J Am Soc Nephrol 14: 680–689, 2003 OFD1, the Gene Mutated in Oral-Facial-Digital Syndrome Type 1, Is Expressed in the Metanephros and in Human Embryonic Renal Mesenchymal Cells

LEILA ROMIO,*† VICTORIA WRIGHT,† KAREN PRICE,* PAUL J. D. WINYARD,* DIAN DONNAI,‡ MARY E. PORTEOUS,§ BRUNELLA FRANCO,¶ GIOVANNA GIORGIO,¶ SUE MALCOLM,† ADRIAN S. WOOLF,* and SALLY A. FEATHER*† *Nephro-Urology and †Clinical and Molecular Genetics Units, Institute of Child Health, University College London, England; ‡University Department of Medical Genetics, St. Mary’s Hospital, Manchester, England; §Department of Clinical Genetics, Western General Hospital, Edinburgh, Scotland; and ¶Telethon Institute of Genetics and Medicine, Naples, Italy.

Abstract. Oral-facial-digital syndrome type 1 (OFD1) causes affected in the syndrome. A polyclonal antibody directed to a polycystic kidney disease (PKD) and malformations of the C-terminal OFD1a epitope detected a 120-kD protein in the mouth, face and digits. Recently, a gene on Xp22, OFD1, was metanephros and in human renal mesenchymal cell lines. In reported to be mutated in a limited set of OFD1 patients. This normal human embryos, OFD1a immunolocalized to the met- study describes mutation analysis in six further OFD1 families. anephric mesenchyme, oral mucosa, nasal and cranial carti- Additionally, gene expression was sought in human develop- lage, and brain. Moreover, using normal human renal mesen- ment. In two OFD1 kindreds affected by PKD, a frameshift chymal cell lines, the immunoreactive protein colocalized with mutation and a splice-site mutation were detected. In four ␥-tubulin, suggesting that OFD1 is associated with the centro- apparently sporadic cases, three frameshift and a missense some. First, it is concluded that OFD1 mutations would gen- mutation were found. Using RT-PCR of RNA from first- erally be predicted to result in unstable transcripts or nonfunc- trimester normal human embryos, both alternative splice forms tional proteins. Second, OFD1 is expressed in human of mRNA (OFD1a and OFD1b) were found to be widely organogenesis; on the basis of the metanephric expression expressed in organogenesis. Northern blot detected OFD1 pattern, the results suggest that OFD1 plays a role in differen- mRNA in metanephros, brain, tongue, and limb, all organs tiation of metanephric precursor cells.

Malformations of the face, oral cavity and digits characterize polycystic kidney disease (PKD) that often leads to end-stage the oral-facial-digital (OFD) syndromes (1,2). OFD1 renal failure in late childhood or adulthood (7–12). In fact, (MIM311200) is the most common, occurring in 1:250,000 OFD1 should be suspected when PKD occurs in females with births. Most cases appear to be sporadic, but others are inher- dysmorphic features or when PKD is transmitted from gener- ited in an X-linked dominant manner. Affected females have ation to generation–affecting only females. Limited histologic malformations of oral cavity (cleft palate, lip and tongue, studies suggest that glomerular cysts predominate (8,10). Brain abnormal dentition, hamartomas), face (hypertelorism and mil- malformations also occur (9,12), accompanied by learning ia), and digits (syndactyly, brachydactyly, polydactyly). Af- difficulties, as do pancreatic cysts (10). On the basis of this fected XY males almost invariably die before birth (3,4); the clinical spectrum, the gene mutated in OFD1 is anticipated to only OFD1 male reported to have prolonged postnatal survival have important roles in normal growth of diverse tissues, being XXY (5). When OFD1 was first delineated, renal disease including the kidney. was not considered to be characteristic (1,6). More recently, Feather et al. (13) mapped OFD1 to Xp22.2 to 22.3, and several OFD1 patients have been reported to have a form of Ferrante et al. (14) identified Cxorf5 (renamed OFD1; acces- sion number Y15164) as the mutated gene in seven kindreds. OFD1 has an open reading frame of 3033 bp over 23 exons Received July 17, 2002. Accepted December 4, 2002. (15). Due to the use of alternative 3' splice sites in intron 9, two Leila Romio and Victoria Wright contributed equally to the work. mRNA species, here designated OFD1a and OFD1b, are gen- Correspondence to Dr. Leila Romio, Clinical and Molecular Genetics Unit, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK. Phone: erated. Although the OFD1b transcript is the longer form, 44-20-7905-2263; Fax: 44-20-7916-0011; E-mail: [email protected] OFD1a has a longer translated region. The two putative OFD1 1046-6673/1403-0680 proteins have different C-termini; the larger form (here desig- Journal of the American Society of Nephrology nated ODF1a) is predicted to have 1011 amino acids (aa), Copyright © 2003 by the American Society of Nephrology whereas OFD1b has 367 aa. Although many OFD1 anomalies DOI: 10.1097/01.ASN.0000054497.48394.D2 are developmental aberrations, no published data exists on J Am Soc Nephrol 14: 680–689, 2003 OFD1 Expression 681

OFD1 expression in human development. We here describe penicillin G, and 1 g/L streptomycin. The day before transfection, further OFD1 mutations in six kindreds, including two families cells were plated at subconfluent density. They were incubated for 6 h with several members affected by PKD and report, for the first in serum-free medium containing 30 ␮l of Lipofectamine reagent ␮ time, an overview of OFD1 expression in human organogen- (Invitrogen) and 10 g of DNA per 10-cm-diameter plate. DNA used esis and subcellular localization in human embryonic renal cell were: (1) myc tag/enhanced green fluorescence protein (EGFP)/OFD1 in pcDNA3 vector (Invitrogen), with OFD1 cDNA corresponding to lines. the OFD1a open reading frame; (2) vector with the myc-EGFP construct only. Cells were analyzed at 36 h after transfection. To Materials and Methods produce renal mesenchymal lines, metanephroi were dissected from Chemicals were obtained from Sigma-Aldrich Chemical Company normal human embryos (two at 10, one at 11, and one at 12 wk (Poole, UK), unless otherwise stated. gestation), diced into five pieces, placed onto plastic tissue culture plates, and fed DMEM/Hams F12 medium (Invitrogen) supplemented Patient Identification and Collection of Samples with 5% FCS, epidermal growth factor (10 ␮g/L), hydrocortisone (36 ␮ Clinical details of two families with multiple members affected by g/L), 3,3',5-triiodo-L-thyronine sodium salt (4 ng/L), insulin/trans- OFD1 and associated PKD have been described (7,10). For mutation ferrin/selenium Sigma media supplement, and antibiotics. Outgrowths analyses, we used these families and four other kindreds who are were passaged, and monolayers were characterized at passages four- described in Results; all were assessed at Clinical Genetics centers eight (data not shown and reference 18). and patients were studied with renal ultrasonography (US). Fifteen terminated normal human fetuses were collected under research eth- RNA Analyses ical committee permission and were staged by external morphology For RT-PCR, RNA (500 ng), extracted from isolated organs with (16) as between 7 and 14 wk of gestation, spanning early organogen- Tri-reagent, was treated with deoxyribonuclease I and subjected to esis. Sections of mature kidney tissue were also examined from areas reverse transcription with Superscript II (Life Technologies BRL). ␮ ␮ that appeared histologically normal adjacent to three Wilms tumors, cDNA was diluted to a volume of 100 l, and 2 l was used as a removed at 28 to 72 mo of age. The metanephros forms in the sixth template with the following primers sets synthesized by MWG-Bio- week from the ureteric bud, which branches to form collecting ducts, tech AG: and the mesenchyme, which differentiates into S-shaped bodies and 1. OFD1 primer set 1: sense (5'TGAATTGAACCAGAAGCTCC3', glomeruli, the first of which form by eight weeks; this process exon 9/10) and antisense (5'CTCCTCTTGCAAATGAACAG3', reiterates until 34 wk. New nephrons are not formed after birth. exon 12) 2. OFD1 primer set 2: sense (5'ATGGTGTCTGCCTGGCTTTG-3', Mutation Detection exon 10a) and antisense (5'GACTGTTATCAGTGCAGGAG3', DNA was isolated from native or transformed leukocytes by stan- exon 10a) dard techniques, after obtaining written consent. PCR amplified the 3. hypoxanthine-guanine phosphoribosyltransferase (HPRT), a ‘house- entire OFD1a coding region (exons 1 to 23) including splice junctions keeping’ gene: sense (5'CCACGAAAGTGTTGGATATAAGC3') (14). Exon 10a, which confers the additional genetic information in and antisense (5'GGCGATGTCAATAGGACTCCAGATG-3') the OFD1b transcript, was not analyzed for mutations. PCR reactions All PCR reactions were performed in a volume of 50 ␮l, with 0.25 ␮ contained 30 ng genomic DNA, 2 mM MgCl2, 200 M dTTP, dGTP, units of HotStartTaq polymerase, 200 ␮M dNTPs, 2 mM MgCl , and ϫ ϫ 2 dCTP, dATP, 25 pmol of each primer, 1 PCR buffer, 1 Q 3 pmol of primers. PCR conditions were: 10 min at 94°C followed by solution, and 0.1 U of HotStartTaq DNA polymerase (Qiagen, Craw- 30 cycles of amplification (30 s at 94°C,30sat58°C, and 1 min at ␮ ley, UK) in 25 l final volume. Cycling parameters were: 94°C for 12 72°C) with final elongation of 5 min at 72°C. PCR products were min, 35 cycles of 94°C for 15 s, 55°C for 15 s, and 72°C for 25 s. PCR electrophoresed through 2% agarose gels containing ethidium bro- products from one proband and, where available, one unaffected mide and sequences of the PCR products confirmed using the ABI married-in member of each pedigree, were screened for sequence Prism Big Dye Terminator Cycle Sequencing kit and an ABI 377 changes by denaturing HPLC (dHPLC), using the WAVE DNA automated sequencer. OFD1 primer set 1 amplifies cDNA derived fragment analysis system (Transgenomic Inc, Crewe, UK). Column from both OFD1 cDNA isoforms to generate a 225-bp OFD1a band, temperatures and acetonitrile gradients were determined using Wave- and an 850-bp OFD1b band. In preliminary experiments, the former Maker v. 3.4.4 (Transgenomic Inc). Proband PCR products showing band was preferentially amplified in the PCR conditions used, while altered elution properties to controls were sequenced on both strands the product from OFD1b was barely visible. Therefore, we designed using ABI Big Dye Terminator Sequencing Kit and an ABI 377 a second set of OFD1 primers (primer set 2) on the region of 630 bp Sequencer (Perkin Elmer, Forster City, CA). Sequences were ana- in exon 10a unique to OFD1b cDNA. For Northern blot, 25 ␮g RNA lyzed using Sequence Analysis v. 3.4.1 (Perkin Elmer). Sequence was run on a formamide agarose gel and transferred to a Nylon changes in probands were then assessed to determine co-segregation membrane (Hybond Nϩ; Amersham Pharmacia Biotech, Bucking- with clinical disease. hamshire, UK). The membrane was hybridized with either the OFD1/ GFP cDNA, described above, or a 18S rRNA probe labeled with Cell Culture 32PdCTP by random priming, using the Megaprime DNA labeling Human embryonic kidney (HEK) 293 cells were transfected to system (Amersham Pharmacia Biotech). Hybridization was performed express full-length OFD1. This line was generated by adenoviral with Quikhybsolution (Stratagene, La Jolla, CA) at 68°C. X-ray films transformation of primary cultures, but it is uncertain what type of were exposed to filters for up to7datϪ70°C. metanephric cell, if any, it faithfully represents. Indeed, Shaw et al. (17) reported that they express neuronal proteins as well as cytoker- Protein Analyses atins. Cells were cultured in Dulbecco Modified Eagle Medium Whole OFD1 proteins were not available, so we selected an oli- (DMEM, Invitrogen) with 10% fetal calf serum (FCS), 1000 U/L gopeptide, CDVQKQIEEQKEEEKIREQQVKER (867 to 891 aa in 682 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 680–689, 2003

OFD1a), to generate antibodies in rabbits. Oligopeptide synthesis and For immunocytochemistry, mesenchymal cells were plated on four- production of antisera were undertaken by Sigma-Genosys (Cam- well Lab-Tek chamber slides (Nunc, Naperville, IL) at a density of bridge, UK). Bleeds from two animals were tested by ELISA against 50,000 per well, cultured overnight, then fixed for 10 min in methanol the immunizing peptide to ensure that antisera had high titer and at Ϫ20°C. After blocking for 1 h with 10% FCS in PBS, they were avidity. Both antisera gave similar results, and for simplicity in incubated overnight at 4°C with OFD1 antiserum (1:100), preimmune Results, we have not distinguished between results derived from serum or anti-serum preincubated with immunizing peptide. In some either. For Western blot, tissues were lysed in RIPA buffer with experiments, for double labeling, the cells were additionally incubated protease inhibitors (19). Protein concentration was quantified (BCA with mouse monoclonal ␥-tubulin antibody (1:50). The cells were kit; Pierce, Rockford, IL), and 50 ␮g was mixed with an equal volume washed three times in PBS and 0.1% Tween-20, and incubated for 1 h of sample buffer (1 ml glycerol, 0.5 ml mercaptoethanol, 3 ml 10% with donkey anti-rabbit FITC (1:100) or donkey anti-mouse Cy5 sodium dodecyl sulfate, 1.25 ml Tris, pH 6.7, and 1 mg of bromo- (1:500) secondary antibodies; the emission spectra for these fluoro- phenol blue), heated at 95°C for 5 min, and loaded onto SDS- chromes is non-overlapping. After immunocytochemistry, some slides polyacrylamide gels. After electrophoresis and transfer by electrob- were also incubated for 5 min with the nuclear marker propidium lotting, membranes were stained with Ponceau S to confirm equality iodide (4 mg/L). Fluorescence was visualized on a confocal laser of total protein transfer (data not shown). Blots were washed with scanning microscope (Leica Aristoplan, Heidleberg, Germany). deionized water, placed in blocking solution (5% nonfat milk, 0.1% Tween-20 in PBS) for 1 h, then incubated overnight at 4°C with primary antibodies directed against the following proteins: OFD1a Results antiserum (1:500); OFD1a antiserum (1:500) preincubated for2hat OFD1 Mutations room temperature with immunogenic peptide as a negative control; Mutations were defined in two OFD1 pedigrees affected by preimmune serum (1:500) as another negative control; WT1 (1:250; PKD, previously clinically described (7,10). Both families had Santa Cruz); PAX2 (1:500; Zymed); hepatocyte growth factor (HGF; been used to map the disease locus (13). In the first pedigree 1:200; R&D Systems); glial cell line-derived neurotrophic factor (see family 1 in Figure 1 of reference 13) an insertion of A in (GDNF; 1:200; R&D Systems). Appropriate horseradish peroxidase- exon 8 (702insA) was detected in one allele, a frameshift conjugated goat anti-rabbit or anti-mouse secondary antibodies (1: predicted to lead to a premature stop codon in exon 8. In the 5000, DAKO, High Wycombe, UK) were applied, and bound second antibody was detected with ECL reagent (Amersham Life Science). next pedigree (see family 2 in Figure 1 in reference 13), a Some blots were stripped and reprobed with either mouse anti-human splice-site mutation was detected; it was caused by the substi- ␤-actin (1:10.000), a housekeeping protein, or anti-myc (1:5000; tution of A for T in the acceptor splice-site of exon 11 leading Invitrogen). to the abolition of the splice-site (IVS10–2AϾT). Tracking the For immunohistochemistry, tissues were fixed in 4% paraformal- mutations through families showed that the females with mu- dehyde overnight, dehydrated, wax-embedded, and sectioned at 5 ␮m. tations had classic OFD1 dysmorphic features, while several Sections were dewaxed in Histoclear (National Diagnostics, Atlanta, clinically unaffected females carried normal alleles only. Table GA) and rehydrated through graded ethanols. Antigens were un- 1 depicts clinical and genetic details of four newly described masked by digestion in 1 mg/ml trypsin for 10 min and then treated affected individuals with no first-degree or other relatives with with 3% hydrogen peroxide in PBS (pH 7.4) for 30 min to quench OFD1 dysmorphology. Sequence analysis revealed three dele- endogenous peroxidase activity. Nonspecific binding was blocked by tions (one in exon 3 and two in exon 9) and one missense incubation with 10% FCS in PBS for 30 min before overnight incu- bation at 4°C with either OFD1a anti-serum or preimmune serum mutation in exon 3. In patients 3, 4, and 6, mutations were not (1:350) or antiserum preincubated with immunizing peptide. Washed detected in maternal DNA, consistent with a de novo genetic slides were exposed to a streptavidin-biotin peroxidase system fol- change causing the disease; maternal DNA was not available lowed by diaminobenzidine (Dako, ABC Kit) and counterstained with for the fourth family. Ninety normal chromosomes were hematoxylin. screened by dHPLC, and none showed shifts in exon 3, con-

Table 1. Clinical and genetic details

Renal Digital Family Mutation Renal Ultrasound Function Oral/Facial Features Features

3 707del 13 (exon 8); Parents PKD 15 y ESRF Hypertelorism, facial milia and Syndactyly have normal sequence clefting, crowded teeth 4 S74F (221TϾC) (exon 3); Normal 14 y ND Hypertelorism, oral frenulae, Brachy- and Parents and female siblings high arched palate, facial syndactyly, have normal sequence milia, hydrocephalus clinodactyly 5 843 del TT (exon 9) PKD 2nd decade ESRF Hypertelorism, cleft palate, Brachy- and multiple oral frenulae syndactyly 6 837 del AA (exon 9); Parents Normal 3 y ND Facial milia, cleft lip and Brachy- and have normal sequence tongue, high arched palate syndactyly, clinodactyly

a All index cases were female. ND, not documented; ESRF, end-stage renal failure. J Am Soc Nephrol 14: 680–689, 2003 OFD1 Expression 683 sistent with the missense change discovered for patient 4. protein. It was absent in cells transfected with the vector alone Figure 1 depicts the above mutations, together with those (Figure 3B, lane 2). Fainter bands, approximately 120 kD, were previously reported (14,20). noted in cells transfected with OFD1a and the vector alone (Figure 3B, lanes 1 and 2); these may represent a low level of OFD1 Transcripts in Human Development endogenous OFD1a protein. Marked diminution of signal in- RT-PCR (Figure 2A) detected OFD1a and OFD1b tran- tensity was observed after preincubation of the antibody with scripts in metanephros, brain, tongue, and limbs from normal immunizing peptide (Figure 3B, lanes 3 and 4) or when pre- human embryos at eight to 14-wk gestation. Both transcripts immune serum was substituted for the antiserum (not shown). were also detected in heart, lung, and gut, which are not known The 140-kD protein was also detected in OFD1a cDNA- to be clinically affected. Organs from two embryos (9 and 14 transfected cells after immunoprecipitation with anti-OFD1 wk gestation) were analyzed by Northern blot (Figure 2B). A antibody and exposure to anti-myc antibody (Figure 3B, lane major OFD1 transcript was detected at 4.0 kb in metanephros, 5). Bands were not detected in nontransfected cells (Figure 3B, brain, tongue, and limb, and a faint band was noted at 4.5 kb; lane 6). these sizes respectively correspond to OFD1a and OFD1b transcripts, as noted in Northern blot of adult tissues (15). Endogenous OFD1 Protein Expression While the signal for 18S rRNA was similar in all four tissues, Using the antiserum validated in transfected cells, we exam- OFD1 signal was most prominent in brain. Using a similar ined endogenous expression of OFD1a during normal human exposure time, transcripts were barely visible in gut, lung, and renal and craniofacial development. A doublet of around 120 heart (not shown). kD, potentially representative of glycosylated or phosphory- lated OFD1a forms, was detected on Western blot in lysates OFD1a-Specific Signal in Transfected HEK293 Cells generated from normal human metanephroi at 8, 10, and 12 wk As assessed by expression of green fluorescence protein gestation (Figure 3C, lanes 1 to 3). Note, signal intensity (GFP), transfection efficiency of HEK 293 cells with the appeared weaker in the older specimen (Figure 3C, lane 3). myc/EGFP/OFD1a construct (Figure 3A) was approximately We then stained normal metanephroi of 7, 10, 13, and 14 wk 70% (not shown). Western blot of lysates from these cells of gestation and the histologically grossly normal areas adja- demonstrated that OFD1a antiserum recognized a major band cent to three postnatal Wilms tumors. In the four normal fetal at 140 kD (Figure 3B, lane 1), the predicted size of the fusion developing metanephroi, a consistent expression pattern was

Figure 1. OFD1 mutations. The diagram shows the structure of OFD1a protein, with the LisH motif (box) and coiled-coil domains indicated. The region of the protein shared by both isoforms is represented by a solid bar, while the hatched bar region is only present in the protein coded by isoform a. Mutations detected in the current study are indicated above the protein; for comparison, mutations reported in reference 14 in reference 20 are shown below the protein. * PKD in patients. The position of the peptide used to raise the antiserum is also shown (circle in the final coiled-coil domain). 684 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 680–689, 2003

Figure 3. OFD1a expression in transfected HEK293 cells and in Figure 2. RT-PCR and Northern blot of developing human organs. whole human metanephroi. (A) Construct used in the transfection (A) RT-PCR. Ethidium bromide-stained gels. Far left (1) and far right experiments. (B) Western blot. Lanes 1, 3, and 5 are cells transfected (12) lanes are 100-bp ladders. Lanes 2 to 10 represent RT-PCR with the vector carrying the OFD1a/myc/EGFP insert, whereas lanes reactions from human embryonic organs. Key: lane 2, 8-wk gestation 2, 4, and 6 are cells transfected with the same vector lacking the insert. metanephros; lane 3, 14-wk metanephros; lane 4, 9-wk brain; lane 5, Lanes 1 and 2 were probed with the OFD1a antiserum, lanes 3 and 4 14-wk tongue; lane 6, 9-wk limb; lane 7, 11-wk limb; lane 8, 13-wk were probed with the OFD1a antiserum that had been prereacted with heart; lane 9, 13-wk lung; lane 10, 13-wk gut. Lane 11 represents a immunizing peptide, and lanes 5 and 6 are immunoprecipitation with sample in which RT was omitted. Note that all tissues expressed the OFD1 antibody probed with an antibody to the myc tag. Note: (1)a two OFD1 mRNA isoforms, OFD1a (225-bp product) and OFD1b major band was detected in the OFD1a-transfected cells, using the (600-bp product), as well as HPRT (210-bp product), the product of a OFD1a and myc probes, and (2) the OFD1a immunoreactive band was housekeeping gene. (B) Northern blot. Autoradiograph of tissues: considerably diminished when the antiserum was prereacted with upper panel, OFD1 probe; lower panel, 18S RNA probe. Note ex- immunizing peptide. The size of the major band is approximately 140 pression of a major OFD1 4.0-kb transcript in 14-wk gestation kidney kD, corresponding to the predicted size of the fusion protein of (lane 1), 9-wk gestation brain (lane 2), 14-wk gestation tongue (lane OFD1a, EGFP, and the myc tag. A faint band, at about 120 kD, was 3), and 9-wk gestation limb (lane 4). A less intense band was detected noted in cells transfected with the OFD1a expression vector, or the at approximately 4.5 kb. The 18S probe produced approximately vector alone (lanes 1 and 2); this may represent endogenous OFD1a equal signals in each lane, suggesting that the brain had the highest protein. (C) Analysis of metanephric tissues. Western blot of normal level of OFD1 mRNA. human metanephroi at 8, 10, and 12 wk gestation (in lanes 1, 2, and 3, respectively) probed with anti-OFD1a antibody demonstrated bands of around 120 kD, the expected size of the endogenous protein. observed: immunoreactive OFD1a protein was detected in the outer nephrogenic zone of the cortex in the mesenchyme (Fig- ure 4A). From these wax-embedded sections, it was difficult to (data not shown). Immunoreactive OFD1a protein was not discern the exact subcellular localization of immunoreactivity, detected in normal appearing areas of postnatal kidney sections although positive signal was not detected in renal cell nuclei. (data not shown). Cranial OFD1 expression was also observed Minimal positive signal was detected in later nephron precur- in an 8-wk embryo: positive signals were detected in nasal sors, including vesicles, comma, and S-shaped bodies. Consis- (Figure 4B) and developing skull (not shown) cartilage, oral tent staining was also not observed in developing glomeruli mucosa (Figure 4C), skin (not shown), brain (not shown), and J Am Soc Nephrol 14: 680–689, 2003 OFD1 Expression 685

Figure 4. Immunohistochemistry. Immunoperoxidase staining of normal human metanephros at 10 wk gestation (frames A and E) and normal head at 8 wk gestation (frames B through D and F through H). All sections counterstained with hematoxylin. Frames A through D were probed with OFD1a antiserum, and frames E through H are nearby sections probed with OFD1 antiserum preincubated with immunizing peptide (E) or with preimmune serum (F, G, H). A. Note the positive immunoreactive signal (brown color) in metanephric mesenchyme (m). Vesicles (v) and ureteric bud branches (u) also shown. (B) Positive signal in a subset of cells in the nasal cartilage. (C) Positive signal in oral mucosa. (D) Positive signal in myocytes of the tongue. Note that there is no significant signal in kidney mesenchyme in section E probed with preabsorbed antiserum; there is faint, probably unspecific signal in the ureteric bud brunches. No significant signal is detected in the sections of the head probed with preimmune serum. Scale bar: 30 ␮minA;20␮minE;100␮m in D and H; 50 ␮m in the remainder. 686 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 680–689, 2003 tongue myocytes (Figure 4D). Adjacent metanephric sections PAX2 transcription factors (21), HGF (22) and GDNF (23). All probed with antiserum preincubated with immunizing peptide lines expressed GDNF, as assessed by Western blot, with a (Figure 4E) showed no mesenchymal signal. Other tissues prominent band at 18 kD (Figure 5A). In three of these lines probed with preimmune serum (Figure 4, F through H) showed (N75, N73, and N70; Figure 5A, lanes 2, 3, and 4), Western no specific signals. blotting additionally detected signals for another mesenchy- mal-derived growth factor, HGF, with a prominent band at 60 Expression of OFD1a Protein in Cultured Cells kD representing the ␣-chain. Furthermore, the three lines also Four cell lines were established from normal human meta- expressed WT1 (52 kD) and PAX2 (doublet at 46 and 48 kD). nephroi. Cells from all cultures appeared uniformly “mesen- In contrast, in the fourth line examined, HGF, WT1, and PAX2 chymal” in shape, with irregular, elongated outlines; although were barely detectable using similar methodology (N84; Figure uncloned, this phenotype was maintained for more than 20 5A). On the basis of these results, we speculate that lines N75, passages. The mesenchymal phenotype of the cells was further N73, and N70 represent “induced” renal mesenchyme, while examined by assessing the expression of proteins characteristic N84 appears more like “uninduced” mesenchyme or stroma. of this lineage in vivo (Figure 5A), including the WT1 (21) and Next, we examined OFD1a expression in the mesenchymal lines using Western blot (Figure 5B): OFD1a protein was not detected in line N84, whereas bands were observed at 120 kD in the other three lines (Figure 5B). Subcellular localization of the protein was then investigated using confocal laser scanning microscopy of lines N84, N75, and N70. No signal was detected in line N84 (data not shown), whereas positive immunoreactive protein was observed in one or two discrete perinuclear dots in virtually all the cells of N75 and N70 lines (Figure 6A and not shown). Using Z-plane scanning, we confirmed that the discrete positive signal was within the cells rather than on the cell surface; nor was this appearance consistent with the cross section of an elongated structure such as the primary cilium. Significant staining was not detected in the cells incubated with preimmune serum or antiserum preincubated with immunizing peptide (Figure 6, B and C). The positive immunofluorescence was typical of cen- trosome-associated proteins; we therefore performed double labeling with anti-OFD1a (Figure 6D) and anti-␥-tubulin (Fig- ure 6E), a well-characterized centrosomal marker (24); immu- noreactive OFD1a and ␥-tubulin co-localized exactly (Figure 6F). Although these cell lines are not clonal, this centrosomal localization was observed in over 98% of cells in cultures of the N75 and N70 lines when the whole thickness of the cell was examined by focusing up and down.

Discussion The Spectrum of OFD1 Mutations OFD1 mutations described here occur throughout the gene, with no “hotspot,” hence confirming the previously reported pattern (14,20) (Figure 1). Most known mutations are small deletion/insertions, causing premature stop codons, while one other affects splicing, which will also lead to a premature stop codon. Because nonsense-mediated decay is the normal con- sequence of premature termination codons (25,26), it is per- Figure 5. Western blot of metanephric mesenchymal cell lines. (A) haps not surprising that there are no obvious phenotype-geno- Cell lysates of metanephric cell lines (N84, N75, N73, N70) were type correlations with regard to the major external dysmorphic probed for WT1, PAX2, HGF, and GDNF. In panel B, the upper panel features of the syndrome. De Conciliis et al. (15) suggest that is a representative blot probed with OFD1a antiserum; note the the OFD1 gene escape X-inactivation on the basis of studies presence of a major band (approximately 120 kD) in all lanes except the N84 cells. In the middle panel, the 120-kD signals were abolished using human-hamster cell hybrids. If correct, then normal when the blot was probed with OFD1a antiserum pre-reacted with females would be expected to have two active copies of the immunizing peptide; faint bands below 100 kD appeared as unspecific gene, whereas affected females would only have one copy. signals. The lower panel demonstrates that ␤-actin “housekeeping” This is, however, equivalent to normal males because they protein was detected in all samples. would also only have one active copy; furthermore, individuals J Am Soc Nephrol 14: 680–689, 2003 OFD1 Expression 687

Figure 6. Subcellular localization of OFD1a. (A) OFD1a immunostaining of N75 cells showed localization in one or two perinuclear dots per cell (arrows). Note that these spots were also detected in cells that initially appeared negative (arrowhead) by scanning through different Z-planes of the cell. (B and C) No specific staining was observed when the cells were respectively incubated with the preimmune serum in the same conditions and with the antiserum preincubated with the immunizing peptide. (D to F) show labeling with anti-OFD1a antiserum in green (C), ␥-tubulin in red (D), and the overlay image (E). OFD1a clearly colocalised with the centrosomal marker ␥-tubulin, with the same positive spots indicated by arrows in each panel. Scale bar: 5 ␮minA,B,andC;10␮minD,E,andF. with Turner’s syndrome (XO) have only one X chromosome sic dysmorphic features, but three other females without such but do not develop the features of OFD1 syndrome. Hence, features did not have the mutant allele. This observation, also haploinsufficiency cannot be the only mechanism underlying made by Ferrante et al. (14), is important for genetic counsel- OFD1 unless selective X-inactivation occurs in different or- ing regarding prenatal diagnosis. It is also pertinent if a renal gans during development. To prove this latter theorem, one transplant from a living female relative is proposed for an would have to demonstrate that only one allele is expressed at OFD1 individual with renal failure. specific time points using techniques such as RT-PCR of polymorphic markers within OFD1. One alternative possibility Does Occurrence of PKD Correlate with Genotype is that the defective gene product has a dominant negative in OFD1? effect, but there is currently no evidence to support this mech- Two OFD1 proteins are predicted to be produced from two anism with OFD1. Virtually nothing is known about the func- alternatively spliced mRNAs (14); the shorter one terminates at tion of OFD1 protein(s), although the predicted molecule con- the beginning of exon 11. Four of the previously published tains LIS1 homology (LisH) motif (27); postulated functions mutations occur beyond this point (Figure 1); in these cases, for this motif include microtubule regulation, either by medi- the sequence of OFD1b, the shorter protein, would be pre- ating dimerization or direct binding to cytoplasmic dynein dicted to be unchanged. Two of these patients did not have heavy chains or microtubules. Notably, three of the 17 muta- PKD on US (14), while the other two were not assessed by US tions previously published or in this report fall within this (20). Conversely, most patients with mutations before this predicted site, including two missense mutations. A fourth point have PKD (Figure 1). One interpretation is that the mutation involves a splice site of exon 3, which contains the shorter protein is responsible for normal kidney growth, and domain, and the protein product would be predicted to lack the the longer protein prevents dysmorphic features. Against this, domain. Such a concentration of mutations in a very short it can be argued that premature stop codons in the later part of stretch of the protein suggests that this domain may genuinely the molecule will lead to nonsense-mediated decay of the have functional significance. OFD1b mRNA. In future, exactly which mRNA alleles exist could be established if suitable mutant cells expressing OFD1 OFD1 Mutations are Highly Penetrant for were available. A further argument against a simple renal Dysmorphic Features phenotype/genotype correlation is that the severity of PKD Tracking mutations through two pedigrees showed that the (i.e., cyst numbers and severity of renal failure at certain ages) mutation is highly penetrant; females with mutations had clas- can vary markedly in one pedigree, all of whom will carry the 688 Journal of the American Society of Nephrology J Am Soc Nephrol 14: 680–689, 2003 same mutation, as described previously by Feather et al. (10). several proteins implicated in both human and murine PKD, In addition, we are aware of one individual with OFD1 dys- including polycystin-1 and -2, polaris, and cystin, has recently morphology who developed cysts on US over several years been described in the primary cilium complex (28,29). (SAF, personal observation); hence, the lack of cysts does not Morover, OFD1 contains a large number of coiled-coil do- preclude their evolution. mains and heptad repeats (15,27) and polycystins interact via coiled-coil domains (30). This raises the possibility that these OFD1 Is Expressed in Developing Human Organs molecules are involved in the same biologic pathway. Func- This study reports for the first time that OFD1 is expressed tional cell biology experiments are clearly required to assess in human organogenesis. De Conciliis et al. (15) demonstrated potential roles of OFD1a during both nephrogenesis and in by Northern blot that OFD1 was expressed in adult human cystic kidney disease. In addition further studies are required to organs. Transcripts corresponding to OFD1a RNA were found establish whether renal mesenchymal cells have primary cilia. in kidney, pancreas, skeletal muscle, liver, lung, brain, heart, Furthermore, while all developing organs that we studied ex- and placenta, while a larger species, postulated to be the pressed both OFD1a and OFD1b isoforms on RT-PCR, it OFD1b transcript, was noted in some organs, including kidney remains possible that the two OFD1 proteins are not expressed and brain. In-situ hybridization studies in mice (14) demon- synchronously, and the pattern of OFD1b protein remains to be strated expression at embryonic day 12 in genital ridges, with determined. transcripts detected later in gestation in craniofacial structures, including oral and nasal cavity epithelia, the nervous system, Acknowledgments and metanephros. In the current study, using the highly sensi- The work was supported by grant from Action Research, the National tive technique of RT-PCR, OFD1a and OFD1b transcripts Kidney Research Fund (R11/1/2000 and R18/1/2000), the Kidney Re- were found in a wide variety of developing human organs, search Aid Fund, the Italian Telethon Foundation and the EC (QLRT- including heart and lung. PCR is so sensitive that we may be 00791). We thank the MRC/Wellcome Trust Human Embryo Bank, detecting low levels of transcripts. In contrast, however, using Institute of Child Health, London, for provision of tissue samples, and less sensitive Northern blot analysis, significant signals were Dr. M Kolatsi-Joannou for technical help. only observed in brain, metanephros, tongue, and limb, which is similar to previous in-situ results in mice (14). We generated References an antiserum to the carboxyterminal of the putative OFD1a 1. Gorlin R, Psaume J: Orodogitofacial dysostosis. A new syn- protein and validated it in HEK293 cells transfected with drome: A study of 22 cases. J Pediatr 61: 520–530, 1962 OFD1a cDNA. In normal human embryos, OFD1a immuno- 2. Toriello HV: Oral-facial-digital syndromes, 1992: Clin Dysmor- phol 2: 95–105, 1993 localized to oral mucosa, nasal cavities, cranial cartilage, and 3. Gillerot Y, Heimann M, Fourneau C, Verellen-Dumoulin C, Van brain. Hence, during development, several cell types and lin- Maldergem L: Oral-facial-digital syndrome type I in a newborn eages express the gene. OFD1a expression was observed in the male. Am J Med Genet 46: 335–338, 1993 mesenchyme of the outer metanephric cortex. These cells are 4. Wettke-Schafer R, Kantner G: X-linked dominant inherited dis- highly proliferative (21), correlating with epithelial transfor- eases with lethality in hemizygous males. Hum Genet 64: 1–23, mation. In fetal kidneys, OFD1a protein was apparently down- 1983 regulated as the mesenchyme transformed into nephron epithe- 5. Wahrman F, Berant M, Jacobs J, Aviad I, Ben-Hur N: The lia and consistent glomerular staining was not observed. oral-facial-digital syndrome: A male lethal condition in a boy Moreover, OFD1a immunoreactivity was absent in sections of with 47/XXY chromosomes. Pediatrics 37: 812–821, 1966 postnatal kidneys, consistent with the hypothesis that it may 6. Doege T, Thuline H, Priest J, Norby D, Bryant J: Studies of a have a role in renal differentiation. family with the oral-facial-digital syndrome. N Engl J Med 271: 1073–1080, 1964 7. Donnai D, Kerzin-Storrar L, Harris R: Familial orofaciodigital OFD1 Is an Intracellular Protein syndrome type I presenting as adult polycystic kidney disease. In normal human embryonic renal mesenchymal lines, J Med Genet 24: 84–87, 1987 OFD1 protein immunolocalized to perinuclear “dots;” further- 8. Stapelton FB, Bernstein J, Koh G, Roy S III, Wilroy RS: Cystic more, ␥-tubulin immunoreactivity overlapped with OFD1. kidneys in a patient with the oral-facial-digital syndrome type 1. These findings are consistent with OFD1 being a centrosome- Am J Kid Dis 1: 288–293, 1982 associated protein. The centrosome is a small nonmembranous 9. Salinas CF, Pai GS, Vera CL, Milutinovic J, Hagerty R, Cooper organelle, often associated with the nuclear membrane, com- JD, Cagna DR: Variability of expression of the orofaciodigital posed of two centrioles surrounded by electron-dense pericen- syndrome type I in black females: Six cases. Am J Med Genet 15: triolar matrix. Interestingly, the centrosomal matrix is the site 574–582, 1991 of microtubule nucleation and contains a high proportion of 10. Feather SA, Winyard PJD, Dodd S, Woolf AS Oral-facial-digital syndrome type 1 is another dominant polycystic kidney disease: coiled coil proteins (24). Further experiments, incorporating Clinical, radiological and histopathological features of a new immunoelectron microscopy and biochemical studies to assess kindred. Nephrol Dial Transplant 12: 1354–1361, 1997 protein-protein interactions, will be necessary to determine the 11. Scolari F, Valzorio B, Carli O, Vizzardi V, Costantino E, Gra- sub-centrosomal localization of OFD1. Although, the precise zioli L, Bondioni MP, Savoldi S, Maiorca R: Oral-facial-digital function of centrioles is unclear, they are known to be essential syndrome type I: An unusual cause of hereditary cystic kidney for the generation of the primary cilium (24). Expression of disease. Nephrol Dial Transplant 12: 1247–1250, 1997 J Am Soc Nephrol 14: 680–689, 2003 OFD1 Expression 689

12. Odent S, Le Marec B, Toutain A, David A, Vigneron J, Treguier 21. Winyard PJ, Risdon RA, Sams VR, Dressler GR, Woolf AS The C, Jouan H, Milon J, Fryns JP, Verloes A: Central nervous PAX2 tanscription factor is expressed in cystic and hyperprolif- system malformations and early end-stage renal disease in oro- erative dysplastic epithelia in human kidney malformations. facio-digital syndrome type I: A review. Am J Med Genet 75: J Clin Invest 98: 451–459, 1996 389–394, 1998 22. Kolatsi-Joannou M, Moore R, Winyard PJ, Woolf AS: Expres- 13. Feather SA, Woolf AS, Donnai D, Malcolm S, Winter R: The sion of hepatocyte growth factor/scatter factor and its receptor, oral-facial-digital syndrome type 1 (OFD1), a cause of polycystic MET, suggests roles in human embryonic organogenesis. Pediatr kidney disease and associated malformations, maps to Xp22.2– Res 41: 657–665, 1997 22.3. Hum Mol Genet 6: 1163–1167, 1997 23. Towers PR, Woolf AS, Hardman P: Glial cell line-derived neu- 14. Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, rotrophic factor stimulates ureteric bud outgrowth and enhances Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Odent survival of ureteric bud cells in vitro. Exp Nephrol 6: 337–351, S, Le Marec B, Malcolm S, Winter R, Ballabio A, Franco B: 1998 Identification of the gene for oral facial digital syndrome type 1. 24. Doxsey S: Re-evaluating centrosome function. Nature Rev Mol Am J Hum Genet 68: 569–576, 2001 Cell Biol 2: 688–698, 2001 15. De Conciliis L, Marchitiello A, Wapenaar MC, Borsani G, Giglio S, 25. Mendell JT, Dietz HC: When the message goes awry: Disease- Mariani M, Consalez GG, Zuffardi O, Franco B, Ballabio A, Banfi producing mutations that influence mRNA content and perfor- S: Characterisation of Cxorf (71–7A), a novel human cDNA map- mance. Cell 107: 411–414, 2001 ping to Xp22 and encoding a protein containing coiled-coil alpha 26. Byers PH: Killing the messenger: New insights into nonsense- helical domains. Genomics 51: 243–250, 1998 mediated mRNA decay. J Clin Inv 109: 3–6, 2002 16. Larsen WJ: Human Embryology, New York, Churchill Living- 27. Emes RD, Ponting CP: A new sequence motif linking lissen- stone, 1993, pp 420 17. Shaw G, Morse S, Ararat M, Graham FL: Preferential transfor- cephaly, Treacher Collins and oral-facial-digital type 1 syn- mation of human neuronal cells by human adenovirus and the dromes, microtubule dynamics and cell migration. Hum Mol origin of HEK 293 cells. FASEB J 16: 869–871, 2002 Genet 10: 2813–2820, 2001 18. Price, et al: Human dysplastic kidney mesenchyme cells generate 28. Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, a perturbed milieu of HGF and GDNF, classic ureteric bud Witman GB, Cole DG: Chlamydomonas IFT88 and its mouse morphogens [Abstract]. J Am Soc Nephrol 13: 103A, 2002 homologue, polycystic kidney disease gene tg737, are required 19. Attar R, Quinn F, Winyard PJD, Mouriquand PDE, Foxall P, for assembly of cilia and flagella. J Cell Biol 151: 709–718, 2000 Hanson MA, Woolf AS: Short-term urinary flow impairment 29. Yoder BK, Hou X, Guay-Woodford LM: The polycystic kidney deregulates PAX2 and PCNA expression and cell survival in disease proteins, polycystin-1, polycystin-2, polaris, and cystin, fetal sheep kidneys. Am J Pathol 152: 1225–1235, 1998 are co-localized in renal cilia. J Am Soc Nephrol 13: 2508–2516, 20. Rakkolainen A, Ala-Mello S, Kristo P, Orpana A, Jarvela I: Four 2002 novel mutations in the OFD1 (Cxorf5) gene in Finnish patients 30. Qian F, Germino FJ, Cai Y, Zhang X, Somlo S, Germino GG: with oral-facial-digital syndrome 1. J Med Genet 39: 292–296, PKD1 interacts with PKD2 through a probable coiled-coil do- 2002 main. Nature Genet 16: 179–183, 1997