Proc. Natd. Acad. Sci. USA Vol. 91, pp. 2679-2683, March 1994 Biochemistry Cloning and functional characterization of a third pituitary adenylate cyclase-activating polypeptide receptor subtype expressed in insulin-secreting cells (GTP-binding-protein-coupled receptor/gene family/phospholipase C/Ca signal) NOBUYA INAGAKI*, HIDEHIKO YOSHIDA*t, MASANARI MIZUTA*, NOBUHISA MIZUNO*, YASUKAZU FuJII*, TOHRU GONOIf, JUN-ICHI MIYAZAKI§, AND SUSUMU SEINO*I *Division of Molecular Medicine, Center for Biomedical Science, tDepartment of Oral Surgery, Chiba University School of Medicine, and tResearch Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260, Japan; and §Department of Disease-Related Gene Regulation Research (Sandoz), Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan Communicated by Donald F. Steiner, December 21, 1993 ABSTRACT Pituitary adenylate cycLase-activating poly- teins (2). Pharmacological studies have indicated that there peptide (PACAP) is a neuropeptide belonging to the vasoactive are at least two types ofPACAP receptor (PACAPR) (2). The intestinal polypeptide/glucagon/secretin family. It is widely PACAP type I receptor present in the central nervous sys- distributed in the body, and a variety ofbiological actions have tem, pituitary, adrenal medulla, and germ cells of the testis been reported. PACAP exerts its biological effects by binding binds PACAP with high affinity but binds VIP with 1000-fold to speciffic receptors that are coupled to GTP-binding proteins. lower affinity. In contrast, the PACAP type II receptor Recent studies have shown that there is a family of PACAP present in the lung, liver, and gastrointestinal tract binds receptors (PACAPRs), and two members of this family have PACAP and VIP with similar affinity. Recently, cDNAs been identified. We report here the cloning, functional expres- encoding PACAP type I (5-9) and type II (10) receptors have sion, and tissue distribution of a third PACAPR subtype, been cloned. designated PACAPR-3. The cDNA encoding PACAPR-3 has Regulation of insulin biosynthesis and secretion is crucial been isolated from a mouse insulin-secreting a-cell line MIN6 for glucose homeostasis in animals (11). As part of a project cDNA library. Mouse PACAPR-3 is a protein of 437 amino characterizing the proteins expressed in pancreatic , cells acids that has 50% and 51% identity with rat PACAP type I that may be involved in the regulation ofinsulin secretion, we and type H receptors, respectively. Expression of recombinant have amplified the cDNAs derived from pancreatic islets that mouse PACAPR-3 in mammalin cells shows that it binds to could encode G-protein-coupled receptors, by using poly- vasoactive intestinal polypeptide as well as PACAP-38 and -27, merase chain reaction (PCR). Here we report the cloning, with a slightly higher affinity for PACAP-38, and is positively sequence, and functional characterization ofathird PACAPR coupled to adenylate cycase. The expression of PACAPR-3 in subtype designated PACAPR-3,11 the tissue distribution of Xenopus oocytes indicates that calcium-activated chloride cur- which is distinct from that of PACAP type I and type II rents are evoked by PACAP and vasoactive intinal polypep- receptors. PACAPR-3 has similar binding properties to that tide, sggesting that PACAPR-3 can also be coupled to phos- of the type II receptor in that it binds both PACAP and VIP pholipase C. RNA blot analysis studies reveal that PACAPR-3 with high affinity. Heterologous expression studies have mRNA is expressed at high levels in MIN6, at moderate levels indicated that PACAPR-3 can be coupled to phospholipase C in pancreatic islets and other insulin-secreting cell lines, HIT- as well as to adenylate cyclase. Interestingly, PACAPR-3 is T15 and RINm5F, as well as in the lung, brain, stomach, and expressed in pancreatic islets and insulin-secreting cell lines colon, and at low levels in the heart. Furthermore, insulin including MIN6 (12), HIT-T15, and RINm5F. Since secretion from MIN6 cells is scantiy stimulated by PACAP-38 stimulates insulin secretion in MIN6 cells, PAC- PACAP-38. These results suggest that the diverse biological APR-3 may play a physiological role in the regulation of effects of PACAP are mediated by a family of structurally insulin secretion. related proteins and that PACAPR-3 participates in the regu- lation of insulin secretion. MATERIALS AND METHODS Pituitary adenylate cyclase-activating polypeptide (PACAP) General Methods. Standard methods were carried out as is a neuropeptide of the vasoactive intestinal polypeptide described (13, 14). Total cellular RNA was isolated by the (VIP)/glucagon/secretin family of peptides (1). PACAP is guanidinium isothiocyanate/CsCl procedure. DNA sequenc- widely distributed, occurring in the central nervous system ing was done by the dideoxynucleotide chain-termination and peripheral tissues such as pituitary, adrenal medulla, procedure after subcloning appropriate DNA fragments into testis, gastrointestinal tract, and pancreas. PACAP has di- M13 mp18 or mpl9. Both strands were sequenced. Radiola- verse biological effects that are tissue-specific (2). Two forms beled and unlabeled peptides were purchased from Peninsula of PACAP, PACAP-38 and PACAP-27, sharing the same Laboratories and the Peptide Institute (Osaka), respectively. N-terminal 27 peptides, are derived by tissue-specific pro- Cloning of cDNA Encoding a G-Protein-Coupled Receptor. teolytic processing of a 176-amino acid precursor protein (3) First-strand cDNA was prepared using 10 ug of total rat and are present at various concentrations in different tissues, pancreatic islet RNA, reverse transcriptase (Superscript, suggesting different processing in various tissues (4). PACAP exerts its biological effects by binding to high- Abbreviations: PACAP, pituitary adenylate cyclase-activating poly- affinity receptors that are coupled to GTP-binding (G) pro- peptide; PACAPR, PACAP receptor; VIP, vasoactive intestinal peptide; G protein, GTP-binding protein; PHM, peptide histidine methionine; GIP, gastric inhibitory peptide. The publication costs ofthis article were defrayed in part by page charge fTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" 'The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. D28132). 2679 Downloaded by guest on September 23, 2021 2680 Biochemistry: Inagaki et al. Proc. Nat!. Acad. Sci. USA 91 (1994) Met Arg Ala Ser Val C)A(A/T/CXG/A/T/C)A(G/A)(G/A/T/C)CC(T/C)TG(G/ GTTGCTGTCGGACCGTGCTGCTGAGGCGCCAAGGACCGAGGCAGCACGCTGAGCCCAAG ATG AGG GCG TCG GTG 10 20 A)AA-3'], respectively. The PCR products were further Val Leu Thr Cys Tyr Cys Trp Leu Leu Val Arg Val Ser Ser Ile His Pro Glu Cys Arg GTG CTG ACC TGC TAC TGC TGG TTO CTG GTG CGG GTG AGC AGC ATC CAT CCA GAA TGT CGC amplified using the sense and antisense primers GS-3 [5'- 30 40 Phe His Leu Glu Ile Gln Glu Glu Glu Thr Lys Cys Ala Glu Leu Leu Ser Ser Gln Thr TGG(A/T/C)T(G/A/T/C)(T/C)T(G/A/T/C)GT(G/A/T/ TTT CAT CTA GAA ATA CAA GAA GAA GAG ACA AAA TGT GCA GAG CTG CTA AGC AGC CAA ACG 50 v 60 C)GA(G/A)GG-3'] and GS-2, respectively. The PCR was Glu Asn Gln Arg Ala Cys Ser Gly Val Trp Asp Asn Ile Thr Cys Trp Arg Pro Ala Asp GAG AAT CAG AGA GCC TGC AGC GGT GTC TGO GAC AAC ATC ACA TGC TOG CGC CCG GCA GAC performed for 40 cycles under the following conditions: 70 80 denaturation for 1 min at annealing for 1 min at 450C, Val Gly Glu Thr Val Thr Val Pro Cys Pro Lys Val Phe Ser Asn Phe Tyr Ser Arg Pro 94TC, GTT GGG GAA ACT GTC ACA GTO CCC TGC CCC AAA GTA TTC AGC AAT TTC TAC AGC AGA CCA and extension for 1 min at 72TC. The PCR products of --480 v 90 T 100 Gly Asn Ile Ser Lys Asn Cys Thr Ser Asp Gly Trp Ser Glu Thr Phe Pro Asp Phe Ile bp were gel-purified and cloned into M13 mpl8 and se- GGA AAC ATA AGC AAA AAC TGC ACT AGC GAT GGA TOG TCA GAG ACA TTT CCA GAT TTC ATA 110 120 quenced. One of the PCR products, rGLR66, encoded a Asp Ala Cys Gly Tyr Asn Asp Pro Glu Asp Glu Ser Lys Ile Ser Phe Tyr Ile Leu Val GAT GCG TGT GGC TAC AAC GAC CCC GAG GAT GAG AGT AAG ATC TCG TTT TAT ATT TTG GTO putative receptor for VIP/glucagon/secretin family. A MIN6 130 140 Lys Ala Ile Tyr Thr Leu Gly Tyr Ser Val Ser Leu Met Ser Leu Thr Thr Gly Ser Ile cDNA library has been made from a mouse insulin-secreting AAG GCC ATT TAT ACC TTO GGC TAC AGT GTT TCT CTG ATO TCT CTT ACA ACA GGA AGC ATA 150 160 cell line, MIN6 cells (12), in the vector AZAP 11 (Stratagene), Ile Ile Cys Leu Phe Arg Lys Leu His Cys Thr Arg Asn Tyr Ile His Leu Asn Leu Phe ATT ATC TGC CTC TTC AGG AAG CTG CAC TOC ACA AGG AAC TAC ATC CAC CTA AAC CTC TTC and S x 105 plaques were- screened by hybridization with a 170 180 a A Leu Ser Phe Met Leu Arg Ala Ile Ser Val Leu Val Lys Asp Ser Val Leu Tyr Ser Ser 32P-labeled rGLR66 DNA fragment as probe. full-length CTC TCC TTC ATO CTG AGA GCC ATC TCT GTG CTG GTC AAG GAC AGC GTO CTC TAC TCC AGC cDNA a A mouse GLR66 was 190 200 encoding (termed AmGLR66) Ser Gly Leu Leu Arg Cys His Asp Gln Pro Ala Ser Trp Val Gly Cys Lys Leu Ser Leu isolated from this library and sequenced.