Nyctereutes Procyonoides) Population in the Invaded Territories and Their Impact on Ecosystem

VYTAUTAS MAGNUS UNIVERSITY

Loreta GRICIUVIENƠ

THE FORMATION OF GENETIC STRUCTURE OF RACCOON DOGS (NYCTEREUTES PROCYONOIDES) POPULATION IN THE INVADED TERRITORIES AND THEIR IMPACT ON ECOSYSTEM

Doctoral Dissertation Biomedical sciences, ecology and environmental (03 B)

Kaunas, 2016 UDK 575:591

Gr-296

The disertation was prepared during the period of 2010-2015 at Vytautas Magnus University

Scientific supervisor: prof. dr. Jana Radzijevskaja (Vytautas Magnus University, biomedical sciences, biology - 01B)

Scientific consultant: prof. dr. Algimantas Paulauskas (Vytautas Magnus University, biomedical sciences, ecology and environmental - 03B)

ISBN 978-609-467-210-1

2 VYTAUTO DIDŽIOJO UNIVERSITETAS

Loreta GRICIUVIENƠ

USǋRINIǏ ŠUNǏ (NYCTERUETES PROCYONOIDES) POPULIACIJǏ GENETINƠS STRUKTǋROS FORMAVIMASIS INVAZINƠSE TERITORIJOSE

IR JǏ POVEIKIS EKOSISTEMOMS

Daktaro disertacija Biomedicinos mokslai, ekologija ir aplinkotyra (03 B)

Kaunas, 2016

Disertacija rengta 2010-2015 metais Vytauto Didžiojo universitete

Mokslinis vadovas: prof. dr. Jana Radzijevskaja (Vytauto Didžiojo universitetas, biomedicinos mokslai, biologija - 01B)

Konsultantas: prof. dr. Algimantas Paulauskas (Vytauto Didžiojo universitetas, biomedicinos mokslai, ekologija ir aplinkotyra - 03B)

TABLE OF CONTENTS

ABBREVIATIONS ______7 INTRODUCTION ______8 1. LITERATURE REVIEW ______12 1.1 Invasive species ______12 1.1.1 Biological and ecological characterization of raccoon dog ______14 1.1.2 Interactions with native predators ______19 1.2 Impact on biodiversity ______20 1.2.1 Predation on native fauna and impact on prey species ______20 1.2.2 Import and enhancement of diseases and parasites on the native fauna ______21 1.3 Distribution of raccoon dogs ______23 1.3.1 Subspecies ______24 1.3.2 Acclimatization of the raccoon dog ______24 1.3.3 Spreading in Europe ______25 1.3.4 Reasons of successful range expansion ______28 1.4. The use of genetic tools in the investigation of raccoon dogs ______29 1.5 Investigations on morphometry of the raccoon dog ______32 2. MATERIALS AND METHODS ______34 2.1 Osteometrical measurements ______34 2.2 Samples for genetic study ______35 2.3 DNA extraction ______35 2.4 Determination of DNA concentration and purity ______36 2.5 The analysis of the mitochondrial control region in raccoon dogs ______36 2.5.1 DNA amplification ______36 2.5.2 Agarose gel electrophoresis ______37 2.5.3 DNA sequencing ______37 2.5.4 Mitochondrial DNA sequence data analysis ______37 2.6 Microsatellite genotyping ______40 2.6.1 DNA amplification ______40 2.6.2 Polyacrylamide gel electrophoresis ______41 2.6.3 Capillary electrophoresis ______42 2.6.4 Analysis of microsatellite data ______43 2.8 Bioinvasion impact assessment on racoon dogs ______44

5 2.9 Molecular detection of tick-borne pathogens in raccoon dogs ______46 2.9.1 DNA extraction from ticks ______46 2.9.2 PCR amplification ______47 2.9.2.1 Molecular detection of Babesia spp ______47 2.9.2.2 Molecular detection of Bartonella spp ______48 2.9.2.3 Molecular detection of Ricketsia spp ______48 2.9.2.4 Molecular detection of Borrelia burgdorferi s.l ______48 2.9.2.6 Molecular detection of Anaplasma phagocytophilum ______49 2.9.2.7 Molecular detection of Francisella tularensis ______50 2.9.3 PCR screening and DNA sequencing ______50 2.10 Investigation of infectious and parasitic diseases of raccoon dogs ______50 3. RESULTS ______52 3.1 Variability of skull morphometric characters in raccoon dogs ______52 3.2 Mitochondrial DNA control region analysis of raccoon dogs ______54 3.3 Population genetic study of the raccoon dog using microsatellite markers ______61 3.4 Assessment of bioinvasion impact on racoon dogs ______69 3.5 Detection and characterization of tick-borne pathogens in raccoon dogs ______71 3.6 Investigation of infectious and parasitic diseases of raccoon dogs ______75 4. DISCUSSION ______78 CONCLUSIONS ______89 LIST OF PUBLICATIONS ______90 ACKNOWLEDGEMENTS ______92 REFERENCES ______93

6 ABBREVIATIONS

AMOVA - Analysis of Molecular Variance BI - Bayesian inference BIC - Bayesian information criterion BINPAS - Bioinvasion Impact/Biopollution Assessment System BPL - Biopollution Level CBL - Condylobasal length DAISIE - Delivering Alien Invasive Species In Europe DNA - Deoxyribonucleic Acid EFSA - The European Food Safety Authority FCA - Factorial Correspondence Analysis FISH - Fluorescence In Situ Hybridization HWE - Hardy-Weinberg Equilibrium IBD - Isolation By Distance IC - Interorbital constriction LT - Length of lower tooth row MCMC - Markov Chain Monte Carlo MH - Mandible height ML - Mandible length ML - maximum likelihood MP - maximum parsimony mtDNA - Mitochondrial DNA NJ - neighbor-joining ORV - Oral Rabies Vaccination PC - Postorbital constriction PCR - Polymerase Chain Reaction RAPD - Random Amplified Polymorphic DNA rRNA - ribosomal Ribonucleic Acid STR - Short Tandem Repeats UPGMA - Unweighted Pair Group Method with Arithmetic mean WHO - World Health Organization ZB - Zygomatic breadth

7 INTRODUCTION

The raccoon dog Nyctereutes procyonoides (Gray, 1834) is a newly established alien species that has had a long and complicated history of introduction and immigration within Europe (Ansorge et al., 2009). After active introductions and acclimatisation in the European part of Russia, the raccoon dog has dispersed into new areas without active human support and has spread rapidly into many European countries (Bobrov et al., 2008; Ansorge et al., 2009; Drygala et al., 2010; Kauhala and Kowalczyk, 2011). Within 50 years (1935–1984), raccoon dogs had colonised over 1.4 million square kilometres of Europe (Nowak, 1973; Helle and Kauhala, 1991) and became the most numerous carnivores in many areas (JĊdrzejewska and JĊdrzejewski, 1998; Sidorovich et al., 2000). There are a few factors that make the raccoon dog especially successful in conquering new areas: resistance to diseases, high reproductive capacity, tendency to wander, adaptability to different climatic and environmental conditions, omnivorous feeding habit and overwintering strategy (Lavrov, 1971; Helle and Kauhala, 1995; Kauhala et al., 2007; Kowalczyk et al., 2008, 2009; Pitra et al., 2010; Sutor et al., 2010). Raccoon dog is included in Recommendation No. 77 of the Convention on the Conservation of European Wildlife and Natural Habitats among invasive species, which have proved to be a threat to the biological diversity and should be eradicated. In some countries (e.g. in Sweden, Lithuania), raccoon dogs may be hunted throughout the year. The invasive species severely affect autochthonous ecosystems and may damage biological diversity (Sutor et al., 2013). Alien species may alter the habitat, and predate on or compete with native fauna or be important vectors of diseases and parasites (Vilà et al., 2010). The raccoon dog is found among the 100 worst alien species in Europe (Drake, 2009). In Lithuania, raccoon dogs like a pest species have an effect on various levels of biological organisation: genetic, population, community and habitat/ecosystem and damage for rodent, bird, insect, amphibian, and reptile populations. This carnivore should receive more attention in disease prevention for its potential as a reservoir for zoonotic diseases. N. procyonoides will continue its expansion in Europe with its impact on the epidemiology of transmissible diseases (Sutor et al., 2013). In Lithuania, raccoon dogs have been noticed since 1948 (Prǌsaitơ et al., 1988; Balþiauskas, 1996). Showing great plasticity in adaptation to various environmental and climatic conditions, they have spread into different areas of Lithuania and by 1960 had colonised the whole country (Prǌsaitơ et al., 1988). Detailed studies of variation in ecology, morphology, behaviour, and genetic traits at the population of raccoon dog are lacking. Genetic studies play a major role in understanding the

8 geographic patterns of invasion and range expansion, the potential for colonisation and establishment (Avise, 2000). In previous studies, genetic diversity, population structure, and phylogeography of raccoon dogs (Pitra et al., 2010; Korablev et al., 2011; ĝlaska et al., 2008; ĝlaska et al., 2011) have been investigated based on such molecular genetic markers as mitochondrial DNA, RAPD and microsatellite markers (Rogalska-Niznik et al., 2003; ĝlaska et al., 2008; Hayashizono et al., 2010; Hong et al., 2013). However, the data on genetic diversity, formation of population structure and phylogeography of the raccoon dogs in the recently invaded territories are still scarce. The Lithuanian raccoon dog population could be used as a model (i) to assess the genetic diversity of raccoon dogs, which invaded a new territory from different locations of introduction, and (ii) to investigate the impact of anthropogenic pressure (intensive hunting, habitat fragmentation by major roads, intensive traffic) on the formation of population structure. Morphological investigations of non-metric and metric skeletal characters also reflect the genetic background of the phenotypic appearance (Ansorge et al., 2009).

The aim of the research: to investigate the genetic structure of raccoon dog populations in invaded territories and assess the impact on the ecosystems.

The main tasks of the research: 1. To investigate the pattern of metric variability of the skull in invasive populations of raccoon dogs and to compare those with autochthonous populations. 2. To evaluate the phylogeographic structure of the raccoon dogs based on sequence polymorphisms of the mtDNA control region. 3. To investigate the impact of anthropogenic pressure on the formation of population structure and the genetic diversity of raccoon dogs using microsatellite markers. 4. To evaluate the impact of raccoon dogs on the ecosystem.

Defensive propositions: 1. The patterns of metric variability of the skulls in invasive populations of raccoon dogs were larger than those of native range raccoon dogs. 2. The raccoon dog population from Lithuania has a higher genetic diversity compared with those from Northern-Western Europe, however a lower genetic diversity as compared with raccoon dogs from autochthonous and introduced to the European part of Russia populations. 3. Anthropogenic pressure and behaviour have impact on the formation of population structure and genetic diversity of raccoon dogs.

9 4. In Lithuania, raccoon dogs have high impact on the environment. 5. The raccoon dog acts as a potential reservoir for endemic parasites and pathogens.

The novelty of the research For the first time, genetic variability and population structure of the invasive raccoon dogs inhabiting Lithuania were investigated. The phylogeographic structure of raccoon dogs from colonised areas in the Baltic region was assessed and compared with those from Northern and Western Europe and areas of native distribution range. During the study, 22 mtDNA D-loop sequences of raccoon dogs were submitted to the GenBank sequences database (accession numbers: KC344215- KC344235 (Lithuania), KC509604 (Latvia)). Nine haplotypes were identified from which one was unique and registered in GenBank for the first time. A new set of microsatellite markers previously developed for Nyctereutes procyonoides koreensis and described in canine genome studies was applied for the first time for genetic characterisation of Nyctereutes procyonoides ussuriensis. The Lithuanian raccoon dog population was used as a model to assess the genetic diversity of raccoon dogs that invaded a new territory from different locations of introduction and showed significant impact of anthropogenic pressure (intensive hunting, habitat fragmentation by major roads, intensive traffic) on the formation of population genetic structure. Furthermore, the osteometrical analysis of raccoon dogs’ skulls collected in 1957 (just after 10 years of their invasion to Lithuania), compared with those obtained in 2007 and with indigenous populations, that was carried out for the first time, showed the formation of new morphometric parameters of skull. The impact of raccoon dogs for community, habitat, and ecosystems and biopollution level were assessed. The epidemiological situation of sarcoptic mange and trichinellosis in invasive raccoon dog, native red fox and Eurasian badger were analysed. For the first time, ectoparasites (ticks) of raccoon dogs were investigated for presence of causative agents of tick- borne diseases. Protozoan parasite Babesia microti, rickettsial pathogens (Rickettsia helvetica, Rickettsia monacensis, Anaplasma phagocytophilum and Bartonella spp.), and Lyme borreliosis (B. afzelii and B. valaisiana) and relapsing fever (B. miyamotoi) spirochetes were identified and their sequences were submitted to GenBank (JN181079 - JN181081, JN181115 - JN181117, KTO33401).

10 Approval of the work Regarding the topic of the dissertation, 4 publications were published: 2 publications were published in the journal, which has an impact factor at the ISI database Science Citation Index Expanded (Web of Science); 2 publications were published in the journals, which are reviewed at the ISI database Zoological Record (Thompson Reuters). The main results of this research were presented at the following conferences and meetings: 1.“85th Annual Conference of the German Society of Mammalogy” (Luxembourg, Luxembourg, 2011). 2.“8th European Vertebrate Pest Management Conference” (Berlin, Germany, 2011). 3.“8th Baltic Theriological Conference” (Palanga, Lithuania, 2011). 4.“International Conference Molecular Ecology” (Viena, Austria, 2012). 5. “7th European Conference on Invasive Alien Species” (Pontevedra, Spain, 2012). 6. “5th Baltic Congress of Genetics” (Kaunas, Lithuana, 2012). 7.“International Biogeography Society” (Miami, Florida, USA, 2012). 8.“The vital nature sign: 7th international scientific conference” (Kaunas, Lithuania, 2013). 9.”7th international conference Research and conservation of biological diversity in Baltic Region” (Daugavpils, Latvia, 2013). 10. “2nd International Symposium on Hunting” (Novi Sad, Serbia, 2013). 11. “8th international conference on biological invasions: from understanding to action” (Antalya, Turkey, 2014). 12. “The vital nature sign: 8th international scientific conference” (Kaunas, Lithuania, 2014). 13. ”8th international conference Research and conservation of biological diversity in Baltic Region” (Daugavpils, Latvia, 2015).

11 1. LITERATURE REVIEW

1.1 Invasive species

We need to have a common understanding of how a species becomes invasive. A species must passs through the stages of invasion process to become established (Fig.1) (Sakai et al., 2001). The first of these, species transportation through human agency, which facilitates the movement of species beyond it native range. Another group of species is those that intentionally moving species. When species survive passage and arrives in region beyond its native range are refered to as introduced (Sakai et al., 2001). After successful colonization, species begins reproducing without human intervention and form a self-sustaining population, which is considered to be as established (Sakai et al., 2001; Keler, 2011). Newly established species has a lag period between species colonization and rapid population growth. This lag time is often interpreted as an ecological phenomenon, including adaptations to the new habitat and genetic adaptation (Sakai et al., 2001). Another stage of invasion process is dispersal by the species themselves (Keler, 2011). Rapid range expansion will be influenced by ability to survive in a particular ecological niche and reproduce in the new environment (Crawley et al., 1986). Most attention has been focused on the impact of invasive species on native species, communities, and ecosystems by ecologists for several decades (Lodge, 1993a, 1993b). It is known that alien invasive species negatively impact many native species and almost all ecosystems, on the European economy, and on human health (Vilà et al., 2010). Economic impacts of these species are estimated to range from milions to 12.5 billion EUR per year (Kettunen et al., 2009). For the impacts of invasive species scientists work in understanding and forecasting the process of invasion and methods that the problems of invasive species could be reduced (Keler, 2011). Based on the datebase DAISIE (Delivering Alien Invasive Species In Europe), the number of extant alien mammals species in Europe is 44, 33 of which are defined as self- sustaining populations. The most common and widely distributed species in over 10 European countries are: brown rat (Rattus norvegicus), muskrat (Ondatra zibethicus), American mink (Mustela vison), racoon (Procyon lotor) and raccoon dog (Nyctereutes procyonoides), coypu (Myocastor coypus), fallow deer (Dama dama), sika deer (Cervus nippon) (Genovesi et al., 2009). These invasive mammals are not native in Europe, and cause a severe negative impact in the invaded areas. The number of invasive species per country are: Germany with 31 species, United Kingdom with 30, Denmark with 18, mainland France with 16, the Czech Republic with 16, Russia with 15 and Italy with 14 (Genovesi et al., 2009).

Can invasiveness be predicted by life history traits? Are there genetic differences between invasive and non-invasive populations? How do the genetic diversity and biology of invasive Native Elsewhere species differ in their native ad introduced areas?

Are there interactions with vectors that affect the likelihood of invasion? Survival in Transport What factors affect propagule pressure, and how is propagule pressure related to likelihood of establishment? Prevention Is environmental tolerance greater in invasive species? How does the recipient environment affect the degree of invasiveness? Establish in New areas Are particular life history stages better targets for management of invasive species?

Is the lag period explained by exponential growth,

stochastic extinction of propagules or evolutionary

change following colonization? Lag period Can modes be used to better predict species that may eventually undergo rapid spread?

Eradication How does dispersal mode or reproductive system affect spread? What is the potential for rapid evolution? Spread Can knowledge of genetic structure of invasive improve management? How does landscape structure influence spread?

What are the impacts of invasive species on biodiversity and how can these be measured? Ecological Imapct Are effects on invasive linear, or does invasive meltdown occur? What factors (propagules pressure, diversity) determine the impact of invasive species on resident species and communities?

Control/Restoration Human Impact What are the economic impacts of invasive species? What traits of invasive or native species allow prediction of the success of restoration efforts?

Fig.1. Generalized steps in invasion process and their relationship to managemenet of invasive species (modified from Lodge, 1993b and Kolar; Lodge, 2001)

13 1.1.1 Biological and ecological characterization of raccoon dog

Physical description. The raccoon dog (Nyctereutes procyonoides), medium-sized carnivore has the appearance of a small fox-like canid with the fur markings similar to those of raccoons (Procyon lotor). The average body length is typically 50 - 68 cm, with the tail length an additional 13 - 25 cm. Legs are short, and overall the body is stocky (Ward and Wurster-Hill, 1990). Body weights of raccoon dog fluctuate according to season. In late autumn it may be 50-70% higher than in spring (Kauhala, 1993). Weight decreases during winter, and starts to increase in March or April, reaching maximum values in August to November (Nowak, 1993). In autumn male raccoon dogs weigh 4.9 – 12 kg, females on the same months 4.6 – 10.3 kg, whereas in spring male raccoon dogs weigh 3.3 – 6.1 kg and females 2.8 – 6.2 kg (Prǌsaitơ et al., 1988). Height ranges from 37 to 39 cm. Raccoon dog has dense and long fur, in a mixture of black, grey, brown and white (Nowak, 1993). The ears are rounded and almost hidden in the hair (Prǌsaitơ et al., 1988). The dental formula is incisors 3/3, canine 1/1, premolars 4/4, and molars 2/3, total 42. Raccoon dogs have small and weak carnassials and relatively large molars (Ward and Wurster- Hill, 1990).

Ecology. Habitat use. Raccoon dogs is distributed across a wide variety of habitats, from agricultural landscapes to subtropical rainforests and suburban areas (Saeki et al., 2007; Kauhala and Auttila, 2010; JĊdrzejewska and JĊdrzejewski, 1998), and their habitat use varies between the introduced and natal ranges (Kauhala, 1996a). Raccoon dogs utilize the burrows of other denning carnivores as badgers (Meles meles), foxes (Vulpes vulpes) and beavers (Castor fiber) in variuos forest habitats. Dens can be constituted by cavity under big rocks, they often use trunks, branches, or roots of fallen trees for shelters (Prǌsaitơ et al., 1988; Kowalczyk et al., 2008). Wild boar feeding sites and nests are also visited by active raccoon dogs (Süld et al., 2014). In contrast to foxes and especially badgers, raccoon dogs rarely dig they own burrows (Nowak, 1993). They are clever opportunist to habitat changes, and can survive in Europe in habitats which are not found in its original distribution area, including coniferous forests, steppe and semi-deserts. In the Russian Far East the raccoon dog show preference to open landscapes, especially damps meadows and agricultural land and avoid dark forests (Nasimovic and Isakov, 1985; Judin, 1977). A study in north-eastern Germany showed more or less avoidance of open farmland (exept during the pup-rearing period), meadows and settlements (villages and farms) (Drygala, 2008). In southern Brandenburg (Germany) grassland and coniferous woods were

14 ranked highest throughout the year and in winter coniferous woods was even more intense than grassland. This behaviour might be related to well-insulated places (badger sets, hollow trees), which provide thermoregulation benefits and help save energy, especially during winter hibernation (Kowalczyk and Zalewski, 2011). In southern Finland raccoon dogs prefer meadows, open woodlands, deforested areas and gardens, because these habitats offer varying food availability (Kauhala and Auttila, 2010). In a Lithuanian study area with 85 % forest cover, raccoon dogs favoured mixed forest, but also used open habitats, mainly swamps (Baltrǌnaitơ, 2006, 2010). The species showed preference for forest and wetlands in Sweden and Ukraine (Herfindal et al., 2012; Woloch and Roženko, 2007). The last study on habitat use was conducted by Melis et al. (2015) within the middle boreal forest region of northern Sweden. The raccoon dogs were more frequently observed in agriculture and wetlands areas, closer to water and roads, at lower altitudes and in gentler slopes (Melis et al., 2015). This shows a habitat selection of raccoon dogs towards water or wetland areas (Baltrǌnaitơ, 2006, 2010) and areas associated with humans (agriculture areas) (Kauhala and Auttila, 2010; Drygala, 2008), which may be related to the increase of food availability. Population density. Because of its nocturnal and secretive behavour estimating the population density of raccoon dogs is difficult (Stiebling, 1999). Physical factor such as climate can causes regional variation in the population density, because availability and abundance of food is greatly affected by climate (Clutton-Brock and Harvey, 1978). In raccoon dog’s native distribution area (Far East with severe winters), population densities were about 0.1 - 2.0 adults/km² (Nasimovic and Isakow, 1985). The density of raccoon dog population is highest in the southern and lowest in the northern provinces of Finland (Helle and Kauhala, 1995). In south-eastern Finland the maximum population density was estimated to be about 0.77 and 2.1 adults/km² and in south Finland maximum population densities ranged between 0.8 and 2.2 adults/km² (Kauhala et al., 2006; Kauhala et al., 2010). In North-Eastern Poland (Suwaáki Landscape Park), Goszczynski (1999) estimated population density as 0.37 adults/km², whereas in the Bialowieza forest raccoon dog density was 0.17 - 0.5 adults/km², as compared to 0.25 - 0.35 foxes and 0.13 - 0.21 badgers (Kowalczyk, 2008). According to Stiebling (1999) raccoon dogs in Brandenburg (Germany) reached densities of 0.12 - 0.22 adults/km². In further investigations in Mecklenburg–Western Pomerania (50 km west of the German-Polish border) the calculated population density was 0.95 adults/km² (Drygala et al., 2008b). In East Germany, raccoon dog density was determined for summer period of 4.90 adults/km² and 1.1 adults/km² during winter (Sutor and Schwarz, 2012). From these data it can be concluded, that further increase in population density is expected in North-Eastern Germany (Drygala, 2009).

15 Home range and dispersal distances. The sizes of home ranges is strongly influenced by season, activity period and landscape type (Drygala et al., 2008a; Jedrzejewska and Jedrzejewski 1998; Asikainen et al., 2004). The home ranges of paired raccoon dogs overlap throughout the year (Kauhala and Holmala, 2006; Drygala et al., 2008b). According to Drygala et al. (2010) young individuals of raccoon dogs avoid to remain in their parental home ranges, because they would use resources without supporting the reproduction success of the breeding pair. Reported home range sizes of raccoon dogs varies from 177.2 ha in Japan (Saeki, 2001) to 700.0 ha (no winter home ranges data) in southern Finland (Kauhala et al., 1993b). In a study made in south- east Finland, Kauhala et al. (2006b) concluded that the mean dispersal distances, estimated on the basis of home range sizes, were 14 km for females and 19 km for males, with the mean maximum distances being 48 km and 71 km respectively. In a later study in northeastern Germany the mean and maximum dispersal distances of both sexes were 13.5 km and 91 km respectively (Drygala et al., 2010). In south Finland the maximum dispersal distance in a couple of months was 145 km (Kauhala and Helle, 1994). Juveniles of raccoon dogs usually disperse during their first autumn and some of them wander long distances by searching for a new suitable home range (Nasimoviþ and Isakov, 1985). In 1953 after the release an ear-tagged raccoon dog in western Ukraine, he was found in Poland after three years; it has roamed about 500 km (Nowak, 1973). Ecological corridors as a water systems and mosaic landscapes are used to facilitate migration by wide-ranging raccoon dogs, whereas mountain ranges and villages/towns may constitute very strong physical barriers to dispersion (Nowak, 1973; Sutor, 2008). Diet. N. procyonoides are true omnivores with a generalist and opportunist feeding behaviour (Nasimovic and Isakov, 1985; Sutor et al., 2010). Diet composition is mainly influenced according to season, landscape structure and availability of different food items (Nasimovic and Isakov, 1985; Sutor et al., 2010; Kauhala and Auniola, 2001). Amphibians (Rana spp., Bufo spp., Bombina spp. and Triturus cristatus) play a main role in raccoon dog diet in spring and summer (JĊdrzejewska and JĊdrzejewski, 1998; Kauhala, 1993; Sutor et al., 2010; Baltrǌnaitơ, 2006; Drygala, 2013). The other staple in the raccoon dog´s diet are small burrowing rodents in all seasons (Sidorovich, 2008; Nasimovic and Isakov, 1985). It may also be a serious predator of ground-nesting birds such as waterfowl (Barbu, 1972; Lavrov, 1971; Sutor et al., 2010). Although the raccoon dogs tends to kill sick or injured birds left behind by hunters (Samusenko and Goloduško, 1961; Barbu, 1972; Kauhala et al., 1993). Eggshell remains are rarely mentioned in the studies of raccoon dogs’ diet. For raccoon dogs, edible plant material (berries, fruits, maize, crops and seeds) is important food items the year round (Baltrǌnaitơ, 2006; Kauhala and Saeki, 2004). Carrion of large animals (wolf or lynx kills,

16 hunting waste or the natural death of ungulates) and crustaceans (crabs, crayfish) is also the food category that is consumed by raccoon dogs (Kauhala and Auttila, 2010; Baltrǌnaitơ, 2006; Selva et al., 2003). Raccoon dogs also profit the food in feeding places of wild boar (Süld et al., 2014). Wintering strategy. Nyctereutes are the only canid who prefer to hibernate in areas where winter is harsh (Kauhala and Saeki, 2004). The raccoon dog usually sleeps when the ambient temperature is < -10 °C, snow cover > 35 cm and day length < 7 h (Kauhala et al., 2007). In Finland, winter lethargy of raccoon dogs lasts until the weather starts to warm up, usually from November to March (Kauhala et al., 2007). In more southern areas, where winters are not so harsh, raccoon dogs do not hibernate (Drygala, 2008b). They put on sufficient fat between early summer and late autumn (Kauhala, 1993; Mustonen et al., 2007). In northern Finland, summers are apparently too short and winters period too long for juveniles to gather large fat reserves and to survive the upcoming winter (Kauhala, 1993; Kauhala and Helle, 1995). Seasonal accumulation of fat in the raccoon dog is characterized by hormonal changes (Nieminen et al., 2002). During hibernation raccoon dogs lose an averarge of about 43% of their body weight. Raccoon dogs lower their body temperature by 1.4 – 2.1 °C during dormancy. This physiological process is considered to be unique among canids, which could facilitate the successful expansion of raccoon dogs in northern Europe (Mustonen et al., 2007). Reproduction. The raccoon dog are strictly monogamous and the male helps out with rearing their offspring when female is foraging (Kauhala et al., 1993). Sexual maturity reach at 9 - 11 months of age. The mating period of raccoon dogs is between February and April, though it varies with region and climate (Nowak, 1993; Helle and Kauhala, 1995). This species has a high reproduction rate compared to other medium-sized carnivore species (Kauhala, 1996b). Average litter size range from 2 to 12, with the highest of 19 pups reported (Nowak, 1993). In study from eastern Poland, litter size varied from 4 to 12, with an average of 8.4 (Kowalczyk et al., 2009). In Lithuania litter size of raccoon dogs is 4 - 13 (usually 9 - 11) cubs (Prǌsaitơ et al., 1988). Variation in litter size at birth associated with body mass of the females; the females which is accumulated large fat reserves during autumn usually produce the most pups (Asikainen et al., 2002). Mortality and age. The lifespan of raccoon dogs is about 7 - 8 years in the wild, but up to 11 years in captivity (Helle and Kauhala 1993). According to Helle and Kauhala (1993), annual mortality rates exceed 50% for adults and 80% for juveniles in a stable population. Studies in the eastern Poland (BiaáowieĪa Forest) showed that the greatest mortality (98%) occurs during the first three years of their life and maximum life span is 7 years (Kowalczyk et al., 2009). Principal causes of mortality are:

17 x Natural sources of mortality. Raccoon dogs, especially puppies, fall victim to natural predators such as badgers, foxes, wolves, lynxes and brown bears (JĊdrzejewska and JĊdrzejewski, 1998). Consumption of ungulate carcasses left by larger predators is risky because they may become prey themselves when carcasses are revisited by wolves, lynx or scavenging birds (white-tailed eagles) (Kowalczyk et al., 2009; Selva et al., 2005). x Hunting and trapping. In many countries raccoon dogs are seldom hunted and trapped for their fur but rather due to their status as pests in Europe (Kauhala and Kowalczyk, 2011). In Japan raccoon dogs being classified as a game species, hunted by traps (foot-hold, snare, etc.) and sometimes with dogs and guns under licence from Wildlife Protection and Hunting Law, 1918 (Saeki and Macdonald, 2004). In many countries (Denmark, Norway, Estonia, Latvia and Lithuania) hunting is permitted all year round (Kauhala and Saeki, 2004). x Road kills. Traffic accidents may be an important cause mortality for wildlife (Oerlemans and Koene, 2008; Saeki and Macdonald, 2004; Kowalczyk et al., 2009). Dispersing of young animals might be more common in suffering traffic accidents than adults, which have stable and familiar home ranges (Saeki and Macdonald, 2004; Kowalczyk et al., 2009). In Japan the total number of raccoon dog killed in road accidents were 110.000 - 370.000 per year (Saeki and Macdonald, 2004). In 2002–2013, it was registered that 1066 individuals were killed on the roads in Lithuania (Balþiauskas and Balþiauskienơ, 2014). x Pathogens and parasites. Sarcoptic mange, a seriuos disease in raccoon dogs, is considered an important cause of mortality in native and introduced ranges (Kowalczyk et al., 2009). An increasing role of raccoon dogs in spreading of emerging zoonosis like echinococcosis and trichinellosis has been demonstrated (Oivanen et al., 2002; Deplazes et al., 2004; Holmala and Kauhala, 2006; Romig et al., 2006). The significance of the raccoon dog as a vector of rabies has been recognized in many European countries (reviewed by Kauhala and Kowalczyk, 2011).

Raccoon dogs became more abundant than native medium-sized carnivores - badgers and red foxes. Increasing population density of the raccoon dogs possibly causes a high rate of contact between individuals, and thus could facilitate transmission of parasites and diseases. Further studies are needed to evaluate the role of the raccoon dog for the introduction and transmission of various infectious and parasitic diseases. These data illustrate the ability of this medium-sized canid to reach areas far away in a comparatively short time, which contributes to the fast expansion of raccoon dogs.

18 1.1.2 Interactions with native predators

The raccoon dog competes or coexists with several native or non-native predators such as polecat (Mustela putorius), badger (Meles meles), stoat (Mustela ermine), American mink (Neovison vison), European otter (Lutra lutra), red fox (Vulpes vulpes), wolf (Canis lupus), white-tailed eagles (Haliaeetus Albicilla), and eagle owl (Bubo bubo) thoughout its range (Bobrov et al., 2008). Badgers and foxes are potential competitors with similar ecological niche, which may lead to minimal competition for foods, habitats or den use (Holmala, 2009). In southern Finland, the raccoon dog's food niche overlapped with badgers and foxes, however different dietary habits were observed. The fox have been shown to have carnivorous diet, while the raccoon dog the most omnivorous and plant material were the most important food resources for the badger (Kauhala et al., 1998a). In northern areas with harsh winters, both raccoon dogs and badgers face the possibility of food limitation. However, these two species are able to hibernate, so food competition between raccoon dog and badgers is expected to be absent or weak (Kauhala and Kowalczyk, 2011). In previous studies (Poland, Belarus and Lithuania) which have examined interspecific diet competition of raccoon dogs and red fox revealed high dietary overlaps in the cold season. Compared to winter, there was less overlap in their food habits in summer (Jedrzejewski et al., 1989; Sidorovich et al., 2000; Baltrǌnaitơ, 2002). During winter, food resources of raccoon dogs become narrower and studies shows that wild ungulate carrion can be important food resource for most predators in the coldest season (Sidorovich et al., 2000, 2008; JĊdrzejewska and JĊdrzejewski, 1998; Kidawa and Kowalczyk, 2011). Consumption of 47% carcasses by raccoon dogs has been observed in BiaáowieĪa (Selva et al., 2005). Competition for carrion is expected to be a result of reduced native carnivore pupulations, particularly in the case of polecats, also including the red fox and brown bear (Ursus arctos) (Sidorovich et al., 2000). Moreover, according to JĊdrzejewska and JĊdrzejewski (1998), highly (59%) overlapped food niche was estimated between the raccoon dogs and polecats in spring and autumn periods in BiaáowieĪa Forest. The settling of raccoon dogs in badger’s burrow may contribute to successful range expansion of raccoon dogs in Europe (Kowalczyk and Zalewski, 2011). The majority (88%) of badger sets were registered to be occupied by raccoon dogs in winter, whereas cohabitation of setts by two species was very rare (10%) in summer (Kowalczyk et al., 2008). Previous studies have shown that, 41% badger setts were recorded in Latvia (Slitere Nature Reserve), 8% badger setts used for reproduction in Lithuania (Žemaitija National Park), 24% badger setts were cohabited by raccoon dogs in Finland in winter and 12% in summer (Zoss, 1992; Uleviþius, 1997; Kauhala and Holmala, 2006). Sharing of burrows can lead to the risk of intraguild

19 predation (Kowalczyk et al., 2008). Indeed, two cases of killing of red fox and raccoon dog cubs by badgers were recorded (Kowalczyk et al., 2008; JĊdrzejewska and JĊdrzejewski, 1998).

1.2 Impact on biodiversity

1.2.1 Predation on native fauna and impact on prey species

Raccoon dogs are perceived as important in reducing bags of game birds, such as waterfowl and grouse populations (Lavrov, 1971). A study in Estonia reported the foraging behaviour of raccoon dogs in a waterfowl nesting, however author concluded that its harmfulness on grouse and hare populations is scarce (Naaber, 1971). They move too clumsily to keep up with its prey as an adult birds and hare (Kauhala, 1996c). Most predator diet studies concluded that the raccoon dog impact on ground breeding birds’ populations is imperceptible (Sutor et al., 2010; Kauhala and Kowalczyk, 2011). However, raccoon dogs may have more impact on prey populations in island ecosystems compared with mainland ecosystems (Kauhala and Auniola, 2001). In Latvia waterfowl nests were depredated more frequently by marsh harrier (53.7%), corvids (14.7%) and American mink (9%) comparing with raccoon dog (0.3%) (Opermanis et al., 2001). Studies of predation are based on stomach contents or scats where it is difficult to distinguish whether a raccoon dog is a potential predator or a scavenger. In an investigation conducted in Finland, was indicated that 67% of raccoon dog feces contained waterfowl remains, however, does not exclude the possibility that many eider died of viral disease (Kauhala and Auniola, 2001). A study of medium - sized predators in Finland revealed that raccoon dogs not decreased the breeding success of ducks (Kauhala, 2004). Contrarily, in another predator removal experiment in Finland indicated, that raccoon dog might have caused a minor effect on reproduction success of ducks (Väänänen et al., 2007). Amphibians (Rana spp., Bufo spp., Bombina spp., and Triturus cristatus) may be especially vulnerable to raccoon dogs because adults are relatively immobile, while larval and juvenile phases are confined to pools (Barbu, 1972; Kauhala and Auniola, 2001; Sutor et al., 2010). Raccoon dog may have harmful effects on population densities of frogs in island ecosystems (Kauhala and Kowalczyk, 2012). In the south-west coast of Finland, decline in frog populations has been attributed to predation and arrival of raccoon dogs, and populations have not declined on the outer islands where raccoon dogs were not found (Kauhala, 1996c).

Impact of raccoon dogs on native fauna is of minor importance than expected. Locally they may, however, be an important threat to populations of waterfowl and amphibians.

20 1.2.2 Import and enhancement of diseases and parasites on the native fauna

The raccoon dog is a host and can act as vector of endemic and parasitic diseases (Kowalczyk et al., 2009; Kauhala and Kowalczyk, 2011). Movement over large areas (especially juveniles) and overlapping home ranges can increase the connectivity of raccoon dogs with other species as badgers and foxes by facilitating the transmission of diseases (Kauhala and Holmala, 2006; Kauhala et al., 2006). Rabies. The red fox has been considered as the major host of sylvatic rabies in Europe (Singer et al., 2009). At present, the raccoon dog may act as another primary wildlife host in the Northern Europe, especially in Baltic countries and Poland (Vanaga et al., 2003; Niin et al., 2008; Singer et al., 2009; Smreczak et al., 2009; Zienius et al., 2011). Over the last decade, about of 90 to 94% of wildlife rabies cases were raccoon dog and red fox (Potzsch et al., 2006). In Lithuania, the number of rabies cases in raccoon dogs increased sharply from 11.8% in 1994 to 28.9% in 2004 (Maþiulskis et al., 2006). Monitoring of oral vaccination of raccoon dogs against rabies has been implemented in several European countries (Finland (1988), Lithuania (2006), Latvia (2005), Estonia (2006) and Poland (1993)) where raccoon dog populations play a significant role in rabies epidemiology (EFSA, 2015; WHO, 2010). As a result of implementation, the number of sylvatic rabies cases has rapidly decreased, especially ORV has led to a significant decrease in reported rabies cases in Estonia and Poland during recent years (Fig. 2) (WHO, 2010). The increasing raccoon dog population may strongly enhance the risk of rabies recurrence in Europe, because cohabitation and community of two important vector species: the red fox and the raccoon dog will pose a problem, what could facilitate the spread of this infectious pathogen (Holmala and Kauhala, 2006; Singer et al., 2009). Where raccoon dog population density is high, it may outcompete the number of red fox for the apparent competition with rabies virus (Singer et al., 2009). The first peak in the occurrence of rabies is highest in autumn due to the dispersal of juvenile raccoon dogs, and another in spring when adults move the longest distances (Kauhala and Holmala, 2006). During their winter hibernation the risk is lowest (Kauhala and Kowalczyk, 2012).

21 Fig. 2. Number of observed rabies cases in raccoon dogs notified in 2004, 2008, 2012 and 2014. The area in blue is where ORV was performed in each year. Source: WHO Collaboration Centre for Rabies Surveillance and Research, Friedrich-Loeffler Institut

Echinococcus multilocularis. Recently, Echinococcus multilocularis has been identified as a dangerous emerging zoonosis in Europe (Eckert et al., 2000). The parasite is not dangerous to other canids but can even cause lethal diseases (alveolar echinococcosis) in humans (Eckert et al., 2000; Kern et al., 2003). In Europe, the red fox has been the most important host of this parasite (small mammals and mainly rodents being the intermediate hosts) (Machnicka- Rowinska et al., 2002; Kern et al., 2003). However, recently the invading raccoon dog has been identified as another potentially important host for E. multilocularis (Machnicka-Rowinska et al., 2002; Laurimaa et al., 2015). E. multilocularis-infected raccoon dogs have been recorded in Poland (prevalence - 8%), Germany (prevalence - 6.3% - 12.0%), Latvia (prevalence - 14.3%), Lithuania (prevalence - 8.2%) and Estonia (prevalence - 1.6%) (Machnicka-Rowinska et al., 2002; Schwarz et al., 2011; Poƺakova, 2009; Bružinskaitơ-Schmidhalter et al., 2012; Laurimaa et al., 2015). No records of this parasite exist from Finland (Oksanen and Lavikainen, 2004). The relatively larger parasite prevalence rates in foxes may help to explain that rodents are more common in their diet, while amphibian transmitted parasites are more prevalent in raccoon dogs (Bružinskaitơ-Schmidhalter et al., 2012).

22 Sarpoctes scabiei. Sarcoptic mange caused by Sarcoptes scabiei can reduce population densities of wild mammals, especially red foxes and raccoon dogs (Kauhala and Kowalczyk, 2011; Pence and Ueckermann, 2002). N.procyonoides may also spread this painful skin disease to other animals including foxes, lynx and brown bears (Morner et al., 2005). Infection may be transferred indirectly, by using the same dens between different carnivore species. For example, red foxes and raccoon dogs frequently may use badger setts for reproduction and wintering (Kauhala and Holmala, 2006; Kowalczyk et al., 2008). Humans also may get infected by the Sarcoptes scabei mite of dogs, and also of foxes, although human infections from animal sources are short-lived and self-limiting (Süld et al., 2014). Trichinella spp. Trichinellosis, caused by parasitic nematodes Trichinella spp. is one of the most important disease in carnivores, especially scavengers, all over the world (Gottstein, 1997; Pozio and Murrell, 2006). The raccoon dog is also known as an important reservoir of Trichinella spp. (T. spiralis, T. nativa, T. pseudospiralis and T. britovi). Furthermore, the prevalence of trichinellosis in foxes increased in Finland after the arrival of raccoon dog population (Oivanen et al., 2002). In northeastern Germany, the percentage increase of infected wild boar is associated with the number of raccoon dogs shot each year (Pannwitz et al., 2010). In Finland, the prevalence of trichinosis in the European lynx (Lynx lynx) was associated with the density of raccoon dogs (Oksanen et al., 1998). High prevalences of infection (T. spiralis, T. britovi T. nativa) has been observed in red foxes, raccoon dogs, wolves, martens and wild boars in Lithuania (Malakauskas et al., 2007). The association with the density of raccoon dog population leads to the conclusion that the raccoon dog might be remarkable reservoir of Trichinella spp. (Oksanen et al., 1998; Oivanen et al., 2002).

Considering that the raccoon dog is becoming increasingly widespread and is already relatively abundant in several countries in Europe, the role of the species must be taken into account when assessing the risks related to public health.

1.3 Distribution of raccoon dogs

The historical distribution of this species was in the Far East, from northern Indochina to the southeast corner of Russia, and also in Mongolia and in the Japanese Archipelago (Fig.3). The native range covers East Asia, the Amur-Ussuri region in Russia, northern Vietnam, Korea, China, and Japan (Lavrov, 1971; Kauhala and Saeki, 2004). The climate in different habitats varies from subtropical regions of Japan, northern Vietnam and southern China to a harsh continental climate with cold winters in Mongolia and south-east Siberia (Kauhala and

23 Kowalczyk, 2011). Differences in body size, fat reserves, and thickness of fur, behavioural and dental characteristics could be results in adaptation of raccoon dogs to their environment with different climates zones (Kauhala and Kowalczyk, 2011).

1.3.1 Subspecies

The raccoon dog diverged from other canids’ lineage probably as early as seven to ten million years ago (Wayne, 1993). The genus spread all over Eurasia with three species in Europe (Nyctereutes donnezani, Nyctereutes tingi and Nyctereutes megamastoides) and two in Asia (Nyctereutes tingi and Nyctereutes sinensis) during the Pliocene epoch (Dermitzakis et al., 2004). The extinction of Nyctereutes began during the early Pleistocene in Europe. However, they persisted until the present day with the living species N. procyonoides in Asia (Tedford and Qiu, 1991). According to Pitra et al. 2010, the systematics of raccoon dogs has long been limited by insufficient of historical type material and an over estimation of the impact of geography on taxonomy. Currently six subspecies of N. procyonoides are recognized (Ward and Wurster-Hill, 1990): N. p. ussuriensis inhabits Russia, northeastern China, and Eurasia; N. p. procyonoides inhabits Vietnam and southern China; N. p. albus and N. p. viverrinus inhabit Japan; N. p. orestes inhabits China; and N. p. koreensis inhabits the Korean Peninsula (Hong et al., 2013).

1.3.2 Acclimatization of the raccoon dog

For the first time in 1929, experiments of acclimatization were performed on the island of Askold, Peter the Great Bay (Sea of Japan), where 20 raccoon dogs were released, and after three years 350 units of raccoon dogs were detected (Bobrov et al., 2008). Also the raccoon dogs were introduced in 1928 or 1929 (415 pregnant females) to Transcaucasia, Abkhazia, southern Ossetia and Karatalinia (Lever, 1985). The populations of raccoon dogs did not consolidate, but remained small or vanished completely in many areas, especially on the Asian side of the Caucasus (Kauhala and Kowalczyk, 2011). First introductions started in the mid-1930s e.g., in Leningrad (50 individuals), Novgorod (50 individuals) and Kalinin Provinces (50 individuals), in North Caucasus (1947 pregnant females were released), Ryazan Province south of Moscow, Kirgizia (78 individuals) and Ukraine (Fig.3) (Lavrov, 1971). During 1936-1939 raccoon dogs were transferred to Astrakhan (342 individuals), and during 1949-1954 they were released to Moldavia (Lever, 1985). Also N.procyonoides were released to the Pihkova (80 individuals in 1947), the Karelian isthmus (82 individuals in 1953), Murmansk (30 individuals during 1935- 1936), Archangel (219 individuals in the early 1950s) (Lavrov, 1971; Lever, 1985). About

24 10000 captive-bred animals had been released at several places in the beginning of the 1950s (Ansorge et al., 2009). They were also introduced in Estonia in the 1950s (Lavrov, 1971). In 1963, one hundred raccoon dogs were released in Belarus (Lever, 1985). In addition, all farmed animals had been released before the Second World War. Farm bred raccoon dogs have not successfully adapted to a new environment, and the majority was lost during their first weeks in the wild. After Second World War raccoon dogs were captured and translocated from successfully settled populations to new areas (Bobrov et al., 2008). Moreover, the exact origin of the primary introduced animals is unknown. It is possible, that raccoon dogs descended from populations of the subspecies Nyctereutes procyonoides ussuriensis in the Amur-Ussuri region of Far East Russia (Morozov, 1953).

Fig.3. Present day area of Nyctereutes procyonoides and changes in its boundaries within the former USSR. 1-native area; 2- places of introduction. In the inset (after Danilov, 2005): 3-places of occurrence and catch; 4-changes in the boundary areas with time

1.3.3 Spreading in Europe

Since the introductions of the populations in former Soviet Union, raccoon dog has expanded its range at an average annual rate of 40 km per year (and even up to 120 km per year) and colonised more than 1.4 million square kilometres of Europe (Fig.4) (Lavrov, 1971). In 1935 raccoon dogs first invaded Finland along the Karelian Isthmus (Siivonen, 1958). During the 1950s the population started to increase, but there was a time-lag of about 10 years until rapid population increase started in the mid-1960s. The population reached the peak and colonized southern and central Finland by the mid-1970s (Helle and Kauhala, 1991). N. 25 procyonoides have now become the most common medium-sized carnivore in Finland (Kauhala, 2007). Also the first individuals were observed in Sweden in 1945 (Notini, 1948). However, the population started to increase just a few years ago (Kauhala and Kowalczyk, 2011). In Norway the presence of raccoon dogs was confirmed in 1983 (Wikan, 1983). No records have been documented in Norway until winter 2007/2008 when a few raccoon dogs were shot in central Norway. Possibly, Sweden and Norway were colonized from Finland (Kauhala and Kowalczyk, 2011).

Fig.4. A map showing the distribution of raccoon dog N. procyonoides in Europe (Kauhala and Kowalczyk, 2011)

Around 1000 raccoon dogs were released into north-eastern part of Latvia in 1947, where by 1962 the population was estimated to be in the vicinity of 10.000 (Kauhala and Kowalczyk, 2011). Raccoon dogs were first noticed in Lithuania in the eastern part of the country in 1948 (Prǌsaitơ et al., 1988; Balþiauskas, 1996). It is believed that raccoon dogs reached Lithuania from Belarus and Latvia. Showing great plasticity in adaptation to various environmental and climatic conditions, raccoon dogs spread into different areas of Lithuania and by 1960 had colonized the whole country. Since 1970 the species has been declared as invasive, and hunting of these animals has been permitted throughout the year (Prǌsaitơ et al., 1988).

26 After this expansion, raccoon dogs prospered until the 1980s (Fig.5). Then they were affected by an intense hunting pressure and also by rabies.

Fig. 5. Monitoring and hunting statistic of raccoon dogs in Lithuania during 1960-1997 and in Germany during 1994-2006

N.procyonoides colonized BiaáowieĪa Primeval Forest from the east and the first recorded sighting in Poland was in the early 1950s (Dehnel 1956; Bunevich and Dackevich, 1985). By the end of the 1960s the species has become common and widespread in almost all of Poland, with the exception of higher parts of the mountains in the south. In some parts of the country the densities of raccoon dog is higher than other carnivores (JĊdrzejewska and JĊdrzejewski, 1998). During the hunting season approximately 11.000 animals were caught, and the hunting bag increases from year to year (Kauhala and Kowalczyk, 2011). The first sightings were recorded in eastern Germany in 1964, but the raccoon dog population remained sparse until it started to increase in the 1990s (Ansorge and Stiebling, 2001). However, thereafter an exponential increase of game kills (Drygala et al., 2002) and during the hunting season of 2005/06 about 30.000 animals were shot (www.komitee.de/index.php?brdjagdstrecke) (Fig.5). Naturally, the raccoon dogs spread to Denmark where the observations were made between 1995-2003 (Baagøe and Jensen, 2007). The raccoon dog was first encountered in France (the north-east area) in 1975 or 1979, but a firm evidence of the establishment of population in this country is still lacking (Leger and Ruette, 2005). Czechoslovakia was reached by raccoon dogs in 1959 having travelled north from Poland and south-east from Romania, which itself had been colonized in 1951 (Lever, 1985). In Romania they appeared from Moldova, which was invaded in 1940-1945 (Barbu, 1972). The species reached Hungary in 1961 (Long, 2003).

27 N.procyonoides is also found occasionally in the Netherlands, Slovenia, Croatia, Bosnia-Herzegovina, Serbia and Macedonia (ûiroviü and Milenkoviü, 1999; Mitchell-Jones et al., 1999). In 2005 it has also been seen and photographed in northern Italy. The animals have managed to cross the Alps (Genovesi, unpublished.). In 2008 one specimen was run over by car in Spain (Kauhala and Kowalczyk, 2011).

1.3.4 Reasons of successful range expansion

Successful range expansion of raccoon dogs in Europe at both national and continental scales are influenced by several factors (Kauhala and Saeki, 2004; Bobrov et al., 2008; Kauhala and Kowalczyk, 2011): x Its high success rate is due to a high ecological plasticity (Bobrov et al., 2008; Kauhala and Kowalczyk, 2011). For example, in Gorsk region the raccoon dog spread up 700 km over a six - year period, and some of them moved over the Volga ice in winter. The species has spread to steppe and semi-desert biotopes from southern districts of Russia (Bobrov et al., 2008). x Moreover, omnivorous feeding habit of raccoon dogs is one of the factor contributing to the high expansion and the success of this species (Sutor et al., 2010; JĊdrzejewska and JĊdrzejewski, 1998). x Another feature of raccoon dogs is their tendency to wander long distances and to establish in new areas (Nasimoviþ and Isakov, 1985). x The high reproductive capacity of the raccoon dog and high share of paternal care increases the speed of range expansion (Helle and Kauhala, 1995; Bobrov et al., 2008; Ikeda, 1983; Yamamoto, 1987). x The overwintering strategy of the wild raccoon dogs makes the animal almost entirely independent of food scarcity during the most unproductive period of the year (Helle and Kauhala, 1995).

Trying to understand the ecology, history of introductions and impact of raccoon dogs, the future work require genetic information that could help understand invasiveness and adaptive significance of raccoon dogs.

28 1.4. The use of genetic tools in the investigation of raccoon dogs

Studies of the genetic diversity of invasive mammal species are quite important for assessing phylogenetic patterns of founder populations, the history of immigrations or the success of colonisation (Suchentrunk et al., 2002; Zachos et al., 2007). The use of genetic tools in the investigation of invasive species has increased over the past two decades. However, genetic variability, relationships, population structure, and phylogeography of invasive raccoon dogs have hardly been investigated in previous studies (Kauhala and Kowalczyk, 2011). Canine- derived microsatellite markers were previously applied in three of six subspecies of N. procyonoides: N. procyonoides procyonides (Rogalska-Niznik et al., 2003; Szczerbal et al., 2003; ĝlaska et al., 2008; Yan et al., 2013), N. procyonoides viverrinus (Hayashizono et al., 2010), and N.procyonoides (ĝlaska et al., 2007; Kasperek et al., 2015). Recently, Hong et al. (2013) have reported isolation and characterization of 12 novel polymorphic loci from N. procyonoides koreensis subspecies. Also investigations of raccoon dogs were carried out using such molecular genetic markers as mitochondrial DNA and RAPD (Stêpniak et al., 2002; Pitra et al., 2010; ĝlaska et al., 2010; ĝlaska et al., 2011; Korablev et al., 2011). Microsatellites, also known as simple sequence repeats (SSR), have been increasingly used in genetic studies for their mutational behaviour, function, evolution and distribution in the genome (Li et al., 2002). Highly variable loci can be used for studies of estimating genetic structure (Epperson, 2004), distinguish close relatives for parentage (Queller et al., 1993) and assign individuals to the correct source population (Wilson and Rannala, 2003). Rogalska-Niznik et al. 2003 applied eighteen canine-derived microsatellite markers in Chinese raccoon dog (N.procyonoides procyonoides) using fluorescence in situ hybridization (FISH). This study is useful for comparative genome map of Canidae species: dog, red fox, arctic fox, and raccoon dog by comparative chromosome painting. A comparative analysis of FISH - mapped markers has facilitated the identification of intrachromosomal rearrangements that has taken place in karyotype evolution of these species. Studies were extended by Szczerbal et al. 2003 increasing the number of physically mapped markers in the Chinese raccoon dog to 25 loci. Investigation showed new chromosomal localisation of four canine cosmid clones in the N. procyonoides procyonoides genome by using dual colour FISH. ĝlaska et al. 2007 developed a set of microsatellites markers for parentage analysis in raccoon dogs. Previously reported 15 microsatellite loci have been optimized in three generations of raccoon dog (207 animals) at a Polish breeding farm. The results indicated high probabilities ranging from 0.959 assuming one known parent to 0.998 assuming both known

29 parents. The authors concluded that this set of markers is a useful tool for the parentage testing in raccoon dogs from breeding farms. ĝlaska et al. 2008 presented a genetic linkage analysis and variability of 20 canine microsatellite markers of the Chinese raccoon dog bred in Poland. In this study the first N. procyonoides procyonoides linkage map was constructed. Such information may contribute as a valuable tool for selection on breeding farms. Hayashizono et al. 2010 successfully amplified PCR products with ZUBECA4 primers prepared for the Japanese raccoon dog. Results indicated that the ZUBECA4 locus is useful for discrimination between samples from Japanese raccoon dog and samples from other animals by typing short tandem repeats (STRs). Also, microsatellite markers have been developed for N. procyonoides procyonoides by Yan et al., 2013. A total of 17 microsatellite markers were isolated and identified from microsatellite library of Chinese raccoon dogs. The results of this analysis could be useful for population genetic studies, individual identification, and phylogenetic analysis in farmed raccoon dogs from China and other Canidae species. Analysis of the genetic diversity and structure of South Korea raccoon dogs’ populations was performed by Hong et al. (2013). Canine-derived microsatellite markers failed to amplify and the other were monomorphic in Korean raccoon dog population. So the novel 12 microsatellite markers were designed and characterized to obtain basic population genetic parameters for raccoon dogs from five provinces of South Korea. The results demonstrated that all of the 12 loci were successfully amplified in N. procyonoides koreensis. Korean raccoon dog population analysed in this study grouped as four distinct genetic subpopulations. Recently, Kasperek et al. 2015 investigated the genetic diversity and population structure of farmed and wild-living raccoon dogs, 15 canine microsatellite loci were identified and characterized. The aim of this study was to detect possible differences between raccoon dogs from breeding farms in south-eastern Poland and two wild raccoon dogs’ populations living in Poland and Russia. Bayesian-based clustering analysis predicted that farmed population is composed of six genetic clusters, whereas animals living in the wild from Polish and Russian populations represented one genetic group. Research confirmed the higher genetic diversity of farmed animals in comparison with wild ones. The mitochondrial genome has strictly maternal inheritance and the most variable part of mtDNA is D-loop region, which is the non-coding region (Sbisà et al., 1997). The mtDNA genes have a very high evolution rate, which is about 5 to 10 times faster than nuclear DNA (Upholt et al., 1977). Mitochondrial DNA (mtDNA) is highly variable and can render

30 information on historical patterns of population demography, admixture, biogeography, and speciation (Avise, 2000; Ballard and Whitlock, 2004). Pitra et al. 2010 investigated polymorphism of the mtDNA control region in populations from several locations in Finland and Germany. Phylogenetic relationships between haplotypes demonstrated the presence of two clades in European raccoon dogs that diverged probably approx. 500.000 years ago. The analysis of a 599 bp fragment of the mtDNA control region revealed 9 haplotypes with 19 variable positions with a sequence divergence of 0.2–3.2% (mean 1.3%). The authors point out that such factors as multiple translocations, secondary contact, and natural processes of colonisation associated with a wide ecological plasticity, contributing to the successful expansion of this species into Europe. Similar results were indicated by Korablev et al. 2011. The analysis revealed a total of 18 haplotypes, among which ten haplotypes were not described earlier. Phylogenetic relationships demonstrated the presence of two clades in raccoon dog’s population from the Upper Volga basin. Higher levels of polymorphism were characterized in raccoon dogs from Russia (Upper Volga basin) (18 haplotypes noted in 30 animals) comparing to those from Western Europe (9 haplotypes noted in 73 animals). ĝlaska et al. 2011 performed analysis of the mitochondrial genes of farm and wild-living raccoon dogs in Poland. The analysis showed higher levels of polymorphism in farm raccoon dogs (polymorphism 90%) than in wild-living animals (polymorphism 27.3%). Analysis of sequence variation of mtDNA identified seven haplogroups, among which three were found in wild-living animals and the other four in the farm animals. Authors concluded that the existence of new haplogroups in the farm raccoon dogs indicates the appearance of adaptive mutations. RAPD-derived markers are mostly found in noncoding regions (Williams et al., 1990). These markers are the most frequently used in diverse fields of study, such as in gene mapping, population genetics, molecular evolutionary genetics, plant and animal breeding. Although the RAPD method is relatively fast, cheap and efficiency of the technique to generate large numbers of markers in a short period compared with previous methods (Bardakci, 2001). Random amplified polymorphic DNA (RAPD) markers have been developed to analyse genetic diversity in farm-raised and wild raccoon dogs (ĝlaska et al., 2010). The wild raccoon dogs’ population showed higher genetic variation as compared to farm-bred raccoon dogs. Phylogenetic analysis demonstrated separation of wild and farm-bred raccoon dogs in different phylogenetic groups. Stêpniak et al. 2002 successfully applied the RAPD technique to identify genetic markers in order to distinguish other species of the family Canidae: the arctic fox (Alopex lagopus), red fox (Vulpes vulpes), Chinese raccoon dog (Nyctereutes procyonoides

31 procyonoides) and six breeds of the domestic dog (Canis familiaris). RAPD-PCR profiles showed specific bands characteristic amplified by ten primers: 42 (35.6%) bands unique to the raccoon dog, 35 (29.6%) unique to the dog, 25 (21.2%) diagnostic for the red fox, and 16 (13.6%) for the arctic fox. The phylogenetic tree derived from species of the family Canidae separated the distinct group of Chinese raccoon dog, suggesting that this species belongs to a different phylogenetic lineage. Authors suggested, that RAPD technology represents as a useful tool for studying phylogenetic relations and distinguishing among species.

However, the data on genetic variability and population structure of the invasive raccoon dogs in colonized areas in the Baltic region is lacking. Consequently, genetic diversity of raccoon dogs from Lithuania should be analysed on the larger scale.

1.5 Investigations on morphometry of the raccoon dog

Comparative morphological investigations of non-metric and metric skeletal characters are classical method to answering questions about the relationships among species, often for classification and taxonomic distinctions (Sims, 2012). The analysis of the variability by the use of non-metric and metric skeletal characters offer the opportunity of utilising mammalian skulls kept in museum collections for genetic studies. This method of assessing population genetics is successfully used for the study of epigenetic variability in invasive species (Ansorge et al., 2009). Ansorge et al. 2009 examined the epigenetic variability and epigenetic distances of recently established and native populations of raccoon dog. A total of 1046 skulls of raccoon dog were collected from European regions and the Amursk area. The skulls were from the collections of the Museums in the Moscow, Finland, Poland, and Germany. The epigenetic variability was studied by using 24 non-metric skull characters. Low levels genetic variability retrieved in this study were calculated in both population from the Amursk and European regions. The epigenetic distances between the raccoon dog populations were quite high. Population from Germany were separated from the other European samples based the results of UPGMA. The morphometric study of two indigenous and five invasive populations of the raccoon dog was carried out by Korablev and Szuma (2012), on the basis dental and cranial size measurements. Comparative analysis showed bigger measurements in introduced populations comparing with native populations. Moreover, raccoon dogs from Europe showed increase of general length of the skull.

32 A comparative analysis was conducted between Finnish and Japanese raccoon dogs based on measurements of the skull and tooth (Kauhala et al., 1998b). It was determined that skulls of Finish raccoon dogs were larger overall in comparison to Japanese raccoon dogs. Authors concluded that differences in skull variation could arise for differences in diet and adaptation to climatic parameters. Hidaka et al. 1998 compared the skulls of badgers (Meles meles) and raccoon dogs. The comparison between measurements demonstrated significantly larger values of most mandibular measurements in raccoon dogs than badgers. Measurements of mandibles showed significant sexual differences in both species. Study on skull osteometry in red foxes and racoon dogs were carried in Lithuania by Jurgelơnas and Daugnora (2005). Red foxes had longer and wider skulls than raccoon dogs. Sex differences in skulls and mandibles features were statistically significantly longer in males’ foxes comparing with female foxes. Furthermore, the results of comparison analysis revealed higher values of skull, cranium and face indexes in raccoon dogs. The skull morphology analysis of red fox and raccoon dogs was performed using comparative anatomy and computed tomography by Jurgelơnas et al. 2007. Results of computer tomography revealed two prominent osseous partitions in the median part of the frontal sinuses in raccoon dogs and one partition in red fox. The maximum length, width and height of the frontal sinus cavity of red foxes found in this study were larger than raccoon dogs. Later, Jurgelơnas et al. 2011 studied skulls of raccoon dogs and red foxes based on determination of differences in the skull shape between sexes and species. Differences of skull form between males and females of raccoon dogs and red foxes were not confirmed. However, the indices (skull, facial, facial-1 and palatal) and palate-palatine ratio were significantly higher of females and males raccoon dogs compared to females and males red foxes.

33 2. MATERIALS AND METHODS

2.1 Osteometrical measurements

The skulls of raccoon dogs hunted in different regions of Lithuania from 1957 to 1960 were studied (7 samples were obtained from Ignalina district, 5 from Kaunas, 4 from Vilnius, 4 from Zarasai, 4 from Širvintai, 3 from Panevơžys, 2 from Švenþionơliai, 2 from Molơtai, 1 from Marijampolơ, 1 from Lazdijai, 1 from Utena, 1 from Anykšþiai and 1 from Kơdainiai). The research was carried out on museum specimens from the collection of the Tadas Ivanauskas Zoological Museum in Kaunas. Overall, 36 skulls of raccoon dogs (20 males and 16 females) were used to examine any variations of skull with respect to sex. In total, 7 measurements were taken on each skull of the raccoon dog (Fig.6). The measurements were performed by using digital calliper with 0.01 mm precision. Skull index was calculated according to the formula (Onar et al., 1997; Onar, 1999): Zygomatic breadth ×100/Condylobasal length. Basic statistics was calculated with Statistica for Windows software (StatSoft, 2004).

Fig.6. Skull measurements taken from Lithuanian raccoon dog skulls: CBL = Condylobasal length; ML = Mandible length; ZB = Zygomatic breadth; LT = Length of lower tooth row; IC = Interorbital constriction; PC = Postorbital constriction; MH = Mandible height

34 2.2 Samples for genetic study

This study was based on the specimens of raccoon dogs collected during a 2-year period (2011-2012) and stored in Tadas Ivanauskas Zoological Museum in Kaunas. A total of 153 N. procyonoides individuals legally harvested by the hunters and found killed on the roads from 37 sampling sites across Lithuania were investigated. (Fig. 7). Twenty one individual were subjected to mitochondrial DNA analysis (sample sizes of mtDNA analyses given in Table 1) and 147 individuals were used for microsatellite analysis. Muscle tissue samples were placed in separate bags and identified by sex, age, date and location. The research material before and after DNA isolation was stored at –20ºC.

Fig.7. Map of sampling localities of the Nyctereutes procyonoides in Lithuania. Black-filled circles show collecting localities of raccoon dogs, outlined circles-samples used fot mtDNA analysis

2.3 DNA extraction

Muscle tissue samples were collected from raccoon dogs and preserved in 75% ethanol. Genomic DNA was extracted from tissue samples using "Thermo Scientific Genomic DNA Purification Kit" (Thermo Fisher Scientific Baltics, Lithuania; catalogue No K0512). Homogenous samples were mixed with 200 ȝl TE buffer (Tris – EDTA buffer) and suspended in 400 μl lysis buffer. The samples were incubated 30 min at 65ƕC until solution is homogeneous. After incubation was added 600 ȝl chloroform and centrifuged for 3 min at 35 10.000 rpm. The upper layer (aqueous layer) was removed and transfered to a clean tube. Extraction by chloroform if the supernatant is dirty was repeated. Transfered the upper aqueous phase containing DNA was added into prepared precipitation solution (720 ȝl of sterile deionized water with 80 ȝl of supplied 10X concentrated Precipitation Solution) and centrifuged for 2 min at 10.000 rpm. The supernatant was removed completely and dissolved DNA pellet in 100 ȝl of NaCl solution. 300 ȝl of 96% cold ethanol was added, the pellet was dissolved and chilled at í20°C for 30 min for precipitation. The mixture was centrifuged at 10.000 rpm for 7 min, and the supernatant was decanted gently. The dried pellet was resuspended in 100 ȝl of TE buffer.

2.4 Determination of DNA concentration and purity

The concentration and the purity of isolated DNA were determined with Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA).

2.5 The analysis of the mitochondrial control region in raccoon dogs

2.5.1 DNA amplification

A 565 bp region of hypervariable domain of the mitochondrial control region was amplified in 22 N. procyonoides individuals. Samples were amplified using primers Rac-1F 5'- TCG TGC ATT AAT GGC TTG C-3' and Rac-1R 5'-CCA TTG ACT GAA TAG CAC CTT G- 3’ (Vilnius University). PCR was performed in 25-ȝL volumes including: 1X PCR buffer (Thermo Scientific), 2 mM MgCl2, 0.4 ȝM of each primer, 2 mM dNTPs, 2 U of Taq DNA polymerase, and 100 ng of template DNA. PCR reactions were carried out in an Eppendorf Mastercycler gradient, 5331 (Germany). Cycling parameters were an initial denaturation step at 95 °C for 5 min, followed by 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 1 min. This cycle was repeated 35 times, followed by 7 min of extension at 72 °C.

36 2.5.2 Agarose gel electrophoresis

To visualise the PCR products, horizontal agarose gel electrophoresis was used (Fig.8). A 1.5% agarose gel was used where 2.55 g of „Top Vision LE GQ Agaroze, #R0491“ („Thermo Fisher Scientific Baltics“, Lithuania) was dissolved in 150 ml of 0.5 X TAE buffer (10 ml 50X

TAE buffer + 990 ml H2O). A 100 bp Gene RulerTM DNA Ladder („Thermo Fisher Scientific Baltics“, Lithuania) was used with the amplification products as a size standard. Ultraviolet (UV) transilluminator GelDoc- It 310 was used to visualize the fluorescent DNA bands. The image was documented using Vision Works LS software (Great Britain).

Fig.8. Amplification of 565 bp of mitochondrial DNA D-loop region. Lane M - 100 bp DNA ladder. Lanes 1-14 – amplified products. Lane K- - negative control

2.5.3 DNA sequencing

The positive bands of the expected size range were excised from the gel. DNA was extracted using the GeneJET Gel Extraction Kit („Thermo Fisher Scientific Baltics“, Lithuania) in accordance with the manufacturer's recommendations. A BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) was used for DNA sequencing reaction according to manufacturer‘s recommendations. Sequencing was performed using 3730xl DNA automated sequencer (Applied Biosystems).

2.5.4 Mitochondrial DNA sequence data analysis

DNA sequence evaluation. Electropherograms were checked by eye for poor base calls and sequence quality and then sequences were edited and aligned using the ClustalW (Thompson et al., 1994) algorithm in MEGA v.5.05 (Tamura et al., 2011). DnaSP v.4.20.2 program was used (Rozas et al., 2003) to calculate the polymorphic sites, number of haplotypes, the average number of pairwise differences, haplotype (h), and nucleotide diversities (ʌ) with their standard deviations. A BLAST search was used to confirm N. procyonoides mtDNA. All 37 sequences were deposited in the GenBank database under the accession numbers KC344215– KC344235 (Lithuania-LT) and KC509604 (Latvia-LV). We compared mtDNA sequences acquired in the present study with previously published GenBank homologous sequences (Table 1). Phylogenetic analyses. Phylogenetic relationships among control region haplotypes were reconstructed using the neighbor-joining (NJ) (Saitou and Nei, 1987), maximum likelihood (ML) (Felsenstein, 1981), and maximum parsimony (MP) (Nei and Kumar, 2000) methods as implemented in MEGA5 software (Tamura et al., 2011), as well as the Bayesian inference (BI) approach (Huelsenbeck et al., 2001) using the program Mr.Bayes v.3.2.1 (Ronquist and Huelsenbeck, 2003). The most appropriate model of nucleotide substitution for data was determined according to the Bayesian information criterion (BIC) using the program jModelTest2 (Guindon and Gascuel, 2003; Darriba et al., 2012). The model selected was the HKY (Hasegawa et al., 1985) + G (Yang, 1994) substitution model [–ln L = 1113.68 (BIC); base frequencies set to A = 0.2823, C = 0.2543, G = 0.1697, T = 0.2938; AC = 0.3320, AG = 6.4693, AT = 0.5250, CG = 0.3304, and CT = 6.1042, GT = 1.0000; Ti/tv ratio = 4.3386; (a) = 0.0211, invariable sites (pinv) = 0]. This model was implemented in ML and Bayesian analyses. The NJ tree was generated using the Kimura 2-parameter model (Kimura, 1981). The significance of NJ, MP, and ML trees was tested using 1000 bootstrap replicates for each (Felsenstein, 1985). For the BI analysis, four independent runs of Markov chain Monte Carlo were launched for 1.0 × 106 generations and sampled every 100 generations. The first 25% of samples were discarded as burn-in, and the remaining saved samples were used to estimate posterior probabilities (PP) of each bipartition. Bayesian tree diagrams were obtained with a tree figure drawing tool, FigTree v1.3.1 (Rambaut, 2009). To address the phylogenetic and phylogeographic relationships among the haplotypes, a median-joining network was constructed using NETWORK 4.6.1.1 (Bandelt et al., 1999). Historical demography. Several different approaches to examine past population dynamics (the populations had undergone a sudden population expansion or had remained stable over time) were investigated. Any deviation from sudden-expansion model was evaluated by calculating the raggedness (r) index (Rogers and Harpending, 1992) and R2 (Ramos-Onsins and Rozas 2002) in DnaSP. The history of demographic changes was also assessed by calculating Tajima’s D-test (Tajima, 1989) and Fu’s Fs tests (Fu, 1997) as well as Fu and Li's (1993) D* and F* test statistics, also using DnaSP. Tajima’s and Fu’s neutrality tests are used to verify whether a population is in mutation/drift equilibrium or, in contrast, if it is expanding (Ramos- Onsins and Rozas, 2002). Negative and signi¿cant values of these parameters are indicative of population expansion and/or negative selection.

38 Table 1. Sequences from GenBank database under accession numbers used in this study

Accession Accession Location number in Location (District, Country) number in (Country) GenBank GenBank Reference Reference KC344215 Ukmergơ d, Lithuania (LT) FJ888513 Germany (DE KC344216 Anykšþiai d, Lithuania (LT) FJ888519 KC344217 Vilnius d, Lithuania (LT) Germany (DE) KC344218 Ignalina d, Lithuania (LT) FJ888514 Finland (FI) FJ888515 KC344219 Lazdijai d, Lithuania (LT) Hungary (HU) KC344220 Švenþioniai d, Lithuania (LT) FJ888516 Germany (DE) KC344221 Vilkaviškis d, Lithuania (LT) FJ888520

KC344222 Prienai d, Lithuania (LT) FJ888521 Finland (FI) Pitra et al., 2010 KC344223 Šilutơ d, Lithuania (LT) FJ888517 Finland (FI) KC344224 Druskininkai d, Lithuania (LT) FJ888518 KC344225 Tauragơ d, Lithuania (LT) JF809822-

Nelidovo raion, KC344226 Mažeikiai d, Lithuania (LT) JF809824 KC344227 Ignalina d, Lithuania (LT) JF809840 Russia (RU/Nel)

KC344228 Kretinga d, Lithuania (LT) Dissertation data JF809825 KC344229 Pasvalys d, Lithuania (LT) JF809828 Olenino raion, KC344230 Šakiai d, Lithuania (LT) JF809829 Russia(RU/Ol) KC344231 Šiauliai d, Lithuania (LT) JF809831 KC344232 Varơna d, Lithuania (LT) JF809837 Toropets raion, KC344233 Kơdainiai d, Lithuania (LT) JF809838 Russia (RU/Tor) KC344234 Rokiškis d, Lithuania (LT) JF809834 Udomlya raion,

KC344235 Ukmergơ d, Lithuania (LT) Russia (RU/Ud) Korablev et al., 2011 KC509604 Jelgavkrasti, Latvia (LV) JF809842 Andreapol EU642411 JF809843 Russia (RU/And) EU642412 JF809844 Vologda oblast, EU642415 JF809848 Russia (RU/Vol) EU642417 EU642416 EU642425 EU642417 Far East Russia EU642426 EU642451 (RU) EU642430 EU642452 EU642436 EU642443 China (CN) Unpublished EU642440 South Korea (SKR) GU256221 EU642445 EU642449 Unpublished

D83614 Japan (JP) Outgroup Okumura et al., 1996

39 2.6 Microsatellite genotyping

2.6.1 DNA amplification

On the basis of the literature, 15 microsatellite markers were selected from previously described in canine genome for genetic characterization of the studied populations: FH2010, FH2054, FH2079, FH2096 (Francisco et al., 1996), FH2088, FH2004, PEZ19 (Kukekova et al., 2004), PEZ17, FH3922, REN112I02, FH3300 (ĝlaska et al., 2005), PEZ2 (Neff et al., 1999), PEZ22 (Mellersh et al., 1997), ZUBECA4 (Dolf et al., 1998), VWF.X (Shibuya et al., 1994) previously described in canine genome were used in present study. PCR analysis were performed to investigate the level of polymorphism at these loci and to evaluate their usefulness for population genetic study of raccoon dogs. Conditions for PCR amplification of microsatellite sequences were optimized. PCR was carried out in 25 μl volumes including: 1X PCR buffer, 2 mM MgCl2, 0.2 mM dNTPs, 2 U Taq DNA polymerase („Thermo Fisher Scientific Baltics“, Lithuania), 0.2 μM of each primer, and 20–60 ng of template DNA. PCR reactions were carried out in Eppendorf Mastercycler gradient (Germany). Parameters for thermal cycling were as follows: an initial denaturation step (95°C for 4 min) was followed by 30 cycles of 1 min at 94°C, 25 s at the locus-specific annealing temperature, 1 min at 72°C and a final extension for 45 min at 72°C. The results of optimized PCR analysis revealed successful amplification of polymorphic fragments of the expected sizes in 5 (FH2096, FH2054, FH2010, PEZ17 and REN112I02) from 15 tested loci (Table 2). Another loci were characterized by a low degree informativeness or not successful amplification. A new set of microsatellite loci developed for N. p. koreensis by Hong et al. (2013) were selected for testing amplification in N.procyonoides in Lithuania (Table 2). DNA was amplified using a touchdown profile for PCR amplification: initial denaturation for 3 min at 94°C, followed by 20 cycles of 94°C for 1 min, annealing temperature of 60–50°C decreased by 0.5°C per cycle, 72°C for 1 min, followed by 20 cycles of 94°C for 1 min, 50°C for 1 min, 72°C for 1 min, and a final extension at 72°C for 10 min. PCR reactions (25 μl) contained 1.5 mM MgCl2, 200 ȝM each dNTP, 0.5 U Taq DNA polymerase, 0.3 ȝM each of the fluorescently labeled forward primer and unlabeled reverse primer, and 10–50 ng template DNA. DNA amplifications results revealed that one locus (Nyct2), either failed to amplify or amplified alleles were difficult to score.

40 Table 2. Characteristics of the 16 microsatellite loci optimized for Nyctereutes procyonoides

Locus Primer sequence Repeat motif Size (bp) F: 5’GAAATGGAACAGTTGAGCATGC3’ FH2010 (ATGA)n 222-242 R: 5’CCCCTTACAGCTTCATTTTCC3’ F: 5’CCGTCTAAGAGCCTCCAG3’ FH2096 (GAAT)n 92-112 R: 5’GACAAGGTTTCCTGGTTCCA3’ F: 5’GCCTTATTCATTGCAGTTAGGG3’ FH2054 (GATA)n 138-145 R: 5’ATGCTGAGTTTTGAACTTTCCC3’ F: 5’CTAAGGGACTGAACTTCTCC3’ Pez-17 (GAAA)n 196-212 R: 5’GTGGAACCTGCTTAAGATTC3’ F: 5’ATAGCCCATGAAATCCA3’ REN112I02 (CA)n 236-252 R: 5’CCCCAAATACATCCCTACAT3’ Nyct1 F: 5’CTGCTCCAACACCACCATTT3’ GT(13) 183–193 R: 5’CCAATTGCGTAAGTCCCAGT3’ Nyct3 F: 5’TGGACAAGGTCACACAGGAA3’ TG(17) 240–252 R: 5’ACCCTCCAAGTGTTCACGAC3’ Nyct4 F: 5’TGCTTCTGTCTCCCCTGTCT3’ TG(14) 223–239 R: 5’AGTTCAGCCGGGTTGTAATG3’ Nyct5 F: 5’CAGGGTTTTGAGGTGGAGAG3’ GT(13) 164–178 R: 5’CACAGTGCGTTAGGCATGA3’ Nyct6 F: 5’GATCCAGCTGTCACTGCTTT3’ GA(18) 141–171 R: 5’GTCTGCTTCTCCCTCTCCCT3’ Nyct7 F: 5’CTAGCCTCCCCCTACCTTTC3’ CT(17) 121–139 R: 5’AACACGAGGTTCACTCCAGG3’ Nyct8 F: 5’CTGCTACTCCTCCTGCCTGT3’ TC(18) 111–127 R: 5’CATTGGAGGCTGTCAGTGAA3’ Nyct9 F: 5’CCCTCAATGGTCTTATCCCC3’ CTG(10) 168–192 R: 5’ACGACCCCTTCATCTGACTG3’ Nyct10 F: 5’CTTGCTGCAAATCTCCCATT3’ GCT(8) 178–187 R: 5’CAAGGAGAGGAGCTGTTTGC3’ Nyct11 F: 5’CCAGTCATCCTGCCTTTGTT3’ TGC(8) 104–119 R: 5’GTGCCCTTGTGGGTTTCTTA3’ Nyct12 F: 5’TAAAGCTCCACAGGGGTCTG3’ GCA(8) 162–171 R:TCATTCCACCATTCTTCTACCA3’

2.6.2 Polyacrylamide gel electrophoresis

The amplified products were separated on 8% denaturing polyacrylamide gel, which was made of: 36.6 ml H20, 2.5 ml 10x TAE buffer, 10 ml 40% acrylamide, 0.5 ml 10 % APS, 41,5 μl TEMED. Samples were mixed with 6 × Loading Dye („Thermo Fisher Scientific Baltics“, Lithuania, Lithuania) and marker „Gene RulerTM 50 bp DNA Ladder” was used into the first and last lane. To visualize the bands, the gel (Fig.9) was transferred onto UV transilluminator using GelDoc-It 310 imaging system and VisionWorks LS software.

Fig.9. Polyacrylamide gel banding patterns for microsatellite marker FH2096 (92-112 bp) in ten individuals of raccoon dogs. M- 50 bp molecular weight marker; 3967, 2016, 619, 20667, 21444, 2639, 2462, 4831, 3528, 20453 - individuals of raccoon dogs; K- negative control

2.6.3 Capillary electrophoresis

After determination of successfully amplified polymorphic loci, subsequent multiplex PCR amplification with fluorescently labelled (FAM, VIC, NED) primers was carried out. Electrophoresis of microsatellite was performed in capillary analyser - 3100 ABI Prism Genetic Analyzer (Applied Biosystems). The length of the alleles obtained was analysed with reference to the GeneScan™ 500 LIZ (Fig.10) molecular size standard using Gene Mapper software v4.0 (Applied Biosystems). A size standard must be added to each PCR sample. The electropherogram peak of signal intensity measured in relative fluorescence units (rfu). Output profiles were manually checked to confirm allelic size variants (Fig.11).

Fig.10. Electropherogram of the GeneScan-500 size standard (Applied Biosystems Ltd)

Fig. 11. Electropherogram of microsatellite markers: A - heterozygote 247/255 bp (Nyct 3), B - heterozygote 158/167 bp (Nyct 6), C heterozygote- 113/119 bp (Nyct 8), D -heterozygote -184/187 bp (Nyct 9). X axis - size in bases bp, Y axis – fluorescence intensity rfu

2.6.4 Analysis of microsatellite data

Analyses of gene diversity. Basic statistics were estimated using GenAlEx version 6.5 (Peakall and Smouse, 2006) to determine the average number of alleles per locus (A), observed

(HO) and expected (HE) heterozygosities. Deviations from the Hardy-Weinberg Equilibrium (HWE) were tested using GENEPOP version 4.0 (Raymond and Rousset, 1995) with exact P values being estimated using the Markov chain algorithm with 10.000 dememorization steps 100 batches and 1.000 iterations. Significance levels were adjusted using a strict Bonferroni correction applied for multiple comparisons (Rice, 1989). MICROCHECKER version 2.2.3 (Oosterhout et al., 2004) set for 1.000 iterations and a 95% confidence interval, and checked for possible scoring errors and null alleles. The polymorphism information content (PIC) was calculated using MSTOOLS software (Park, 2001). Allelic richness (AR) was estimated using

FSTAT software version 2.9.3 (Goudet, 2001), and private allelic richness (PR) was obtained using HP-RARE v1.1 via a rarefaction method (Kalinowski, 2005). Analyses of genetic differentiation and population structure. To assess the level of population genetic structure we calculated pairwise Nei’s genetic distances (DNei; Nei, 1973) between each pair of the sample sites using the software GenAlEx 6.5. FST values were estimated according to Weir and Cockerham’s (1984) version of Wright’s F-statistic with the use of FSTAT program package, followed by sequential Bonferroni correction for multiple tests.

In a subsequent analysis, pairwise ĭST values were estimated via AMOVA in GenAlEx v.6.5 and significance assessed by 1000 permutations. The partitioning of total genetic diversity

43 within and between the sample sites (without recurring genotypes) was estimated with the hierarchical analysis of molecular variance (AMOVA) using both RST (SMM- stepwise mutation model) and FST (IAM-infinite-allele model) values in GenAlEx v.6.5. To test for isolation-by- distance (IBD), Mantel test (Mantel, 1967) with 999 permutations was performed in the software GenAlEx to estimate the correlation between genetic and geographical distances. Factorial correspondence analysis (FCA) on the microsatellite data for individual raccoon dogs was performed using GENETIX v4.05.2 (Belkhir et al., 2004). Bayesian clustering analyses were performed with STRUCTURE v2.3.4 (Pritchard et al., 2000) to determine the number of genetic clusters (K) and to assign individuals to their likely origin. STRUCTURE was run 10 times for each value of K ranging from K = 1 to K = 9 with an initial burn-in period consisting of 200.000 replications and a run length of 100.000 Markov chain Monte Carlo (MCMC) iterations of the total data set. Because significant gene flow was expected, admixture and allele frequency correlated models were applied. We used StructureHarvester v0.6.9.3 to determine the most likely number of clusters by calculating ǻK, which is based on the rate of change of the “estimate likelihood” between successive K values (as described in Evanno et al., 2005). The output of genetic clustering for all the individuals in 37 sampling sites and for each of pre- defined sampling area were visualized by calculating the average per cluster assignment values.

2.8 Bioinvasion impact assessment on racoon dogs

The following yearly periods were used in the analysis in different subregions (Table 3). To evaluate the biopollution level (BPL) of N. procyonoides was used the method of Bioinvasion Impact/Biopollution Assessment System (BINPAS), available at http://www.corpi.ku.lt/databases/binpas, which was proposed by Olenin et al. (2007) (Table 4). The BPL calculation (Table 5) is based on abundance and distribution range (ADR), the magnitude of bioinvasion impact was assessed.

44 Table 3. Number of sampling sites in different subregions of Lithuania Sub-regions Size Period Kamanos Strict Nature Reserve: Woodland 10-100 1999-2001 Mazuoliai Forest, Radviliskis District 1-10 1996-1996 Radviloniai Forest, Radviliskis District 1-10 1996-1996 Margavoniai Forest, Radviliskis District 1-10 1996-1996 Dzukija National Park, Varena District: Woodland 100-1000 1996 -2002 Zemaitija National Park Woodland 10-100 1997-1998 Geidukonys Forest, Varena District 1-10 1999-1999 Baubliai Forest, Baubliai Village, Kretinga District 1-10 2000-2000 Verkiai Regional Park, Vilnius District: Woodland 10-100 2000-2001 Netiesos Hydrological Reserve, Varena District 1-10 2002-2002 Kreisa Brook Valley, Ricieliai, Varena District 1-10 2002-2002 Subartonys Forest, Subartonys, Varena District 1-10 2002-2002 Kurtuvenai Regional Park: Woodland 1-10 1999, 2001, 2004, 2006

Table 4. Ranking bioinvasion impact according to Olenin et al. 2007 Abundance and Impact on native Impact on ecosystem Impact on communities distribution habitats functioning C0- no impact; no A- low numbers in displacement on native sp H0- no impact; no E0- no impact; no one or several in presence of AS; ranking habitat alteration. measurable effect. localities of native sp quantitatively unchanged. B- low numbers in H1- weak impact; E1- weak impact; C1- weak impact; local many localities; alteration of a measurable, but weak displacement of native sp; moderate numbers habitat, but no changes with no loss or dominant sp remain the in one or several reduction of spatial addition of new same. localities extent of habitat. ecosystem function. C2- moderate impact; large C- low numbers in H2- moderate scale displacement on E2- moderate impact; all localities; impact; alteration native sp; Type - specific moderate modification moderate numbers and reduction of communities are changed of ecosystem in many localities; spatial extent of a noticeably; shifts in performance, changes in high numbers in habitat. community dominant functional group. several localities species. C3- population extinctions D- moderate H3- strong impact; E3- strong impact; within ecosystem; alien numbers in all alteration of a key severe shifts in species are dominant; loss localities; high habitat; severe ecosystem functioning, of type- specific numbers in many reduction of spatial reorganisation of the community within an localities extent of habitat. food web. ecological group. C4- massive impact; E4- massive impact; H4- massive impact; population extinction of extreme, ecosystem- loss of habitats in E- high numbers in native keystone species; wide shift in the food most of the all localities extinction of type-specific web; and/or loss of the assessment unit; loss communities occurs within role of a functional of a key habitat. more than ecological group. group.

45 Table 5. Assessment of biopollution level (BPL, 0-4) index according to abundance/distribution class and impact on communities (C), native habitats (H) and ecosystems (E) (Olenin et al., 2007)

Class of abundance and Impact on communities (C), Biopollution native habitats (H) and level distribution ecosystems (E) (BPL) A. Low numbers in one or No impact (C0, H0, E0) 0 several localities Weak impact (C1, H1, E1) 1 No impact (C0, H0, E0) or 1 B. Low numbers in many localities Weak impact (C1, H1, E1) Moderate numbers in one or several Moderate impact (C2, H2, E2) 2 localities Strong impact (H3) 3 No impact (C0, H0, E0) or 1 C. Low numbers in all localities Weak impact (C1) Moderate numbers in many Weak impact (H1, E1) or 2 localities Moderate impact (C2, H2, E2) High numbers in several localities Strong impact (H3) 3 Massive impact (H4) 4 Weak impact (C1, H1, E1) or 2 D. Moderate numbers in all Moderate impact (C2, E2) localities Moderate impact (H2) or 3 High numbers in many localities Strong impact (C3, H3, E3) Massive impact (H4) 4 Weak impact (H1, E1) 2 Moderate impact (C2, H2, E3) or 3 E. High numbers in all localities Strong impact (C3, H3, E3) Massive impact (C4, H4, E4) 4

2.9 Molecular detection of tick-borne pathogens in raccoon dogs

The possible role of raccoon dogs in spread of tick-born transmitted diseases in Lithuania was determined. Ticks were collected from road-killed raccoon dogs. In total 44 ticks (40 Ixodes ricinus and 4 Dermacentor reticulatus) from 9 raccoon dogs have been tested by using molecular methods. All ticks were put into test tubes with 70% ethanol and it kept at 4° C until investigation. Tick species were identified by morphological criteria.

2.9.1 DNA extraction from ticks

Extraction of DNA from questing (unfed) ticks was carried out by lysis in ammonium hydroxide (NH4OH), with 80ௗȝl for nymphs and 100ௗȝl for adults. Briefly, each tick was taken from the 70% ethanol solution used for storage and air dried. A 2.5% ammonia solution was used in a 0.5ௗml microcentrifuge tube and heated at 99ƕC for 25ௗmin in a thermostat block (Heating/cooling dry block, BioSan, England). After a brief centrifugation (in order to collect condensate from the cap and sides of the tube) the tubes were opened and heated at 99°C for

46 approximately 10-15ௗmin to evaporate ammonia. The lysates were stored at +4°C until use as templates for PCR or at –20°C for longer periods. DNA from engorged ticks was extracted using the Genomic DNA Purification Kit („Thermo Fisher Scientific Baltics“, Lithuania) according to the protocol suggested by the manufacturer.

2.9.2 PCR amplification

Ticks removed from raccoon dogs were examined for presence of different pathogens: Babesia spp., Bartonella spp., Borrelia burgdorferi sensu lato, Rickettsia spp., Anaplasma phagocytophilyum and Francisella tularensis. Different molecular markers, conventional and nested PCR, and sequence analysis for determination and identification of pathogen were used.

2.9.2.1 Molecular detection of Babesia spp

For detection, the primers BJ1 (5'-GTCTTGTAATTGGAATGATGG-3') and BN2 (5'- TAGTTTATGGTTAGGACTACG-3') were used to amplify a 470 bp fragment of 18S rRNA gene of Babesia spp. (Casati et al., 2006). The PCR reactions were conducted in 25 ȝl reaction tubes with the following reagents: 2X PCR master Mix, 10 pmol/ȝl of each primer, ddH2O and 100 ng/ul of DNA template. PCR consisted of an initial denaturation step at 94 ºC for 10 min followed by 35 cycles of 1 min at 94 ºC, 1 min at 55 ºC, 2 min at 72 ºC, with final elongation step of 5 min at 72 ºC after the last cycle. Negative and positive controls were included in all runs. Molecular detection of Babesia spp. was also performed including primers PIRO-A1 (5ƍ- AGG GAG CCT GAG AGA CGG CTA CC-3ƍ and PIRO-B (5ƍ-TTA AAT ACG AAT GCC CCC AAC-3ƍ) which amplify 450 bp long portion of the 18S rRNA gene of piroplasms (Fòldvari et al., 2005). The reaction mixture contained 1x PCR Master Mix (+ KCl), 2 mM of MgCl2, 0.2 mM of each dNTP, 12.5 pmol of each primer and 0,75 U of of Taq polymerase, 100 ng/ul DNA and ddH2O. The reaction was run in a thermocycler according to the following program: initial denaturation for 10 min at 94°C was followed by a cycle 94°C for 30 s, 58°C for 30 s and 72°C for 45 s, repeated 40 times and finished with 72°C for 5 min. Negative and positive controls were included in all runs.

47 2.9.2.2 Molecular detection of Bartonella spp

Bartonella spp. DNA in samples was detected using a PCR of the gltA gene with primers BhCS.1137n (5‘-AAT GCA AAA AGA ACA GTA AAC A-3‘) and BhCS.781p (5‘GGG GAC CAG CTC ATG GTG G-3‘) (Podsiadly et al., 2007). A 379 bp product were considered as a positive result. The PCR reactions were conducted in 25 ȝl reaction tubes with the following reagents: 1x PCR Master Mix (+ KCl), 1.5 mM of MgCl2, 0.2 mM of each dNTP,

0,4 ȝmol of each primer and 1,5 U of Taq polymerase, 100 ng/ul DNA and ddH2O. PCR consisted of an initial denaturation step at 95 ºC for 5 min followed by 40 cycles of 1 min at 95 ºC, 1 min at 55 ºC, 2 min at 72 ºC, with final elongation step of 5 min at 72 ºC after the last cycle.

2.9.2.3 Molecular detection of Ricketsia spp

The presence of rickettsiae in ticks was determined by amplification of a 381-bp fragment of gltA gene by PCR using primers RpCS.877p (5‘-GGG GGC CTG CTC ACG GCG G-3‘) and RpCS.1258n (5‘-AAT GCA AAA AGT ACA GTG AAC A-3‘) (Regnery et al., 1991). The PCR reactions were conducted in 20 ȝl reaction tubes with the following reagents:

1x PCR Master Mix (+ KCl), 2 mM of MgCl2, 0.2 mM of each dNTP, 12,5 pmol of each primer and 0,75 U of Taq polymerase, 100 ng/ul DNA and ddH2O. PCR consisted of an initial denaturation step at 95 ºC for 5 min followed by 35 cycles of 20 s at 95 ºC, 30 s at 53 ºC, 60 s at 60 ºC, with final elongation step of 7 min at 72 ºC after the last cycle.

2.9.2.4 Molecular detection of Borrelia burgdorferi s.l

B. Burgdorferi s.l. infection was performed by using direct PCR amplification of B. burgdorferi s.l. DNA from ticks. As target for amplification the ospA gene localized on lp-54 plasmid in B. burgdorferi s.l. genome was used. PCR was performed using primers SL-F (5’- AAT AGG TCT AAT AAT AGC CTT AAT AGC -3’) and SL-R (5’-CTA GTG TTT TGC CAT CTT CTT TGA AAA- 3’) designed to amplify 307 bp fragment DNA of all genospecies of B. burgdorferi s. l. complex (Demaerschalck et al., 1995). Reaction volume of 25 ȝl contained 12.5 ȝl 2x PCR Master Mix (Thermo Fisher Scientific, Lithuania), 10 pmol of each primer (SL-

F and SL-R) (Roth, Germany), ddH2O and 2.5 ȝl of the processed tick sample. In each PCR run were used positive (DNA of Borrelia positive ticks) and negative (double distilled water)

48 controls. PCR conditions were the following: 95° C for 2 min, followed by 40 cycles of 94°C for 20 sec; 62°C for 20 sec; and 72°C for 30 sec. Final extending was at 72°C for 2 min. Genotyping of positive samples was done using genospecies-specific primers for B. burgdorferi sensu stricto (GI), B. afzelii (GIII) and B. garinii (GII) and by direct sequencing of the 16S (rrsA) – 23S (rrlA) intergenic spacer (IGS), using the IGS1-F and IGS1-R primers for the first PCR and IGS2-F and IGS2-R primers for the nested PCR (Demaerschalck et al., 1995). The other B. burgdorferi s.l. positive ticks were then analyzed by using B. valaisiana specific primers (Vennestrøm et al., 2008) which amplified 549 fragment of 16S rRNA gene.

2.9.2.6 Molecular detection of Anaplasma phagocytophilum

The presence of A. phagocytophilum in ticks was determined by amplification of a 546 bp fragment of the 16S rRNA gene. The external primers ge3a (5’-CAC ATGCAAGTCGAACGGATTATTC-3’) and ge10r (5’-TTCCGTTAAGAAGGATCTAAT CTCC-3’) were used in the first PCR (Massung et al., 1998). The PCR reactions were conducted in 50 ȝl reaction tubes with the following reagents: 1x PCR Master Mix (+ KCl), 2 mM of

MgCl2, 0.2 mM of each dNTP, 0,5 ȝM of each primer and 1,25 U of Taq polymerase, 100 ng/ul

DNA and ddH2O. PCR cycles included an initial 2 min denaturation step at 95 °C, followed by 40 cycles of denaturation at 94 °C for 30 sec, annealing at 55 °C for 30 sec, and extension at 72 °C for 60 sec. Amplification was completed by holding the reaction mixture at 72 °C for 5 min to allow complete extension of PCR products. The amplified product of this reaction was used as the template for a later nested PCR reaction, performed with the internal primers ge9f (5ƍ- AACGGATTATTCTTTATAGCTTGCT-3’) and ge2 (5ƍ-GGCAGTATTAAAAGCAGCTCC AGG-3’) (Massung et al., 1998). Nested cycling conditions were as described for the primary amplification, except that 30 cycles were used. Amplification of a 381-bp fragment of the msp4 gene was accomplished using primers MAP4AP5 (5ƍ-ATGAATTACAGAGAATTGCTTGTAGG-3’) and MSP4AP3 (5ƍ-TTAATT GAAAGCAAATCTTGCTCCTATG-3’) (Fuente et al., 2005). Each PCR mixture consisted of the following: 100 ng/ul DNA, 10 pmol/ȝl of each primer, 2x PCR Master Mix and ddH2O. PCR cycles included an initial 5 min denaturation step at 94 °C, followed by 40 cycles of denaturation at 94 °C for 30 sec, annealing at 56 °C for 30 sec, and extension at 72 °C for 50 sec. Amplification was completed by holding the reaction mixture at 72 °C for 5 min to allow complete extension of PCR products. Another PCR was carried out using primers msp4f (5’- CTATTGGYGGNGCYAGAGT-3’) and msp4r (5’-GTTCATCGAAAATTCCGTGGTA-3’) (Bown et al., 2007). Each PCR mixture consisted of the following: 1 ȝl PCR products, 10

49 pmol/ȝl of each primer, 2x PCR Master Mix and ddH2O. PCR cycles included an initial 5 min denaturation step at 94 °C, followed by 40 cycles of denaturation at 94 °C for 20 sec, annealing at 58 °C for 20 sec, and extension at 72 °C for 50 sec. Amplification was completed by holding the reaction mixture at 72 °C for 5 min to allow complete extension of PCR products.

2.9.2.7 Molecular detection of Francisella tularensis

Ticks collected from raccoon dogs were tested for the presence of F. tularensis by PCR using primers Ftul-F (5‘-GTGTTAGGGCATTTCGAGGAGTCT-3‘) and Ftul-R (5‘-CTGGCC AGTTCTATCTTGAGG-3‘) specific for F. tularensis outer membrane protein fopA gene (Sibley et al., 2005). The primers amplify a 459 bp product. The PCR reactions were conducted in 25 ȝl reaction tubes with the following reagents: 1x PCR Master Mix (+ KCl), 2 mM of

MgCl2, 0.25 mM of each dNTP, 0,8 μM of each primer and 0,5 U of Taq polymerase, 100 ng/ul

DNA and ddH2O. PCR consisted of an initial denaturation step at 94 ºC for 3 min followed by 40 cycles of 30 s at 94 ºC, 60 s at 55 ºC, 60 s at 72 ºC, with final elongation step of 5 min at 72 ºC after the last cycle.

2.9.3 PCR screening and DNA sequencing

The PCR amplification products were separated by electrophoresis on 1.5% agarose gel and visualized under UV light (EASY Win32, Herolab, Germany). PCR products selected for DNA sequencing were purified with a GeneJET Gel Extraction Kit (Thermo Fisher Scientific Baltics, Lithuania) following the manufacturer‘s recommendations. A BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) was used for DNA sequencing reaction according to manufacturer‘s recommendations. Sequencing was performed using 3730xl DNA automated sequencer (Applied Biosystems).

2.10 Investigation of infectious and parasitic diseases of raccoon dogs

The study was performed in three different study sites located in the western (Telšiai), central (Raseiniai) and eastern (Rokiškis) districts of Lithuania. During 1994–2002 in these areas foxes, raccoon dogs and badgers epidemiological situation has been assessed on the basis of the veterinary services and hunt statistics. Raccoon dogs and other predators were hunted by shooting, trapping or lying in wait to cave with dogs. Also samples have been taken in the following cases: a) assuming that the animal is infected with rabies or other diseases, b) the

50 animal came into the house and settled in, c) a sudden death of the animal, d) a dead beast found. All analyses were performed by STATISTICA and the results were expressed as mean values and their confidence intervals (CI) (p < 0.05).

51 3. RESULTS

3.1 Variability of skull morphometric characters in raccoon dogs

The descriptive statistics of different skull measurements on the skulls of 36 Lithuanian raccoon dogs is presented in Table 6. It was determined that males were larger than females in the population from Lithuania (according to 6 measurements). Only one measurement postorbital constriction (PC) were larger among females than males of raccoon dogs. The comparative analysis was performed comparing skulls of raccoon dogs collected in 1957 - 1960 year period, just after 10 years of their invasion to Lithuania, skulls collected in 2005 in Lithuania (Jurgelơnas et al., 2005) and skulls from two indigenous populations in Amur and Khabarovsk regions (Korablev et al., 2013). The results of comparison analysis revealed that condylobasal length (CBL) of raccoon dog skulls was 118.44 mm ± 1.15 in females and 119.79 mm ± 0.87 in males while Korablev et al. (2013) revealed that CBL was 116.99 mm ± 0.38 in females and 118.67 mm ± 0.46 in males from Amur region and 118.58 ± 1.17 mm in females, 119.81 ± 1.28 mm in males from Khabarovsk krai. Jurgelơnas et al. (2005) reported that the mean CBL of N.procyonoides was 120 mm ± 0.26 for males and 120.28 mm ± 0.25 for females. The measurements obtained by Jurgelơnas et al. (2005) somewhat larger than that detected in our study. Only length of lower tooth row (LT) were found shorter in raccoon dogs, collected in 2003-2005 years period. ML, ZB and LT were relatively longer in Lithuania than in Amur region and Khabarovsk krai. Accordingly, interorbital constriction and mandible height measurements were larger in populations from native range than in Lithuania. According to Jurgelơnas et al. (2005), N.procyonoides is somewhat larger with a mean ML of 90.6 mm ± 0.22 for males and 88.8 mm ± 0.42 for females by comparing these results with indigenous populations. Results of this study suggested that only difference between measurement in males and females in length of lower tooth row (LT) was found to be statistically significant (p<0.05). Jurgelơnas et al. (2005) assigned that two mean values in males and females of the raccoon dog differed significantly.

52 Table 6. Descriptive statistics for females and males of the raccoon dogs from Lithuania (present data, Jurgelơnas et al. (2005)) and from native range populations (Korablev et al., (2013))

CBL ML ZB LT IC PC MH Our data Lithuania F Max-min 124.60-105.10 97.20-62.10 70.60-57.30 62.30-53.50 25.30-18.70 23.30-18.10 48.20-31.80 1957 M±ER 118.44±1.15 87.82±2.04 66.71±0.81 58.91±0.53 22.23±0.40 20.31±0.36 38.21±0.92 M Max-min 126.20-114.10 98.40-58.40 74.20-63.40 65.30-57.30 26.20-19.20 23.00-15.50 42.10-32.80 M±ER 119.79±0.87 91.66±1.86 68.39±0.61 60.51±0.49 22.80±0.44 19.66±0.47 38.49±0.43 Diff.p < NS NS NS 0.04 NS NS NS Lithuania Jurgelơnas et al., 2005 2005 F M±ER 122.8±0.25 88.8±0.42 69.2±0.27 45.3±0.25 - - 38.5±0.15 M M±ER 120±0.26 90.6±0.22 67.9±0.21 45.9±0.22 - - 38.9±0.20 Korablev et al., 2013 Amur F Max-min 108.96-124.49 92.26-79.07 62.04-75.93 47.88-38.63 27.32-37.20 17.51-29.30 41.86-52.87 M±ER 116.99±0.38 85.51±0.32 66.24±0.30 43.79±0.22 31.55±0.23 19.89±0.18 47.67±0.25 M Max-min 109.97-128.38 95.27-79.06 62.07-74.72 49.48-38.73 27.68-39.38 17.25-30.49 41.34-55.97 M±ER 118.67±0.46 86.72±0.42 67.83±0.30 43.77±0.22 32.58±0.23 20.41±0.21 48.66±0.29 Khabarovsk F Max-min 112.96-123.86 90.68-83.28 61.87-73.76 46.18-41.68 28.54-37.61 18.94-22.68 44.95-52.03 M±ER 118.58±1.17 86.76±0.95 66.49±1.34 44.12±0.59 30.80±0.95 20.50±0.40 49.21±1.15 M Max-min 113.19-124.84 83.10-93.48 73.39-62.58 46.43-43.58 27.81-36.99 8.63-22.73 43.62-54.25 M±ER 119.81±1.28 87.93±1.27 67.80±1.18 45.34±0.33 32.37±1.10 20.39±0.40 49.09±0.99 F females; M males; M ± ER mean and standart error; max-min maximum and minimum; CBL condylobasal length. ML mandible length. ZB zygomatic breadth. LT length of lower tooth row. IC interorbital constriction. PC postorbital constriction. MH mandible height; p<0.05

Comparative analysis revealed that index of raccoon dog skulls was the highest in males from Amur and Lithuania (1957), while the lowest index were observed in Khabarovsk and Lithuania (2005) (Fig.12).

57,2 57 56,8 56,6 56,4 56,2 Females 56 55,8 Males 55,6 Values of skull indexes Values 55,4 Lithuania 1957 Lithuania 2005 Amur Khabarovsk (Our data) Jurgelơnas et Korablev et al.,Korablev et al., al., (2005) (2013) (2013)

Fig.12. Comparison of skull indices

3.2 Mitochondrial DNA control region analysis of raccoon dogs

DNA sequences in the control region of mtDNA were investigated in 21 raccoon dogs from different locations in Lithuania and one specimen of raccoon dog was found road-killed in northern Latvia (Jelgavkrasti) (Fig.13). The current 22 sequences were combined with the sequences from earlier data (n = 32) (Table 1).

Fig.13. The sampling localities of study (triangles), introduction sites (circles) (according to Bobrov et al., 2008). The distribution of mtDNA haplotypes belonging to haplogroup II are marked in outlined triangles The nucleotide proportions in the mtDNA fragment were examined: adenine 28.1% (A), cytosine 26.6% (C), guanine 17.9% (G) and thymine 27.4% (T), which was consistent with the earlier obtained data for the mtDNA control region in raccoon dog. The analysis of 22 sequences of a 540-bp fragment of the mtDNA control region in the raccoon dogs inhabiting Lithuania (n = 21) and Latvia (n = 1) revealed 9 haplotypes with 19 variable positions, including 15 transitions, 3 transversions, and one deletion (Table 7). Haplotype H_1 was the most frequent and was found in 6 out of 20 different collection sites, followed by H_2 (3 sites) and H_9 (3 sites) (Table 7). Haplotypes H_3, H_6, H_8 were specific for respective sampling locations. Haplotype H_7 was obtained from two sites in Latvia and Lithuania. Haplotype H_5, detected in Lithuania, was unique, and differs from the most similar sequences in GenBank by one nucleotide.

Table 7. Variable sites observed among mitochondrial control region sequences (540bp) of N. procyonoides from Lithuania and other countries. •Indicates the same base; - Indicates the base deletion

Variable sites

3 7 7 7 8899111222344 4 4 8 6 7 8 1907059168834 6 8 number Accession Haplotypes

Haplogroups 177647552 9 5 Other countries KC344215 HU KC344217 RU H_1 KC344226 T A T C G G A C T C T C T T G T T A G KC344224 KC344229 KC344220 HU KC344218 . . C . . . . T C ...... FI H_2 KC344225 DE I KC344230 RU H_3 KC344219 . . C . . . . T ...... DE KC344235 FI H_4 KC344231 . . C . . . . T C . . . . . - . . . . RU KC344228 KC344227 ...... - . . . . H_5 KC344233 ...... - . . . A FI H_6 KC344232 DE KC344221 C G . T A A G . . T C A C A . . C G A RU H_7 KC509604 LV FI C G . T A A G . . T C A C A . A C G A DE H_8 KC344222 II RU CN KC344234 FI H_9 KC344216 C G . T A A G . . T C A C A - A C G A DE KC344223 RU

55 A high level of mtDNA haplotype diversity (h) among 22 samples was estimated to be 0.881 ± 0.045, however nucleotide diversity (ʌ) (0.01351 ± 0.00251) was low. The phylogenetic relationships among the haplotypes of N. procyonoides in Lithuania demonstrated the presence of two haplogroups (clades) (Fig. 15 - 17). The first haplogroup (I) consisted of 6 haplotypes (n = 16), while the second (II) consisted of only 3 haplotypes (n = 6). Haplogroup II had lower nucleotide diversity and fewer divergent haplotypes than haplogroup I. The sample size, number of haplotypes, values of nucleotide diversity, and haplotype diversity within each haplogroup in Lithuania and other regions are presented in Table 8.

Table 8. Diversity indices for the mitochondrial control region of N.procyonoides from different regions

Number of Location n s Ș nh ʌ (±SD) h (±SD) pairwise differences Haplogroup Haplogroup 0.00403 ± 0.817 ± I 16 5 5 6 2.18 ± 2.31 Baltic region 0.00041 0.068 (this study) 0.00309 ± 0.733 ± II 6 3 3 3 1.67 ± 0.81 0.00075 0.155 0.753 ± North and I 65 6 6 7 0.00354 2.12 ± 2.88 0.001 Western Europe 0.571 ± (Pitra et al., 2010) II 8 1 1 2 0.00095 0.57 ± 0.25 0.010 Russia, Upper 0.0040 ± 0.970 ± I 21 10 9 12 2.37 ± 1.38 Volga basin, 0.0026 0.044 (Korablev et al., 0.0056 ± 1.000 ± II 9 9 10 6 3.35 ± 2.00 2011) 0.0038 1.00 South Korea 0.00514 ± 0.956 ± I 10 9 9 8 2.64 ± 2.33 (GenBank data) 0.0010 0.06 n = number of individuals, s = polymorphic sites, Ș = number of mutations, nh = number of haplotypes, h = haplotype diversity, ʌ = nucleotide diversity and SD = standard deviations

In order to compare the level of genetic diversity and describe phylogeographic patterns throughout raccoon dog distribution in Eurasia, data (n = 22) were combined with sequences available from earlier studies (n = 32) to an overall sample size of 54. The phylogenetic relationships among raccoon dogs from the different parts of the modern species distribution range were reconstructed using comparative analysis of sequences from Lithuania, Latvia, and the GenBank sequences of N. procyonoides from Finland, Germany, Hungary, Russia, China, South Korea, and Vietnam (Fig. 14 - 17). The NJ, ML, MP and BI trees showed similar topologies and had similar branching structures (Fig. 14 - 17). In NJ, MP and BI trees, the mtDNA control region haplotypes were

56 clearly separated into two groups: haplogroup I and haplogroup II. However, ML tree (Fig.14) consisted of three haplogroups, and haplogroup 3 contained the South Korean haplotypes.

Fig.14. Maximum Likelihood tree constructed from haplotypes of N.procyonoides, based on mtDNA control region. Numbers above branches show the Bootstrap values. Lithuanian haplotypes were marked with solid triangle. I, II and III– indicate number of haplogroup

In NJ tree (Fig. 15), haplogroup 1 was the same as that of the MP tree (Fig.16). The Bayesian tree (Fig.17) exhibited two haplogroups supported by higher posterior probability values (95-100%) than the bootstrap values (12 – 99%) of the ML, MP and NJ trees (Fig. 14- 16). Combined analyses of our sequences and others deposited previously in the GenBank revealed 3.1% of sequence divergence between the two haplogroups. The mean distance between sequences within haplogroup I was higher and equaled 0.6%, compared to 0.4 % in haplogroup II.

Fig. 15. Neighbor-Joining tree constructed from haplotypes of N.procyonoides, based on the complete sequences of mitochondrial control region. Numbers above branches show the Bootstrap values. Lithuanian haplotypes were marked with solid triangle. I and II – indicate number of haplogroups

Fig.16. Maximum Parsimony tree constructed from haplotypes of N.procyonoides, based on mtDNA control region. Numbers above branches show the Bootstrap values. Lithuanian haplotypes were marked with solid triangle. I, II – indicate number of haplogroup

Fig.17. Bayesian phylogenetic tree constructed from haplotypes of N.procyonoides, based on the complete sequences of mitochondrial control region. Numbers above branches show the Bayesian posterior probabilities. Lithuanian haplotypes were marked with solid triangle. I and II – indicate number of haplogroup

The geographical structure of the raccoon dogs in Europe was supported by the median- joining network which confirms a clear bipartition of raccoon dog haplotypes in Europe: there is a visible separation into two main haplogroups (Fig. 18). The haplogroups are separated by eleven mutation steps. Neutrality tests of Tajima’s D, Fu and Li’s F * and D *were used to test departure from neutrality, whereas Fu’s FS and R 2 were used to test for population size stability (Table 9). These quantities showed positive a statistically non-significant deviation from selective neutrality for entire data set, and for both haplogroups. However, the Fu’s Fs statistic showed a low negative and non-significant value of -0.464 in haplogroup I (Table 9). Demographic histories were also inferred by the raggedness statistic, r which quantifies the smoothness of the observed pairwise difference distribution (population growth = lower r values). The mismatch distributions showed relatively unimodal pattern with low raggedness values (r = 0.0622) and low mismatch mean (2.175) for haplogroup I, suggesting a population expansion for this clade (Table 9; Fig.19A). The mismatch distribution of pairwise nucleotide differences in sequences of the overall N.procyonoides population showed unimodal distribution (Fig.19C).

Fig. 18. Median joining network based on mtDNA sequences of N. procyonoides. Circles represent haplotypes, with size proportional to relative frequencies. Network branches linking the cycles indicate one mutation step; two or more mutations are represented by slashes crossed with the network branches

Table 9. Statistical tests for neutrality and the estimate of demographic parameters for N.procyonoides based on mtDNA sequences data

Mismatch distribution Haplogroup I Haplogroup II Total analysis Mismatch observed mean 2.175 1.667 7.758 Raggedness statistic (r) 0.0622 0.2400 0.0510 Tau 1.803 1.667 1.471 Theta initial (ș0) 0.372 0.000 6.287 Theta final (ș1) 1000.000 Neutrality tests Ramos-Onsins and Rozas 0.2106 0.2778 0.2041 R2 statistic Tajima's D statistic 1.46133 p>0.10 1.38606 p>0.10 1.80629 p>0.10 Fu and Li's D* statistic 0.45883 p>0.10 1.39584 p>0.10 1.58110 p>0.10 Fu andN. Li's F* statistic 0.83528 p>0.10 1.46483 p>0.10 1.92174 p>0.10 Fu's FS statistic -0.464 p>0.10 0.688 p>0.10 1.820 p>0.10

60 A B

Fig.19. Mismatch distributions for clade I (A), clade II (B) and all individuals (C). Shown are the observed distribution (dashed) and the expected distribution of a population with constant size (lines)

3.3 Population genetic study of the raccoon dog using microsatellite markers

Genetic diversity. For variation at microsatellite loci to assess we arranged our sampling data in four groups (I, II, III, IV subpopulations) also taking into account the fragmentation of country by main roads (E67, E85) with high volume of traffic (Fig. 26). Raccoon dog samples were collected from different regions of Lithuania representing different landscapes. The first (I) and second (II) sampling areas are covered by mixed forests and grasslands; deciduous broad- leaved woods are dominant in the third (III) sampling area, and pine (Pinus sylvestris) forests are prevalent in the fourth (IV) sampling area. To investigate the genetic diversity and structure of raccoon dog populations, 17 microsatellite markers, 5 described in canine genome (FH2096, FH2054, FH2010 (Francisco et al., 1996), PEZ17 (Kukekova et al., 2004) and REN112I02 (ĝlaska et al., 2005)) and 12 developed for N. procyonoides koreensis (Nyct 1-12; Hong et al., 2013; Table 10), were used in the present study. A total of 147 raccoon dogs were successfully genotyped at sixteen microsatellite loci, and altogether 149 alleles were detected (Table 10). The size of alleles varied according to each locus and ranged from 84 bp to 266 bp. The number of alleles for each locus (A) ranged from 4 to 15 with an average over all loci and all sample sites of 9.31. Over all loci, the average number of alleles per sample site (A) varied from 5.4 (IV) to 8 (I) with an average of 6.975 (Table 10).

61 Table 10. Genetic diversity of raccoon dogs from Lithuania estimated based on polymorphisms in 16 microsatellite loci. N - number of samples, A - number of alleles, (HO) and (HE) - observed and expected heterozygosities, P - values for HWE exact test for heterozygote deficiency/excess. Significant HWE deviation values marked by * (Bonferroni correction, adjusted p = 0.003)

17 17 FH FH FH PEZ PEZ 2096 2054 2010 REN Mean Mean Mean Mean Nyct1 Nyct1 Nyct3 Nyct4 Nyct5 Nyct6 Nyct7 Nyct8 Nyct9 112I02 Nyct10 Nyct10 Nyct11 Nyct12 I (N=41) A 8 6 9 10 8 6 9 11 4 9 4 7.64 15 4 12 9 4 8 HE 0.800 0.651 0.761 0.769 0.737 0.688 0.667 0.818 0.499 0.589 0.544 0.684 0.882 0.569 0.878 0.788 0.603 0.703 HO 0.805 0.561 0.659 0.854 0.805 0.707 0.537 0.805 0.317 0.610 0.488 0.650 0.949 0.683 0.854 0.854 0.902 0.712 P 0.821 0.017 0.193 0.217 0.243 0.680 0.022 0.424 0.000* 0.464 0.223 0.314 0.053 0.135 0.581 0.000* 0.929 II (N=36) A 9 6 9 9 9 6 11 10 3 5 4 7.36 14 6 10 9 4 7.8 HE 0.776 0.574 0.761 0.762 0.768 0.664 0.723 0.816 0.526 0.598 0.545 0.683 0.874 0.640 0.865 0.789 0.663 0.709 HO 0.800 0.529 0.743 0.750 0.743 0.778 0.833 0.743 0.486 0.528 0.528 0.678 0.968 0.750 1.000 0.861 0.943 0.749 P 0.994 0.009 0.489 0.063 0.016 0.954 0.098 0.025 0.001* 0.004 0.458 0.089 0.076 0.009 0.145 0.000* 0.995 III (N=56) A 9 7 7 5 9 5 6 7 2 4 4 5.91 12 5 10 10 5 6.7 HE 0.775 0.601 0.744 0.629 0.746 0.635 0.590 0.750 0.436 0.525 0.474 0.628 0.829 0.596 0.855 0.734 0.659 0.661 HO 0.741 0.625 0.643 0.625 0.714 0.661 0.661 0.679 0.536 0.554 0.482 0.629 0.889 0.691 0.818 0.818 0.852 0.687 P 0.006 0.979 0.023 0.635 0.328 0.951 0.235 0.000* 0.0845 0.992 0.524 0.424 0.058 0.860 0.022 0.000* 0.999 IV (N=14) A 7 4 6 5 7 4 4 5 2 4 3 4.64 10 5 8 7 5 5.4 HE 0.778 0.566 0.707 0.666 0.778 0.541 0.635 0.742 0.477 0.594 0.349 0.621 0.832 0.622 0.827 0.755 0.735 0.663 HO 0.500 0.500 0.643 0.857 0.714 0.357 0.571 0.786 0.643 0.357 0.429 0.578 0.929 0.571 0.786 0.857 0.857 0.647 P 0.002* 0.279 0.166 0.084 0.250 0.048 0.299 0.568 0.273 0.005 0.506 0.776 0.469 0.386 0.637 0.776 0.004 Total (N=147) A 10 9 9 10 10 7 11 14 4 11 4 9 15 6 12 11 6 - HE 0.782 0.598 0.743 0.706 0.757 0.632 0.653 0.781 0.485 0.577 0.478 0.654 0.854 0.607 0.856 0.767 0.665 - HO 0.711 0.554 0.672 0.771 0.744 0.626 0.651 0.753 0.495 0.512 0.482 0.634 0.933 0.674 0.864 0.848 0.889 - P 0.000* 0.000* 0.026 0.427 0.114 0.013 0.236 0.000* 0.999 0.000* 0.615 0.163 0.002* 0.684 0.062 0.000* - Hong et al., 2013 (N=104) A 10 13 8 10 10 12 9 9 4 6 4 8.7 ------HE 0.783 0.689 0.776 0.787 0.807 0.804 0.739 0.793 0.515 0.696 0.574 0.723 ------HO 0.692 0.702 0.653 0.689 0.624 0.767 0.598 0.667 0.375 0.65 0.466 0.619 ------P 0.005 0.00* 0.008 0.00* 0.00* 0.001* 0.004 0.002* 0.002* 0.426 0.011 ------

The values of observed (HO) and expected (HE) heterozygosities across all loci ranged from 0.482 to 0.933 and from 0.485 to 0.856 respectively (Table 10). Five loci (FH2054, FH2010, PEZ17, REN 112I02, FH2096) demonstrated a higher number of observed heterozygosities than expected. However, a significant deviation was detected only in two of them. A significantly higher number of expected than observed heterozygosities was detected in four loci (Nyct1, Nyct3, Nyct9, Nyct11) (Table 10). The mean values of the observed and expected heterozygosities estimated across the sampling areas were HO = 0.699 (ranged from

0.647 to 0.749) and HE = 0.684 (ranged from 0.661 to 0.709), respectively.

Allelic richness (AR) values ranged from 2.88 to 9.77. Estimates of allelic richness (AR) varied slightly among sampling areas, with the highest value being obtained in sampling locality I (6.14) (Table 11). Private alleles were found in all sampling areas. The greatest average number of unique alleles was detected in the sampling areas II and I (0.65 and 0.59, respectively) (Table 11). The PIC index ranged from 0.40 to 0.87, with the average of 0.68 (Table 11). The high PIC values indicated suitability of these loci for genetic studies of the invaded N. procyonoides population in Lithuania. MICROCHECKER detected the possible presence of null alleles or scoring errors in Nyct3 and Nyct10 loci in some samples of raccoon dogs. However, the Brookfield frequency indicates the heterozygote deficiency is very low (0.0938 and 0.1123) and there was no evidence for linkage disequilibrium. Genetic diferentiation and population structure. The genetic differentiation among subpopulations designated a priori (that corresponding with sampling areas in different geographical regions according to fragmentation by two main roads of Lithuania) was investigated (Fig. 26). Nei’s genetic distances (DNei) and FST analysis indicated a low genetic differentiation between all pairs of subpopulations (Table 12). FST calculations using the FSTAT software revealed that significant values were found between subpopulation I and III, and II and III. Pairwise values between other combinations were not significant (Table 12). On the contrary, trying to estimate population differentiation using another different estimators, pairwise population comparisons showed nonsignificant and different values between sampling locations (Table 13).

The analysis of Molecular Variance (AMOVA) based on RST estimated that 8% of the genetic variation is attributable to differences among the sampled locations and 91% of the genetic variation - within the locations, whereas based on FST it estimated 1% of the genetic variation among the sampled locations.

Table 11. Summary of genetic variation analysis of raccoon dogs, allelic richness (AR), private allelic richness (PR), and polymorphism information content (PIC)

I II III IV Mean Locus Size AR PR PIC AR PR PIC AR PR PIC AR PR PIC AR PR PIC (bp) Nyct1 184-196 7.06 0.23 0.77 7.53 0.85 0.75 7.06 0.60 0.75 7.00 0.05 0.74 7.43 0.43 0.77 Nyct3 233-255 5.08 0.38 0.60 4.95 0.66 0.54 5.55 0.92 0.57 4.00 0.00 0.52 5.25 0.49 0.58 Nyct4 227-249 6.57 0.24 0.73 6.72 0.32 0.73 5.68 0.390.71 6.00 0.41 0.67 6.20 0.34 0.72 Nyct5 158-178 7.09 0.71 0.74 6.95 1.14 0.73 4.55 0.00 0.57 5.00 0.28 0.62 6.10 0.53 0.68 Nyct6 146-172 5.77 0.07 0.70 6.48 0.86 0.73 6.96 0.37 0.71 7.00 0.22 0.74 6.50 0.38 0.73 Nyct7 124-148 5.19 0.57 0.63 4.271 0.63 0.61 4.11 0.000.57 4.00 0.13 0.50 4.55 0.33 0.61 Nyct8 107-131 6.12 0.99 0.62 6.49 1.66 0.68 4.06 0.15 0.53 4.00 0.30 0.57 5.28 0.78 0.60 Nyct9 157-200 7.99 1.65 0.80 8.75 1.69 0.79 5.12 0.59 0.71 5.00 0.16 0.69 7.19 1.02 0.77 Nyct10 181-188 3.30 0.45 0.44 3.44 0.04 0.44 2.00 0.00 0.34 2.00 0.00 0.36 2.88 0.12 0.40 Nyct11 90-117 4.85 2.06 0.51 4.36 0.34 0.51 2.69 0.44 0.41 4.00 0.54 0.51 4.08 0.85 0.48 Nyct12 161-170 3.77 0.12 0.49 4.28 0.02 0.47 3.27 0.00 0.41 3.00 0.00 0.31 3.67 0.03 0.44 FH 2054 134-164 11.0 0.82 0.87 11.0 1.15 0.86 8.61 0.27 0.81 10.0 0.30 0.81 9.77 0.64 0.85 FH2010 218-238 3.80 0.00 0.51 4.94 0.39 0.59 4.11 0.00 0.54 5.00 0.17 0.59 4.37 0.14 0.56 PEZ17 186-218 9.89 0.68 0.87 8.48 0.16 0.85 8.59 0.00 0.84 8.00 0.36 0.81 9.22 0.30 0.87 REN112I02 240-266 7.05 0.40 0.76 6.89 0.55 0.76 6.77 0.00 0.69 7.00 0.01 0.72 6.96 0.24 0.74 FH2096 84-106 3.70 0.00 0.53 3.93 0.00 0.60 4.16 0.26 0.59 5.00 1.00 0.69 4.13 0.32 0.59 Total - 6.14 0.59 0.66 6.12 0.65 0.67 5.20 0.29 0.61 5.38 0.25 0.62 - - -

Table 12. Pairwise comparisons of FST (above diagonal) and Nei’s genetic distance DNei (below diagonal) between Lithuanian raccoon dogs in four sampling areas using FSTAT

Sampling area I II III IV I 0.0008 0.0027* 0.0068 II 0.034 0.0031* -0.0007 III 0.027 0.029 0.0009 IV 0.070 0.053 0.047

Table 13. Pairwise comparisons of FST (above diagonal) between Lithuanian raccoon dogs in four sampling areas using GenAlEx

Sampling area I II III IV I 0.001NS 0.003NS 0.007NS II 0.004NS 0.000NS III 0.000NS IV

The factorial correspondence analysis (FCA), as shown in Fig. 20, did not reveal distinct clustering for the samples from different locations. The subpopulations partially overlap and are not clearly separable from each other. However, a tendency of separation of individuals from different sampling localities is also observed (Fig. 20).

Fig. 20. Spatial presentation of the distribution pattern of Nyctereutes procyonoides from four sampling areas obtained by Factorial Correspondence Analysis (FCA)

The Mantel test based on correlation between the pairwise geographic and genetic distances observed across all collection localities revealed a weak but significant (r = 0.229, p = 0.001) correlation (Fig. 21). A relatively high regression coefficient and significant association between genetic and geographic distances was obtained for the individuals from combined subpopulations I and II (western part; r = 0.432, p = 0.001), and a weak but significant (r = 0.188, p = 0.029) correlation for the individuals from combined subpopulations I and III (Fig.22, Fig.23). However, there was no significant association between genetic and geographic distances for the individuals of the combined subpopulations III and IV (eastern part; r = 0.081, p = 0.250) (Fig.24). This result demonstrated west-east direction in observed correlation between genetic and geographical distances.

Fig. 21. The relationship between geographic (km) and genetic distances (FST) among the 37 sample sites

Fig.22. The relationship between geographic (km) and genetic distances (FST) among the combined subpopulations I and II

Fig.23. The relationship between geographic (km) and genetic distances (FST) among the combined subpopulations I and III

Fig.24. The relationship between geographic (km) and genetic distances (FST) among the combined subpopulations III and IV

Bayesian clustering analyses was used to determine the hidden population structure of raccoon dogs in Lithuania, and to find out whether the geographical grouping of samples corresponded with genetic groups. The ǻK values were the highest when 4 genetically distinct clusters were identified. Plots of mean estimates of log-likelihood probability of data (Ln P[K]) and the ǻK (mean (|L''[K]|/sd(L[K])) versus K values generated by STRUCTURE simulations of the data from four sample areas are shown in Figure 25 A and B, respectively. A sharp peak of ǻK at 9.69 for Kௗ=ௗ4 indicated four genetic clusters according to the genotypic variations. However, these four clusters did not correspond to the four a-priory designated subpopulations (Fig. 25). Although a single cluster dominates in some sampling localities from the coastal area (Fig. 25, 26), no clear geographical clustering of raccoon dogs was observed. All genetic

67 clusters with low to high confidence were found in most locations, and each of the four subpopulations had more than one cluster (Fig. 25, 26).

Fig. 25. Clustering analysis of raccoon dogs genotypes from Lithuania using Bayesian assignment. A) Mean likelihood [L (K) ± SD] over 10 runs assuming K clusters (K = 1–8). B) ǻK, where the modal value of the distribution is considered as the highest level of structuring. C) Individual assignment to the K=4 clusters. Each individual is represented by a bar, with coloured sections indicating the likelihood of assignment to the corresponding cluster

Fig.26. Colored pie chart showing proportion of the STRUCTURE clusters in ech samling sites

3.4 Assessment of bioinvasion impact on racoon dogs

A bioinvasion impact assessment method (BPL - biopollution index) was applied to N. procyonoides monitoring data collected from different locations of Lithuania. BPL takes into account abundance and distribution range of an alien species and the magnitude of the impact on native communities, habitats and ecosystem functioning. Most frequently the raccoon dog was found in high numbers in many localities and defined as D class according to the abundance and distribution (75%). In other cases, the raccoon dog was found in moderate numbers in many localities (25%) (Table 14). The biopollution level (BPL) estimated for N. procyonoides ranged from BPL=2 (moderate impact (25%)) to BPL=3 (strong impact (75%)) (Table 14).

Table 14. An overall assessment of impact caused by raccoon dogs in 12 locations of Lithuania Assessment of Abundance and Assessment of Biopollution Level (BPL) Distribution Range (n/(%)) (n/(%)) A B C D E 0 1 2 3 4 - - 4 9 - - - 4 9 - (25%) (75%) (25%) (75%)

69 High abundance and distribution (D) and strong biopollution level (BPL=3) were observed in 9 localities (Kretinga, Varơna, Radviliškis, Vilnius districts and Kamanos Strict Nature Reserve, Kurtuvenai Regional Park, Zemaitija National Park) (Table 15). The raccoon dog impacts on native species and communities (C2) were moderately negative. A strong impact (C3) was noted only once, when it was found at one sampling locality (Radviloniai Forest, Radviliskis District) (Table 15).

Table 15. Assessment of bioinvasion impact on racoon dogs in different locations of Lithuania

Assessment unit (ADR) Impacts on community community Level (BPL) Abundance and Total Biopollution Distribution Range Impact to habitats Impact to Ecosystem Baubliai Forest, Baubliai Village, Kretinga District D C2 H1 E3 3 (2000 - 2000) Dzukija National Park, Varena District: Woodland C C2 H1 E2 2 (1996 - 2002) Geidukonys Forest, Varena District (1999 - 1999) D C2 H1 E3 3 Kamanos Strict Nature Reserve: Woodland (1999 - D C2 H1 E3 3 2001) Kreisa Brook Valley, Ricieliai, Varena District (2002 C C2 H1 E2 2 - 2002) Kurtuvenai Regional Park: Woodland (2006 - 2006) D C2 H1 E3 3

Kurtuvenai Regional Park: Woodland (1999 - 1999) D C2 H1 E3 3

Kurtuvenai Regional Park: Woodland (2004 - 2004) D C2 H1 E3 3

Kurtuvenai Regional Park: Woodland (2001 - 2001) D C2 H1 E3 3 Margavoniai Forest, Radviliskis District (1996 - D C2 H1 E3 3 1996) Mazuoliai Forest, Radviliskis District (1996 - 1996) C C2 H1 E2 2 Netiesos Hydrological Reserve, Netiesos, Varena D C2 H1 E3 3 District (2002 - 2002) Radviloniai Forest, Radviliskis District (1996 - 1996) D C3 H1 E3 3 Subartonys Forest, Subartonys, Varena District (2002 C C2 H1 E2 2 - 2002) Verkiai Regional Park, Vilnius District: Woodland D C2 H1 E3 3 (2000 - 2001) Zemaitija National Park Woodland (1997 - 1998) D C2 H1 E3 3

70 The impacts on habitats were estimated in all cases at level H1 (weak impact). In many cases, the impacts on habitats were weak (H1), but a strong biopollution level (BPL=3) was noted (Table 15). The impacts on ecosystem functioning ranged from moderate (E2) in four localities to strong impact (E3) in nine localities (Table 15).

3.5 Detection and characterization of tick-borne pathogens in raccoon dogs

In this study ticks were removed from raccoon dogs and examined for presence of different pathogens (Babesia spp., Bartonella spp., Borrelia burgdorferi sensu lato, Rickettsia spp., Anaplasma phagocytophilyum and Francisella Tularensis). The possible role of raccoon dogs in spread of tick-borne transmitted diseases in Lithuania was determined. A total 44 ticks (40 Ixodes ricinus and 4 Dermacentor reticulatus) from 9 raccoon dogs have been tested by using different molecular markers. With the help of PCR two ticks were found to be positive for Babesia spp. For identification of Babesia species, PCR products (450 bp fragment of 18S rRNR gene) of one positive sample were sequenced. The sequencing of 18S rRNR gene showed that Babesia spp. was detected in one positive I.ricinus sample (Fig. 27).

Fig.27. Identification of Babesia spp. in 1.5 % agarose gel after PCR amplification with PIRO-A1/PIRO- B primers. Lines M – Gene Ruler TM 50bp DNA ladder, (Thermo Fisher Scientific Baltics, Lithuania); Lines K- negative control (ddH2O); Lines 34, 40 – amplified products; Lines 45, 10– negative tick samples

The nucleotide sequence of the 18SrRNA gene of one I. ricinus tick sample (Lithuania, R7.1-13) showed a 100 % sequence similarity to the sequence of B. microti (Fig. 28). The phylogenetic analysis of the 18SrRNA gene demonstrated that B.microti positive tick from raccoon dog were similar to the sequences previously found in Germany (I. ricinus, H. sapiens), Estonia (I. persulcatus) and Denmark (Canis familliaris).

71 67 JX417370 H.s.Babesia microti AU GU057383 I.p. Babesia microti RU AF231349 I.r. Babesia microti DE R7.1-13 I.r. Babesia microti LT KP688578 C.f. Babesia microti DK 100 EF413181 H.s. Babesia microti DE HQ629933 I.p. Babesia microti EE KT008057 C.f Babesia canis canis EE EU152128 D.r Babesia canis canis PL

0.02 Fig.28. .Phylogenetic tree based on aligned sequences of the 18SrRNR gene of Babesia spp. created using the neighbor joining method and a bootstrap analysis of 500replicates.Sequences with accession numbers have been taken fromGenBank for comparison. Sample sequenced in the present study are marked. Abbrevations: H. s. – Homo sapiens, I. r. – Ixodes ricinus, I. p. – Ixodes persulcatus, C.f. - Canis familliaris, D.r. - Dermacentor reticulatus. LT – Lithuania, DE – Germany, EE – Estonia, AU – Australia, RU – Russia, DK - Denmark, PL - Poland

Rickettsial DNA was found in 4 of the 44 ticks determined by amplification of a 381-bp fragment of gltA gene by PCR using primers RpCS.877p and RpCS.1258n (Fig.29). Sequencing of 381-bp fragments of gltA gene and BLAST alignment confirmed the identification of Rickettsia monacensis (327 bp) in one I. ricinus tick. Sequencing of PCR product showed that Rickettsia helvetica (321-334 bp) were detected in two I. ricinus ticks collected from three raccoon dogs (Fig.29, Fig.30). The gltA sequences derived from Rickettsia positive I.ricinus ticks from Lithuania, Romania were identical to each other and showed 100% similarity with R. monacensis sequences deposited in GenBank (Fig.30). Rickettsia helvetica sequences were identical to sequences from Romania, Switzerland and Germany (Fig.30).

Fig.29. Identification of Rickettsia spp. in 1.5 % agarose gel after PCR amplification with RpCS.877p and RpCS.1258n primers. Lines M – Gene Ruler TM 100bp DNA ladder, (ThermoFisher, Lithuania); Lines K- negative control (ddH2O); Lines 5, 18,37,39,43 – amplified products

72 JX003686 R.monacensis I.r.RO

99 JQ669950 R.monacensis I.r. IT GQ925820 R.monacensis I.r. SRB Ku10.1-5 I.r. LT JN182786 R.conorii H.s. IT 100 DQ821855 R.conorri PT R7.2-3 I.r LT Ku10.2-18 I.r LT DQ131912 R.helvetica I.p.RU 100 EU359287 R.helvetica I.r. CH KC007126 R.helvetica I.r. DE

0.005 Fig.30. Phylogenetic tree based on aligned sequences of the gltA gene of Ricketsia spp. created using the neighbor joining method and a bootstrap analysis of 500 replicates.Sequences with accession numbers have been taken fromGenBank for comparison. Samples sequenced in the present study are marked. Abbrevations: H. s. – Homo sapiens, I. r. – Ixodes ricinus, I. p. – Ixodes persulcatus. RO – Rumunia, LT – Lithuania, IT – Italy, PT – Portugal, RU – Russia, CH – Switzerland, DE – Germany, SRB-Serbia

For identification of Bartonella species, PCR products (379 bp fragment of gltA gene) of five positive samples were sequenced (Fig.31). The sequencing of gltA gene showed that Bartonella spp. was detected in one positive I.ricinus sample. The identification of Bartonella species based on sequences alignment to the species level had failed (Fig.32).

Fig.31. Identification of Bartonella spp.in 1.5 % agarose gel after PCR amplification with BhCS.1137n and BhCS.781p primers. Lines M – Gene Ruler TM 100bp DNA ladder, (Thermo Fisher Scientific Baltics, Lithuania); Lines K- negative control (ddH2O); Lines 9, 30, 23, 44, 5 - amplified products; Line 11, 17, 38 – negative tick samples

73 100 KT825961 Rickettsia helvetica I.p. RU 58 FJ157326 Rickettsia helvetica I.r. SP 97 KP283016 Rickettsia monacensis I.r.SP KP215387 Rickettsia monacensis I.r. EE KR816895 Uncultured Bartonella sp. I.r. LT 98 JQ228398 Uncultured Bartonella sp. D.m. FR KU10.1-9 LT

100 R9.1-5 LT 99 DQ672603 Rickettsia sp. I.r. PL

0.1 Fig.32. Phylogenetic tree based on aligned sequences of the gltA gene of Bartonella spp. created using the neighbor joining method and a bootstrap analysis of 500 replicates.Sequences with accession numbers have been taken fromGenBank for comparison. Sample sequenced in the present study are marked. Abbrevations: D. m. – Dermacentor marginatus, I. r. – Ixodes ricinus, I.p. - Ixodes persulcatus. FR –France, LT – Lithuania, PL – Poland, RU - Russia, SP - Spain

In order to identify Borrelia species in ticks the genotyping was done. B. burgdorferi s.l. DNA was found in 6 out of 44 ticks. We used multiplex PCR with primers specific for B. afzelii, B. gariniii, B. burgdorferi s. s. and B. valaisiana. Multiplex PCR analysis indicated that two of tested ticks were infected with B. afzelii, one with B. miyamotoi and one with B. valaisiana (Fig.33, 34). In two infected ticks we could not identified Borrelia species by using these primers. Sequencing of 470 bp fragments of 16S-23S IGS and BLAST alignment confirmed the identification of B. miyamotoi in one tick (Fig. 34). Borrelia miyamotoi sequence were similar to sequences from Austria and Sweden (Fig.34).

1 2 3 4 5 6 7 8 9

Fig.33. Identification of Borrelia burgdorferi s.l.genospecies in 1.5 % agarose gel after PCR amplification species specific primers. Lines M – Gene Ruler TM 100 bp DNA ladder, (Ferment, Lithuania); Lines 2, 3, 8 - samples infected with B.afzelii (189 bp) ; Lines 2, 5, 8 - samples infected with B. valaisiana (549 bp) ; Line K+ - positive tick control with B. valaisiana (549 bp); Line K- negative control (H2O)

74 R7.1-13 100 KP202177 Borrelia miyamotoi I.r. AT 99 AY363705 Borrelia miyamotoi I.r. SE AY16378 Borrelia garinii LV EU203147 Borrelia hermsii USA KP79535 Borrelia garinii P.g USA

0.05 Fig.34. Phylogenetic tree based on aligned sequences of the 16S-23S gene intergenic spacer sequences of Borrelia spp. created using the neighbor joining method and a bootstrap analysis of 500 replicates. Sequences with accession numbers have been taken from GenBank for comparison. Sample sequenced in the present study are marked. Abbrevations: I. r. – Ixodes ricinus, P. g. - Peromyscus gossypinus (cotton mouse). AT – Austria, USA – United State of America, LV - Latvia, SE - Sweden

Anaplasma phagocytophilum was also detected in three I.ricinus ticks collected from one raccoon dog. The partial nucleotide sequences of the A. phagocytophilum 16S rRNA and msp4 genes were added to the GenBank database under the accession numbers JN181079 to JN181081 and JN181115 to JN181117, respectively. Francisella tularensis pathogens were not detected in tested ticks samples removed from raccoon dogs.

The findings of the present study show that raccoon dogs can be a host and vector for a variety of pathogens. This may result in a growing importance of this invasive species concerning the epidemiology of some transmissible diseases.

3.6 Investigation of infectious and parasitic diseases of raccoon dogs

In this study the diseases like mange and trichina in three species of medium-sized predators were analyzed: invasive raccoon dog, native red fox and Eurasian badger. The analyses of mange and trichina are summarized in Tables 16, 17 and 18. Investigation of sarcoptic mange epidemiological situation in the eastern and western part of Lithuania from 1994 till 2002 showed that 119 raccoon dogs, 75 red foxes and 4 Eurasian badgers were mange-positive (Table 16, 17). In 1994–2001, 1 270 raccoon dog samples of mange cases were examined in the eastern part of Lithuania and mange was confirmed in 7.0% (Table 17).

75 Table 16. Investigation of Sarcoptic mange epidemiological situation in eastern part of Lithuania Raccoon dog Red fox Years Tested Positive, n Positive, % Tested Positive, n Positive, samples samples % 1994 30 2 6.6 65 5 7.7 1995 47 2 4.2 87 8 9.2 1996 61 3 4.9 125 2 1.6 1997 43 3 6.9 200 2 1.0 1998 91 8 8.8 216 4 1.8 1999 102 13 12.7 272 3 1.1 2000 382 21 5.5 202 14 6.9 2001 514 37 7.2 536 15 2.8 Total 1270 89 7.0 1703 53 3.1 *Eurasian badger not tested in Rokiškis

In 2000–2002, 30 (12.6%) raccoon dogs from 238 analyzed samples were mange positive in the western part of Lithuania (Table 18). From 1994 till 1999, the prevalence of mange cases in raccoon dogs increased from 6.6% to 12.7% in the eastern and in 2000 till 2002 decreased from 26.2% to 5.9% in the western part, respectively. Concerning red fox, in 1994–2001 1703 samples of mange suspected cases were examined in the eastern part and 324 cases in the western part. The prevalences of positive cases in the eastern and western part of Lithuania red foxes were 3.1% and 6.8% respectively. From 1994 till 2001, the prevalence of mange cases in red foxes decreased from 9.2% to 1.0% in the eastern part and in 2000 till 2002 from 12.2% to 7.1% to in the western part. The highest prevalence of mange cases was registered in the western part of Lithuania in 2000, when among 90 mange suspected samples tested 11 positive red fox (12.2%). In 2000–2002 in the western part 4 mange positive Eurasian badgers out of 111 mange suspected samples (3.6%) were also registered.

Table 17. Investigation of Sarcoptic mange epidemiological situation in western part of Lithuania Raccoon dog Red fox Eurasian badger n n n % % % Years Tested Tested Tested samples Positive Positive samples Positive samples Positive Positive Positive 2000 84 22 26.2 90 11 12.2 53 1 1.9 2001 137 7 5.1 220 10 4.5 49 3 6.1 2002 17 1 5.9 14 1 7.1 9 - 0 Total 238 30 12.6 324 22 6.8 111 4 3.6

76 The analysis of trichinellosis epidemiological situation in the central part of Lithuania in 1994–2001 showed that 2 raccoon dog and even 66 red fox cases were diagnosed (Table 18). Only one Eurasian badger trichinellosis case was diagnosed in the western part of Lithuania.

Table 18. Investigation of trichinellosis epidemiological situation (cases per year) in central and western parts of Lithuania Raseiniai Telšiai Years Raccoon Red fox Raccoon Red fox Eurasian dog dog badger 1994 1 2 - - - 1995 - 5 - - - 1996 1 11 - - - 1997 - 19 - - - 1998 - 20 - - - 1999 - 6 - - - 2000 - 2 - - - 2001 - - - 1 1 2002 - - - - - Total 2 66 0 1 1

The raccoon dogs have been shown to enhance the frequency of the sarcoptic mange and act as a new potential reservoir for endemic parasites and pathogens.

77 4. DISCUSSION

Variability of skull morphometric characters in raccoon dogs. The results of study indicated, that males of raccoon dogs are slightly larger than females in six morphometric characteristics CBL, ML, ZB, LT, MH and IC (Table 6). Kauhala et al. 1998a found a minor difference between males and females of raccoon dogs from Finland and Japan. The data on N. procyonoides craniometry from Russia confirmed that males are bigger than females, and the coefficient of variation in males exceeds that in females (Korablev and Szuma, 2013). However, Korablev and Szuma (2013) noted, that investigated populations of raccoon dogs did not reveal obvious sexual size dimorphism for cranium signs. Kauhala et al. 1998 indicated that slight sexual dimorphism could be the result for strictly monogamous and natural selection. Possibly to be the larger size in males would be not advantage, because large animals need more food. The second explanation for monorphism of raccoon dog could be absence of partition of ecological niches between males and females (Drygala, 2008b). The results of skull measurements indicated some differences among raccoon dog skulls collected in different regions. Generally, the maximum condylobasal length of the N. procyonoides found in this study was larger than that previously reported by Korablev et al. (2013) (Table 6). The mean values of the three of seven characters (IC, PC, and MH) were lower that those found in the study from native range of the raccoon dog (Korablev et al., 2013) (Table 6). The comparative analysis of skull measurements in native range, introduced and invasion populations of raccoon dogs is presented in Table 19. In many cases the measurements of raccoon dog skulls were larger in populations in European part of Russia and Finland than those of native range raccoon dogs. Means of condylobasal skull length (CL) showed higher values in raccoon dogs from Europe (excluding Poland) comparing with indigenous populations. The biggest ones were found in population from Finland (122 mm) and Lithuania (121.4 mm) while the smallest in Poland (117.98 mm), Russia (118.51 mm) and Japan (109.5). The highest mandible length (ML) was evaluated in Finland (92 mm) and Lithuania (89.7 mm). Populations from Finland (70.9 mm), Lithuania (68. 5 mm) and European part of Russia (68.3 mm) were biggest in zygomatic breadth (ZB). The longest lower tooth rows (LT) were found in raccoon dogs from Lithuania (59.8 mm) (during this study). The biggest interorbital constriction (IC) measurements were revealed in European part of Russia (32.5 mm) and Poland (32.4 mm). Raccoon dogs from Japan (21.3), European part of Russia (20.6 mm) and Russian Far East (20.3) showed higher values of postorbital constriction (PC) comparing with Europe. The highest mandible (MH) demonstrated Finish raccoon dogs (51.3) (Table 19). Although four

78 measurements (CBL, ML, ZB and MH) of Finish raccoon dogs were larger than other populations. In present study the comparison of skull measurements confirmed the results by Ansorge et al. 2009 showing separation of Amursk Region (native populations) samples from all European samples of raccoon dogs.

Table 19. Descriptive statistics of absolute skull measurements in native range and introduced, invasion populations of raccoon dogs

Native range Introduced and invasion populations populations Asia Europe

) (2003-2005) (2003-2005) 2005 2013) 2013) (1968-1975) (1974-1992) (1974-1992) Measurements Poland Poland Finland Finland Lithuania al., 1998a) nas and Daugnora, nas and Daugnora, ơ Szuma, 2013) Szuma, 2013) Szuma, 2013) Szuma, 2013) Japan Russia (Korablev and Szuma, (Kauhala et al., 1998a) (Kauhala et al., 1998a) Lithuania (1986-1992) (Kauhala et (Kauhala (1986-1992) European part of Russia Data of study (1957-1960) Data of study (1957-1960) (Jurgel (1960-2007) (Korablev and (Korablev (1960-2007) (1947-2010) (Korablev and (Korablev (1947-2010) CBL 118.5 109.5 ± 3.5 119.8 122 ± 3.5 117.98 119.1 ± 4.2 121.4 ML 86.7 83.2 ± 3.3 88.3 92 ± 3.1 86.9 89.9 ± 8.3 89.7 ZB 67.0 63.6 ± 2.5 68.3 70.9 ± 2.5 67.8 67.6 ± 3.0 68.5 LT 44.3 50.2 ± 2.0 44.8 53.3 ± 1.6 43.9 59.8 ± 2.3 45.6 IC 31.8 22.3 ± 1.2 32.5 23,9 ± 1.3 32.4 22.5 ± 1.8 - PC 20.3 21.3 ± 1.4 20.6 19,8 ± 1.4 20.0 19.9 ± 1.8 - MH 48.7 42.4 ± 2.3 50.3 51.3 ± 2.3 50.1 38.4 ± 2.8 38.7 Abrevations: CBL condylobasal length, ML mandible length, ZB zygomatic breadth, LT length of lower tooth row, IC interorbital constriction, PC postorbital constriction, MH mandible height

The important factors for size variability are historic invasion process (introduction and immigration), number of animals in invasion populations and stochastic factors (Korablev et al., 2013; Ansorge et al., 2009). According to Judin (1977), it is probable that all animals introduced within the former Soviet Union are progeny of population from Amursk region. Combination of separate population into the metapopulation in European Russia has influenced their morphological specificity (Korablev et al., 2013). The differences in skull variation most probably could arise from differences in the diet, adaptation to local environment as well as availability of food and climatic parameters (temperate zone). For example, raccoon dogs from Finland are more carnivorous comparing with Japanese, because Japanese raccoon dogs are consumer of grinding insects and fruits for the milder climate. It should be noted that Japanese raccoon dogs belong to the subspecies N. p. viverrinus. Moreover, variation of skull

79 morphometric characteristics can depend on the sampling period of skulls series (Ansorge et al., 2009). Mitochondrial DNA control region analysis of raccoon dogs. The combination of high haplotype diversity (9 haplotypes in 22 sequences) and low nucleotide diversity (0.01351±0.00251), as observed in present study, can be a signature of a rapid demographic expansion from a small effective population size. In such a case new haplotypes have accumulated without large sequence differences (Avise, 2000). Similarly high haplotype diversity and low nucleotide diversity values have been reported in other canine species such as the grey wolf (Canis lupus L) (Gomerþiü et al., 2010), coyotes (Canis latrans) (Bozarth et al., 2011), and red foxes (Vulpes vulpes L.) (Edwards et al., 2012). Similar results were obtained in raccoon dogs from Western Europe and European part of Russia. In recent years, statistical tests were developed to detect selective neutrality of mutations, have been implemented to detect such population growth. Tajima’s D test (1989) is based on the allele frequency distribution of segregating nucleotide sites, while Fu’s FS test (1997) is based on the distribution of alleles or haplotypes. R2 test is based on difference between average number of nucleotide differences and the number of singleton mutations in each sequence (Ramos and Rozas, 2002). Positive Tajima’s D, Fu’s FS and R2 test indicate, that Lithuanian samples has not undergone major growth (Table 9). According to Pitra et al. 2010 the growth of raccoon dog populations has been too recent to determine in present studies. Mismatch distribution indices and Fu's FS statistic indicated some size expansion for the haplotypes of clade I (Fig.19A), other statistical test indices did not corroborate this finding. Estimated haplotypes and haplogroups were not related with any spatial geographic structure of the populations, haplotypes attributed to haplogroup II were detected only in raccoon dogs hunted sites located near rivers in the lowlands whereas animals with haplotypes belonged to haplogroup I were found across the whole country (Fig.13). All haplotypes detected in Lithuania, except of one (haplotype H_5) (Table 7) were identical to those obtained in Finland (H_2, H_4, H_6, H_8, H_9), Germany (H_2, H_3, H_6, H_8, H_9), Hungary (H_1, H_2), Russia (upper Volga basin) (H_1, H_2, H_4, H_7, H_8, H_9), and China (H_8). Raccoon dogs from China and Vietnam both clustered in haplogroup II (Figure 14-17). The sequence of N. procyonoides from Vietnam was distinct and separated from other sequences of this haplogroup (Figure 14-17). The geographically adjacent populations clearly show some degree of genetic divergence and similarities of certain mtDNA haplotypes (Figure 35). The phylogenetic analysis showed the detection of two distinct clades within Europe. The primary separation of N. procyonoides in two clades is not clear and is still discussed. The

80 climate changes during the mid-Pleistocene in continental Siberia might have led to the genetic differentiation within species (Prokopenko et al., 2002; Pitra et al., 2010). It was suggested that diversification of clades have occurred long before the recurrent introductions in Europe, and is the result of environmentally isolating mechanisms (Pitra et al., 2010). Existence of two clades in the introduced population is associated with the introduction of raccoon dogs from two spatially isolated autochthonous populations (Korablev et al., 2011). It seems that repeated translocation events in the early period of introduction included individuals of already differentiated mtDNA lineages (Pitra et al., 2010).

Fig.35. Geographical distribution of mtDNA control region haplotypes in Europe. Pie charts show the proportions of haplotypes

A similar distribution of molecular genetic variation in two haplogroups was observed in N. procyonoides from Lithuania and Northern, Western Europe (Pitra et al., 2010). On the contrary, in Russia, Korablev et al. (2011) obtained higher genetic diversity in haplogroup II (defined as “haplogroup I” in Korablev et al., 2011). Patterns of molecular genetic variation in raccoon dogs from Lithuania obtained in the present study have indicated higher genetic diversity of these animals compared to those from Northern and Western Europe (Pitra et al., 2010), but lower genetic polymorphism compared to raccoon dogs from South Korea (autochthonous population; haplogroup I) and from Russia (introduced population; Korablev et al., 2011) (Table 8). Higher levels of genetic diversity observed in the introduced populations in Russia can be result of introduction of large group of animals from different sites (Korablev et 81 al., 2011). The lower genetic diversity in Lithuania could be results of immigrants from neighboring countries Belarus and Latvia. Raccoon dog were introduced in Latvia in the 1947 and in Estonia in the 1950s from reacclimatized sites of Russia. In Belarus, the species was introduced between 1936 and 1956 from breeding farms and reacclimatized sites of Russia (Long, 2003). The most abundant haplotype H_1 occurred in Lithuania, was also found in Russia and Hungary, while was not detected in other investigated European countries (Fig.35). This suggests invasion from introduced population, possible through Belarus. In Latvia about 1000 raccoon dogs were reported to have been observed or hunted during 1951. In 1960 about 4210 hunted raccoon dogs were reported. Although raccoon dogs were found all over Estonia in the 1950s (Lavrov, 1971), their numbers remained low because of the presence of numerous wolves and lynx populations, the natural enemies of raccoon dogs in Estonia. In contrast, the number of wolves and lynx decreased in 1940-1950 in Lithuania, which allowed rapid spread of raccoon dogs in the country. This species colonized Lithuania in about 10 years (Balþiauskas, 1996). Multiple introduction (in different years and from different locations) and rapid population growth during the first decade of invasion as well as admixture and subsequent intraspecific hybridization of invasive populations could explain high genetic diversity of Lithuanian raccoon dog population observed in the present study. Currently hunting of raccoon dogs in Lithuania is permitted throughout the year. The density of the Lithuanian population varied in different time periods (according to the data of Ministry of Environment of the Republic of Lithuania, http://www.am.lt) and according to monitoring data during 1960-1970 it reached from 3000 to 14 000 in ten year period. The hunting statistics showed that more than 5000 raccoon dogs were hunted in 2002, 4000 in 2003, 3439 in 2004-2005, 2818 in 2006-2007, 5554 in 2008-2009, 10290 in 2010-2011, and 4791 in 2011-2012. Regulating populations by hunting could affect the dispersal behavior and the population structure of this species. Our results confirmed that high variation of donor autochthonous populations, as well as repeated introductions may have rendered invaders with high adaptive potential. Multiple immigration events could prevent genetic bottlenecks and generate genetic diversity through genetic exchanges. This could have allowed raccoon dogs to evolve in response to the changing climate, and to have an increasing impact on native communities and ecosystems in the future (Robert et al., 2003; Lavergne et al., 2007).

Population genetic study of the raccoon dog using microsatellite markers. In the present study, the genetic diversity and the population structure of invasive N. procyonoides ussuriensis in colonized areas in the Baltic region were for the first time investigated using

82 microsatellite markers. Investigations showed that the invasive raccoon dogs in Lithuania exhibit a high level of genetic diversity. The mean values of the observed and expected heterozygosities estimated across the sampling areas were 0.699 and 0.684 respectively. In order to compare the genetic diversity of raccoon dogs from their recently expanded range (in Lithuania) and natural range (in South Korea), we analyzed polymorphisms in 11 microsatellite loci developed for N. p. koreensis by Hong et al. (2013). Similar genetic variation patterns were detected in the investigated loci of raccoon dogs as compared with previously published on South Korean dogs (Hong et al., 2013). The number of alleles per locus (A) ranged from 4 to 14 and from 4 to 13 in the invasive N. p. ussuriensis and the endemic N. p. koreensis (Hong et al. 2013), respectively. The average number of alleles over all loci was slightly higher in Lithuanian raccoon dogs (Table10). The mean value of observed heterozygosity was higher in Lithuanian populations, while the mean value of expected heterozygosity was higher in South Korean raccoon dogs’ populations. Allele size ranges in the raccoon dog populations in South Korea were narrower (excluding one locus -Nyct12) than those of raccoon dog populations in Lithuania (Table11). Sequencing of the control region of mtDNA has showed a higher genetic variation of raccoon dogs from Lithuania compared to those from Northern and Western Europe (Pitra et al., 2010), but lower genetic diversity compared to raccoon dogs from South Korea (Korablev et al., 2011; Paulauskas et al., 2015). Phylogenetic analysis indicates different invasion corridors of the raccoon dog in Lithuania. Multiple introductions in different years and from different locations as well as the admixture and the subsequent intraspecific hybridization of invasive populations could explain the high genetic diversity in microsatellite loci of the Lithuanian raccoon dog population observed in the present study. In the present study, higher heterozygosity levels were reported in subpopulations I and II situated in the western part of country, than in subpopulation from the eastern part (III and IV)

(Table 10; Fig. 26). The observed heterozygosities (HO) were higher than the expected (HE) in three subpopulations (I, II, III) (Table 10). However, in subpopulation IV the observed heterozygosity (HO) was estimated to be lower than the expected heterozygosity (HE) (Table 10). The genetic differentiation among subpopulations based on Nei’s genetic distances and

FST analysis was very low. Significant FST values were observed between the western (sampling areas I and II) and eastern subpopulations (III) (Table 12). According to RST estimates (AMOVA) only 8% of the genetic variation was attributable to differences among the sampled locations. Although STRUCTURE and FCA analyses did not reveal a clear separation between

83 subpopulations, it indicated a difference in genotype and allele frequencies between the western and eastern subpopulations (Figure 20, 25). The IBD test confirmed this structure (Figure 21). The widespread distribution of raccoon dogs in Lithuania, high level of genetic variation within the raccoon dog subpopulations and low level of variation portioned among subpopulations suggest migration and gene flow among locations and may give the appearance of a lack of population structure. However, the pattern of isolation-by-distance indicated weak population structure and demonstrated west-east direction in the observed correlation between the genetic and geographical distances. As it was suggested by the previous population study on raccoon dog conducted using mtDNA markers (Pitra et al. 2010), the power of correlation between pairwise genetic divergence and pairwise geographic distance could depend on the length of time since a territory was colonized. So, the impact of distance on the genetic structure of Lithuanian raccoon dog population could become more pronounced in the future. The result of Mantel test obtained for combined subpopulations (I and II; and III and IV) supported the genetic differentiation between western (I, II) and eastern (III, IV) subpopulations. Anthropogenic pressure and behavior may play a more significant role in the formation of the raccoon dog population structure. The raccoon dog has a high dispersal capability that is a necessary precursor for the gene flow. Raccoon dogs have colonized a territory of 1.4 million km within 50 years (1935–1984) in Europe (Sutor, 2008). Generally, raccoon dogs disperse when they have reached sexual maturity at the age of 8–10 months, but according to some investigations, it seems that dispersal could take place at an earlier age (Sutor, 2008). There is also evidence that not only juveniles but even unmated adults disperse (Sutor, 2008). However, a species’ ability to disperse does not depend only on its ability and propensity to move from one site to another. Physical barriers may also hinder dispersal and prevent gene flow. The obtained moderate genetic differentiation among the raccoon dog populations in South Korea occurs due to such geographical barriers as high mountain ranges, which separated the populations, and geographical distances between the populations (Hong et al., 2013). In Lithuania, no such natural geographical barriers exist and other barriers, created due to anthropogenic activity, such as main roads with the high volume of traffic, could reduce gene flow and affect the formation of population structure of raccoon dogs. The effect of geographic distance on genetic differentiation and significant genetic differences observed between the eastern and western subpopulations could occur due to the habitat fragmentation by the “Via Baltica” highway which stretches from the south to the north of Lithuania (Fig. 26) with a traffic volume of 4.000-8.000 vehicles and more than 2.500 heavy vehicles’per day, and by the fenced Vilnius-Kaunas highway.

84 The high level of genetic diversity of the raccoon dog populations in Lithuania could be one of the factors that led to the high population viability, which can be realized through resistance to diseases, physical condition of an individual, low embryonic mortality rate, and many other features. The results of the present study provide a foundation for subsequent studies on the partitioning of genetic variation across Lithuanian populations.

Assessment of bioinvasion impact on racoon dogs. In this study we examined the distribution and bioinvasion situation in Lithuania of the invasive species N.procyonoides. At the local scale raccoon dogs were usually found in moderate amounts and assigned to class D according to the abundance and distribution. The biopollution level ranged from moderate impact to strong impact. The raccoon dog impact on native species and communities (C2-C3) were negative for amphibians, mollusks, rodents, birds, insects, reptiles’ populations and transmit patogenes. Poultry and rabbits may become easy prey to raccoon dogs. They collect everything from the ground –frogs, newts, snakes, all edible invertebrates, bird's eggs, juveniles of animals and birds. If the food is in the shallows and islands, raccoon dogs swim and destroy juveniles and eggs of bitterns, marsh harriers and all other birds. Raccoon dogs have been reported to cause severe damage to waterfowl colonies in Estonia (Kauhala, 1996c; Kull et al., 2001). It may also be a serious predator of tetraonid birds (V. Sidorovich, pers. comm.). N. procyonoides may become a threat to bird and frog populations, particularly on islands (Kauhala, 1996a). Adult frogs and tadpoles are easy prey for raccoon dogs and this may cause a decline in frog populations, especially on islands and in other fragmented or isolated areas (Kauhala and Auniola, 2001; Sutor et al., 2010). The raccoon dog impact on habitats were weak. Raccoon dogs prefer moist deciduous and mixed forests with abundant understore, river valleys, lakeshores, marshes, and moist heath (Kauhala 1996; Jedrzejewska and Jedrzejewski, 1998). They may occupy also a mosaic of woodland and agricultural area (Drygala et al., 2000). N. procyonoides often settle in badger setts in winter and during the reproduction season (Kowalczyk et al., 2000). The habit of using badger setts has probably facilitated the invasion of raccoon dogs in Europe (Kowalczyk et al., 2008), because deep and complex badger setts might offer refuge against the cold and predation (Kowalczyk and Zalewski, 2011). In Lithuania has been observed that very rarely dig their own burrows, usually occupy badger setts or abandoned beaver burrows (Uleviþius, 1997). In some biosphere reserves raccoon dogs have a strong impact on ecosystem. They are carriers of rabbies, hosts of important zoonotic helminths, eat breeding birds, but themselves become prey of wolves.The elimination of this species would pose threats to the integrity and

85 sustainability of ecosystems, because these animals are part of the biocenotic relationships (Bobrov et al., 2008). In some cases, N.procyonoides can play a positive role. These animals are useful in agriculture because of catching pests of trees and fields: mice, voles, gophers and insects pests (locusts, maybugs, weevils and wheat bugs). Raccoon dogs cannot be attributed to pests of fish farming. These predators eat mainly small fishes or fish in dried water body, as well as collect fishes from the shore near the fishing grounds (Bobrov et al., 2008).

Characterization of tick-borne pathogens in raccoon dogs. In this study the raccoon dogs were examined for presence of different pathogens: Babesia spp., Bartonella spp., Borrelia burgdorferi sensu lato, Rickettsia spp., Anaplasma phagocytophilyum and Francisella tularensis. Sequences analysis showed that one sequence was identical to Babesia microti in I. ricinus ticks from one raccoon dog. Babesiosis is a tick-borne disease caused by the genus Babesia (Camacho et al., 2010), is one of the most spread and ubiquitous infections of free- living animals worldwide (Zygner et al., 2007). Large forms of Babesia (3-5 ȝm) were designated B. canis, and all small Babesia were thought to be B. gibsoni (0.5-2.5 ȝm). Several species of wildlife, such as raccoons, red foxes, skunks, and white-tailed deer are important reservoirs of zoonotic Babesia species (Piesma et al., 1979; Kawabuchi et al., 2005; Hodžiü et al., 2015). Up to date the first detection of B.microti in raccoon dogs have been described in South Korea (Han et al., 2010). Our study is the first study of a molecular detection and characterization of B.microti infection in raccoon dogs in Europe. It shows that B. microti-like parasite infection is present throught the wild raccoon dog population in Lithuania, and the raccoon dog may act as a reservoir of B. microti-like parasite-infected ticks in this area. The prevalence of B. microti in wild raccoon dogs should be investigated. The molecular analyses of 44 ticks from 9 raccoon dogs revealed the presence of Rickettsia helvetica and Ricketsia monacensis. Ricketsiae are obligate intracellular, Gram- negative bacteria. A wide variety vertebrate (small mammals, rodents, and lagomorphs) are potential reservoirs for Rickettsiae, also they may be accidental hosts and acquire infection by a tick bite (Regnery et al., 1991). In Lithuania, the presence of two rickettsial species (R. raoultii, and R. helvetica) transmitted by ticks has been previously confirmed (Radzijevskaja et al., 2015). In Spain, the distribution of Rickettsia sp. in ticks infesting carnivores (Iberian lynx, common genet, Egiptian mongoose, Eurasian badger and red foxes) was investigated. The results of previous study indicated the detection of three Rickettsia species: R. monacensis, R. helvetica and R. massiliae (Ma´rquez and Milla´n, 2009). No ricketsial pathogens in red foxes

86 from Bosnia and Herzegovina have been detected (Hodžiü et al., 2015). The result of the present study show that further analysis are necessary to elucidate the potential role of raccoon dogs in their epidemiology. Three Borrelia species were identified: one raccoon dog harbored both, B. afzelii and B. myiamotoi infected I. ricinus, and one B. valaisiana infected I. ricinus ticks. Lyme borreliosis (LB) is a bacterial infection caused by the spirochete. B. burgdorferi s.l can be divided into 18 named species (Margos et al., 2009; Vollmer et al., 2011). A variety of mammalian are reservoirs hosts of B. burgdorgferi s.l. (mainly are rodents) (Gern and Humair, 2002). Gherman et al. 2012 have previously reported the identification of B. burgdorferi s.l. infection in the marbled polecat (Vormela peregusna) and two European minks (Mustela lutreola) from Romania. In a recent study, Dumitrache et al. 2015 found a prevalence of 1.42 % of the pathogen in red foxes in Romania and showed similarities B. burgdorferi sensu stricto (s.s.) and B. afzelii. In Europe the information about the prevalence of B. burgdorferi s.l. in raccoon dogs is scarce. To our knowledge, this is the first study investigating tick-borne pathogens in samples collected from raccoon dogs in Lithuania. Bartonella spp. was found in I. ricinus from one specimen of raccoon dog. The Bartonella zoonotic vector pathogen is an emerging zoonotic agent. Among them, the genus Bartonella includes more than 30 species or subspecies that can affect wild and domestic mammals (Breitschwerdt and Kordick, 2000). In Europe, there is little information regarding the prevalence of vector-borne diseases in carnivores. The genus Bartonella was detected in 5.7% (12/212) of wild carnivores from Northern Spain. Bartonella henselae was identified in a wildcat (Felis silvestris), Bartonella rochalimae in a red fox (Vulpes vulpes) and in a wolf (Canis lupus), and Bartonella sp. in badgers (Meles meles) (Gerrikagoitia et al., 2011). The prevalence of Bartonella species was investigated among wild carnivores, including Japanese badgers (Meles anakuma), Japanese martens (Martes melampus), Japanese weasels (Mustela itatsi), Siberian weasel (Mustela sibirica), raccoon dogs (Nyctereutes procyonoides), and raccoons (Procyon lotor) in Japan. Bartonella bacteria were identified in Japanese badger (6.7%) and Japanese marten (12.5%); however, no Bartonella species was found in other carnivores. In several (n = 3) ticks from raccoon dogs Anaplasma phagocytophilum infection was detected. A. phagocytophilum is an obligate intracellular bacterial parasite, which causes granulocytic anaplasmosis in animals and humans (Woldehiwet, 2010). Infection with A. phagocytophilum in domestic animals is documented, but there is sparse information on the infection of A.phagocytophilum in wild animals (Härtwig et al., 2014). A. phagocytophilum infection in red foxes and in I. ricinus ticks collected from red foxes has been previously

87 reported. The prevelance (2.7%) of infection of red foxes was obtained in Poland (Karbowiak et al., 2009). In a recent study, Dumitrache et al. 2015 recorded a prevalence of 4.4% of the pathogen in I.ricinus collected from red foxes in Romania. In a similar study conducted in Hungary, the prevalence was 1.3 % (Sréter et al., 2004). In Europe the information about the prevalence of A. phagocytophilum in raccoon dogs is scarce. In the recent study carried out in Germany, Härtwig et al. 2014 detected A. phagocytophilum in 3 out of 13 (23%) lungs of raccoon dogs.

Investigation of infectious and parasitic diseases of raccoon dogs. Our results indicate that in three different Lithuanian regions the invasive raccoon dog is the most important vector of mange among wild animals. The role of the raccoon dog as a vector of mange may further increase in Europe, because the raccoon dog population is still growing and spreading (Ansorge and Stiebling, 2001; Drygala et al., 2008b). Therefore S. scabiei is an important mortality factor of raccoon dogs both in native and introduced ranges. Raccoon dogs may also transmit the parasite to other animals including foxes and Eurasian badgers (Mörner et al., 2005). Moreover, the occurrence of infected raccoon dogs in the area may increase the risk of serious epizootics among foxes, because both species may use badger sets as den sites (Kauhala et al., 2006; Kowalczyk et al., 2008). Badgers may be infected on rare occasions (Collins et al., 2010). Study of raccoon dog diet in Estonia revealed that individuals infected sarcoptic mange consume more carrion comparing with uninfected animals. This indicates that sarcoptic mange can be one of the factors leading to foraging decisions or the ability to locate or catch live prey (Süld et al., 2014). The analysis of trichinellosis epidemiological situation in the central part of Lithuania in 1994–2001 showed that 2 raccoon dog and even 66 red fox cases were diagnosed. It demonstrated that foxes are the most common reservoirs of trichinellosis in Lithuania. The same results were confirmed in other studies (Pozio, 1998; Oivanen et al., 2002). Merely one Eurasian badger trichinellosis case was diagnosed in the western part of Lithuania. A field study in Finland concluded that raccoon dogs together with red foxes were the most important reservoir hosts for Trichinella spp. (Airas et al., 2010). A similar study of raccoon dogs and red foxes in Lithuania has revealed that Trichinella spp. (46.6%) was highly prevalent among foxes while raccoon dogs had lower prevalence (Bruzinskaité- Schmidhalter et al., 2012). This is reflected in this study when 3 raccoon dog and even 66 red fox cases were diagnosed in the central and western part of Lithuania. Recent experimental studies have shown that in Lithuania the diet of raccoon dogs mainly involves amphibians whilst red foxes prefer rodents (Baltrǌnaitơ, 2002). Therefore, it is not surprising that more red foxes than raccoon dogs were infected with trichinellosis. 88 CONCLUSIONS

1. After measuring and comparing the skulls of raccoon dogs, results of the study indicated that male raccoon dogs were slightly larger than females in five morphometric characteristics (CBL, ML, ZB, LT and IC) (p>0.05). In many cases, the measurements of Lithuanian raccoon dog skulls were larger than those of native range raccoon dogs.

2. The analysis of the mtDNA control region in raccoon dogs demonstrated the presence of two haplogroups. The patterns of molecular genetic variation in raccoon dogs from Lithuania obtained in the present study indicated a higher genetic diversity of these animals as compared with those from Northern-Western Europe, however a lower genetic polymorphism as compared with raccoon dogs introduced to the European part of Russia.

3. The microsatellite analysis of raccoon dogs indicated a high level of genetic variation observed within subpopulations, whereas a low level of variation portioned among subpopulations suggests migration and gene flow among locations. The significant correlation between genetic and geographic distances indicated isolation that reflected the distance between locations.The fencing of highways and very intensive traffic could be barriers to gene flow between the western and eastern sampling areas of raccoon dogs.

4. The assessment of bioinvasion impact based on the classification of abundance and distribution range in different regions of Lithuania revealed that the impact of raccoon dogs on community is moderately negative, weak on habitat and strong on ecosystems. The overall biopollution index for raccoon dogs was estimated at strong biopollution level.

5. The molecular detection of pathogens in ticks from raccoon dogs revealed the presence of Babesia microti, Rickettsia helvetica and Rickettsia monacensis, Bartonella spp. and Borrelia afzelii, B. myiamotoi and B. valaisiana and Anaplasma phagocytophilyum. Raccoon dogs may be involved in the epidemiology of these pathogens by maintaining the infection and posing an important risk to public health. Active migration and infestation of raccoon dogs with infected ticks may propagate the spreading of ticks, and their related pathogens, into new geographical regions.

89 LIST OF PUBLICATIONS

Regarding the topic of the dissertation, 4 publications were published: 1. Griciuvienơ L., Paulauskas A., Radzijevskaja J, Žukauskienơ J., Pǌraitơ I, 2016. Impact of anthropogenic pressure on the formation of population structure and genetic diversity of raccoon dog Nyctereutes procyonoides. Current Zoology. [IF: 1.814] 2. Paulauskas A., Griciuvienơ L., Radzijevskaja J., Gedminas V, 2015. Genetic characterization of the raccoon dog (Nyctereutes procyonoides), an alien species in the Baltic region. Tourkish Journal of Zoology 40 (3):1-11 (ISSN 1300-0179). [IF: 0.630] 3. Janulaitis Z., Juknelytơ S., Griciuvienơ L., Paulauskas A, 2014. Raccoon dog (Nyctereutes procyonoides) and native predators infection pathogens and parasites comparison. Biology 60 (1): 9-15 (ISSN 1392-0146). 4. Griciuvienơ L., Paulauskas A., Radzijevskaja J., Gedminas V, 2013. Variability of skull morphometric characters in Nycetereutes procyonoides. Biology 59 (2): 151-156 (ISSN 1392-0146).

The results of this research have been presented in 11 international conferences: 1. Griciuvienơ L., Paulauskas A., Sruoga A., Gedminas V (2011). Genetic diversity of raccoon dogs (Nyctereutes procyonoides) in Lithuania. 85th Annual Conference of the German Society of Mammalogy, Luxembourg: p. 10-10 (ISSN 1616-5047). 2. Pǌraitơ I., Griciuvienơ L., Paulauskas A., Sruoga A., Gedminas V., Butkauskas D (2011). Genetic variability of raccoon dogs and their impacts on the environment in Lithuania. 8th European Vertebrate Pest Management Conference, Berlyn, Germany: p. 51-52 (ISBN 9783930037636). 3. Gedminas V., Griciuvienơ L., Paulauskas A., Grigonis R (2011). Data on morphometry of raccoon dogs (Nyctereutes procyonoides) from Lithuania. 8th Baltic Theriological Conference, Palanga, Lithuania: p. 17-17 (ISBN 9789986443575). 4. Paulauskas A., Griciuvienơ L., Radzijevskaja J., Gedminas V (2012). Genetic variation of raccoon dogs (Nyctereutes procyonoides) in Lithuania. 7th European Conference on Invasive Alien Species, Pontevedra, Spain: p. 366-366. 5. Griciuvienơ L., Paulauskas A., Radzijevskaja J., Juknelytơ S., Gedminas V (2012). Investigation of genetic diversity and population structure of raccoon dogs in Lithuania by using microsatellite analysis. 5th Baltic Congress of Genetics, Kaunas, Lithuania. Biology 58 (3): 155-155 (ISSN 1392-0146).

90 6. Paulauskas A., Griciuvienơ L., Radzijevskaja J., Gedminas V (2012). Molecular phylogeography and genetic structure of alien species raccoon (Nyctereutes procyonoides) in Europe. International Biogeography Society, Miami, Florida, USA: p. 90-90. 7. Jonauskaitơ I., Juškaitơ E., Griciuvienơ L., Radzijevskaja J., Paulauskas A (2013). Raccoon dog ectoparasites and their transmitted pathogens. The vital nature sign: 7th international scientific conference, Kaunas, Lithuania: p. 29-29 (ISSN 2335-8653). 8. Griciuvienơ L., Paulauskas A., Radzijevskaja J., Gedminas V (2013). Mitochondrial DNA haplotype diversity in raccoon dogs (Nyctereutes procyonoides). Research and conservation of biological diversity in Baltic region: 7th international conference, Daugavpils, Latvia: p. 50-50 (ISBN 9789984146164). 9. Paulauskas A., Griciuvienơ L., Juknelytơ S., Radzijevskaja J., Gedminas V (2014). Genetic diversity and population structure of raccoon dog (Nyctereutes procyonoides) in invaded areas. NEOBIOTA 2014: 8th international conference on biological invasions: from understanding to action, Antalya, Turkey: p. 78-78 (ISBN 9786054672806). 10. Juknelytơ S., Griciuvienơ L., Paulauskas A., Radzijevskaja J., Gedminas V (2014). Genetic diversity and population structure of raccoon dog (Nyctereutes procyonoides) analysis in Lithuania. The vital nature sign: 8th international scientific conference, Kaunas, Lithuania: p. 95-95 (ISSN 2335-8653). 11. Griciuvienơ L., Paulauskas A., Radzijevskaja J., Gedminas V (2014). Genetic characterization of alien species raccoon dog (Nyctereutes procyonoides) in Baltic region. Research and conservation of biological diversity in Baltic region: 8th international conference, Daugavpils, Latvia: p. 11-11 (ISBN 9789984146874).

91 ACKNOWLEDGEMENTS

I sincerely appreciate my scientific supervisor prof. dr. Jana Radzijevskaja for the valuable theoretical and practical advices, the perfect conditions, profound advices, encouragements and sincere care. I am grateful to prof. dr. Algimantas Paulauskas for valuable consultations, advices and for helping in collection of study materials. I am also thankful to Vaclovas Gedminas (Kaunas Tadas Ivanauskas Zoological Museum) for the study material, to dr. Judita Žukauskinơ (Vytautas Magnus University) for the work in laboratory, and for students Simona Juknelytơ, Indrơ Jonauskaitơ and Akvilơ Veliþkaitơ (Vytautas Magnus University). I thank for all collective of Biology Department (Vytautas Magnus University, Faculty of Natural Sciences) that more or less contributed to this dissertation. I thank to Research Council of Lithuania and Vytautas Magnus University for financial supports. The most sincere thanks go to my family: husband Domas and parents, for the care and support. Thanks to all friends who more or less contributed to the preparation of the dissertation.

92 REFERENCES

1. Hodžiü A., Aliü A., Fuehrer H. P., Harl J., Piazzai W. W., Duscher G., 2015. A molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasites & Vectors 8: 88. 2. Airas N., Saari S., Mikkonen T., Virtala A. M., Pellikka J., Oksanen A., Isomursu M., Kilpelä S. S., Lim C. W, Sukura A., 2010. Sylvatic Trichinella spp. infection in Finland. Journal of Parasitology 96 (1): 67–76. 3. Ansorge H., Ranyuk M., Kauhala K., Kowalczyk R., Stier N., 2009. Raccoon dog Nyctereutes procyonoides populations in the area of origin and in colonised regions – the epigenetic variability of an immigrant. Annales Zoologici Fennici 46: 51–62. 4. Ansorge H., Stiebling U., 2001. Population biology of the raccoon dog Nyctereutes procyonoides in eastern Germany immigration strategy of an alien species? Beiträge zur Jagdund Wildforschung 26: 247–254 (in German). 5. Asikainen J., Mustonen A. M., Hyvärinrn H., Nieminen P., 2004. Seasonal physiology of the wild raccoon dog (Nyctereutes procyonoides). Zoological Science 21 (4):385–391. 6. Asikainen J., Mustonen A.M., Nieminen P., Pasanen S., Araja-Matilainen H., Hyvarinen H., 2002. Reproduction of the raccoon dog (Nyctereutes procyonoides) after feeding or food deprivation in winter. Journal of Animal Physiology and Animal Nutrition 86 (11/12): 367–375. 7. Avise J. C., 2000. Phylogeography: The History and Formation of Species. 1st ed. Cambridge, Massachusetts, USA: Harvard University Press, 303 pp. 8. Baagøe H. J., Jensen T. S., 2007. Atlas of Danish Mammals. Copenhagen: Gyldendal, 392 pp (in Danish). 9. Balþiauskas L., 1996. Lithuanian mammal fauna review. Hystrix 8:9–15. 10. Balþiauskas L., Balþiauskienơ L., 2014. Raccoon dog: relationships between roadkill numbers, traffic intensity, the hunting bag and climate change. In: Seiler A ed. IENE 2014 International Conference on Ecology and Transportation, Programme and Abstracts. Malmö, Sweden: IENE. 11. Ballard J. W., Whitlock M. C., 2004. The incomplete history of mitochondria. Molecular Ecology 13: 729–744. 12. Baltrǌnaitơ L., 2002. Diet composition of the red fox (Vulpes vulpes) pine marten (Martes martes) and raccoon dog (Nyctereutes procyonoides Gray) in clay plain landscape, Lithuania. Acta Zoologica Lituanica 12(4): 1392–1657.

93 13. Baltrǌnaitơ L., 2006. Diet and winter habitat use of red fox, pine marten and raccoon dog in Dzǌkija national Park, Lithuania. Acta Zoologica Lituanica 16 (1): 46–53. 14. Baltrǌnaitơ L., 2010. Winter habitat use, niche breadth and overlap between the red fox, pine marten and raccoon dog in different landscapes of Lithuania. Folia Zoologica 59 (4): 278-284. 15. Bandelt H. J., Forster P., Rohl A., 1999. Median joining networks for inferring intra specific phylogenies. Molecular Biology and Evolution 16 (1): 37–48. 16. Barbu P., 1972. Contributions to the study of the raccoon dog, Nyctereutes procyonoides ussuriensis Matschie, 1907, from the Danube delta. Saugetierkundliche Mitteilungen, 20 (4):375-405 (in German). 17. Bardakci F., 2001. Random Amplified Polymorphic DNA (RAPD) Markers. Turkish Journal of Biology 25: 185-196. 18. Belkhir K., Borsa P., Chikhi L., Raufaste N., Catch F., 2004. GENETIX software under Windows TM for the genetics of the populations. Montpellier, France: Laboratory genome, populations, interactions, CNRS UMR 5000, University of Montpellier II. 19. Bobrov V. V., Varshavskii A. A., Khlyap L. A., 2008. Raccoon dog Nyctereutes procyonoides (Gray, 1834). In: Drebuadze J. J., Neronov V. M., editors. Alien Mammals in the Ecosystems of Russia. 1st ed. Moscow, Russia: KMK Scientific Press Ltd, pp. 111–117 (in Russian). 20. Bown K. J., Lambin X., Ogden N. H., Petrovec M., Shaw S. E., Woldehiwet Z., Birtles R. J., 2007. High-resolution genetic fingerprinting of European strains of Anaplasma phagocytophilum by use of multilocus variable-number tandem- repeat analysis. Journal of Clinical Microbiology 45 (6): 1771-17776. 21. Bozarth C. A., Hailer F., Rockwood L. L., Edwards C. W., Maldonaldo J. E., 2011. Coyote colonization of northern Virginia and admixture with Great Lakes wolves. Journal of Mammalogy 92: 1070–1080. 22. Breitschwerdt E. B., Kordick D. L., 2000. Bartonella infection in animals: carriership, reservoir potential, pathogenicity, and zoonotic potential for human infection. Clinical Microbiology Reviews 13 (3): 428-438. 23. Bružinskaitơ-Schmidhalter R., Šarkǌnas M., Malakauskas A., Mathis A., Torgerson P., Deplazes P., 2012. Helminths of red foxes (Vulpes vulpes) and raccoon dogs (Nyctereutes procyonoides) in Lithuania. Parasitology: 139 (1): 120–127. 24. Buddhachat K., Meesong O., Nganvongpanit K., Osathanunkul M., Chomdej S., 2012. Molecular Characterization and Detection of Babesia canis vogeli in Asymptomatic

94 Roaming Dogs in Chiang Mai, Thailand. Thai Journal of Veterinary Medicine 42 (2): 173-178. 25. Bunevich A. N., Dackevich V. A., 1985. Spatial distribution and food of the raccoon dog in BiaáowieĪa Forest. Zapovedniki Belorussii 9:114–120 [in Russian]. 26. Camacho A. T., Pallas E., Gestal J. J., Guitia´n F. J., Olmeda A. S., 2002. Natural infection by a Babesia microti–like piroplasm in a splenectomised dog. Veterinary Record 150 (12): 381–382. 27. Casati S., Sager H., Gern L., Piffaretti J. C., 2006. Presence of potentially pathogenic Babesia sp. for human in Ixodes ricinus in Switzerland. Annals of Agricultural Environmental Medicine 13 (1): 65–70. 28. ûiroviü D., Milenkoviü M., 1999. Previous findings of the raccoon dog (Nyctereutes procyonoides ussuriensis Matschie, 1907) in Yugoslavia and analysis of probable paths of its immigration. Contributions to the Zoogeography and Ecology of Eastern Mediterranean Region 1: 75–82. 29. Clutton-Brock T. H., Harvey P. H., 1978. Mammals, resources and reproductive strategies. Nature 273: 191-195. 30. Collins R., Wessels M. E., Wood R., Couper D., Swift A., 2010. Sarcoptic mange in badgers in the UK. Veterinary Record 167 (17): 668. 31. Crawley M. J., Kornberg H., Lawton J. H., Usher M. B., Southwood R., O'Connor R. J., Gibbs A., 1986. The population biology of invaders. Philosophical Transactions of the Royal Society of London 314:711–729. 32. Danilov P. I., 2005. Game Animals of Karelia: Ecology, Resources, Management, Protection. Nauka, Moscow 338 pp (in Russian). 33. Darriba D., Taboada G. L., Doallo R., Posada D., 2012. jModelTest 2: more models, new heuristics and parallel computing. Nature Methods 9 (8): 772-772. 34. Dehnel A., 1956. New species of mammal in Polish fauna Nyctereutes procynoides (Gray). ChroĔmy PrzyrodĊ Ojczystą 12 (6):17–21 (in Polish). 35. Demaerschalck I., Messaoud A. B., De Kesel M., Hoyois B., Lobet Y., Hoet P., Bigaignon G., Bollen A., Godfroid E, 1995. Simultaneous presence of different Borrelia burgdorferi genospecies in biological fluids of Lyme disease patients. Journal of Clinical Microbiology 33 (3): 602. 36. Deplazes P., Hegglin D., Gloor S., Romig T., 2004. Wilderness in the city: the urbanization of Echinococcus multilocularis. Trends in Parasitology 20 (2): 77–84.

95 37. Dermitzakis M. D., Van Der Geer A. A. E., Lyras G. A., 2004. The phylogenetic position of raccoon dogs: implications of their neuroanatomy. 5th International Symposium on Eastern Mediterranean Geology Thessaloniki, Greece, 14–20 April. 38. Dolf G., Schlapfer J., Switonski M., Stranzinger G., Gaillard C., Schelling C., 1998. The highly polymorphic canine microsatellite ZuBeCa4 is localized on canine chromosome 3q15-q18. Animals Genetics 29: 403–404. 39. Drake J. A., 2009. Handbook of Alien Species in Europe. Invading Nature Springer Seris in Invasion Ecology; Vol.3.Springer, Dordrecht pp 399. 40. Drygala F., Stier N., Zoller H., Boegelsack K., Mix H. M., Roth M., 2008a. Habitat use of the raccoon dog (Nyctereutes procyonoides) in north-eastern Germany. Mammalian Biology 73: 371-378. 41. Drygala F., Stier N., Zoller H., Mix H. M., Bögelsack K., Roth M., 2008b. Spatial organisation and intraspecific relationship of the raccoon dog Nyctereutes procyonoides in Central Europe. Wildlife Biology 14(4):457-466. 42. Drygala F., 2009. Space use pattern, dispersal and social organisation of the raccoon dog (Nyctereutes procyonoides GRAY, 1834), an invasive, alien canid in Central Europe. PhD thesis. Technische Universität Dresden, Dresden, Germany. 43. Drygala F., Zoller H., Stier N., Roth M., 2010. Dispersal of raccoon dog Nyctereutes procyonoides into a newly invaded area in Central Europe. Wildlife biology 16:150–161. 44. Drygala F., Werner U., Zoller H., 2013. Diet composition of the invasive raccoon dog (Nyctereutes procyonoides) and the native red fox (Vulpes vulpes) in north-east Germany. Italian Journal of Mammalogy 24 (2): 190-194. 45. Dumitrache M. O., Matei I. A., Ionică A. M., Kalmár Z., D’Amico G., Barabási S. S et al., 2015. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato genospecies in red foxes (Vulpes vulpes) from Romania. Parasit Vectors 8: 514. 46. Eckert J., Conraths F. J., Tackmann K., 2000. Echinococcosis: An emerging or re-emerging zoonosis? International Journal of Parasitology 30: 1283–1294. 47. Edwards C. J., Soulsbury C. D., Statham M. J., Ho S. Y. W., Wall D., Dolf G., Iossa G., Baker P. J., Harris S., Sacks B. N et al. 2012. Temporal genetic variation of the red fox, Vulpes vulpes, across Western Europe and the British Isles. Quaternary science reviews 57 (100): 95–104. 48. EFSA AHAW Panel, 2015. Update on oral vaccination of foxes and raccoon dogs against rabies. Scientific Panel on Animal Health and Welfare (AHAW). EFSA Journal 13 (7): 70 pp.

96 49. Epperson B.K., 2004. Multilocus estimation of genetic structure within populations. Theoretical Population Biology 65: 227–237. 50. Evanno G., Regnaut S., Goudet J., 2005. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14: 2611– 2620. 51. Excoffier L., Laval G., Schneider S., 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47- 50. 52. Felsenstein J., 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution 17: 368–376. 53. Felsenstein J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39 (4): 783–791. 54. Fòldvari G., Hell E., Farkas R., 2005. Babesia canis canis in dogs from Hungary: detection by PCR and sequencing. Veterinary Parasitology 127 (3): 221–226. 55. Francisco L. V., Langston A. A., Mellersh C. S., Neal C. L., Ostrander E. A., 1996. A class of highly polymorphic tetranucleotide repeats for canine genetic mapping. Mammalian Genome 7: 359–362. 56. Fu Y. X., 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147 (2): 915–925. 57. Fu Y. X., Li W. H., 1993. Statistical tests of neutrality of mutations. Genetics 133:693–709. 58. Fuente J., Massung R. F., Wong S. J., Chu F. K., Lutz H., Meli M., von Loewenich F. D et al., 200. Sequence Analysis of the msp4 Gene of Anaplasma phagocytophilum Strains. Journal of Clinical Microbiology 43(3): 1309–1317. 59. Genovesi P., Bacher S., Kobelt M., Pascal M., Scalera R., 2009. Alien mammals of Europe. In: Drake JA ed. Handbook of Alien Species in Europe. Invading Nature: Springer Series in Invasion Ecology. Dordrecht, the Netherlands: Springer 3:119–128. 60. Gern L., Humair P., 2002. Ecology of Borrelia burgdorferi sensu lato in Europe. Lyme Borreliosis: Biology, Epidemiology and Control. Edited by: Gray J., Kahl O., Lane R. S., Stanek G. New York: CABI Publishing: 149–174. 61. Gerrikagoitia X., Gil H., GarcƷa-Esteban C., Anda P., Juste R. A., Barral M., 2011. Presence of Bartonella Species in Wild Carnivores of Northern Spain. Applied and Environmental Microbiology 78 (3): 885–888. 62. Gherman C. M., Sándor A. D., Kalmár Z., Marinov M., Mihalca A. D., 2012. First report of Borrelia burgdorferi sensu lato in two threatened carnivores: the marbled polecat,

97 Vormela peregusna and the European mink, Mustela lutreola (Mammalia: Mustelidae). BMC Veterinary Research 8:137. 63. Gomerþiü T., Sindiþiü M., Galov A., Arbanasiü H., Kusak J., Kocijan I., Gomerþiü M. D., Huber Ĉ., 2010. High genetic variability of Croatian grey wolf (Canis lupus L.) population as revealed by mitochondrial DNA control region sequences. Zoological Studies 49 (6): 816-823. 64. Goszczynski J., 1999. Fox, raccoon dog and badger densities in North Eastern Poland. Acta Teriologica 44 (4): 413-420. 65. Gottstein B., Pozio E., Connolly B., Gamble H. R., Eckert J., Jakob H. P., 1997. Epidemiological investigation of trichinellosis in Switzerland. Veterinary Parasitology 72 (2): 201–207. 66. Goudet J., 2001. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3). Updated from Goudet (1995). Journal of Heredity 86: 485–486. 67. Guindon S., Gascuel O., 2003. A simple, fast and accurate method to estimate large phylogenies by maximum-likelihood. Systematic Biology 52 (5): 696–704. 68. Han J. I., Sook J. L., Hye J. J., Ki J. N., 2010. Asymptomatic Babesia microti–like parasite infection in wild raccoon dogs (Nyctereutes procyonoides) in South Korea. Journal of Wildlife Diseases 46 (2): 632-635. 69. Harpending H. C., 1994. Signature of ancient population growth in a low-resolution mitochondrial DNA mismatch distribution. Human Biology 66 (4): 591–601. 70. Härtwig V., von Loewenich F. D., Schulze C., Straubinger R. K., Daugschies A., Dyachenko V., 2014. Detection of Anaplasma phagocytophilum in red foxes (Vulpes vulpes) and racoon dogs (Nyctereutes procyonoides) from Brandenburg, Germany. Ticks Tick - Borne Disease 5 (3): 277-280. 71. Hasegawa M., Kishino H., Yano T., 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160–174. 72. Hayashizono N., Ago K., Hayashi T., Ago M., Ogata M., 2009. Amplification of Microsatellites of Japanese Raccoon Dogs (Nyctereutes procyonoides viverrinus) with Primers for the Dog ZUBECA4 Locus. Medical Journal of Kagoshima University 61 (3): 41–46. 73. Helle E., Kauhala K., 1991. Distribution history and present status of the raccoon dog in Finland. Holarctic Ecology 14: 278–286. 74. Helle E., Kauhala K., 1993. Age structure, mortality and sex ratio of the raccoon dog in Finland. Journal of Mammalogy 74 (4): 936-942.

98 75. Helle E., Kauhala K., 1995. Reproduction in the raccoon dog in Finland. Journal of Mammalogy 76:1036-1046. 76. Herfindal I., Melis C., Dahl F., Åhlén P. A., 2012. Spatial ecology and habitat use by an invasive alien species – the raccoon dog in Scandinavia. Report, Norwegian University of Science and Technology. 77. Hidaka S., Matsumoto M., Hiji H., Ohsako S., Nishinakagawa H., 1998. Morphology and Morphometry of Skulls of Raccoon Dogs, Nyctereutes procyonoides and Badgers, Meles meles. Journal of Veterinary and Medical Science 60 (2): 161-167. 78. Holmala K., Kauhala K., 2006. Ecology of wildlife rabies in Europe. Mammal Review 36: 17–36. 79. Holmala K., 2009. The community of medium-sized carnivores: the interactions between species, habitats and rabies. PhD thesis. University of Helsinki, Department of Biological and Environmental Sciences. 80. Hong Y. J., Kim K. S., Lee H., Min M. S., 2013. Population genetic study of the raccoon dog (Nyctereutes procyonoides) in South Korea using newly developed 12 microsatellite markers. Genes Genetic Systems 88: 69–76. 81. Huelsenbeck J. P., Ronquist F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. 82. Ikeda H., 1983. Development of young and parental care of the raccoon dog Nyctereutes procyonoides viverrinus Temmick, in captivity. Journal of the Mammalogical Society of Japan 9: 229–236. 83. Jedrzejewski W., Jedrzejewska B., Szymura A., 1989. Food Niche Overlap in a Winter Community of Predators in the Bialowieza Primeval Forest, Poland. Acta Theriologica 34: 487–496. 84. JĊdrzejewska B., JĊdrzejewski W., 1998. Predation in Vertebrate Communities: The BiaáowieĪa Primeval Forest as a Case Study (Ecological Studies). Berlin-Heidelberg- New York- Tokyo: Springer Verlag 135: 215–219. 85. Judin V.G., 1977. Enotowidnaja sobaka Primorja i Priamurja - Nauka, Moskva. 86. Jurgelơnas E., Daugnora L., 2005. Osteometric study of red fox and raccoon dog skulls. Veterinary and zootechnics 32 (54): 11-15. 87. Jurgelơnas E., Daugnora L., Monastyreckienơ E., Balþiauskas L., 2007. On the skull morphology of raccoon dog (Nyctereutes procyonoides) and red fox (Vulpes vulpes). Acta Zoologica Lituanica 17 (1): 41–46.

99 88. Jurgelơnas E., Daugnora L., Lasys V., Venskutonis D., 2011. Skull shape variation of raccoon dogs and red foxes in Lithuania. Veterinary Medicine and Zootechnics 55 (77): 8-13. 89. Kalinowski S. T., 2005. HP-RARE: a computer program for performing rarefaction on measures of allelic diversity. Molecular Ecology Notes 5 (1): 187–189. 90. Karbowiak G., Vichova B., Majlathova V., Hapunik J., Petko B., 2009. Anaplasma phagocytophilum infection of red foxes (Vulpes vulpes). Annals of Agricultural and Environmental Medicine 16 (2): 299–300. 91. Kasperek K., Horecka B., Jakubczak A., ĝlaska B., GryziĔska M., Bugno-Poniewierska M., Piórkowska M., JeĪewska-Witkowska G., 2015. Analysis of Genetic Variability in Farmed and Wild Populations of Raccoon Dog (Nyctereutes Procyonoides) Using Microsatellite Sequences. Annals of Animal Science 15 (4): 889–901. 92. Kauhala K., 1993. Growth, size, and fat reserves of the raccoon dog in Finland. Acta Theriologica 38 (2): 139-150. 93. Kauhala K., Kaunisto M., Helle E., 1993a. Diet of the raccoon dog Nyctereutes procyonoides in Finland. Zeitschrift für Säugetierkunde 58:129–136. 94. Kauhala K., Helle E., Taskinen K., 1993b. Home-range of the Raccoon Dog (Nyctereutes procyonoides) In Southern Finland. Journal of Zoology 231:95-106. 95. Kauhala K., Helle E., 1994. Home ranges and monogamy of the raccoon dog in southern Finland. Suomen Riista 40: 32-41 (in Finnish). 96. Kauhala K., 1996a. Habitat use of raccoon dogs, Nyctereutes procyonoides, in southern Finland. Zeitschrift für Säugetierkunde 61: 269–275. 97. Kauhala K., 1996b. Reproductive strategies of the raccoon dog and the red fox in Finland. Acta Teriologica 41 (1): 51-58. 98. Kauhala K., 1996c. Introduced carnivores in Europe with special reference to central and northern Europe. Wildlife Biology 2 (3): 197-204. 99. Kauhala K., Laukkanen P., von Rége I., 1998. Summer food composition and food niche overlap of the raccoon dog, red fox and badger in Finland. Ecography 21: 457-463. 100. Kauhala K., Viranta S., Kishimoto M., Helle E., Obara I., 1998b. Skull and tooth morphology of Finnish and Japanese raccoon dogs. Annales Zoologici Fennici 35: 1–16. 101. Kauhala K. and Auniola M. 2001. Diet of raccoon dogs in summer in the Finnish archipelago. Ecography 24:151–156. 102. Kauhala K., 2004. Removal of medium-sized predators and the breeding success of ducks in Finland. Folia Zoologica 53 (4): 367–378.

100 103. Kauhala K., Saeki M., 2004. Raccoon dog Nyctereutes procyonoides. In: Sillero-Zubiri C., Hoffmann M., Macdonald D. W ed. Canids: Foxes, Wolves, Jackals and Dogs: Status Survey and Conservation Action Plan. Cambridge: IUCN Publication Services: 136–142. 104. Kauhala K., Holmala K., 2006. Contact rate and risk of rabies spread between medium- sized carnivores in southeast Finland. Annales Zoologici. Fennici 43: 384–357. 105. Kauhala K., Holmala K., Lammers W., Schregel J., 2006. Home ranges and densities of medium-sized carnivores in south-east Finland, with special reference to rabies spread. Acta Theriologica 51: 1–13. 106. Kauhala K., 2007. The numbers of medium-sized carnivores in Finland. Riista- ja kalatalous -Selvityksiä 1: 1–18 (in Finnish). 107. Kauhala K., Holmala K., Schregel J., 2007. Seasonal activity patterns and movements of the raccoon dog, a vector of diseases and parasites, in southern Finland. Mammalian Biology 72: 342–353. 108. Kauhala K., Auttila M., 2010. Habitat preferences of the native badger and the invasive raccoon dog in southern Finland. Acta Theriologica 55: 231–240. 109. Kauhala K., Schregel J., Auttila M., 2010. Habitat impact on raccoon dog Nyctereutes procyonoides home range size in southern Finland. Acta Theriologica 55(4):371–380. 110. Kauhala K., Kowalczyk R., 2011. Invasion of the raccoon dog Nyctereutes procyonoides in Europe: History of colonization, features behind its success, and threats to native fauna. Current Zoology 57:584-598. 111. Kauhala K., Kowalczyk R., 2012. The raccoon dog (Nyctereutes procyonoides) in the community of medium-sized carnivores in Europe: its adaptations, impact on native fauna and management of the population. Carnivores. Species, Conservation and Management. Nova Science Publishers, New York: 49-77. 112. Kawabuchi T., Tsuji M., Sado A., Matoba Y., Asakawa M., Ishihara C., 2005. Babesia microti like parasites detected in feral raccoons (Procyon lotor) captured in Hokkaido, Japan. Journal of Veterinary Medical Science 67 (8): 825–827. 113. Keller R. P., Geist J., Jeschke J. M., Kühn I., 2011. Invasive species in Europe: ecology, status, and Policy. Environmental Sciences Europe 23 (23): 1-17. 114. Kern P., Bardonnet K., Renner E., Auer H., Pawlowski Z. et al., 2003. European echinococcosis registry: Human alveolar echinococcosis, Europe, 1982–2000. Emerging Infectiuos Diseases 9: 343–349. 115. Kettunen M., Genovesi P., Gollasch S., Pagad S., Starfinger U., Brink P., Shine C., 2009. Technical support to EU strategy on invasive alien species (IAS) Assessment of the

101 impacts of IAS in Europe and the EU. Brussels: Institute for European Environmental Policy 25:185-196. 116. Kidawa D., Kowalczyk R., 2011. The effects of sex, age, season and habitat on diet of the red fox Vulpes vulpes in northeastern Poland. Acta Theriologica 56(3): 209–218. 117. Kimura M., 1981. Estimation of evolutionary distances between homologous nucleotide sequences. Proceedings of the National Academy of Sciences 78: 454– 458. 118. Kolar C., Lodge D. M., 2001. Progress in invasion biology: predicting invaders. Trends in Ecology and Evolution 16 (4): 199–204. 119. Korablev N. P., Korablev M P., Rozhnov V. V., Korablev P. N., 2011. Polymorphism of the mitochondrial DNA control region in the population of raccoon dog (Nyctereutes procyonoides Gray, 1834) introduced into the Upper Volga basin. Russian Journal of Genetics 47 (10): 1227–1233. 120. Korablev N. P., Szuma E., 2013. Variability of native and invasive raccoon dogs’ Nyctereutes procyonoides populations: looking at translocation from a morphological point of view. Acta Theriologica 59 (1): 61-79. 121. Kowalczyk R., Jedrzejewska B., Zalewski A., Jedrzejewski W., 2008. Facilitative interactions between the Eurasian badger (Meles meles), the red fox (Vulpes vulpes), and the invasive raccoon dog (Nyctereutes procyonoides) in Biaáowieza Primeval Forest, Poland. Canadian Journal of Zoology 86 (12):1389–1396. 122. Kowalczyk, R., Zalewski A., JĊdrzejewska B., Ansorge H., Bunevich A. N., 2009. Reproduction and mortality of invasive raccoon dogs (Nyctereutes procyonoides) in the BiaáowieĪa Primeval Forest (eastern Poland). Annales Zoologici Fennici 46: 291-301. 123. Kowalczyk R., Zalewski A., 2011. Adaptation to cold and predation — shelter use by invasive raccoon dogs Nyctereutes procyonoides in BiaáowieĪa Primeval Forest (Poland). European Journal of Wildlife Research 57: 133–142. 124. Kukekova A. V., Trut L. N., Oskina I. N., Kharlamova A.V., Shikhevich S. G., Kirkness E. F., Aguirre G. D., Acland G. M., 2004. A marker set for construction of a genetic map of the silver fox (Vulpes vulpes). Journal of Heredity 95: 185–194. 125. Kull T., Kukk T., Lilleleht V., Ojaveer H., 2001. Võõrliigid Eestis: kes on tulnuktaimed- ja loomad ning mida nendega peale hakata. Keskkonnaministeerium, Tallinn. 23 pp. (in Estonian). 126. Laurimaaa L., Sülda K., Moksa E., Valdmanna H., Umhangb G., Knappc J., Saarma U., 2015. First report of the zoonotic tapeworm Echinococcus multilocularis in raccoon dogs in Estonia, and comparisons with other countries in Europe. Veterinary Parasitology 212 (3-4): 200-205.

102 127. Lavergne S., Molofsky J., 2007. Increased genetic variation and evolutionary potential drive the success of an invasive grass. Proceedings of the National Academy of Sciences 104 (10): 3883-3888. 128. Lavrov N. P., 1971. Results of raccoon dog introductions in different parts of the Soviet Union. Trudy Kafedry Biologii MGZPI 29: 101–160 (in Russian). 129. Léger F., Ruette S., 2005. Raccoon dog in France. Faune Savage 269: 4–13 (in French). 130. Lever C., 1985. Naturalized Mammals of the World. London: Longman. 131. Li Y.C., Korol A.B., Fahima T., Beiles A., Nevo E., 2002. Microsatellites: genomic distribution, putative functions, and mutational mechanisms: a review. Molecular Ecology 11 (12): 2453–2465. 132. Lodge D. M., 1993a. Biological invasions: lessons for ecology. Trends in Ecology and Evolution 8:133-137. 133. Lodge D. M., 1993b. Species invasions and deletions: community effects and responses to climate and habitat change. In Biotic Interactions and Global Change, ed. Karieva P. M., Kingsolver J. G., Huey R. B. Sunderland, MA: Sinauer: 559 pp. 134. Long J., 2003. Introduced Mammals of the World: Their History, Distribution and Influence. 1st ed. Melbourne, Australia: CSIRO Publishing: 612 pp. 135. Machnicka-RowiĔska B., Rocki B., Dziemian E., Kolodziej-Sobocinska M., 2002. Raccoon dog (Nyctereutes procyonoides) - the new host of Echinococcus multilocularis in Poland. Wiadomosci parazytologiczne 48 (1): 65-68 (in Polish). 136. Maþiulskis P., Lukauskas K., Sedereviþius A., Kiudulas V., Pockeviþius A., 2006. Epidemiology of enzootic rabies in Lithuania. Medycyna Weterynaryjna 62 (7): 769–772 (in Lithuanian). 137. Malakauskas A., Paulauskas V., Jarvis T., Keidans P., Eddi C., Kapel C.M., 2007. Molecular epidemiology of Trichinella spp. in three Baltic countries: Lithuania, Latvia, and Estonia. Parasitology Research 100 (4): 687–693. 138. Mantel N., 1967. The detection of disease clustering and a generalized regression approach. Cancer Research 27 (2): 209–220. 139. Margos G., Vollmer S.A., Cornet M., Garnier M., Fingerle V., Wilske B., Bormane A., Vitorino L., Pereira M.C., Drancourt M., Kurtenbach K., 2009. A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Applied Environmental Microbiology 75 (16): 5410–5416. 140. Márquez F. J., Millán J., 2009. Rickettsiae in ticks from wild and domestic carnivores of Doñana National Park (Spain) and surrounding area. Clinical Microbiology and Infection 15: 224–226.

103 141. Massung R. F., Slater K., Owens J. H., Nicholson W. L., Mather T. N., Solber V. B., Olson J. G., 1998. Nested PCR assay for detection of granulocytic ehrlichiae. Journal of Clinical Microbiology 36: 1090–1095. 142. Melis C., Herfindal I., Dahl F., Åhlén P., 2015. Individual and temporal variation in habitat association of an alien carnivore at its invasion front. PLOS ONE 10 (3): e0122492. 143. Mellersh C. S., Langston A. A., Acland G. M., Fleming M. A., Ray K., Wiegand N. A., Francisko L.V., Gibbs M., Aguirre G. D., Ostrander E. A., 1997. A linkage map of the canine genome. Genomics 46 (3): 326–336. 144. Mitchell-Jones A. J., Amori G., Bogdanowicz W., Krystufek B., Reijnders P. J. H. et al., 1999. The Atlas of European Mammals. London: Academic Press. 145. Mörner T., Eriksson H., Brojer C., Nilsson K., Uhlhorn H et al., 2005. Diseases and mortality in free-ranging brown bear (Ursus arctos), gray wolf (Canis lupus), and wolverine (Gulo gulo) in Sweden. Journal of Wildlife Diseases 41 (2): 298-303. 146. Morozov V. F., 1953. Akklimatizacija ussurskogo enota (Nyctereutes procyonoides, GRAY) kakprimer uspešnogo preobrazovanija fauny pušcnych sverej evropejskoj territorii SSSR. Zool Z 23:524–533. 147. Mustonen A. M, Asikainen J., Kauhala K., Paakkonen T., Nieminen P., 2007. Seasonal rhythms of body temperature in the free-ranging raccoon dog Nyctereutes procyonoides with special emphasis on winter sleep. Chronobiology International 24 (6):1095–1107. 148. Naaber J., 1971. Raccoon dog. Eesti Lodus 14: 449–455 (in Estonian). 149. Nasimoviþ A. A., Isakov J. A., 1985. Arctic Fox, Red Fox and Raccoon Dog: Distribution of Populations, Ecology and Preservation. Nauka, Moscow: 116–145 (in Russian). 150. Neff M. W., Broman K. W., Mellersh C. S., Ray K., Gregory M. A et al., 1999. A second generation genetic linkage map of the domestic dog, Canis familiaris. Genetics 151 (2): 803–820. 151. Nei M., 1972. Genetic distance between populations. American Naturalist 106:283- 292. 152. Nei M., Kumar S., 2000. Molecular Evolution and Phylogenetics. 2nd ed. Oxford, UK: Oxford University Press. 153. Nieminen P., Mustonen A. M., Asikainen J., Hyvärinen H., 2002. Seasonal weight regulation of the raccoon dog Nyctereutes procyonoides: interactions between melatonin, leptin, ghrelin, and growth hormone. Journal of Biological Rhythms 17 (2): 155–163. 154. Niin E., Laine M., Guiot A., Demerson J., Cliquet F., 2008. Rabies in Estonia: situation before and after the first campaigns of oral vaccination of wildlife with SAG2 vaccine bait. Vaccine 26 (29-30): 3556-3565. 155. Notini G., 1948. New Swedish fur animal. Svensk Jakt 86: 68–70 (in Swedish).

104 156. Nowak E., 1993. Nyctereutes procyonoides Gray, 1834 - Marderhund. In: Stubbe M., Krapp F. (eds.). Handbuch der Säugetiere Europas, Aula Verlag, Wiesbaden, Germany. Band 5: Raubsäuger: 215-248. 157. Oerlemans M., Koene P., 2008. Possible implications of the presence of the raccoon dog (Nyctereutes procyonoides) in the Netherlands. Lutra 51(2): 123-131. 158. Oivanen L., Kapel C. M. O., Pozio E., La Rosa G., Mikkonen T., Sukura A., 2002. Associations between Trichinella species and host species in Finland. Journal of Parasitology 88: 84–88. 159. Oksanen A., Lavikainen A., 2004. Echinococcosis in Fennoscandia. International Archives of the Hydatidosis 35: 62. 160. Oksanen A., Lindgren E., Tunkkari P., 1998. Epidemiology of trichinellosis in lynx in Finland. Journal of Helminthology 72: 47–53. 161. Okumura N., Ishiguro N., Nakano M., Matsui A., Sahara M., 1996. Intra- and interbreed genetic variations of mitochondrial DNA major non-coding regions in Japanese native dog breeds (Canis familiaris). Animal Genetics 27 (6): 397–405. 162. Olenin S., Minchin D., Daunys D., 2007. Assessment of biopollution in aquatic ecosystems. Marine Pollution Bulletin 55 (7-9): 379-394. 163. Onar V., Mutus R., Kahvecio÷lu K. O., 1997. Morphometric analysis of the foramen magnum in German Shepherd dogs (Alsatians). Annals of Anatomy 179 (6): 563–568. 164. Onar V. A., 1999. Morphometric Study on the Skull of the German Shepherd Dog (Alsatian). Anatomia Histologia Embryologia 28: 253–6. 165. Oosterhout C. V., Hutchinson W. F., Wills D. P. M., Shipley P. F., 2004. MICRO- CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. 166. Opermanis O., Mednis A., Bauga I., 2001. Duck nests and predators: interaction, specialisation and possible management. Wildlife Biology 7 (2): 87-96. 167. Pannwitz G., Mayer-Scholl A., Balicka-Ramisz A., Nökler K., 2010. Increased prevalence of Trichinella spp., Northeastern Germany, 2008. Emerging Infectious Diseases 16 (6): 936-942. 168. Park S. D. E., 2001. Trypanotolerance in West African cattle and the population genetic effects of selection. PhD thesis, University of Dublin, Dublin, Ireland. 169. Peakall R., Smouse P. E., 2006. GenAlEx 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: 288–295. 170. Pence D.B., Ueckermann E., 2002. Sarcoptic mange in wildlife. Scientific and Technical Review of the Office International des Epizooties 21:385-398.

105 171. Piesman J., Spielman A., Etkind P., Ruebush T. K., II Juranek D. D., 1979. Role of deer in the epizootiology of Babesia microti in Massachusetts, USA. Journal of Medical Entomology 15: 537–540. 172. Pitra C., Schwarz S., Fickel J., 2010. Going west: Invasion genetics of the alien raccoon dog Nyctereutes procyonoides in Europe. European Journal of Wildlife Research 56: 117–129. 173. Podsiadly E., Chmielewski T., Marczak R., Sochon E., Tylewska-Wierzbanowska S., 2007. Bartonella henselae in the human environment in Poland. Scandinvian Journal of Infectiuos Diseases 39: 956–62. 174. Poƺakova A., 2009. Fox (Vulpes vulpes) and raccoon dog (Nyctereutes procyonoides) helminth fauna in Latvia. MSc Degree Thesis, LLU, Jelgava (in Latvian). 175. Potzsch C. J., Kliemt A., Klöss D., Schröder R., Müller W., 2006. Rabies in Europe - Trends and Developments. Development Biology (Basel) Karger: 125:59-68. 176. Pozio E., 1998. Trichinellosis in the European Union. Epidemiology, ecology and economic impact. Parasitology Today 14: 35–38. 177. Pozio E., Murrell K. D., 2006. Systematics and epidemiology of Trichinella. Advances in Parasitology 63: 367–439. 178. Pritchard J. K., Stephens M., Donnelly P., 2000. Inference of population structure using multilocus genotype data. Genetics 155 (2): 945–959. 179. Prokopenko A. A., Williams D. F., Kuzmin M. I., Karabanov E. B., Khursevich G. K., Peck J. A., 2002. Muted climate variations in continental Siberia during the mid- Pleistocene epoch. Nature 418: 65–68. 180. Prǌsaitơ J., Mažeikytơ R., Pauža D., Paužienơ N., Baleišis R., Juškaitis R et al., 1988. Fauna of Lithuania. 1 st ed. Vilnius, Lithuania: Mokslas Publishers (in Lithuanian). 181. Queller D.C., Strassmann J. E., Hughes C. R., 1993. Microsatellites and kinship. Trends in Ecology and Evolution 8 (8): 285–288. 182. Radzijevskaja J., Paulauskas A., Aleksandraviciene A., Jonauskaite I., Stanko M et al., 2015. New records of spotted fever group rickettsiae in Baltic region. Microbes and Infection 17: 874-878. 183. Rambaut A., 2009. FigTree: Tree Figure Drawing Tool, version 1.3.1. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh, UK. 184. Ramos-Onsins S. E., Rozas J., 2002. Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution 19: 2092–2100. 185. Raymond M., Rousset F., 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity 86 (3): 248–249.

106 186. Regnery R. L., Spruill C. L., Plikaytis B. D., 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. Journal of Bacteriology 173(5): 1576-1589. 187. Rice W. R., 1989. Analyzing tables of statistical tests. Evolution 43 (1): 223–225. 188. Robert A., Couvet D., Sarrazin F., 2003. Bottlenecks in large populations: the effect of immigration on population viability. Evolutionary Ecology 17 (3): 213–231. 189. Rogalska-Niznik N., Szczerbal .I, Dolf G., Schläpfer J., Schelling C et al., 2003. Canine- derived cosmid probes containing microsatellites can be used in physical map of the arctic fox (Alopex lagopus) and the Chinese raccoon dog (Nyctereutes procyonides procyonides) genomes. Journal of Heredity 94 (1): 89-93. 190. Rogers A. R., Harpending H., 1992. Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution 9:552–569. 191. Romig T., Dinkel A., Mackenstedt U., 2006. The present situation of echinococcosis in Europe. Parasitology International 55: 187–191. 192. Ronquist F., Huelsenbeck J. P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19 (12): 1572–1574. 193. Rozas J., Sánchez-DelBarrio J. C., Messegyer X., 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19:2496–2497. 194. Saeki M., Johnson P., Macdonald D. W., 2007. Movements and habitat selection of raccoon dog (Nyctereutes procyonoides) in a mosaic landscape. Journal of Mammalogy 88: 1098-1111. 195. Saeki M., Macdonald D. W., 2004. The effects of traffic on the raccoon dog (Nyctereutes procyonoides viverrinus) and other mammals in Japan. Biological Conservation 118 (5): 559–571. 196. Saeki M., 2001. Ecology and conservation of the raccoon dog (Nyctereutes procyonoides) in Japan. PhD dissertation, Oxford, UK, 272 pp. 197. Saitou N., Nei M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4 (4): 406–425. 198. Sakai A., Allendorf F. W., Holt J. S., Lodge D. M., Molifsky J., With K. A., Baughman S., Cabin R. J., Cohen J. E., Ellstrand N. C., et al., 2001. The population biology of invasive species. Annual Review of Ecology and Systematics 32:305–332. 199. Samusenko É. G., Goloduško B. Z., 1961. Nutrition of the raccoon dog in Belarus. In: Ges ND ed. Fauna and Ecology of Terrestrial Vertebrates of Belarus. Minsk: Izdatelstvo Ministerstva vysshego, srednego specialnogo i professionalnogo obrazovaniâ BSSR: 71– 82 (in Russian).

107 200. Sato S., Kabeya H., Miura T., Suzuki K., Bai Y., Kosoy M., Sentsui H., Kariwa H., Maruyama S., 2012. Isolation and phylogenetic analysis of Bartonella species from wild carnivores of the suborder Caniformia in Japan. Veterinary Microbiology 161 (1-2): 130–136. 201. Sbisà E., Tanzariello F., Reyes A., Pesole G., Saccone C., 1997. Mammalian mitochondrial D-loop region structural analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205: 125 – 140. 202. Schwarz S., Sutor A., Staubach C., Mattis R., Tackmann K., Conraths F. J., 2011. Estimated prevalence of Echinococcus multilocularis in raccoon dogs Nyctereutes procyonoides in northern Brandenburg, Germany. Current Zoology 57: 655-661. 203. Selva N., JĊdrzejewska B., JĊdrzejewski W., 2003. Scavenging on European bison carcasses in BiaáowieĪa Primeval Forest (eastern Poland). Ecoscience 10 (3): 303-311. 204. Selva N., JĊdrzejewska B., JĊdrzejewski W., Wajrak A., 2005. Factors affecting carcass use by a guild of scavengers in European temperate woodland. Canadian Journal of Zoology 83 (12): 1590-1601. 205. Shibuya H., Collins B. K., Huang T. H., Johnson G. S., 1994. A polymorphic (AGGAAT)n tandem repeat in an intron of the canine von Willebrand factor gene. Animals Genetics 25: 122. 206. Sibley J. A., Cross R. H., Quon A. L., Dutcyvich K., Edge T. A., Leighton F. A., Appleyard G. D., 2005. Development of diagnostic test methods for detecting key wildlife pathogens in bacteria-containing commercial biodegradation products. World Journal of Microbiology and Biotechnology 21: 417-432. 207. Sidorovich A. G., Polozow A. G., Lauzhel G. O., Krasko D. A., 2000. Dietary overlap among generalist carnivores in relation to the impact of the introduced raccoon dog Nyctereutes procyonoides on native predators in northern Belarus. Zeitschrift für Säugetierkunde 65: 271–285. 208. Sidorovich V. E., Solovej I. A., Sidorovich A. A., Dyman A. A., 2008. Seasonal and annual variation in the diet of the raccoon dog Nyctereutes procyonoides in northern Belarus: the role of habitat type and family group. Acta Theriologica 53: 27–38. 209. Siivonen L., 1958. Early history of the raccoon dog in Finland. Suomen Riista 12: 165–166 (in Finnish). 210. Sims M., 2012. Cranial morphology of five felids: Acinonyx jubatus, Panthera onca, Panthera pardus, Puma concolor, Uncia uncial. Russian Journal of Theriology 11: 157– 170.

108 211. Singer A., Kauhala K., Holmala K., G. C, 2009. Rabies in northeastern Europe-the threat from invasive raccoon dogs. Journal of Wildlife Diseases 45: 1121-1137. 212. ĝlaska B., Jezewska G., Zieba G., 2005. Preliminary results of application of chosen DNA sequence primers of Canis familiaris in amplification of Nyctereutes procyonoides genom parallelis loci. Roczniki naukowe polskiego towarzystwa zootechnicznego 1 (2): 253-260. 213. ĝlaska B., ZiĊba G., JeĪewska-Witkowska G., 2007. Raccoon dog (Nyctereutes procyonoides Gray) parentage testing based on STR markers. EJPAU 10(3): 1-16. 214. ĝlaska B., Jezewska G., Zieba G., Pierzchala M., 2008. Genetic variability and linkage of selected microsatellite markers in the Chinese raccoon dog (Nyctereutes procyonoides procyonoides). Arch Tierz Dummerstorf 51: 187– 198. 215. ĝlaska B., Zieba G., Rozempolska-Rucinska I., Jezewska-Witkowska G., Jakubczak A., 2010. Evaluation of Genetic Biodiversity in Farm-bred and Wild Raccoon Dogs in Poland. Folia biologica (Kraków) 58 (3-4): 195-199. 216. ĝlaska B., Grzybowska-Szatkowska L., 2011. Analysis of the mitochondrial haplogroups of farm and wild-living raccoon dogs in Poland. Mitochondrial DNA 22: 105–110. 217. Smreczak M., Oráowska A., ZmudziĔski J. F., 2009. Rabies situation in Poland in 2008. Bulletin of the Veterinary Institute in Pulawy 53: 583-587. 218. Sréter T., Sréter-Lancz Z., Széll Z., Kálmán D., 2004. Anaplasma phagocytophilum: an emerging tick-borne pathogen in Hungary and Central Eastern Europe. Annals of Tropical Medicine and Parasitology 98(4):401–405. 219. StatSoft, Inc. 2004. STATISTICA (data analysis software system), version 6. www.statsoft.com. 220. Stêpniak E., Zagalska M. M., Switoñski M., 2002. Use of RAPD technique in evolution studies of four species in the family Canidae. Journal of Applied Genetics 43:489-499. 221. Stiebling U., 1999. Zur Habitatnutzung des Marderhundes Nyctereutes procyonoides (Gray, 1834) in der uckermärkischen Agrarlandschaft: Ergebnisse zur Populationsdichte und— dynamik. Beitr Jagd Wildforschung 24:343–353. 222. Suchentrunk F., Ansorge H., Stier N., Nitze M., 2002. First account on allozymic variability of raccoon dogs, Nyctereutes procyonoides, immigrating into central Europe. Mammalian Biology 67: 37–38. 223. Süld K., Valdmann H., Laurimaa L., Soe E., Davison J. Saarma U., 2014. An Invasive Vector of Zoonotic Disease Sustained by Anthropogenic Resources: The Raccoon Dog in Northern Europe. PLoS ONE 9(5): e96358.

109 224. Sutor A., 2004. Raccoon dog Nyctereutes procyonoides: habitat use, activity pattern, diet compositions - a telemetry study in Brandenburg. In Alien species in changing landscapes. Nachrichten der Gestellshaft fur ökologie. Gfö. Annual Conference, June 2004. 225. Sutor A., 2008. Dispersal of the alien raccoon dog Nyctereutes procyonoides in Southern Brandenburg, Germany. European Journal of Wildlife Research 54:321–326. 226. Sutor A., Kauhala K., Ansorge H., 2010. Diet of the raccoon dog (Nyctereutes procyonoides) - a canid with an opportunistic foraging strategy. Acta Theriologica 55(2): 165–176. 227. Sutor A., Schwarz S., 2012. Home ranges of raccoon dogs (Nyctereutes procyonoides, Gray, 1834) in Southern Brandenburg, Germany. European Journal of Wildlife Research 58: 85-97. 228. Sutor A., Schwarz S., Conraths F. J., 2013. The biological potential of the raccoon dog (Nyctereutes procyonoides, Gray1834) as an invasive species in Europe-new risks for disease spread? Acta Theriologica 59: 49-59. 229. Szczerbal I., Kubickova S., Schelling C., Dolf G., Schläpfer J., Rubes J., 2003. Application of dual colour FISH for localisation of canine microsatellite markers in the Chinese raccoon dog (Nyctereutes procyonoides procyonoides) genome. Journal of Applied Genetics 44 (1): 71–76. 230. Tajima D., Tajima F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585–595. 231. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S., 2011. MEGA 5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739. 232. Tedford R. H., Qiu Z., 1991. Pliocene Nyctereutes (Carnivora: Canidae) from Yushe, Shanxi, with comments on Chinese fossil raccoon dogs. Vertebrata PalAsiatica 29:179– 189. 233. Thompson J. D., Higgins D. G., Gibson T. J., 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. 234. Uleviþius A., 1997. Burrowing carnivores in Žemaitija National Park, NW Lithuania: burrow setts and territory use. Acta Zoologica Lituanica 7: 127–132. 235. Upholt W. B., Dawid I. B., 1977. Mapping of mitochondrial DNA of individual sheep and goats: rapid evolution in the D loop region. Cell 11:571-583.

110 236. Väänänen V. M., Nummi P., Rautiainen A., Asanti T., Huolman I et al., 2007. The effect of raccoon dog Nyctereutes procyonoides removal on waterbird breeding success. Suomen Riista 53: 49–63 (in Finnish with English summary). 237. Vanaga S., van der Heide R., Joffe R., van der Poel W. H. M., 2003. Rabies in wildlife in Latvia. Vector-Borne and Zoonotic Diseases 3: 117-124. 238. Vennestrøm J., Egholm H., Jensen P. M., 2008. Occurrence of multiple infections with different Borrelia burgdorferi genospecies in Danish Ixodes ricinus nymphs. Parasitology International 57 (1): 32–37. 239. Vilà M., Basnou C., Pyšek P., Josefsson M., Genovesi P., Gollasch S., Nentwig W., Olenin S., Roques A., Roy D., Hulme P., DAISIE partners, 2010. How well do we understand the impacts of alien species on ecosystem services? A panEuropean cross-taxa assessment. Frontiers in Ecology and the Environment 8:135-144. 240. Vollmer S., Bormane A., Dinnis R., Seelig F., Dobson D. M. A., Aanensen D., James M., Donaghy M., Randolph S., Feil E., Kurtenbach K., Margos G., 2011. Host migration impacts on the phylogeography of Lyme Borreliosis spirochaete species in Europe. Environmental Microbiology 13 (1): 184–192. 241. Ward O. G., Wurster-Hill D. H., 1990. Nyctereutes procyonoides. Mammalian Species 358: 1–5. 242. Wayne R. K., 1993. Molecular evolution of the dog family. Trends in Genetics 9:218–224. 243. Weir B. S., Cockerham C. C., 1984. Estimating F -statistics for the analysis of population structure. Evolution 38:1358–1370. 244. Wikan S., 1983. Raccoon dog found dead in Sör-Varanger: A new Norwegian mammal. Fauna 36 (3): 103 (in Norwegian). 245. Williams J. G. K., Kubelik A.R., Livak K.J., Rafalski J. A., Tingey S. V., 1990. DNA polymorphisms amplified by arbitrary primers are useful as Genetic Markers. Nucleic Acids Research 18 (22): 6531–6535. 246. Wilson G. A., Rannala B., 2003. Bayesian inference of recent migration rates using multilocus genotypes. Genetics 163: 1177–1191. 247. Woldehiwet Z., 2010. The natural history of Anaplasma phagocytophilum. Veterinry Parasitology 167: 108–122. 248. Woloch A., Roženko N., 2007. Die Akklimatisation des Marderhundes (Nyctereutes procyonoides Gray, 1834) in der Südukraine. Beitr Jagd Wildforschung 32: 409–422. 249. World Health Organization (WHO), 2005. Distribution of rabies in Europe. Rabies Bulletin Europe 29(4): 7-20.

111 250. World Health Organization (WHO), 2009. Distribution of rabies in Europe. Rabies Bulletin Europe 33(4): 9-20. 251. World Health Organization WHO (2010). Distribution of rabies in Europe. Rabies Bulletin Europe 34(4): 12-24. 252. World Health Organization (WHO), 2013. Distribution of rabies in Europe. Rabies Bulletin Europe 37(1): 13-26. 253. Yamamoto I., 1987. Male parental care in the raccoon dog Nyctereutes procyonoides during the early rearing period. In: Itô Y, Brown JL, Kikkawa J ed. Animal Societies: Theories and Facts. Tokyo: Japan Scientic Society Press: 189–195. 254. Yan S. Q., Li Y. M., Bai C. Y., Ding X. M., Li W. J., Hou J. N., Zhao Z. H., Sun J. H., 2013. Development and characterization of polymorphic microsatellite markers for Chinese raccoon dog (Nyctereutes procyonoides procyonoides). Genetics and Molecular Research 12: 6351-6355. 255. Yang Z., 1994. Estimating the pattern of nucleotide substitution. Journal of Molecular Evolution 39: 105–111. 256. Zachos F. E., Cirovic D., Rottgardt I., Seiffert B., Oeking S., Eckert I., Hartl G. B., 2007. Geographically large-scale genetic monomorphism in a highly successful introduced species: the case of the muskrat (Ondatra zibethicus) in Europe. Mammalian Biology 72: 123-126. 257. Zienius D., Pridotkas G., Lelesius R., Sereika V., 2011. Raccoon dog rabies surveillance and post-vaccination monitoring in Lithuania 2006 to 2010. Acta Veterinaria Scandinavica 53 (1): 58. 258. Zoss A., 1992. Some aspects of the ecology of European badger (Meles meles L.) in the Slitere Nature Reserve. Acta et commentationes Univeritatis Tartuensis 55: 176–185. 259. Zygner W., Gojska O., Rapacka G., Jaros D., Wedrychowicz H., 2007. Hematological changes during the course of canine babesiosis caused by large Babesia in domestic dogs in Warsaw (Poland) Veterinary Parasitology 145: 146–151.

112

Loreta GRICIUVIENĖ

THE FORMATION OF GENETIC STRUCTURE OF RACCOON DOGS (NYCTEREUTES PROCYONOIDES) POPULATION IN THE INVADED TERRITORIES AND THEIR IMPACT ON ECOSYSTEM

Doctoral Dissertation

Spausdino – Vytauto Didžiojo universitetas (S. Daukanto g. 27, LT-44249 Kaunas) Užsakymo Nr. K15-036. Tiražas 15 egz. 2016 05 25. Nemokamai.