(12) United States Patent (10) Patent No.: US 6,911,338 B2 Strobel Et Al

USOO6911338B2 (12) United States Patent (10) Patent No.: US 6,911,338 B2 Strobel et al. (45) Date of Patent: Jun. 28, 2005

(54) ENDOPHYTIC FUNGIAND METHODS OF 5,270,340 A 12/1993 Kunisch et al. USE 5,612,338 A 3/1997 Trah 6,310,005 B1 10/2001 Assmann et al. (76) Inventors: Gary Strobel, 2107 Fairway Dr., Bozeman, MT (US) 59715; Denise C. OTHER PUBLICATIONS Manker, 3037 Prado La., Davis, CA (US) 95616; Julien Mercier, 1719 McGee Ave., Berkeley, CA (US) 94.703 Strobel et al., Microbiology, 147:2943-2950, 2001.* Worapong, et al., Mycotaxon. 81:463-475, 2001.* (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 60 days. * cited by examiner (21) Appl. No.: 10/121,740 Primary Examiner Irene Marx (74) Attorney, Agent, or Firm McDonough Holland & (22) Filed: Apr. 11, 2002 Allen PC; Michelle L. Samonek (65) Prior Publication Data (57) ABSTRACT US 2003/01864.25 A1 Oct. 2, 2003 This invention provides a novel endophytic fungus, Related U.S. Application Data MuSCOdor, that produces a mixture of Volatile antibiotics (60) Provisional application No. 60/363,072, filed on Mar. 11, with activity on Specific plant pathogens, bacteria, nemo 2002, and provisional application No. 60/283.902, filed on todes and insects. Also provided is a method for treating or Apr. 16, 2001. protecting plants, Soil and Seeds from microbial infections (51) Int. Cl...... C12N 1/14 comprising applying an effective amount of a Volatile anti (52) U.S. Cl...... 435/254.1; 424/93.5; 504/117; biotic producing MuSCOdor Sp. The invention also relates to 435/262.5; 435/34 fungicidal, bactericidal, insecticidal and nematicidal com (58) Field of Search ...... 435/254.1, 262.5, positions comprising this novel Muscodor Strain and the 435/34; 424/93.5; 504/117 antibiotics and metaboliteS produced by this Strain either alone, or in combination with other chemical and biological (56) References Cited pesticides. Also provided is a method for identifying and isolating related gas producing fungi. U.S. PATENT DOCUMENTS 4.954,497 A 9/1990 Kamikado et al. 8 Claims, No Drawings US 6,911,338 B2 1 2 ENDOPHYTIC FUNG AND METHODS OF Volatile antibiotics with activity against fungi, bacteria, USE insects and nematodes. In one aspect, the Muscodor is identified using the information provided herein, including, CROSS-REFERENCE TO RELATED but not limited to partial genomic Sequences Set forth in SEQ APPLICATIONS ID NOS: 1 to 4. Strains of Muscodor albus and Muscodor roseus were deposited on Feb. 1, 2002 in the Agricultural This application claims the benefit under 35 U.S.C. S Research Culture Collection located at 1815 N. University 119(e) of U.S. Provisional Application Nos. 60/283.902 and Street Peoria, Ill. 61604 U.S.A. (NRRL) in accordance with 60/363,072, filed Apr. 16, 2001 and Mar. 11, 2002, respec the Budapest Treaty on the International Recognition of the tively. The contents of these applications are hereby incor Deposit of Microorganisms for the Purpose of Patent Pro porated by reference into the present disclosure. cedure and the Regulations thereunder (Budapest Treaty). The Strains were assigned the following Accession Num FIELD OF THE INVENTION bers: The present invention relates to the isolation of novel Muscodor albuS 620-Accession Number NRRL 30547 fungi that produce volatile antibiotics. The Volatile com Muscodor roseus A3-5-Accession Number NRRL 30548 pounds have biological activity against plant and human 15 The Strains have been deposited under conditions that assure pathogenic fungi and bacteria, insects and nematodes. that access to the cultures will be available during the pendency of this application. However, it should be under BACKGROUND OF THE INVENTION stood that the availability of a deposit does not constitute a license to practice the Subject invention in derogation of Throughout this application, various articles and books patent rights granted by governmental action. are referenced by authorship and date. The full bibliographic Compositions containing the fungi and/or the Volatile citation for each publication can be found at the end of the compounds are also provided. The compositions are useful Specification, immediately preceding the claims. to treat Soil and to protect plants, Seed, grain, and fruit from It is well recognized that fungi produce antibiotics that are pathogenic fungi and bacteria. The compositions also are useful in the treatment of diseases, in industrial applications 25 useful to protect postharvest food against bacterial and and as pesticides, e.g., penicillin, cephalosporins, fungal infections. The compositions are further useful for tetracyclin, and cycloSporins, none of which are volatile. treating human or animal waste and for treating and/or Many fungal Species are known to emit low concentrations preventing toxic mold infestations of buildings and building of gaseous Substances, especially ones that have distinctive materials. Such as wood. Methods of treating and protecting obnoxious odors, and this has prompted chemical analyses Soil, plants, Seed, grain, waste products, building materials of the fungal volatiles (Bjurman et al., 1992). Some of these and postharvest food products against bacterial, insecticidal, Volatile Substances are common to many fungi, whereas nematicidal and fungal infections are further provided by others seem to be unique for one species (Schnurer et al., this invention. 1999; Rapior et al., 2000). Dennis & Webster (1971) BRIEF DESCRIPTION OF THE TABLES reported that certain Trichoderma spp. produced volatile 35 antibiotics that inhibited the growth of Such test fungi as Table 1 shows the effects of the volatile compounds of M. Rhizoctonia Solani, Pythium ultimum and Fusarium albuS and an artificial mixture of M. albuS compounds on a Oxysporum. No lethality to any of the test fungi were group of test microbes. After exposure to M. albuS gases, the reported by these authors and comprehensive chemical test microbe was evaluated for its viability after removal analyses of the Volatile components of the fungal cultures from the gases. The artificial atmosphere consisted of the was not performed, although acetaldehyde was Suggested as 40 compounds identified after analysis of the M. albuS gases. one of the Volatiles. Thus, in Spite of Some attention being The microbial growth in the artificial atmosphere was mea given to the Volatile compounds of fungal cultures over the Sured after exposure to the artificial mixture of compounds years, no lethal mixture of Volatile antimicrobials produced at 3.2-90 ul/50 cc in order to obtain ICso's. The % growth by fungi have been reported. 45 over the control and viability were measured after exposure It is also well known that various microorganisms exhibit to 60 ul/50 cc. Viability was determined after the removal of biological activity So as to be useful to control plant dis the compounds at 3 dayS. eases. Although progreSS has been made in the field of Table 2 shows the average number of broccoli Seedlings identifying and developing biological pesticides for control per pot one week after planting (meansistandard deviation) ling various plant diseases of agronomic and horticultural 50 using Vermiculite. Pots were planted immediately without an importance, most of the pesticides in use are Still Synthetic incubation period. compounds. Many of these chemical fungicides are classi Table 3 shows the results of an experiment determining fied as carcinogens by the EPA and are toxic to wildlife and the ability of Muscodor albus to control blue mold of apple. other non-target Species. For example, methyl bromide is Table 4 shows the results of GC/MS analysis of the widely used as a Soil fumigant and to treat postharvest 55 volatile compounds produced by M. albus. Several minor microbial infections. Due to its high toxicity to humans and peaks and the breakthrough peak were omitted from the total animals and deleterious effect on the atmosphere, the use of analysis Since they represent only 1% of the total area methyl bromide will Soon be eliminated and there is a great Compounds found in the control PDA plate are not included need to find Safer replacements for this and other Synthetic in this table. pesticides. 60 Table 5 shows the results of an assay to determine the This invention satisfies this need and provides related inhibitory influence of each class of Volatile compounds. advantages as well. This is expressed as the 9% of the test microbe growth as compared to a control not in the presence of the test DETAILED DESCRIPTION OF THE compounds. The compounds were tested for a 2 day expo INVENTION 65 Sure at the relative concentrations that they occur in M. albuS Novel endophytic fungi including Muscodor albus and at the optimum test concentration 60 ul/50 CC air space or Muscodor roseus are provided that produce a mixture of 1.2 titl/cc. US 6,911,338 B2 3 4 Table 6 shows Muscodor albuS volatiles used to treat “Bacterial” means the ability of a substance to increase covered Smut infested barley Seeds. Sets of untreated and mortality or inhibit the growth rate of bacteria. uninfested Seeds were used as controls. “Nematicidal' means the ability of a substance to increase MODES FOR CARRYING OUT THE mortality or inhibit the growth rate of nematodes. “Antibiotic” includes any substance that is able to kill or INVENTION inhibit a microorganism. Antibiotics may be produced by a Throughout this disclosure, various publications, patents microorganism or by a Synthetic process or Semisynthetic and published patent Specifications are referenced by an process. The term, therefore, includes a Substance that identifying citation. The disclosures of these publications, inhibits or kills fungi for example, cycloheximide or nysta patents and published patent specifications are hereby incor tin. porated by reference into the present disclosure to more fully The term “culturing” refers to the propagation of organ describe the state of the art to which this invention pertains. isms on or in media of various kinds. “Whole broth culture” The practice of the present invention employs, unless refers to a liquid culture containing both cells and media. otherwise indicated, conventional techniques of molecular “Supenatant” refers to the liquid broth remaining when cells biology (including recombinant techniques), microbiology, 15 grown in broth are removed by centrifugation, filtration, cell biology, biochemistry and immunology, which are Sedimentation, or other means well known in the art. within the skill of the art. Such techniques are explained An “effective amount' is an amount Sufficient to effect fully in the literature. These methods are described in the beneficial or desired results. An effective amount can be following publications. See, e.g., Sambrook et al. MOLECU administered in one or more administrations. In terms of LAR CLONING: A LABORATORY MANUAL, 2" edition (1989); treatment and protection, an “effective amount' is that CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel amount Sufficient to ameliorate, Stabilize, reverse, Slow or et al. eds. (1987)); the series METHODS IN ENZYMOLOGY delay progression of the target infection or disease States. (Academic Press, Inc.); PCR: A PRACTICAL APPROACH (M. “Positive control” means a compound known to have MacPherson et al. IRL Press at Oxford University Press 25 pesticidal activity. “Positive controls” include, but are not (1991)); and PCR 2: A PRACTICAL APPROACH (M. J. limited to commercially available chemical pesticides. The MacPherson, B. D. Hames and G. R. Taylor eds. (1995)). term “negative control’ means a compound not known to Definitions have pesticidal activity. Examples of negative controls are The singular form “a,” “an and “the' include plural water or ethyl acetate. references unless the context clearly dictates otherwise. For The term “metabolite” or “volatile” refers to any example, the term “a cell” includes a plurality of cells, compound, Substance or byproduct of a fermentation of a including mixtures thereof. microorganism that has the biological activity. Volatiles in The term “comprising” is intended to mean that the most instances evaporate readily at ambient temperature and compositions and methods include the recited elements, but preSSure. not excluding others. “Consisting essentially of when used 35 The term “mutant” refers to a variant of the parental strain to define compositions and methods, Shall mean excluding as well as methods for obtaining a mutant or variant in which other elements of any essential Significance to the combi the desired biological activity is similar to that expressed by nation. Thus, a composition consisting essentially of the the parental Strain. The "parent Strain' is defined herein as elements as defined herein would not exclude trace contami the original Muscodor Strains before mutagenesis. Mutants nants from the isolation and purification method and agri 40 occur in nature without the intervention of man. They also culturally acceptable carriers. “Consisting of shall mean are obtainable by treatment with or by a variety of methods excluding more than trace elements of other ingredients and and compositions known to those of skill in the art. For Substantial method steps for applying the compositions of example, parental Strains may be treated with a chemical this invention. Embodiments defined by each of these tran such as N-methyl-N'-nitro-N-nitro so guanidine, Sition terms are within the Scope of this invention. 45 ethylmethaneSulfone, or by irradiation using gamma, X-ray, AS used herein, "biological control' is defined as control or UV-irradiation, or by other means well known to those of a pathogen or insect by the use of a Second organism. practiced in the art. Known mechanisms of biological control include enteric A “composition' is intended to mean a combination of bacteria that control root rot by out-competing fungi for active agent and another compound, carrier or composition, Space on the Surface of the root. Bacterial toxins, Such as 50 inert (for example, a detectable agent or label or liquid antibiotics, have been used to control pathogens. The toxin carrier) or active, Such as an adjuvant. Examples of agricul can be isolated and applied directly to the plant or the tural carriers are provided below. The fungi can also be bacterial Species may be administered So it produces the formulated as a composition, with a carrier or alternatively, toxin in situ. 55 with at least one chemical or biological pesticide. The term “fungus' or “fungi' includes a wide variety of All numerical designations, e.g., pH, temperature, time, nucleated Spore-bearing organisms that are devoid of chlo concentration, and molecular weight, including ranges, are rophyll. Examples of fungi include yeasts, molds, mildews, approximations which may be varied (+) or (-) by incre rusts, and mushrooms. ments of 0.1. It is to be understood, although not always The term “bacteria' includes any prokaryotic organism 60 explicitly Stated that all numerical designations are preceded that does not have a distinct nucleus. by the term “about'. It also is to be understood, although not “Pesticidal' means the ability of a substance to increase always explicitly Stated, that the reagents described herein mortality or inhibit the growth rate of plant pests. are merely exemplary and that equivalents of Such are well "Fungicidal' means the ability of a Substance to increase known in the art. mortality or inhibit the growth rate of fungi. 65 In order to achieve good dispersion and adhesion of “Insecticidal' means the ability of a Substance to increase compositions within the present invention, it may be advan mortality or inhibit the growth rate of insects or their larvae. tageous to formulate the whole broth culture, Supernatant US 6,911,338 B2 S 6 and/or Volatile with components that aid dispersion and codor and two species thereof, Muscodor albus and Mus adhesion. Suitable formulations will be known to those codor roseus, and mutants thereof. skilled in the art (wettable powders, granules and the like, or Also provided by this invention are gaseous composition can be microencapsulated in a Suitable medium and the like, (s) (“volatiles”) produced by the isolated Muscodor cultures. liquids Such as aqueous flowables and aqueous Suspensions, 5 In one aspect, the Volatile composition has the components Volatile compositions and emulsifiable concentrates. Other recited in Table 4. The gaseous compositions can be com Suitable formulations will be known to those skilled in the bined with a Suitable dispersing agent or carrier. In another art. aspect, the compositions optionally contain an effective A “variant' is a Strain having all the identifying charac amount of one or more of a fungicide, an insecticide, a teristics of the strains of this invention and can be identified 10 nematicide, an antimicrobial, a bactericide or a food preser as having a genome that hybridizes under conditions of high vative. Stringency to the genome of the organism, the partial Applicants have further identified the components of the Sequence of which has been deposited in the GenBank Volatile byproduct and have Synthesized it from commer depository. “Hybridization” refers to a reaction in which one cially available materials. The components of the Synthetic or more polynucleotides react to form a complex that is 15 stabilized via hydrogen bonding between the bases of the volatile are recited in Table 4. It should be understood, nucleotide residues. The hydrogen bonding may occur by although not always explicitly Stated that the Synthetic Watson-Crick base pairing, Hoogstein binding, or in any composition can be used in the methods described herein as other Sequence-specific manner. The complex may comprise an alternative or as a Substitute to the natural gaseous two Strands forming a duplex Structure, three or more Strands byproduct produced by Muscodor fungi. forming a multi-Stranded complex, a Single Self-hybridizing Muscodor gases affect a number of other microbes related Strand, or any combination of these. Hybridization reactions to human health issues. It is lethal to the major fungal and can be performed under conditions of different “stringency.” bacterial pathogens of humans including C. albicans and A. In general, a low Stringency hybridization reaction is carried fumigatus (Table 1) and Pseudomonas sp. It kills bacteria out at about 40 C. in 10xSSC or a solution of equivalent 25 that contaminate food such as S. aureus and E. coli (Table 1). ionic Strength/temperature. A moderate Stringency hybrid It has been found to be lethal to Stachybotrys sp. ization is typically performed at about 50° C. in 6xSSC, and (contaminator of homes, and public buildings) and also a a high Stringency hybridization reaction is generally per number of wood decay fungi. formed at about 60° C. in 1XSSC. Thus, the fungi and the gases produced by the fungi are A variant may also be defined as a Strain having a genomic useful to inhibit the growth of or kill an organism Selected Sequence that is greater than 85%, more preferably greater from the group consisting of a fungus, a bacteria, a than 90% or more preferably greater than 95% sequence microorganism, a nematode and an insect. Using methods identity to the genome of M. roseus or M. albus. A poly well known to those of skill in the art, the fungi or its volatile nucleotide or polynucleotide region (or a polypeptide or byproduct is contacted with the organism in an amount polypeptide region) has a certain percentage (for example, 35 effective to kill or inhibit the growth of the organism. 80%, 85%, 90%, or 95%) of “sequence identity” to another Alternatively, the fungi and/or its volatile byproduct can be Sequence, which means that, when aligned, that percentage used to treat human or animal waste, e.g., as a component of of bases (or amino acids) are the same in comparing the two a waste water or Solid management or treatment. They also Sequences. This alignment and the percent homology or are useful to decontaminate human and animal waste, e.g., Sequence identity can be determined using Software pro 40 decrease or remove bacterial and fungal contamination. Yet grams known in the art, for example, those described in further, the fungi and/or its volatile byproduct can be used to Current Protocols in Molecular Biology (F. M. Ausubel et treat or prevent toxic mold on building materials and in al., eds., 1987) Supplement 30, section 7.7.18, Table 7.7.1. buildings by contacting the building, the building materials, Preferably, default parameters are used for alignment. A or the Spaces between the building materials with an effec preferred alignment program is BLAST, using default tive amount of the volatile byproduct. For the purpose of parameters. In particular, preferred programs are BLASTN illustration only, an effective amount of the volatile byprod and BLASTP, using the following default parameters: uct can be used alone or in combination with other fumigants Genetic code=standard; filter=none; strand=both; cutoff=60; in a room or alternatively, during whole building fumiga expect=10; Matrix=BLOSUM62; Descriptions=50 tions. sequences; sort by=HIGH SCORE; Databases=non so When used in agricultural applications, the invention redundant, GenBank+EMBL-DDBJ--PDB+GenBank CDS provides a method for treating or protecting fruit, Seeds, translations--SwissProtein--SPupdate+PIR. These software plants or the Soil Surrounding the plants from an infestation programs are publicly available through the National Center by an organism Selected from the group consisting of a for Biotechnology (Bethesda, Md.). fungus, a bacteria, a microorganism, and an insect, by Applicants have isolated and characterized a novel fungi ss contacting the microorganism with an effective amount of an named Muscodor. Two species of the novel Muscodor have isolated Muscodor culture or its volatile byproduct. also been isolated and characterized, i.e., MuSCOdor albuS Further provided by this invention is a method for iden and MuSCOdor roseus. Partial genomic Sequences for Mus tifying novel Muscodor fungi, comprising contacting an codor albus are provided in SEQ ID NOS.: 1 and 2 and effective amount of the fungi to be screened with the partial genomic sequences for Muscodor roseuS (designated 60 volatiles of Muscodor albus or Muscodor roseus under A3-5) are provided in SEQ ID NOS. 3 and 4. A partial culturing conditions and Selecting the fungi which is resis genomic sequence for M. roseuS (A10) was also obtained. tant to the volatiles of the Muscodor albus or Muscodor An isolated culture of Muscodor albus has been deposited roseus thereby identifying novel Muscodor fungi. Further with the NRRL under Accession No. 30457. An isolated provided are the isolated Muscodor fungi selected by this culture of MuSCOdor roseus designated A3-5 has been depos 65 method. ited with the NRRL under Accession No. 30458. Thus, this Yet further provided is a method for obtaining a volatile invention provides an isolated novel fungi designated Mus composition by culturing the isolated MuSCOdor of this US 6,911,338 B2 7 8 invention and collecting the volatile composition produced In order to determine how to best store isolate 620, several by the growing MuSCOdor. conditions were tried. The fungus was grown on Sterilized The following examples are provided to illustrate the Whatmann No. 1 filter paper discs that were placed on to the invention. These examples are not to be construed as lim surface of PDA in Petri Plates. The fungus was inoculated as iting. an agar plug in the middle of the filter paper disc on the PDA plate. The plate was incubated for 14 days at 22 C. The EXAMPLES paper disc was then removed and placed in a laminar flow hood under Sterile conditions for 1 day, or until the paper Example 1 with its fungal mycelium was dry. The paper disc was then Fungal Isolation 1O cut into many pieces and Stored under various conditions. Also, agar plugs containing the fungus were placed in Sterile Muscodor albus distilled water and stored at 4 C.: In another set of test Several Small limbs of a mature Cinnamomum zeylanicum conditions, mycelial pieces growing on agar were placed in tree located 20 miles west of La Ceiba, Honduras, were 15% glycerol and stored at -70° C. In each test, fungal removed and immediately transported back to Montana 15 Viability was determined by placing the mycelial fragments State University for processing in the fall of 1997. Small on to a PDA plate and examining it for fungal growth after pieces of inner bark, Sapwood and Outer xylem tissueS of the 3-4 days. limbs were aseptically removed and placed on Petri plates In order to determine how to best store Muscodor roseus containing water agar. After incubation for Several days, isolates (designated internally as A3-5 and A-10) Several hyphal tips of developing fungi were aseptically removed conditions were tried. The fungus was grown on Sterilized and placed on potato dextrose agar (PDA). In addition, after Whatmann No. 1 filter paper discs that were placed on to the 7 days, fungal colonies were transferred to gamma irradiated surface of PDA in Petri Plates. The fungus was inoculated as carnation leaves (0.5x0.5 cm) to encourage spore produc an agar plug in the middle of the filter paper disc on the PDA tion. Of Several fungi that were isolated the one of great plate. The plate was incubated for 14 days at 22 C. The interest, because of its musty odor, was an isolate 25 paper disc was then removed and placed in a laminar flow designated "620, later identified as Muscodor albus. hood under Sterile conditions for 1 day, or until the paper Muscodor roseus with its fungal mycelium was dry. The paper disc was then Fungus was isolated from several small limbs of a Fern cut into many pieces and stored at 23° C., 4 C., O C. and Leafed Grevellia (Grevillea pteridifolia) 12°59'39" South -70° C. Also, agar plugs containing the fungus were placed and 132°28'50" East obtained from the Northern Territory of in sterile distilled water and stored at 4 C. In another set of Australia. Small pieces of inner bark, Sapwood and outer test conditions, mycelial pieces growing on agar were placed xylem tissues of some small limbs (0.5 cm dia) were in 15% glycerol and stored at -70° C. In each test, fungal aseptically removed and placed on Petri plates containing Viability was determined by placing the mycelial fragments water agar (Strobel et al., 1996). After incubation for several on to a PDA plate and examining it for fungal growth after days, hyphal tips of developing fungi were aseptically 35 3-4 days. removed and placed on potato dextrose agar (PDA). In addition, after 7 days, fungal colonies were transferred to Example 3 gamma irradiated carnation leaves (0.5x0.5 cm) and other plant materials to encourage Spore production. Of the Several Fungal DNA Isolation fungi that were isolated, the one of greatest interest, because 40 For DNA isolation, all fungi were grown in potato deX of its musty odor, was an isolate designated-" A3-5.” trose broth (PDA) in 1.5 ml for 18 to 24 h at 23° C. The An additional strain of Muscodor was obtained from the mycelium was harvested by centrifugation and washed twice Small limbs of the Australia Ironwood (Erythophelum with sterile ddHO. Total genomic DNA was extracted by chlorostachys) at 15°29'29" South and 131°23'12" East. This the methods of Lee and Taylor (1990). endophyte was isolated using the Volatiles of M. albuS as a 45 selection tool. Plant material, from which endophytes were Example 4 to be isolated, were placed in the same agar plate as a rapidly growing two-week old culture of M. albus. Then, the only Amplification of 18S Ribosomal DNA organisms developing from the plant material were the ones resistant to M. albus, which are possibly other volatile 50 Partial nucleotide base pair fragments of the 18S r DNA antibiotic producers or relatives of M. albus in the Xylari gene from each fungus was amplified via the polymerase aceous group (Strobel et al., 2001). The most commonly chain reaction (PCR) as a single fragment with the primer isolated endophytes from this tree were PeStalotiopsis spp. UK4F (5' CYGGTTGATCCTGCCRG) and UREV and other Xylaria spp. It was internally designated “A-10'. (5'GYTACCTTGACGAACTT). PCR was performed in a 55 50 ul reaction vial containing 0.1 uggenomic DNA, 0.4 uM Example 2 each primer, 0.16 mM four dNTPs and 5u Taq polymerase (Promega) in a buffer of 10 mM tris-HCl (pH 9.0 at 25° C), Fungal Growth and Storage 50 mM KC1, 3 mM MgCl, 0.1% Triton X-100. Amplifica The fungus was grown on a number of different media tion was for 30 cycles (45s at 94.5° C., 45s at 53.5°C., 90 including Tryptic Soy Broth Agar (TSBA), Corn Meal Agar 60 at 72.5° C). (CMA), Malt Agar (MA), Potato Dextrose Agar (PDA), Difco, Laboratories, Detroit, Mich. Also the fungus was Example 5 inoculated on to Petri plates containing water agar with Amplification of Internal Transcribed Space individual Samples of Small wood shavings of Western white Sequences (ITS) and 5.8S rDNA. pine (Pinus monticola), black walnut (Juglans nigra), and 65 maple (Acer Saccharum) as well as bark pieces of C. The ITS regions of the test fungus was amplified using zeylanicum in order to encourage spore production. PCR and the universal ITS primers ITS5 (5' US 6,911,338 B2 9 10 GGAAGTAAAAGTCGTAACAAGG) and ITS4 (5 Seus (U32411), Pestalosphaeria hansenii (AF242846) Dis TCCTCCGCTTATTGATATGC) (White et al., 1990). PCR coStroma tricellular (AF346546) and Amphisphaeria sp. was performed in a 50 ul reaction containing 0.1 uggenomic (AF346545). The bootstrap analysis was set as the follow DNA, 0.4 uMeach primer, 0.16 mM four dNTPs and 5u Taq ing: 100 replications, tree bisection-reconnection branch polymerase (Promega) in a buffer of 10 mM tris-HCl (pH Swapping, random Sequence addition. All characters were 9.0 at 25°C.), 50 mM KC1, 3 mM MgCl2, and 0.1% Triton weighted equally. X-100. PCR cycling conditions consisted of denaturation at 94 C. for 1.5 min, annealing at 55 C. for 2.5 min, and Example 7 extension at 72 C. for 3 min for 40 cycles, with a final extension at 72° C. for 10 min (Willits, 1999). The PCR Analysis of Antibiotic Volatiles Produced by products were gel purified and desalted using the QuickStep Muscodor albuS PCR purification kit (Edge Biosystems). A method was devised to analyze the gases in the air Space Example 6 above the M. albus mycelium growing in Petri plates. A “Solid Phase Micro Extraction” syringe was used to trap the Searching and Comparison 18S ri)NA and ITS1&2 15 fungal volatiles. The fiber material (Supelco) was 50/30 Sequences divinylbenzene/carburen on polydimethylsiloxane on a Stable flex fiber. The Syringe was placed through a Small hole Muscodor albus drilled in the side of the Petri plate and exposed to the vapor Both 18S ridNA and ITS 1-2 sequences of Muscodor phase for 45 min. The Syringe was then inserted into a gas albus were Submitted to GenBank with serial numbers chromatograph (Hewlett Packard 5890 Series II Plus) AF324337 and AF324336, respectively. These sequences equipped with a mass-selective detector. A 30 mx0.25 mm were also were Searched or compared with other fungal I.D. ZB Wax capillary column with a film thickness of 0.50 sequences under BLAST 2.1. and a search of NCBI at the mm was used for the Separation of the volatiles. The column web site www.ncbi.nlm.nih.gov/BLAST. Comparison and was temperature programmed as follows: 25 C. for 2 min alignment Sequences were done by using ClustalW version 25 followed to 220 C. at 5 C./min. The carrier gas was Helium 1.7 (Thomson, J. and Gibson T., 1997), and manually Ultra High Purity (local distributor) and the initial column aligned afterward. head pressure was 50 kPa. The He pressure was ramped with Maximum parsimony bootstrap method (Felsenstein, the temperature ramp of the oven to maintain a constant 1985) with heuristic search and maximum parsimonious carrier gas flow velocity during the course of the Separation. consensus heuristic search were performed using PAUP Prior to trapping the Volatiles, the fiber was conditioned at (Swofford, 1999). The bootstrap analysis was set as the 240 C. for 20 minutes under a flow of helium gas. A 30 sec. following: 100 replications, tree bisection-reconnection injection time was used to introduce the Sample fiber into the branch Swapping, and random Sequence addition. All char GC. The gas chromatograph was interfaced to a VG 70E-HF acters were weighted equally. Reference taxa were Taphri double focusing magnetic mass spectrometer operating at a nales. Protomyces inouyei (GenBank serial number 35 mass resolution of 1500. The MS was scanned at a rate of D11377), Taphrina wiesneri (D12531), T. deformans 0.50 sec. per mass decade over a mass range of 35-360 amu. (U00971) and T. pruni-Subcordatae (AB000957). Data acquisition and data processing was performed on the Muscodor roseus VG SIOS/OPUS interface and software package. Initial identification of the unknowns produced by M. albus was Both 18S ridNA and ITS1&2 sequences of culture col 40 lection “A3-5’ were Submitted to GenBank with serial made through library comparison using the NIST database. number AY034664 and AY034665, respectively. While the Comparable analyses were conducted on Petri plates 18S r DNA of isolate “A-10" was assigned AYO49023. In containing only PDA and the compounds obtained addition, both 18S rDNA and ITS1&2 sequences of “A3-5” therefrom, mostly Styrene, were Subtracted from the analy also were Searched or compared with other fungal Sequences 45 Ses done on plates containing the fungus. Final identification under BLAST 2.2.1 (Altschulet al., 1997), a search of NCBI of 20/28 compounds was done on a comparative basis to at the web site http://www.ncbi.nlm.nih.gov/BLAST. Com authentic standards using the GC/MS methods described parison and alignment Sequences were done by using herein. However, 8 other compounds composing only CLUSTALW version 1.7 (Thomson and Gibson, 1997), and approximately 20% of the volatiles have only been tenta manually aligned afterward. 50 tively identified on the basis of the NIST data base infor Phylogenetic analysis of the aligned 1708 bp of partial mation and were not included in any of the bioassay tests 18S ridNA sequences was performed using the maximum that employed artificial mixtures of M. albuS compounds. parSimony analysis of the Phylogeny Using ParSimony AS a first approximation, the quantitative analysis of each Analysis (PAUP) program version 4.0b4a (Swofford, compound found in fungal cultures is based on its relative 1999). The number of parsimony-informative characters are 55 peak area obtained after GC-MS analysis. This number was 190, and 1448 characters and are constant. The phylogenetic used to prepare artificial atmospheres of the M. albuS gases analysis was performed on eighteen taxa, including refer in the relative proportions that they occur in culture. ence taxa. The reference taxa were Traphinales: Taphrina wiesneri (GenBank accession number D12531), Taphrina Example 8 deformans (U00971) and Taphrina pruni-Subcordatae 60 (AB000957). The remaining fifteen species were Muscodor Sourcing of Fungal Volatile Compounds albus (AF324337), Muscodor roseus (AYO34664), Xylaria The majority of the compounds produced by M. albus carpophila (Z49785), X. curta (U32417), X. hypoxylon were obtained from Aldrich Chem Co., however, valencene (U20378), X. polymorpha (AB014043), Xylaria sp. was obtained from Fluka Chem Co. and synthetic bulnesene (AB014042), Rosellinia necatrix (AB014044), Poronia 65 was obtained from Dr. Clayton Heathcock of U.C. Berkeley, punctata (AF064052), Daldinia concentrica (U32402), Dept of Chemistry and can be synthesized following the Hypoxylon fragiforme (AB014046) and Hypoxylon atroro procedures of Heathcock and Ratcliffe (1971). US 6,911,338 B2 11 12 The other esters that were not commercially available Monilinia fructicola, Candida albicans and bacteria were were made following Some of the acylation procedures as Set applied as a Spore/cell Suspension, while the other pathogens forth in Hoefle, G. et al., (1978). were applied as a single 3 or 6 mm mycelial plug in each Propanoic acid, 2-methyl,3-methylbutyl ester. Isobutyryl plate. Pathogen growth, measured by colony diameter, was chloride (2 ml 19.1 mmol) was slowly added to a 0 C evaluated after 3 dayS. Reisolation of pathogens, to evaluate solution of isoamyl alcohol (1 ml, 9.5 mmol), their viability, was attempted at the end of the experiments 4-dimethylaminopyridine (583 mg, 4.8 mmol), and pyridine by lifting the agar in the inoculated area and transferring it (0.85 ml, 10.5 mmol) in dichloromethane. A precipitate was to fresh PDA plates. evident 5 minutes after addition was complete. After Stirring The relative ability of the authenticated volatile M. albus 12 h under argon, the reaction was poured into 20 ml of 0.1 compounds to inhibit and kill test organisms is also shown NHCl. The layers were separated and the aqueous layer was in Table 1. Test Solutions were prepared by placing com extracted with 20 ml of methylene chloride. The organic pounds in Vials in the relative proportions that they occurred layers were combined and washed with 10 ml of saturated in the gas phase of M. albuS cultures. The test mixture was aqueous ammonium chloride then 10 ml of Saturated aque placed in a presterilized microcup (4x6 mm) located in the ous Sodium bicarbonate. The organic layers were dried over 15 center of a Petri plate containing PDA. When not in use, the magnesium Sulfate, filtered, and concentrated in vacuo. mixture was stored at 0° C. The test organisms, freshly Purified by distillation through a 14 mm Vigreaux column growing and excised on 3 mm agar blocks (at least 3 agar (bp 60–62 C, 25 mm). The resulting clear, colorless oil was blocks per test fungus), were placed 2-3 cm from the Stirred over Amberlyst 15 to remove any remaining isobu microcup and the plate wrapped with two layers of parafilm. tyryl chloride. "H NMR (250 MHz, CDC1) 409 (t, 2H, J Measurements were made on mycelial growth from the edge 6.7), 2.53 (m, 1H), 1.68 (m, 1H), 1.52 (q, 2H, J 6.5), 1.16 (d, of the agar blocks after a given time period. However, in the 6H, J 7.0), 0.92 (d. 6H, J 6.5). case of bacteria and Candida albicans they were Streaked on Propanoic acid, 2-methyl-ethyl ester. Isobutyryl chloride the test side of the PDA plate and checked for new visible (2 ml 19.1 mmol) was slowly added to a 0C solution of ethyl growth and viability by restreaking from the original area of alcohol (0.55 ml, 9.5 mmol),4-dimethylaminopyridine (583 25 the agar plate that had been inoculated. Appropriate controls mg, 4.8 mmol), and pyridine (0.85ml, 10.5 mmol) in dichlo were also set up in which no test Solution was placed into the romethane. A precipitate was evident 5 minutes after addi microcup. Tests on 3.2-90 ul of the artificial mixture per 50 tion was complete. After Stirring 12 h under argon, the CC of air space above the PDA plate were done on 3 reaction was poured into 20 ml of 0.1 NHCl. The layers replicates in order to obtain ICs data for each test organism. were separated and the aqueous layer was extracted with 20 Individual classes of compounds were also tested in the ml of methylene chloride. The organic layers were combined relative amounts in which they occur at the optimum con and washed with 10 ml of Saturated acqueous ammonium centration of the entire mixture which is 60 ul of test mixture chloride then 10 ml of Saturated acqueous Sodium bicarbon per 50 CC of air space above the culture in a standard Petri ate. The organic layers were dried over magnesium Sulfate, plate. For instance, the esters represent 44% of the mixture filtered, and concentrated in vacuo. Purified by distillation 35 of the identified volatiles and were tested at 26.4 ul/50 CC through a 14 mm Vigreaux column (bp 102 C). H (300 air Space and the same procedure was used for each of the MHz, CDC1) 4.12 (q, 2H, J 7.2), 2.52 (m, 1H), 1.25 (t, 3H, other classes of compounds that were identified. Finally, J 6.9), 1.16 (d. 6H, J 7.2). each individual compound, especially among the esters, was 1-Butanol, 3 methyl, acetate. Under an atmosphere of tested at the concentration or relative percentage in which it argon, acetyl chloride (6.5 ml, 91.8 mmol) was added 40 occurs in 60 ul. Viability of the test microbes was made by dropwise to a 0° C. solution of isoamyl alcohol (5 ml, 45.9 aseptically removing the Small agar block and placing it on mmol), N,N-dimethylpyridine (2.8 g., 23 mmol), and anhy a PDA plate and observing growth after 1-3 days. drous pyridine (4.1 ml, 50.5 mol) in dichloromethane (92 None of the pathogens, except F. Solani and F. Oxysporum ml). The reaction mixture was poured into 100 ml of 0.1 N lycopersici, grew in the presence of M. albus (Table 1) and HCl, and the resulting layers were separated. The organic 45 their growth was inhibited. Both of these pathogens survived layer was washed with 50 ml of Saturated acqueous ammo in the presence of M. albus, when transferred to fresh plates nium chloride then dried over magnesium Sulfate. The three days later. Also the volatiles of M. albus did not kill M. organic layer was filtered and concentrated in vacuo to a albuS itself or its close relative Xylaria sp., although they did clear oil. The resulting oil was purified by distillation (bp inhibit the growth of Xylaria sp. (Table 1). 134–136° C) to give isoamyl acetate. "H NMR (300 MHz, 50 CDC1) 4.08 (t, 2H, J 6.9), 2.03 (s, 3H), 1.68 (m, 1H), 1.51 Example 10 (q, 2H, J 6.9), 0.92 (d. 6H, J 6.6). Testing of Classes of Volatile Compounds and Individual Volatile Components in in vitro Assays Example 9 55 Individual classes of compounds in the natural volatiles of M. albus were evaluated in order to determine the relative Inhibition of Fungal and Human Pathogens by biological activity of each. Each class of compounds, in the Volatiles in in Vitro Petri Plate Assays relative proportions that they occur, was tested at the level A strip of agar was removed from the middle of PDA of the percentages that they occur in the total 60 ul/50 CC plates, creating two approximately equal and Separate Sec 60 (1.2 ul/CC) (Table 5). This was done with a selected group tions where microorganisms could grow, as described by of 7 test fungi. Each group of compounds possessed Some Strobel et al., 2001. One agar plug of M. albus culture was inhibitory activity against the test organisms (Table 5). placed on one Section and grown for 10 days with the plates However, on a comparative basis the esters had more enclosed in a plastic bag. After ten days, the other Section inhibitory activity than any other group of compounds was inoculated with various fungal pathogens, with Sec 65 (Table 5). tioned plates without M. albus serving as control. There Each compound in the class of esters was individually were three plates for each treatment. Penicillium expansum, evaluated. When a comparable test on each ester was US 6,911,338 B2 13 14 conducted as per the conditions in Table 5, 1-butanol, left uncovered. The bags were removed after 3 days. Results 3-methyl, acetate, almost completely mimicked the results show that liquid culture applied at the higher rate (200 ml/L of all esters as in Table 5. It represented 62% of all of the of Vermiculite) was as effective in preventing damping off as identified combined esters and was therefore tested at the solid Muscodor cultures on PDA (Table 2). The effect of level of 0.32 ul/CC. Additionally, minimal inhibitory bio 5 Muscodor application appears to be immediate, as normal activity was displayed by propionic acid, 2-methyl, emergence rates were obtained with these treatments, even 3-methylbutyl ester and little or no activity was noted on the though there was no incubation period before planting. The part of the other esters. Although the esters, and the low rate of liquid culture caused Some reduction in damping 1-butanol, 3 methyl-acetate had inhibitory activity in the off, but was not as effective. Sealing the volatiles in the pot bioassay tests, under no conditions in any test, was death of with a plastic bag did not improve efficacy (Table 2). any test fungus observed under the Standard 3 day exposure period (Table 5). This is a significant observation, Since the Example 12 death of test organisms was noted in both the complete artificial atmosphere and in the natural Petri plate atmo Activity of Muscodor albus as a Postharvest Sphere of M. albuS. The result Strongly Suggests that an 15 Treatment of Infested Fruit additive or Synergistic mechanism is operational in the case Single wounds were made with a nail on the equator of of the M. albus volatiles. Thus, while each class of com apples, cv Gala, which were placed in plastic plates, pounds possesses more or less inhibitory activity, a complete wounded Side up, in 3.8 L plastic boxes. Nine apples were mixture of the ingredients is needed to bring about death of placed in each box and there were three boxes per treatment. the test fungi and bacterium (Table 1). The fruits were inoculated with blue mold, Penicillium Based on the fact that the volatiles of M. albus can inhibit expansum by pipetting 20 ul of conidial suspension (10"/ml) and kill E. coli (Table 1) experiments were done using M. into each wound either 24 hours before (pre-inoculation) or albuS to determine if its gases can inhibit and kill the immediately before the experiment. For the Muscodor fumi microflora found in human and animal wastes Such as E. coli gation treatment, 140 grams of colonized rye grain were and other fecal microbes. These microbes commonly are the 25 placed in the containers which were then Sealed. The control cause of dysentery and other diseases during times of major contained only inoculated fruits in Sealed boxes. They were crises including natural disasters, and wars. Conceivably, M. incubated at room temperature (19-22 C.). Disease was albuS could be developed and used for field applications to evaluated as the percentage of infected fruits after 7, 14 and decontaminate human and animal wastes. Thus, according to 21 days (Table 3). The treatment that was pre-inoculated our experiments, a two week old colony of M. albuS growing showed no infection of the apples while a very low infection on a half Side of a Petri plate containing PDA was prepared. rate was seen of only 7% at the 21 day rating for fruit Then on the separated other half plate was streaked (using inoculated immediately before exposing the fruit to Mus Standard microbiological methods) Solid human waste. A codor. control plate was Set up in which no colony of M. albuS was present. After two days, of incubation at 23 C., there were 35 Example 13 Significantly more bacterial and fungal colonies growing in the control plate than the plate with M. albuS. In a compa Activity of Muscodor albuS Against Insects and rable experiment, M. albuS was incubated Solely in liquid Nematodes human waste (urine) and total bacterial growth was pre Nematode (Caenorhabditis elegans) cluded as contrasted to a control (without the M. albus) in 40 Plates using the moat system (Worapong et al., 2001) which bacterial growth flourished. were inoculated on one side with M. albus, and on the Example 11 opposite Side with E. coli, or free-living nematodes with E. coli. Identical plates were set up without the Muscodor. Activity of Muscodor albus Against the Soil After five-days the plate without the Muscodor had devel Pathogen Rhizoctonia Solani in vivo 45 oped a large reproducing population of nematodes which For these experiments, the growing medium is first crossed the moat and were beginning to populate the oppo infested with R. Solani by adding one culture on a PDA plate site side of the petri dish. The E. coli had grown to normal to 1L of growing medium (vermiculite). This rate allows colony morphology on the companion plate. The Muscodor near 100% seedling mortality with low variability among 50 treated plate had developed a Substantial colony that was pots. Muscodor albus in various forms is then added to the Sending mycelia acroSS the Surface of the PDA. The nema growing medium, which is then placed in 3 inch plastic pots. todes that were present were sluggish, yet motile. By Seven The pots are planted with approximately 70 seeds of days, the Muscodor reached the edge of the PDA and was broccoli, placed in a tray and watered from the bottom. The Sending mycelia into the moat of the plate with E. coli, and Seedlings are counted after approximately one week. Con 55 the plate with the round worms. Only a small number of trols consist of R. Solani only, Muscodor albus only and living adult nematodes were present on the agar, and their plain growing medium. Depending on the experiment, there mobility was limited. are 3 or 4 pots per treatment, arranged in a completely Beet Armyworm (Spodoptera exigua) randomized design. Three Small plastic beakers containing approximately 150 A 10 day-old liquid culture of PDB was homogenized for 60 grams of autoclaved rye Seed colonized with M. albuS were a few Seconds in a blender and incorporated at a rate of 50 placed in a plastic box (approximately 250 in). A compan or 200 ml per L of vermiculite. The solid agar culture ion box was set up at room temperature with out the three treatment was done as described above, with 2 plates of 2 beakers of fungus. Both boxes contained a petri plate of week-old culture per L. The pots were Sown immediately PDA with a small plug of Rhizoctonia Solani in the center, after filling. The effect of sealing the volatiles in the pots was 65 as a bioassay indicator. 96-well microtitre plates containing also investigated: for each treatment, a plastic bag was beet armyworm eggs that had been overlaid onto artificial sealed over 3 pots with a rubber band while 3 other pots were diet were introduced into each box. After two days, the eggs US 6,911,338 B2 15 16 in the box without the Muscodor began to hatch, and the R. producing endophytes were isolated. These organisms were Solani developed new mycelia. The armyworm eggs did not obtained from two Separate tree Species native to Australia. hatch in the box containing the rye culture of M. albus. These two fungal cultures bore similarities to M. albus in Moreover, the growth of R. Solani was suppressed. After 5 that they made no fruiting Structures in culture, produced no days, the armyworms in the untreated box had achieved Spores, had a musty odor and were inhibitory or lethal to Second to third instar. many microorganisms. However, by the same token, these organisms possessed cultural, chemical, and molecular bio Paired microtitre plates were introduced into the boxes logical characteristics that differed from M. albus. with armyworms larvae that had been grown for three days It has been well demonstrated that the molecular charac on artificial diet. The plate in the Muscodor box ceased teristics of an organism are unique to it and it can be used feeding and remained Stunted compared to the untreated to help in classification especially when critical Structures controls. After five days, the armyworms in the treated plate (spore production) or other features are missing. Thus, the were dead. phylogenetic character mapping method combined with Corn Rootworm Beetles, Diabrotica undecimpunctata morphological data can assist in fungal identification. Paired microtitre plates were introduced into the boxes 15 Commonly, the rDNA genes are targeted for taxonomic with corn rootworm eggs that had been overlaid onto purposes because they are highly conserved (Bruns et al., artificial diet. The eggs had just begun to hatch when the 1991; Guarro et al., 1999 and Mitchell et al., 1995). In plates were introduced into the test boxes. Approximately addition to its 18S ri)NA, the ITS1&2 sequences are also half of the eggs hatched in the Muscodor box. The remainder conserved. After Searching partial 18S ridNA sequences of did not hatch, and all of the neonates were dead within two M. roseus “A3-5” (2055 bp) with data in GenBank under days. The microtitre plate in the untreated control box BLASTN 2.2.1, the results showed 100% similarities with developed a normal infestation that progressed with 3-6 2089 bp of Muscodor albus (AF324337) from site 1-981, third-instar grubs per well, after one-week. 1319–2048, and 98% similarities with 982 bp of Xylaria Example 14 polymorpha (AB014043) and Hypoxylon fragiforme 25 (AB014046), and 97% similarities with 982 bp of Rosellinia Treatment of Smut Infested Barley Seeds with necatrix (AB014044). In addition, isolate “A-10" possesses Muscodor albuS 99% sequence similarity of its 18Sr DNA (2051 bp) to that of isolate “A3-5. In controlled, replicated experiments, 25 barley Seeds On the other hand, comparative analysis of the ITS 1&2 infested with Ustilago hordei (covered Smut, Table 6) were and 5.8S rDNA sequences of M. roseus “A3-5” hit ITS 1&2 placed in each of two agar plates with the gases of M. albuS of Muscodor albus (AF324337), X. arbuscula CBS 452.63 for four days and then planted in test pots in the greenhouse. (AF163029) and CBS 454.63 (AF163028), X. enteroleuca After 15 weeks the plants were harvested and evaluated for CBS 148. (AF163033), X. longipes CBS 148.73 Smut in the seed heads. There was 100% control of this (AF163038), X. mali CBS 385.35 (AF163040), X. cornu disease in two groups of plants that had been exposed to M. 35 damae CBS 724.69 (AF163031), at 99,91, 91, 91, 90 and albuS gases and no sign of any inhibition or damage to the 89% similarities, respectively. No total identities of either plants caused by the gas treatment. An identical number of partial 18S ridNA or ITS 1&2 and 5.8S rDNA sequences control plants (untreated and U. hordei infested seed) had were found. 50% and 41%, respectively of infected seed heads in this Phylogenetic analysis based on 18S Sequences showed experiment. Also, as expected, uninfected Seed yielded 40 that M. roseuS is a Sister group to Muscodor albuS plants having no diseased grains. (AF324337) with robust bootstrap confidence measured Results and Discussion 100% from 100 replications. In addition, maximum parsi mony analysis shows that both M. albus and M. roseus are Muscodor albus, gen. et sp. nov., is a deuteromycetous more closely related to the Xylariaceae e.g. Xylaria spp., (mycelial Sterilia) endophytic species bearing molecular 45 Rosellinia necatrix (AB014044) and Poronia punctata relatedness to the ascomyceteous group-Xylaria. The fungus (AF064052) than to three representative genera of Amph is related to Xylariaceae by virtue of 96–98% homology of ishaeriaceae. Pestalosphaeria hansenii (AF242846), Dis its 18S rDNA (2089 bp) to representative members of this coStroma tricellular (AF346546) and Amphisphaeria sp. group. Furthermore, ITS1, 5.8S, and ITS2 sequences (652 (AF346545) with bootstrap confidence measured at 68% bp) of M. albus showed close relatedness to several Xylaria 50 from 100 replications (Felsenstein, 1985). This result was spp. including X. arbuscula, X. longipes, and X. mali at the also Supported by a Strict consensus heuristic Search phylo 89-92% level. Both the 18S r)NA and the ITS 1&2 5.8 S genic tree of 30 equally most parsimonious 18s r)NA rDNA are unique, and therefore, MuSCOdor is considered a cladograms. Therefore, M. roseuS should be placed in the taxonomically distinct genus and species. (Worapong et al., family Xylariaceae, Xylariales. Moreover, the results of the 2001) 55 comparison both the 18S rDNA and the ITS 1&2 and 5.8S The volatiles of M. albus were also tested against plants rDNA of M. roseus “A3-5” possess high similarities to M. inoculated with pathogenic fungi. The Volatiles themselves albus (Worapong et al., 2001). Also, the molecular biologi had no detrimental effects on higher plants that were tested. cal data (18Sr DNA) suggests that bothisolates “A3-5” and However, it was possible to demonstrate a 100% control of “A-10' of M. roseus should be considered closely related, covered Smut of barley using the Volatiles to treat Seed 60 and virtually identical organisms. Furthermore, the molecu inoculated with Ustilago hordei. Thus, because of the poten lar biological data provides Some Support of the concept for tial practical importance of volatile antibiotic producing the division of M. albus, previously described, from this fungi it was deemed important to determine if other organ proposed new fungal Species-M. roseuS. isms in this group exist in nature. While the molecular biology of M. roseus shows that this Using Standard techniques for the isolation of endophytic 65 organism has the best fit into the group-Xylariaceae, it also fungi, as well as the use of the Volatiles of M. albuS as a demonstrates close 18Sr DNA relatedness to M. albus. Selection tool in culture, at least two more Volatile antibiotic However, because there is Such relatedness at the limited US 6,911,338 B2 17 18 r-DNA molecular level, it may be argued that the two fungi 3. Bjurman J. and Kristensson, J. (1992) Mycopathologia are identical. Nevertheless, other chemical characters in both 118: 173. M. albus and M. roseus were examined and discovered to be 4. Bruns, T. D., et al. (1991). Annu. Rev. Ecol. Syst. 22: different. Thus, while both M. albus and M. roseus shared 525-564. the biochemical ability of producing a musty Smelling odor, which has been demonstrated to have powerful antibiotic 5. Dennis, C. & Webster, J. (1971) Trans. Br. Mycol. Soc. properties, many of the Volatiles produced by these two 57: 41-48 organisms were identical as measured by GC/MS. It has 6. Felsenstein, J. (1985). Evolution 39: 783–791. been often noted that fungi do produce a variety of odorous 7. Guarro, J., et al. (1999). Clinical Microbiology Reviews, Substances, but the impressive antibiotic properties of Mus 12: 454-500. codor spp. Seems to be unique (Burman et al., 1992; Rapoir 8. Hawksworth, D.C. and Rossman, A.Y. (1987) Phytopath. et al., 2000 and Schnurer et al., 1999). However, the 87: 888. Volatiles of these two fungi also contained different com 9. Heathcock, R. and Ratcliffe, R. (1971). J. Am. Chem. Soc. pounds (Strobel et al., 2001). As an example, M. albus 93: 1746. produced 2-monanone, caryophyllene, and acetic acid 2-phenylethyl ester, while these compounds were not 15 10. Hoefle, G. et al., (1978) Vorbrueggen, Agnew. Chem., detected in either isolate of M. roseus. On the other hand, Int. Ed. Engl. 17:569. bothisolates of M. roseus made compounds not detected in 11. Lee, S. B. and Taylor, J. W. (1990). In PCR Protocols. A M. albuS Volatiles, Such as 2-butenoic acid, ethyl ester; 1,2,4, Guide to Methods and Applications. Edited by Innis, M. trimethylbenzene and 2.3 nonadiene. This result lends some A., Gelfand, D. H., Sninsky J. J., White, T. J. Academic chemical Support to the assignment given in this report Press, Inc., California: pp. 282-287. Suggesting that M. albuS is taxonomically distinct from M. 12. Li, J. Y. et al., (2000), Org. Lett. 2: 767. OS8iS. 13. Li, J. Y. et al., (2001), Phytochem. 56: 463. Other, more classical features of M. roseus (isolates 14. Mitchell, J. I., et al. (1995). Mycologist 9: 67–75. “A3-5” and “A-10) were also examined and compared to 15. Nelson, P. V.(1998) Greenhouse Operation and Manage M. albus. These isolates of M. roseus produced a slow 25 ment 5' ed. Prentice-Hall. growing, dense, lightly rose colored mycelium on all media tested. This contrasts to M. albus that produces a whitish 16. Rapior, S., et al. (1995). Mycologia 92: 305-308. mycelium on all comparable media tested (Worapong et al., 17. Rapior, S. (2000), Mycologia 92: 305. 2001). No spores formed on any medium including ones 18. Schnurer, J., et al. (1999). Fungal Genetics and Biology containing the host plant material or carnation leaves. 27: 209-217. Hyphae varied in diameter (0.8-3.6 um) and were often 19. Schnurer, J. et al., (1999), Fungal Genetics and Biology intertwined to make more complex structures and even 27: 209. hyphal coils. These hyphae were generally bigger than those 20. Stierle, A. et al., (1993), Science 260: 214. of M. albus. The mycelia of M. roseus generally make more 21. Strobel, G. A. et al., (2001), Microbiol. 147: 2943-2950. complex interwined Structures in culture than M. albuS. In 35 22. Strobel, G. A., et al. (1996). Microbiology 142:435-440. fact, the appearance of hyphal coils of fungi in culture is not 23. Strobel, G. A., et al. (2000). Mycotaxon. 76: 257–266. common, in our experience, and yet these structures often 24. Swofford, D. L. (1999). Phylogenetic Analysis. Using appeared in M. roseuS cultures. parsimony (* and Other Methods). Version 4.0d64. Finally it is to be noted that for M. roseus, the best storage condition was after drying on filter paper and placement at Sunderland, Mass.: Sinauer ASSociates. -70° C. Under these conditions the fungus remains vailable 40 25. Thomson, J. and Gibson T. (1997). Clustal V. Multiple for over 1.5 years. Also, this fungus could be stored at 4 C. Sequence Alignments. In: Documentation (Installation in Sterile water but with less certainty of recovering a viable and Usage) European Molecular Biology Laboratory organism after 6 months. Also, Storage in 15% glycerol at Postfach Germany: 1-37. -70° C. effectively preserved the viability of the organism. 26. White, T. J., et al. (1990). Amplification and direct The preceding discussion and examples are intended 45 Sequencing of fungal ribosomal RNA genes for phyloge merely to illustrate the art. AS is apparent to one of skill in netics. In PCR Protocols: A guide to Methods and Appli the art, various modifications can be made to the above cations. Edited by Innis, M. A., Gelfand, D. H., Sninsky without departing from the Spirit and Scope of this invention. J. J., White, T. J. Academic Press, Inc., California: References 315-324. 1. Altschul, S. F., et al. (1997). Nucleic Acids Res. 25: 50 27. Willits, D. A. and Sherwood, J. E. (1999). Phytopath. 89: 3389-34O2 212-217. 2. Bacon C. W. and White JR. J. F. Microbial Endophytes. 28. Worapong, J. et al. (2001). Mycotaxon. 79: 67-69. Marcel Dekker Inc., New York. . 29. Yang, X. et al., (1994), Plant Science 102:1.

TABLE 1. The effects of the volatile compounds of M. albus and an artificial mixture of M. albus compounds On a group of test microbes. % Growth Viability % Growth over ICso (mm) after 3 days control after a Viability after in artificial over control exposure 2 day exposure 3 days exposure to atmosphere for in artificial artificial Test Microbe to M. albus M. albus culture 2 days (ul/CC) atmosphere atmosphere Pythium ultimum O Dead O48 O.O1 O Dead Phytophthora cinnamoni O Dead O.29 OO6 O Dead US 6,911,338 B2 19 20

TABLE 1-continued The effects of the volatile compounds of M. albus and an artificial mixture of M. albus compounds On a group of test microbes. % Growth Viability % Growth over ICso (mm) after 3 days control after a Viability after in artificial over control exposure 2 day exposure 3 days exposure to atmosphere for in artificial artificial Test Microbe to M. albus M. albus culture 2 days (ul/CC) atmosphere atmosphere Penicillium expansun Dead # # # Rhizoctonia Soiani Dead O.08 O.O2 O Dead Ustilago hordei Dead O31 - 0.09 O Dead Stagnospora nodorun Dead 0.15 - O O Dead Sclerotinia Sclerotiorum Dead O.17 O.OS O Alive Scerotinia minor Dead # # # Aspergilius finigatius 0.41 - 0.05 O ive Monilinia fructicola # # # Fusarium Solani 19.4 O.284 113 O.O7 42.O 2 ive Fusarium oxysporun 4 # # # Verticilium dahliae O O.3 - O O ead Cercospora beticola 17.5 - 3.5 0.12 + 0.15 8 - 2 ive Tapesia yallundae O O64 - O O ead Xylaria sp. 25 - O O41 O.O3 O ive Muscodor albus 100 - O O.6 O 17.5 - 7.5 ive Escherichia coli # O ead Staphiococcus aureus # O ead Micrococcus luteus # O ead Candida albicans # Trace ive Bacilius.Subtilius # O ive Legend: *The amount of each positively identified compound used in the artificial mixture was obtained by applying the electron ionization cross section (% of the total area) of the compound obtained in the GC/MS analysis. The artificial mixtures were subsequently tested by placing them in a pre-sterilized microcup (4 x 6 mm) located in the center of a test Petri plate containing PDA. Agar plugs containing freshly growing test microbes (or streaked microbes) were positioned about 2-3 cm from the center microcup. Then the plate was wrapped with 2 layers of parafilm and incubated for two or more days at 23° C. Measurements of linear mycelial growth were made from the edge of the inoculum agar plug to the edge of the mycelial colony. # Not measured in this experimental design.

TABLE 2 TABLE 3-continued Average number of broccoli seedlings per pot one week after 40 Percent of applies infected with blue mold (Penicillium expansum) after planting (means + standard deviation) using vermiculite. 7, 14 and 21 days, comparing pre-inoculation with blue mold to inoculation immediately before exposure to Muscodor. Untreated controls Muscodor treatment Non-infested Rhizoctonia-infested were not exposed to Muscodor. Treatments 7 days 14 days 21 days Unsealed pots 45 24 hour pre-inoc Check 65 - 1 1 - 1 o Liquid: 50 ml/L 64 11 39 - 11 Untreated Control 1OO 1OO 1OO Liquid: 200 ml/L 618 63 - 15 Muscodor O O O PDA culture 625 68 - 1 Sealed pots 50 a: standard deviations are high due to small number of fruits.

Check 65 - 1 1 - 1 Liquid: 50 ml/L 59 3 31 19 TABLE 4 Liquid: 200 ml/L 57 2 66 11 PDA culture 62 6 62 - 10 SCMS analysis of the volatile compounds produced by M. albus. 55 Total Area RT (%) M/Z Possible compound MW TABLE 3 3:45 0.33 114 Octane 114 Percent of applies infected with blue mold (Penicillium expansum) after 4:19 O.93 58 Acetone 58 7, 14 and 21 days, comparing pre-inoculation with blue mold to 4:37 0.68 74 Methyl acetate 74 inoculation immediately before exposure to Muscodor. Untreated controls 5:56 7.63 88 Ethyl acetate 88 were not exposed to Muscodor. 6:51 0.31 102 Propanoic acid, 2-methyl, methyl ester 102 7:16 6.24 * Ethanol 46 Treatments 7 days 14 days 21 days 8:03 2.07 116 Propanoic acid, 2-methy-methyl ester 116 11:45 0.58 * Propanoic acid, 2-methyl 2-methylpropyl 144 Untreated Control 1OO 1OO 1OO 65 ester Muscodor O O 7 - 13 12:05 2.06 74 Isobutyl alcohol 74 US 6,911,338 B2 21 22

TABLE 4-continued TABLE 4-continued

GC/MS analysis of the volatile compounds produced by M. albus. GC/MS analysis of the volatile compounds produced by M. albus.

Total Total Area RT (%) M?z Possible compound MW RT Possible compound MW 1O 27:55 O34 204 # Naphthalene, 1,2,4a,5,6,8a-hexahydro-4,7- 204 12:50 22.24 * 1-butanol, 3-methyl, acetate 130 dimethyl-1-(1-methylethyl)-, 1R-(1-alpha., 14:57 1.53 * Propanoic acid, 2-methyl, 3-methylbutyl 158 4a.alpha., 8a.alpha.) ester 28:34 O36 204 # Spiro5.5undec-2-ene, 3,7,7-trimethyl-11 204 15:28 22.99 * 1-butanol, 3-methyl- 88 15 methylene 16:08 O.29 138 # Furan, 2-pentyl- 138 28:50 1.07 204 Azulene, 1,2,3,5,6,7,8,8a-octahydro-1,4- 204 18:53 O.29 142 # 4-nonanone 142 dimethyl-7-(1-methylethyenyl)-, 1S 20:38 O.41 142 2-nonanone 142 (1.alpha., 7.alpha., 8a.beta.) Common 21:07 O.30 204 # Naphthalene, decahydro-4a-methyl-1- 204 20 Name: Bulnesene methylene-7-(1-methylethylidene)-, (4aR- 28:57 3.24 204 Naphthalene, 1,2,3,5,6,7,8,8a-octahydro 204 trans)- 1,8a-dimethyl-7-(1-methylethenyl)-, 1R 22:54 1.51 204 # Azulene, 1,2,3,4,5,6,7,8-Octahydro-1,4- 204 (1.alpha., 7.beta., 8a.alpha.) Common dimethyl-7-(1-methylethenyl)-, 1S- 25 Name: Valenceme (1.alpha., 4.alpha., 7.alpha.) 31:12 1.74 : Acetic acid, 2-phenylethyl ester 164 1.06 122 122 23:16 O.94 204 # Cyclohexene, 4-(1,5-dimethyl-1,4- 204 33:17 Phenylethyl alcohol hexadienyl)-1-methyl- 39:OO 9.76 204 Unknown 204 25:20 3.63 204 # 1H-3a7-methanoaZulene, 2,3,4,7,8,8a- 204 3O * No molecular-ion peak was observed in the spectrum of either the stan hexahydro-3,6,8.8 tetramethyl-, 3R dard compound or the compound undergoing the analysis. (3.alpha., 3a.beta., 7.beta., 8a.alpha.) # Denotes that a spectrum and retention time of this component was 25:30 6.08 88 Propanoic acid, 2-methyl 88 observed and the substance matched to the most likely compound in the NIST data base, but the data have not been confirmed by use of an appro 26:04 O.48 204 Caryophyllene 204 priate identical standard compound by either retention time or MS. These 35 compounds were not placed in the artifical mixture in the bioassay test.

TABLE 5 The inhibitory influence of each class of volatile compounds is expressed as the % of the test microbe growth as compared to a control not in the presence of the test compounds. Alcohols Esters Ketones Acids Lipids 0.48 ulfcc 0.53 ul/cc 0.02 ulfcc 0.09 ul/cc 0.08 ulfcc % growth % growth % growth % growth % growth Test Microbe # of control of control of control of control of control Pythium ultimum 11.2 + 4 O 67.5 - 7 40.93 75 - O Rhizoctonia Soiani 55 - 5 O 67.5 - 7.5 67.5 - 7.5 40 - O Tapesia yallundae 35 - 15 O 7S 25 1OOO 100 - O Xylaria sp. 75 - 25 O 100 - O 1OOO 100 - O Sclerotinia Sclerotiorum 29 3 8.1 + 1.5 20.6 - 12 40 O 78 - 2 Cercospora beticola 588 5 - 5 100 - O 83 - 17 100 - O Fusarium Solani 7O 10 55 - 5 90 - 10 80 20 80 - 10 *All measurements of mycelial growth compared to the untreated control were made as described in Table 1 # None of the microbes were killed after a three day exposure to any of the artificial test mix tures given on this table. US 6,911,338 B2 23 24

TABLE 6

Number of Barley Seeds Heads Infected within Ustilago hordei with and without Muscodor albuS Pre-treatment.

Ratio of Diseased to Healthy Plants

Treatment Expt 1 Expt 2 1O No treatment 16/32 13/31 M. albus volatiles O/33 Of 42 Uninfested control Of 41 O/39

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS: 4 <210> SEQ ID NO 1 &2 11s LENGTH 2089 &212> TYPE DNA <213> ORGANISM: Muscodor albus

<400 SEQUENCE: 1 cc.ggttgatc citgc.cagtag toatatgctt gtotcaaaga ttaa.gc.catg catgtctaag 60 tataag caat tatacagoga aactg.cgaat ggcto attaa atcagittatc gtttatttga 120 tagtacctta citacttgg at aac cqtggta attctagagc taatacatgc taaaaatcc.c 18O gacticacgga gggatgtatt tattagatta aaaac caatg cc cctogggg citttctggtg 240 attcaitaata actitcacgaa togcatggcc ttgcgc.cggc gatggttcat toaaattitct gcccitatcaa cittitcgatgg cagggtottg gcc toccatg gttacaacgg gtaacggagg 360 gttagg gcto gacCCCggag aaggagcCtg agaaacggct actacatcca aggalagg Cag 420

Caggcgc.gca aattacccala toccgacacg gggaggtagt gacaataaat actgatacag 480 ggctcittittg ggtottgtaa ttggaatgag tacaatittaa. atc.ccittaac gaggaacaat 540 tggagggcaa. gtotggtgcc agCagcc.gc.g gtaattic cag citccaatago gtatattaaa 600 gttgttgcag ttaaaaagct cgtagttgaa ccittggg cct tdcgcctcac 660 cgc.gtgcact ggcctittccc totggggagc cccatgccitt to attaggtg 720 tggtggggaa ccaggactitt tactgttgaaa aaattagagt gttcaaag.ca ggccitatgct c gaata catc agcatggaat aatagaatag gacgtgtggit totattttgt tggtttctag 840 gaccgc.cgta atgattaata gggacagtcg ggggtgtcag tattoaattg to a gaggtoga 9 OO aattcttgga tittattgaag actalactact gc gaaag cat to accaagga tgttittcatt 96.O aatcaggaac gaaagttagg ggatcgalaga cgatcagata cc.gtogtagt cittalaccata 1020 aactatoccg actagg gatc atttitttgac cc.gctcggca ccttacgaga 1080 aatcaaagtc tittgg gttct ggggggagta tggtogcaag gctgaaactt aaagaaattg 1140 acggaagggC accaccagga gttalaccago gttacattcg togcactctg citccaaaaag 1200 taggcc tota gaaggctcgg tggcttgctg atalactacta gtotcctgta atggaggcga 1260 cacccittaala gtgcggggac atcctgttaa aagtotagac gcc.ggacctg gctcqgaaac 1320 gagtcCaggg cgc.ca.gatta accatctggg ttggctaata agtgctagac ttgggacitat 1380

US 6,911,338 B2 29 30

-continued togc citctgt agtggttc.cg gcc cc toccg taaaaccocc tatat caaag gttgaccitcg 600 gatcaggtag gaataccc.gc tigaacttaag catat caata agcc.ggagga 650

What is claimed is: 6. The composition of claim 4, further comprising at least 1. A biologically pure culture of a Strain of MuSCOdor. one chemical or biological pesticide. 2. A biologically pure culture of a Strain of Muscodor 7. The biologically pure culture of claim 2 wherein the albus. Strain is NRRL 30547. 3. A biologically pure culture of a strain of Muscodor 8. The biologically pure culture of claim 3 wherein the OS8iS. Strain is NRRL 30548. 4. A composition comprising the biologically pure culture of any one of claims 1-3 and a carrier. 15 5. The composition of claim 4, wherein the carrier is an agriculturally acceptable carrier.