described (Mehanovic et al., 2019). The sequences of the constructed plasmids were confirmed by an on-site sequencing service.

1.5.2 Cell culture Mouse MA-10 Leydig cells (ATCC, Cat# CRL-3050, RRID:CVCL_D789), donated by Dr. Ascoli (University of Iowa, USA), were grown in DMEM/F12 medium supplemented with 2.438 g/L sodium bicarbonate, 3.57 g/L HEPES, 15% horse serum, 50 mg/L penicillin and o streptomycin sulphate on plates coated with 0.1% gelatin at 37 C and 5% CO2. MA-10 cells, generated from Leydig cell tumours, represent immature ALC (Ascoli, 1981). Upon stimulation by luteinizing hormone/human chorionic gonadotrophin (Lhcgr), forskolin, or cAMP, MA-10 Leydig cells produce mainly progesterone due to a defect in 17- hydroxylase/17,20 lyase (CYP17A1) activity (Engeli et al., 2018).

1.5.3 siRNA-mediated depletion of COUP-TFII, RNA isolation, Microarray and RT- qPCR Endogenous COUP-TFII was depleted in MA-10 Leydig cells using an siRNA approach as described previously (Mehanovic et al., 2019). Briefly, MA-10 cells were transfected with 150 nM of COUP-TFII targeting siRNA (Nr2f2-MSS235957 Thermo Fisher Scientific, Ontario, Canada) or with Stealth RNAi™ siRNA Negative Control, Med GC (siRNA Ctrl)

(Thermo Fisher Scientific, Ontario, Canada) for 48 hours using JetPRIME Transfection Reagent (PolyPlus-transfection, Illkirch, France) or polyethylenimine hydrochloride (PEI) (Sigma-Aldrich Canada, Ontario, Canada). Next, the siRNA-treated cells were collected, and total RNA was isolated using either TRIZOL reagent (Thermo Fisher Scientific, Ontario, Canada) or the guanidinium thiocyanate procedure (Chomczynski and Sacchi, 2006). Total RNAs were isolated from three independent experiments, and 250 ng of each were submitted to the microarray facility at the Centre Hospitalier Universitaire de Québec Research Centre. Samples were prepared as described previously in (Abdou et al., 2014). DNA microarray experiments were carried out using Affymetrix Mouse Gene 1.0 ST arrays (Thermofisher Scientific, Ontario, Canada).

For microarray data validation, cDNA was synthesized using iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Ontario, Canada) as previously described (Bergeron et al., 2015; Martin et al., 2008; Mehanovic et al., 2019). Generated cDNA was used as a template for qPCR experiments using FastStart DNA Master SYBR Green I (Roche Diagnostics, Québec, Canada) or SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Ontario, Canada). The qPCR measurements were performed using a LightCycler 1.5 (Roche Diagnostics, Québec, Canada) or CFX96 (Bio-Rad Laboratories, Ontario, Canada) real-time PCR instrument. The sequences of primer sets for each gene and their melting temperatures are listed in Table 1.1. The mRNA levels were calculated using Pfaffl’s method (Pfaffl, 2001) or as previously described (Bergeron et al., 2015; Martin et al., 2008; Mehanovic et al., 2019). Relative gene expression from COUP-TFII-depleted and Ctrl MA-10 cells was normalized to the expression of internal Rpl19 control and data plotted as a percent of the siRNA Ctrl- treated samples.

1.5.4 Microarray data processing Microarray data were analysed using Partek genomics suite 7.0 (Partek, Inc. St. Louis, MO, USA). To generate a list of differentially expressed genes, analysis of variance (ANOVA) was performed and genes with absolute difference greater than 1.3-fold and unadjusted P- value <0.01 compared to the siRNA Ctrl-treated samples were selected.

1.5.5 Gene ontology and motif prediction First, the list of differentially expressed genes identified by Partek analysis was sorted in ascending order based on fold change. Enriched gene ontology biological processes (GO BP) and Reactome biological pathways were generated from the list of downregulated genes using the g:Profiler web-based tool with a threshold value set at 0.05 (Raudvere et al., 2019; Reimand et al., 2019). The enriched networks were visualized using Cytoscape (Shannon et al., 2003), a network visualization software (version 3.7.2), with Enrichment map plugin (Merico et al., 2010) and Reactome plugin (Wu et al., 2010). To detect the presence of potential direct repeat (DR1) and nuclear receptor element (NRE) in a gene of interest, the proximal gene promoter regions (-500 bp to +50 bp) were downloaded from the NCBI database and scanned for DR1 and NRE motifs (Yusuf et al., 2012) using the web-based motif discovery tool FIMO (version 5.1.0) (Grant et al., 2011). The P-value, q-value, and false discovery rate are indicated in Table 1.6.

1.5.6 Accession number Microarray data have been deposited in the GEO database (GSE163283) and can be assessed using the following link https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE163283 and entering the token ezcvwgwsbnqjpgd into the box. Please note that this is a temporary link for review purposes only; a permanent publicly available link will be made available upon acceptance of the manuscript.

1.5.7 Cell transfections and luciferase assays To measure promoter activation, transient transfections of MA-10 Leydig cells were performed using polyethylenimine hydrochloride (PEI) (Sigma-Aldrich Canada, Ontario, Canada) as previously described (Mehanovic et al., 2019). Briefly, the cells were plated in 24-well plates 24 h prior to transfection. The next day, the cells were co-transfected with 400 ng of reporter vector along with 100 ng of expression vector (empty as control, or COUP- TFII expression vector) and PEI dissolved in OPTI-MEM medium (GIBCO by Life Technologies, Burlington, Ontario, Canada). Sixteen hours after transfection, the media was replaced, and the cells were grown for an additional 32 h. After the cells were lysed, the lysates were collected and luciferase measurements were performed using a Tecan Spark

10M multimode plate reader (Tecan, North Carolina, USA) as previously described (Martin et al., 2008; Martin et al., 2009).

1.5.8 Western blots Extraction, quantification, and electrophoresis of nuclear proteins from MA-10 Leydig cells was performed as previously described (Mehanovic et al., 2019). Immunodetection of COUP-TFII and Lamin B proteins was performed using a mouse monoclonal anti-COUP- TFII antibody (dilution 1:1000; R&D systems Inc, Minnesota, USA; Cat#PP-H7147-00, RRID:AB_2155627) (RRID:AB_2155627 and https://scicrunch.org/resolver/AB_2155627) and a polyclonal anti-Lamin B antibody made in goat (dilution 1:1000; Santa Cruz Biotechnology, California, USA; Cat# sc-6216, RRID:AB_648156) (RRID:AB_648156 and https://scicrunch.org/resolver/AB_648156), respectively.

1.5.9 Statistical analyses Statistical analyses between two groups were performed using Student’s t-test in Microsoft Excel (Microsoft Corporation, USA) (RRID:SCR_016137 and https://scicrunch.org/resolver/SCR_016137). P-values from each comparison are indicated in the figure legend.

1.6 Results 1.6.1 Validation of siRNA-mediated reduction of COUP-TFII expression in MA-10 Leydig cells Previous studies have established a role for COUP-TFII in Leydig cell differentiation and steroidogenesis (Mendoza-Villarroel et al., 2014b; Qin et al., 2008). However, the mechanism of action of COUP-TFII in Leydig cells remains unclear as only a handful of COUP-TFII target genes have been identified in these cells (Di-Luoffo et al., 2016; Mehanovic et al., 2019; Mendoza-Villarroel et al., 2014a; Mendoza-Villarroel et al., 2014b). To gain additional insights into how COUP-TFII acts in Leydig cells, COUP-TFII was depleted in MA-10 Leydig cells using an siRNA-directed approach. Efficiency of COUP- TFII depletion was determined by western blotting and RT-qPCR. As shown in Figure 1.1A, Coup-tfIii mRNA levels were reduced by about 70% compared to the siRNA Ctrl-treated cells after 48 hours. COUP-TFII protein levels were similarly reduced in COUP-TFII- depleted MA-10 Leydig cells (Fig. 1.1B).

1.6.2 Microarray analysis To identify differentially expressed genes in COUP-TFII-depleted MA-10 Leydig cells, total RNA was collected from three independent experiments and used for microarray studies. Microarray data were analyzed utilizing the Partek Genomics Suite software and are presented in Supplemental Table S1. The quality of the microarray data was visualized and evaluated using intuitive Principal Component Analysis (PCA) method which simplifies high throughput data while retaining patterns. The 2D-PCA biplot produced two distinct, non- overlapping clusters corresponding to the samples that were collected from cells treated with COUP-TFII siRNAs (green circles) or Ctrl siRNAs (orange circles), indicating that COUP- TFII has an impact on the transcriptome of MA-10 Leydig cells (Fig. 1.2A).

A heatmap showing differentially expressed genes was generated with a threshold fold change of ±1.3 and an unadjusted P-value of <0.01 and is presented in Figure 1.2B. Under these screening parameters, 262 genes were identified to be differentially expressed, of which 205 genes were downregulated (represented in red) and 57 upregulated (represented in blue). The top 50 downregulated genes are presented in Table 1.2, showing gene name, fold change, and P-value. A full list of differentially expressed genes is provided in Supplemental Table

S2. The most downregulated gene is Pten with fold change of -2.27. As expected, the previously identified COUP-TFII Leydig cell target genes Star (-1.71 fold) and Akr1c14 (- 1.66 fold) were picked up in the microarray screen (Table 1.2). Additionally, Coup-tfii was also downregulated by 1.56 fold.

1.6.3 Biological processes affected by COUP-TFII Gene Ontology (GO) computational analysis is a widely used and accepted approach to associate a gene product to a particular cellular, molecular, or biological process (Hill et al., 2008). To identify biological processes (BPs) impaired by the depletion of COUP-TFII in MA-10 Leydig cells, the 205 downregulated genes were used in GO analysis. GO analysis produced 376 GO BP terms; the top 20 most affected biological processes are listed in Table 1.3 and the full list of BP terms is presented in Supplemental Table S3. Several functions were identified as impaired including biological, metabolic, cellular, cell proliferation, and developmental processes as well as their mode of regulation. This further supports the role of COUP-TFII in steroidogenesis in addition to identifying novel broader roles in Leydig cell function and differentiation.

The uncovered BPs associate a gene to a particular process without demonstrating relationship between the two. To better delineate the roles of COUP-TFII in Leydig cells, the list of 205 downregulated genes was further investigated using g:Profiler to identify which REACTOME pathways are affected (Fig. 1.3 and Table 1.4) in COUP-TFII-depleted MA- 10 cells. Use of REACTOME databases provides a highly detailed representation of the pathways at the molecular level. As shown in Table 1.4, 34 REACTOME pathways were enriched when the significance threshold level was set at 0.1. To illustrate the most probable pathways impaired in COUP-TFII-depleted MA-10 cells, the pathways were sorted based on the FDR values (the smaller the value, the higher probability). Table 1.4 shows that several metabolic pathways were affected, including metabolism, lipid metabolism, steroid metabolism, biological oxidations, and signal transduction, all of which are consistent with a disruption in the steroidogenic function of the cell. Although the g:Profiler REACTOME approach identifies the pathways that are impaired in COUP-TFII-depleted Leydig cells, it does not represent the complex interrelationship between them. To get visual insights into pathway interactions, the Cytoscape plugin EnrichmentMap was used. As shown in Figure

1.3, we found that COUP-TFII was involved in general REACTOME pathways implicated in Generic Transcription Pathway, RNA polymerase II transcription, Signal Transduction, and Metabolism (Fig. 1.3, blue ovals). Consistent with previous reports implicating COUP- TFII in Leydig cell function (Di-Luoffo et al., 2016; Mehanovic et al., 2019; Mendoza- Villarroel et al., 2014a; Mendoza-Villarroel et al., 2014b), we found that REACTOME pathways involved in steroidogenesis were affected in COUP-TFII-depleted Leydig cells (Fig. 1.3, green oval). These included Metabolism of steroid hormones, Metabolism of steroids, and Metabolism of lipids, which are well linked to each other (Fig 1.3, green oval). The REACTOME pathways involved in small molecule membrane transport are grouped by a purple oval. Additional REACTOME pathways involved in cellular defense, which include bile acid metabolism (bile acid is produced from cholesterol) are identified by red ovals in Figure 1.3. Taken together, these data establish COUP-TFII’s essential involvement in steroidogenesis and more generally lipid metabolism in Leydig cells.

1.6.4 Validation of microarray results via qPCR In silico analyses of the microarray data provided significant evidence demonstrating that several genes and biological processes were impaired by depletion of COUP-TFII in MA-10 Leydig cells. To validate the variation in mRNA levels observed with the microarray analysis, we selected a series of genes involved in steroidogenesis (Fig. 1.4A), cholesterol transport (Fig. 1.4B), metabolic process (Fig. 1.4C), lipid metabolic process (Fig. 1.4D), and male gonad development (Fig. 1.4E) for further investigation by RT-qPCR. As shown in Figure 1.4, mRNA levels for Star, Prlr, Cyp11a1, Lhcgr, Gsta3, Fdx1, Scarb1, Inha, Hsd3b1, Nr0b2, and Amhr2 were significantly reduced by 47%, 32%, 33%, 14%, 38%, 16%, 40%, 82%, 50%, 60%, and 55%, respectively, which is comparable to the calculated fold changes obtained with the Partek analysis of the microarray data (Table 1.5). From the list of upregulated genes from the microarray data (Table 1.5), we chose to validate Pdgfra that had a fold change +1.19. The results from RT-qPCR confirmed that the mRNA levels of Pdgfra were indeed increased by 64% (Fig. 1.4E). Next, we chose Pde8a with a fold change of - 1.12, which was outside of our initial screening criteria (difference greater than absolute 1.3 fold). The mRNA levels of Pde8a were found to be significantly reduced by 17% in the qPCR experiments (Fig. 1.4A), therefore suggesting that genes with absolute fold changes as low as 1.12 may be considered.

1.6.5 Motif discovery COUP-TFII regulates gene expression by binding most often directly to nuclear response elements (AGGTCA, NRE) and direct repeats (AGGTCANAGGTCA, DR1), or their variants, that are present in the promoter region of target genes (reviewed in Tsai and Tsai, 1997). Therefore, it may be assumed that COUP-TFII could modulate the expression of the differentially expressed genes in COUP-TFII-depleted MA-10 Leydig cells through NRE, DR1 and their variants. We next determined if a subset of the modulated genes contains a DR1 or NRE by performing in silico analysis of the -500/+50 bp region of their gene promoters. The promoter region of each gene analyzed, the matched sequences and their locations, the P- and q-values are listed in Table 1.6. We screened the promoter regions for RGGYCARAKRYMV (DR1) and RGGYCA (NRE) motifs. As shown in Table 1.6, Pdgfra was the only gene that did not contain any potential DR1 or NRE in its proximal promoter region. Potential DR1 and NRE elements were detected, however, in the promoter of the Inha, Amhr2, Lhcgr, Cyp11a1, Hsd3b1, Pde8a, Scarb1, Gsta3, Fdx1, and Nr0b2 genes (Table 1.6), in addition to the previously characterized DR1 in the Star promoter (Mendoza- Villarroel et al., 2014b). In the proximal promoter region of the Prlr gene, only a NRE was detected. Based on the presence of DR1s or NREs, it can be speculated that these genes could be direct targets of COUP-TFII in MA-10 Leydig cells.

1.6.6 COUP-TFII activates the mouse Gsta3 promoter To investigate whether COUP-TFII directly activates gene transcription via the predicted motifs mapped within a proximal promoter region, we performed functional promoter luciferase assays. We chose to investigate the Gsta3 gene, which is involved in metabolic process, as well as the Hsd3b1, and Inha genes that are involved in Leydig cell function. Since Amhr2 is a recently identified target for COUP-TFII in Leydig cells (Mehanovic et al., 2019), the mouse Amhr2 promoter was used as a positive control. As expected, the -1486 bp Amhr2 promoter was activated by about 17 fold by COUP-TFII while the minimal -34 bp reporter, devoid of COUP-TFII response element, was not significantly activated (Fig. 1.5A). (Mehanovic et al., 2019).

In mice, members of the GSTA protein family are involved in detoxification and reduction of fatty acids and phospholipid hydroperoxides (Zhao et al., 1999). To test whether COUP-

TFII activates the mouse Gsta3 promoter, transient transfections were performed in MA-10 Leydig cells using a -2062/+38 bp Gsta3 and a minimal -21/+38 bp Gsta3 reporter lacking putative COUP-TFII binding motifs. As shown in Figure 1.5B, a 2.6-fold activation was observed in the presence of COUP-TFII on the -2062/+38 bp reporter while the -21/+38 bp construct was not significantly activated by COUP-TFII. These data are consistent with the fact that the mouse Gsta3 gene has a single predicted DR1 element located between -267 bp and -255 bp and a single NRE located between -315 bp and -310 bp within the proximal promoter (Table 1.6). Since the -21/+38 bp Gsta3 construct lacks both DR1 and NRE, our data suggest that the DR1 and/or NRE may be involved in the COUP-TFII-dependent activation of the Gsta3 promoter.

In steroidogenic cells, the HSD3B1 enzyme is required for steroid hormone biosynthesis. In silico analysis revealed that the mouse Hsd3b1 gene has two potential DR1 elements located between -298 bp and -286 bp as well as between +13 bp and +25 bp, respectively. Additionally, it has a single NRE located between +20 bp and +25 bp (Table 1.6). Despite the presence of these potential COUP-TFII response elements, a -1923/+112 bp mouse Hsd3b1 luciferase reporter was not activated by COUP-TFII (Fig. 1.5C).

In Leydig cells, inhibin  (Inha) is implicated in regulation of the HPG axis (reviewed in Anderson and Sharpe, 2000). The mouse Inha has a single potential DR1 element located between -387 bp and -375 bp, and three potential NRE (-116 bp to -111 bp, -111 bp to -106 bp, and -39 bp to -34 bp) (Table 1.6). The mouse -683/+41 bp Inha luciferase reporter, however, was not activated by COUP-TFII (Fig. 1.5C).

1.7 Discussion An inducible Coup-tfii global knockout mouse model has been used to show a role for COUP- TFII in Leydig cell differentiation and function (Qin et al., 2008). In this model, Leydig cells failed to fully differentiate and were arrested at the progenitor stage (Qin et al., 2008). Additionally, their steroidogenic production was reduced (Qin et al., 2008). Identifying the molecular pathways and specific target genes governed by COUP-TFII in Leydig cells remain critical areas to completely define its mechanism of action in Leydig cells. Previous studies identified a handful of target genes directly regulated by COUP-TFII in Leydig cells (Di-Luoffo et al., 2016; Mehanovic et al., 2019; Mendoza-Villarroel et al., 2014a; Mendoza- Villarroel et al., 2014b). Each of these studies was focused on a single gene. Our present work provides a broader picture of the genes regulated by COUP-TFII in Leydig cells. Using a transcriptomic approach of COUP-TFII-depleted MA-10 Leydig cells, we have identified 262 differentially expressed genes, including 205 downregulated genes. An in-depth bioinformatic analysis of our data revealed that more than 20 biological processes and 35 pathways are orchestrated by COUP-TFII in MA-10 Leydig cells.

1.7.1 COUP-TFII regulates transcription of multiple genes involved in Leydig cell steroidogenesis and HPG axis homeostasis Our current results are consistent with previous findings where COUP-TFII was found to activate steroidogenesis by regulating the expression of the key steroidogenic gene Star in Leydig cells (Mendoza-Villarroel et al., 2014b). The results reported herein reveal additional genes encoding steroidogenic enzymes (Cyp11a1, Hsd3b1, and Gsta3) and a supporting protein (Fdx1) whose expression was reduced by depletion of COUP-TFII. The results are in agreement with findings from inducible Coup-tfii knockout mice where decreased expression of Hsd3b1 and Cyp11a1 was reported (Qin et al., 2008).

COUP-TFII typically regulates gene expression by binding directly to response elements located within the promoter region of its target genes (reviewed in Lin et al., 2011). Although the mouse Inha, Hsd3b1, and Gsta3 proximal promoters have multiple potential COUP-TFII response elements (DR1 and NRE), only the Gsta3 promoter was activated by COUP-TFII. COUP-TFII likely regulates Gsta3 expression by binding to one or both response elements. The fact that COUP-TFII failed to activate some of the promoters despite the presence of

potential response elements is not unique to this transcription factor. It is known that the presence of a transcription factor binding motif in a promoter sequence does not necessarily mean it is functional. Members of the nuclear receptor subfamilies tend to have almost identical binding affinities for similar DNA response elements (reviewed in Cotnoir-White et al., 2011). For instance, the nuclear receptor retinoid X receptor alpha (RXR) was found to have identical affinity for DR1 element as COUP-TFII (Fang et al., 2012). This nuclear receptor was also found to be expressed in rodent Leydig cells (Boulogne et al., 1999; Gaemers et al., 1998). Alternately, activation by COUP-TFII might require the binding of additional transcription factors to elements located outside of the promoter fragment used in our assays. Another plausible explanation is that the response element is not accessible due to steric hindrance caused by other nearby DNA-bound proteins, including estrogen receptor (Chu et al., 1998), forkhead box A1 (FOXA1) factor and GATA binding proteins (GATA) (Erdos and Balint, 2020). Or the element could be occupied by another protein with a higher affinity for the element. Nuclear receptor SF1 (NR5A1, AD4BP) is highly expressed in Leydig cells (reviewed in Parker et al., 2002) where it regulates expression of some of the same genes as COUP-TFII, such as Star (Mendoza-Villarroel et al., 2014b) and Amhr2 (Teixeira et al., 1999). COUP-TFII and SF1 were found to compete for the same NRE present in regulatory regions of many genes, including Cyp17a1 (Bakke and Lund, 1995) and Oxt (Wehrenberg et al., 1994) This is not uncommon for nuclear receptors since several are known to bind to similar sequences (reviewed in Weikum et al., 2018), and Leydig cells are known to express several nuclear receptors (reviewed in Martin and Tremblay, 2010).

Although COUP-TFII was found not to activate a fragment of the Cyp11a1 promoter (Mendoza-Villarroel et al., 2014b), Cyp11a1 mRNA levels were nonetheless significantly reduced in COUP-TFII-depleted Leydig cells implying a role for COUP-TFII. The mitochondrial CYP11A1 enzyme is responsible for the transformation of cholesterol into pregnenolone and marks the first step of testosterone synthesis. By donating electrons, FDX1 is considered a critical regulator of CYP11A1 enzymatic activity (reviewed in Nebert et al., 2013). Fdx1 mRNA levels were also reduced in the absence of COUP-TFII. Under certain conditions, Leydig cells and Leydig cell lines rely on exogenously available cholesterol esters for steroidogenesis, which is regulated by the scavenger receptor class B type 1 (SRB1 or SR-BI) pathway, a receptor for cholesterol-carrying lipoproteins, encoded by the Scarb1

gene (Rao et al., 2003; Reaven et al., 2000). Interestingly, we found that Scarb1 mRNA levels are significantly reduced in the absence of COUP-TFII thus suggesting additional essential roles for COUP-TFII in the activation of steroidogenesis. Another important regulator of cholesterol bioavailability for steroidogenesis is the protein STAR and expression of Star is significantly reduced in the absence of COUP-TFII (this work and (Mendoza-Villarroel et al., 2014b)). A reduction of SRB1 levels would lead to a decrease in intracellular cholesterol availability while decreased STAR levels reduces the availability of CYP11A1 substrate, which ultimately contributes to a reduction of Cyp11a1 expression. Altogether, these findings further strengthen the role of COUP-TFII as an essential activator of the initial steps of steroidogenesis in Leydig cells.

Members of GST superfamily of enzymes are mostly recognized for their roles in cellular detoxification by making electrophilic radical biproducts more suitable for cellular export (reviewed in Allocati et al., 2018). Members of the GSTA subfamily, GSTA1, GSTA2, GSTA3, GSTA4, are detected in mouse and human Leydig cells (Klys et al., 1992; Mitchell et al., 1997). Steroidogenesis produces a high number of reactive oxygen species, which are known to downregulate the expression of essential steroidogenic enzymes (Lee et al., 2009). Our microarray data revealed a significant reduction in the expression level of several detoxification genes, including Gsta1, Gsta2, Gsta3, and Gsta4, in Leydig cells depleted in COUP-TFII. Although we found that COUP-TFII can activate the Gsta3 promoter, our microarray data suggest it may have a broader role in the regulation of several genes of the oxidative stress response.

In addition to producing testosterone, Leydig cells also contribute to the homeostasis of the HPG axis by producing Inhibin, a heterodimeric glycoprotein hormone composed of two α and β subunits encoded by the Inha and Inhba genes (reviewed in Anderson and Sharpe, 2000). Our results have confirmed a reduction of mRNA levels for both Inha and Inhba genes in COUP-TFII-depleted Leydig cells. Even though Inha mRNA levels were reduced, we found that COUP-TFII could not directly activate an Inha reporter construct, which would be consistent with an indirect regulation. Alternatively, the functional COUP-TFII response element, or that of another required transcription factor, might be located outside of the

fragment used in our assays (-683/+41 bp). Additional work is required to elucidate the mechanism of COUP-TFII action on Inha expression.

1.7.2 COUP-TFII and Leydig cell proliferation and differentiation Prolactin, signaling through its receptor PRLR (encoded by the Prlr gene), has a biphasic effect on steroidogenesis in rats (Maran et al., 2001) as well as in the MA-10 Leydig cell line (Weiss-Messer et al., 1998). At low concentrations, PRL stimulates testosterone biosynthesis, while at high concentrations it blocks CYP17A1 activity thus preventing the conversion of precursors into active androgens (Welsh et al., 1986; Barkey et al., 1987). In addition to their roles in steroidogenesis, pituitary hormones PRL and LH, acting via their receptors PRLR and LHCGR, are necessary for proper Leydig cell proliferation and differentiation (Dombrowicz et al., 1996). In COUP-TFII-depleted Leydig cells, mRNA levels of both Prlr and Lhcgr were significantly reduced. Although the mechanism remains to be determined, these data along with data from the temporal Coup-tfii knockout mice (Qin et al., 2008) support the implication of COUP-TFII in Leydig cell proliferation and differentiation in addition to steroidogenesis.

1.7.3 COUP-TFII, a dual regulator of steroidogenesis The nuclear receptor NR0B2 (small heterodimer partner, SHP) was found to be an important repressor of steroidogenesis (Volle et al., 2007). NR0B2 acts by suppressing the expression of several steroidogenic genes including Star (Vega et al., 2015; Volle et al., 2007). In COUP-TFII-depleted MA-10 Leydig cells, Nr0b2 mRNA levels are reduced by ~60%. Although the mechanism of COUP-TFII action in the expression of Nr0b2 remains to be fully elucidated, our data place COUP-TFII upstream of NR0B2 in the cascade of regulators of steroidogenesis. It is interesting to note that in Leydig cells, COUP-TFII seems to be involved in both stimulation and repression of steroidogenesis by activating the expression of several steroidogenic genes required to increase androgen production (such as STAR, CYP11A1), and also by activating the expression of an important repressor of steroidogenesis (NR0B2). Although this may appear contradictory, it is reasonable to think that the same transcription factor might be involved in the regulation of several processes, some opposing, in order to avoid insufficient or excessive androgen production, both of which have deleterious effects on male overall health.

1.8 Acknowledgments We are thankful to Dr. Jose Teixeira, Dr. Ming Tsai, and Dr. Mario Ascoli for kindly providing the Amhr2 reporter construct, the COUP-TFII expression plasmid and the MA-10 Leydig cell line, respectively.

1.9 Conflict of interest Samir Mehanovic, Raifish E. Mendoza-Villarroel, Philippe Talbot, Robert S. Viger and Jacques J. Tremblay declare that they have no conflict of interest.

1.10 Author contributions SM performed the majority of the experiments along with REMV and PT. JJT conceived the original idea and supervised the project. SM wrote the manuscript with support from JJT and RSV. All authors provided critical feedback and helped shape the research, analysis and manuscript.

1.11 Data availability All data generated or analyzed during this study are included in this published article or in data repositories.

1.12 Funding This work was supported by a grant from the Canadian Institutes of Health Research (funding reference number MOP-81387) to JJT. SM was the recipient of a studentship from the Fondation du CHU de Québec-Université Laval.

1.13 Figures

Figure 1.1 COUP-TFII was depleted in MA-10 Leydig cells using small interfering RNA (siRNA). The cells were transfected with either siRNA control (siRNA Ctl) or siRNA targeting Coup- tfii (siRNA COUP-TFII) for 48 hours prior to total RNA and nuclear protein extraction. (A) Coup- tfii mRNA levels were quantified by RT-qPCR and normalized to Rpl19 mRNA. Data from three independent experiments are plotted as the mean ± SEM (**P<0.01). (B) COUP-TFII protein levels are decreased in COUP-TFII-depleted MA-10 Leydig cells. A representative Western blot image (top) from three independent experiments is shown. Ten micrograms of nuclear extract from control siRNA (lane 1) and siRNA targeting COUP-TFII (lane 2) transfected cells were loaded per lane. LAMIN B (LMNB1) was used as a loading control (bottom). Results are representative of three individual experiments.

Figure 1.2 Microarray analysis revealed differentially expressed genes in COUP-TFII-depleted MA-10 Leydig cells. The results from microarray screenings were analyzed using Partek Genomics Suite 7.0. (A) The 2D-PCA biplot illustrates two distinctly different gene set populations. The green circles represent data points from COUP-TFII-depleted cells, and orange circles from control cells. The percent variance (%) is indicated next to the Principal Component 1 (PC1), PC2, and overall Principal Component Analysis (PCA). (B) The heatmap produced from the hierarchical clustering using genes with fold change of ± 1.3 and unadjusted P-value <0.01. The number of differentially expressed genes is indicated below the heatmap. A relative intensity scale is shown on the right.

Figure 1.3 Depletion of COUP-TFII in MA-10 Leydig cells affects genes involved in biological pathways related to steroidogenesis. Enriched REACTOME pathways were obtained using g:Profiler from the list of downregulated genes with a significance threshold level (gSCS) set at 0.1. The interacting network graph was generated with the Cytoscape plugin EnrichmentMap using an FDR q-value cutoff of 0.1. The REACTOME root term node was removed from the network graph. The node size represents the number of genes grouped within a particular pathway.

Figure 1.4 COUP-TFII regulates expression of genes involved in steroidogenesis (A), cholesterol transport (B), metabolic process (C), lipid metabolic process (D), and male gonad development (E). MA-10 Leydig cells were transfected with siRNA Ctl or siRNA against COUP-TFII for 48 hours and total RNA was isolated. Total RNA was reverse transcribed and selected genes quantified by qPCR as indicated. Relative mRNA levels were normalized to Rpl19 and data are plotted as mean ± SEM of three to eleven independent experiments (n). The black bars represent gene expression in MA-10 Leydig cells transfected with siRNA against COUP-TFII normalized to cells transfected with siRNA Ctl (white bars). The P values and the calculated percent changes are indicated above the bars. (***P<0.001, **P<0.01, *P<0.05).

Figure 1.5 COUP-TFII activates the mouse Amhr2 and Gsta3 promoters in MA-10 Leydig cells. MA-10 Leydig cells were co-transfected with either 100 ng of an empty expression vector (-, control, white bars) or 50 ng of a COUP-TFII expression vector (+, black bars), along with 400 ng of (A) mouse Amhr2 promoter constructs (-1486/+74 bp or -34/+74 bp), (B) mouse Gsta3 promoter constructs (-2062/+38 bp or -21/+38 bp), and (C) mouse Hsd3b1 promoter (-1923/+112 bp) or mouse Inha promoter (-683/+41 bp). Results from three independent experiments are shown as the mean fold activation over control ± SEM. COUP-TFII response elements are indicated on each promoter. Grey hexagon: Direct repeat 1 (RGGYCARAKRYMV); black ovals: nuclear receptor element (RGGYCA); hatched rectangle: GC-box. An asterisk (*) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05).

1.14 Tables

Table 1.1 Oligonucleotides used in this study.

Purpose Description Template Sequence Tm oC qPCR Coup-tfii F: TGGAGAAGCTCAAGGCACTG 62.6 R: AAGAGCTTTCCGAACCGTGT Star F: GTTCCTCGCTACGTTCAAGC 62.6 R: GAAACACCTTGCCCACATCT Prlr F: TCTCAGAGACACGCGGCTG 65 R: TTCTGCTGGAGAGAAAAGTCTG Cyp11a1 F: CACCAGTATTATCAGAGGCCC 62.6 R: GATGAAGTCCTGAGCTACACC Lhcgr F: TGCCTTTGACAACCTCCTCA 62.6 R: GAAACATCTGGGAGGGTCCG Gsta3 F: TGGCGGGGAAGCCAGTCCTT 62.6 R: ACCTTGCCAGGTCATCCCGAGT Pde8a F: GTGCAATTTGGCCCGATGA 62.6 R: GATGTCATGGAGTTTGTCCTGG Fdx1 F: AAGAACCGAGATGGCGAGAC 62.6 R: GACAAACTTGGCAGCCCAAC Scarb1 F: GCTGCTGTTTGCTGCGCTCG 62.6 R: GGGTCCACGCTCCCGGACTA Inha F: CGAACTTGTCCGGGAGCTCGT- 61 R: TGGCTGGTCCTCACAGGTGGC Hsd3b1 F: GGC TGGATGGAGCTGCCTGG 62 R: GCTCTCCTCAGGCAC TGGGC Nr0b2 F: TACCCAGGGTGCCCAGCCATC 62.6 R: TGCAGGTGTGCGATGTGGCAG Amhr2 F: CCCTCTGCCCTCTGGGCCTT 68.8 R: ACTGGCCATCCTGCCAACGC Rpl19 F: CTGAAGGTCAAAGGGAATGTG 62.6 R: GGACAGAGTCTTGATGATCTC Pdgfra F: CAATCCAAAGATGTCCAGGTC 62.6 R: ACCAAGTCAGGTCCCATTTAC Promoter -21/+38 bp -76/38 F: 61 construct Gsta3 Gsta3 CTCATCAATGTAAGCTTGAGGGCGTATTC s promoter AAATTTA R: TAAATTTGAATACGCCCTCAAGCTTACATT GATGAG F: TAGCGctcgagTGTTCCCCTTCCTTGATCC 60

- Mouse R: GGggtaccGCTCAGTTCAGAATGTAG 1923/+112 gDNA bp Hsd3b1

Table 1.2 Top 50 downregulated genes.

Gene symbol Fold change P-value Gene symbol Fold change P-value

Pten -2.271 3.53E-03 Prlr -1.659 6.48E-04 Cd109 -2.252 2.24E-06 Cbr3 -1.654 1.29E-03 Gsta3 -2.079 5.01E-05 Bik -1.647 1.99E-03 Plb1 -2.028 8.67E-03 Gsta2 -1.643 2.15E-04 Stk32a -2.027 3.36E-03 Cdhr5 -1.635 2.32E-04 Vaultrc5 -1.995 4.09E-03 Gm3776 -1.634 1.16E-03 Lgmn -1.974 1.22E-04 Htra1 -1.630 5.21E-03 Pten -1.961 3.00E-03 Gsta1 -1.625 8.57E-04 Cav1 -1.897 5.93E-06 Gsta4 -1.603 2.84E-03 Hsd3b1 -1.846 2.12E-03 Aldh1a1 -1.590 3.62E-04 Tlcd2 -1.831 4.30E-04 Aldh1a7 -1.566 4.96E-04 Pcx -1.824 1.08E-03 Coup-tfii -1.560 1.71E-03 Sspn -1.777 1.56E-04 Dram1 -1.558 9.29E-04 Hmox1 -1.768 1.42E-04 Kdm7a -1.557 1.86E-03 Slc7a11 -1.756 1.32E-03 Inha -1.555 5.82E-04 Akr1c18 -1.754 1.82E-03 Prss35 -1.554 2.84E-04 Ehf -1.754 6.40E-04 Tbata -1.552 2.87E-05 Nrk -1.742 9.71E-04 Frk -1.545 1.04E-03 Slc40a1 -1.736 6.45E-04 Kdm7a -1.537 6.36E-05 Adam23 -1.725 3.80E-04 Rxfp1 -1.536 4.80E-03 Star -1.708 2.12E-04 Wnt6 -1.528 3.52E-04 Nqo1 -1.684 1.87E-03 Slc44a3 -1.526 3.32E-05 Txndc12 -1.667 4.12E-04 Hephl1 -1.524 1.45E-05 Gm10639 -1.665 4.37E-04 Zcwpw1 -1.522 7.48E-03 Akr1c14 -1.662 5.95E-04 Pi4k2b -1.520 3.29E-04 The genes are sorted by fold change and represented in increasing order. False discovery rate (FDR) <0.05.

Table 1.3 Top 20 impaired biological processes.

GO ID Description False Gene discovery rate Count GO:0008150 biological process 4.25E-53 175 GO:0008152 metabolic process 1.1E-42 125 GO:0009987 cellular process 2.75E-39 146 GO:0071704 organic substance metabolic process 1.18E-38 118 GO:0044237 cellular metabolic process 2.47E-34 111 GO:0044238 primary metabolic process 1.65E-30 106 GO:0006807 nitrogen compound metabolic process 1.27E-28 101 GO:1901564 organonitrogen compound metabolic process 2.67E-28 83 GO:0050896 response to stimulus 9.28E-24 99 GO:0065007 biological regulation 7.06E-23 110 GO:0065008 regulation of biological quality 1.1E-20 58 GO:0070887 cellular response to chemical stimulus 2.82E-20 49 GO:0051716 cellular response to stimulus 6.73E-19 82 GO:0050789 regulation of biological process 1.86E-18 101 GO:0032502 developmental process 5.91E-18 67 GO:0042221 response to chemical 6.44E-18 63 GO:0048513 animal organ development 9.67E-18 49 GO:0051186 cofactor metabolic process 2.71E-17 22 GO:0048856 anatomical structure development 9.01E-17 63 GO:0044281 small molecule metabolic process 3.41E-16 37 P-value <0.0001. GO ID-Gene Ontology unique seven-digit identifier.

Table 1.4 Enriched pathways from differentially expressed genes.

Description Genes False Gene (REACTOME ID) discovery Count rate REACTOME root term Pten, Cd109, Gsta3, Plb1, Lgmn, Cav1, 4.32E-28 96 (0000000) Hsd3b1, Hmox1, Slc7a11, Akr1c18, Slc40a1, Adam23, Star, Nqo1, Akr1c14, Prlr, Cbr3, Htra1, Gsta1, Aldh1a1, Kdm7a, Inha, Frk, Rxfp1, Wnt6, Slc44a3, Pi4k2b, Adam12, Ero1l, Serpinb1a, Igfbp6, Ecm1, Blvrb, Abcb1a, Cdon, Hao2, Ugt1a2, Adh1, Entpd5, Cmbl, Amhr2, Erlin2, Casp7, Ssu72, Tap1, Usp2, Spta1, Cited4, Zdhhc2, Slc26a7, Klk1b22, Aqp11, Rhpn2, Tuba8, Pir, Ids, Cd274, Klk1b21, Usp3, Car7, Gls2, Fam13a, Sdk1, Ptgis, Rnf5, Gcnt4, Clcn5, Asah2, Rps19bp1, Maoa, Dysf, Myc, Nr0b2, Acacb, Cdkn1a, Triap1, Fdx1, Gstt1, Slc11a1, Hmgcs2, Lrp8, C2, Gins1, Thra, Pdgfd, Nuf2, Pipox, Nmrk1, Rfk, Bc025920, Slc6a15 Metabolism Blvrb, Gpt, Lrp8, Pipox, Cav1, Fdx1, 2.57E-20 39 (R-MMU-1430728) Car7, Gsta1, Gstt1, Adh1, Nmral1, Aldh1a1, Eno3, Maoa, Ugt1a2, Akr1c18, Pten, Ehhadh, Hao2, Hsd3b1, Hmgcs2, Entpd5, Gls2, Asah2, Ptgis, Rfk, Plb1, Star, Ids, Cmbl, Slc44a3, Cbr3, Hmox1, Pi4k2b, Gsta3, Nqo1, Akr1c14, Nmrk1, Acacb Biological oxidations Fdx1, Cbr3, Maoa, Ugt1a2, Gsta3, Gsta1, 2.61E-09 11 (R-MMU-211859) Ptgis, Gstt1, Adh1, Cmbl, Aldh1a1 Metabolism of lipids Asah2, Fdx1, Ptgis, Plb1, Star, Slc44a3, 1.71E-07 15 (R-MMU-556833) Pi4k2b, Akr1c18, Pten, Hao2, Ehhadh, Hsd3b1, Hmgcs2, Akr1c14, Acacb Phase I - Functionalization of Fdx1, Cbr3, Maoa, Ptgis, Adh1, Cmbl, 4.37E-06 7 compounds Aldh1a1 (R-MMU-211945) Metabolism of vitamins and Lrp8, Akr1c18, Ptgis, Rfk, Plb1, Akr1c14, 1.27E-05 8 cofactors Nmrk1, Acacb (R-MMU-196854) Transport of small molecules Slc47a1, Slc40a1, Slc6a15, Erlin2, 2.52E-05 13 (R-MMU-382551) Slc44a3, Slc11a1, Slc26a7, Abcb1a, Hmox1, Slc7a11, Clcn5, Aqp11, Rnf5

Metabolism of steroids Fdx1, Akr1c18, Ptgis, Hsd3b1, Akr1c14, 4.67E-05 6 (R-MMU-8957322) Star Retinoid metabolism and Lrp8, Akr1c18, Plb1, Akr1c14 1.98E-04 4 transport (R-MMU-975634) Metabolism of fat-soluble Lrp8, Akr1c18, Plb1, Akr1c14 2.79E-04 4 vitamins (R-MMU-6806667) Signal Transduction Lrp8, Cav1, Nuf2, Myc, Rhpn2, Plb1, Frk, 3.04E-04 22 (R-MMU-162582) Adh1, Rxfp1, Cdon, Fam13a, Aldh1a1, Tuba8, Pdgfd, Amhr2, Usp2, Akr1c18, Pten, Cdkn1a, Wnt6, Akr1c14, Spta1 Transport of bile salts and Slc11a1, Slc47a1, Slc40a1, Slc6a15, 0.001368 5 organic acids, metal ions and Slc44a3 amine compounds (R-MMU-425366) SLC-mediated Slc11a1, Slc26a7, Slc47a1, Slc40a1, 0.001925 7 transmembrane transport Slc7a11, Slc6a15, Slc44a3 (R-MMU-425407) Visual phototransduction (R- Lrp8, Akr1c18, Plb1, Akr1c14 0.001931 4 MMU-2187338) Heme degradation Blvrb, Hmox1 0.002755 2 (R-MMU-189483) Basigin interactions Cav1, Slc7a11 0.003703 2 (R-MMU-210991) Phospholipid metabolism Pi4k2b, Pten, Plb1, Slc44a3 0.003775 4 (R-MMU-1483257) Synthesis of bile acids and Akr1c18, Ptgis, Akr1c14 0.006214 3 bile salts via 7alpha- hydroxycholesterol (R-MMU-193368) Glutathione conjugation Gsta3, Gsta1, Gstt1 0.016312 3 (R-MMU-156590) Synthesis of bile acids and Akr1c18, Ptgis, Akr1c14 0.017396 3 bile salts (R-MMU-192105) Ethanol oxidation Adh1, Aldh1a1 0.017921 2 (R-MMU-71384) Metabolism of steroid Fdx1, Hsd3b1, Star 0.022533 3 hormones (R-MMU-196071) Phase II - Conjugation of Ugt1a2, Gsta3, Gsta1, Gstt1 0.026377 4 compounds (R-MMU-156580)

Metabolism of porphyrins Blvrb, Hmox1 0.028728 2 (R-MMU-189445) Bile acid and bile salt Akr1c18, Ptgis, Akr1c14 0.030166 3 metabolism (R-MMU-194068) Regulation of PTEN stability Pten, Frk 0.031781 2 and activity (R-MMU-8948751) Iron uptake and transport Slc40a1, Hmox1 0.037622 2 (R-MMU-917937) Regulation of PTEN Pten 0.040824 1 localization (R-MMU-8948747) RNA Polymerase II Nr0b2, Bc025920, Usp2, Myc, Triap1, 0.058265 10 Transcription Cdkn1a, Thra, Ssu72, Cited4, Gls2 (R-MMU-73857) ABC-family proteins Abcb1a, Rnf5, Erlin2 0.066937 3 mediated transport (R-MMU-382556) RA biosynthesis pathway Adh1, Aldh1a1 0.067602 2 (R-MMU-5365859) Protein localization Pipox, Hmox1, Hao2, Ehhadh 0.076884 4 (R-MMU-9609507) Metabolism of water-soluble Ptgis, Rfk, Nmrk1, Acacb 0.082467 4 vitamins and cofactors (R-MMU-196849) Hemostasis Tuba8, Lrp8, Cav1, Cd109, Slc7a11, Ecm1 0.083591 6 (R-MMU-109582) Generic Transcription Nr0b2, Bc025920, Usp2, Myc, Triap1, 0.086909 9 Pathway Cdkn1a, Thra, Cited4, Gls2 (R-MMU-212436) REACTOME ID-REACTOME pathway unique identifier.

Table 1.5 List of genes chosen for further validation

Process Gene Gene name Microarray data qPCR data symbol Fold- P- Fold- P-value change value change

Steroidogenesis Star Steroidogenic acute -1.72 0.000 -1.89 0.010 regulatory protein

Prlr Prolactin receptor -1.65 0.001 -1.47 0.002

Inha Inhibin alpha -1.48 0.001 -5.56 (n/a)

Amhr2 Anti-Mullerian hormone -1.40 0.000 -2.22 0.009 type 2 receptor

Lhcgr Luteinizing -1.28 0.001 -1.16 0.001 hormone/choriogonadotropin receptor

Cyp11a1 Cytochrome P450, family -1.26 0.004 -1.49 0.003 11, subfamily a, polypeptide 1

Hsd3b1 Hydroxy-delta-5-steroid -1.96 0.010 -2.00 (n/a) dehydrogenase, 3 beta- and steroid delta-isomerase 1

Pde8a Phosphodiesterase 8A -1.12 0.005 -1.21 0.043

Cholesterol Scarb1 Scavenger receptor class B, -1.14 0.001 -1.67 0.000 transport member 1

Metabolic Gsta3 Glutathione S-transferase, -2.03 0.000 -1.61 0.000 process alpha 3

Lipid Fdx1 Ferredoxin 1 -1.30 0.000 -1.19 0.003 metabolic process

Male gonad Pdgfra Platelet derived growth 1.19 0.074 1.64 0.016 development factor receptor, alpha polypeptide

Nr0b2 Nuclear receptor subfamily -1.36 0.002 -2.50 0.015 0, group B, member 2

Table 1.6 Results of the in silico promoter analyses.

Gene Location of promoter Strand Start End P-value q-value Matched sequence P-value q- Matched symbol (-500/+50) RGGYCARAKRYMV value sequence RGGYCA Star NC_000074.6 - -75 -63 3.63e-05 0.352 GGGTCAAGGATGG (25807974..25808523) - -191 -179 8.72e-05 0.352 GGGGCAGAGGATA - -392 -380 0.000774 0.467 CTGGCAGAGGCAA + -470 -465 0.000195 0.373 GGGTCA - -171 -166 0.000195 0.373 GGGTCA - -68 -63 0.000195 0.373 GGGTCA - -184 -179 0.000752 0.403 GGGGCA Prlr NC_000081.6 NONE (10176738..10177287) - -455 -450 0.000592 0.377 GGGCCA Inha NC_000067.6 - -387 -375 0.000514 0.447 AGGGCAGGTGGTC (75506577..75507126) + -116 -111 0.000195 0.373 GGGTCA + -111 -106 0.000432 0.377 AGGTCA + -39 -34 0.000592 0.377 GGGCCA Amhr2 NC_00081.6 + -281 -269 0.000638 0.447 AGGGCAGAAGGTC (102444890..102445439) + -253 -248 0.000432 0.377 AGGTCA Lhcgr NC_000083.6 - -468 -456 0.00012 0.352 AGGGCAAAATTCA (88792010..88792559, + -77 -65 0.000137 0.352 AGGTCAAGGAGAA complement) + -124 -112 0.0007 0.447 AGGGCAAGTCTTA + +7 +19 0.000326 0.43 CGGGCAGAGGGTA + -203 -191 0.000961 0.51 AGTTCAAAGCCTC + -77 -72 0.000432 0.377 AGGTCA Cyp11a1 NC_000075.6 - -155 -143 0.000356 0.43 GGTGCAGGTGTGA (57,997,524..57,998,073) + -224 -212 0.00052 0.447 GGGCCATGTGCTC

100

+ -224 -219 0.000592 0.377 GGGCCA Hsd3b1 NC_000069.6 - +13 +25 0.000488 0.447 GGGGCAGCTTCAA (98,859,745..98,860,294, - -298 -286 0.000592 0.447 AGGTCCAGTGCTA complement) - +20 +25 0.000752 0.403 GGGGCA Pde8a NC_000073.6 - -171 -159 0.000707 0.447 GGGGCACCTAGCC (812122765..81213314) - -258 -253 0.000432 0.377 AGGTCA + -65 -60 0.000432 0.377 AGGTCA - -164 -159 0.000752 0.403 GGGGCA Scarb1 NC_000071.6 - -156 -144 0.000186 0.352 AGGGCAGAAGACC (125341045..125341594, + -329 -317 0.000244 0.402 AGTGCAAAGGGCC complement) + +35 +47 0.000911 0.51 GGGCCATGGCGCA - -281 -276 0.000592 0.377 GGGCCA - -269 -264 0.000592 0.377 GGGCCA + +35 +40 0.000592 0.377 GGGCCA Gsta3 NC_000067.6 - -267 -255 0.000943 0.51 CTGGCAGATGTTA (21240085..21240634)) - -315 -310 0.000592 0.377 GGGCCA Fdx1 NC_000075.6 + +14 +26 0.000389 0.431 GGGTTATAGGACA (51963553..519964102, - -394 -389 0.000946 0.488 CGGTCA complement) Pdgfra NC_000071.6 NONE NONE (75150822..75151371) Nr0b2 NC_000070.6 - -245 -233 0.000115 0.352 AGGGCACAGGGCC (133552876..133553425) - -253 -241 0.00018 0.352 GGGCCACCTGCCC + -465 -453 0.000272 0.402 GGGTCATGTATTC + -143 -131 0.000557 0.447 GGGTCAGCGTGTA + -199 -187 0.000704 0.447 AGGCCACGTGGAG + -465 -460 0.000195 0.373 GGGTCA - -302 -297 0.000195 0.373 GGGTCA - -246 -241 0.000592 0.377 GGGCCA

101

+ +9 +14 0.000592 0.377 GGGCCA - -179 -174 0.000752 0.403 GGGGCA

102

1.15 References Abdou, H.S., Bergeron, F., and Tremblay, J.J. (2014). A cell-autonomous molecular cascade initiated by AMP-activated protein kinase represses steroidogenesis. Mol Cell Biol 34, 4257- 4271. Allocati, N., Masulli, M., Di Ilio, C., and Federici, L. (2018). Glutathione transferases: substrates, inihibitors and pro-drugs in cancer and neurodegenerative diseases. Oncogenesis 7, 8. Anderson, R.A., and Sharpe, R.M. (2000). Regulation of inhibin production in the human male and its clinical applications. Int J Androl 23, 136-144. Ascoli, M. (1981). Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108, 88-95. Bakke, M., and Lund, J. (1995). Transcriptional regulation of the bovine CYP17 gene: two nuclear orphan receptors determine activity of cAMP-responsive sequence 2. Endocr Res 21, 509-516. Barkey, R.J., Weiss-Messer, E., Mandel, S., Gahnem, F., and Amit, T. (1987). Prolactin and antiprolactin receptor antibody inhibit steroidogenesis by purified rat Leydig cells in culture. Mol Cell Endocrinol 52, 71-80. Bashamboo, A., Eozenou, C., Jorgensen, A., Bignon-Topalovic, J., Siffroi, J.P., Hyon, C., Tar, A., Nagy, P., Solyom, J., Halasz, Z., et al. (2018). Loss of Function of the Nuclear Receptor NR2F2, Encoding COUP-TF2, Causes Testis Development and Cardiac Defects in 46,XX Children. Am J Hum Genet 102, 487-493. Bergeron, F., Nadeau, G., and Viger, R.S. (2015). GATA4 knockdown in MA-10 Leydig cells identifies multiple target genes in the steroidogenic pathway. Reproduction 149, 245- 257. Boulogne, B., Levacher, C., Durand, P., and Habert, R. (1999). Retinoic acid receptors and retinoid X receptors in the rat testis during fetal and postnatal development: immunolocalization and implication in the control of the number of gonocytes. Biol Reprod 61, 1548-1557. Chen, H., Stanley, E., Jin, S., and Zirkin, B.R. (2010). Stem Leydig cells: from fetal to aged animals. Birth Defects Res C Embryo Today 90, 272-283. Chomczynski, P., and Sacchi, N. (2006). The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat Protoc 1, 581-585. Chu, K., Boutin, J.M., Breton, C., and Zingg, H.H. (1998). Nuclear orphan receptors COUP- TFII and Ear-2: presence in oxytocin-producing uterine cells and functional interaction with the oxytocin gene promoter. Mol Cell Endocrinol 137, 145-154.

103

Cotnoir-White, D., Laperriere, D., and Mader, S. (2011). Evolution of the repertoire of nuclear receptor binding sites in genomes. Mol Cell Endocrinol 334, 76-82. Di-Luoffo, M., Brousseau, C., Bergeron, F., and Tremblay, J.J. (2015). The Transcription Factor MEF2 Is a Novel Regulator of Gsta Gene Class in Mouse MA-10 Leydig Cells. Endocrinology 156, 4695-4706. Di-Luoffo, M., Brousseau, C., and Tremblay, J.J. (2016). MEF2 and NR2F2 cooperate to regulate Akr1c14 gene expression in mouse MA-10 Leydig cells. Andrology 4, 335-344. Dombrowicz, D., Sente, B., Reiter, E., Closset, J., and Hennen, G. (1996). Pituitary control of proliferation and differentiation of Leydig cells and their putative precursors in immature hypophysectomized rat testis. J Androl 17, 639-650. Engeli, R.T., Furstenberger, C., Kratschmar, D.V., and Odermatt, A. (2018). Currently available murine Leydig cell lines can be applied to study early steps of steroidogenesis but not testosterone synthesis. Heliyon 4, e00527. Erdos, E., and Balint, B.L. (2020). NR2F2 Orphan Nuclear Receptor is Involved in Estrogen Receptor Alpha-Mediated Transcriptional Regulation in Luminal A Breast Cancer Cells. Int J Mol Sci 21. Fang, B., Mane-Padros, D., Bolotin, E., Jiang, T., and Sladek, F.M. (2012). Identification of a binding motif specific to HNF4 by comparative analysis of multiple nuclear receptors. Nucleic acids research 40, 5343-5356. Gaemers, I.C., van Pelt, A.M., van der Saag, P.T., Hoogerbrugge, J.W., Themmen, A.P., and de Rooij, D.G. (1998). Differential expression pattern of retinoid X receptors in adult murine testicular cells implies varying roles for these receptors in spermatogenesis. Biol Reprod 58, 1351-1356. Grant, C.E., Bailey, T.L., and Noble, W.S. (2011). FIMO: scanning for occurrences of a given motif. Bioinformatics 27, 1017-1018. Harpelunde Poulsen, K., Nielsen, J.E., Frederiksen, H., Melau, C., Juul Hare, K., Langhoff Thuesen, L., Perlman, S., Lundvall, L., Mitchell, R.T., Juul, A., et al. (2019). Dysregulation of FGFR signalling by a selective inhibitor reduces germ cell survival in human fetal gonads of both sexes and alters the somatic niche in fetal testes. Hum Reprod 34, 2228-2243. Hill, D.P., Smith, B., McAndrews-Hill, M.S., and Blake, J.A. (2008). Gene Ontology annotations: what they mean and where they come from. BMC Bioinformatics 9, S2. Klys, H.S., Whillis, D., Howard, G., and Harrison, D.J. (1992). Glutathione S-transferase expression in the human testis and testicular germ cell neoplasia. Br J Cancer 66, 589-593. Kurihara, I., Lee, D.K., Petit, F.G., Jeong, J., Lee, K., Lydon, J.P., DeMayo, F.J., Tsai, M.J., and Tsai, S.Y. (2007). COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet 3, e102.

104

Lee, C.T., Li, L., Takamoto, N., Martin, J.F., Demayo, F.J., Tsai, M.J., and Tsai, S.Y. (2004). The nuclear orphan receptor COUP-TFII is required for limb and skeletal muscle development. Mol Cell Biol 24, 10835-10843. Lee, H.J., Kao, C.Y., Lin, S.C., Xu, M., Xie, X., Tsai, S.Y., and Tsai, M.J. (2017). Dysregulation of nuclear receptor COUP-TFII impairs skeletal muscle development. Sci Rep 7, 3136. Lee, S.Y., Gong, E.Y., Hong, C.Y., Kim, K.H., Han, J.S., Ryu, J.C., Chae, H.Z., Yun, C.H., and Lee, K. (2009). ROS inhibit the expression of testicular steroidogenic enzyme genes via the suppression of Nur77 transactivation. Free Radic Biol Med 47, 1591-1600. Lin, F.J., Qin, J., Tang, K., Tsai, S.Y., and Tsai, M.J. (2011). Coup d'Etat: an orphan takes control. Endocr Rev 32, 404-421. Lottrup, G., Nielsen, J.E., Maroun, L.L., Moller, L.M., Yassin, M., Leffers, H., Skakkebaek, N.E., and Rajpert-De Meyts, E. (2014). Expression patterns of DLK1 and INSL3 identify stages of Leydig cell differentiation during normal development and in testicular pathologies, including testicular cancer and Klinefelter syndrome. Hum Reprod 29, 1637-1650. Maran, R.R., Arunakaran, J., and Aruldhas, M.M. (2001). Prolactin and Leydig cells: biphasic effects of prolactin on LH-, T3- and GH-induced testosterone/oestradiol secretion by Leydig cells in pubertal rats. Int J Androl 24, 48-55. Martin, L.J., Boucher, N., Brousseau, C., and Tremblay, J.J. (2008). The orphan nuclear receptor NUR77 regulates hormone-induced StAR transcription in Leydig cells through cooperation with Ca2+/calmodulin-dependent protein kinase I. Mol Endocrinol 22, 2021- 2037. Martin, L.J., Boucher, N., El-Asmar, B., and Tremblay, J.J. (2009). cAMP-induced expression of the orphan nuclear receptor Nur77 in MA-10 Leydig cells involves a CaMKI pathway. J Androl 30, 134-145. Martin, L.J., and Tremblay, J.J. (2010). Nuclear receptors in Leydig cell gene expression and function. Biol Reprod 83, 3-14. Mehanovic, S., Mendoza-Villarroel, R.E., Viger, R.S., and Tremblay, J.J. (2019). The Nuclear Receptor COUP-TFII Regulates Amhr2 Gene Transcription via a GC-Rich Promoter Element in Mouse Leydig Cells. J Endocr Soc 3, 2236-2257. Mendoza-Villarroel, R.E., Di-Luoffo, M., Camire, E., Giner, X.C., Brousseau, C., and Tremblay, J.J. (2014a). The INSL3 gene is a direct target for the orphan nuclear receptor, COUP-TFII, in Leydig cells. J Mol Endocrinol 53, 43-55. Mendoza-Villarroel, R.E., Robert, N.M., Martin, L.J., Brousseau, C., and Tremblay, J.J. (2014b). The nuclear receptor NR2F2 activates Star expression and steroidogenesis in mouse MA-10 and MLTC-1 Leydig cells. Biol Reprod 91, 1–12.

105

Merico, D., Isserlin, R., Stueker, O., Emili, A., and Bader, G.D. (2010). Enrichment map: a network-based method for gene-set enrichment visualization and interpretation. PLoS One 5, e13984. Mitchell, A.E., Morin, D., Lakritz, J., and Jones, A.D. (1997). Quantitative profiling of tissue- and gender-related expression of glutathione S-transferase isoenzymes in the mouse. Biochem J 325 ( Pt 1), 207-216. Nebert, D.W., Wikvall, K., and Miller, W.L. (2013). Human cytochromes P450 in health and disease. Philos Trans R Soc Lond B Biol Sci 368, 20120431. Parker, K.L., Rice, D.A., Lala, D.S., Ikeda, Y., Luo, X., Wong, M., Bakke, M., Zhao, L., Frigeri, C., Hanley, N.A., et al. (2002). Steroidogenic factor 1: an essential mediator of endocrine development. Recent Prog Horm Res 57, 19-36. Pereira, F.A., Qiu, Y., Zhou, G., Tsai, M.J., and Tsai, S.Y. (1999). The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development. Genes Dev 13, 1037-1049. Petit, F.G., Jamin, S.P., Kurihara, I., Behringer, R.R., DeMayo, F.J., Tsai, M.J., and Tsai, S.Y. (2007). Deletion of the orphan nuclear receptor COUP-TFII in uterus leads to placental deficiency. Proc Natl Acad Sci U S A 104, 6293-6298. Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT- PCR. Nucleic Acids Res 29, e45. Polvani, S., Pepe, S., Milani, S., and Galli, A. (2019). COUP-TFII in Health and Disease. Cells 9. Qin, J., Tsai, M.J., and Tsai, S.Y. (2008). Essential roles of COUP-TFII in Leydig cell differentiation and male fertility. PLoS One 3, e3285. Rao, R.M., Jo, Y., Leers-Sucheta, S., Bose, H.S., Miller, W.L., Azhar, S., and Stocco, D.M. (2003). Differential regulation of steroid hormone biosynthesis in R2C and MA-10 Leydig tumor cells: role of SR-B1-mediated selective cholesteryl ester transport. Biol Reprod 68, 114-121. Raudvere, U., Kolberg, L., Kuzmin, I., Arak, T., Adler, P., Peterson, H., and Vilo, J. (2019). g:Profiler: a web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res 47, W191-W198. Reaven, E., Zhan, L., Nomoto, A., Leers-Sucheta, S., and Azhar, S. (2000). Expression and microvillar localization of scavenger receptor class B, type I (SR-BI) and selective cholesteryl ester uptake in Leydig cells from rat testis. J Lipid Res 41, 343-356. Reimand, J., Isserlin, R., Voisin, V., Kucera, M., Tannus-Lopes, C., Rostamianfar, A., Wadi, L., Meyer, M., Wong, J., Xu, C., et al. (2019). Pathway enrichment analysis and visualization of omics data using g:Profiler, GSEA, Cytoscape and EnrichmentMap. Nat Protoc 14, 482- 517.

106

RRID:AB_648156, and https://scicrunch.org/resolver/AB_648156. RRID:AB_2155627, and https://scicrunch.org/resolver/AB_2155627. Shannon, P., Markiel, A., Ozier, O., Baliga, N.S., Wang, J.T., Ramage, D., Amin, N., Schwikowski, B., and Ideker, T. (2003). Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res 13, 2498-2504. Shima, Y. (2019). Development of fetal and adult Leydig cells. Reprod Med Biol 18, 323- 330. Takamoto, N., You, L.R., Moses, K., Chiang, C., Zimmer, W.E., Schwartz, R.J., DeMayo, F.J., Tsai, M.J., and Tsai, S.Y. (2005). COUP-TFII is essential for radial and anteroposterior patterning of the stomach. Development 132, 2179-2189. Teixeira, J., Kehas, D.J., Antun, R., and Donahoe, P.K. (1999). Transcriptional regulation of the rat Mullerian inhibiting substance type II receptor in rodent Leydig cells. Proc Natl Acad Sci U S A 96, 13831-13838. Tremblay, J.J., and Viger, R.S. (1999). Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13, 1388-1401. Tsai, S.Y., and Tsai, M.J. (1997). Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age. Endocr Rev 18, 229-240. Upadia, J., Gonzales, P.R., and Robin, N.H. (2018). Novel de novo pathogenic variant in the NR2F2 gene in a boy with congenital heart defect and dysmorphic features. Am J Med Genet A 176, 1423-1426. Vega, A., Martinot, E., Baptissart, M., De Haze, A., Saru, J.P., Baron, S., Caira, F., Schoonjans, K., Lobaccaro, J.M., and Volle, D.H. (2015). Identification of the link between the hypothalamo-pituitary axis and the testicular orphan nuclear receptor NR0B2 in adult male mice. Endocrinology 156, 660-669. Volle, D.H., Duggavathi, R., Magnier, B.C., Houten, S.M., Cummins, C.L., Lobaccaro, J.M., Verhoeven, G., Schoonjans, K., and Auwerx, J. (2007). The small heterodimer partner is a gonadal gatekeeper of sexual maturation in male mice. Genes Dev 21, 303-315. Wang, J., Abhinav, P., Xu, Y.J., Li, R.G., Zhang, M., Qiu, X.B., Di, R.M., Qiao, Q., Li, X.M., Huang, R.T., et al. (2019). NR2F2 lossoffunction mutation is responsible for congenital bicuspid aortic valve. Int J Mol Med 43, 1839-1846. Wehrenberg, U., Ivell, R., Jansen, M., von Goedecke, S., and Walther, N. (1994). Two orphan receptors binding to a common site are involved in the regulation of the oxytocin gene in the bovine ovary. Proc Natl Acad Sci U S A 91, 1440-1444. Weikum, E.R., Liu, X., and Ortlund, E.A. (2018). The nuclear receptor superfamily: A structural perspective. Protein Sci 27, 1876-1892.

107

Weiss-Messer, E., Ber, R., Amit, T., and Barkey, R.J. (1998). Characterization and regulation of prolactin receptors in MA-10 Leydig cells. Mol Cell Endocrinol 143, 53-64. Welsh, T.H., Jr., Kasson, B.G., and Hsueh, A.J. (1986). Direct biphasic modulation of gonadotropin-stimulated testicular androgen biosynthesis by prolactin. Biol Reprod 34, 796- 804. Wu, G., Feng, X., and Stein, L. (2010). A human functional protein interaction network and its application to cancer data analysis. Genome Biol 11, R53. Wu, S.P., Yu, C.T., Tsai, S.Y., and Tsai, M.J. (2016). Choose your destiny: Make a cell fate decision with COUP-TFII. J Steroid Biochem Mol Biol 157, 7-12. You, L.R., Takamoto, N., Yu, C.T., Tanaka, T., Kodama, T., Demayo, F.J., Tsai, S.Y., and Tsai, M.J. (2005). Mouse lacking COUP-TFII as an animal model of Bochdalek-type congenital diaphragmatic hernia. Proc Natl Acad Sci U S A 102, 16351-16356. Yusuf, D., Butland, S.L., Swanson, M.I., Bolotin, E., Ticoll, A., Cheung, W.A., Zhang, X.Y., Dickman, C.T., Fulton, D.L., Lim, J.S., et al. (2012). The transcription factor encyclopedia. Genome Biol 13, R24. Zhao, T., Singhal, S.S., Piper, J.T., Cheng, J., Pandya, U., Clark-Wronski, J., Awasthi, S., and Awasthi, Y.C. (1999). The role of human glutathione S-transferases hGSTA1-1 and hGSTA2-2 in protection against oxidative stress. Arch Biochem Biophys 367, 216-224

108

2 Chapter 2. The nuclear receptor COUP-TFII regulates Amhr2 gene transcription via a GC-rich promoter element in mouse Leydig cells

2.1 Chapter introduction In Chapter 1, I identified 262 differentially expressed in COUP-TFII-depleted MA-10 Leydig cells. One of those genes is Amhr2. In this Chapter, I addressed the second objective.

Authors contributions: Raifish E. Mendoza-Villarroel performed sets of experiments (siRNA depletion, RNA isolation, RT-qPCR) for Amhr2 gene. All other results presented in this chapter were generated by me.

Status of the manuscript: The manuscript was published in Journal of the Endocrine Society (Mehanovic et al., 2019).

109

The nuclear receptor COUP-TFII regulates Amhr2 gene transcription via a GC-rich promoter element in mouse Leydig cells

Samir Mehanovic1, Raifish E. Mendoza-Villarroel1, Robert S. Viger1,2 and Jacques J. Tremblay 1,2

1 Reproduction, Mother and Child Health, Centre de recherche du centre hospitalier universitaire de Québec—Université Laval, CHUL Room T3-67, Québec City, Québec, Canada, G1V 4G2.

Keywords: anti-Müllerian hormone receptor type 2, COUP-TFII, Leydig cells, nuclear receptor, NR2F2, SP1

110

2.2 Résumé Le récepteur nucléaire COUP-TFII / NR2F2 est exprimé dans les cellules de Leydig adultes et la délétion conditionnelle du gène Coup-tfii/Nr2f2 empêche leur différenciation. La production de stéroïdes est également réduite dans les cellules de Leydig appauvries en COUP-TFII soutenant un rôle supplémentaire dans la stéroïdogenèse pour ce facteur de transcription. L'action COUP-TFII dans les cellules de Leydig reste à être complètement caractérisée. Dans le présent travail, nous rapportons que COUP-TFII est un régulateur essentiel du gène codant pour le récepteur de l'hormone anti-Müllérienne de type 2 (Amhr2), qui participe à la différenciation des cellules de Leydig et à la stéroïdogenèse. Nous avons constaté que les niveaux d'ARNm d'Amhr2 sont réduits dans les cellules MA-10 Leydig appauvries en COUP-TFII. Conformément à cela, COUP-TFII active directement un fragment de -1486 pb du promoteur Amhr2 de souris dans des tests de transfection transitoire. La région sensible à COUP-TFII a été localisée entre -67 pb et -34 pb. Le test d'immunoprécipitation de la chromatine a confirmé le recrutement de COUP-TFII au promoteur Amhr2 proximal tandis que le test de précipitation d'ADN a révélé que COUP- TFII s'associe à la région -67/-34 pb in vitro. Même si la région -67 / -34 pb contient un élément imparfait pour la liaison d’un récepteur nucléaire, l'activation médiée par COUP- TFII du promoteur Amhr2 nécessite une séquence riche en GC à -39 pb connue pour être liée par le facteur de transcription SP1. COUP-TFII coopère transcriptionnellement avec SP1 sur le promoteur Amhr2. Les mutations qui ont modifié la séquence GCGGGGCGG à -39 pb ont aboli l'activation médiée par COUP-TFII, la coopération COUP-TFII/SP1 et réduit la liaison COUP-TFII au promoteur Amhr2 proximal. Nos données permettent de mieux comprendre le mécanisme de l'action COUP-TFII dans les cellules de Leydig grâce à l'identification et à la régulation du promoteur Amhr2 en tant que nouvelle cible.

111

2.3 Abstract The nuclear receptor COUP-TFII/NR2F2 is expressed in adult Leydig cells and conditional deletion of the Coup-tfii/Nr2f2 gene impedes their differentiation. Steroid production is also reduced in COUP-TFII-depleted Leydig cells supporting an additional role in steroidogenesis for this transcription factor. COUP-TFII action in Leydig cells remains to be fully characterized. In the present work, we report that COUP-TFII is an essential regulator of the gene encoding the anti-Müllerian hormone receptor type 2 (Amhr2), which participates in Leydig cell differentiation and steroidogenesis. We found that Amhr2 mRNA levels are reduced in COUP-TFII-depleted MA-10 Leydig cells. Consistent with this, COUP-TFII directly activates a -1486 bp fragment of the mouse Amhr2 promoter in transient transfection assays. The COUP-TFII responsive region was localized between -67 bp and -34 bp. Chromatin immunoprecipitation assay confirmed COUP-TFII recruitment to the proximal Amhr2 promoter while DNA precipitation assay revealed that COUP-TFII associates with the -67/-34 bp region in vitro. Even though the -67/-34 bp region contains an imperfect nuclear receptor element, COUP-TFII-mediated activation of the Amhr2 promoter requires a GC-rich sequence at -39 bp known to bind the SP1 transcription factor. COUP-TFII transcriptionally cooperates with SP1 on the Amhr2 promoter. Mutations that altered the GCGGGGCGG sequence at -39 bp abolished COUP-TFII-mediated activation, COUP- TFII/SP1 cooperation, and reduced COUP-TFII binding to the proximal Amhr2 promoter. Our data provide a better understanding of the mechanism of COUP-TFII action in Leydig cells through the identification and regulation of the Amhr2 promoter as a novel target.

112

2.4 Introduction Anti-Müllerian hormone (AMH), produced by Sertoli cells in males and granulosa cells in females, is a glycoprotein that belongs to transforming growth factor-beta (TGFβ) family of proteins (reviewed in 1). In fetal males, AMH is best known for its essential function in promoting the regression of the Müllerian ducts that would otherwise develop into the fallopian tubes, uterus, and upper vagina (reviewed in 2). AMH has also been described as an important regulator of Leydig cell differentiation and function. For instance, AMH inhibits steroidogenesis in fetal and adult primary Leydig cells (3-5) as well as in various Leydig cell lines (6, 7). This inhibitory role of AMH on Leydig cell steroidogenesis was also reported in animal studies. Administration of AMH to adult rodents was found to inhibit testosterone biosynthesis (8, 9), and male transgenic mice overexpressing AMH exhibit feminized genitalia caused by reduced serum testosterone levels and Leydig cell numbers (10, 11). The reduced number of Leydig cells in these mice was attributed to AMH-mediated inhibition of the differentiation of mesenchymal stem cells into Leydig cells (4). Conversely, inactivation of the Amh gene in mice results in the retention of Müllerian duct derivatives as well as impairment in the differentiation of the adult Leydig cell population (12). In Amh-deficient male mice, plasma testosterone concentrations are reduced in pubertal animals but are normal in adults (13). This is believed to be due to Leydig cell hyperplasia where individual Leydig cells have a reduced capacity for testosterone biosynthesis leading to a deficit in androgen production, which is later compensated by an increase in the number of Leydig cells (13).

In Leydig cells, AMH acts via a heterodimeric receptor composed of the anti-Müllerian hormone type 2 receptor (AMHR2) (14, 15) and the activin receptor-like kinase 3 (ALK3). Amhr2 mRNA is present in Leydig cells as well as in several rodent Leydig cell lines (16, 17). At the protein level, AMHR2 is found in both the fetal and adult Leydig cell populations in rodents (15, 18). Deletion of the Amhr2 gene in male mice causes pseudohermaphroditism, infertility, seminiferous tubule atrophy, and Leydig cell hyperplasia (14), while Leydig cell- specific ablation of Alk3 causes impairments in Leydig cell differentiation and androgen metabolism (19). In humans, mutations inactivating the AMH or AMHR2 gene lead to the development of persistent Müllerian duct syndrome (PMDS) in males characterized by infertility, inguinal hernias, and cryptorchidism (20), and in some cases Leydig cell hyperplasia, azoospermia, and low serum testosterone levels (21).

113

Despite the important role for the AMH/AMHR2 system in regulating the differentiation and function of both Leydig cell populations, much remains to be understood regarding the mechanisms governing Amhr2 gene expression in these cells. The Amhr2 promoter has been reported to be regulated by the nuclear receptor steroidogenic factor 1 (SF1/Ad4BP/NR5A1) acting via two conserved nuclear receptor binding motifs (17, 22, 23). SF1 also cooperates with -catenin to synergistically activate Amhr2 transcription (23). The transcription factor GATA4 was also found to activate the Amhr2 promoter in Leydig cells (24). Other regulators of Amhr2 promoter activity include Wilms' tumor 1 (WT1) (25) and early growth response 1 (EGR1) in murine LβT2 gonadotrope cells (26).

114

2.5 Materials and Methods 2.5.1 Plasmids The -1486/+77, -758/+77, -486/+77, -257/+77, -151/+77, -122/+77, -67/+77, -51/+77, - 45/+77, and -34/+77 bp mouse Amhr2 promoter constructs were generated by PCR using an Amhr2 reporter construct as template provided by Dr. Jose Teixeira (Michigan State University, USA), and sequence-specific forward primers containing a Bam HI cloning site and a common reverse primer containing a Xho I cloning site. The primer sequences are listed in Table 2.1. PCR fragments were enzyme digested, gel-purified, and cloned into the Bam HI/Sal I sites of a modified pXP1 luciferase reporter vector (40). Mutations within the promoter region were generated using the PfuUltra High-Fidelity DNA Polymerase AD according to the manufacturer’s instructions (Agilent Technologies, California, USA) with the primer sets listed in Table 2.1. A plasmid containing the mouse COUP-TFII cDNA (31) was obtained from Dr. Ming Tsai (Baylor College of Medicine, USA) and the COUP-TFII cDNA was subsequently subcloned into the pcDNA3.1 mammalian expression vector (Invitrogen Canada, Ontario, Canada). All generated plasmids and PCR products were verified by an on-site sequencing service.

2.5.2 Cell Culture, Transfections, and Reporter Assays Mouse MA-10 Leydig cells (ATCC, Cat# CRL-3050, RRID:CVCL_D789) (41), provided by Dr. Mario Ascoli (University of Iowa, USA), were grown in DMEM/F12 medium supplemented with 2.438 g/L sodium bicarbonate, 3.57 g/L HEPES, and 15% horse serum on plates coated with 0.1% gelatin. Penicillin and streptomycin sulphate were added to a final o concentration of 50 mg/L, and cells were incubated at 37 C and 5% CO2 in a humidified incubator. MA-10 Leydig cells were isolated from mouse Leydig cell tumours (M5480P), and they represent immature Leydig cell population (42) as characterized by the high expression of 5α-reductase (43). Stimulation of MA-10 Leydig cells by luteinizing hormone/human chorionic gonadotropin, forskolin, and cAMP results in increased steroid production (42). MA-10 cells were transiently transfected using polyethylenimine hydrochloride (PEI) (Sigma-Aldrich Canada, Ontario, Canada) as described in reference (44) with minor modifications. Briefly, the cells were plated in 24-well plates 24 h prior to the

115

transfection. To determine COUP-TFII responsiveness, the cells were co-transfected on the next day with 400 ng of reporter vector along with different amounts of expression vectors and PEI dissolved in OPTI-MEM medium (GIBCO by Life Technologies, Burlington, Ontario, Canada). To determine relative promoter activity, the cells were co-transfected with 400 ng of reporter vector, 10 ng phRL-TK renilla luciferase expression vector, and 90 ng of an inert pSP64 plasmid (Promega, Madison, Wisconsin). Sixteen hours after transfection, the media were replaced, and the cells were grown for additional 32 h. After the cells were lysed, the cell lysates were collected and analysed using Tecan Spark 10M multimode plate reader (Tecan, North Carolina, USA) as previously described (45, 46).

2.5.3 siRNA Transfection and RT-qPCR MA-10 Leydig cells were transfected with 150 nM siRNA directed against Coup-tfii transcripts (Nr2f2-MSS235957, Life Technologies, USA) or with (siRNA Ctl) Stealth RNAi™ siRNA Negative Control, Med GC (Thermo Fisher Scientific, Ontario, Canada) using JetPRIME Transfection Reagent (PolyPlus, France) according to the manufacturer’s protocol. The cells were incubated for 48 h and total RNA was extracted using TRIZOL (Thermo Fisher Scientific, Ontario, Canada) following the supplier’s instructions. Amhr2 mRNA levels were determined by RT-qPCR as previously described (24, 45). Relative expression of Amhr2 was normalized to the expression of Rpl19, used as internal control, and is plotted as a ratio of Amhr2 to Rpl19 levels; primer sets are listed in Table 2.1.

2.5.4 Protein Purification and Western Blots Nuclear proteins from MA-10 Leydig cells were extracted as previously described (47) and quantified using a Bradford protein assay (Bio-Rad Laboratories, Ontario, Canada). In vitro translated COUP-TFII was generated using the Promega TNT Quick Coupled Transcription/Translation System (Thermo Fisher Scientific, Ontario, Canada) according to manufacturer’s protocol without additional purification or quantification. Denatured proteins were resolved by SDS-PAGE and transferred onto a PVDF membrane (Millipore, Ontario, Canada). Immunodetection was performed using horseradish peroxidase (HRP)-conjugated antibodies according to the manufacturer protocols and the following reagents: ECL and ECL Prime Western Blotting Detection Reagents (GE Healthcare Life Sciences, Ontario, Canada), Clarity Western ECL Substrate (Bio-Rad Laboratories, Ontario, Canada), Clarity Max

116

Western ECL Substrate (Bio-Rad Laboratories, Ontario, Canada). Detection of COUP-TFII and Lamin B proteins was performed using a mouse monoclonal anti-COUP-TFII antibody (dilution 1:1000; R&D systems Inc, Minnesota, USA; Cat#PP-H7147-00, RRID:AB_2155627) (48) and a goat polyclonal anti-Lamin B antibody (dilution 1:1000; Santa Cruz Biotechnology, California, USA; Cat# sc-6216, RRID:AB_648156) (49), respectively.

2.5.5 Chromatin Immunoprecipitation-quantitative PCR (ChIP-qPCR) assay Three million MA-10 Leydig cells were plated on a 0.1% gelatin-coated 100 mm plate and incubated for 24 h. Once the cells reached 80% confluency, the protein/DNA complexes were crosslinked by supplementing the media with 1% formaldehyde and incubating for 10 min at 37 oC. The crosslinking reaction was stopped by the addition of glycine to a final concentration of 125 mM with shaking for 10 min at 25 oC. Chromatin immunoprecipitation (ChIP) experiments were performed as described previously (30). ChIP DNA fragments were analysed by qPCR using specific primer sets for proximal and distal regions of the Amhr2 gene regulatory region (Table 2.1). The qPCR amplifications were done on a C1000 Thermal Cycler (Bio-Rad Laboratories, Ontario, Canada) using PerfeCTa SYBR Green FastMix (Quantabio, Massachusetts, USA) and the following conditions: 3 min at 95 oC, followed by 46 cycles of denaturation (10 s at 95 oC), annealing (30 s at 59 oC), and extension (20 s at 72 oC). Specificity of the primer sets for the target regions were verified by agarose gel electrophoresis and sequencing. Results are represented as fold enrichments and were calculated from ChIP αCOUP-TFII (R&D systems Inc, Minnesota, USA; Cat#PP-H7147- 00, RRID:AB_2155627) (48) samples relative to the ChIP control IgG (Santa Cruz Biotechnology, USA; Cat# sc-2025, RRID:AB_737182) (50) after both samples were normalized to the input. Fold enrichment was calculated as follows: fold enrichment = 2-∆∆Ct, where each target gene region was first normalized to the input following formula “normalized to input” ∆Ct=∆Ct (ChIP)-(∆Ct input – log dilution factor). Then, -∆∆Ct =“normalized to input” ∆Ct (NR2F2)-normalized to input ∆Ct (IgG). The ChIP results were confirmed in three separate experiments.

117

2.5.6 DNA Pull-down Assay DNA pull-down assays were performed as previously described (30) with minor modifications. Biotinylated and nonbiotinylated oligonucleotides were synthesized by IDT (Integrated DNA Technologies, Iowa, USA) and are listed in Table 2.1. Ten micrograms of biotinylated oligonucleotides and 10 µg of complementary oligonucleotides were annealed in 100 µL Taq reaction buffer (New England Biolabs, Ontario, Canada) using a Biometra o TGradient thermocycler (Montréal Biotech, Québec, Canada), and stored at -20 C until use. Streptavidin magnetic beads from Promega (Thermo Fisher Scientific, Ontario, Canada) were washed 4 times with B&W buffer (5 mM Tris-Cl, pH 7.5, 0.5 mM EDTA, and 1 M NaCl). DNA probes were diluted to 20 ng/µL in B&W buffer. One microgram of the diluted DNA probe was added to 50 µL of pre-washed magnetic beads and incubated at 24 oC for 20 min. The beads were washed once with 300 µL cold B&W buffer, once with 300 µL Protein Binding Buffer (20 mM Tris-Cl pH 7.5, 1 mM EDTA, 1 mM DTT, 0.15% Triton X-100, 100 mM NaCl, 4 mM MgCl2, 5% Glycerol). After DNA probes were bound to the beads, the beads were blocked with 0.67% BSA in 300 µL Protein Binding Buffer by rotation at 23 oC for 20 min. Next, the beads were washed once with Protein Binding Buffer. To the beads, 130 µg of nuclear extracts were added in 500 µL Protein Binding Buffer and incubated for 90 min (60 min at 4 oC and 30 min at 23 oC) with constant rotation, followed by 7 washes in 300 µL cold Protein Binding Buffer. Bound proteins were eluted in 20 uL of 1x Laemmli buffer by incubating at 95 oC for 10 min and analysed by Western Blotting.

2.5.7 Statistical Analyses All statistical analyses were performed using GraphPad Prism software (GraphPad Software Inc., USA; RRID:SCR_002798) (51) or Microsoft Excel (Microsoft Corporation, USA; RRID:SCR_016137) (52). Statistical analyses between two groups were performed using Student t-test or by one-way ANOVA followed by Newman-Keuls post hoc test for multiple comparisons between the groups. P-values from each comparison are indicated in the figure legends.

118

2.6 Results 2.6.1 COUP-TFII regulates Amhr2 gene transcription in Leydig cells Transcriptomic microarray analysis of COUP-TFII-depleted MA-10 Leydig cells revealed several genes whose expression was affected by the lower level of COUP-TFII protein (Mehanovic, Mendoza-Villarroel, Tremblay, in preparation). Due to its well-established role in Leydig cell differentiation and steroidogenesis (6, 7, 11, 53), an interesting candidate was the Amhr2 gene. We therefore decided to further investigate whether COUP-TFII could be involved in the regulation of Amhr2 gene expression. MA-10 Leydig cells were transfected with either control siRNA or siRNA directed against COUP-TFII. Decreased COUP-TFII protein levels were confirmed by Western blot (Fig. 2.1A, top panel). In COUP-TFII depleted MA-10 Leydig cells, Amhr2 mRNA levels were reduced by ~36% compared to control cells (Fig. 2.1A, bottom panel). To test if the decrease in Amhr2 mRNA levels in COUP-TFII- depleted cells was due to a direct action of COUP-TFII on the Amhr2 promoter, MA-10 Leydig cells were co-transfected with two mouse Amhr2 reporter constructs, -1486/+77 bp and -34/+77 bp, in the absence or presence of a COUP-TFII expression vector. As shown in Figure 2.1B, the -1486/+77 bp Amhr2 reporter was activated up to 4-fold by COUP-TFII, whereas the -34/+77 bp Amhr2 reporter was only weakly activated by COUP-TFII.

2.6.2 COUP-TFII-dependent activation of the Amhr2 promoter does not require SF1 regulatory elements Previous studies have demonstrated that COUP-TFII can act via SF1 regulatory elements on target genes (54-56). The Amhr2 promoter contains two previously characterized SF1 elements at -250 bp (5’-AGGTCA-3’) and at -200 bp (5’-AGGTCC-3’) (17). To test whether COUP-TFII regulates Amhr2 promoter activity through the two SF1 elements, Ahmr2 promoter constructs harboring mutations in the distal, proximal or both SF1 elements were generated and transfected in MA-10 Leydig cells. Surprisingly, these mutations had no impact on COUP-TFII responsiveness (Fig. 2.2), which suggests that one or more unknown regulatory elements are required.

119

2.6.3 An intact GC-rich sequence is essential for COUP-TFII-dependent activation of the Amhr2 promoter To locate the COUP-TFII response element, a series of 5’ progressive deletion constructs were generated and transfected in MA-10 Leydig cells. As shown in Fig. 2.3A, deletion from -1486 to -67 bp did not impair COUP-TFII-dependent activation of the Amhr2 promoter. However, a -34 bp deletion construct was only modestly activated by COUP-TFII (2 fold compared to ~20 fold with longer promoter constructs) (Fig. 2.3A). These results suggest that the critical COUP-TFII response element is located between -67 and -34 bp.

Analysis of the basal promoter activity of the same Amhr2 deletion constructs revealed a small but significant increase in activity with deletion from -1486 bp to -486 bp (Fig. 2.3B). Subsequent deletions to -122 bp and -67 bp caused a significant decrease in promoter activity (Fig. 2.3B), with the -67 bp reporter having only ~30% activity of the -1486 bp reporter. Finally, a deletion to -34 bp abrogated Amhr2 promoter activity (Fig. 2.3B). These data indicate that the key regulatory elements required for Amhr2 promoter activity in MA-10 Leydig cells are located within the -122 to -34 bp, the region that also contains the COUP- TFII response element.

We next determined if COUP-TFII could directly bind to the -67/-34 bp region of the Amhr2 promoter. Using DNA pull-down assays and nuclear extracts from MA-10 Leydig cells, we found that COUP-TFII binds in vitro to oligonucleotides corresponding to the -67/-34 bp region (Fig. 2.4A, lane 4), as well as to a high-affinity direct repeat 1 (DR1) binding sequence used as positive control (Fig. 2.4A, lane 2). No significant binding was observed when only the magnetic beads were used as a negative control (Fig. 2.4A, lane 3). We subsequently performed ChIP-qPCR to determine whether COUP-TFII is recruited to the -67/-34 region of the Amhr2 promoter in a native chromatin environment in MA-10 Leydig cells. As shown in Figure 2.4B, COUP-TFII was found to be associated with the proximal Amhr2 promoter, between -140 to +29 bp, a region that contains the -67/-34 bp COUP-TFII-responsive sequence. In contrast, COUP-TFII was not significantly recruited to a distal region of the Amhr2 gene (-3395 to -3274 bp) that is devoid of AGGTCA-like motifs and used as negative control.

120

To better locate the COUP-TFII binding region, we performed an in silico analysis of the - 67/-34 bp region of the Amhr2 promoter across different species. This analysis revealed the presence of a potential nuclear receptor element (NRE) 5’-AGGACA-3’ (Fig. 2.5A) at -48 bp that could potentially be recognized by COUP-TFII. To test the functional importance of this predicted nuclear receptor motif in COUP-TFII responsiveness, we used site-directed mutagenesis to mutate the NRE sequence (AGGACA to AaagCA, M1) in the context of the -67/+77 bp Amhr2 promoter. Surprisingly, mutation of the NRE did not significantly impair the ability of COUP-TFII to activate the Amhr2 reporter (Fig. 2.5B), suggesting that the 5’- AGGACA-3’ motif is not responsible for the COUP-TFII responsiveness. In agreement with this observation, we found that COUP-TFII present in nuclear extracts could still bind to the mutated -67/-34 bp sequence in DNA pull-down assays (Fig. 2.5C, lane 4). To ultimately pinpoint the COUP-TFII response element within the -67/-34 bp region of the Amhr2 promoter, we generated two additional 5’ deletion constructs of the Amhr2 promoter: -51/+77 bp (retains the NRE) and -45/+77 bp (removes the NRE). As shown in Figure 2.6, both -51 bp and -45 bp reporters were still activated by COUP-TFII, while the -34 bp was no longer responsive. This indicated that the COUP-TFII response element most likely resides between -45 and -34 bp. Sequence analysis of the -45 to -34 bp region identified a GC-rich sequence (5’-GCGGGGCGG-3’) at -43/-34 bp that is adjacent to the NRE and well conserved across species (Fig. 2.7A). To validate the requirement of this GC-rich sequence, different mutations were introduced within the -67/+77 bp construct: GCGGGGCGG to GCttGGCGG (M2), GCGGGGCGG to GCGGGGCtt (M3), and GCGGGGCGG to GCttGGCtt (M4). Co- transfections in MA-10 Leydig cells showed that all three mutations reduced COUP-TFII- mediated activation to background levels, as observed with the minimal -34 bp reporter (Fig. 2.7B). An intact GC-rich sequence at -39 bp is therefore essential for COUP-TFII-dependent activation of the Amhr2 promoter.

2.6.4 COUP-TFII binds to the GC-rich sequence To confirm whether COUP-TFII directly binds to the GC-rich sequence in vitro, we performed DNA pull-down assays using either nuclear extracts from MA-10 Leydig cells that endogenously express COUP-TFII (Fig. 2.8A) or recombinant COUP-TFII in vitro transcribed and translated (Fig. 2.8B). As expected, endogenously expressed COUP-TFII was found to bind to oligonucleotides containing -67/-34 bp WT and -67/-34 bp M1 (mutated

121

NRE) (Fig. 2.8A, lanes 5 and 7 respectively). COUP-TFII from MA-10 nuclear extracts could still bind to oligonucleotides -67/-34 bp M4 containing a mutated GC-rich sequence (above background observed with the beads), albeit to a lesser extent than the WT or M1 (mutated NRE) sequences (compare lanes 5, 6, and 7 in Fig. 2.8A). The residual binding observed with M4 could be due to low affinity binding of COUP-TFII to the NRE. We also found that COUP-TFII from MA-10 Leydig cell nuclear extracts can bind to oligonucleotides containing the SF1 distal (5’-AGGTCA-3’) and SF1 proximal (5’-AGGTCC-3’) sequences (Fig. 2.8A, lanes 8 and 9 respectively) of the Amhr2 promoter, with COUP-TFII having a higher affinity for the distal site. A high-affinity DR1 (HA-DR1) WT binding site was used as positive control (Fig. 2.8A, lane 2) while magnetic beads (Fig. 2.8A, lane 4) and a mutated HA-DR1 sequence (Fig. 2.8A, lane 3) were used as negative controls. Since COUP-TFII can bind to DNA in association with other transcription factors present in nuclear extracts, we used in vitro transcribed/translated COUP-TFII in DNA pull-down assays to study the binding properties of the COUP-TFII protein by itself. As expected, in vitro produced COUP- TFII could bind to the HA-DR1 sequence (Fig. 2.8B, top panel, lane 2). COUP-TFII binding was also observed on the SF1 distal sequence (Fig. 2.8B, top panel, lane 7). In order to detect any low affinity binding of COUP-TFII, the same blot was exposed for a longer period (Fig. 2.8B, lower panel). This longer exposure revealed that COUP-TFII can bind weakly to the SF1 proximal sequence (Fig. 2.8B, lower panel, lane 8). Very weak binding of in vitro produced COUP-TFII to the WT -67/-34 bp sequence was also detected (Fig. 8B, lower panel, lane 5). Mutation of the GC-rich sequence (M4) within the -67/-34 bp sequence abolished the binding as it was indistinguishable from the magnetic beads used as negative control (Fig. 2.8B, lower panel, lanes 4 and 6). The weak binding of in vitro generated COUP- TFII by itself to the -67/-34 bp sequence of the Amhr2 promoter indicates that it likely requires the presence of another transcription factor present in MA-10 Leydig cell extracts in order to properly bind to this sequence.

2.6.5 COUP-TFII cooperates with SP1 on the Amhr2 promoter GC-rich sequences are known to be bound by members of the Specificity Protein (SP) family of transcription factors, such as SP1 and SP3 (reviewed in 57). SP1 and SP3 are ubiquitously expressed including in various Leydig cell lines such as MA-10 Leydig cells (58, 59). Furthermore, SP1 and COUP-TF factors have been reported to cooperate to regulate gene

122

expression (reviewed in 60). We therefore examined the possibility that COUP-TFII and SP1 might cooperate on the Amhr2 promoter. As shown in Fig. 2.9, COUP-TFII can activate the Amhr2 promoter by about 10 fold while SP1 is a weaker activator (about 1.6 fold). Combination of both transcription factors led to synergistic activation of 20 fold (Fig. 9). This COUP-TFII/SP1 cooperation was lost when the GC-rich sequence was mutated (M4 in Fig. 2.9) and no cooperation was observed with the minimal -34/+77 bp reporter (Fig. 2. 9).

123

2.7 Discussion AMH is abundantly produced by Sertoli cells during fetal life to ensure regression of the Müllerian ducts in developing male embryos. AMH is also present in the adult testis albeit at lower level, where it is known to regulate Leydig cell steroidogenesis (4, 6-9) as well as postnatal Leydig cell differentiation (4, 8-11, 61). The effects of AMH on Leydig cells are mediated via the AMH receptors AMHR2 (4, 15) and ALK3 (19). Leydig cell lines, including rat R2C and mouse MA-10, are known to express Amhr2 and treatment of these cells or mice with AMH represses steroidogenesis (6-9).

2.7.1 Identification of COUP-TFII as new regulator of Amhr2 expression in Leydig cells Despite the importance of AMH/AMHR2 in regulating Leydig cell differentiation and function, very little is known about the regulation of Amhr2 gene expression in these cells. Studies on the human and rat AMHR2 promoter have revealed that the nuclear receptor SF1 (NR5A1/Ad4BP) is important for AMHR2 promoter activity (17, 22).

The nuclear receptor COUP-TFII (NR2F2) is also expressed in Leydig cells from the adult population and is known to bind to DNA sequence similar to SF1 elements (54-56, 62). As SF1, COUP-TFII regulates the expression of the Star (30) and Insl3 (63) genes in Leydig cells. Our analysis of COUP-TFII-depleted MA-10 Leydig cells revealed that Amhr2 mRNA levels were significantly reduced in the absence of COUP-TFII, indicating that COUP-TFII is also required for expression of the endogenous Amhr2 gene in these cells. Consistent with a direct action on Amhr2 transcription, we found that COUP-TFII could activate a -1486 bp mouse Amhr2 promoter construct in MA-10 Leydig cells. This promoter fragment contains the two previously characterized SF1 elements at -250 bp (5’-AGGTCA-3’) and at -200 bp (5’-AGGTCC-3’) to which COUP-TFII can bind in vitro. However, mutation/deletion of either or both SF1 elements had no effect on the transactivation of the Amhr2 promoter by COUP-TFII indicating that they are not required for COUP-TFII-mediated activation. Although another region of the Amhr2 promoter is required for COUP-TFII responsiveness, it remains possible that COUP-TFII might still contribute to Amhr2 transcription via the SF1 elements in a different context.

124

Results from functional studies in R2C Leydig cells revealed that a sequence located between -99 to -91 bp of the Amhr2 promoter and containing an AGG core nuclear receptor binding motif (5’-AGAGGTGGGT-3’) is required for maximal activation by SF1 (17). We hypothesized that the same region might be involved in COUP-TFII-dependent transactivation of the Amhr2 promoter. However, we found that deletion of that region did not affect Amhr2 promoter activation by COUP-TFII in MA-10 Leydig cells. Instead, we found that a region between -67 to -34 bp, to which COUP-TFII can bind, is essential for COUP-TFII-dependent activation of mouse Amhr2 promoter in MA-10 Leydig cells. This is also consistent with the fact that the proximal Amhr2 promoter (-151 to -34 bp) contains all the regulatory elements for maximal activity in MA-10 Leydig cells.

2.7.2 Mechanisms of COUP-TFII action on the Amhr2 promoter Sequence analysis of the -67 to -34 bp region revealed the presence of a potential nuclear receptor element (NRE) that contains an AGG core motif for the binding of nuclear receptors (5’AGGACA-3’). We initially hypothesized that COUP-TFII might regulate Amhr2 promoter activity via this NRE. Surprisingly, deletion or mutation (5’-AGGACA-3’ to AaagCA-3’) of the NRE did not reduce COUP-TFII-dependent activation. Similarly, mutation of the NRE did not drastically affect the binding of COUP-TFII present in nuclear extracts from MA-10 Leydig cells. These data indicate that COUP-TFII either directly binds to another sequence within the -67 to -34 bp region or is recruited to the proximal promoter via interaction with another DNA-bound transcription factor. The reduced binding of in vitro- produced recombinant COUP-TFII compared to COUP-TFII present in nuclear extracts from MA-10 Leydig cells supports the hypothesis of an interaction with, or stabilization by, another transcription factor. This is also consistent with the fact that COUP-TFII is known to regulate gene expression as homodimer or heterodimer with other transcription factors (reviewed in 29, 64, 65).

Fine mapping of the Amhr2 promoter revealed that the COUP-TFII-responsive sequence is located between -45/-34 bp. This sequence contains a species-conserved GC-rich sequence and mutations within the GC-rich sequence abolished COUP-TFII-dependent activation of the Amhr2 promoter, and reduced binding of COUP-TFII present in MA-10 Leydig cell extracts as well as in vitro-produced recombinant COUP-TFII, which indicates that COUP-

125

TFII can bind directly to the GC-rich sequence, albeit with low affinity. Interestingly, footprinting analyses of the Amhr2 promoter incubated with nuclear proteins from R2C Leydig cells revealed that the GC-rich sequence is protected from DNase I digestion, which indicates the binding of a transcription factor believed to be SP1 (17). SP1 belongs to a family of ubiquitous transcription factors that can drive gene expression by binding to GC-rich sequences located in promoter region of target genes (reviewed in 57). SP1 is expressed in Leydig cells where it regulates expression of several genes including the genes encoding the LH receptor (66), the nuclear receptor SF1 (67), and the PDGF-R (58).

Although the role of SP1 in Amhr2 expression in Leydig cells remained unexplored, it was proposed that it might participate in the initiation of transcription of this TATA-less promoter and/or interact with other transcription factors to contribute to the expression of the gene (17). In agreement with this hypothesis, we found that COUP-TFII and SP1 functionally cooperate to further activate the Amhr2 promoter and that this activation required an intact GC-rich sequence. These data support a model (Fig. 2.10) whereby COUP-TFII by itself can bind with low affinity to the GC-rich sequence within the proximal Amhr2 promoter (Fig. 2.10A) and is stabilized by an interaction with SP1 and/or another transcription factor (Fig. 2.10B) ultimately leading to increased gene Amhr2 transcription. In addition to the GC-rich sequence, we cannot exclude the possibility that the NRE is also involved in COUP-TFII binding to the Amhr2 promoter once SP1 has stabilized the complex. However, in our experiments, we consistently observed a significant decrease in COUP-TFII-dependent activation when the GC-rich sequence is mutated indicating that the NRE sequence cannot compensate for the absence of an intact adjacent GC-rich sequence. A similar mechanism of COUP-TFII recruitment via DNA-bound SP1 was originally proposed by Pipaón to describe COUP-TFII action on the nerve growth factor-induced protein A (Ngfi-A/Egr-1) promoter (68). In their model, they proposed that SP1 serves as a docking protein for COUP-TF as they found that COUP-TF cannot bind its responsive element alone. Since then, this mechanism of SP1/COUP-TF cooperation has been reported for the expression of several other genes in various tissues including the human immunodeficiency virus type 1 long terminal repeat (HIV-1 LTR) (69), neuropilin 2 (Nrp2) (70), orthodenticle homeobox 2 (Otx2) (71), EYA Transcriptional Coactivator And Phosphatase 1 (Eya1), Wilms’ tumor 1 (Wt1) (72), E2F transcription factor 1 (E2f1) (73), Angiopoietin 1 (Ang1) (74), Glut4 (75), and

126

insulin-like growth factor 1 (Igf1) (76). These gene promoters, although activated by COUP- TFII, do not contain a classical COUP-TFII binding site. COUP-TFII responsiveness was rather found to require an intact SP1 element in the proximal promoter to which COUP-TFII is recruited. However, recruitment of COUP-TFII to those GC-rich sequences had so far only been demonstrated by chromatin immunoprecipitation (ChIP), which does not discriminate between direct binding to DNA and indirect recruitment via interaction with another DNA- bound transcription factor. Our current work shows that COUP-TFII can directly bind to a GC-rich sequence. In addition to a functional cooperation, COUP-TFII and SP1 were found to physically interact (68) consistent with an SP1-mediated recruitment and/or stabilization of COUP-TFII to the promoter of target genes.

In conclusion, our present work establishes a role for the nuclear receptor COUP-TFII in the expression of the Amhr2 gene in Leydig cells. We found that COUP-TFII action does not require direct binding to DNA but rather involves a cooperation with the SP1 transcription factor bound to a GC-rich sequence within the proximal Amhr2 promoter.

127

2.8 Disclosure summary The authors have nothing to disclose.

2.9 Funding This work was supported by a grant from the Canadian Institutes of Health Research (funding reference number MOP-81387) to JJT. SM was the recipient of a studentship from the Fondation du CHU de Québec-Université Laval.

2.10 Acknowledgments We are thankful to Dr. Jose Teixeira, Dr. Ming Tsai, and Dr. Mario Ascoli for kindly providing the Amhr2 reporter construct, the COUP-TFII plasmid and the MA-10 Leydig cell line, respectively.

2.11 Data Availability All data generated or analyzed during this study are included in this published article or in the data repositories listed in References.

128

2.12 Figures

Figure 2.1 COUP-TFII regulates mouse Amhr2 gene transcription in MA-10 Leydig cells. (A) Depletion of COUP-TFII in MA-10 Leydig cells reduces Amhr2 gene expression. MA-10 Leydig cells were transfected with control siRNA (white bars) or siRNA targeting COUP-TFII (black bars). After 48 h, cells were collected and nuclear extracts as well as total RNA were prepared. The efficiency of COUP-TFII depletion was determined by Western blot using 5 µg of nuclear extracts from cells transfected with control siRNA (lane 1) and siRNA targeting COUP-TFII (lane 2). Lamin B (LMNB1) was used as a loading control. Amhr2 mRNA levels were quantified by qPCR and normalized to Rpl19 mRNA. Data are represented as mean ± SEM. An asterisk indicates a statistically significant difference (P<0.05). (B) COUP-TFII activates the mouse Amhr2 promoter in MA-10 Leydig cells. MA-10 Leydig cells were co-transfected with either 100 ng of an empty expression vector (control, white bars) or an expression vector for COUP-TFII (black bars), along with 400 ng of Amhr2 promoter construct (-1486/+77 bp or -34/+77 bp, as indicated). Results are shown as fold activation over control ± SEM. A hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05) while an asterisk

129

represents a statistically significant difference in the activation by COUP-TFII between the -1486 and -34 bp reporters (P<0.05).

130

Figure 2.2 COUP-TFII does not require the SF1 elements to activate the Amhr2 promoter. MA-10 Leydig cells were co-transfected with 100 ng of an empty expression vector (white bars) or 50 ng of an expression vector for COUP-TFII (black bars) along with 400 ng of Amhr2 reporter constructs -1486/+77 bp, -34/+77 bp, or -1486/+77 bp harboring mutations (depicted by a large X) within the SF1 elements (identified by white ovals) as indicated on the left side of the graph. Results are shown as fold activation over control ± SEM. For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05). An asterisk represents a statistically significant difference in the activation by COUP-TFII between the -1486 bp reporters and the -34 bp reporter (P<0.05).

131

Figure 2.3 The COUP-TFII responsive element is located within the proximal Amhr2 promoter region. (A) MA-10 Leydig cells were co-transfected with 100 ng of an empty expression vector (-, white bars) or an expression vector for COUP-TFII (+, black bars) along with a series of progressive 5’ deletion constructs of the mouse Amhr2 promoter (400 ng) as indicated (left panel). The two previously reported SF1 elements are depicted by a white oval. Results are shown as fold activation over control ± SEM. For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05). An asterisk represents a statistically significant difference in the activation by COUP-TFII of each reporter compared to that of the -34 bp reporter (P<0.05). (B) The regulatory elements required for

132

maximal Amhr2 promoter activity in MA-10 Leydig cells are located within the proximal -151 bp. MA-10 Leydig cells were transfected with a series of progressive 5’ deletion constructs of the mouse Amhr2 promoter as indicated (left panel). Results are shown as relative activity compared to the activity of the -1486 bp reporter, which was arbitrarily set at 100%. A different letter indicates a statistically significant difference (P<0.05).

133

Figure 2.4 COUP-TFII binds to the -67/-34 Amhr2 promoter region in vitro and is recruited to the proximal region of the gene. (A) DNA pull-down assays were performed using oligonucleotides containing a high-affinity COUP-TFII direct repeat 1 sequence (HA-DR1) or oligonucleotides that contain the -67/-34 bp sequence of the Amhr2 promoter along with nuclear extracts from MA-10 Leydig cells. Beads alone (no oligonucleotide) were used as negative control (Beads). Western blots were used to detect COUP-TFII. Input corresponds to 5 µg of the nuclear extracts used in the DNA pull-down assay (n=3). (B) ChIP assays were performed using an IgG (negative control) or a COUP- TFII antiserum. A 169 bp fragment of the proximal Amhr2 promoter containing the COUP-TFII responsive -67/-34 region was amplified by quantitative PCR immediately following the ChIP assay (-140 to +29 bp, black bars). A distal region (-3395 to -3274 bp) that does not contain a COUP-TFII element was used as a negative control (white bars). The amplified regions of the Amhr2 gene are shown. Results are represented as fold enrichment of ChIP DNA αCOUP-TFII over ChIP DNA mouse IgG from three independent experiments ± SEM. A hashtag indicates a statistically significant difference between distal and proximal Amhr2 promoter (black bar over white bar) for ChIP COUP- TFII (P<0.05).

134

Figure 2.5 The AGGACA sequence within the -67/-34 region is not required for COUP-TFII binding and activation of the Amhr2 promoter. (A) Representation of the -1486/+77 bp Amhr2 promoter showing the two previously characterized SF1 elements (white oval) and the COUP-TFII responsive region (-67/-34 bp, black rectangle). Sequence alignment of the -67/-34 bp region from various species (mouse, rat, human, orangutan, chimp) revealed a potential binding site (box) for nuclear receptors (nuclear receptor element, NRE; AGGACA or AGGATG). An asterisk (*) corresponds to a species-conserved nucleotide compared to the mouse sequence. (B) MA-10 Leydig cells were co-transfected with 50 ng of an empty expression vector (-, white bars) or an expression vector for COUP-TFII (+, black bars) along with 400 ng of various Amhr2 reporter constructs: - 67/+77 bp WT, -67/+77 bp harboring a mutation (AGGACA  AaagCA) in the potential NRE (M1), and -34/+77 bp. The NRE is represented by a black diamond (WT) and a large X represents the mutation. Results are shown as fold activation over control (± SEM). For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05). An asterisk represents a statistically significant difference in the activation by COUP-TFII of each reporter compared to that of the -34 bp reporter (P<0.05). (C) DNA pull-down assays were performed using oligonucleotides containing a high-affinity COUP-TFII direct repeat 1 sequence (HA-DR1) or oligonucleotides that contain the -67/-34 bp sequence of the Amhr2 promoter either wild-type (WT) or harboring a trinucleotide mutation in the potential NRE (AGGACA  AaagCA, M1) along with nuclear extracts from MA-10 Leydig cells. Western blots were used to detect COUP-TFII. Input corresponds to 25 µg of the nuclear extracts used in the DNA pull-down assay (n=3).

135

Figure 2.6 The COUP-TFII response element is located within -45 bp to -34 bp of the Amhr2 promoter. MA-10 Leydig cells were co-transfected with 50 ng of an empty expression vector (-, white bars) or an expression vector for COUP-TFII (+, black bars) along with 400 ng of different 5’ progressive Amhr2 deletion constructs as indicated. Results are shown as fold activation over control ± SEM. For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05). An asterisk represents a statistically significant difference in the activation by COUP-TFII of each reporter compared to that of the -34 bp reporter (P<0.05).

136

Figure 2.7 An intact GC-rich sequence is required for the COUP-TFII-mediated activation of the -67 bp Amhr2 promoter. (A) In silico sequence analysis of the -52/-34 Amhr2 revealed the presence of a highly conserved GC-rich sequence located from -43 to -34 bp (gray box) adjacent to the potential NRE (bolded nucleotides). An asterisk (*) corresponds to a species-conserved nucleotide compared to the mouse sequence. (B) MA-10 Leydig cells were co-transfected with an empty expression vector (-, white bars) or an expression vector for COUP-TFII (+, black bars) along with various Amhr2 reporter constructs: -67/+77 bp WT, -67/+77 bp harboring different mutations within the GC-rich sequence (M2, M3, M4), and -34/+77 bp. The potential NRE (AGGACA) is represented by a black diamond and while the GC-rich sequence is depicted by the grey rectangle. The mutated nucleotides are in lowercase and underlined. Results are shown as fold activation over control ± SEM. For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, black bar over white bar, P<0.05). An asterisk represents a statistically significant difference in the activation by COUP-TFII between the -67 bp reporters and the -34 bp reporter (P<0.05).

137

Figure 2.8 COUP-TFII binds to the -67/-34 bp Amhr2 region. DNA pull-down assays were performed using either nuclear extracts from MA-10 Leydig cells (A) or in vitro-produced COUP- TFII (B) along with various biotinylated double-strand oligonucleotides containing a high-affinity COUP-TFII direct repeat 1 sequence wild-type (HA-DR1 WT) or harboring a mutation that destroys the binding site (HA-DR1 Mut), the Amhr2 -67/-34 bp sequence either wild-type (WT) or with a mutation in the potential NRE (M1) or in the GC-rich sequence (M4), or the previously characterized SF1 distal and proximal elements. Beads alone (no oligonucleotide) were used as a negative control (Beads). Input in (A) corresponds to 5 µg of the nuclear extracts, and in (B) to 2.5% (v/v) of the product of the in vitro translation reaction used in the DNA pull-down assay (n=3). Western blots were used to detect COUP-TFII. Input corresponds to 5 µg of the nuclear extracts used in the DNA pull-down assay (n=3). In (B), two images of the same blot using different exposure times are shown.

138

Figure 2.9 COUP-TFII and SP1 cooperate to activate the Amhr2 promoter. MA-10 Leydig cells were co-transfected with an empty expression vector (white bars) or expression vectors for COUP- TFII (black bars) and SP1 (hatched bars) alone or in combination (gray bars), along with various Amhr2 reporter constructs: -67/+77 bp WT, -67/+77 bp harboring a mutation within the GC-rich sequence (M4), and -34/+77 bp. The potential NRE (AGGACA) is represented by a black diamond and the GC-rich sequence is depicted by the grey rectangle. Mutation of the GC-rich sequence is depicted by large X. Results are shown as fold activation over control ± SEM. For each reporter, a hashtag (#) represents a statistically significant difference from its control (empty expression vector, value set at 1, P<0.05). For the -67/+77 bp WT reporter, an asterisk represents a statistically significant difference in the activation between COUP-TFII alone and the combination of COUP- TFII and SP1 (P<0.05).

139

Figure 2.10 Proposed model for the COUP-TFII-dependent activation of the Amhr2 promoter in MA-10 Leydig cells. (A) COUP-TFII is recruited to the proximal promoter region where it binds mainly to the GC-rich sequence and only with low affinity to the NRE. (B) Binding of SP1 to the GC-rich sequence and interaction with COUP-TFII stabilizes COUP-TFII resulting in higher transcription. The DNA sequence for the NRE is shown in bold while the GC-rich sequence is boxed.

140

2.13 Tables

Table 2.1 Oligonucleotides used in this study.

Purpose Descriptio Templat Sequence n e Promoter -1486/+77 Amhr2 F: CGGGATCCAGCCCCTTTACCTTTTG Construc bp reporter ts -758/+77 construct F: CGGGATCCAGAAGAGGATGTCAAATC bp (17) -486/+77 F: CGGGATCCAGTACAGCCAGGACTACAC bp -257/+77 F: CGGGATCCAAGGTCAGTAGGGGTAGAG bp -151/+77 F: CGGGATCCTGAAGAAAAGATTGATTCTCTGC bp -122/+77 F: CGGGATCCTTTCTCTGCCTGTTTC bp -67/+77 bp F: CGGGATCCACAGAGACCGGGATAG -51/+77 bp F: CGGGATCCAGGACAGAGCGGGGCGGA -45/+77 bp F: CGGGATCCGAGCGGGGCGGAGTTG -34/+77 bp F: CGGGATCCAGTTGGGGATTGAAGGCTTGG R: CGCAGATCTCGAGAAGGATGC -1486/+77 - F: bp SF1 1486/+7 AGAAGGTCCAGCACCTTCTTCCAAaacCAGTAGGGGTAGAG Distal mut 7 bp ATTTC R: GAAATCTCTACCCCTACTGgttTTGGAAGAAGGTGCTGGACC TTCT -1486/+77 - F: GTTCTCAGCTGGACAGCCAAaacCCCTTCCTCCCCTCTC bp SF1 1486/+7 R: GAGAGGGGAGGAAGGGgttTTGGCTGTCCAGCTGAGAAC Proximal 7 bp mut -1486/+77 - F: GTTCTCAGCTGGACAGCCAAaacCCCTTCCTCCCCTCTC bp SF1 1486/+7 Distal, 7 bp SF1 R: GAGAGGGGAGGAAGGGgttTTGGCTGTCCAGCTGAGAAC Proximal Distal mut mut -67/+77 bp -67/+77 F: CACAGAGACCGGGATAaagCAGAGCGGGGCGGAG M1 bp R: CTCCGCCCCGCTCTGcttTATCCCGGTCTCTGTG 67/+77 bp -67/+77 F: GGGATAGGACAGAGCttGGCGGAGTTGGGGAT M2 bp R: ATCCCCAACTCCGCCaaGCTCTGTCCTATCCC -67/+77 bp -67/+77 F: TAGGACAGAGCGGGGCttAGTTGGGGATTGAAGG M3 bp R: CCTTCAATCCCCAACTaaGCCCCGCTCTGTCCTA -67/+77 bp -67/+77 F: M4 bp CCGGGATAGGACAGAGCttGGCttAGTTGGGGATTGAAGGC R: GCCTTCAATCCCCAACTaaGCCaaGCTCTGTCCTATCCCGG F: /5Biosg/AGCTTCAGGTCAGAGGTCAGAGAGCT

141

DNA HA DR1 R: AGCTCTCTGACCTCTGACCTGAAGCT Pull- WT down HA DR1 F: /5Biosg/AGCTTCAaaTCAGAaaTCAGAGAGCT Mut R: AGCTCTCTGAttTCTGATTTGAAGCT -67/-34 bp F: /5Biosg/CCACAGAGACCGGGATAGGACAGAGCGGGGCGG WT R: CCGCCCCGCTCTGTCCTATCCCGGTCTCTGTGG -67/-34 bp F: /5Biosg/CCACAGAGACCGGGATAaagCAGAGCGGGGCGG M1 R: CCGCCCCGCTCTGcttTATCCCGGTCTCTGTGG -67/-34 bp F: /5Biosg/CCACAGAGACCGGGATAGGACAGAGCttGGCtt M4 R: aaGCCaaGCTCTGTCCTATCCCGGTCTCTGTGG SF1 distal F: /5Biosg/TTCTTCCAAGGTCAGTAGGGGTAGAGATTT

R: AAATCTCTACCCCTACTGACCTTGGAAGAA SF1 F: /5Biosg/TTCTCAGCTGGACAGCCAAGGTCCCTTCCTCC proximal R: GGAGGAAGGGACCTTGGCTGTCCAGCTGAGAA ChIP -140/+29 F:ATTGATTCTCTGCTCCTCCCTTTC bp Amhr2 R:CTCAGCCAAGGCTTCCTACAAATA promoter -3395/- F: TCAAAAGAAATAATGACCCGAGGC 3274 bp R: CAAATGGCTTCTTTGGTCTGGAAT Amhr2 promoter qPCR Amhr2 F: CCCTCTGCCCTCTGGGCC TT R: ACTGGCCATCCTGCCAACGC Rpl19 F: CTGAAGGTCAAAGGGAATGTG R: GGACAGAGTCTTGATGATCTC

142

2.14 References 1. Josso N, di Clemente N, Gouedard L. Anti-Mullerian hormone and its receptors. Mol Cell Endocrinol. 2001;179(1-2):25-32. 2. Behringer RR. The in vivo roles of mullerian-inhibiting substance. Curr Top Dev Biol. 1994;29(171-187. 3. Gautier C, Levacher C, Saez JM, Habert R. Transforming growth factor beta1 inhibits steroidogenesis in dispersed fetal testicular cells in culture. Mol Cell Endocrinol. 1997;131(1):21-30. 4. Racine C, Rey R, Forest MG, Louis F, Ferre A, Huhtaniemi I, Josso N, di Clemente N. Receptors for anti-mullerian hormone on Leydig cells are responsible for its effects on steroidogenesis and cell differentiation. Proc Natl Acad Sci USA. 1998;95(2):594-599. 5. Rouiller-Fabre V, Carmona S, Merhi RA, Cate R, Habert R, Vigier B. Effect of anti- Mullerian hormone on Sertoli and Leydig cell functions in fetal and immature rats. Endocrinology. 1998;139(3):1213-1220. 6. Teixeira J, Fynn-Thompson E, Payne AH, Donahoe PK. Mullerian-inhibiting substance regulates androgen synthesis at the transcriptional level. Endocrinology. 1999;140(10):4732-4738. 7. Fynn-Thompson E, Cheng H, Teixeira J. Inhibition of steroidogenesis in Leydig cells by Mullerian-inhibiting substance. Mol Cell Endocrinol. 2003;211(1-2):99-104. 8. Sriraman V, Niu E, Matias JR, Donahoe PK, MacLaughlin DT, Hardy MP, Lee MM. Mullerian inhibiting substance inhibits testosterone synthesis in adult rats. J Androl. 2001;22(5):750-758. 9. Trbovich AM, Sluss PM, Laurich VM, O'Neill FH, MacLaughlin DT, Donahoe PK, Teixeira J. Mullerian Inhibiting Substance lowers testosterone in luteinizing hormone- stimulated rodents. Proc Natl Acad Sci USA. 2001;98(6):3393-3397. 10. Behringer RR, Cate RL, Froelick GJ, Palmiter RD, Brinster RL. Abnormal sexual development in transgenic mice chronically expressing mullerian inhibiting substance. Nature. 1990;345(6271):167-170. 11. Lyet L, Louis F, Forest MG, Josso N, Behringer RR, Vigier B. Ontogeny of reproductive abnormalities induced by deregulation of anti-mullerian hormone expression in transgenic mice. Biol Reprod. 1995;52(2):444-454. 12. Behringer RR, Finegold MJ, Cate RL. Mullerian-inhibiting substance function during mammalian sexual development. Cell. 1994;79(3):415-425. 13. Wu X, Arumugam R, Baker SP, Lee MM. Pubertal and adult Leydig cell function in Mullerian inhibiting substance-deficient mice. Endocrinology. 2005;146(2):589-595.

143

14. Mishina Y, Rey R, Finegold MJ, Matzuk MM, Josso N, Cate RL, Behringer RR. Genetic analysis of the Mullerian-inhibiting substance signal transduction pathway in mammalian sexual differentiation. Genes Dev. 1996;10(20):2577-2587. 15. Lee MM, Seah CC, Masiakos PT, Sottas CM, Preffer FI, Donahoe PK, Maclaughlin DT, Hardy MP. Mullerian-inhibiting substance type II receptor expression and function in purified rat Leydig cells. Endocrinology. 1999;140(6):2819-2827. 16. Baarends WM, Hoogerbrugge JW, Post M, Visser JA, De Rooij DG, Parvinen M, Themmen AP, Grootegoed JA. Anti-mullerian hormone and anti-mullerian hormone type II receptor messenger ribonucleic acid expression during postnatal testis development and in the adult testis of the rat. Endocrinology. 1995;136(12):5614-5622. 17. Teixeira J, Kehas DJ, Antun R, Donahoe PK. Transcriptional regulation of the rat Mullerian inhibiting substance type II receptor in rodent Leydig cells. Proc Natl Acad Sci USA. 1999;96(24):13831-13838. 18. Mendis-Handagama SM, Di Clementi N, Ariyaratne HB, Mrkonjich L. Detection of anti-Mullerian hormone receptor II protein in the postnatal rat testis from birth to sexual maturity. Histol Histopathol. 2006;21(2):125-130. 19. Wu X, Zhang N, Lee MM. Mullerian inhibiting substance recruits ALK3 to regulate Leydig cell differentiation. Endocrinology. 2012;153(10):4929-4937. 20. Picard JY, Cate RL, Racine C, Josso N. The Persistent Mullerian Duct Syndrome: An Update Based Upon a Personal Experience of 157 Cases. Sex Dev. 2017;11(3):109-125. 21. Gujar NN, Choudhari RK, Choudhari GR, Bagali NM, Mane HS, Awati JS, Balachandran V. Male form of persistent Mullerian duct syndrome type I (hernia uteri inguinalis) presenting as an obstructed inguinal hernia: a case report. J Med Case Rep. 2011;5:586. 22. de Santa Barbara P, Moniot B, Poulat F, Boizet B, Berta P. Steroidogenic factor-1 regulates transcription of the human anti-mullerian hormone receptor. J Biol Chem. 1998;273(45):29654-29660. 23. Hossain A, Saunders GF. Synergistic cooperation between the beta-catenin signaling pathway and steroidogenic factor 1 in the activation of the Mullerian inhibiting substance type II receptor. J Biol Chem. 2003;278(29):26511-26516. 24. Bergeron F, Nadeau G, Viger RS. GATA4 knockdown in MA-10 Leydig cells identifies multiple target genes in the steroidogenic pathway. Reproduction. 2015;149(3):245-257. 25. Klattig J, Sierig R, Kruspe D, Besenbeck B, Englert C. Wilms' tumor protein Wt1 is an activator of the anti-Mullerian hormone receptor gene Amhr2. Mol Cell Biol. 2007;27(12):4355-4364. 26. Garrel G, Denoyelle C, L'Hote D, Picard JY, Teixeira J, Kaiser UB, Laverriere JN, Cohen-Tannoudji J. GnRH Transactivates Human AMH Receptor Gene via Egr1 and FOXO1 in Gonadotrope Cells. Neuroendocrinology. 2019;108(2):65-83.

144

27. Lin FJ, Qin J, Tang K, Tsai SY, Tsai MJ. Coup d'Etat: an orphan takes control. Endocr Rev. 2011;32(3):404-421. 28. Wu SP, Yu CT, Tsai SY, Tsai MJ. Choose your destiny: Make a cell fate decision with COUP-TFII. J Steroid Biochem Mol Biol. 2016;157:7-12. 29. Tsai SY, Tsai MJ. Chick ovalbumin upstream promoter-transcription factors (COUP- TFs): coming of age. Endocr Rev. 1997;18(2):229-240. 30. Mendoza-Villarroel RE, Robert NM, Martin LJ, Brousseau C, Tremblay JJ. The nuclear receptor NR2F2 activates Star expression and steroidogenesis in mouse MA-10 and MLTC-1 Leydig cells. Biol Reprod. 2014;91(1):26. 31. Pereira FA, Qiu Y, Zhou G, Tsai MJ, Tsai SY. The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development. Genes Dev. 1999;13(8):1037-1049. 32. Lee CT, Li L, Takamoto N, Martin JF, Demayo FJ, Tsai MJ, Tsai SY. The nuclear orphan receptor COUP-TFII is required for limb and skeletal muscle development. Mol Cell Biol. 2004;24(24):10835-10843. 33. Lee HJ, Kao CY, Lin SC, Xu M, Xie X, Tsai SY, Tsai MJ. Dysregulation of nuclear receptor COUP-TFII impairs skeletal muscle development. Sci Rep. 2017;7(1):3136. 34. Takamoto N, You LR, Moses K, Chiang C, Zimmer WE, Schwartz RJ, DeMayo FJ, Tsai MJ, Tsai SY. COUP-TFII is essential for radial and anteroposterior patterning of the stomach. Development. 2005;132(9):2179-2189. 35. You LR, Takamoto N, Yu CT, Tanaka T, Kodama T, Demayo FJ, Tsai SY, Tsai MJ. Mouse lacking COUP-TFII as an animal model of Bochdalek-type congenital diaphragmatic hernia. Proc Natl Acad Sci USA. 2005;102(45):16351-16356. 36. Kurihara I, Lee DK, Petit FG, Jeong J, Lee K, Lydon JP, DeMayo FJ, Tsai MJ, Tsai SY. COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet. 2007;3(6):e102. 37. Petit FG, Jamin SP, Kurihara I, Behringer RR, DeMayo FJ, Tsai MJ, Tsai SY. Deletion of the orphan nuclear receptor COUP-TFII in uterus leads to placental deficiency. Proc Natl Acad Sci USA. 2007;104(15):6293-6298. 38. Zhao F, Franco HL, Rodriguez KF, Brown PR, Tsai MJ, Tsai SY, Yao HH. Elimination of the male reproductive tract in the female embryo is promoted by COUP-TFII in mice. Science. 2017;357(6352):717-720. 39. Qin J, Tsai MJ, Tsai SY. Essential roles of COUP-TFII in Leydig cell differentiation and male fertility. PLoS One. 2008;3(9):e3285. 40. Tremblay JJ, Viger RS. Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol. 1999;13(8):1388-1401.

145

41. RRID:CVCL_D789, https://scicrunch.org/resolver/CVCL_D789. 42. Ascoli M. Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology. 1981;108(1):88- 95. 43. Trbovich AM, Martinelle N, O'Neill FH, Pearson EJ, Donahoe PK, Sluss PM, Teixeira J. Steroidogenic activities in MA-10 Leydig cells are differentially altered by cAMP and Mullerian inhibiting substance. J Steroid Biochem Mol Biol. 2004;92(3):199-208. 44. Longo PA, Kavran JM, Kim MS, Leahy DJ. Transient mammalian cell transfection with polyethylenimine (PEI). Methods Enzymol. 2013;529:227-240. 45. Martin LJ, Boucher N, Brousseau C, Tremblay JJ. The orphan nuclear receptor NUR77 regulates hormone-induced StAR transcription in Leydig cells through cooperation with Ca2+/calmodulin-dependent protein kinase I. Mol Endocrinol. 2008;22(9):2021-2037. 46. Martin LJ, Boucher N, El-Asmar B, Tremblay JJ. cAMP-induced expression of the orphan nuclear receptor Nur77 in MA-10 Leydig cells involves a CaMKI pathway. J Androl. 2009;30(2):134-145. 47. Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with 'mini-extracts', prepared from a small number of cells. Nucleic Acids Res. 1989;17(15):6419. 48. RRID:AB_2155627, https://scicrunch.org/resolver/AB_2155627. 49. RRID:AB_648156, https://scicrunch.org/resolver/AB_648156. 50. RRID:AB_737182, https://scicrunch.org/resolver/AB_737182. 51. RRID:SCR_002798, https://scicrunch.org/resolver/SCR_002798. 52. RRID:SCR_016137, https://scicrunch.org/resolver/SCR_016137. 53. Laurich VM, Trbovich AM, O'Neill FH, Houk CP, Sluss PM, Payne AH, Donahoe PK, Teixeira J. Mullerian inhibiting substance blocks the protein kinase A-induced expression of cytochrome p450 17alpha-hydroxylase/C(17-20) lyase mRNA in a mouse Leydig cell line independent of cAMP responsive element binding protein phosphorylation. Endocrinology. 2002;143(9):3351-3360. 54. Wehrenberg U, Ivell R, Jansen M, von Goedecke S, Walther N. Two orphan receptors binding to a common site are involved in the regulation of the oxytocin gene in the bovine ovary. Proc Natl Acad Sci USA. 1994;91(4):1440-1444. 55. Bakke M, Lund J. Mutually exclusive interactions of two nuclear orphan receptors determine activity of a cyclic adenosine 3',5'-monophosphate-responsive sequence in the bovine CYP17 gene. Mol Endocrinol. 1995;9(3):327-339. 56. van den Driesche S, Walker M, McKinnell C, Scott HM, Eddie SL, Mitchell RT, Seckl JR, Drake AJ, Smith LB, Anderson RA, Sharpe RM. Proposed role for COUP-TFII in

146

regulating fetal Leydig cell steroidogenesis, perturbation of which leads to masculinization disorders in rodents. PLoS One. 2012;7(5):e37064. 57. Li L, He S, Sun JM, Davie JR. Gene regulation by Sp1 and Sp3. Biochem Cell Biol. 2004;82(4):460-471. 58. Bergeron F, Bagu ET, Tremblay JJ. Transcription of platelet-derived growth factor receptor alpha in Leydig cells involves specificity protein 1 and 3. J Mol Endocrinol. 2011;46(2):125-138. 59. Giatzakis C, Papadopoulos V. Differential utilization of the promoter of peripheral-type benzodiazepine receptor by steroidogenic versus nonsteroidogenic cell lines and the role of Sp1 and Sp3 in the regulation of basal activity. Endocrinology. 2004;145(3):1113- 1123. 60. Safe S, Kim K. Nuclear receptor-mediated transactivation through interaction with Sp proteins. Prog Nucleic Acid Res Mol Biol. 2004;77:1-36. 61. Salva A, Hardy MP, Wu XF, Sottas CM, MacLaughlin DT, Donahoe PK, Lee MM. Mullerian-inhibiting substance inhibits rat Leydig cell regeneration after ethylene dimethanesulphonate ablation. Biol Reprod. 2004;70(3):600-607. 62. Zheng W, Horton CD, Kim J, Halvorson LM. The orphan nuclear receptors COUP-TFI and COUP-TFII regulate expression of the gonadotropin LHbeta gene. Mol Cell Endocrinol. 2010;330(1-2):59-71. 63. Mendoza-Villarroel RE, Di-Luoffo M, Camire E, Giner XC, Brousseau C, Tremblay JJ. The INSL3 gene is a direct target for the orphan nuclear receptor, COUP-TFII, in Leydig cells. J Mol Endocrinol. 2014;53(1):43-55. 64. Park JI, Tsai SY, Tsai MJ. Molecular mechanism of chicken ovalbumin upstream promoter-transcription factor (COUP-TF) actions. Keio J Med. 2003;52(3):174-181. 65. Qin J, Tsai SY, Tsai MJ. The critical roles of COUP-TFII in tumor progression and metastasis. Cell Biosci. 2014;4(1):58. 66. Nikula H, Koskimies P, El-Hefnawy T, Huhtaniemi I. Functional characterization of the basal promoter of the murine LH receptor gene in immortalized mouse Leydig tumor cells. J Mol Endocrinol. 2001;26(1):21-29. 67. Scherrer SP, Rice DA, Heckert LL. Expression of steroidogenic factor 1 in the testis requires an interactive array of elements within its proximal promoter. Biol Reprod. 2002;67(5):1509-1521. 68. Pipaon C, Tsai SY, Tsai MJ. COUP-TF upregulates NGFI-A gene expression through an Sp1 binding site. Mol Cell Biol. 1999;19(4):2734-2745. 69. Rohr O, Aunis D, Schaeffer E. COUP-TF and Sp1 interact and cooperate in the transcriptional activation of the human immunodeficiency virus type 1 long terminal repeat in human microglial cells. J Biol Chem. 1997;272(49):31149-31155.

147

70. Lin FJ, Chen X, Qin J, Hong YK, Tsai MJ, Tsai SY. Direct transcriptional regulation of neuropilin-2 by COUP-TFII modulates multiple steps in murine lymphatic vessel development. J Clin Invest. 2010;120(5):1694-1707. 71. Tang K, Xie X, Park JI, Jamrich M, Tsai S, Tsai MJ. COUP-TFs regulate eye development by controlling factors essential for optic vesicle morphogenesis. Development. 2010;137(5):725-734. 72. Yu CT, Tang K, Suh JM, Jiang R, Tsai SY, Tsai MJ. COUP-TFII is essential for metanephric mesenchyme formation and kidney precursor cell survival. Development. 2012;139(13):2330-2339. 73. Chen X, Qin J, Cheng CM, Tsai MJ, Tsai SY. COUP-TFII is a major regulator of cell cycle and Notch signaling pathways. Mol Endocrinol. 2012;26(8):1268-1277. 74. Qin J, Chen X, Xie X, Tsai MJ, Tsai SY. COUP-TFII regulates tumor growth and metastasis by modulating tumor angiogenesis. Proc Natl Acad Sci USA. 2010;107(8):3687-3692. 75. Crowther LM, Wang SC, Eriksson NA, Myers SA, Murray LA, Muscat GE. Chicken ovalbumin upstream promoter-transcription factor II regulates nuclear receptor, myogenic, and metabolic gene expression in skeletal muscle cells. Physiol Genomics. 2011;43(4):213-227. 76. Kim BJ, Takamoto N, Yan J, Tsai SY, Tsai MJ. Chicken Ovalbumin Upstream Promoter-Transcription Factor II (COUP-TFII) regulates growth and patterning of the postnatal mouse cerebellum. Dev Biol. 2009;326(2):378-391.

148

3 Chapter 3. COUP-TFII cooperates with GATA4 to regulate Amhr2 transcription in mouse MA-10 Leydig cells

3.1 Chapter introduction In Chapter 2, I demonstrated the mechanism of action of COUP-TFII in the regulation of the Amhr2 gene in MA-10 Leydig cells. In silico analysis of the mouse Amhr2 promoter revealed the presence of a GATA factor response element in close proximity to the NRE. Since GATA4 is another essential Leydig cell transcription factor, it prompted me to ask if it cooperates with COUP-TFII in Leydig cells. In this Chapter, I address the last objective, where I investigate a novel cooperation between COUP-TFII and GATA4 in the regulation of Amhr2 gene transcription in a steroidogenic cell line.

Author contributions: All results presented in this chapter were generated by me.

Status of the manuscript: The manuscript is being completed—new questions came to light that need addressing before final submission.

149

COUP-TFII cooperates with GATA4 to regulate Amhr2 transcription in mouse MA-10 Leydig cells

Samir Mehanovic1, Robert S. Viger1,2 and Jacques J. Tremblay1,2,*

1 Reproduction, Mother and Child Health, Centre de recherche du centre hospitalier universitaire de Québec—Université Laval, CHUL Room T3-67, Québec City, Québec, Canada, G1V 4G2.

Short title: COUP-TFII/GATA4 cooperation on Amhr2

Keywords: COUP-TFII, NR2F2, Steroidogenesis, Leydig cells, Amhr2, GATA4, GATA6

150

3.2 Résumé Les cellules de Leydig, situées dans la région interstitielle du testicule, produisent de la testostérone et de l'insuline 3, deux hormones essentielles à la différenciation sexuelle masculine et aux fonctions de reproduction. Le récepteur nucléaire COUP-TFII et le facteur en doigt de zinc GATA4 sont deux facteurs de transcription impliqués dans la différenciation, l'expression génique et la fonction des cellules de Leydig. Étant donné que les promoteurs de plusieurs gènes exprimés dans les cellules de Leydig contiennent des motifs de liaison pour les facteurs GATA et les récepteurs nucléaires, nous avons émis l'hypothèse que GATA4 et COUP-TFII pourraient coopérer pour réguler l'expression des gènes dans les cellules de Leydig. Pour tester notre hypothèse, nous avons d'abord analysé les gènes différentiellement exprimés à partir de cellules de Leydig MA-10 appauvries en GATA4 et COUP-TFII. Cela a révélé 44 gènes couramment régulés, y compris le gène du récepteur d'hormone anti- Müllérienne (Amhr2). Chez les hommes, la voie AMH / AMHR2 régule la régression des canaux de Müller pendant la différenciation sexuelle et la différenciation des cellules de Leydig et la stéroïdogenèse. Bien que GATA4 (4 fois) et COUP-TFII (6 fois) puissent activer indépendamment le promoteur Amhr2 de souris, leur combinaison a conduit à une activation plus forte (10 fois). Nos résultats suggèrent qu'un “GC-rich element”, situé dans la région principale du promoteur et récemment identifié comme clé pour l’activité COUP-TFII, est également essentiel pour l'activation dépendante de GATA4 du promoteur Amhr2 ainsi que pour la coopération COUP-TFII/GATA4. La coopération fonctionnelle COUP-TFII/GATA4 est probablement le résultat d'une interaction entre les deux facteurs dans les cellules de Leydig tel que confirmé par des tests de co-immunoprécipitation. Les tests d'immunoprécipitation de la chromatine (ChIP) ont validé le recrutement de GATA4 et COUP-TFII sur le promoteur Amhr2 proximal, qui contient des sites de liaison pour les deux facteurs en plus de le “GC-rich element”. Nos résultats ont établi l'importance d'une coopération fonctionnelle GATA4/COUP-TFII dans l'expression génique des cellules de Leydig.

151

3.3 Abstract Leydig cells, located in the interstitial region of the testis, produce testosterone and insulin- like 3, two hormones essential for male sex differentiation and reproductive functions. The nuclear receptor COUP-TFII and the zinc finger factor GATA4 are two transcription factors involved in Leydig cell differentiation, gene expression and function. Since the promoters of several Leydig cell-expressed genes contain binding motifs for both GATA factors and nuclear receptors, we hypothesized that GATA4 and COUP-TFII might cooperate to regulate gene expression in Leydig cells. To test our hypothesis, we first analysed the differentially expressed genes from GATA4- and COUP-TFII-depleted MA-10 Leydig cells. This revealed 44 commonly regulated genes including the anti-Müllerian hormone receptor (Amhr2) gene. In males, the AMH/AMHR2 pathway regulates Müllerian duct regression during sex differentiation and Leydig cell differentiation and steroidogenesis. Although both GATA4 (4-fold) and COUP-TFII (6-fold) can independently activate the mouse Amhr2 promoter, their combination led to a stronger activation (10-fold). Our results suggest that a GC-rich element, located in the core promoter region and recently identified as key for COUP-TFII- responsiveness, is also essential for GATA4-dependent activation of Amhr2 promoter as well as for the COUP-TFII/GATA4 cooperation. The functional COUP-TFII/GATA4 cooperation is likely the result of an interaction between the two factors in Leydig cells as confirmed by co-immunoprecipitation assays. Chromatin immunoprecipitation (ChIP) assays validated GATA4 and COUP-TFII recruitment to the proximal Amhr2 promoter, which contains binding sites for both factors in addition to the GC-rich element. Our results established the importance of a functional GATA4/COUP-TFII cooperation in Leydig cell gene expression.

152

3.4 Introduction Chicken ovalbumin upstream promoter transcription factor type II (COUP-TFII/NR2F2) belongs to the COUP-TF subfamily of nuclear receptors. In most cases, COUP-TF transcription factors regulate gene expression by binding to a nuclear response element (NRE) which contains one or two copies of sequences related to AGGTCA (reviewed in Tsai and Tsai, 1997). COUP-TFII is expressed in limbs, stomach, diaphragm, uterus, heart, and in gonads (Pereira et al., 1999). Although a constitutive global inactivation of Coup-tfii in mice results in early fetal lethality due to improper angiogenesis and heart defects (Pereira et al., 1999), a temporal-specific global knockout at later developmental stages revealed a crucial role for COUP-TFII in Leydig cell differentiation and function (Qin et al., 2008). In adult mouse gonads, COUP-TFII is detected in Leydig cells and some peritubular cells (Mendoza-Villarroel et al., 2014b). In Leydig cells, COUP-TFII was found to directly regulate several genes important for Leydig cell function including Star (Mendoza-Villarroel et al., 2014b), Insl3 (Mendoza-Villarroel et al., 2014a), Akr1c14 (Di-Luoffo et al., 2016), and Amhr2 (Mehanovic et al., 2019). In addition, bioinformatic analyses of transcriptomic data obtained from COUP-TFII-depleted MA-10 Leydig cells revealed over 260 dysregulated genes, many of which are involved in lipid metabolism, male gonad development, and steroidogenesis (Mehanovic et al, in preparation).

In vertebrates, the GATA family of transcription factors consists of six paralogs (GATA1- 6), which are involved in organogenesis and regulation of essential molecular functions in many tissues (reviewed in Tremblay et al., 2018). These transcription factors are named from their ability to recognize and bind to the WGATAR consensus sequence located in the promoter region of their target genes. GATA4 is detected several tissues including the heart, gut, and gonads (reviewed in Viger et al., 2008). In the mouse testis, GATA4 mRNA and protein are detected in Leydig and Sertoli cells (Ketola et al., 1999). Global inactivation of Gata4 in mice results in death between E7.5 and E10.5 due to improper cardiac morphogenesis (Kuo et al., 1997; Molkentin et al., 1997). Conditional inactivation of Gata4 in the earliest stages of gonadal development also revealed that GATA4 is essential for gonad formation in both males and females (Hu et al., 2013). GATA4 was also found to be required for Leydig cell differentiation and function in the fetal testis (Bielinska et al., 2007; Padua et al., 2015). Conversely, expression of GATA4, along with two other transcription factors, is

153

sufficient to reprogram mouse fibroblasts into Leydig-like cells (Yang et al., 2017). Consistent with its key role in Leydig cells, GATA4 was found to regulate the expression of several genes in these cells including Star, Sf1, Cyp19a1, Cyp11a1, HSD3B2, Inha, and Amhr2 ((Bergeron et al., 2015; Tremblay and Viger, 2001a) and reviewed in Tremblay and Viger, 2003; Viger et al., 2008; Viger et al., 2004). Microarray analyses of GATA4-depleted Leydig cell lines also revealed several potential new target genes involved in glycolysis, cholesterol metabolism and transport, and steroidogenesis (Bergeron et al., 2015; Schrade et al., 2015).

Interestingly, several genes appear to be regulated by both COUP-TFII and GATA4 in Leydig cells raising the possibility that they may act jointly in a common pathway to ensure proper steroidogenic gene expression and function in these cells. To test this possibility, we performed an extensive analysis of microarray data from both COUP-TFII- and GATA4- depleted MA-10 Leydig cells. Here we report the identification of 44 commonly dysregulated genes, 33 downregulated and 11 upregulated), in COUP-TFII/GATA4-depleted Leydig cells. One of the downregulated genes is Amhr2, a gene coding for the AMH type 2 receptor. We found that COUP-TFII and GATA4 interact and cooperate to activate the mouse Amhr2 promoter in Leydig cells. Consistent with the fact that Leydig cells express both GATA4 and GATA6, a cooperation was also observed between COUP-TFII and GATA6 but not with other GATA family members. Both COUP-TFII and GATA4 were found to be recruited to the proximal Amhr2 promoter, a region that contains a GC-rich sequence that was found to be required for the COUP-TFII/GATA4 cooperation. Collectively, our data identify several genes commonly regulated by COUP-TFII and GATA4 in Leydig cells and establish the existence of a functional COUP-TFII/GATA4 cooperation in regulation of Amhr2 gene expression in mouse MA-10 Leydig cells.

154

3.5 Materials and methods 3.5.1 Microarray data analyses The depletion and validation of GATA4 and COUP-TFII in MA-10 Leydig cells using siRNA was described previously (Mehanovic et al, manuscript in preparation) (Bergeron et al., 2015). The complete gene lists from GATA4-depleted (Bergeron et al., 2015) and COUP- TFII-depleted (Mehanovic et al, manuscript in preparation) MA-10 Leydig cells compared to control cells were used in our analysis. The genes affected by GATA4 depletion used for the analysis were limited to 1.3 fold change, P-value <0.05, and FDR <0.25. Differentially expressed genes affected by COUP-TFII depletion were limited to 1.3 fold change and P- value <0.01. The lists of genes that fit the selection criteria for both the GATA4-depleted and the COUP-TFII-depleted MA-10 Leydig cells were combined. The genes were grouped into four gene sets: COUP-TFII upregulated, COUP-TFII downregulated, GATA4 downregulated, and GATA4 upregulated. The identification of commonly regulated genes between the sets was performed using a web-based Venn diagram tool (Heberle et al., 2015). The presence of potential direct repeats (DR1) and nuclear receptor elements (NRE) for the binding of COUP-TFII in the proximal regulatory region (-500 bp to +50 bp) of these genes was previously reported (Mehanovic et al, manuscript in preparation). The presence of GATA motifs was determined by downloading from the NCBI database the sequence of the mouse proximal regulatory region (-500 bp to +50 bp) of each gene followed by an analysis using the web-based motif discovery tool FIMO (version 5.1.0) (Grant et al., 2011).Cell culture

Mouse MA-10 Leydig cells (ATCC, Cat# CRL-3050, RRID:CVCL_D789), donated by Dr. Ascoli (University of Iowa, USA), were grown in DMEM/F12 medium supplemented with 2.438 g/L sodium bicarbonate, 3.57 g/L HEPES, 15% horse serum, on gelatin-coated plates. MA-10 cells, generated from a mouse Leydig cell tumour, represent immature Leydig cells from the adult population (Ascoli, 1981). African green monkey kidney fibroblast CV-1 cells were grown in DMEM medium supplemented with 3.7 g/L HEPES and 10% newborn calf serum. Penicillin and streptomycin sulphate were supplemented to the cell culture media to o a final concentration of 50 mg/L, and both cell lines were incubated at 37 C, 5% CO2 in a humidified incubator.

155

3.5.2 Plasmids and luciferase promoter assays The mouse Amhr2 reporter constructs (-1486/+77 bp, -67/+77 bp, -67/+77 bp M4 mut GC box, and -34/+77 bp), the mouse Gsta (-2062/+38 bp), and a modified pXP1 (used as control) vector were described previously (Mehanovic et al., 2019; Tremblay and Viger, 1999). Expression plasmids for mouse COUP-TFII, mouse GATA1, mouse GATA3, rat GATA4, and rat GATA6 have been previously described (Bouchard et al., 2005; Mehanovic et al., 2019; Tremblay and Viger, 2001b). To measure promoter activation, MA-10 and CV-1 cells were transiently transfected using polyethylenimine hydrochloride (PEI) (Sigma-Aldrich Canada, Ontario, Canada) as previously described (Mehanovic et al., 2019). Briefly, the cells were plated in 24-well plates and co-transfected with 400 ng of reporter vector along with 100 ng of expression vectors (empty expression vector pcDNA3.1 as control, COUP-TFII, GATAs, or COUP-TFII+GATAs). Sixteen hours post transfection, the media was replaced, and the cells were grown for additional 32 h. The cells were then lysed, the lysates collected, and luciferase measurements performed using a Tecan Spark 10M multimode plate reader (Tecan, North Carolina, USA) as previously described (Mehanovic et al., 2019).

3.5.3 Chromatin immunoprecipitation (ChIP)-qPCR assay ChIP assays were performed by plating 1.2-4.5 x 106 MA-10 cells in gelatin-coated 150 mm dishes and grown in regular culture media. Once the cells reached 80-90 % confluency (3-4 days), the media was discarded, and the cells were washed one time with 1x PBS (warmed at 37oC). The cells were crosslinked by adding 15 ml of 1% formaldehyde, DMEM/F12, 15% horse serum media and incubating at 37oC for 10 min. The crosslinking reaction was stopped by addition of 1.5 ml of 2.5 M glycine in PBS followed by incubation for 2-5 min on a rocker platform at low setting. The crosslinking media was removed, and the cells were rinsed twice with 15 ml of cold 1x PBS. The cells were scraped, collected by centrifugation, and the pellets were stored at -80oC. Next, the cells (20 x 106) were lysed and chromatin was fragmented using a Sonicator Misonix Ultra sonic processor part S-4000 in 0.4 ml SDS Lysis Buffer (50 mM Tris-HCl pH 8, 1% (w/v) sodium dodecyl sulfate (SDS), 10 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0, 1 mM PMSF, 1 µg/ml Pepstatin, 1 µg/ml Leupeptin, 1 µg/ml Aprotinin). The cellular debris were removed by centrifugation and the supernatant was diluted 1:10 in ChIP dilution buffer to a final concentration of 20 mM Tris

156

(pH8), 2 mM EDTA (pH8), 0.1% SDS, 150 mM NaCl, 1% Triton X-100, 1 mM PMSF, 1 µg/ml Pepstatin, 1 µg/ml Leupeptin, 1 µg/ml Aprotinin). To prepare the reference input control sample and to determine the efficiency of chromatin shearing and the concentration, an aliquot of 200 µl was diluted with 275 µl of 1xTE (10 mM Tris-HCl pH 8.0, 1 mM EDTA), 30 µl 5M NaCl, 25 µl of 20% SDS. Decrosslinking was performed by adding RNAse A to a final concentration of 20 µg/ml and incubating for 4 h at 65oC, followed by addition of Proteinase K to a final concentration of 200 µg/ml and continuing incubation overnight. The sheared chromatin was cleaned up by phenol/chloroform extraction and ethanol precipitation, and resuspended in 10 mM Tris-Cl, pH 8.5. The chromatin shearing efficiency was determined by running an aliquot on an agarose gel (1x TAE), and the amount quantified by Nanodrop. Immunoprecipitation was performed by addition of 100 µg of sheared chromatin to 50 µl pre-bound magnetic Dynabeads protein G beads (Invitrogen, Ontario, CAN) with 5 µg of a goat polyclonal antiserum against GATA4 (C-20, Cat# SC-1237; Santa Cruz, California, USA) or a goat IgG as control (Cat# SC-2028; Santa Cruz, California, USA), or monoclonal antibody against human COUP-TFII made in the mouse (Cat# PP-H7147-00; R&D systems, Ontario, CAN) or a mouse IgG as control (Cat# SC-2025, Santa Cruz, California, USA), and incubating in 20 mM Tris (pH 8.0), 2 mM EDTA (pH 8.0), 0.1% SDS, 150 mM NaCl, 1% Triton X-100, 1 mM PMSF, 1 µg/ml Pepstatin, 1 µg/ml Leupeptin, 1 µg/ml Aprotinin at 4oC overnight with constant rotation. A magnet was used to isolate the magnetic beads and associated proteins, and to discard the supernatant. The beads and associated proteins were washed one time with low salt buffer (20 mM Tris-HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 150 mM NaCl, 2 mM EDTA), two times with high salt buffer (20 mM Tris-HCl pH 8.0, 0.1% SDS, 1% Triton X-100, 500 mM NaCl, 2 mM EDTA), three times with lithium wash buffer (100 mM Tris-HCl pH 8.0, 0.25 M LiCl, 1% NP-40, 1% deoxycholic acid), and three times with TE. The beads were resuspended in 200 µl of 10 mM Tris-HCl pH8.0, 0.3 M NaCl, 5 mM EDTA, 0.5% SDS, 50 µg/ml RNase A and incubated for 4 h at 65oC. The magnetic beads were separated, discarded, and the supernatant was collected. Proteinase K was added to a final concentration of 250 µg/ml, and incubation was continued at 65oC overnight to complete de-crosslinking. The immunoprecipitated chromatin was cleaned up by phenol/chloroform extraction and ethanol precipitation, and resuspended in 10 mM Tris-Cl, pH 8.5. ChIP DNA fragments and reference input samples were diluted

157

10 fold and quantified by qPCR using specific primer sets targeting the Amhr2 promoter proximal region (-140/+29 bp; forward: 5’-ATT GAT TCT CTG CTC CTC CCT TTC-3’, reverse: 5’-CTC AGC CAA GGC TTC CTA CAA ATA-3’) and distal region (-3395/-3274 bp; forward: 5’-TCA AAA GAA ATA ATG ACC CGA GGC-3’, reverse: 5’-CAA ATG GCT TCT TTG GTC TGG AAT-3’). The qPCR experiments were performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Quebec, Canada) and analysed as previously described (Mehanovic et al., 2019). The analysed and plotted data come from three independent experiments.

3.5.4 Co-immunoprecipitation (Co-IP) assays Extraction of nuclear proteins from MA-10 Leydig cells was performed as described previously (Mehanovic et al., 2019). Magnetic Dynabeads protein G beads (Invitrogen, Ontario, Canada) were equilibrated by washing 5 times with 1x PBS, 0.02% Tween-20. The antibodies were pre-bound to 50 µl of magnetic beads by incubation with 5 µg of an GATA4 polyclonal antiserum made in goat (C-20, Cat# SC-1237; Santa Cruz, California, USA) or goat IgG as control (Cat# SC-2028; Santa Cruz, California, USA) in total volume of 200 µl at 23oC for 20 min. The unbound antibodies were removed by washing the magnetic beads 1 time with 200 µl of 1x PBS, 0.02% Tween-20 and 1 time with cold IP buffer (150 mM NaCl,

1 mM EDTA pH 8.0, 50 mM Tris pH 7.4, 0.3% IGEPAL, 1 mM DTT, 1x NaF, 1x Na2VO4, 0.5 mM PMSF). For immunoprecipitation, 200 µg of nuclear extract was immunoprecipitated with the antibody pre-bound magnetic beads in 500 µl of IP buffer overnight at 4oC with continuous rotation. As an additional control, 50 µl of magnetic beads were incubated without nuclear extract and treated under the same conditions. After the incubation, the beads from all conditions were washed 5x with 500 µl cold IP buffer, and the proteins were eluted in 2 steps. First, an elution was carried out by incubating the beads with 20 µl of mild elution buffer (50 mM glycine pH 2.8) for 5 minutes at 23oC. After eluate collection, the remaining beads were boiled in 20 µl of 1x Laemmli buffer at 95oC for 10 min. The immunoprecipitated samples were separated by SDS-PAGE and analysed by Western blot using a monoclonal antibody against human COUP-TFII made in the mouse (Cat# PP-H7147-00; dilution 1:1000; R&D systems, Ontario, Canada) as described previously (Mehanovic et al., 2019). To detect GATA4, the same membrane was stripped

158

with 0.2 N NaOH and re-probed with a monoclonal antibody against human GATA4 made in the mouse (G-4, Cat# SC-25310; dilution 1:50; Santa Cruz, California, USA).

3.5.5 Statistical analyses Statistical analyses between two groups were performed using Student’s t-test in Microsoft Excel (Microsoft Corporation, USA). The P-values from each comparison are indicated on the relevant figures as well as in the figure legends.

159

3.6 Results 3.6.1 Identification of genes commonly regulated by COUP-TFII and GATA4 To identify overlapping roles for COUP-TFII and GATA4 in the regulation of Leydig cell function, we used previously generated microarray data (Mehanovic et al, manuscript in preparation) (Bergeron et al., 2015). First, we examined differentially expressed genes in MA-10 Leydig cells depleted for both transcription factors separately. The previously reported raw data from GATA4- and COUP-TFII-depleted MA-10 cells was screened to identify genes which were differentially expressed by at least ±1.3-fold and statistically significant relative to the control cells. The screening of the data revealed 307 differentially expressed genes in COUP-TFII-depleted MA-10 cells (237 downregulated and 70 upregulated) and 676 in GATA4-depleted MA-10 cells (361 downregulated and 315 upregulated) (Fig. 3.1A). The differentially expressed genes were grouped into four gene sets associated with each depleted transcription factor: COUP-TFII downregulated (< -1.3-fold, Fig. 3.1A, green circle), COUP-TFII upregulated (> +1.3-fold change, Fig. 3.1A, orange circle), GATA4 downregulated (< -1.3-fold, Fig. 3.1A, blue circle), and GATA4 upregulated (> +1.3-fold change, Fig. 3.1A, yellow circle). Next, we used a web-based Venn diagram tool to identify common genes between the four data sets. As shown in Figure 3.1A, there are 33 gene entries common to both (COUP-TFII and GATA4) downregulated data sets. Additionally, there were 11 gene entries upregulated in both data sets. The complete list of gene entries and the results from the analysis are presented in Table 3.1. Based on their established roles in Leydig cell function, we selected the following five genes for further examination: Amhr2, Gsta3, Hsd3b1, Inha, and Star. Using qPCR, previous work validated that the mRNA levels of all these genes are downregulated in COUP-TFII- and in GATA4- depleted MA-10 cells (Mehanovic et al, manuscript in preparation) (Bergeron et al., 2015). As a first step to determine whether both factors could cooperate to regulate the expression of these genes, we analysed the first 500 bp of their regulatory region for the presence of response elements for GATA and COUP-TF factors. As shown in Figure 3.1B, multiple potential GATA motifs (yellow diamonds) were detected in the proximal promoter regions. The potential COUP-TFII response elements, which were reported previously (Mehanovic et al, manuscript in preparation), are represented in Figure 3.1B by a green oval (NRE) and a red hexagon (DR1). A recently identified GC-rich sequence in the Amhr2 promoter

160

essential for COUP-TFII responsiveness is also indicated (blue rectangle in Fig. 3.1B). The exact location and sequence of the GATA motifs are listed in Table 3.2 while those for COUP-TFII are be found in (Mehanovic et al, manuscript in preparation).

3.6.2 COUP-TFII and GATA4 cooperate on the Amhr2 promoter in Leydig cells To investigate whether COUP-TFII and GATA4 can functionally cooperate to regulate gene expression in Leydig cells, we selected to examine the mouse Amhr2 (-1486/+77 bp) and Gsta3 (-2062/+38 bp) promoters. As shown in Figure 3.2, sequence analysis of the Amhr2 promoter revealed the presence of two GATA response elements (yellow diamonds) located at -219 and -51 bp, a single DR1 element (red hexagon) at -275 bp, two potential NRE (green ovals) at -251 and -48 bp, and a GC-rich box (blue rectangle) at -39 bp previously identified as important for COUP-TFII responsiveness (Mehanovic et al., 2019). In the mouse Gsta3 promoter, sequence analysis identified two potential GATA response elements (-335 and -92 bp) and a single DR1 element (-312 bp) (Fig. 3.2). As shown in Figure 3.2, COUP-TFII was found to activate both the Amhr2 (6 fold) and Gsta3 (2.5 fold) promoters, which is consistent with our recent reports (Mehanovic et al., 2019) (Mehanovic et al, manuscript in preparation). Similarly, GATA4 can activate the Amhr2 promoter by 4 fold, which is in line with a previous report (Bergeron et al., 2015). However, GATA4 could not activate the Gsta3 reporter despite the presence of two potential GATA response elements (Fig. 3.2). When COUP-TFII and GATA4 were combined, a cooperation was observed on the Amhr2 promoter (10 fold), but not on the Gsta3 promoter (Fig. 3.2). The activation and cooperation are specific since an empty reporter plasmid used as control was not responsive (Fig. 3.2).

3.6.3 A functional GC-box is essential for COUP-TFII and GATA4 cooperation As mentioned previously, the proximal -500 region of the mouse Amhr2 promoter contains multiple potential COUP-TFII and GATA4 response elements (Fig. 3.1B). Next, we focused on narrowing down the region of the promoter accountable for the cooperation between the two transcription factors. The first -67 bp of the Amhr2 promoter contains the COUP-TFII responsive GC-box at -39 bp (Mehanovic et al., 2019) in addition to an imperfect NRE (AGGACA, -48 bp) to which COUP-TFII can bind (Mehanovic et al., 2019). Interestingly, a potential GATA element (-51 bp) is located right next to the two COUP-TFII elements. We hypothesized that the proximity and the location of all three response elements (GATA, NRE,

161

GC-box) is sufficient for an optimal transcriptional cooperation. To test this, transient transfections were performed using a -67/+77 bp Amhr2 reporter construct (contains all three response elements) and minimal -34/+77 bp reporter devoid of the elements as control. As shown in left panel of Figure 3.3A, the -67/+77 bp promoter region is sufficient to support the activation by GATA4 and by COUP-TFII independently, but also the COUP- TFII/GATA4 cooperation in MA-10 Leydig cells. The minimal -34/+77 bp reporter was not activated (Fig. 3.3A). When the same experiments were performed in heterologous CV-1 fibroblast cells, no activation of the Amhr2 reporter by COUP-TFII or GATA4, and therefore no cooperation, was observed (Fig. 3.3A, right panel). This suggests that additional factor(s) present in MA-10 Leydig cells but absent in CV-1 cells might be required for the COUP- TFII/GATA4-dependent activation of the Amhr2 promoter.

We next defined the site requirement for the COUP-TFII/GATA4 cooperation. Since mutation of the GC-box is known to abolish COUP-TFII-dependent activation of the -67/+77 bp Amhr2 promoter (Mehanovic et al., 2019), we questioned whether the same GC-box is also essential for the cooperation with GATA4. As shown in Figure 3.3B, a -67/+77 bp Amhr2 reporter construct harboring a mutation in the GC-box was no longer activated by COUP-TFII as expected, but activation by GATA4 was also abrogated. The cooperation between the two factors was also lost on the -67/+77 bp reporter with the GC-box mutated (Fig. 3.3B). These results indicate that an intact GC-box at -39 bp is not only essential for COUP-TFII- and GATA4-dependent activation of the Amhr2 promoter but also for the functional cooperation between the two factors. These data also indicate that the GATA element at -51 bp and the NRE at -49 bp are not sufficient to support activation and cooperation between COUP-TFII and GATA4.

3.6.4 GATA4 is recruited to the proximal region of the mouse Amhr2 promoter To determine whether GATA4 is recruited to the proximal region of the Amhr2 promoter, ChIP-qPCR assays were performed. As shown in Figure 3.4, GATA4 is significantly recruited to the proximal region (-140/+29 bp, black bar) compared to the IgG control or a distal region devoid of consensus GATA element (-3395/-3274 bp, white bar). Recruitment of COUP-TFII to the proximal region has been reported previously (Mehanovic et al., 2019) and was used as a control (Fig. 3.4). These results confirm that GATA4 is recruited to the -

162

140 to +29 region of the Amhr2 promoter, which contains a GATA motif (-51 bp) and a GC- box (-38 bp).

3.6.5 COUP-TFII and GATA4 interact in MA-10 Leydig cells To gain further insights into the mechanism of the COUP-TFII/GATA4 cooperation in Leydig cells, co-immunoprecipitation assays were performed to determine whether endogenous COUP-TFII and GATA4 present in MA-10 Leydig cell extracts interact. As shown in Figure 3.5, the COUP-TFII protein was detected in the samples immunoprecipitated with an antibody against the GATA4 protein (Fig 3.5, top image, lane 3), while only faint background bands were observed for the negative controls (IP with goat IgG or beads only; Fig. 3.5, top image, lanes 2 and 4, respectively). When the same membrane was stripped and re-probed using a GATA4 antibody (made in a different species than the one use in the IP), the GATA4 protein was only detected in the sample immunoprecipitated with the GATA4 antibody, as expected (Fig. 3.5, bottom image, lane 3). Taken together, these data confirm that COUP-TFII and GATA4 are part of the same complex natively in MA-10 Leydig cells, which may be responsible for their functional cooperation in the regulation of Amhr2 promoter activity.

3.6.6 COUP-TFII also cooperates with GATA6, but not with GATA1 or GATA3 Since GATA4 belongs to a family composed six members (GATA1-6), some of which share significant homology, and since GATA4 and GATA6 are expressed in Leydig cells (reviewed in Tremblay et al., 2018; Viger et al., 2008), we next tested whether the functional cooperation with COUP-TFII was unique to GATA4 or also occurred with other GATA family members. As shown in Figure 3.6, of the GATA factors tested (GATA1, GATA3, GATA4, and GATA6), only GATA4 and GATA6 were found to activate the Amhr2 promoter (-1486/+77 bp and -67/+77 bp reporter constructs) and to functionally cooperate with COUP- TFII. GATA1 and GATA3 failed to activate the Amhr2 promoter and no cooperation with COUP-TFII was observed (Fig. 3.6). Together, these data revealed that the COUP- TFII/GATA cooperation is not limited to GATA4 but also takes place with GATA6.

163

3.7 Discussion The transcription factors COUP-TFII and GATA4 have each been defined as a master regulator of Leydig cell differentiation and function by their involvement in the expression of numerous genes (Bergeron et al., 2015; Bielinska et al., 2007; Di-Luoffo et al., 2016; Mehanovic et al., 2019; Mendoza-Villarroel et al., 2014a; Mendoza-Villarroel et al., 2014b; Padua et al., 2015; Qin et al., 2008; Tremblay and Viger, 2001a), and (reviewed in Tremblay and Viger, 2003; Viger et al., 2008; Viger et al., 2004). Here we have identified several genes that are commonly regulated by COUP-TFII and GATA4 by analysing transcriptomic data from MA-10 Leydig cells depleted of each factor. Furthermore, we describe the existence of a functional cooperation between COUP-TFII and GATA4 on the Amhr2 promoter in Leydig cells and provide information about the mechanisms of this cooperation by showing that COUP-TFII and GATA4 physically interact in these cells.

3.7.1 COUP-TFII and GATA4: a novel partnership in Leydig cells In our present work, we report a transcriptional cooperation between the zinc finger transcription factor GATA4 and the orphan nuclear receptor COUP-TFII on the Amhr2 promoter in Leydig cells. Although a similar cooperation between COUP-TFII and GATA4 has been reported on the atrial natriuretic factor (Anf) promoter in fibroblast CV-1 and COS- 7 cells (Huggins et al., 2001; Wang et al., 2019), this is the first report of a COUP- TFII/GATA4 cooperation in steroidogenic Leydig cells.

Although a COUP-TFII/GATA4 cooperation was observed in fibroblast cells on the Anf promoter (Huggins et al., 2001; Wang et al., 2019), we did not observe an activation or a cooperation between COUP-TFII and GATA4 of the Amhr2 promoter in CV-1 fibroblast cells. In our hands, the cooperation seemed specific to the steroidogenic MA-10 Leydig cells. It is very likely that a specific unidentified transcription factor or co-factor is essential for the activity of COUP-TFII and/or GATA4 on the Amhr2 promoter in the MA-10 Leydig cells. In the case of the Amhr2 promoter, we found that a GC-box was essential for the activation by GATA4 (present work), by COUP-TFII (Mehanovic et al., 2019), and for the cooperation between the two factors (present work). GC-rich sequences, frequently found in gene promoters, are generally bound by transcription factors belonging to the Specific Protein (SP) family, such as SP1. On the Amhr2 promoter, we recently reported that COUP-TFII and SP1

164

work in a cooperative manner (Mehanovic et al., 2019). GATA4 was also found to physically interact and cooperate with SP1 on the Anf promoter (Hu et al., 2011). Based on our data showing the requirement of an intact GC-rich sequence at -38 bp for the activation by COUP- TFII and GATA4 as well as for their cooperation, and the fact that both factors are known to interact with and cooperate with SP1 on several promoters (Hu et al., 2011; Mehanovic et al., 2019), it is tempting to speculate that SP1, by acting on the GC-box at -38 bp, might be the cornerstone for the activation of the Amhr2 promoter by COUP-TFII and GATA4. For instance, SP1 might help stabilize both COUP-TFII and GATA4 binding to nearby motifs (- 51 for GATA and -49 for NRE) that do not match the perfect consensus sequences for high affinity binding by these transcription factors. Although SP1 is traditionally recognized as a ubiquitously expressed transcription factor, there are some exceptions. For instance, CV-1 cells have been shown to express high levels of SPase, a cysteine protease that has selective cleavage activity toward transcription factor SP1 leading to rapid degradation of this transcription factor in these cells (Nishinaka et al., 1997; Nishinaka et al., 2005). The low levels of SP1 protein in CV-1 cells could therefore explain the lack of cooperation between COUP-TFII and GATA4 on the Amhr2 promoter.

The family of GATA transcription factor consist of 6 members, GATA1-6, that can be separated into two subgroups based on spatial and temporal expression patterns. GATA1/2/3 are expressed mainly in hematopoietic cell lineages, whereas GATA4/5/6 are found in tissues deriving from the mesoderm and the endoderm such as the heart, gut, and gonads (reviewed in Viger et al., 2008). Leydig cells are known to express GATA4 and GATA6 and both factors are essential for Leydig cell differentiation and function (reviewed in Viger et al., 2008). In our present work, we found that in addition to GATA4, GATA6 could also activate the Amhr2 promoter and cooperate with COUP-TFII. We also found that GATA4 and COUP- TFII physically interact in MA-10 Leydig cells. Since GATA4 and GATA6 share high protein sequence similarity, it is likely that the GATA6/COUP-TFII cooperation is also due to a physical interaction between the two factors. COUP-TFII was also reported to interact with two other GATA family members, GATA2 and GATA3 in HEK293 cells (Xu et al., 2008). Based on this, we expected to also observe a cooperation between COUP-TFII and these GATA factors. Unexpectedly, GATA1 and GATA3 failed to activate the Amhr2 promoter and to cooperate with COUP-TFII. One possible explanation could be that GATA1

165

and GATA3 cannot be recruited to the Amhr2 promoter in the same way GATA4 and GATA6 can. It is also possible that the interaction affinity between COUP-TFII and GATA4/6 is stronger than between COUP-TFII and GATA1/2/3. Supporting this hypothesis is the fact that the COUP-TFII/GATA4 interaction in MA-10 Leydig cells was observed using nuclear extracts with physiological levels of endogenous proteins while the COUP-TFII interaction with GATA2/3 was observed using nuclear extracts of cells with supraphysiological levels of GATA transcription factors due to overexpression (Xu et al., 2008).

In conclusion, our present data identify several genes commonly regulated by COUP-TFII and GATA4 and defined a functional and physical cooperation between these two factors in the regulation of Amhr2 expression in steroidogenic Leydig cells.

166

3.8 Disclosure summary The authors have nothing to disclose.

3.9 Funding This work was supported by a grant from the Canadian Institutes of Health Research (funding reference number MOP-81387) to JJT. SM was the recipient of a studentship from the Fondation du CHU de Québec-Université Laval.

3.10 Acknowledgments We are thankful to Dr. Jose Teixeira, Dr. Ming Tsai, and Dr. Mario Ascoli for kindly providing the Amhr2 reporter construct, the COUP-TFII expression plasmid and the MA-10 Leydig cell line, respectively.

167

3.11 Figures

Figure 3.1 Data analysis reveal commonly regulated genes in GATA4- and in COUP-TFII- depleted MA-10 Leydig cells. (A) The four-set Venn diagram highlights commonly regulated genes between COUP-TFII upregulated vs. GATA4 upregulated and between COUP-TFII downregulated vs GATA4 downregulated. (B) In silico analysis identifies potential GATA4 and COUP-TFII response elements in the mouse Amhr2, Gsta3, Hsd3b1, Inha, and Star promoters. The scale below the promoter indicates the position of the responsive elements located between -500 to +50 base pairs. TSS, transcription start site. Yellow diamonds, GATA response element. Red hexagon, COUP-TFII direct repeat 1 (DR1) response element. Green oval, COUP-TFII, nuclear receptor element (NRE). Blue rectangle, GC-rich sequence.

168

Figure 3.2 COUP-TFII cooperates with GATA4 to activate the mouse -1486/+77 bp Amhr2 promoter. MA-10 Leydig cells were transiently transfected with 400 ng of promoter constructs (Amhr2, Gsta3, or empty luciferase vector as indicated on the left) and either 100 ng of an empty expression vector (white bars), 50 ng of empty vector+ 50 ng of COUP-TFII expression vectors (light shade of blue bars), or 50 ng of empty vector+ 50 ng of GATA4 expression vectors (blue bars), or 50 ng of COUP-TFII+50 ng of GATA4 expression vector (darkest shade of blue bars). Results are shown as fold activation over control (empty expression vector, value set at 1) ± SEM. The number of replicates is indicated by “n”. An asterisk (*) represents a statistically significant difference (P<0.05). The scale below indicates the position of the GATA, COUP-TFII, and GC-box elements within -500 to +50 base pairs. TSS, transcription start site. Yellow diamonds, GATA response element. Red hexagons, COUP-TFII direct repeat 1(DR1) response element. Green ovals, COUP-TFII, nuclear receptor element (NRE). Blue rectangle, GC-rich sequence.

169

Figure 3.3 COUP-TFII cooperates with GATA4 to activate the mouse Amhr2 promoter in MA- 10 Leydig cells but not in CV-1 fibroblasts cells. MA-10 Leydig cells were transiently transfected with 400 ng of -1486/+77 bp, -67/+77 bp, and -34/77 bp Amhr2 promoter constructs (A) or -67/+77 bp (mut) Amhr2 promoter construct harboring a mutation (represented by the large X and by underlined lower case letters) in the GC-box (B), along with either 100 ng of empty expression vector (white bars), 50 ng of empty vector and 50 ng of COUP-TFII expression vector (light shade of blue bars), 50 ng of empty vector and 50 ng of GATA4 expression vector (blue bars), or 50 ng of COUP- TFII and 50 ng of GATA4 expression vector (darkest shade of blue bars) in MA-10 Leydig cells (left panel) and CV-1 fibroblast cells (right panel). Results are shown as fold activation over control (empty expression vector, value set at 1) ± SEM. The number of replicates is indicated by “n”. An asterisk (*) represents a statistically significant difference (P<0.05). The scale below indicates the position of the GATA, COUP-TFII, and GC-box elements within -500 to +50 base pairs. TSS, transcription start site. Yellow diamonds, GATA response element, also shown as the yellow boxed sequence. Red hexagons, COUP-TFII direct repeat 1 (DR1) response element. Green ovals, COUP- TFII, nuclear receptor element (NRE), also shown as green bold letter sequence. Blue rectangle, GC- rich sequence, also shown as blue boxed sequence.

170

Figure 3.4 GATA4 is recruited to the proximal promoter region of the Amhr2 gene in MA-10 Leydig cells. ChIP assays were performed using crosslinked chromatin incubated with either an IgG (negative control) from mouse or goat, a goat anti-GATA4 antiserum, or a mouse anti-COUP-TFII antibody. The PCR amplified regions of the Amhr2 genes are schematically indicated and defined as distal (spanning from -3395 to -3274 bp, white bars) and proximal (spanning from -140 to +29 bp, black bars). Data are presented as fold enrichments, which were determined by qPCR and normalized to the appropriate negative controls. The number of the replicates is indicated by “n”. An asterisk (*) represents a statistically significant difference (P<0.05).

171

Figure 3.5 GATA4 and COUP-TFII interact in MA-10 Leydig cells. Lysates from MA-10 Leydig cells were immunoprecipitated with either goat IgG (control) or goat α-GATA4 antiserum, or with beads only (control). The immunoprecipitates were visualized by immunoblotting using a mouse α- COUP-TFII antibody (top image). The same membrane was stripped and re-probed with a mouse α- GATA4 antiserum. The top image is representative of three independent experiments. The input represents 10% of starting nuclear extract.

172

Figure 3.6 COUP-TFII cooperates with GATA4 and GATA6 but not with GATA1 and GATA3 on the Amhr2 promoter. Four hundred nanograms of Amhr2 promoter constructs (-1486/+77 bp, - 67/+77 bp, and -34/77 bp) were transiently co-transfected with either 100 ng of an empty expression vector (white bars), 50 ng of empty vector and 50 ng of COUP-TFII expression vector, 50 ng of empty vector and 50 ng of GATA1/3/4/6 expression vector as indicated, or 50 ng of COUP-TFI and 50 ng of GATA1/3/4/6 expression vectors. Results are shown as fold activation over control (empty expression vector, value set at 1) ± SEM. The number of replicates is indicated by “n”. The scale below indicates the position of the GATA, COUP-TFII, and GC-box elements within -500 to +50 base pairs. TSS, transcription start site. Yellow diamonds, GATA response element (also shown as

173

the yellow boxed sequence). Red hexagons, COUP-TFII direct repeat 1 (DR1) response element. Green ovals, COUP-TFII, nuclear receptor element (NRE) (also shown as green bold letter sequence). Blue rectangle, GC-rich sequence (also shown as blue boxed sequence).

174

3.12 Tables

Table 3.1 Complete list of the differentially expressed genes in MA-10 cells depleted of COUP-TFII and GATA4.

Condition Gene name Gene Count COUP-TFII Pten, Plb1, Vaultrc5, Lgmn, Cav1, Tlcd2, Sspn, Slc7a11, Akr1c18, Ehf, Nrk, Adam23, Fbn1, Txndc12, Gm10639, 197 downregulated Akr1c14, Prlr, Cbr3, Bik, Gsta2, Cdhr5, Gm3776, Gsta1, Col6a3, Tppp3, Gsta4, Aldh1a1, Tap2, Aldh1a7, Dram1, Kdm7a, Prss35, Frk, Rxfp1, Wnt6, Slc44a3, Hephl1, Zcwpw1, Pi4k2b, Plgrkt, Efemp1, Adam12, A4galt, Serpinb1a, Olfr1189, Anxa9, Slc25a34, Fam135b, Ecm1, Blvrb, Abcb1a, Cdon, Pm20d1, Serpinb6b, Tmem38b, Ugt1a2, Tmem45a, Gabrg1, Phf11d, Srxn1, 4931406C07Rik, Adh1, Aox1, Nedd9, Psmb9, Ccdc122, Nol3, Purb, Slc25a33, Cyp2s1, Cmbl, Casp7, Tns2, Ssu72, Tap1, 1110002L01Rik, Usp2, Spta1, Afmid, Cited4, Psmg2, Zdhhc2, Fam69a, AU021092, B330016D10Rik, Gm9938, Klk1b22, Snora31, Ly6a, Aqp11, Rhpn2, Lynx1, Fbxo47, Cdkl3, Wdr34, 6330562C20Rik, Tuba8, Pir, Tprkb, Osmr, Snord118, Gm24208, Ids, Ppif, Hiat1, Cd274, Cep350, Klk1b21, Car7, Tmem25, Galnt2, Gm7347, Prl, Matn2, Tceanc, AA415398, Sdk1, Casp1, Gm14373, Ptgis, Gpcpd1, Rnf5, Gcnt4, 5031410I06Rik, Tmem53, Gm14494, Pawr, Syt12, Asah2, Pkd2l2, Mgat4c, Ribc1, Ccdc159, Tomm20, Gm5617, Rps19bp1, Pon2, Lactb2, Maoa, Cdkn3, Dysf, Myc, Nr0b2, Acacb, Cdkn1a, Triap1, Gm20721, Faim, Pram1, Gstt1, Slc11a1, Hmgcs2, Lrp8, C2, Lsr, Plau, Gins1, Thra, Pdgfd, Ahnak2, Tspan5, Nuf2, Pipox, Grk5, Nmrk1, Atf3, 5330417C22Rik, BC025920, Slc6a15, Hspb11, 9130230L23Rik, Tstd3, Pxk, Dhdh, Avpi1, Trmt10a, Gpt, Hagh, Ehhadh, LOC105247036, Gm13534, Gm8074, Igsf11, Nmral1, Gm5862, Selenbp1, Cib3, Slc47a1, Eno3, Gm5519, Ptar1, Trim12a, Llph-ps1, Grasp, Gm22358, Lypd6, E2f2 GATA4 Cyb5, Eomes, 8030411F24Rik, Tnni3, Srd5a1, Rln3, Aldoc, Slc25a24, Lipg, Tmem86a, Cmpk2, Bnip3, Gata1, 361 downregulated Arhgap19, Calcoco2, Otc, Olfr1029, Mme, Sgpl1, Gem, Sds, Hspb1, Ugdh, Mfsd7c, Slc2a1, Rnd2, Bhlhe40, Layn, Dusp9, Gata4, Myl9, Zfpm1, 9130008F23Rik, Jhdm1d, Slc6a9, Pgbd5, Fzd4, Cdc42ep3, Vat1, Tex2, Slc35d1, Scarb1, Aldh4a1, Sfxn1, Tmem104, Pvrl2, Hdc, Lama1, Rny1, Me2, Clcn3, Bet1, Trib2, Gm12942, Ypel5, Tgoln1, Gm14005, Csnk1e, Sat1, Fam178b, Slc7a8, Stk40, Txnip, Rassf4, Synpo2, Mkrn1-ps1, Stard3nl, Mapkbp1, Tmem170b, Vti1b, Arrb1, Lmo2, Tram2, Pcyt1a, Rhobtb1, Pigu, Slc33a1, 6330578E17Rik, Psen2, Gpt2, Nt5e, Hmbox1, Rnf144b, Rho, Fam57b, Lipn, P4ha1, Masp1, Osm, Dcun1d1, Gramd3, Kitl, Wdyhv1, Gba, Tert, Tle6, 1600002H07Rik, Adamts9, Pgm2, Tmc8, Pgd, Itga5, Lefty1, Il1r1, 3010026O09Rik, Plcxd2, Ier3, Cpd, Tomm20l, App, Sh2d4a, Sc5d, Cd151, Pvr, Thrsp, Strbp, Ctsd, Atp6v0b, Crisp2, 1700020A23Rik, Tmem178, Clca2, Ogfod1, Ldlr, Ndrg2, Racgap1, Slc7a6, Gatsl3, Ttpa, Clcn6, Car13, Stk38, Lamc1, Tmem43, Arl5b, Gm2011, Atp7a, Nipsnap3b, Zfp826, Mki67, Olfr1030, St3gal5, Appl2, Tmem30a, Slc19a2, Acsbg1, Sema6c, Lmo7, Igf2bp2, Gclm, Fnip1, 3110057O12Rik, Piga, Rgs3, Mycbp2, Casp4, Sun1, Hmgb2, Usp11, Ptprj, Rpia, Rras2, B130016D09Rik, Mocos, Usp43, Ctsl, Cpox, Nod1, St3gal6, Entpd7, Stard8, Sap30, Nudt12, Ppp1r3a, Creg1, Ykt6, Dffb, Sqstm1, Prr13, Ltbp3, Slc41a1, Hmmr, Atp1b1,

175

Larp4, Slc12a7, Pla2g15, Gba2, E430025E21Rik, Mavs, Bhlhe41, Cog2, Txnrd1, Ttll10, Gpr137bps, Kif23, Mudeng, Sel1l, Ccnb2, Tmem179b, Tmem65, Xiap, Krcc1, Hbby, Atp6v0d1, Mir6921, Lmnb2, 2210011C24Rik, Akr1b8, Muc1, Speer4a, Atp1b3, Ldb2, Rangap1, Cyp4f13, Eea1, Lmln, Patl1, Bco2, Il4ra, Paqr8, Prkar2a, Mtmr14, Loxl2, B3galnt2, Golga4, Dixdc1, Clcn7, Sun2, Manba, Foxc1, Scap, Ccdc117, Sec24d, Slc9a3r1, Fam134b, Rab3ip, Atg4b, Il27ra, Btg1, Cpeb3, Add3, Usp31, Rce1, Mycbp, Ppip5k1, Ipo7, Tmem39a, Ccna2, Dnajb2, Lrrc2, Apaf1, Plekhb2, Rasa1, Bhlha15, Zfp449, 0610010O12Rik, Nqo2, Tbc1d8, Pqlc2, Bard1, Plagl2, Anxa3, Fbxo33, Ccdc111, Slc2a8, Tmem135, Rnf34, Kif3b, B230217C12Rik, Tnfaip2, Chst11, BC005537, Mfsd11, Tmem2, Itpkb, Hltf, Scd4, Cdca5, Lix1, Slc35f5, Ptprb, 1810037I17Rik, Rpap1, Kazn, Soat1, Naa40, Cnnm3, Col20a1, Foxn3, Wdr44, Ggps1, Ctage5, Abcb6, Wdr91, Msra, Sema4b, Epha2, Tubgcp5, Cyp51, Kctd9, Vps45, Folr1, 2510003E04Rik, Klhl28, Hes1, Nostrin, Dbnl, Rad17, Heatr5a, Slitrk2, Pcmtd2, Blmh, 2310035K24Rik, Ly96, Mvd, Fam103a1, Inhba, Rp9, Heatr7a, Itsn2, Anln, Mospd2, Polk, Tbcel, Tle2, Fam59a COUP-TFII Cd109, Gsta3, Stk32a, Hsd3b1, Pcx, Hmox1, Slc40a1, Star, Nqo1, Htra1, Inha, Tbata, Ero1l, Hao2, Hsd3b6, Entpd5, 33 downregulated and Crip1, Erlin2, Amhr2, Slc26a7, Gipc2, Paqr7, Usp3, Hs6st2, Fam13a, Lgals3, Clcn5, Eepd1, Gucy1b2, Fdx1, Figf, GATA4 Hspa4l, Rasgrf2 downregulated COUP-TFII Mfsd1, Hsdl1, Ccbl2, Col4a3bp, Klhdc8a, Csdc2, 9530091C08Rik, Elmod2, Cldn12, Mapre3, Gper1, Abcg4, 57 upregulated Tcp11l2, Aldh1l2, Rbpj, D030056L22Rik, Lrig2, 9330182L06Rik, Bdh2, 9830147E19Rik, Fam179b, Marcksl1, Rab27a, Slc1a5, Armcx1, Twistnb, Slc35c2, D3Ertd751e, Dmxl2, Camk2n1, Unc119, Gm3912, Rgl3, Gid4, Abhd3, Slc35e1, Lpp, Tmem33, R3hdm4, Tmem59, Maged1, Rhoq, Ins2, Cdc14a, Elovl4, Taf9b, Smpdl3a, Fgfr4, Uhmk1, Maf, Ctns, Gm8388, Nagpa, Hpse, Mybpc3, E2f5, Pttg1ip GATA4 Tpm2, Utp6, Pitpnm1, Carm1, Rnf214, Kdelc2, Pigy, 2310081J21Rik, Snrpg, Wdr48, Cyp2u1, Gm6623, Tdrd3, 297 upregulated Hddc2, Arhgef10, Flna, Dpy19l1, Ranbp17, Rcn2, Syce2, Nudt21, Mgll, Rara, Btbd2, Slfn3, Zfhx4, Ttc39b, Lrrc38, Gm12592, Celf2, Zfp937, Rnd3, Tmem205, Agxt2l2, Lpgat1, Fam111a, Stxbp1, Snx18, Arsb, Smarcd2, St6gal1, Atp13a3, Slc2a9, 4933426M11Rik, Samd10, Mir92-1, Sccpdh, Tet3, Fermt2, 1110008P14Rik, Kras, Afap1, Nme3, Ddx3x, Polr3h, Mir19a, Sox12, 9430020K01Rik, Scml2, Ehd2, Ccbl1, Isoc1, Fam108b, Arntl2, Ptprs, Mapk6, Ttc39c, Mpv17l2, Sphk1, Srl, Rtf1, Esam, Ror1, Ddx6, Pnrc1, Lrrc8a, Tnfrsf19, Ppdpf, Usp22, 1700028J19Rik, Ythdf3, Rangrf, Fam53b, 4931428F04Rik, Klhl22, Pde1a, Slc16a10, Arid1a, Mkl2, Umps, Nr1h3, Rc3h2, Cdr2l, Slfn9, Pabpc4l, Trim24, Smo, Gpr135, Myst3, Lactb, Gata6, Klf9, Rcl1, Mov10l1, Gstz1, Fzd1, Dexi, Nfix, H3f3a, D8Ertd82e, Lnx2, Ccl27a, Pik3r1, Dhx58, Jagn1, Zbtb20, S1pr3, Nudt7, Arid1b, Rybp, Gpr75, Mir568, 4930432K21Rik, Rhbdl3, Adra1d, Cyb5d2, Tbxa2r, Cyp2f2, Gm904, Fbxw17, Adck3, Accs, Trim2, A630089N07Rik, Bscl2, Abhd8, Gpr63, Lage3, Ly6e, Ttyh2, Map3k6, Brdt, Hivep3, Spred1, Fam38a, Atf7ip, Klk1b1, Nr4a2, Pik3r2, Sbk1, Gm3893, Fam196a, Fam102a, Tprn, Alpl, 6330545A04Rik, Tgm3, 4933409K07Rik, Nsun3, Lrp4, B3gnt3, Echdc2, Frmd6, Naf1, Vmn2r43, Rin3, Gatad1, Prrg1, Efna5, Nt5dc2, Ppp1r14b, Rasa3, Dock4, Nkain1, Il34, Mpzl1,

176

Ube2e2, Nif3l1, Greb1l, Dcbld2, Akr1d1, Mtap1a, Nipa1, Itga6, Nfia, 4930420K17Rik, Nipsnap1, Psip1, Kansl1l, Tst, Tmem41a, Metrn, D430041D05Rik, Btbd19, Gsg1l, Ptges3, Pdk4, B130024G19Rik, Dync1li2, Mep1b, Gm10033, Ckm, St6galnac4, Emp2, Fam185a, Stbd1, Ppp2r1b, Smad5, AA388235, Cerk, Gpr176, 9230110C19Rik, Taf4b, Trps1, Prnp, Prss23, Alox12, Xylt1, Vmn2r48, Pknox2, AW555464, Ift57, Slc25a23, Cdc42ep2, Ctnnbip1, Prox1, Dtx4, Frmd5, Ninj1, Ece2, Frmd4b, Shox2, Slc27a1, Sox18, Nbl1, Csgalnact1, Cnot7, A730020M07Rik, Rell1, Camkk1, Git1, Tmem231, Mtch1, Ccdc109b, Stx11, Zic5, Mlc1, Chml, Fam165b, Polr2m, Oplah, Cav2, Gja1, Rapgef4, Nit2, Gm12248, 4933439F18Rik, Clcn4-2, 2810055F11Rik, Ptn, Gpd1, Tekt5, Dync2li1, Slc16a2, Rassf2, Lgals12, 1700019G17Rik, Ssbp2, Cldn25, Hlf, Cox7a1, Bag3, Fut10, Tesc, Egr1, Trp53i11, Sumo3, Flrt1, Deptor, Gpr30, Suclg2, Rgs10, Plin1, Car2, Fam26e, Icosl, Tmem35, Apcdd1, Chst2, Tril, Sorbs2, Fjx1, 1500015O10Rik, Vsnl1, Neto2, Vcan, Itgb8 COUP-TFII Prkci, Fam126a, Ctxn1, Vmn2r30, Dnm3, D15Ertd621e, Crk, Ssr3, Clic4, Sdcbp, Man2a1 11 upregulated and GATA4 upregulated COUP-TFII Nr2f2, Gm7120, Igfbp6, 2810416G20Rik, Gls2, Smpdl3b, Rfk 7 downregulated and GATA4 upregulated COUP-TFII Slc38a7, Sesn2 2 upregulated and GATA4 downregulated

177

Table 3.2 The predicted GATA response element locations and sequences in -500/+50bp of the selected promoters.

Promoter Strand Start End P-value Sequence Amhr2 - -221 -216 0.00128 TGATAA + -54 -49 0.00176 GGATAG Gsta3 - -338 -333 0.00128 AGATAA - -94 -89 0.00128 AGATAA Hsd3b1 + -185 -180 0.000578 TGATAG - -278 -273 0.00128 AGATAA - -133 -128 0.00128 AGATAA - -482 -477 0.00361 TGATAC Inha + -16 -11 0.000578 AGATAG + -50 -45 0.00128 AGATAA Star - -37 -32 0.00128 AGATAA

178

3.13 References Ascoli, M. (1981). Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108, 88-95. Bergeron, F., Nadeau, G., and Viger, R.S. (2015). GATA4 knockdown in MA-10 Leydig cells identifies multiple target genes in the steroidogenic pathway. Reproduction 149, 245- 257. Bielinska, M., Seehra, A., Toppari, J., Heikinheimo, M., and Wilson, D.B. (2007). GATA-4 is required for sex steroidogenic cell development in the fetal mouse. Dev Dyn 236, 203-213. Bouchard, M.F., Taniguchi, H., and Viger, R.S. (2005). Protein kinase A-dependent synergism between GATA factors and the nuclear receptor, liver receptor homolog-1, regulates human aromatase (CYP19) PII promoter activity in breast cancer cells. Endocrinology 146, 4905-4916. Di-Luoffo, M., Brousseau, C., and Tremblay, J.J. (2016). MEF2 and NR2F2 cooperate to regulate Akr1c14 gene expression in mouse MA-10 Leydig cells. Andrology 4, 335-344. Grant, C.E., Bailey, T.L., and Noble, W.S. (2011). FIMO: scanning for occurrences of a given motif. Bioinformatics 27, 1017-1018. Heberle, H., Meirelles, G.V., da Silva, F.R., Telles, G.P., and Minghim, R. (2015). InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams. BMC Bioinformatics 16, 169. Hu, X., Li, T., Zhang, C., Liu, Y., Xu, M., Wang, W., Jia, Z., Ma, K., Zhang, Y., and Zhou, C. (2011). GATA4 regulates ANF expression synergistically with Sp1 in a cardiac hypertrophy model. J Cell Mol Med 15, 1865-1877. Hu, Y.C., Okumura, L.M., and Page, D.C. (2013). Gata4 is required for formation of the genital ridge in mice. PLoS Genet 9, e1003629. Huggins, G.S., Bacani, C.J., Boltax, J., Aikawa, R., and Leiden, J.M. (2001). Friend of GATA 2 physically interacts with chicken ovalbumin upstream promoter-TF2 (COUP-TF2) and COUP-TF3 and represses COUP-TF2-dependent activation of the atrial natriuretic factor promoter. J Biol Chem 276, 28029-28036. Ketola, I., Rahman, N., Toppari, J., Bielinska, M., Porter-Tinge, S.B., Tapanainen, J.S., Huhtaniemi, I.T., Wilson, D.B., and Heikinheimo, M. (1999). Expression and regulation of transcription factors GATA-4 and GATA-6 in developing mouse testis. Endocrinology 140, 1470-1480. Kuo, C.T., Morrisey, E.E., Anandappa, R., Sigrist, K., Lu, M.M., Parmacek, M.S., Soudais, C., and Leiden, J.M. (1997). GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev 11, 1048-1060.

179

Mehanovic, S., Mendoza-Villarroel, R.E., Viger, R.S., and Tremblay, J.J. (2019). The Nuclear Receptor COUP-TFII Regulates Amhr2 Gene Transcription via a GC-Rich Promoter Element in Mouse Leydig Cells. J Endocr Soc 3, 2236-2257. Mendoza-Villarroel, R.E., Di-Luoffo, M., Camire, E., Giner, X.C., Brousseau, C., and Tremblay, J.J. (2014a). The INSL3 gene is a direct target for the orphan nuclear receptor, COUP-TFII, in Leydig cells. J Mol Endocrinol 53, 43-55. Mendoza-Villarroel, R.E., Robert, N.M., Martin, L.J., Brousseau, C., and Tremblay, J.J. (2014b). The nuclear receptor NR2F2 activates star expression and steroidogenesis in mouse MA-10 and MLTC-1 Leydig cells. Biol Reprod 91, 26. Molkentin, J.D., Lin, Q., Duncan, S.A., and Olson, E.N. (1997). Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes Dev 11, 1061-1072. Nishinaka, T., Fu, Y.H., Chen, L.I., Yokoyama, K., and Chiu, R. (1997). A unique cathepsin- like protease isolated from CV-1 cells is involved in rapid degradation of retinoblastoma susceptibility gene product, RB, and transcription factor SP1. Biochim Biophys Acta 1351, 274-286. Nishinaka, T., Song, J., Lum, K., and Chiu, R. (2005). Molecular cloning of cDNA for SPase, a monkey cathepsin L orthologue. DNA Seq 16, 147-150. Padua, M.B., Jiang, T., Morse, D.A., Fox, S.C., Hatch, H.M., and Tevosian, S.G. (2015). Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes. Endocrinology 156, 1873-1886. Pereira, F.A., Qiu, Y., Zhou, G., Tsai, M.J., and Tsai, S.Y. (1999). The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development. Genes Dev 13, 1037-1049. Qin, J., Tsai, M.J., and Tsai, S.Y. (2008). Essential roles of COUP-TFII in Leydig cell differentiation and male fertility. PloS one 3, e3285. Schrade, A., Kyronlahti, A., Akinrinade, O., Pihlajoki, M., Hakkinen, M., Fischer, S., Alastalo, T.P., Velagapudi, V., Toppari, J., Wilson, D.B., et al. (2015). GATA4 is a key regulator of steroidogenesis and glycolysis in mouse Leydig cells. Endocrinology 156, 1860- 1872. Tremblay, J.J., and Viger, R.S. (1999). Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1. Mol Endocrinol 13, 1388-1401. Tremblay, J.J., and Viger, R.S. (2001a). GATA factors differentially activate multiple gonadal promoters through conserved GATA regulatory elements. Endocrinology 142, 977- 986.

180

Tremblay, J.J., and Viger, R.S. (2001b). GATA Factors Differentially Activate Multiple Gonadal Promoters through Conserved GATA Regulatory Elements*. Endocrinology 142, 977-986. Tremblay, J.J., and Viger, R.S. (2003). Novel roles for GATA transcription factors in the regulation of steroidogenesis. J Steroid Biochem Mol Biol 85, 291-298. Tremblay, M., Sanchez-Ferras, O., and Bouchard, M. (2018). GATA transcription factors in development and disease. Development 145. Tsai, S.Y., and Tsai, M.J. (1997). Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age. Endocr Rev 18, 229-240. Viger, R.S., Guittot, S.M., Anttonen, M., Wilson, D.B., and Heikinheimo, M. (2008). Role of the GATA family of transcription factors in endocrine development, function, and disease. Mol Endocrinol 22, 781-798. Viger, R.S., Taniguchi, H., Robert, N.M., and Tremblay, J.J. (2004). Role of the GATA family of transcription factors in andrology. J Androl 25, 441-452. Wang, J., Abhinav, P., Xu, Y.J., Li, R.G., Zhang, M., Qiu, X.B., Di, R.M., Qiao, Q., Li, X.M., Huang, R.T., et al. (2019). NR2F2 lossoffunction mutation is responsible for congenital bicuspid aortic valve. Int J Mol Med 43, 1839-1846. Xu, Z., Yu, S., Hsu, C.H., Eguchi, J., and Rosen, E.D. (2008). The orphan nuclear receptor chicken ovalbumin upstream promoter-transcription factor II is a critical regulator of adipogenesis. Proc Natl Acad Sci U S A 105, 2421-2426. Yang, Y., Li, Z., Wu, X., Chen, H., Xu, W., Xiang, Q., Zhang, Q., Chen, J., Ge, R.S., Su, Z., et al. (2017). Direct Reprogramming of Mouse Fibroblasts toward Leydig-like Cells by Defined Factors. Stem Cell Reports 8, 39-53.

181

4 Chapter 4 General discussion

Although Coup-tfii inactivation has been shown to disturb the differentiation and function of adult Leydig cells in mice (Qin et al., 2008), the molecular mechanisms by which COUP- TFII and its interacting partners regulate these processes are mostly undefined. In this work, I have identified new target genes and functional partners for COUP-TFII that expand its role in Leydig cell function. Depletion of COUP-TFII in the model MA-10 Leydig cell line uncovered 262 differentially expressed genes, including Gsta3 and Amhr2. The roles of the COUP-TFII in the regulation of Amhr2 and Gsta3 transcription were demonstrated by classical luciferase promoter assays. COUP-TFII can activate the Amhr2 promoter via an interaction with the SP1 transcription factor. COUP-TFII was found to bind to a GC-rich element within the Amhr2 promoter in vitro. Furthermore, COUP-TFII transcriptionally cooperates with two members of the GATA family of transcription factors, GATA4 and GATA6, in the regulation of Amhr2 promoter activity. This conclusion was further substantiated by demonstrating that COUP-TFII and GATA4 are recruited to the same region of the Amhr2 gene, and they are found to molecularly associate in vitro. Together these results indicate that COUP-TFII regulates the expression of genes implicated in Leydig cell differentiation and function and functionally cooperates with GATA4 and GATA6.

4.1 Implications of COUP-TFII-dependent activation of Amhr2 4.1.1 COUP-TFII activates the Amhr2 promoter specifically in Leydig cell lines and may require an interacting partner or a ligand Since COUP-TFII could not activate the Amhr2 promoter in a heterologous CV-1 fibroblast cell line, the activation of this promoter by COUP-TFII appears to be specific to Leydig cell lines, including MA-10 (Chapter 3) and MLTC-1 (data not shown). The CV-1 cell line is a non-steroidogenic cell line. My results strongly suggest that the expression of one or more Leydig cell-specific or enriched transcription factors is required for the COUP-TFII- dependent activation of the Amhr2 promoter. The results from luciferase promoter assays demonstrate that COUP-TFII cooperates with SP1, GATA4, and GATA6 in MA-10 Leydig cells to activate the Amhr2 promoter. Although expressed in CV-1 cells, the transcription factor SP1 is not sufficient for the COUP-TFII-dependent activation of the Amhr2 promoter in these cells. Other potential transcription factors that are known to regulate gene expression

182

in Leydig cells are SF1, NUR77, LRH1, WT1, or DMRT1 (Wen et al., 2014 and reviewed in Martin and Tremblay, 2010), and they could partner with COUP-TFII. Indeed, it was demonstrated that conversion of mouse fibroblasts into Leydig-like testosterone-producing cells is achievable by the addition of only three transcription factors (SF1, GATA4, DMRT1) (Yang et al., 2017b). Furthermore, COUP-TFII was reported to cooperate with SF1 on the Insl3 promoter in Leydig cells and CV-1 cells (Mendoza-Villarroel et al., 2014a). Altogether, these data imply that the addition of either of these factors, SF1 or DMRT1, could promote COUP-TFII-dependent activation of the Amhr2 promoter in Leydig cells, either directly or indirectly, and is warranted for further investigation.

To identify novel COUP-TFII interacting partners required for Amhr2 expression in Leydig cells, I propose an in-depth proteomic characterization of the COUP-TFII-interacting partners bound to the proximal region of the Amhr2 promoter. To answer this question, I propose using MA-10 Leydig cells and a control cell line that expresses COUP-TFII and does not express Amhr2, such as CV-1 cell. Next, nuclear protein extracts can be isolated from both cell lines and incubated with a DNA sequence corresponding to the -67/+34 bp region of the Amhr2 promoter (sequence shown in Chapter 2). This transcriptional complex can be easily isolated using DNA-pull down assays using a well-established protocol (Chapter 2). The isolated proteins can be identified by sensitive proteomic methods, such as mass spectrometry. Using the CV cell line would be useful to exclude interacting partners that may be expressed in other cell lines. These experiments would help identify the Leydig cell- specific transcription factors and co-factors that interact with COUP-TFII and SP1 in the regulation of Amhr2 gene expression in Leydig cell lines. Additionally, some novel interacting partners might be involved in the COUP-TFII-dependent regulation of the Amhr2 gene in other cell types where AMHR2 is found, such as LβT2 and αT3-1 (section 4.1.2). Furthermore, the knowledge of these newly identified COUP-TFII-specific partners would significantly advance our understanding of the mechanisms of gene regulation in Leydig cells in general.

Another plausible explanation for the inability of COUP-TFII to activate the Amhr2 promoter in CV-1 cells in the absence of a potential COUP-TFII ligand. As mentioned in the General introduction, COUP-TFII is considered an orphan nuclear receptor, and only a handful of

183

possible modulators have been reported (Kruse et al., 2008; Le Guevel et al., 2017; Wang et al., 2020). Potential ligands that could lead to COUP-TFII-dependent activation in CV-1 cells are retinoic acids (9-cis-RA and ATRA). Retinoic acids, metabolites of vitamin A, may cause a conformational change in the COUP-TFII ligand-binding domain to promote interaction with co-activators, such as steroid receptor coactivator 3 (SRC-3) (Kruse et al., 2008), which may be expressed in CV-1 cells. Furthermore, Kruse et al. demonstrated that the addition of 9-cis-RA in excess to culture media improved COUP-TFII-dependent activation of the human NGFI-A promoter in a heterologous cell line (COS-7) derived from the CV-1 cell line. Indeed, the data indicate that vitamin A is necessary for proper Leydig cell differentiation (Yang et al., 2018), indicating its significance. In cells, the enzyme alcohol dehydrogenase (ADH) is essential for the conversion of vitamin A to retinoic acid (reviewed in Duester, 1998). Furthermore, in Leydig cells, ADH1 increases retinoic acid synthesis, enhancing Leydig cell proliferation via modulating Sf1 promoter activity (Yang et al., 2018). Interestingly, the expression of Adh1 is reduced in COUP-TFII-depleted MA-10 Leydig cells (Chapter 1), suggesting that COUP-TFII may regulate the synthesis of retinoic acid, therefore the availability of its ligand. These studies and my results (Chapter 1) provide a basis for additional investigations exploring the involvement of retinoic acid in the activation of COUP-TFII and, therefore, COUP-TFII-dependent activation of the Amhr2 promoter in non- steroidogenic cell lines.

4.1.2 Indirect regulation of Leydig cell function by COUP-TFII The importance of the AMH/AMHR2 signaling pathway in Leydig cells has been thoroughly described in the General Introduction. Recently, the AMHR2 protein and Amhr2 mRNA were reported in mouse gonadotrope cell lines (LβT2 and αT3-1) and in rat primary pituitary cells (Bedecarrats et al., 2003; Garrel et al., 2016), suggesting that the AMH/AMHR2 signaling pathway might indirectly regulate Leydig cell function. Both COUP-TFII and COUP-TFI are expressed in the mouse pituitary gland and in pituitary gonadotrope cell lines (Zheng et al., 2010). Because COUP-TFII is expressed in the pituitary gland, its biological action in regulating the HPG axis may be broader than initially thought. COUP-TFII can activate Lhb expression in the CV-1 cell line via an SF1 binding site (Zheng et al., 2010). However, COUP-TFII was found to inhibit Lhb expression indirectly in the LβT2 gonadotrope cell line (Zheng et al., 2010), suggesting cell-specific modes of gene regulation. One noticeable

184

difference between these two cell types is the expression of Amhr2, a receptor for AMH. In rodent pituitary cells and cell lines, AMH activates the expression of Lhb promoter (Bedecarrats et al., 2003), but the exact mechanism of action is not fully understood. Furthermore, AMH synergistically cooperates with GnRH to activate this promoter (Bedecarrats et al., 2003). The inhibitory effect of COUP-TFII in regulating Lhb expression in LβT2 cells may be reversed by incubating gonadotrope cells with AMH, therefore mimicking the natural cellular environment of these cells. The COUP-TFII-dependent activation of the Amhr2 may provide one of the missing components in understanding the AMH-mediated activation of Lhb in gonadotrope cells.

The pulsatile secretion of GnRH from the hypothalamus regulates the release of LH from the pituitary gland. Pulsatory stimulation by GnRH increases Lhb mRNA levels in LβT2 cells. GnRH was found to activate the hAMHR2 promoter in LβT2 cells via the NGFI-A response element located in the proximal promoter region (Garrel et al., 2019). Additionally, NGFI-A cooperates with SF1 and β-catenin in the activation of this promoter (Garrel et al., 2019). The proposed NGFI-A response element on the hAMHR2 promoter overlaps with the NRE, the GC-rich sequence (Garrel et al., 2019). Interestingly, mutation of the GC-rich sequence results in the loss of hAMHR2 promoter activity (Garrel et al., 2019), which corroborates my results. However, this study has not confirmed that NGFI-A binds to its response element or is recruited to this region of the promoter (Garrel et al., 2019), suggesting several possible explanations for their result. The first is that the observed GnRH transactivation via NGFI-A might activate this promoter indirectly by regulating the expression of other transcription factors, such as COUP-TFII and GATA4. I hypothesize that GnRH activation of the hAMHR2 promoter via NGFI-A in gonadotrope cells is upstream of Coup-tfii expression and/or regulation. Indeed, GnRH regulates the expression of Coup-tfii in LβT2 cells (Zheng et al., 2015). In support of this hypothesis, my results revealed that COUP-TFII is recruited to the proximal promoter region of the mouse Amhr2 gene and binds to the GC-rich sequence in vitro. The second explanation is that COUP-TFII regulates the expression of NGFI-A. In support of this explanation, previous studies demonstrate that COUP-TFII activates the rodent and human NGFI-A promoter (Al Turki et al., 2014; Pipaon et al., 1999). Taken together, these explanations implicate COUP-TFII in the indirect regulation of Leydig function and differentiation by modulating the expression of Lhb in gonadotrope cells.

185

4.1.3 COUP-TFII regulation of AMH-dependent cancers In addition to its role in normal physiological processes, COUP-TFII is implicated in many cancers, including prostate, breast, ovarian, and colon cancers (reviewed in Litchfield and Klinge, 2012; Polvani et al., 2019; Qin et al., 2014). The exact mechanism of how COUP- TFII exerts its actions on cancer progression is still not well understood (reviewed in Yun and Park, 2020). Successful recovery of some cancer patients, including breast cancer, is associated with lower COUP-TFII levels, pointing to COUP-TFII as a possible therapeutic target (reviewed in Polvani et al., 2019; Yun and Park, 2020).

Higher levels of AMH are implicated in patients diagnosed with breast cancer (reviewed in Verdiesen et al., 2020) and prostate cancer ((Hoshiya et al., 2003) and reviewed in Sklavos et al., 2014). Some drug-resistant cancer cells continue to respond to AMH, making the AMH/AMHR2 system a suitable therapeutic target (reviewed in MacLaughlin and Donahoe, 2010). Qin et al. proposed a role for COUP-TFII in prostate cancer metastasis, where the TGFβ-dependent growth barrier is bypassed by sequestering transcription factors (i.e., SMAD4) (Qin et al., 2014).

4.2 A novel role for COUP-TFII, GATA4, and SP1 in the regulation of the mouse Amhr2 promoter 4.2.1 COUP-TFII binds to a GC-box region in vitro GC-rich boxes (also known as SP1 sites) located in gene regulatory regions are usually bound by SP1 and SP3 (Li et al., 2004). Pipaón et al. proposed a model for the transcriptional regulation of the human NGFI-A gene by COUP-TFII that involves an association with SP1. However, COUP-TFII was shown not to bind to DNA directly but to “tether” to SP1 (Pipaon et al., 1999). Interestingly, based on ChIP results, another report concluded that COUP-TFII binds directly to the GC-box by interacting with SP1 (Qin et al., 2014). Since they relied solely on the interpretation of the ChIP data, their conclusion is slightly misleading. The ChIP technique demonstrates recruitment to a specific gene region but does not necessarily show direct binding to the DNA. My results presented in Chapter 2 clearly demonstrate that COUP- TFII binds weakly to a GC-rich box in vitro. The association with SP1 in vivo most likely strengthens this COUP-TFII direct binding to the GC-rich box. As far as I know, this is the first result that demonstrated the direct binding of COUP-TFII to a region of the Amhr2 gene

186

containing a GC-box in vitro. This finding indicates that COUP-TFII could also bind to other GC-rich boxes located in regulatory gene regions.

It would be fascinating to investigate if COUP-TFII can be recruited to the GC-rich box in the absence of SP1 in MA-10 Leydig cells. This can be easily investigated by depleting SP1 in these cells using a gene-silencing technique, such as siRNA targeting SP1. The siRNAs (siRNA Control and siRNA targeting SP1) could be delivered to MA-10 Leydig cells via PEI transfection reagent following a well-established protocol (Chapters 1 and 2). The COUP- TFII recruitment to the GC-rich box would be examined using a Cleavage Under Targets & Release Using Nuclease (CUT&RUN) technique (Skene and Henikoff, 2017), followed by the next-generation sequencing. The CUT&RUN is an epigenomic profiling technique that employs antibody-targeted controlled cleavage by micrococcal nuclease to release DNA- protein complexes for DNA sequencing. This is a straightforward and robust method that provides near base-pair resolution. Two of the main advantages of using the CUT&RUN method over traditional Chromatin Immunoprecipitation (ChIP) assay are the elimination of the crosslinking and sonication steps, which may prevent the binding of the antibody to the transcription factor by masking the epitopes and result in the degradation of the proteins of interest. Forty-eight hours after the transfection, the cells would be lysed and the nuclei isolated. Prior to the CUT&RUN, the efficiency of the SP1 depletion would be assayed by quantifying protein and mRNA levels. If the efficiency of the SP1 depletion is sufficient (˃70%, based on Coup-tfii mRNA depletion level, Chapter 1) compared to the control (siRNA Control transfected cells), the CUT&RUN can be performed according to (Skene et al., 2018). For this step, the nuclei from siRNA Control and siRNA targeting SP1 would be incubated with anti-COUP-TFII antibody or anti-SP1 antibody individually and micrococcal nuclease to release DNA. The DNA is then isolated from the supernatant and utilized directly to construct sequencing libraries using a commercially available library preparation kit (i.e., Ultra II DNA library prep kit, NEB). Once the next-generation sequencing of the library is completed, the data would be analyzed from anti-COUP antibody and anti-SP1 antibody separately. The peaks corresponding to the GC-box regions in SP1 depleted samples for each transcription factor will be mapped and normalized to the data from the control samples (siRNA Control), respectively. I expect that COUP-TFII will be recruited to some known SP1 genomic areas of target genes even in the absence of SP1 in MA-10 Leydig cells, such

187

as Amhr2, Lhcgr, and vascular endothelial growth factor (Vegf) regulatory regions (Teixeira et al., 1999; Nikula et al., 2001; Schwarzenbach et al., 2004) and many other novel genomic regions. Indeed, COUP-TFI was found to regulate Lhcgr promoter (Zhang and Dufau, 2003), suggesting that COUP-TFII might be involved in the regulation of this promoter by interacting with a GC-rich box. The identified novel genomic regions will be confirmed by traditional ChIP and DNA pulldown assays using well-established protocols (Chapters 2 and 3).

4.2.2 Proposed mechanism of COUP-TFII, GATA4, and SP1 action in the regulation of Amhr2 promoter activity in Leydig cells Based on my findings presented in this thesis, I hypothesize that the -67/+77 bp region of the Amhr2 promoter is necessary for COUP-TFII/GATA4-dependent activation of this promoter in Leydig cells. Figure 4.1 depicts a model for the mechanism of action of these transcription factors. COUP-TFII and GATA4 cooperate to activate Amhr2 promoter activity. My results suggest that the intact GC-rich box found in the core promoter region is essential for COUP- TFII/GATA4 cooperation and activation. Further research is needed to determine whether the imperfect GATA binding site (-53 bp) could also participate in the GATA4-dependent activation of this promoter. It was suspected that SP1 could be involved in the formation of the transcriptional complex on the Amhr2 promoter (Teixeira et al., 1999), most likely by interacting with the GC-rich box (Fig. 4.1). Based on the presence of the GC-rich box in the the -67+77 bp region of Amhr promoter and earlier conclusions (Teixeira et al., 1999), I hypothesize that SP1 binding to the GC-rich box is needed for maximal COUP-TFII- dependent activation of this promoter. However, further investigation is needed to answer this question.

188

Figure 4.1 Proposed model for the COUP-TFII/GATA4 regulation of the mouse Amhr2 promoter. The drawing indicates the binging sites for GATA4, COUP-TFII and SP1. COUP-TFII and GATA4 require an intact GC-rich site for the activation of this promoter. SP1 stabilizes COUP- TFII and GATA4 binding to their respective sites.

189

General conclusion

COUP-TFII in Leydig cells: a deeper understanding of its functions and molecular mechanisms of action The hormones testosterone and INSL3, which are produced by Leydig cells, are well accepted to be essential in the regulation of overall male health and sexual function. Using elegant mouse models to globally inactivate Coup-tfii at different time intervals, COUP-TFII was shown to be essential for proper Leydig cell differentiation and testosterone production (Qin et al., 2008). However, only a handful of reports have identified direct gene targets for COUP-TFII in Leydig cells, such as Star, Insl3, and Akr1c14 (Di-Luoffo et al., 2016; Mendoza-Villarroel et al., 2014a; Mendoza-Villarroel et al., 2014b). Based on the presence of NREs in the gene promoter regions, another report suggested additional COUP-TFII gene targets in steroidogenic cells, such as Cyp11a1 and Cyp17a1 (van den Driesche et al., 2012). Many questions about the mechanisms of COUP-TFII action in Leydig cells remain unanswered, and the research presented in this thesis fills some of those gaps.

In Chapter 1, the analyses using microarray data obtained from the model MA-10 Leydig cell line implicate COUP-TFII in regulating essential genes involved in the initiation and activation of steroidogenesis, androgen homeostasis, and cell differentiation. The depletion of COUP-TFII in MA-10 Leydig cells was achieved using transient transfection of COUP- TFII-targeting siRNA (small interference RNA). The approach is well documented and adequate to deplete proteins of interest, but there are important limitations with these experiments including the fact that they rely on highly efficient transient transfections and the efficacy of the siRNAs. The depletion levels of COUP-TFII tend to differ due to the widely used lipid-based transfection methods (i.e., PEI). Furthermore, the different cell lines used during my work (CV-1, MLTC-1, and MA-10) have very different transfection efficiencies using PEI (data not shown).

To overcome the limitations of the transfection efficiency and possibly toxicity of transfection reagents, the CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) genome editing technique was used to generate two endogenously COUP-TFII- depleted MA-10 cell lines (Appendix A, Fig. A1). This technique uses targeted RNA guides to introduce breaks in chromosomal DNA. A schematic representation illustrates which exon

190

was targeted by the guide RNAs (Appendix A, Fig. A1). By using cellular non-homologous end-joining repair machinery, very precise gene editing can be achieved.

As can be seen on the Western blot image (Appendix, Fig. A1B, Lanes 8-9), COUP-TFII was depleted with the same or better efficiency in both gene-edited cell lines (∆Coup-tfii-03 and ∆Coup-tfii-04) when compared to the transient siRNA approach (Chapter 1, Fig 1.1B). COUP-TFII protein levels in these newly generated genetically edited-MA10 Leydig cell lines appear to remain unchanged after at least eleven passages (Appendix A, Fig. A1B, Lanes 2-3). When the gene-edited MA-10 (∆Coup-tfii-03 and ∆Coup-tfii-04) cells were stimulated with forskolin (FSK), COUP-TFII protein levels remain unchanged (Appendix A, Fig. A1B, Lanes 5-6), which is consistent with a previous report (Mendoza-Villarroel et al., 2014b). The reduction in the expression levels of Star, Amhr2, and Gsta3 are comparable, if not better, to those obtained using the transient siRNA approach (Appendix A, Fig. IC). The advantages of using the CRISP/Cas9 gene-editing method are low cost and feasibility because it does not require expensive siRNAs and transfection reagents. Another significant advantage is the permanent nature of the mutation in the gene of interest compared to only transient knockdown using an siRNA approach. Therefore, the gene-editing method could be used as an alternative to target COUP-TFII in other Leydig cell model lines such as MLTC- 1 or even isolated primary mouse Leydig cells.

The microarray data was very informative and highly beneficial in identifying at least two additional COUP-TFII potentially directly regulated genes (Amhr2 and Gsta3) in MA-10 Leydig cells. In Chapter 2, extensive work was performed to investigate the mechanism of COUP-TFII-dependent activation of the mouse Amhr2 promoter. COUP-TFII was found to cooperate with SP1 to activate this gene in steroidogenic cell lines.

As described in Chapter 2, COUP-TFII is somewhat indiscriminate when it comes to binding to a consensus sequence. If we take the Amhr2 promoter as an example, at least two potential COUP-TFII response elements were identified. Both of these elements may contribute to the COUP-TFII-dependent activation, but only the GC-rich box was found to be essential. To help narrow down the promoters that could be activated directly by COUP-TFII, various web-based tools were used to predict the presence of COUP-TFII response elements within promoter regions. Other promoters like Hsd3b1 and Inha have potential COUP-TFII

191

elements in their respective promoter region, but COUP-TFII did not activate these promoters. This may seem contradictory since these two genes were significantly downregulated in COUP-TFII-depleted MA-10 Leydig cells, suggesting a role for COUP-TFII in their expression. This phenomenon is not unique to COUP-TFII, as it is well recognized that the presence of a motif for transcription factor does not guarantee that the transcription factor will bind and activate expression of this gene via that binding site. There are some potential reasons for this that are not mutually exclusive. For example, access to the binding site might be limited due to other nearby DNA-bound transcription factors. Alternatively, the transcription factor might require stabilization by other transcription factors or post- translational modifications (ex. phosphorylation) prior to binding. In addition, adequate expression of the transcription factor acting as a COUP-TFII partner could be necessary to observe activation. Another possibility is that the promoter used in my assays was not long enough to include all potential transcription factor binding sites required for COUP-TFII- dependent activation.

To predict more efficiently COUP-TFII response elements occupied within the genome, we would need to look at the flanking regions surrounding them. Indeed, the DNA structure surrounding the response elements affects transcription factor binding (reviewed in Dror et al., 2015). To my knowledge, this was never investigated for COUP-TFII in any cell line. This study can be efficiently done at low cost using high-throughput-systematic evolution of ligands via exponential enrichment (HT-SELEX). HT-SELEX was successfully performed for the transcription GATA4, a partner of COUP-TFII, which revealed that specific nucleotides flanking the 3’ and 5’ regions around the GATA core binding motif are preferred for maximum binding efficiency (Yella et al., 2018). When preparing the DNA library, we would need to design randomized regions surrounding the core COUP-TFII binding sequence (AGGTCA, NRE) (NNNNNAGGTCANNGGTCNNNNNN) flanked by the primer regions on each side for the PCR amplifications. The binding reactions between in vitro generated tagged COUP-TFII, and the DNA pool would be performed and repeated until maximum affinity is achieved. Then the final enriched pool would be sequenced (NGS). Without going into technical details of the HT-SELEX technique, newly obtained results using that approach would identify preferred flanking sequences surrounding COUP-TFII response elements. These findings would allow us to screen gene regulatory regions looking

192

for specific flanking sequences surrounding the response elements and predict with better efficiency and accuracy COUP-TFII target genes combined with other techniques.

One of the more exciting findings discovered is the functional cooperation between COUP- TFII and GATA4 on the Amhr2 promoter in MA-10 Leydig cells (Chapter 3). These transcription factors are essential for steroidogenesis in MA-10 Leydig cells (Bergeron et al., 2015; Mendoza-Villarroel et al., 2014b). The COUP-TFII/GATA4 functional cooperation is most likely due to their molecular interaction (Chapter 3). However, an interaction between these two transcription factors remains to be investigated in Leydig cells. The fact that COUP-TFII cooperates with another GATA member (GATA6) in the regulation of the Amhr2 promoter in Leydig cells makes it even more interesting and gives impetus to look for other cell types where these transcription factors co-localize. In support of this finding, COUP-TFII was found to molecularly interact with GATA2 and GATA3 in HEK293 cells and functionally cooperate with GATA2 (Xu et al., 2008) and GATA4 (Huggins et al., 2001; Wang et al., 2019). In my assays, functional cooperation was not observed with GATA1 or GATA3 (Chapter 3), suggesting possible cell-specific interactions and/or differences in GATA family sequence homology are responsible for this result. Aside from the well- conserved GATA DNA binding domain, the N-terminal and C-terminal domains of GATA4 and GATA6 share low percent similarity (reviewed in Tremblay et al., 2018). Deletion of DNA binding domain and 39 subsequent amino acids from GATA2 resulted in reduced molecular interaction with COUP-TFII (Xu et al., 2008), suggesting the importance of this region. It is unclear whether the similar region found in the other five GATA members is responsible for physical interaction with COUP-TFII. To address this question, two tagged COUP-TFII expression vectors were constructed. A GST-tagged COUP-TFII construct in a bacterial expression vector and a 3xFLAG-tagged COUP-TFII in a mammalian expression vector were created. These constructs can be used to investigate COUP-TII interactions with the GATA members in vitro and in vivo. Additionally, the 3xFLAG-tagged COUP-TFII expression vector can be used for Co-IP to identify COUP-TFII partners in Leydig cells, including GATA members. The bacterial expression vectors can be used to generate and purify recombinant proteins, which can then be used to determine COUP-TFII affinities for different GATA members in vitro. Finally, there is no evidence that demonstrates if GATA2

193

deletion impairs functional cooperation with COUP-TFII, and this question remains to be investigated.

In conclusion, my findings shed new light on the mechanisms of COUP-TFII action in Leydig cells. Furthermore, the discovery of Amhr2 and Gsta3 genes as targets for COUP-TFII- dependent activation emphasizes a crucial role of COUP-TFII in the regulation of Leydig cell function. The discovery of two new COUP-TFII transcriptional partners, GATA4 and GATA6, strengthens the importance of COUP-TFII in these cells.

Future perspectives Testicular Dysgenesis Syndrome (TDS) Leydig cells are the primary source of testosterone in adult males. It is therefore critical to establish what is causing the deterioration of Leydig cells in aging males and in TDS. Endocrine-disrupting compounds have negative effects on Leydig cell function and development (reviewed in Hu et al., 2009; Pallotti et al., 2020; Sharpe and Skakkebaek, 2008). Organochlorines (dichlorodiphenyltrichloroethane (DTT), found in Northern Quebec) suppress androgen production in mouse Leydig cells by targeting proteins and enzymes involved in the initial steps of the steroidogenesis (Enangue Njembele et al., 2014). The neonicotinoids (new nicotine-like insecticides) have a detrimental impact on Leydig cell function and numbers in rodents (Abdel-Rahman Mohamed et al., 2017; Kong et al., 2017). Phthalates, a group of commonly used plasticizers, affect FLCs and ALCs function and development (Chauvigne et al., 2011; Lv et al., 2019). Phthalate exposure increases reactive oxygen species (ROS) levels, such as superoxide radicals and H2O2. The glutathione S- transferases are implicated in the detoxification of ROS generated by oxidative stress (Sherratt and Hayes, 2001). Exposure of fetal rat testes to mono-(2-ethylhexyl) phthalate negatively affects the expression of glutathione S-transferase alpha 4 (Gsta4) (Chauvigne et al., 2011). Similarly, exposure of 3-weeks old rats to di-(2-ethylhexyl) phthalate results in decreased expression of genes involved in oxidative stress response, including glutathione S- transferase alpha 2 (Gsta2) (Murata et al., 2003).

The expression of several genes implicated in oxidative stress response were downregulated in COUP-TFII-depleted MA-10 Leydig cells, such as Gsta1, Gsta2, Gsta3, Gsta4, and ATP-

194

binding cassette sub-family B member 1B (Abcb1b) (Chapter 1). While the primary role of GSTA enzymes is to eliminate ROS, some are also involved in steroidogenesis (Johansson and Mannervik, 2001; Pandey and Miller, 2005). Exposure of stimulated Leydig cells and cell line to mono-(2-ethylhexyl) phthalate result in reduced steroid production and altered expression of genes implicated in oxidative stress response (Fan et al., 2010).

COUP-TFII was shown to be essential for Leydig cell differentiation and steroidogenesis in mouse models (Qin et al., 2008), and was found to activate steroidogenesis in Leydig cell lines by regulating Star expression (Mendoza-Villarroel et al., 2014b). The effects of endocrine disruptors on COUP-TFII-depleted mouse Leydig cell lines will be important to investigate. COUP-TFII can modulate and induce protective roles against endocrine disruptors to keep the population of adult Leydig cells healthy by regulating the expression of genes implicated in oxidative stress response, but this remains unproven. Retinoic acids (RAs), metabolites of vitamin A, activate COUP-TFII-dependent gene transcription (Kruse et al., 2008). I hypothesize that supplementing RAs to the culture media will activate COUP- TFII and reverse the harmful effects of phthalates on Leydig cell lines by upregulating the expression of genes implicated in the oxidative stress response.

If my hypothesis is correct, then the use of animal models is warranted. Qui et al. reported that the inactivation of Coup-tfii does not affect steroidogenesis in ALCs of aging mice (Qin et al., 2008). Since the tests were conducted on mice kept in a stress-free and endocrine disruptor-free environment (Qin et al., 2008), the roles of COUP-TFII in the phthalate- exposed aging mice remain unknown.

195

References

Abdel-Rahman Mohamed, A., Mohamed, W.A.M., and Khater, S.I. (2017). Imidacloprid induces various toxicological effects related to the expression of 3beta-HSD, NR5A1, and OGG1 genes in mature and immature rats. Environ Pollut 221, 15-25.

Abdou, H.S., Bergeron, F., and Tremblay, J.J. (2014). A cell-autonomous molecular cascade initiated by AMP-activated protein kinase represses steroidogenesis. Mol Cell Biol 34, 4257- 4271.

Abdou, H.S., Villeneuve, G., and Tremblay, J.J. (2013). The calcium signaling pathway regulates leydig cell steroidogenesis through a transcriptional cascade involving the nuclear receptor NR4A1 and the steroidogenic acute regulatory protein. Endocrinology 154, 511- 520.

Achatz, G., Holzl, B., Speckmayer, R., Hauser, C., Sandhofer, F., and Paulweber, B. (1997). Functional domains of the human orphan receptor ARP-1/COUP-TFII involved in active repression and transrepression. Mol Cell Biol 17, 4914-4932.

Ademi, H., Stévant, I., Rands, C.M., Conne, B., and Nef, S. (2020). Expression of Wnt5a defines the major progenitors of fetal and adult Leydig cells. bioRxiv, 2020.2007.2025.221069.

Agoulnik, A.I. (2007). Relaxin and related peptides in male reproduction. Adv Exp Med Biol 612, 49-64.

Al Turki, S., Manickaraj, A.K., Mercer, C.L., Gerety, S.S., Hitz, M.P., Lindsay, S., D'Alessandro, L.C., Swaminathan, G.J., Bentham, J., Arndt, A.K., et al. (2014). Rare variants in NR2F2 cause congenital heart defects in humans. Am J Hum Genet 94, 574-585.

Anbalagan, M., Huderson, B., Murphy, L., and Rowan, B.G. (2012). Post-translational modifications of nuclear receptors and human disease. Nucl Recept Signal 10, 10.1621/nrs.10001.

196

Andersen, C.Y., and Ezcurra, D. (2014). Human steroidogenesis: implications for controlled ovarian stimulation with exogenous gonadotropins. Reprod Biol Endocrinol 12, 128. 10.1186/1477-7827-12-128.

Andersson, A.M., Jensen, T.K., Juul, A., Petersen, J.H., Jorgensen, T., and Skakkebaek, N.E. (2007). Secular decline in male testosterone and sex hormone binding globulin serum levels in Danish population surveys. J Clin Endocrinol Metab 92, 4696-4705.

Aranguren, X.L., Beerens, M., Coppiello, G., Wiese, C., Vandersmissen, I., Lo Nigro, A., Verfaillie, C.M., Gessler, M., and Luttun, A. (2013). COUP-TFII orchestrates venous and lymphatic endothelial identity by homo- or hetero-dimerisation with PROX1. J Cell Sci 126, 1164-1175.

Archambeault, D.R., and Yao, H.H. (2010). Activin A, a product of fetal Leydig cells, is a unique paracrine regulator of Sertoli cell proliferation and fetal testis cord expansion. Proc Natl Acad Sci U S A 107, 10526-10531.

Archambeault, D.R., and Yao, H.H. (2014). Loss of smad4 in Sertoli and Leydig cells leads to testicular dysgenesis and hemorrhagic tumor formation in mice. Biol Reprod 90, 62.

Ascoli, M. (1981). Characterization of several clonal lines of cultured Leydig tumor cells: gonadotropin receptors and steroidogenic responses. Endocrinology 108, 88-95.

Ascoli, M. (2007). Immortalized Leydig Cell Lines as Models for Studying Leydig Cell Physiology. In The Leydig Cell in Health and Disease, A.H. Payne, and M.P. Hardy, eds. (Totowa, NJ: Humana Press), pp. 373-381.

Ascoli, M., Fanelli, F., and Segaloff, D.L. (2002). The lutropin/choriogonadotropin receptor, a 2002 perspective. Endocr Rev 23, 141-174.

Ashraf, U.M., Sanchez, E.R., and Kumarasamy, S. (2019). COUP-TFII revisited: Its role in metabolic gene regulation. Steroids 141, 63-69.

197

Badis, G., Berger, M.F., Philippakis, A.A., Talukder, S., Gehrke, A.R., Jaeger, S.A., Chan, E.T., Metzler, G., Vedenko, A., Chen, X., et al. (2009). Diversity and complexity in DNA recognition by transcription factors. Science 324, 1720-1723.

Bain, D.L., Heneghan, A.F., Connaghan-Jones, K.D., and Miura, M.T. (2007). Nuclear receptor structure: implications for function. Annu Rev Physiol 69, 201-220.

Bakke, M., and Lund, J. (1995). Mutually exclusive interactions of two nuclear orphan receptors determine activity of a cyclic adenosine 3',5'-monophosphate-responsive sequence in the bovine CYP17 gene. Mol Endocrinol 9, 327-339.

Barsoum, I., and Yao, H.H. (2011). Redundant and differential roles of transcription factors Gli1 and Gli2 in the development of mouse fetal Leydig cells. Biol Reprod 84, 894-899.

Bashamboo, A., Eozenou, C., Jorgensen, A., Bignon-Topalovic, J., Siffroi, J.P., Hyon, C., Tar, A., Nagy, P., Solyom, J., Halasz, Z., et al. (2018). Loss of Function of the Nuclear Receptor NR2F2, Encoding COUP-TF2, Causes Testis Development and Cardiac Defects in 46,XX Children. Am J Hum Genet 102, 487-493.

Bay, K., and Andersson, A.M. (2011). Human testicular insulin-like factor 3: in relation to development, reproductive hormones and andrological disorders. Int J Androl 34, 97-109.

Becker, M., and Hesse, V. (2020). Minipuberty: Why Does it Happen? Horm Res Paediatr 93, 76-84.

Bedecarrats, G.Y., O'Neill, F.H., Norwitz, E.R., Kaiser, U.B., and Teixeira, J. (2003). Regulation of gonadotropin gene expression by Mullerian inhibiting substance. Proc Natl Acad Sci U S A 100, 9348-9353.

Behringer, R.R. (1994). The in vivo roles of mullerian-inhibiting substance. Curr Top Dev Biol 29, 171-187.

Bergeron, F., Bagu, E.T., and Tremblay, J.J. (2011). Transcription of platelet-derived growth factor receptor alpha in Leydig cells involves specificity protein 1 and 3. J Mol Endocrinol 46, 125-138.

198

Bergeron, F., Nadeau, G., and Viger, R.S. (2015). GATA4 knockdown in MA-10 Leydig cells identifies multiple target genes in the steroidogenic pathway. Reproduction 149, 245- 257.

Berridge, M.J., Bootman, M.D., and Lipp, P. (1998). Calcium - a life and death signal. Nature 395, 645-648.

Bian, Y., Song, C., Cheng, K., Dong, M., Wang, F., Huang, J., Sun, D., Wang, L., Ye, M., and Zou, H. (2014). An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. J Proteomics 96, 253-262.

Bielinska, M., Seehra, A., Toppari, J., Heikinheimo, M., and Wilson, D.B. (2007). GATA-4 is required for sex steroidogenic cell development in the fetal mouse. Dev Dyn 236, 203-213.

Bitgood, M.J., and McMahon, A.P. (1995). Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol 172, 126-138.

Bornstein, S.R., Rutkowski, H., and Vrezas, I. (2004). Cytokines and steroidogenesis. Mol Cell Endocrinol 215, 135-141.

Bouin, P., and Ancel, P. (1903). Recherches sur les cellules interstitielles du testicule des mammiferes. Arch de Zool Exp Gen 1, 437-523.

Bouma, G.J., Washburn, L.L., Albrecht, K.H., and Eicher, E.M. (2007). Correct dosage of Fog2 and Gata4 transcription factors is critical for fetal testis development in mice. Proc Natl Acad Sci U S A 104, 14994-14999.

Bourguet, W., Vivat, V., Wurtz, J.M., Chambon, P., Gronemeyer, H., and Moras, D. (2000). Crystal structure of a heterodimeric complex of RAR and RXR ligand-binding domains. Mol Cell 5, 289-298.

Bremner, W.J., Millar, M.R., Sharpe, R.M., and Saunders, P.T. (1994). Immunohistochemical localization of androgen receptors in the rat testis: evidence for stage- dependent expression and regulation by androgens. Endocrinology 135, 1227-1234.

199

Brennan, J., Tilmann, C., and Capel, B. (2003). Pdgfr-alpha mediates testis cord organization and fetal Leydig cell development in the XY gonad. Genes Dev 17, 800-810.

Brown, M.S., and Goldstein, J.L. (1997). The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331-340.

Burbach, J.P., Lopes da Silva, S., Cox, J.J., Adan, R.A., Cooney, A.J., Tsai, M.J., and Tsai, S.Y. (1994). Repression of estrogen-dependent stimulation of the oxytocin gene by chicken ovalbumin upstream promoter transcription factor I. J Biol Chem 269, 15046-15053.

Cao, Z., West, C., Norton-Wenzel, C.S., Rej, R., Davis, F.B., Davis, P.J., and Rej, R. (2009). Effects of resin or charcoal treatment on fetal bovine serum and bovine calf serum. Endocr Res 34, 101-108.

Carter, M.E., Gulick, T., Moore, D.D., and Kelly, D.P. (1994). A pleiotropic element in the medium-chain acyl coenzyme A dehydrogenase gene promoter mediates transcriptional regulation by multiple nuclear receptor transcription factors and defines novel receptor-DNA binding motifs. Mol Cell Biol 14, 4360-4372.

Chan, S.M., Xu, N., Niemeyer, C.C., Bone, J.R., and Flytzanis, C.N. (1992). SpCOUP-TF: a sea urchin member of the steroid/thyroid hormone receptor family. Proc Natl Acad Sci U S A 89, 10568-10572.

Chauvigne, F., Plummer, S., Lesne, L., Cravedi, J.P., Dejucq-Rainsford, N., Fostier, A., and Jegou, B. (2011). Mono-(2-ethylhexyl) phthalate directly alters the expression of Leydig cell genes and CYP17 lyase activity in cultured rat fetal testis. PloS one 6, e27172, 10.1371/journal.pone.0027172.

Chung, E., and Brock, G.B. (2011). Cryptorchidism and its impact on male fertility: a state of art review of current literature. Can Urol Assoc J 5, 210-214.

Clark, A.M., Garland, K.K., and Russell, L.D. (2000). Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod 63, 1825-1838.

200

Clark, B.J., Wells, J., King, S.R., and Stocco, D.M. (1994). The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269, 28314-28322.

Cooney, A.J., Tsai, S.Y., O'Malley, B.W., and Tsai, M.J. (1992). Chicken ovalbumin upstream promoter transcription factor (COUP-TF) dimers bind to different GGTCA response elements, allowing COUP-TF to repress hormonal induction of the vitamin D3, thyroid hormone, and retinoic acid receptors. Mol Cell Biol 12, 4153-4163.

Costa, R.R., and Varanda, W.A. (2007). Intracellular calcium changes in mice Leydig cells are dependent on calcium entry through T-type calcium channels. J Physiol 585, 339-349.

Cutting, A.D., Ayers, K., Davidson, N., Oshlack, A., Doran, T., Sinclair, A.H., Tizard, M., and Smith, C.A. (2014). Identification, expression, and regulation of anti-Mullerian hormone type-II receptor in the embryonic chicken gonad. Biol Reprod 90, 106.

Davidoff, M.S., Middendorff, R., Enikolopov, G., Riethmacher, D., Holstein, A.F., and Muller, D. (2004). Progenitor cells of the testosterone-producing Leydig cells revealed. J Cell Biol 167, 935-944.

De Bosscher, K., Desmet, S.J., Clarisse, D., Estebanez-Perpina, E., and Brunsveld, L. (2020). Nuclear receptor crosstalk - defining the mechanisms for therapeutic innovation. Nat Rev Endocrinol 16, 363-377.

De Bosscher, K., and Haegeman, G. (2009). Minireview: latest perspectives on antiinflammatory actions of glucocorticoids. Mol Endocrinol 23, 281-291.

De Giorgio, F., Maduro, C., Fisher, E.M.C., and Acevedo-Arozena, A. (2019). Transgenic and physiological mouse models give insights into different aspects of amyotrophic lateral sclerosis. Dis Model Mech 12. de Santa Barbara, P., Moniot, B., Poulat, F., Boizet, B., and Berta, P. (1998). Steroidogenic factor-1 regulates transcription of the human anti-mullerian hormone receptor. J Biol Chem 273, 29654-29660.

201

DeFalco, T., Takahashi, S., and Capel, B. (2011). Two distinct origins for Leydig cell progenitors in the fetal testis. Dev Biol 352, 14-26.

Di-Luoffo, M., Brousseau, C., and Tremblay, J.J. (2016). MEF2 and NR2F2 cooperate to regulate Akr1c14 gene expression in mouse MA-10 Leydig cells. Andrology 4, 335-344.

Dombrowicz, D., Sente, B., Closset, J., and Hennen, G. (1992). Dose-dependent effects of human prolactin on the immature hypophysectomized rat testis. Endocrinology 130, 695- 700.

Dror, I., Golan, T., Levy, C., Rohs, R., and Mandel-Gutfreund, Y. (2015). A widespread role of the motif environment in transcription factor binding across diverse protein families. Genome Res 25, 1268-1280.

Dror, I., Rohs, R., and Mandel-Gutfreund, Y. (2016). How motif environment influences transcription factor search dynamics: Finding a needle in a haystack. Bioessays 38, 605-612.

Duester, G. (1998). Alcohol Dehydrogenase as a Critical Mediator of Retinoic Acid Synthesis from Vitamin A in the Mouse Embryo. J Nutr 128, 459S-462S.

Dufau, M.L. (1998). The luteinizing hormone receptor. Annu Rev Physiol 60, 461-496.

Dufau, M.L., Tsuruhara, T., Horner, K.A., Podesta, E., and Catt, K.J. (1977). Intermediate role of adenosine 3':5'-cyclic monophosphate and protein kinase during gonadotropin- induced steroidogenesis in testicular interstitial cells. Proc Natl Acad Sci U S A 74, 3419- 3423.

Eik-Nes, K.B. (1975). Production and secretion of 5alpha-reduced testosterone (DHT) by male reproductive organs. J Steroid Biochem 6, 337-339.

Enangue Njembele, A.N., Bailey, J.L., and Tremblay, J.J. (2014). In Vitro Exposure of Leydig Cells to an Environmentally Relevant Mixture of Organochlorines Represses Early Steps of Steroidogenesis. Biol Reprod 90, 118. 10.1095/biolreprod.113.116368.

202

Engeli, R.T., Furstenberger, C., Kratschmar, D.V., and Odermatt, A. (2018). Currently available murine Leydig cell lines can be applied to study early steps of steroidogenesis but not testosterone synthesis. Heliyon 4, e00527. 10.1016/j.heliyon.2018.e00527.

Epstein, P.M. (2017). Different phosphodiesterases (PDEs) regulate distinct phosphoproteomes during cAMP signaling. Proc Natl Acad Sci U S A 114, 7741-7743.

Estermann, M.A., and Smith, C.A. (2020). Applying Single-Cell Analysis to Gonadogenesis and DSDs (Disorders/Differences of Sex Development). Int J Mol Sci 21. 10.3390/ijms21186614.

Evans, R.M., and Mangelsdorf, D.J. (2014). Nuclear Receptors, RXR, and the Big Bang. Cell 157, 255-266.

Everett, L.J., and Lazar, M.A. (2013). Cell-specific integration of nuclear receptor function at the genome. Wiley Interdiscip Rev Syst Biol Med 5, 615-629.

Fan, J., Traore, K., Li, W., Amri, H., Huang, H., Wu, C., Chen, H., Zirkin, B., and Papadopoulos, V. (2010). Molecular mechanisms mediating the effect of mono-(2- ethylhexyl) phthalate on hormone-stimulated steroidogenesis in MA-10 mouse tumor Leydig cells. Endocrinology 151, 3348-3362.

Forest, M.G., Cathiard, A.M., and Bertrand, J.A. (1973). Evidence of testicular activity in early infancy. J Clin Endocrinol Metab 37, 148-151.

Fowler, P.A., Bhattacharya, S., Gromoll, J., Monteiro, A., and O'Shaughnessy, P.J. (2009). Maternal smoking and developmental changes in luteinizing hormone (LH) and the LH receptor in the fetal testis. J Clin Endocrinol Metab 94, 4688-4695.

Franco, H.L., and Yao, H.H. (2012). Sex and hedgehog: roles of genes in the hedgehog signaling pathway in mammalian sexual differentiation. Chromosome Res 20, 247-258.

Frye, C.A., Koonce, C.J., Edinger, K.L., Osborne, D.M., and Walf, A.A. (2008). Androgens with activity at estrogen receptor beta have anxiolytic and cognitive-enhancing effects in male rats and mice. Horm Behav 54, 726-734.

203

Gacasan, S.B., Baker, D.L., and Parrill, A.L. (2017). G protein-coupled receptors: the evolution of structural insight. AIMS Biophys 4, 491-527.

Gadaleta, R.M., and Magnani, L. (2014). Nuclear receptors and chromatin: an inducible couple. J Mol Endocrinol 52, R137-149.

Garrel, G., Denoyelle, C., L'Hote, D., Picard, J.Y., Teixeira, J., Kaiser, U.B., Laverriere, J.N., and Cohen-Tannoudji, J. (2019). GnRH Transactivates Human AMH Receptor Gene via Egr1 and FOXO1 in Gonadotrope Cells. Neuroendocrinology 108, 65-83.

Garrel, G., Racine, C., L'Hote, D., Denoyelle, C., Guigon, C.J., di Clemente, N., and Cohen- Tannoudji, J. (2016). Anti-Mullerian hormone: a new actor of sexual dimorphism in pituitary gonadotrope activity before puberty. Sci Rep 6, 23790.

Ge, R.S., Dong, Q., Sottas, C.M., Chen, H., Zirkin, B.R., and Hardy, M.P. (2005). Gene expression in rat leydig cells during development from the progenitor to adult stage: a cluster analysis. Biol Reprod 72, 1405-1415.

Ge, R.S., Dong, Q., Sottas, C.M., Papadopoulos, V., Zirkin, B.R., and Hardy, M.P. (2006). In search of rat stem Leydig cells: identification, isolation, and lineage-specific development. Proc Natl Acad Sci U S A 103, 2719-2724.

Ge, R.S., and Hardy, M.P. (1998). Variation in the end products of androgen biosynthesis and metabolism during postnatal differentiation of rat Leydig cells. Endocrinology 139, 3787-3795.

Germain, P., Staels, B., Dacquet, C., Spedding, M., and Laudet, V. (2006). Overview of nomenclature of nuclear receptors. Pharmacol Rev 58, 685-704.

Ghinea, N., Vu Hai, M.T., Groyer-Picard, M.T., Houllier, A., Schoevaert, D., and Milgrom, E. (1992). Pathways of internalization of the hCG/LH receptor: immunoelectron microscopic studies in Leydig cells and transfected L-cells. J Cell Biol 118, 1347-1358.

Giguere, V. (1999). Orphan nuclear receptors: from gene to function. Endocr Rev 20, 689- 725.

204

Glass, C.K., and Saijo, K. (2010). Nuclear receptor transrepression pathways that regulate inflammation in macrophages and T cells. Nat Rev Immunol 10, 365-376.

Gnessi, L., Basciani, S., Mariani, S., Arizzi, M., Spera, G., Wang, C., Bondjers, C., Karlsson, L., and Betsholtz, C. (2000). Leydig cell loss and spermatogenic arrest in platelet-derived growth factor (PDGF)-A-deficient mice. J Cell Biol 149, 1019-1026.

Goda, M., Oda, K., Oda, A., Kobayashi, N., and Otsuka, M. (2017). Involvement of the Multidrug and Toxic Compound Extrusion Transporter in Testosterone Release from Cultured Pig Leydig Cells. Pharmacology 100, 31-39.

Gouedard, L., Chen, Y.G., Thevenet, L., Racine, C., Borie, S., Lamarre, I., Josso, N., Massague, J., and di Clemente, N. (2000). Engagement of bone morphogenetic protein type IB receptor and Smad1 signaling by anti-Mullerian hormone and its type II receptor. J Biol Chem 275, 27973-27978.

Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J.M., Argos, P., and Chambon, P. (1986). Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature 320, 134-139.

Griswold, S.L., and Behringer, R.R. (2009). Fetal Leydig cell origin and development. Sex Dev 3, 1-15.

Gujar, N.N., Choudhari, R.K., Choudhari, G.R., Bagali, N.M., Mane, H.S., Awati, J.S., and Balachandran, V. (2011). Male form of persistent Mullerian duct syndrome type I (hernia uteri inguinalis) presenting as an obstructed inguinal hernia: a case report. J Med Case Rep 5, 586.

Guo, J.J., Ma, X., Wang, C.Q., Ge, Y.F., Lian, Q.Q., Hardy, D.O., Zhang, Y.F., Dong, Q., Xu, Y.F., and Ge, R.S. (2013). Effects of luteinizing hormone and androgen on the development of rat progenitor Leydig cells in vitro and in vivo. Asian J Androl 15, 685-691.

Gurevich, V.V., and Gurevich, E.V. (2019). GPCR Signaling Regulation: The Role of GRKs and Arrestins. Front Pharmacol 10, 125. 10.3389/fphar.2019.00125.

205

Hakkarainen, J., Zhang, F.P., Jokela, H., Mayerhofer, A., Behr, R., Cisneros-Montalvo, S., Nurmio, M., Toppari, J., Ohlsson, C., Kotaja, N., et al. (2018). Hydroxysteroid (17beta) dehydrogenase 1 expressed by Sertoli cells contributes to steroid synthesis and is required for male fertility. FASEB J 32, 3229-3241.

Hanahan, D. (1997). Signaling vascular morphogenesis and maintenance. Science 277, 48- 50.

Hansson, V., Skalhegg, B.S., and Tasken, K. (2000). Cyclic-AMP-dependent protein kinase (PKA) in testicular cells. Cell specific expression, differential regulation and targeting of subunits of PKA. J Steroid Biochem Mol Biol 73, 81-92.

Hardie, D.G. (2011). AMP-activated protein kinase: an energy sensor that regulates all aspects of cell function. Genes & development 25, 1895-1908.

Hermann-Kleiter, N., and Baier, G. (2014). Orphan nuclear receptor NR2F6 acts as an essential gatekeeper of Th17 CD4+ T cell effector functions. Cell Commun Signal 12, 38.

Hermann-Kleiter, N., Gruber, T., Lutz-Nicoladoni, C., Thuille, N., Fresser, F., Labi, V., Schiefermeier, N., Warnecke, M., Huber, L., Villunger, A., et al. (2008). The nuclear orphan receptor NR2F6 suppresses lymphocyte activation and T helper 17-dependent autoimmunity. Immunity 29, 205-216.

Hirakawa, T., and Ascoli, M. (2003). The lutropin/choriogonadotropin receptor-induced phosphorylation of the extracellular signal-regulated kinases in leydig cells is mediated by a protein kinase a-dependent activation of ras. Mol Endocrinol 17, 2189-2200.

Hirakawa, T., Galet, C., and Ascoli, M. (2002). MA-10 cells transfected with the human lutropin/choriogonadotropin receptor (hLHR): a novel experimental paradigm to study the functional properties of the hLHR. Endocrinology 143, 1026-1035.

Hollenberg, S.M., Weinberger, C., Ong, E.S., Cerelli, G., Oro, A., Lebo, R., Thompson, E.B., Rosenfeld, M.G., and Evans, R.M. (1985). Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318, 635-641.

206

Holst, J.P., Soldin, O.P., Guo, T., and Soldin, S.J. (2004). Steroid hormones: relevance and measurement in the clinical laboratory. Clin Lab Med 24, 105-118.

Hornbeck, P.V., Zhang, B., Murray, B., Kornhauser, J.M., Latham, V., and Skrzypek, E. (2015). PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res 43, D512-520.

Horton, J.D., Shah, N.A., Warrington, J.A., Anderson, N.N., Park, S.W., Brown, M.S., and Goldstein, J.L. (2003). Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci U S A 100, 12027-12032.

Hoshiya, Y., Gupta, V., Segev, D.L., Hoshiya, M., Carey, J.L., Sasur, L.M., Tran, T.T., Ha, T.U., and Maheswaran, S. (2003). Mullerian Inhibiting Substance induces NFkB signaling in breast and prostate cancer cells. Mol Cell Endocrinol 211, 43-49.

Hossain, A., and Saunders, G.F. (2003). Synergistic cooperation between the beta-catenin signaling pathway and steroidogenic factor 1 in the activation of the Mullerian inhibiting substance type II receptor. J Biol Chem 278, 26511-26516.

Hu, G.X., Lian, Q.Q., Ge, R.S., Hardy, D.O., and Li, X.K. (2009). Phthalate-induced testicular dysgenesis syndrome: Leydig cell influence. Trends Endocrinol Metab 20, 139- 145.

Hu, G.X., Lin, H., Chen, G.R., Chen, B.B., Lian, Q.Q., Hardy, D.O., Zirkin, B.R., and Ge, R.S. (2010). Deletion of the Igf1 gene: suppressive effects on adult Leydig cell development. J Androl 31, 379-387.

Hu, Y.C., Okumura, L.M., and Page, D.C. (2013). Gata4 is required for formation of the genital ridge in mice. PLoS Genet 9, e1003629. 10.1371/journal.pgen.1003629.

Huang, S., Ye, L., and Chen, H. (2017). Sex determination and maintenance: the role of DMRT1 and FOXL2. Asian J Androl 19, 619-624.

207

Huggins, G.S., Bacani, C.J., Boltax, J., Aikawa, R., and Leiden, J.M. (2001). Friend of GATA 2 physically interacts with chicken ovalbumin upstream promoter-TF2 (COUP-TF2) and COUP-TF3 and represses COUP-TF2-dependent activation of the atrial natriuretic factor promoter. J Biol Chem 276, 28029-28036.

Ito, M., Yu, R., and Jameson, J.L. (1997). DAX-1 inhibits SF-1-mediated transactivation via a carboxy-terminal domain that is deleted in adrenal hypoplasia congenita. Mol Cell Biol 17, 1476-1483.

Ivell, R., Heng, K., and Anand-Ivell, R. (2014). Insulin-Like Factor 3 and the HPG Axis in the Male. Front Endocrinol 5, 6.

Izumi, K. (2016). Disorders of Transcriptional Regulation: An Emerging Category of Multiple Malformation Syndromes. Mol Syndromol 7, 262-273.

Japon, M.A., Rubinstein, M., and Low, M.J. (1994). In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J Histochem Cytochem 42, 1117-1125.

Jensen, E.V. (1962). On the mechanism of estrogen action. Perspect Biol Med 6, 47-59.

Jensen, E.V., and Jacobson, H.I. (1960). Fate of Steroid Estrogens in Target Tissues. In Biological Activities of Steroids in Relation to Cancer, G. Pincus, and E.P. Vollmer, eds. (Academic Press), pp. 161-178.

Jensen, E.V., Jacobson, H.I., Walf, A.A., and Frye, C.A. (2010). Estrogen action: a historic perspective on the implications of considering alternative approaches. Physiol Behav 99, 151-162.

Ji, I., and Ji, T.H. (1991). Exons 1-10 of the rat LH receptor encode a high affinity hormone binding site and exon 11 encodes G-protein modulation and a potential second hormone binding site. Endocrinology 128, 2648-2650.

208

Jia, H., Sullivan, C.T., McCoy, S.C., Yarrow, J.F., Morrow, M., and Borst, S.E. (2015). Review of health risks of low testosterone and testosterone administration. World J Clin Cases 3, 338-344.

Jo, Y., King, S.R., Khan, S.A., and Stocco, D.M. (2005). Involvement of protein kinase C and cyclic adenosine 3',5'-monophosphate-dependent kinase in steroidogenic acute regulatory protein expression and steroid biosynthesis in Leydig cells. Biol Reprod 73, 244- 255.

Johansson, A.S., and Mannervik, B. (2001). Human glutathione transferase A3-3, a highly efficient catalyst of double-bond isomerization in the biosynthetic pathway of steroid hormones. J Biol Chem 276, 33061-33065.

Johnson, P.F., and McKnight, S.L. (1989). EUKARYOTIC TRANSCRIPTIONAL REGULATORY PROTEINS. Annu Rev Biochem 58, 799-839.

Josso, N., di Clemente, N., and Gouedard, L. (2001). Anti-Mullerian hormone and its receptors. Mol Cell Endocrinol 179, 25-32.

Josso, N., Racine, C., di Clemente, N., Rey, R., and Xavier, F. (1998). The role of anti- Mullerian hormone in gonadal development. Mol Cell Endocrinol 145, 3-7.

Kaivo-oja, N., Jeffery, L.A., Ritvos, O., and Mottershead, D.G. (2006). Smad signalling in the ovary. Reprod Biol Endocrinol 4, 21.

Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N., and Sternberg, M.J. (2015). The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc 10, 845-858.

Ketola, I., Rahman, N., Toppari, J., Bielinska, M., Porter-Tinge, S.B., Tapanainen, J.S., Huhtaniemi, I.T., Wilson, D.B., and Heikinheimo, M. (1999). Expression and regulation of transcription factors GATA-4 and GATA-6 in developing mouse testis. Endocrinology 140, 1470-1480.

Khan, S., Teerds, K., and Dorrington, J. (1992). Growth factor requirements for DNA synthesis by Leydig cells from the immature rat. Biol Reprod 46, 335-341.

209

Kilcoyne, K.R., Smith, L.B., Atanassova, N., Macpherson, S., McKinnell, C., van den Driesche, S., Jobling, M.S., Chambers, T.J., De Gendt, K., Verhoeven, G., et al. (2014). Fetal programming of adult Leydig cell function by androgenic effects on stem/progenitor cells. Proc Natl Acad Sci U S A 111, E1924-1932.

Kimura, A.P., Yoneda, R., Kurihara, M., Mayama, S., and Matsubara, S. (2017). A Long Noncoding RNA, lncRNA-Amhr2, Plays a Role in Amhr2 Gene Activation in Mouse Ovarian Granulosa Cells. Endocrinology 158, 4105-4121.

Klattig, J., Sierig, R., Kruspe, D., Besenbeck, B., and Englert, C. (2007). Wilms' tumor protein Wt1 is an activator of the anti-Mullerian hormone receptor gene Amhr2. Mol Cell Biol 27, 4355-4364.

Kong, D., Zhang, J., Hou, X., Zhang, S., Tan, J., Chen, Y., Yang, W., Zeng, J., Han, Y., Liu, X., et al. (2017). Acetamiprid inhibits testosterone synthesis by affecting the mitochondrial function and cytoplasmic adenosine triphosphate production in rat Leydig cells. Biol Reprod 96, 254-265.

Koopman, P. (1999). Sry and Sox9: mammalian testis-determining genes. Cell Mol Life Sci 55, 839-856.

Kozina, V., Geist, D., Kubinova, L., Bilic, E., Karnthaler, H.P., Waitz, T., Janacek, J., Chernyavskiy, O., Krhen, I., and Jezek, D. (2011). Visualization of Reinke's crystals in normal and cryptorchid testis. Histochem Cell Biol 135, 215-228.

Krishnan, V., Pereira, F.A., Qiu, Y., Chen, C.H., Beachy, P.A., Tsai, S.Y., and Tsai, M.J. (1997). Mediation of Sonic hedgehog-induced expression of COUP-TFII by a protein phosphatase. Science 278, 1947-1950.

Kruse, S.W., Suino-Powell, K., Zhou, X.E., Kretschman, J.E., Reynolds, R., Vonrhein, C., Xu, Y., Wang, L., Tsai, S.Y., Tsai, M.J., et al. (2008). Identification of COUP-TFII orphan nuclear receptor as a retinoic acid-activated receptor. PLoS Biol 6, e227. 10.1371/journal.pbio.0060227.

210

Kumar, D.L., and DeFalco, T. (2018). A perivascular niche for multipotent progenitors in the fetal testis. Nat Commun 9, 4519.

Kumar, T.R., Wang, Y., Lu, N., and Matzuk, M.M. (1997). Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15, 201-204.

Kumarasamy, S., Waghulde, H., Gopalakrishnan, K., Mell, B., Morgan, E., and Joe, B. (2015). Mutation within the hinge region of the transcription factor Nr2f2 attenuates salt- sensitive hypertension. Nat Commun 6, 6252.

Kurihara, I., Lee, D.K., Petit, F.G., Jeong, J., Lee, K., Lydon, J.P., DeMayo, F.J., Tsai, M.J., and Tsai, S.Y. (2007). COUP-TFII mediates progesterone regulation of uterine implantation by controlling ER activity. PLoS Genet 3, e102. 10.1371/journal.pgen.0030102.

Kurihara, I., Shibata, H., Kobayashi, S., Suda, N., Ikeda, Y., Yokota, K., Murai, A., Saito, I., Rainey, W.E., and Saruta, T. (2005). Ubc9 and Protein Inhibitor of Activated STAT 1 Activate Chicken Ovalbumin Upstream Promoter-Transcription Factor I-mediated Human CYP11B2 Gene Transcription. J Biol Chem 280, 6721-6730.

Kurtoglu, S., and Bastug, O. (2014). Mini puberty and its interpretation. Turk Pediatri Ars 49, 186-191.

Ladias, J.A., and Karathanasis, S.K. (1991). Regulation of the apolipoprotein AI gene by ARP-1, a novel member of the steroid receptor superfamily. Science 251, 561-565.

Lalli, E. (2014). Role of Orphan Nuclear Receptor DAX-1/NR0B1 in Development, Physiology, and Disease. Advances in Biology 2014, 582749. 10.1155/2014/582749.

Lambert, S.A., Jolma, A., Campitelli, L.F., Das, P.K., Yin, Y., Albu, M., Chen, X., Taipale, J., Hughes, T.R., and Weirauch, M.T. (2018). The Human Transcription Factors. Cell 175, 598-599.

Latronico, A.C., and Arnhold, I.J. (2012). Inactivating mutations of the human luteinizing hormone receptor in both sexes. Semin Reprod Med 30, 382-386.

211

Laurich, V.M., Trbovich, A.M., O'Neill, F.H., Houk, C.P., Sluss, P.M., Payne, A.H., Donahoe, P.K., and Teixeira, J. (2002). Mullerian inhibiting substance blocks the protein kinase A-induced expression of cytochrome p450 17alpha-hydroxylase/C(17-20) lyase mRNA in a mouse Leydig cell line independent of cAMP responsive element binding protein phosphorylation. Endocrinology 143, 3351-3360.

Le Guevel, R., Oger, F., Martinez-Jimenez, C.P., Bizot, M., Gheeraert, C., Firmin, F., Ploton, M., Kretova, M., Palierne, G., Staels, B., et al. (2017). Inactivation of the Nuclear Orphan Receptor COUP-TFII by Small Chemicals. ACS Chem Biol 12, 654-663.

Lee, M.M., Donahoe, P.K., Hasegawa, T., Silverman, B., Crist, G.B., Best, S., Hasegawa, Y., Noto, R.A., Schoenfeld, D., and MacLaughlin, D.T. (1996). Mullerian inhibiting substance in humans: normal levels from infancy to adulthood. J Clin Endocrinol Metab 81, 571-576.

Lee, M.M., Seah, C.C., Masiakos, P.T., Sottas, C.M., Preffer, F.I., Donahoe, P.K., Maclaughlin, D.T., and Hardy, M.P. (1999). Mullerian-inhibiting substance type II receptor expression and function in purified rat Leydig cells. Endocrinology 140, 2819-2827.

Lee, T.I., and Young, R.A. (2013). Transcriptional regulation and its misregulation in disease. Cell 152, 1237-1251.

Leisegang, K., and Henkel, R. (2018). The in vitro modulation of steroidogenesis by inflammatory cytokines and insulin in TM3 Leydig cells. Reprod Biol Endocrinol 16, 26.

Leng, X., Cooney, A.J., Tsai, S.Y., and Tsai, M.J. (1996). Molecular mechanisms of COUP- TF-mediated transcriptional repression: evidence for transrepression and active repression. Mol Cell Biol 16, 2332-2340.

212

Levasseur, A., Paquet, M., Boerboom, D., and Boyer, A. (2017). Yes-associated protein and WW-containing transcription regulator 1 regulate the expression of sex-determining genes in Sertoli cells, but their inactivation does not cause sex reversal. Biol Reprod 97, 162-175.

Leydig, F. (1850). Zur Anatomie der männlichen Geschlechtsorgane und Analdrüsen der Säugetiere. Z wiss Zool 2, 1-57.

Li, L., He, S., Sun, J.M., and Davie, J.R. (2004). Gene regulation by Sp1 and Sp3. Biochem Cell Biol 82, 460-471.

Li, L., Xie, X., Qin, J., Jeha, G.S., Saha, P.K., Yan, J., Haueter, C.M., Chan, L., Tsai, S.Y., and Tsai, M.J. (2009). The nuclear orphan receptor COUP-TFII plays an essential role in adipogenesis, glucose homeostasis, and energy metabolism. Cell Metab 9, 77-87.

Li, X., Wang, Z., Jiang, Z., Guo, J., Zhang, Y., Li, C., Chung, J., Folmer, J., Liu, J., Lian, Q., et al. (2016). Regulation of seminiferous tubule-associated stem Leydig cells in adult rat testes. Proc Natl Acad Sci U S A 113, 2666-2671.

Li, Y., Xia, Y., Wang, Y., Mao, L., Gao, Y., He, Q., Huang, M., Chen, S., and Hu, B. (2013). Sonic hedgehog (Shh) regulates the expression of angiogenic growth factors in oxygen- glucose-deprived astrocytes by mediating the nuclear receptor NR2F2. Mol Neurobiol 47, 967-975.

Lin, F.J., Qin, J., Tang, K., Tsai, S.Y., and Tsai, M.J. (2011). Coup d'Etat: an orphan takes control. Endocr Rev 32, 404-421.

Lin, T., Blaisdell, J., and Haskell, J.F. (1987). Transforming growth factor-beta inhibits Leydig cell steroidogenesis in primary culture. Biochem Biophys Res Commun 146, 387- 394.

Litchfield, L.M., and Klinge, C.M. (2012). Multiple roles of COUP-TFII in cancer initiation and progression. J Mol Endocrinol 49, R135-148.

Liu, C., Rodriguez, K., and Yao, H.H. (2016). Mapping lineage progression of somatic progenitor cells in the mouse fetal testis. Development 143, 3700-3710.

213

Liu, S., Chen, X., Wang, Y., Li, L., Wang, G., Li, X., Chen, H., Guo, J., Lin, H., Lian, Q.Q., et al. (2017). A role of KIT receptor signaling for proliferation and differentiation of rat stem Leydig cells in vitro. Mol Cell Endocrinol 444, 1-8.

Liu, Y., and Teng, C.T. (1992). Estrogen response module of the mouse lactoferrin gene contains overlapping chicken ovalbumin upstream promoter transcription factor and estrogen receptor-binding elements. Mol Endocrinol 6, 355-364.

Lokeshwar, S.D., Patel, P., Fantus, R.J., Halpern, J., Chang, C., Kargi, A.Y., and Ramasamy, R. (2020). Decline in Serum Testosterone Levels Among Adolescent and Young Adult Men in the USA. Eur Urol Focus.

Loots, G.G., Ovcharenko, I., Pachter, L., Dubchak, I., and Rubin, E.M. (2002). rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res 12, 832-839.

Lottrup, G., Nielsen, J.E., Maroun, L.L., Moller, L.M., Yassin, M., Leffers, H., Skakkebaek, N.E., and Rajpert-De Meyts, E. (2014). Expression patterns of DLK1 and INSL3 identify stages of Leydig cell differentiation during normal development and in testicular pathologies, including testicular cancer and Klinefelter syndrome. Hum Reprod 29, 1637-1650.

Lumpkin, R.J., Gu, H., Zhu, Y., Leonard, M., Ahmad, A.S., Clauser, K.R., Meyer, J.G., Bennett, E.J., and Komives, E.A. (2017). Site-specific identification and quantitation of endogenous SUMO modifications under native conditions. Nat Commun 8, 1171.

Luo, X., Ikeda, Y., and Parker, K.L. (1994). A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77, 481-490.

Luscombe, N.M., Laskowski, R.A., and Thornton, J.M. (2001). Amino acid-base interactions: a three-dimensional analysis of protein-DNA interactions at an atomic level. Nucleic Acids Res 29, 2860-2874.

Lv, Y., Fang, Y., Chen, P., Duan, Y., Huang, T., Ma, L., Xie, L., Chen, X., Chen, X., Gao, J., et al. (2019). Dicyclohexyl phthalate blocks Leydig cell regeneration in adult rat testis. Toxicology 411, 60-70.

214

Ma, X., Dong, Y., Matzuk, M.M., and Kumar, T.R. (2004). Targeted disruption of luteinizing hormone beta-subunit leads to hypogonadism, defects in gonadal steroidogenesis, and infertility. Proc Natl Acad Sci U S A 101, 17294-17299.

MacLaughlin, D.T., and Donahoe, P.K. (2010). Mullerian inhibiting substance/anti- Mullerian hormone: a potential therapeutic agent for human ovarian and other cancers. Future Oncol 6, 391-405.

Majdic, G., McNeilly, A.S., Sharpe, R.M., Evans, L.R., Groome, N.P., and Saunders, P.T. (1997). Testicular expression of inhibin and activin subunits and follistatin in the rat and human fetus and neonate and during postnatal development in the rat. Endocrinology 138, 2136-2147.

Makela, J.A., Koskenniemi, J.J., Virtanen, H.E., and Toppari, J. (2019). Testis Development. Endocr Rev 40, 857-905.

Mangelsdorf, D.J., and Evans, R.M. (1995). The RXR heterodimers and orphan receptors. Cell 83, 841-850.

Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schutz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., et al. (1995). The nuclear receptor superfamily: the second decade. Cell 83, 835-839.

Manna, P.R., Kero, J., Tena-Sempere, M., Pakarinen, P., Stocco, D.M., and Huhtaniemi, I.T. (2001). Assessment of mechanisms of thyroid hormone action in mouse Leydig cells: regulation of the steroidogenic acute regulatory protein, steroidogenesis, and luteinizing hormone receptor function. Endocrinology 142, 319-331.

Manova, K., Nocka, K., Besmer, P., and Bachvarova, R.F. (1990). Gonadal expression of c- kit encoded at the W locus of the mouse. Development 110, 1057-1069.

Manuylov, N.L., Zhou, B., Ma, Q., Fox, S.C., Pu, W.T., and Tevosian, S.G. (2011). Conditional ablation of Gata4 and Fog2 genes in mice reveals their distinct roles in mammalian sexual differentiation. Dev Biol 353, 229-241.

215

Martin, L.J. (2016). Cell interactions and genetic regulation that contribute to testicular Leydig cell development and differentiation. Mol Reprod Dev 83, 470-487.

Martin, L.J., Boucher, N., Brousseau, C., and Tremblay, J.J. (2008). The orphan nuclear receptor NUR77 regulates hormone-induced StAR transcription in Leydig cells through cooperation with Ca2+/calmodulin-dependent protein kinase I. Mol Endocrinol 22, 2021- 2037.

Martin, L.J., and Tremblay, J.J. (2010). Nuclear receptors in Leydig cell gene expression and function. Biol Reprod 83, 3-14.

Mason, A.J., Hayflick, J.S., Zoeller, R.T., Young, W.S., 3rd, Phillips, H.S., Nikolics, K., and Seeburg, P.H. (1986). A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science 234, 1366-1371.

Mauduit, C., Goddard, I., Besset, V., Tabone, E., Rey, C., Gasnier, F., Dacheux, F., and Benahmed, M. (2001). Leukemia inhibitory factor antagonizes gonadotropin induced- testosterone synthesis in cultured porcine leydig cells: sites of action. Endocrinology 142, 2509-2520.

Mazaira, G.I., Zgajnar, N.R., Lotufo, C.M., Daneri-Becerra, C., Sivils, J.C., Soto, O.B., Cox, M.B., and Galigniana, M.D. (2018). The Nuclear Receptor Field: A Historical Overview and Future Challenges. Nucl Receptor Res 5. 10.11131/2018/101320.

McKenna, N.J., Lanz, R.B., and O'Malley, B.W. (1999). Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20, 321-344.

Mendis-Handagama, S.M., and Ariyaratne, H.B. (2001). Differentiation of the adult Leydig cell population in the postnatal testis. Biol Reprod 65, 660-671.

216

Mendoza-Villarroel, R.E., Di-Luoffo, M., Camire, E., Giner, X.C., Brousseau, C., and Tremblay, J.J. (2014a). The INSL3 gene is a direct target for the orphan nuclear receptor, COUP-TFII, in Leydig cells. J Mol Endocrinol 53, 43-55.

Mendoza-Villarroel, R.E., Robert, N.M., Martin, L.J., Brousseau, C., and Tremblay, J.J. (2014b). The nuclear receptor NR2F2 activates star expression and steroidogenesis in mouse MA-10 and MLTC-1 Leydig cells. Biol Reprod 91, 26.

Menon, K.M., and Menon, B. (2012). Structure, function and regulation of gonadotropin receptors - a perspective. Mol Cell Endocrinol 356, 88-97.

Mishina, Y., Rey, R., Finegold, M.J., Matzuk, M.M., Josso, N., Cate, R.L., and Behringer, R.R. (1996). Genetic analysis of the Mullerian-inhibiting substance signal transduction pathway in mammalian sexual differentiation. Genes Dev 10, 2577-2587.

Miyabayashi, K., Katoh-Fukui, Y., Ogawa, H., Baba, T., Shima, Y., Sugiyama, N., Kitamura, K., and Morohashi, K. (2013). Aristaless related homeobox gene, Arx, is implicated in mouse fetal Leydig cell differentiation possibly through expressing in the progenitor cells. PloS one 8, e68050. 10.1371/journal.pone.0068050.

Miyajima, N., Kadowaki, Y., Fukushige, S., Shimizu, S., Semba, K., Yamanashi, Y., Matsubara, K., Toyoshima, K., and Yamamoto, T. (1988). Identification of two novel members of erbA superfamily by molecular cloning: the gene products of the two are highly related to each other. Nucleic Acids Res 16, 11057-11074.

Moger, W.H. (1991). Evidence for compartmentalization of adenosine 3',5'-monophosphate (cAMP)-dependent protein kinases in rat Leydig cells using site-selective cAMP analogs. Endocrinology 128, 1414-1418.

Mukherjee, S., Palczewski, K., Gurevich, V., Benovic, J.L., Banga, J.P., and Hunzicker- Dunn, M. (1999). A direct role for arrestins in desensitization of the luteinizing hormone/choriogonadotropin receptor in porcine ovarian follicular membranes. Proc Natl Acad Sci U S A 96, 493-498.

217

Mullican, S.E., Dispirito, J.R., and Lazar, M.A. (2013). The orphan nuclear receptors at their 25-year reunion. J Mol Endocrinol 51, T115-140.

Munoz-Tello, P., Lin, H., Khan, P., de Vera, I.M.S., Kamenecka, T.M., and Kojetin, D.J. (2020). Assessment of NR4A Ligands That Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1. J Med Chem 63, 15639-15654.

Murata, A., Sekiya, K., Watanabe, Y., Yamaguchi, F., Hatano, N., Izumori, K., and Tokuda, M. (2003). A novel inhibitory effect of D-allose on production of reactive oxygen species from neutrophils. J Biosci Bioeng 96, 89-91.

Murphy, E.P., Dobson, A.D., Keller, C., and Conneely, O.M. (1996). Differential regulation of transcription by the NURR1/NUR77 subfamily of nuclear transcription factors. Gene Expr 5, 169-179.

Murphy, L., Jeffcoate, I.A., and O'Shaughnessy, P.J. (1994). Abnormal Leydig cell development at puberty in the androgen-resistant Tfm mouse. Endocrinology 135, 1372- 1377.

Nedumaran, B., Kim, G.S., Hong, S., Yoon, Y.S., Kim, Y.H., Lee, C.H., Lee, Y.C., Koo, S.H., and Choi, H.S. (2010). Orphan nuclear receptor DAX-1 acts as a novel corepressor of liver X receptor alpha and inhibits hepatic lipogenesis. J Biol Chem 285, 9221-9232.

Neocleous, V., Fanis, P., Cinarli, F., Kokotsis, V., Oulas, A., Toumba, M., Spyrou, G.M., Phylactou, L.A., and Skordis, N. (2019). 46,XY complete gonadal dysgenesis in a familial case with a rare mutation in the desert hedgehog (DHH) gene. Hormones 18, 315-320.

Nguyen, T.M. (2017). Impact of 5'-amp-activated Protein Kinase on Male Gonad and Spermatozoa Functions. Front Cell Dev Biol 5, 25.

Nikula, H., Koskimies, P., El-Hefnawy, T., and Huhtaniemi, I. (2001). Functional characterization of the basal promoter of the murine LH receptor gene in immortalized mouse Leydig tumor cells. J Mol Endocrinol 26, 21-29.

Nuclear Receptors Nomenclature, C. (1999). A unified nomenclature system for the nuclear receptor superfamily. Cell 97, 161-163.

218

O'Shaughnessy, P.J., Baker, P., Sohnius, U., Haavisto, A.M., Charlton, H.M., and Huhtaniemi, I. (1998). Fetal development of Leydig cell activity in the mouse is independent of pituitary gonadotroph function. Endocrinology 139, 1141-1146.

O'Shaughnessy, P.J., Baker, P.J., Heikkila, M., Vainio, S., and McMahon, A.P. (2000). Localization of 17beta-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis--androstenedione is the major androgen secreted by fetal/neonatal leydig cells. Endocrinology 141, 2631-2637.

O’Shaughnessy, P.J., Mitchell, R.T., Monteiro, A., O’Hara, L., Cruickshanks, L., der Grinten, H.C.-v., Brown, P., Abel, M., and Smith, L.B. (2019). Androgen receptor expression is required to ensure development of adult Leydig cells and to prevent development of steroidogenic cells with adrenal characteristics in the mouse testis. BMC Dev Biol 19, 8.

Olivares, A.M., Moreno-Ramos, O.A., and Haider, N.B. (2015). Role of Nuclear Receptors in Central Nervous System Development and Associated Diseases. J Exp Neurosci 9, 93- 121.

Padua, M.B., Jiang, T., Morse, D.A., Fox, S.C., Hatch, H.M., and Tevosian, S.G. (2015). Combined loss of the GATA4 and GATA6 transcription factors in male mice disrupts testicular development and confers adrenal-like function in the testes. Endocrinology 156, 1873-1886.

Pallotti, F., Pelloni, M., Gianfrilli, D., Lenzi, A., Lombardo, F., and Paoli, D. (2020). Mechanisms of Testicular Disruption from Exposure to Bisphenol A and Phtalates. J Clin Med 9.

Pandey, A.V., and Miller, W.L. (2005). Regulation of 17,20 lyase activity by cytochrome b5 and by serine phosphorylation of P450c17. J Biol Chem 280, 13265-13271.

Pangas, S.A., Li, X., Umans, L., Zwijsen, A., Huylebroeck, D., Gutierrez, C., Wang, D., Martin, J.F., Jamin, S.P., Behringer, R.R., et al. (2008). Conditional deletion of Smad1 and Smad5 in somatic cells of male and female gonads leads to metastatic tumor development in mice. Mol Cell Biol 28, 248-257.

219

Paris, F., Flatters, D., Caburet, S., Legois, B., Servant, N., Lefebvre, H., Sultan, C., and Veitia, R.A. (2017). A novel variant of DHH in a familial case of 46,XY disorder of sex development: Insights from molecular dynamics simulations. Clin Endocrinol (Oxf) 87, 539- 544.

Park, E., Song, C.H., Park, J.I., Ahn, R.S., Choi, H.S., Ko, C., and Lee, K. (2014). Transforming growth factor-beta1 signaling represses testicular steroidogenesis through cross-talk with orphan nuclear receptor Nur77. PloS one 9, e104812. 10.1371/journal.pone.0104812.

Park, J.I., Tsai, S.Y., and Tsai, M.J. (2003). Molecular mechanism of chicken ovalbumin upstream promoter-transcription factor (COUP-TF) actions. Keio J Med 52, 174-181.

Park, S.Y., Meeks, J.J., Raverot, G., Pfaff, L.E., Weiss, J., Hammer, G.D., and Jameson, J.L. (2005). Nuclear receptors Sf1 and Dax1 function cooperatively to mediate somatic cell differentiation during testis development. Development 132, 2415-2423.

Pastorcic, M., Wang, H., Elbrecht, A., Tsai, S.Y., Tsai, M.J., and O'Malley, B.W. (1986). Control of transcription initiation in vitro requires binding of a transcription factor to the distal promoter of the ovalbumin gene. Mol Cell Biol 6, 2784-2791.

Patel, S.R., and Skafar, D.F. (2015). Modulation of nuclear receptor activity by the F domain. Mol Cell Endocrinol 418 Pt 3, 298-305.

Pawlak, M., Lefebvre, P., and Staels, B. (2012). General molecular biology and architecture of nuclear receptors. Curr Top Med Chem 12, 486-504.

Pereira, F.A., Qiu, Y., Zhou, G., Tsai, M.J., and Tsai, S.Y. (1999). The orphan nuclear receptor COUP-TFII is required for angiogenesis and heart development. Genes Dev 13, 1037-1049.

Perilhou, A., Tourrel-Cuzin, C., Kharroubi, I., Henique, C., Fauveau, V., Kitamura, T., Magnan, C., Postic, C., Prip-Buus, C., and Vasseur-Cognet, M. (2008). The transcription factor COUP-TFII is negatively regulated by insulin and glucose via Foxo1- and ChREBP- controlled pathways. Mol Cell Biol 28, 6568-6579.

220

Petit, F.G., Salas, R., Tsai, M.J., and Tsai, S.Y. (2004). The regulation of COUP-TFII gene expression by Ets-1 is enhanced by the steroid receptor co-activators. Mech Ageing Dev 125, 719-732.

Picard, J.Y., Cate, R.L., Racine, C., and Josso, N. (2017). The Persistent Mullerian Duct Syndrome: An Update Based Upon a Personal Experience of 157 Cases. Sex Dev 11, 109- 125.

Piccolo, S., Dupont, S., and Cordenonsi, M. (2014). The biology of YAP/TAZ: hippo signaling and beyond. Physiol Rev 94, 1287-1312.

Pierce, J.G., and Parsons, T.F. (1981). Glycoprotein hormones: structure and function. Annu Rev Biochem 50, 465-495.

Pierre, A., Estienne, A., Racine, C., Picard, J.Y., Fanchin, R., Lahoz, B., Alabart, J.L., Folch, J., Jarrier, P., Fabre, S., et al. (2016). The Bone Morphogenetic Protein 15 Up-Regulates the Anti-Mullerian Hormone Receptor Expression in Granulosa Cells. J Clin Endocrinol Metab 101, 2602-2611.

Pierre, S., Eschenhagen, T., Geisslinger, G., and Scholich, K. (2009). Capturing adenylyl cyclases as potential drug targets. Nat Rev Drug Discov 8, 321-335.

Pipaon, C., Tsai, S.Y., and Tsai, M.J. (1999). COUP-TF upregulates NGFI-A gene expression through an Sp1 binding site. Mol Cell Biol 19, 2734-2745.

Plant, T.M., and Marshall, G.R. (2001). The functional significance of FSH in spermatogenesis and the control of its secretion in male primates. Endocr Rev 22, 764-786.

Polvani, S., Pepe, S., Milani, S., and Galli, A. (2019). COUP-TFII in Health and Disease. Cells 9. 10.3390/cells9010101.

Prole, D.L., and Taylor, C.W. (2019). Structure and Function of IP3 Receptors. Cold Spring Harb Perspect Biol 11. 10.1101/cshperspect.a035063.

221

Qiao, X.H., Wang, Q., Wang, J., Liu, X.Y., Xu, Y.J., Huang, R.T., Xue, S., Li, Y.J., Zhang, M., Qu, X.K., et al. (2018). A novel NR2F2 loss-of-function mutation predisposes to congenital heart defect. Eur J Med Genet 61, 197-203.

Qin, J., Tsai, M.J., and Tsai, S.Y. (2008). Essential roles of COUP-TFII in Leydig cell differentiation and male fertility. PloS one 3, e3285. 10.1371/journal.pone.0003285.

Qin, J., Tsai, S.Y., and Tsai, M.J. (2014). The critical roles of COUP-TFII in tumor progression and metastasis. Cell Biosci 4, 58. 10.1186/2045-3701-4-58.

Qiu, Y., Krishnan, V., Pereira, F.A., Tsai, S.Y., and Tsai, M.J. (1996). Chicken ovalbumin upstream promoter-transcription factors and their regulation. J Steroid Biochem Mol Biol 56, 81-85.

Racine, C., Rey, R., Forest, M.G., Louis, F., Ferre, A., Huhtaniemi, I., Josso, N., and di Clemente, N. (1998). Receptors for anti-mullerian hormone on Leydig cells are responsible for its effects on steroidogenesis and cell differentiation. Proc Natl Acad Sci U S A 95, 594- 599.

Rakoczy, J., Fernandez-Valverde, S.L., Glazov, E.A., Wainwright, E.N., Sato, T., Takada, S., Combes, A.N., Korbie, D.J., Miller, D., Grimmond, S.M., et al. (2013). MicroRNAs-140- 5p/140-3p modulate Leydig cell numbers in the developing mouse testis. Biol Reprod 88, 143.

Rastinejad, F., Huang, P., Chandra, V., and Khorasanizadeh, S. (2013). Understanding nuclear receptor form and function using structural biology. J Mol Endocrinol 51, T1-T21.

Rebois, R.V. (1982). Establishment of gonadotropin-responsive murine leydig tumor cell line. J Cell Biol 94, 70-76.

Rebourcet, D., Mackay, R., Darbey, A., Curley, M.K., Jorgensen, A., Frederiksen, H., Mitchell, R.T., O'Shaughnessy, P.J., Nef, S., and Smith, L.B. (2020). Ablation of the canonical testosterone production pathway via knockout of the steroidogenic enzyme HSD17B3, reveals a novel mechanism of testicular testosterone production. FASEB J 34, 10373-10386.

222

Rezanezhad, B., Borgquist, R., Willenheimer, R., and Elzanaty, S. (2019). The Association between Serum Testosterone and Risk Factors for Atherosclerosis. Curr Urol 13, 101-106.

Robert, N.M., Tremblay, J.J., and Viger, R.S. (2002). Friend of GATA (FOG)-1 and FOG-2 differentially repress the GATA-dependent activity of multiple gonadal promoters. Endocrinology 143, 3963-3973.

Robinson-Rechavi, M., Carpentier, A.S., Duffraisse, M., and Laudet, V. (2001). How many nuclear hormone receptors are there in the human genome? Trends Genet 17, 554-556.

Roosen-Runge, E.C., and Anderson, D. (1959). The development of the interstitial cells in the testis of the albino rat. Acta anatomica 37, 125-137.

Rosa, A., and Brivanlou, A.H. (2011). A regulatory circuitry comprised of miR-302 and the transcription factors OCT4 and NR2F2 regulates human embryonic stem cell differentiation. EMBO J 30, 237-248.

Rothschild, G., Sottas, C.M., Kissel, H., Agosti, V., Manova, K., Hardy, M.P., and Besmer, P. (2003). A role for kit receptor signaling in Leydig cell steroidogenesis. Biol Reprod 69, 925-932.

Rouiller-Fabre, V., Carmona, S., Merhi, R.A., Cate, R., Habert, R., and Vigier, B. (1998). Effect of anti-Mullerian hormone on Sertoli and Leydig cell functions in fetal and immature rats. Endocrinology 139, 1213-1220.

Sablin, E.P., Blind, R.D., Krylova, I.N., Ingraham, J.G., Cai, F., Williams, J.D., Fletterick, R.J., and Ingraham, H.A. (2009). Structure of SF-1 bound by different phospholipids: evidence for regulatory ligands. Mol Endocrinol 23, 25-34.

Sagami, I., Tsai, S.Y., Wang, H., Tsai, M.J., and O'Malley, B.W. (1986). Identification of two factors required for transcription of the ovalbumin gene. Mol Cell Biol 6, 4259-4267.

Salam, R., Kshetrimayum, A.S., and Keisam, R. (2012). Testosterone and metabolic syndrome: The link. Indian J Endocrinol Metab 16 Suppl 1, S12-19.

223

Satoh, H., Nagae, Y., Immenschuh, S., Satoh, T., and Muller-Eberhard, U. (1994). Identification of a liver preference enhancer element of the rat hemopexin gene and its interaction with nuclear factors. J Biol Chem 269, 6851-6858.

Schoorlemmer, J., van Puijenbroek, A., van Den Eijnden, M., Jonk, L., Pals, C., and Kruijer, W. (1994). Characterization of a negative retinoic acid response element in the murine Oct4 promoter. Mol Cell Biol 14, 1122-1136.

Schrade, A., Kyronlahti, A., Akinrinade, O., Pihlajoki, M., Hakkinen, M., Fischer, S., Alastalo, T.P., Velagapudi, V., Toppari, J., Wilson, D.B., et al. (2015). GATA4 is a key regulator of steroidogenesis and glycolysis in mouse Leydig cells. Endocrinology 156, 1860- 1872.

Seldeen, K.L., McDonald, C.B., Deegan, B.J., Bhat, V., and Farooq, A. (2009). DNA plasticity is a key determinant of the energetics of binding of Jun-Fos heterodimeric transcription factor to genetic variants of TGACGTCA motif. Biochemistry 48, 12213- 12222.

Sever, R., and Glass, C.K. (2013). Signaling by nuclear receptors. Cold Spring Harb Perspect Biol 5, a016709.

Shan, L.X., Phillips, D.M., Bardin, C.W., and Hardy, M.P. (1993). Differential regulation of steroidogenic enzymes during differentiation optimizes testosterone production by adult rat Leydig cells. Endocrinology 133, 2277-2283.

Sharpe, R.M., and Skakkebaek, N.E. (2008). Testicular dysgenesis syndrome: mechanistic insights and potential new downstream effects. Fertil Steril 89, e33-38.

Shen, Y.-c., Larose, H., Shami, A.N., Moritz, L., Manske, G.L., Ma, Q., Zheng, X., Sukhwani, M., Czerwinski, M., Sultan, C., et al. (2020). Tcf21+ mesenchymal cells contribute to testis somatic cell development, homeostasis, and regeneration. bioRxiv, 10.1101/2020.05.02.074518.

Schnabel C.A., Selleri L., and Cleary M.L. (2003). Pbx1 is essential for adrenal development and urogenital differentiation. Genesis 37, 123-130.

224

Schwarzenbach, H., Chakrabarti, G., Paust, H.J., and Mukhopadhyay, A.K. (2004). Gonadotropin-mediated regulation of the murine VEGF expression in MA-10 Leydig cells. J Androl 25, 128-139.

Sherratt, P.J., and Hayes, J.D. (2001). Glutathione S-transferases. In Enzyme Systems that Metabolise Drugs and Other Xenobiotics, C. Ioannides, ed. (John Wiley & Sons), pp. 319- 352.

Shima, Y., Miyabayashi, K., Baba, T., Otake, H., Katsura, Y., Oka, S., Zubair, M., and Morohashi, K. (2012). Identification of an enhancer in the Ad4BP/SF-1 gene specific for fetal Leydig cells. Endocrinology 153, 417-425.

Shima, Y., Miyabayashi, K., Sato, T., Suyama, M., Ohkawa, Y., Doi, M., Okamura, H., and Suzuki, K. (2018). Fetal Leydig cells dedifferentiate and serve as adult Leydig stem cells. Development 145.

Shimizu-Albergine, M., Tsai, L.C., Patrucco, E., and Beavo, J.A. (2012). cAMP-specific phosphodiesterases 8A and 8B, essential regulators of Leydig cell steroidogenesis. Mol Pharmacol 81, 556-566.

Shimizu-Albergine, M., Van Yserloo, B., Golkowski, M.G., Ong, S.E., Beavo, J.A., and Bornfeldt, K.E. (2016). SCAP/SREBP pathway is required for the full steroidogenic response to cyclic AMP. Proc Natl Acad Sci U S A 113, E5685-5693.

Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., Soding, J., et al. (2011). Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 7, 539.

Skene, P.J., and Henikoff, S. (2017). An efficient targeted nuclease strategy for high- resolution mapping of DNA binding sites. Elife 6. 10.7554/eLife.21856.

Skene, P.J., Henikoff, J.G., and Henikoff, S. (2018). Targeted in situ genome-wide profiling with high efficiency for low cell numbers. Nat Protoc 13, 1006-1019.

225

Sklavos, M.M., Zhou, C.K., Pinto, L.A., and Cook, M.B. (2014). Prediagnostic circulating anti-Mullerian hormone concentrations are not associated with prostate cancer risk. Cancer Epidemiol Biomarkers Prev 23, 2597-2602.

Sladek, F.M. (2011). What are nuclear receptor ligands? Mol Cell Endocrinol 334, 3-13.

Smith, L.B., and Walker, W.H. (2014). The regulation of spermatogenesis by androgens. Semin Cell Dev Biol 30, 2-13.

Soderlund, M.B., Sjoberg, A., Svard, G., Fex, G., and Nilsson-Ehle, P. (2002). Biological variation of retinoids in man. Scand J Clin Lab Invest 62, 511-519.

Stanley, E.L., Johnston, D.S., Fan, J., Papadopoulos, V., Chen, H., Ge, R.S., Zirkin, B.R., and Jelinsky, S.A. (2011). Stem Leydig cell differentiation: gene expression during development of the adult rat population of Leydig cells. Biol Reprod 85, 1161-1166.

Stevant, I., Neirijnck, Y., Borel, C., Escoffier, J., Smith, L.B., Antonarakis, S.E., Dermitzakis, E.T., and Nef, S. (2018). Deciphering Cell Lineage Specification during Male Sex Determination with Single-Cell RNA Sequencing. Cell Rep 22, 1589-1599.

Stewart, T.A., and Davis, F.M. (2019). An element for development: Calcium signaling in mammalian reproduction and development. Biochim Biophys Acta Mol Cell Res 1866, 1230-1238.

Sutherland, E.W., and Rall, T.W. (1958). Fractionation and characterization of a cyclic adenine ribonucleotide formed by tissue particles. J Biol Chem 232, 1077-1091.

Svechnikov, K., Landreh, L., Weisser, J., Izzo, G., Colon, E., Svechnikova, I., and Soder, O. (2010). Origin, development and regulation of human Leydig cells. Horm Res Paediatr 73, 93-101.

Svingen, T., and Koopman, P. (2013). Building the mammalian testis: origins, differentiation, and assembly of the component cell populations. Genes Dev 27, 2409-2426.

226

Tang, K., Lin, F.J., Tsai, S.Y., and Tsai, M.J. (2006). Role of chicken ovalbumin upstream promoter‐transcription factor I in the development of nervous system. In Advances in Developmental Biology (Elsevier), pp. 297-312.

Teerds, K.J., and Huhtaniemi, I.T. (2015). Morphological and functional maturation of Leydig cells: from rodent models to primates. Hum Reprod Update 21, 310-328.

Teixeira, J., Kehas, D.J., Antun, R., and Donahoe, P.K. (1999). Transcriptional regulation of the rat Mullerian inhibiting substance type II receptor in rodent Leydig cells. Proc Natl Acad Sci U S A 96, 13831-13838.

Themmen, A.P.N., and Huhtaniemi, I.T. (2000). Mutations of gonadotropins and gonadotropin receptors: elucidating the physiology and pathophysiology of pituitary-gonadal function. Endocr Rev 21, 551-583.

Tian, X., Kang, D.S., and Benovic, J.L. (2014). beta-arrestins and G protein-coupled receptor trafficking. Handb Exp Pharmacol 219, 173-186.

Tornari, C., Towers, E.R., Gale, J.E., and Dawson, S.J. (2014). Regulation of the orphan nuclear receptor Nr2f2 by the DFNA15 deafness gene Pou4f3. PloS one 9, e112247. 10.1371/journal.pone.0112247.

Travison, T.G., Araujo, A.B., O'Donnell, A.B., Kupelian, V., and McKinlay, J.B. (2007). A population-level decline in serum testosterone levels in American men. J Clin Endocrinol Metab 92, 196-202.

Tremblay, J.J. (2015). Molecular regulation of steroidogenesis in endocrine Leydig cells. Steroids 103, 3–10.

Tremblay, M., Sanchez-Ferras, O., and Bouchard, M. (2018). GATA transcription factors in development and disease. Development 145, 20.

Tsai-Morris, C.H., Buczko, E., Wang, W., and Dufau, M.L. (1990). Intronic nature of the rat luteinizing hormone receptor gene defines a soluble receptor subspecies with hormone binding activity. J Biol Chem 265, 19385-19388.

227

Tsai, S.Y., Sagami, I., Wang, H., Tsai, M.J., and O'Malley, B.W. (1987). Interactions between a DNA-binding transcription factor (COUP) and a non-DNA binding factor (S300- II). Cell 50, 701-709.

Tsai, S.Y., and Tsai, M.J. (1997). Chick ovalbumin upstream promoter-transcription factors (COUP-TFs): coming of age. Endocr Rev 18, 229-240.

Ueda, H., Sun, G.C., Murata, T., and Hirose, S. (1992). A novel DNA-binding motif abuts the zinc finger domain of insect nuclear hormone receptor FTZ-F1 and mouse embryonal long terminal repeat-binding protein. Mol Cell Biol 12, 5667-5672.

UniProt, C. (2021). UniProt: the universal protein knowledgebase in 2021. Nucleic acids research 49, D480-D489.

Upadia, J., Gonzales, P.R., and Robin, N.H. (2018). Novel de novo pathogenic variant in the NR2F2 gene in a boy with congenital heart defect and dysmorphic features. Am J Med Genet A 176, 1423-1426.

Valdes-Socin, H., Salvi, R., Daly, A.F., Gaillard, R.C., Quatresooz, P., Tebeu, P.M., Pralong, F.P., and Beckers, A. (2004). Hypogonadism in a patient with a mutation in the luteinizing hormone beta-subunit gene. N Engl J Med 351, 2619-2625. van den Driesche, S., Walker, M., McKinnell, C., Scott, H.M., Eddie, S.L., Mitchell, R.T., Seckl, J.R., Drake, A.J., Smith, L.B., Anderson, R.A., et al. (2012). Proposed role for COUP- TFII in regulating fetal Leydig cell steroidogenesis, perturbation of which leads to masculinization disorders in rodents. PloS one 7, e37064. 10.1371/journal.pone.0037064.

Varelas, X. (2014). The Hippo pathway effectors TAZ and YAP in development, homeostasis and disease. Development 141, 1614-1626.

Venkatesh, T., Suresh, P.S., and Tsutsumi, R. (2014). New insights into the genetic basis of infertility. Appl Clin Genet 7, 235-243.

228

Verdiesen, R.M.G., van Gils, C.H., van der Schouw, Y.T., and Onland-Moret, N.C. (2020). Anti-Mullerian hormone levels and risk of cancer: A systematic review. Maturitas 135, 53- 67.

Vigen, R., O'Donnell, C.I., Baron, A.E., Grunwald, G.K., Maddox, T.M., Bradley, S.M., Barqawi, A., Woning, G., Wierman, M.E., Plomondon, M.E., et al. (2013). Association of testosterone therapy with mortality, myocardial infarction, and stroke in men with low testosterone levels. JAMA 310, 1829-1836.

Viger, R.S., Mertineit, C., Trasler, J.M., and Nemer, M. (1998). Transcription factor GATA- 4 is expressed in a sexually dimorphic pattern during mouse gonadal development and is a potent activator of the Mullerian inhibiting substance promoter. Development 125, 2665- 2675.

Vilardaga, J.P., Agnati, L.F., Fuxe, K., and Ciruela, F. (2010). G-protein-coupled receptor heteromer dynamics. J Cell Sci 123, 4215-4220.

Villard, J. (2004). Transcription regulation and human diseases. Swiss Med Wkly 134, 571- 579.

VuHai-LuuThi, M.T., Misrahi, M., Houllier, A., Jolivet, A., and Milgrom, E. (1992). Variant forms of the pig lutropin/choriogonadotropin receptor. Biochemistry 31, 8377-8383.

Wagner, S.A., Beli, P., Weinert, B.T., Nielsen, M.L., Cox, J., Mann, M., and Choudhary, C. (2011). A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. Mol Cell Proteomics 10, M111 013284.

Wang, J., Abhinav, P., Xu, Y.J., Li, R.G., Zhang, M., Qiu, X.B., Di, R.M., Qiao, Q., Li, X.M., Huang, R.T., et al. (2019). NR2F2 lossoffunction mutation is responsible for congenital bicuspid aortic valve. Int J Mol Med 43, 1839-1846.

Wang, L., Cheng, C.M., Qin, J., Xu, M., Kao, C.Y., Shi, J., You, E., Gong, W., Rosa, L.P., Chase, P., et al. (2020). Small-molecule inhibitor targeting orphan nuclear receptor COUP- TFII for prostate cancer treatment. Sci Adv 6, eaaz8031. 10.1126/sciadv.aaz8031.

229

Wang, L.H., Ing, N.H., Tsai, S.Y., O'Malley, B.W., and Tsai, M.J. (1991). The COUP-TFs compose a family of functionally related transcription factors. Gene Expr 1, 207-216.

Wang, L.H., Tsai, S.Y., Sagami, I., Tsai, M.J., and O'Malley, B.W. (1987). Purification and characterization of chicken ovalbumin upstream promoter transcription factor from HeLa cells. J Biol Chem 262, 16080-16086.

Wang, Z., Benoit, G., Liu, J., Prasad, S., Aarnisalo, P., Liu, X., Xu, H., Walker, N.P., and Perlmann, T. (2003). Structure and function of Nurr1 identifies a class of ligand-independent nuclear receptors. Nature 423, 555-560.

Warnecke, M., Oster, H., Revelli, J.P., Alvarez-Bolado, G., and Eichele, G. (2005). Abnormal development of the locus coeruleus in Ear2(Nr2f6)-deficient mice impairs the functionality of the forebrain clock and affects nociception. Genes Dev 19, 614-625.

Wattenberg, L.W. (1958). Microscopic histochemical demonstration of steroid-3 beta-ol dehydrogenase in tissue sections. J Histochem Cytochem 6, 225-232.

Weikum, E.R., Liu, X., and Ortlund, E.A. (2018). The nuclear receptor superfamily: A structural perspective. Protein Sci 27, 1876-1892.

Wen, Q., Cheng, C.Y., and Liu, Y.X. (2016). Development, function and fate of fetal Leydig cells. Semin Cell Dev Biol 59, 89-98.

Wen, Q., Liu, Y., and Gao, F. (2011). Fate determination of fetal Leydig cells. Front Biol 6, 12-18.

Wen, Q., Zheng, Q.S., Li, X.X., Hu, Z.Y., Gao, F., Cheng, C.Y., and Liu, Y.X. (2014). Wt1 dictates the fate of fetal and adult Leydig cells during development in the mouse testis. Am J Physiol Endocrinol Metab 307, E1131-1143.

Werner, R., Merz, H., Birnbaum, W., Marshall, L., Schroder, T., Reiz, B., Kavran, J.M., Baumer, T., Capetian, P., and Hiort, O. (2015). 46,XY Gonadal Dysgenesis due to a Homozygous Mutation in Desert Hedgehog (DHH) Identified by Exome Sequencing. J Clin Endocrinol Metab 100, E1022-1029.

230

Wrana, J.L., Attisano, L., Wieser, R., Ventura, F., and Massague, J. (1994). Mechanism of activation of the TGF-beta receptor. Nature 370, 341-347.

Wu, X., Arumugam, R., Baker, S.P., and Lee, M.M. (2005). Pubertal and adult Leydig cell function in Mullerian inhibiting substance-deficient mice. Endocrinology 146, 589-595.

Wu, X., Zhang, N., and Lee, M.M. (2012). Mullerian inhibiting substance recruits ALK3 to regulate Leydig cell differentiation. Endocrinology 153, 4929-4937.

Xu, W., Zhu, Q., Liu, S., Dai, X., Zhang, B., Gao, C., Gao, L., Liu, J., and Cui, Y. (2018). Calretinin Participates in Regulating Steroidogenesis by PLC-Ca(2+)-PKC Pathway in Leydig Cells. Sci Rep 8, 7403.

Xu, Z., Yu, S., Hsu, C.H., Eguchi, J., and Rosen, E.D. (2008). The orphan nuclear receptor chicken ovalbumin upstream promoter-transcription factor II is a critical regulator of adipogenesis. Proc Natl Acad Sci U S A 105, 2421-2426.

Yamazaki, T., Suehiro, J., Miyazaki, H., Minami, T., Kodama, T., Miyazono, K., and Watabe, T. (2013). The COUP-TFII variant lacking a DNA-binding domain inhibits the activation of the Cyp7a1 promoter through physical interaction with COUP-TFII. Biochem J 452, 345-357.

Yang, X., Feng, S., and Tang, K. (2017a). COUP-TF Genes, Human Diseases, and the Development of the Central Nervous System in Murine Models. Curr Top Dev Biol 125, 275-301.

Yang, Y., Li, Z., Wu, X., Chen, H., Xu, W., Xiang, Q., Zhang, Q., Chen, J., Ge, R.S., Su, Z., et al. (2017b). Direct Reprogramming of Mouse Fibroblasts toward Leydig-like Cells by Defined Factors. Stem Cell Rep 8, 39-53.

Yang, Y., Luo, J., Yu, D., Zhang, T., Lin, Q., Li, Q., Wu, X., Su, Z., Zhang, Q., Xiang, Q., et al. (2018). Vitamin A Promotes Leydig Cell Differentiation via Alcohol Dehydrogenase 1. Front Endocrinol 9, 644. 10.3389/fendo.2018.00644.

Yao, H.H., Whoriskey, W., and Capel, B. (2002). Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes Dev 16, 1433-1440.

231

Ye, L., Li, X., Li, L., Chen, H., and Ge, R.S. (2017). Insights into the Development of the Adult Leydig Cell Lineage from Stem Leydig Cells. Front Physiol 8, 430.

Yella, V.R., Bhimsaria, D., Ghoshdastidar, D., Rodriguez-Martinez, J.A., Ansari, A.Z., and Bansal, M. (2018). Flexibility and structure of flanking DNA impact transcription factor affinity for its core motif. Nucleic Acids Res 46, 11883-11897.

Yun, S.H., and Park, J.I. (2020). Recent progress on the role and molecular mechanism of chicken ovalbumin upstream promoter-transcription factor II in cancer. J Int Med Res 48, 300060520919236.

Zechel, C. (2005). The germ cell nuclear factor (GCNF). Mol Reprod Dev 72, 550-556.

Zhang, F.P., Pakarainen, T., Zhu, F., Poutanen, M., and Huhtaniemi, I. (2004). Molecular characterization of postnatal development of testicular steroidogenesis in luteinizing hormone receptor knockout mice. Endocrinology 145, 1453-1463.

Zhang, F.P., Poutanen, M., Wilbertz, J., and Huhtaniemi, I. (2001). Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout (LuRKO) mice. Mol Endocrinol 15, 172-183.

Zhang, L., Chen, M., Wen, Q., Li, Y., Wang, Y., Wang, Y., Qin, Y., Cui, X., Yang, L., Huff, V., et al. (2015). Reprogramming of Sertoli cells to fetal-like Leydig cells by Wt1 ablation. Proc Natl Acad Sci U S A 112, 4003-4008.

Zhang, Y., and Dufau, M.L. (2003). Dual mechanisms of regulation of transcription of luteinizing hormone receptor gene by nuclear orphan receptors and histone deacetylase complexes. J Steroid Biochem Mol Biol 85, 401-414.

Zhao, F., Franco, H.L., Rodriguez, K.F., Brown, P.R., Tsai, M.J., Tsai, S.Y., and Yao, H.H. (2017). Elimination of the male reproductive tract in the female embryo is promoted by COUP-TFII in mice. Science 357, 717-720.

232

Zheng, W., Grafer, C.M., Kim, J., and Halvorson, L.M. (2015). Gonadotropin-releasing hormone and gonadal steroids regulate transcription factor mRNA expression in primary pituitary and immortalized gonadotrope cells. Reprod Sci 22, 285-299.

Zheng, W., Horton, C.D., Kim, J., and Halvorson, L.M. (2010). The orphan nuclear receptors COUP-TFI and COUP-TFII regulate expression of the gonadotropin LHbeta gene. Mol Cell Endocrinol 330, 59-71.

Zirkin, B.R., and Papadopoulos, V. (2018). Leydig cells: formation, function, and regulation. Biol Reprod 99, 101-111.

233

Appendix A

Generation of gene-edited MA-10 cells

Figure A1. COUP-TFII depletion in MA-10 Leydig cell line using CRISPR/Cas9 gene editing techniques. (A) Schematic representation showing three exons coding for COUP-TFII (414 amino acids). Exon 2 was targeted using RNA guides (sequences not listed) inducing breaks in DNA. The guides expected to cause mutations in the translated protein between residues 166 to 199. (B) Western blot images demonstrating a reduction in COUP-TFII protein levels in two Coup-tfii gene-edited cell lines (∆Coup-tfii-03 and ∆Coup-tfii-04). Protein extraction and forskolin (FSK) stimulation were performed as previously described (Mehanovic et al., 2019; Mendoza-Villarroel et al., 2014b). wt, wild type; ∆Coup-tfii-XX PXX, -indicates cell line #, P passage #; marker, protein marker; DMSO, vehicle; LMNB1, LAMIN B; (C) Results from RT-qPCR which were performed using the same conditions as previously described (Mehanovic et al., 2019).

234