DOCSLIB.ORG

Expressed in Insulin-Secreting Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expressed in Insulin-Secreting Cells Proc. Natd. Acad. Sci. USA Vol. 91, pp. 2679-2683, March 1994 Biochemistry Cloning and functional characterization of a third pituitary adenylate cyclase-activating polypeptide receptor subtype expressed in insulin-secreting cells (GTP-binding-protein-coupled receptor/gene family/phospholipase C/Ca signal) NOBUYA INAGAKI*, HIDEHIKO YOSHIDA*t, MASANARI MIZUTA*, NOBUHISA MIZUNO*, YASUKAZU FuJII*, TOHRU GONOIf, JUN-ICHI MIYAZAKI§, AND SUSUMU SEINO*I *Division of Molecular Medicine, Center for Biomedical Science, tDepartment of Oral Surgery, Chiba University School of Medicine, and tResearch Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260, Japan; and §Department of Disease-Related Gene Regulation Research (Sandoz), Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan Communicated by Donald F. Steiner, December 21, 1993 ABSTRACT Pituitary adenylate cycLase-activating poly- teins (2). Pharmacological studies have indicated that there peptide (PACAP) is a neuropeptide belonging to the vasoactive are at least two types ofPACAP receptor (PACAPR) (2). The intestinal polypeptide/glucagon/secretin family. It is widely PACAP type I receptor present in the central nervous sys- distributed in the body, and a variety ofbiological actions have tem, pituitary, adrenal medulla, and germ cells of the testis been reported. PACAP exerts its biological effects by binding binds PACAP with high affinity but binds VIP with 1000-fold to speciffic receptors that are coupled to GTP-binding proteins. lower affinity. In contrast, the PACAP type II receptor Recent studies have shown that there is a family of PACAP present in the lung, liver, and gastrointestinal tract binds receptors (PACAPRs), and two members of this family have PACAP and VIP with similar affinity. Recently, cDNAs been identified. We report here the cloning, functional expres- encoding PACAP type I (5-9) and type II (10) receptors have sion, and tissue distribution of a third PACAPR subtype, been cloned. designated PACAPR-3. The cDNA encoding PACAPR-3 has Regulation of insulin biosynthesis and secretion is crucial been isolated from a mouse insulin-secreting a-cell line MIN6 for glucose homeostasis in animals (11). As part of a project cDNA library. Mouse PACAPR-3 is a protein of 437 amino characterizing the proteins expressed in pancreatic , cells acids that has 50% and 51% identity with rat PACAP type I that may be involved in the regulation ofinsulin secretion, we and type H receptors, respectively. Expression of recombinant have amplified the cDNAs derived from pancreatic islets that mouse PACAPR-3 in mammalin cells shows that it binds to could encode G-protein-coupled receptors, by using poly- vasoactive intestinal polypeptide as well as PACAP-38 and -27, merase chain reaction (PCR). Here we report the cloning, with a slightly higher affinity for PACAP-38, and is positively sequence, and functional characterization ofathird PACAPR coupled to adenylate cycase. The expression of PACAPR-3 in subtype designated PACAPR-3,11 the tissue distribution of Xenopus oocytes indicates that calcium-activated chloride cur- which is distinct from that of PACAP type I and type II rents are evoked by PACAP and vasoactive intinal polypep- receptors. PACAPR-3 has similar binding properties to that tide, sggesting that PACAPR-3 can also be coupled to phos- of the type II receptor in that it binds both PACAP and VIP pholipase C. RNA blot analysis studies reveal that PACAPR-3 with high affinity. Heterologous expression studies have mRNA is expressed at high levels in MIN6, at moderate levels indicated that PACAPR-3 can be coupled to phospholipase C in pancreatic islets and other insulin-secreting cell lines, HIT- as well as to adenylate cyclase. Interestingly, PACAPR-3 is T15 and RINm5F, as well as in the lung, brain, stomach, and expressed in pancreatic islets and insulin-secreting cell lines colon, and at low levels in the heart. Furthermore, insulin including MIN6 (12), HIT-T15, and RINm5F. Since secretion from MIN6 cells is scantiy stimulated by PACAP-38 stimulates insulin secretion in MIN6 cells, PAC- PACAP-38. These results suggest that the diverse biological APR-3 may play a physiological role in the regulation of effects of PACAP are mediated by a family of structurally insulin secretion. related proteins and that PACAPR-3 participates in the regu- lation of insulin secretion. MATERIALS AND METHODS Pituitary adenylate cyclase-activating polypeptide (PACAP) General Methods. Standard methods were carried out as is a neuropeptide of the vasoactive intestinal polypeptide described (13, 14). Total cellular RNA was isolated by the (VIP)/glucagon/secretin family of peptides (1). PACAP is guanidinium isothiocyanate/CsCl procedure. DNA sequenc- widely distributed, occurring in the central nervous system ing was done by the dideoxynucleotide chain-termination and peripheral tissues such as pituitary, adrenal medulla, procedure after subcloning appropriate DNA fragments into testis, gastrointestinal tract, and pancreas. PACAP has di- M13 mp18 or mpl9. Both strands were sequenced. Radiola- verse biological effects that are tissue-specific (2). Two forms beled and unlabeled peptides were purchased from Peninsula of PACAP, PACAP-38 and PACAP-27, sharing the same Laboratories and the Peptide Institute (Osaka), respectively. N-terminal 27 peptides, are derived by tissue-specific pro- Cloning of cDNA Encoding a G-Protein-Coupled Receptor. teolytic processing of a 176-amino acid precursor protein (3) First-strand cDNA was prepared using 10 ug of total rat and are present at various concentrations in different tissues, pancreatic islet RNA, reverse transcriptase (Superscript, suggesting different processing in various tissues (4). PACAP exerts its biological effects by binding to high- Abbreviations: PACAP, pituitary adenylate cyclase-activating poly- affinity receptors that are coupled to GTP-binding (G) pro- peptide; PACAPR, PACAP receptor; VIP, vasoactive intestinal peptide; G protein, GTP-binding protein; PHM, peptide histidine methionine; GIP, gastric inhibitory peptide. The publication costs ofthis article were defrayed in part by page charge fTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" 'The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. D28132). 2679 Downloaded by guest on September 23, 2021 2680 Biochemistry: Inagaki et al. Proc. Nat!. Acad. Sci. USA 91 (1994) Met Arg Ala Ser Val C)A(A/T/CXG/A/T/C)A(G/A)(G/A/T/C)CC(T/C)TG(G/ GTTGCTGTCGGACCGTGCTGCTGAGGCGCCAAGGACCGAGGCAGCACGCTGAGCCCAAG ATG AGG GCG TCG GTG 10 20 A)AA-3'], respectively. The PCR products were further Val Leu Thr Cys Tyr Cys Trp Leu Leu Val Arg Val Ser Ser Ile His Pro Glu Cys Arg GTG CTG ACC TGC TAC TGC TGG TTO CTG GTG CGG GTG AGC AGC ATC CAT CCA GAA TGT CGC amplified using the sense and antisense primers GS-3 [5'- 30 40 Phe His Leu Glu Ile Gln Glu Glu Glu Thr Lys Cys Ala Glu Leu Leu Ser Ser Gln Thr TGG(A/T/C)T(G/A/T/C)(T/C)T(G/A/T/C)GT(G/A/T/ TTT CAT CTA GAA ATA CAA GAA GAA GAG ACA AAA TGT GCA GAG CTG CTA AGC AGC CAA ACG 50 v 60 C)GA(G/A)GG-3'] and GS-2, respectively. The PCR was Glu Asn Gln Arg Ala Cys Ser Gly Val Trp Asp Asn Ile Thr Cys Trp Arg Pro Ala Asp GAG AAT CAG AGA GCC TGC AGC GGT GTC TGO GAC AAC ATC ACA TGC TOG CGC CCG GCA GAC performed for 40 cycles under the following conditions: 70 80 denaturation for 1 min at annealing for 1 min at 450C, Val Gly Glu Thr Val Thr Val Pro Cys Pro Lys Val Phe Ser Asn Phe Tyr Ser Arg Pro 94TC, GTT GGG GAA ACT GTC ACA GTO CCC TGC CCC AAA GTA TTC AGC AAT TTC TAC AGC AGA CCA and extension for 1 min at 72TC. The PCR products of --480 v 90 T 100 Gly Asn Ile Ser Lys Asn Cys Thr Ser Asp Gly Trp Ser Glu Thr Phe Pro Asp Phe Ile bp were gel-purified and cloned into M13 mpl8 and se- GGA AAC ATA AGC AAA AAC TGC ACT AGC GAT GGA TOG TCA GAG ACA TTT CCA GAT TTC ATA 110 120 quenced. One of the PCR products, rGLR66, encoded a Asp Ala Cys Gly Tyr Asn Asp Pro Glu Asp Glu Ser Lys Ile Ser Phe Tyr Ile Leu Val GAT GCG TGT GGC TAC AAC GAC CCC GAG GAT GAG AGT AAG ATC TCG TTT TAT ATT TTG GTO putative receptor for VIP/glucagon/secretin family. A MIN6 130 140 Lys Ala Ile Tyr Thr Leu Gly Tyr Ser Val Ser Leu Met Ser Leu Thr Thr Gly Ser Ile cDNA library has been made from a mouse insulin-secreting AAG GCC ATT TAT ACC TTO GGC TAC AGT GTT TCT CTG ATO TCT CTT ACA ACA GGA AGC ATA 150 160 cell line, MIN6 cells (12), in the vector AZAP 11 (Stratagene), Ile Ile Cys Leu Phe Arg Lys Leu His Cys Thr Arg Asn Tyr Ile His Leu Asn Leu Phe ATT ATC TGC CTC TTC AGG AAG CTG CAC TOC ACA AGG AAC TAC ATC CAC CTA AAC CTC TTC and S x 105 plaques were- screened by hybridization with a 170 180 a A Leu Ser Phe Met Leu Arg Ala Ile Ser Val Leu Val Lys Asp Ser Val Leu Tyr Ser Ser 32P-labeled rGLR66 DNA fragment as probe. full-length CTC TCC TTC ATO CTG AGA GCC ATC TCT GTG CTG GTC AAG GAC AGC GTO CTC TAC TCC AGC cDNA a A mouse GLR66 was 190 200 encoding (termed AmGLR66) Ser Gly Leu Leu Arg Cys His Asp Gln Pro Ala Ser Trp Val Gly Cys Lys Leu Ser Leu isolated from this library and sequenced.
Load more

Recommended publications
  • The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands
    The Activation of the Glucagon-Like Peptide-1 (GLP-1) Receptor by Peptide and Non-Peptide Ligands Clare Louise Wishart Submitted in accordance with the requirements for the degree of Doctor of Philosophy of Science University of Leeds School of Biomedical Sciences Faculty of Biological Sciences September 2013 I Intellectual Property and Publication Statements The candidate confirms that the work submitted is her own and that appropriate credit has been given where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Clare Louise Wishart to be identified as Author of this work has been asserted by her in accordance with the Copyright, Designs and Patents Act 1988. © 2013 The University of Leeds and Clare Louise Wishart. II Acknowledgments Firstly I would like to offer my sincerest thanks and gratitude to my supervisor, Dr. Dan Donnelly, who has been nothing but encouraging and engaging from day one. I have thoroughly enjoyed every moment of working alongside him and learning from his guidance and wisdom. My thanks go to my academic assessor Professor Paul Milner whom I have known for several years, and during my time at the University of Leeds he has offered me invaluable advice and inspiration. Additionally I would like to thank my academic project advisor Dr. Michael Harrison for his friendship, help and advice. I would like to thank Dr. Rosalind Mann and Dr. Elsayed Nasr for welcoming me into the lab as a new PhD student and sharing their experimental techniques with me, these techniques have helped me no end in my time as a research student.
    [Show full text]
  • The Role of Clinical Proteomics, Lipidomics, and Genomics in the Diagnosis of Alzheimer's Disease
    Edith Cowan University Research Online ECU Publications Post 2013 3-31-2016 The Role of Clinical Proteomics, Lipidomics, and Genomics in the Diagnosis of Alzheimer's Disease Ian James Martins Edith Cowan University Follow this and additional works at: https://ro.ecu.edu.au/ecuworkspost2013 Part of the Medicine and Health Sciences Commons 10.3390/proteomes4020014 Martins, I. J. (2016). The Role of Clinical Proteomics, Lipidomics, and Genomics in the Diagnosis of Alzheimer’s Disease. Proteomes, 4(2), 14.Available here This Journal Article is posted at Research Online. https://ro.ecu.edu.au/ecuworkspost2013/2456 proteomes Article The Role of Clinical Proteomics, Lipidomics, and Genomics in the Diagnosis of Alzheimer’s Disease Ian James Martins School of Medical Sciences, Edith Cowan University, 270 Joondalup Drive, Joondalup 6027, Australia; [email protected]; Tel.: +61-8-6304-2574 Academic Editors: Edwin Lasonder and Jacek R. Wisniewski Received: 5 February 2016; Accepted: 28 March 2016; Published: 31 March 2016 Abstract: The early diagnosis of Alzheimer’s disease (AD) has become important to the reversal and treatment of neurodegeneration, which may be relevant to premature brain aging that is associated with chronic disease progression. Clinical proteomics allows the detection of various proteins in fluids such as the urine, plasma, and cerebrospinal fluid for the diagnosis of AD. Interest in lipidomics has accelerated with plasma testing for various lipid biomarkers that may with clinical proteomics provide a more reproducible diagnosis for early brain aging that is connected to other chronic diseases. The combination of proteomics with lipidomics may decrease the biological variability between studies and provide reproducible results that detect a community’s susceptibility to AD.
    [Show full text]
  • Cloning, Characterization, and Expression of a Human Calcitonin Receptor from an Ovarian Carcinoma Cell Line
    Cloning, characterization, and expression of a human calcitonin receptor from an ovarian carcinoma cell line. A H Gorn, … , S M Krane, S R Goldring J Clin Invest. 1992;90(5):1726-1735. https://doi.org/10.1172/JCI116046. Research Article A human ovarian small cell carcinoma line (BIN-67) expresses abundant calcitonin (CT) receptors (CTR) (143,000 per cell) that are coupled, to adenylate cyclase. The dissociation constants (Kd) for the CTRs on these BIN-67 cells is approximately 0.42 nM for salmon CT and approximately 4.6 nM for human CT. To clone a human CTR (hCTR), a BIN-67 cDNA library was screened using a cDNA probe from a porcine renal CTR (pCTR) that we recently cloned. One positive clone of 3,588 bp was identified. Transfection of this cDNA into COS cells resulted in expression of receptors with high affinity for salmon CT (Kd = approximately 0.44 nM) and for human CT (Kd = approximately 5.4 nM). The expressed hCTR was coupled to adenylate cyclase. Northern analysis with the hCTR cDNA probe indicated a single transcript of approximately 4.2 kb. The cloned cDNA encodes a putative peptide of 490 amino acids with seven potential transmembrane domains. The amino acid sequence of the hCTR is 73% identical to the pCTR, although the hCTR contains an insert of 16 amino acids between transmembrane domain I and II. The structural differences may account for observed differences in binding affinity between the porcine renal and human ovarian CTRs. The CTRs are closely related to the receptors for parathyroid hormone-parathyroid hormone-related peptide and secretin; these receptors comprise a […] Find the latest version: https://jci.me/116046/pdf Cloning, Characterization, and Expression of a Human Calcitonin Receptor from an Ovarian Carcinoma Cell Line Alan H.
    [Show full text]
  • Human Physiology Course
    Human Physiology Course Endocrine System Principles of hormonal regulation Assoc. Prof. Mária Pallayová, MD, PhD [email protected] Department of Human Physiology, PJ Safarik University FOM April 6-7, 2020 (9th week – Summer Semester 2019/2020) Chemical messenger systems Types of chemical messenger systems: Neurotransmitters Endocrine hormones Neuroendocrine hormones Paracrines Autocrines Cytokines Neurotransmitters are released by axon terminals of neurons into the synaptic junctions act locally to control nerve cell functions. Endocrine hormones are released by glands or specialized cells into the circulating blood influence the function of target cells at another location in the body. Neuroendocrine hormones are secreted by neurons into the circulating blood influence the function of target cells at another location in the body. Paracrines are secreted by cells into the extracellular fluid affect neighboring target cells of a different type. Autocrines are secreted by cells into the extracellular fluid affect the function of the same cells that produced them. Cytokines are peptides secreted by cells into the extracelular fluid can function as autocrines, paracrines, or endocrine hormones. e.g., the interleukins and other lymphokines secreted by helper cells and act on other cells of the immune system. adipokines= cytokine hormones (e.g., leptin) produced by adipocytes. Hormonal vs. Humoral ????? Hormonal vs. Humoral hormonal = endocrine humoral = endocrine + autocrine + paracrine The Endocrine Sytem the endocrine signaling communication and coordination system. relies on hormones, chemical substances that are released into the bloodstream, to deliver messages to cells of the body. Hormones and Functions Hormones are produced by: – endocrine glands – endocrine tissues (the brain, heart, kidney, adipose tissue, and GI tract).
    [Show full text]
  • International Union of Pharmacology. XXXV. the Glucagon Receptor Family
    0031-6997/03/5501-167–194$7.00 PHARMACOLOGICAL REVIEWS Vol. 55, No. 1 Copyright © 2003 by The American Society for Pharmacology and Experimental Therapeutics 30106/1047548 Pharmacol Rev 55:167–194, 2003 Printed in U.S.A International Union of Pharmacology. XXXV. The Glucagon Receptor Family KELLY E. MAYO, LAURENCE J. MILLER, DOMINIQUE BATAILLE, STEPHANE´ DALLE, BURKHARD GO¨ KE, BERNARD THORENS, AND DANIEL J. DRUCKER Department of Biochemistry, Molecular Biology and Cell Biology, Northwestern University, Evanston, Illinois (K.E.M.); Mayo Clinic and Foundation, Department of Molecular Pharmacology and Experimental Therapeutics, Rochester, Minnesota (L.J.M.); INSERM U 376, Montpellier, France (D.B., S.D.); Department of Medicine II, Grosshadern, Klinikum der Ludwig-Maximilians, University of Munich, Germany (B.G.); Institute of Pharmacology and Toxicology, University of Lausanne, Lausanne, Switzerland (B.T.); and Banting and Best Diabetes Centre, Toronto General Hospital, University of Toronto, Toronto, Ontario, Canada (D.J.D.) Abstract .............................................................................. 168 I. Introduction ........................................................................... 168 II. Secretin receptor....................................................................... 169 A. Molecular basis for receptor nomenclature ............................................ 169 B. Endogenous agonist................................................................. 169 C. Receptor structure .................................................................
    [Show full text]
  • Secretin and Autism: a Clue but Not a Cure
    SCIENCE & MEDICINE Secretin and Autism: A Clue But Not a Cure by Clarence E. Schutt, Ph.D. he world of autism has been shaken by NBC’s broadcast connections could not be found. on Dateline of a film segment documenting the effect of Tsecretin on restoring speech and sociability to autistic chil- The answer was provided nearly one hundred years ago by dren. At first blush, it seems unlikely that an intestinal hormone Bayless and Starling, who discovered that it is not nerve signals, regulating bicarbonate levels in the stomach in response to a but rather a novel substance that stimulates secretion from the good meal might influence the language centers of the brain so cells forming the intestinal mucosa. They called this substance profoundly. However, recent discoveries in neurobiology sug- “secretin.” They suggested that there could be many such cir- gest several ways of thinking about the secretin-autism connec- culating substances, or molecules, and they named them “hor- tion that could lead to the breakthroughs we dream about. mones” based on the Greek verb meaning “to excite”. As a parent with more than a decade of experience in consider- A simple analogy might help. If the body is regarded as a commu- ing a steady stream of claims of successful treatments, and as a nity of mutual service providers—the heart and muscles are the pri- scientist who believes that autism is a neurobiological disorder, I mary engines of movement, the stomach breaks down foods for have learned to temper my hopes about specific treatments by distribution, the liver detoxifies, and so on—then the need for a sys- seeing if I could construct plausible neurobiological mechanisms tem of messages conveyed by the blood becomes clear.
    [Show full text]
  • Membrane-Tethered Ligands Are Effective Probes for Exploring Class B1 G Protein-Coupled Receptor Function
    Membrane-tethered ligands are effective probes for exploring class B1 G protein-coupled receptor function Jean-Philippe Fortina, Yuantee Zhua, Charles Choib, Martin Beinborna, Michael N. Nitabachb, and Alan S. Kopina,1 aMolecular Pharmacology Research Center, Molecular Cardiology Research Institute, Tufts Medical Center, Tufts University School of Medicine, Boston, MA 02111; and bDepartment of Cellular and Molecular Physiology, Yale School of Medicine, New Haven, CT 06520 Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved March 6, 2009 (received for review January 6, 2009) Class B1 (secretin family) G protein-coupled receptors (GPCRs) peptide hormone complexes, providing important insight into modulate a wide range of physiological functions, including glu- the molecular mechanisms underlying PTH (3), corticotropin- cose homeostasis, feeding behavior, fat deposition, bone remod- releasing factor (CRF) (4), GIP (5), and exendin-4 (EXE4) (6) eling, and vascular contractility. Endogenous peptide ligands for interaction with their corresponding GPCRs. Notably, these these GPCRs are of intermediate length (27–44 aa) and include reports highlight that each of the peptides docks as an amphipathic receptor affinity (C-terminal) as well as receptor activation (N- ␣-helix in a hydrophobic groove present in the receptor ECD. terminal) domains. We have developed a technology in which a Peptide ligands that modulate class B1 GPCR function hold peptide ligand tethered to the cell membrane selectively modu- considerable promise as therapeutics. The peptidic GLP-1 mi- lates corresponding class B1 GPCR-mediated signaling. The engi- metic EXE4 (also known as exenatide or BYETTA) activates the neered cDNA constructs encode a single protein composed of (i)a GLP-1 receptor (GLP-1R) and represents the first incretin- transmembrane domain (TMD) with an intracellular C terminus, (ii) based pharmaceutical for the treatment of type 2 diabetes (7).
    [Show full text]
  • Glucagon-Like Peptide-1 Stimulates Luteinizing Hormone- Releasing Hormone Secretion in a Rodent Hypothalamic Neuronal Cell Line
    Glucagon-like peptide-1 stimulates luteinizing hormone- releasing hormone secretion in a rodent hypothalamic neuronal cell line. S A Beak, … , S R Bloom, D M Smith J Clin Invest. 1998;101(6):1334-1341. https://doi.org/10.1172/JCI610. Research Article To examine the influence of the putative satiety factor (GLP-1) on the hypothalamo-pituitary-gonadal axis, we used GT1-7 cells as a model of neuronal luteinizing hormone- releasing hormone (LHRH) release. GLP-1 caused a concentration- dependent increase in LHRH release from GT1-7 cells. Specific, saturable GLP-1 binding sites were demonstrated on these cells. The binding of [125I]GLP-1 was time-dependent and consistent with a single binding site (Kd = 0.07+/-0.016 nM; binding capacity = 160+/-11 fmol/mg protein). The specific GLP-1 receptor agonists, exendin-3 and exendin-4, also showed high affinity (Ki = 0.3+/-0.05 and 0.32+/-0.06 nM, respectively) as did the antagonist exendin-(9-39) (Ki = 0.98+/- 0.24 nM). At concentrations that increased LHRH release, GLP-1 (0.5-10 nM) also caused an increase in intracellular cAMP in GT1-7 cells (10 nM GLP-1: 7.66+/-0.4 vs. control: 0.23+/-0.02 nmol/mg protein; P < 0.001). Intracerebroventricular injection of GLP-1 at a single concentration (10 microg) produced a prompt increase in the plasma luteinizing hormone concentration in male rats (GLP-1: 1.09+/-0.11 vs. saline: 0.69+/-0.06 ng/ml; P < 0.005). GLP-1 levels in the hypothalami of 48-h-fasted male rats showed a decrease, indicating a possible association of the satiety factor with the low luteinizing hormone levels in animals with a negative energy balance.
    [Show full text]
  • Amylin: Pharmacology, Physiology, and Clinical Potential
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2015 Amylin: Pharmacology, Physiology, and Clinical Potential Hay, Debbie L ; Chen, Steve ; Lutz, Thomas A ; Parkes, David G ; Roth, Jonathan D Abstract: Amylin is a pancreatic ฀-cell hormone that produces effects in several different organ systems. Here, we review the literature in rodents and in humans on amylin research since its discovery as a hormone about 25 years ago. Amylin is a 37-amino-acid peptide that activates its specific receptors, which are multisubunit G protein-coupled receptors resulting from the coexpression of a core receptor protein with receptor activity-modifying proteins, resulting in multiple receptor subtypes. Amylin’s major role is as a glucoregulatory hormone, and it is an important regulator of energy metabolism in health and disease. Other amylin actions have also been reported, such as on the cardiovascular system or on bone. Amylin acts principally in the circumventricular organs of the central nervous system and functionally interacts with other metabolically active hormones such as cholecystokinin, leptin, and estradiol. The amylin-based peptide, pramlintide, is used clinically to treat type 1 and type 2 diabetes. Clinical studies in obesity have shown that amylin agonists could also be useful for weight loss, especially in combination with other agents. DOI: https://doi.org/10.1124/pr.115.010629 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-112571 Journal Article Published Version Originally published at: Hay, Debbie L; Chen, Steve; Lutz, Thomas A; Parkes, David G; Roth, Jonathan D (2015).
    [Show full text]
  • Glucose-Dependent Insulinotropic Polypeptide (GIP): from Prohormone to Actions in Endocrine Pancreas and Adipose Tissue
    PHD THESIS DANISH MEDICAL BULLETIN Glucose-dependent Insulinotropic Polypeptide (GIP): From prohormone to actions in endocrine pancreas and adipose tissue Randi Ugleholdt The two incretins, glucagon-like peptide 1 (GLP-1) and glu- This review has been accepted as a thesis with two original papers by University of cose dependent insulinotropic polypeptide (gastric inhibitory Copenhagen 14th of December 2009 and defended on 28th of January 2010 peptide, GIP) have long been recognized as important gut hor- mones, essential for normal glucose homeostasis. Plasma levels Tutor: Jens Juul Holst of GLP-1 and GIP rise within minutes of food intake and stimulate Official opponents: Jens Frederik Rehfeld, Baptist Gallwitz & Thure Krarup pancreatic β-cells to release insulin in a glucose-dependent man- ner. This entero-insular interaction is called the incretin effect and Correspondence: Department of Biomedical Sciences, Cellular and Metabolic Re- search Section, University of Copenhagen, Faculty of Health Sciences, Blegdamsvej accounts for up to 70% of the meal induced insulin release in man 3B build. 12.2, 2200 Copenhagen N, Denmark and via this incretin effect, the gut hormones facilitate the uptake of glucose in muscle, liver and adipose tissue (2). Although the E-mail: [email protected] pancreatic effects of these two gut hormones have been the target of extensive investigation both hormones also have nu- merous extrapancreatic effects. Thus, GLP-1 decreases gastric Dan Med Bull 2011;58:(12)B4368 emptying and acid secretion and affects appetite by increasing fullness and satiety thereby decreasing food intake and, if main- THE TWO ORIGINAL PAPERS ARE tained at supraphysiologic levels, eventually body weight (3).
    [Show full text]
  • The Enteral Insulin-Stimulation After Whipple's Operation
    Diabetologia 11, 207--210 (1975) by Springer-Verlag 1975 The Enteral Insulin-Stimulation after Whipple's Operation J. F. Rehfeld, F. Stadil, H. Baden and K. Fischerman Dept. of Clinical Chemistry and Surgical Gastroenterology (F), Bispebjerg Hospital; Dept. of Surgical Gastroenterology (C), Rigshospitalet; and Dept. of Surgical Gastroenterology (S), Gentofte Hospital, Hellerup, Denmark Received: January 20, 1975, and in revised form: March 17, 1975 Summary. The insulin response to oral and intravenous The results suggest, that hormones from the first part of the glucose was measured in ten patients after resection of intestinal tract are not necessary as incretins. antrum, duodenum, proximal jejunum, and the head of pan- creas (Whipple's operation). Compared to matched normal Key words: Gastrin, gastrointestinal hormones, glucose, subjects the operation reduced neither We total nor the gut incretin, insulin secretion, pancreatico-duodenectomy. hormone induced part of the insulin response to oral glucose. Oral ingestion of glucose in man causes an insulin before each test. After an overnight fast the examina- response more than twice as big as that to parenteral tion began between 8 : 00 and 9 : 00 a.m. glucose infusion [4, 6, 7]. This phenomenon has been attributed to an enteral factor called incretin [15], Experimental Procedure but the nature of incretin is still uncertain. Hormones of the upper digestive tract -- gastrin Oral Glucose Tolerance Test [2], cholecystokinin [2, 5], secretin [2], and gastric The subjects were given 50 g glucose as a 25 per inhibitory polypeptide (GIP) [3] -- have all proved cent solution flavoured with lemon. Blood samples insulinogenic in high doses.
    [Show full text]
  • Inhibition of Gastrin Release by Secretin Is Mediated by Somatostatin in Cultured Rat Antral Mucosa
    Inhibition of gastrin release by secretin is mediated by somatostatin in cultured rat antral mucosa. M M Wolfe, … , G M Reel, J E McGuigan J Clin Invest. 1983;72(5):1586-1593. https://doi.org/10.1172/JCI111117. Research Article Somatostatin-containing cells have been shown to be in close anatomic proximity to gastrin-producing cells in rat antral mucosa. The present studies were directed to examine the effect of secretin on carbachol-stimulated gastrin release and to assess the potential role of somatostatin in mediating this effect. Rat antral mucosa was cultured at 37 degrees C in Krebs-Henseleit buffer, pH 7.4, gassed with 95% O2-5% CO2. After 1 h the culture medium was decanted and mucosal gastrin and somatostatin were extracted. Carbachol (2.5 X 10(-6) M) in the culture medium increased gastrin level in the medium from 14.1 +/- 2.5 to 26.9 +/- 3.0 ng/mg tissue protein (P less than 0.02), and decreased somatostatin-like immunoreactivity in the medium from 1.91 +/- 0.28 to 0.62 +/- 0.12 ng/mg (P less than 0.01) and extracted mucosal somatostatin-like immunoreactivity from 2.60 +/- 0.30 to 1.52 +/- 0.16 ng/mg (P less than 0.001). Rat antral mucosa was then cultured in the presence of secretin to determine its effect on carbachol-stimulated gastrin release. Inclusion of secretin (10(-9)-10(-7) M) inhibited significantly carbachol-stimulated gastrin release into the medium, decreasing gastrin from 26.9 +/- 3.0 to 13.6 +/- 3.2 ng/mg (10(-9) M secretin) (P less than 0.05), to 11.9 +/- 1.7 ng/mg (10(-8) secretin) (P less than 0.02), and to 10.8 +/- 4.0 ng/mg (10(-7) M secretin) (P less than […] Find the latest version: https://jci.me/111117/pdf Inhibition of Gastrin Release by Secretin Is Mediated by Somatostatin in Cultured Rat Antral Mucosa M.
    [Show full text]