Rapid Colorimetric Detection of Genome Evolution in Scrambled Synthetic Saccharomyces Cerevisiae Strains

microorganisms

Article Rapid Colorimetric Detection of Genome Evolution in SCRaMbLEd Synthetic Saccharomyces cerevisiae Strains

1, 1,2, , 3 1,2 Elizabeth L. I. Wightman † , Heinrich Kroukamp * †, Isak S. Pretorius , Ian T. Paulsen and Helena K. M. Nevalainen 1,2 1 Centre of Excellence in Synthetic Biology, Department of Molecular Sciences, Macquarie University, Sydney, NSW 2109, Australia; [email protected] (E.L.I.W.); [email protected] (I.T.P.); [email protected] (H.K.M.N.) 2 Biomolecular Discovery and Design Research Centre, Macquarie University, Sydney, NSW 2109, Australia 3 Chancellery, Macquarie University, Sydney, NSW 2109, Australia; [email protected] * Correspondence: [email protected]; Tel.: +61-2-9850-8129 Contributed equally. † Received: 5 November 2020; Accepted: 30 November 2020; Published: 1 December 2020

Abstract: Genome-scale engineering and custom synthetic genomes are reshaping the next generation of industrial yeast strains. The Cre-recombinase-mediated chromosomal rearrangement mechanism of designer synthetic Saccharomyces cerevisiae chromosomes, known as SCRaMbLE, is a powerful tool which allows rapid genome evolution upon command. This system is able to generate millions of novel genomes with potential valuable phenotypes, but the excessive loss of essential genes often results in poor growth or even the death of cells with useful phenotypes. In this study we expanded the versatility of SCRaMbLE to industrial strains, and evaluated different control measures to optimize genomic rearrangement, whilst limiting cell death. To achieve this, we have developed RED (rapid evolution detection), a simple colorimetric plate-assay procedure to rapidly quantify the degree of genomic rearrangements within a post-SCRaMbLE yeast population. RED-enabled semi-synthetic strains were mated with the haploid progeny of industrial yeast strains to produce stress-tolerant heterozygous diploid strains. Analysis of these heterozygous strains with the RED-assay, genome sequencing and custom bioinformatics scripts demonstrated a correlation between RED-assay frequencies and physical genomic rearrangements. Here we show that RED is a fast and effective method to evaluate the optimal SCRaMbLE induction times of different Cre-recombinase expression systems for the development of industrial strains.

Keywords: Saccharomyces cerevisiae; SCRaMbLE; genome evolution; industrial yeast strains

1. Introduction Specialized strains of the yeast Saccharomyces cerevisiae are harnessed by industry for the production of food and beverages, pharmaceuticals, chemical building blocks and fuel. While past strategies such as ALE (adaptive laboratory evolution), random mutagenesis and rational design approaches have produced a myriad of improved strains, the field of genetic engineering now benefits from whole-genome reengineering approaches and the synthesis of custom designer genomes [1]. SCRaMbLE (synthetic chromosome rearrangement and modification by LoxPSym-mediated evolution) is a genome rearrangement system developed for use in the Saccharomyces cerevisiae 2.0 (Sc2.0) synthetic genome, facilitating large-scale genomic rearrangements [2]. The system allows gene deletions, insertions, inversion and translocations genome-wide to generate large libraries of unique strains that can be screened for desired phenotypes.

Microorganisms 2020, 8, 1914; doi:10.3390/microorganisms8121914 www.mdpi.com/journal/microorganisms Microorganisms 2020, 8, 1914 2 of 18

Valuable industrial characteristics, such as inhibitor tolerance and high protein secretion, often have complex and/or unknown genetic determinants [3–5]. Utilizing the genome-scale randomization of SCRaMbLE, improvements of complex phenotypes have already been accomplished [6–9]. An example of the capability for genome rearrangement was the rapid generation of semi-synthetic heterozygous diploid strains containing a single copy of the synthetic chromosomes synV and synX, with significantly improved thermotolerance at 42 ◦C after a single round of SCRaMbLE [9], whereas a similar increase in thermotolerance using ALE took over 300 generations [10]. SCRaMbLE was also used to optimize the biosynthetic pathway for improved violacein yields, demonstrating that this strategy could potentially be applied to optimize the production of any metabolite [7]. These SCRaMbLEd strains contained only one synthetic chromosome in a haploid genome context; therefore, it is conceivable that strains harboring more synthetic DNA, with more loxP recombinase recognition sites, could produce greater genomic diversity with associated novel phenotypes of interest. Thus far, SCRaMbLE has also been explored for a variety of fundamental and applied applications, including genome minimization [2], biosynthetic pathway assembly [8,11] and for the optimization of hydrolytic enzyme ratios for biofuel applications [12]. SCRaMbLE has been successfully employed to develop yeast strains with novel phenotypes; however, this is accompanied by the rapid loss of essential genes, especially in haploid cell populations. This often leads to retarded cell growth and high lethality rates, characteristics frequently used to estimate the degree of SCRaMbLE that has occurred in haploid cells [2,13]. In addition to the loss of cell viability, other non-lethal deleterious effects could mask the effects of desirable phenotypes generated through genomic rearrangement, while growth-impaired mutant cells are vulnerable to being outcompeted by healthier, less-SCRaMbLEd cells. It is thus imperative to maintain a balance between the degree of genomic rearrangement and cell viability so as to maximize the discovery of useful phenotypes. Considering that industrial strains are generally diploid and that the 2n gene copy-number could serve as a viability buffer in the event of essential gene loss, SCRaMbLE holds tremendous potential to augment commercial strain development and improvement [9]. It has previously been shown that the survival of SCRaMbLEd diploids is significantly higher than that of haploids, with a viability over 70% compared to less than 30% in haploid strains under the same treatment conditions [9]. Although SCRaMbLEing in diploid cells overcomes some of the limitations associated with rapid haploid cell death, it abolishes the use of viability as a simple output to gauge the degree of genome scrambling in the population. Simultaneously, it increases the complexity of the bioinformatic analysis of these genomes due to the high sequence similarity between equivalent synthetic and non-synthetic genomic regions. As such, there is a need for new methods which overcome these limitations. In this study, we have developed RED (rapid evolution detection), a simple colorimetric plate-assay procedure to determine the degree of genomic rearrangements within SCRaMbLEd diploid yeast populations. RED-capable semi-synthetic laboratory strains were combined with haploids from four different industrial strains. The frequency of red-pigmented colonies was quantified and compared to the relative degree of gene loss within randomly selected colonies in the population. We subsequently used the RED system to monitor the leakiness and SCRaMbLE induction profile of several previously reported Cre-recombinase expression vectors. As proof of concept, we have showed that RED could be generally applied to semi-synthetic industrial strains to rapidly evaluate the frequency of genomic rearrangements in a SCRaMbLEd population, which allows the fine-tuning and selection of optimal SCRaMbLE conditions for strain library generation.

2. Materials and Methods

2.1. Culturing Media Chemicals used in this study were obtained from Sigma-Aldrich, Australia and used as recommended by the supplier, unless stated otherwise. Saccharomyces cerevisiae strains were routinely Microorganisms 2020, 8, 1914 3 of 18

1 1 1 cultivated in YPD (10 g L− w/v yeast extract, 20 g L− w/v peptone, 20 g L− w/v glucose) at 30 ◦C and were shaken at 200 rpm for liquid cultures. Escherichia coli DH5α cultures were used for plasmid 1 1 propagation and were cultivated at 37 ◦C in Luria Bertani broth or agar (10 g L− tryptone, 5 g L− 1 1 1 yeast extract, 10 g L− sodium chloride, 20 g L− bacteriological agar) supplemented with 100 µg mL− ampicillin for plasmid selection. 1 1 1 YP-gal agar (10 g L− yeast extract, 20 g L− peptone, 20 g L− galactose), supplemented with 1 400 µg mL− hygromycin B (InvivoGen, USA), was used to select HO-deleted heterozygous diploid 1 industrial strains and the subsequent haploid progeny. Sporulation agar plates contained 1 g L− yeast 1 1 extract, 10 g L− potassium acetate and 20 g L− bacteriological agar. S. cerevisiae strains containing Cre-plasmids were selected and maintained using SC-ura medium 1 1 1 (20 g L− glucose, 1.92 g L− yeast synthetic drop-out medium supplements without uracil, 0.68 g L− -ade 1 1 yeast nitrogen base without amino acids). SC agar (20 g L− glucose, 0.68 g L− yeast nitrogen 1 1 1 1 base without amino acids, 20 mg L− uracil, 20 mg L− L-methionine, 60 mg L− L-leucine, 20 mg L− 1 L-histidine, 20 g L− bacteriological agar) was used to select for ADE2-positive transformants.

2.2. Construction of Cre Plasmids All DNA manipulations were performed using reagents supplied by New England Biolabs, Australia according to the manufacturer’s recommendation, unless otherwise stated. All PCR primer sequences are provided in Table A1. Four plasmids, each containing different native yeast promoters to allow the differential expression of the Cre-recombinase gene, were used in this study (Table1). The pLM160 plasmid, containing the CLB2 promoter, has previously been constructed [9,14,15]. To construct pEW_SCW11p, the SCW11p Cre-EBD cassette was liberated from the pLM006 plasmid by SacI and EcoRI restriction enzyme digestion, and ligated directionally into the corresponding sites of the SacI and EcoRI digested pLM160 plasmid. The GAL1 promoter from pHK300-HO was isolated by digestion with EcoRI and PacI. The Cre-EBD cassette and the backbone plasmid from pLM160 were PCR-amplified using primers Cre-F+PacI and Cre-CassetteR (Table A1), which added a PacI restriction enzyme recognition site. The PCR amplicon was digested with PacI and EcoRI, and the digested GAL1 promoter was subsequently ligated into the Cre-EBD containing plasmid backbone, to yield pEW_GAL1p (Table1).

Table 1. Cre-recombinase expression plasmids.

Plasmid Name Relevant Genotype References

pHK300-HO ho::GAL1p –kanMX4 [14] pLM006 HIS3, CEN6, SCW11p Cre_EBD [9,15] pEW_CLB URA3, CEN6, CLB2p Cre_EBD aka pLM160 [9,15] pEW_GAL URA3, CEN6, GAL1p Cre_EBD This study pEW_SCW URA3, CEN6, SCW11p Cre_EBD This study

2.3. Industrial Haploid Strain Generation To generate stable haploid progeny of the industrial strains, ho-deletion cassette PCR fragments were generated from the pHK300-HO plasmid (Table1), using the HO_ampl-F /R primer set (Table A1) and transformed into Y-11878, Y-582, YB-428 and MH-1000 (Table2) using the LiOAc /SS carrier DNA/PEG transformation method [16], and recovered for 4 h in YP-gal broth before plating onto 1 YP-gal agar, supplemented with 400 µg mL− G418–sulfate. The galactose-dependent expression of the geneticin resistance gene ensured the minimal influence of its protein product during strain evaluation on glucose-containing media. Putative transformants were selected and the disruption of at least one HO allele was confirmed with PCR using the HO_conf-F/R primer set (Table A1). Y-11878, Y-582, YB-428 and MH-1000 strains heterozygous for a functional HO gene were grown to the stationary phase in YPD medium. A thick cell suspension of each culture was spread on sporulation agar plates and incubated at ambient temperature until sufficient asci formation was observed (after 3–6 days). Microorganisms 2020, 8, 1914 4 of 18

Random spore isolation was performed as previously described [5] and spore suspensions were plated 1 on YP-gal agar, supplemented with 400 µg mL− hygromycin B to select for HO-disrupted haploid progeny. The HO gene encodes an endonuclease which allows yeast to convert between mating types, thus facilitating spontaneous diploid formation. The colonies were selected form the MH-1000, Y-11878, YB-428 and Y-582 backgrounds and were designated HK01, HK02, HK03 and HK04, respectively. The mating type selection was performed by multiplex PCR using the MatLocus, MatA and MatAlpha primers (Table A1), as previously described [17].

2.4. RED-Capable Strain Preparation Strain preparation is summarized in Figure1. To introduce RED capability into the strains intended for SCRaMbLE library generation, the native ADE2 on chromosome XV of the haploid strains HK01–HK04 and yZY175 was replaced with a kanMX4 marker, conferring resistance to geneticin. The ade2::kanMX4 locus, along with ~200 bp flanking sequences, was PCR amplified from genomic DNA (extracted using the SDS/LiOAc genomic DNA extraction procedure [18]) obtained from the BY4741 ade2∆ strain [19] (Table2). The kanMX4-containing fragment was transformed into all five haploid strains to replace and disrupt the native ADE2 gene using the LiOAc/SS carrier DNA/PEG 1 method [16]. Transformants (red colonies) were selected on YPD agar supplemented with 200 µg mL−

MicroorganismsG418-sulfate 2020 (Roche), 8, x FOR and PEER to REVIEW reﬂect a lack of ADE2 were designated HK01-a, HK02-a, HK03-a5 of and 18 HK04-a, based on the corresponding isogenic strain used.

FigureFigure 1. 1.StrategyStrategy to generate to generate RED-enabled RED-enabled heterozygous heterozygous diploid diploid S. cerevisiaeS. cerevisiae strains.strains. Native Native ade2 andade2 ura3and wereura3 wereremoved removed from fromindustrially industrially deri derivedved HK01–HK04 HK01–HK04 haploid haploid strains. strains. Native Native ade2ade2 waswas also also deleteddeleted from from Chr Chr XV XV in in the the semi-syn semi-syntheticthetic yZY175 yZY175 strain, strain, and and functional functional ADE2ADE2 waswas re-introduced re-introduced intointo Syn Syn Chr Chr VI VI replacing replacing the the non-essential non-essential YFL019CYFL019C gene.gene. In In this this locus, locus, ADE2ADE2 is isflanked flanked by by the the existingexisting loxPsym loxPsym sequences. sequences. Mating Mating of of the the two two mo modifieddified parental parental haploids haploids generated generated RED-enabled RED-enabled EW01–EW04EW01–EW04 containing containing nativenative (non-synthetic) (non-synthetic) chromosomes chromosomes from from HK01–HK04 HK01–HK04 (MATa) (MATa) and synthetic and syntheticchromosomes chromosomes from yZY175 from (MAT yZY175α). Colors(MAT ofα). yeast Colors strains of yeast shown strains in this shown figure arein representativethis figure are of representativethe color of strains of the followingcolor of strains each genetic following manipulation. each genetic manipulation.

Table 2. Summary of relevant S. cerevisiae strains used in this study.

Strain Description Genotype Reference Contains synthetic chromosomes yZY175 MATα [20] III, VI and IX-R MH-1000 Industrial distillery yeast MATa/MATα [21] Y-11878 Isolated from Jamaican cane juice MATa/MATα [22] YB-428 Isolated from rum fermentation MATa/MATα [22] Y-582 Isolated from dry claret wine MATa/MATα [22] HK01 Progeny derived from MH1000 MATa ho::GAL1p—kanMX4 This study HK02 Progeny derived from Y-11878 MATa ho::GAL1p—kanMX4 This study HK03 Progeny derived from Y-582 MATa ho::GAL1p—kanMX4 This study HK04 Progeny derived from YB-428 MATa ho::GAL1p—kanMX4 This study HK01-au Uracil / adenine auxotrophic HK01 MATa ura3Δ ade2Δ::kanMX4 This study HK02-au Uracil / adenine auxotrophic HK02 MATa ura3Δ ade2Δ::kanMX4 This study HK03-au Uracil / adenine auxotrophic HK03 MATa ura3Δ ade2Δ::kanMX4 This study HK04-au Uracil / adenine auxotrophic HK04 MATa ura3Δ ade2Δ::kanMX4 This study MATα ura3Δ ade2Δ::kanMX4 EW00 RED-enabled yZY175 (haploid) This study yfl019c::ADE2 MATa/MATα ura3Δ/ura3Δ EW01 RED-enabled HK01-au X EW00 This study ade2Δ::kanMX4/

Microorganisms 2020, 8, 1914 5 of 18

A functional copy of ADE2 was reintroduced into a synthetic chromosome of strain yZY175 ade2∆ to complement the ade2 deletion from native Chr XV, producing white-colored colonies. The ADE2 CDS (with ~500 bp upstream and downstream flanking sequences) was amplified from S. cerevisiae BY4741 using forward and reverse primers ‘ADE2 + YFL019C’ using the same PCR conditions as above (Table A1). The primers added 40 bp of flanking sequences homologous to the YFL019C locus on Chr VI. The ADE2-containing PCR fragment was then transformed into synthetic Chr VI of the yZY175 ade2∆, disrupting the nonessential gene YFL019C, thus generating a loxPsym-flanked ADE2. White colonies were selected on adenine-deficient (SC-ade) agar and the selected isolate was named EW00. To allow the use of the Cre-recombinase expression plasmids containing URA3 as a selectable marker, the native URA3 was deleted from the HK01-a, HK02-a, HK03-a and HK04-a strains. The ura3∆0 locus of the S. cerevisiae BY4742 strain was amplified using forward and reverse ‘Ura30 primers that annealed approximately 250 bp upstream and downstream of the native CDS (Table A1). The fragment was transformed into the four strains and transformants were selected on YPD agar supplemented 1 with 1 g L− Thermo Scientific™ 5-FOA (Fluoroorotic acid). The absence of a functional URA3 was subsequently confirmed by the absence of growth on media lacking uracil (SC-ura agar); these strains were identified using the following convention: HK0x-au. Heterozygous diploid strains EW01, EW02, EW03 and EW04 were generated by mating each of the HK01-au, HK02-au, HK03-au and HK04-au with the semi-synthetic EW00. Individual strains were grown overnight in YPD broth, inoculated into fresh YPD broth to OD600 0.125 and incubated for 3 h. Cultures were then diluted to OD600 0.5 and co-cultured overnight in equal proportions in YPD broth at an ambient temperature to allow mating. Cell suspensions were plated on SC-ade to limit the growth of the industrial haploid colonies. Diploid colonies were identified by mating-type PCR, as described earlier. To study the dynamics of previously reported SCRaMbLE induction systems, facilitated by different native yeast promoters driving Cre-recombinase expression, EW01 was transformed with either pLM160, pEW_GAL1p or pEW_SCW11p and putative transformants selected on SC-ura agar plates, to produce strains EW01-CLB, EW01-GAL and EW01-SCW, respectively.

2.5. Spot Assays for Fitness Evaluation Industrial diploid strains, their haploid progeny (HK01–HK04) and RED-enabled diploid strains (EW01–EW04) were cultivated overnight in YPD after which they were inoculated into fresh YPD medium to a ﬁnal optical density at 600 nm (OD600) of 0.125 and grown for 3–4 h. Cultures were washed twice with phosphate buﬀered saline. Cells were diluted to an OD of 0.5 and a 10 dilution 600 × series spotted on YPD agar plates containing either 10% v/v ethanol, 12% v/v ethanol, 1.5 M sorbitol or 25 mM dithiothreitol (DTT).

2.6. Ethanol Production Determination Cultures of heterozygous strains EW01–04 and industrial diploids MH-1000, Y-11878, YB-428 and Y-582 were grown overnight in YPD. The cultures were then inoculated into 40 mL of fresh YPD with 1 high glucose concentration (200 g L− glucose) in 50 mL falcon tubes to an OD600 of 0.2. A rubber stopper with S-bend airlocks filled with ~2 mL of sterile water was attached to the top of the Falcon tubes to allow for CO2 escape. The cultures were incubated at ambient temperature for 120 h to allow the fermentation to finish. The final ethanol concentration in culture supernatant was measured using the Megazyme ethanol assay kit (K-ETOH, Megazyme, Ireland) as per the manufacturer’s instructions. Microorganisms 2020, 8, 1914 6 of 18

Table 2. Summary of relevant S. cerevisiae strains used in this study.

HK01 Progeny derived from MH1000 MATa ho::GAL1p—kanMX4 This study

HK02 Progeny derived from Y-11878 MATa ho::GAL1p—kanMX4 This study

HK03 Progeny derived from Y-582 MATa ho::GAL1p—kanMX4 This study

HK04 Progeny derived from YB-428 MATa ho::GAL1p—kanMX4 This study HK01-au Uracil / adenine auxotrophic HK01 MATa ura3∆ ade2∆::kanMX4 This study HK02-au Uracil / adenine auxotrophic HK02 MATa ura3∆ ade2∆::kanMX4 This study HK03-au Uracil / adenine auxotrophic HK03 MATa ura3∆ ade2∆::kanMX4 This study HK04-au Uracil / adenine auxotrophic HK04 MATa ura3∆ ade2∆::kanMX4 This study MATα ura3∆ ade2∆::kanMX4 EW00 RED-enabled yZY175 (haploid) This study yfl019c::ADE2 MATa/MATα ura3∆/ura3∆ EW01 RED-enabled HK01-au X EW00 ade2∆::kanMX4/ ade2∆::kanMX4 This study YFL019C/yfl019c::ADE2 MATa/MATα ura3∆/ura3∆ EW02 RED-enabled HK02-au X EW00 ade2∆::kanMX4/ade2∆::kanMX4 This study YFL019C/yfl019c::ADE2 MATa/MATα ura3∆/ura3∆ EW03 RED-enabled HK03-au X EW00 ade2∆::kanMX4/ade2∆::kanMX4 This study YFL019C/yfl019c::ADE2 MATa/MATα ura3∆/ura3∆ EW04 RED-enabled HK04-au X EW00 ade2∆::kanMX4/ade2∆::kanMX4 This study YFL019C/yfl019c::ADE2

EW01-CLB EW01 with plasmid pLM160 yﬂ019c::ADE2 CLB2p Cre_EBD This study

EW01-GAL EW01 with plasmid pEW_GAL1 yﬂ019c::ADE2 GAL1p Cre_EBD This study

EW01-SCW EW01 with plasmid pEW_SCW11 yﬂ019c::ADE2 SCW11p Cre_EBD This study

2.7. SCRaMbLE The RED-assay workﬂow is shown in Figure2. Strain EW01-GAL was cultivated overnight at 30 ◦C in YPD broth, then inoculated into fresh YPD to an OD600 of 0.2 and cultivated for 3–4 h. To induce SCRaMbLE, cells were washed twice with ddH2O and inoculated into fresh YP galactose 1 broth (20 g L− galactose) supplemented with 1 µM β-estradiol at an OD600 of 0.2. In addition to this, EW01-GAL cultures were also prepared in YP galactose without β-estradiol and YPD with and without β-estradiol. Cells were incubated with 200 rpm shaking at 30 ◦C and samples were taken at 0, 2, 4 and 6 h, washed twice with ddH2O and plated on YPD agar. Plates were incubated for 2–3 days at 30 ◦C before colony numbers and colors (red or white) were recorded. A random selection of eight red and eight white colonies from each time point was analyzed by PCR to indicate the presence or absence of chromosome arms. One pair of primers was used for each chromosome arm of the native and synthetic Chr III and VI (Table A1). Microorganisms 2020, 8, 1914 7 of 18

Microorganisms 2020, 8, x FOR PEER REVIEW 7 of 18

FigureFigure 2. 2.Flow Flow diagramdiagram ofof thethe RED RED assay assay experimental experimental procedure.procedure. RED-enabled semi-synthetic heterozygousheterozygous diploid diploid cells,cells, containing a a synthetic synthetic copy copy of of chr chr III IIIand and VI, VI,were were engineered engineered to turn to turnred reddue due to loxP-mediated to loxP-mediated loss loss of ADE2 of ADE2 (a). Cre-recombinase(a). Cre-recombinase expression expression was induced was induced for 2, 4 for and 2, 6 4 h and to 6allow h to allow increased increased genomic genomic rearra rearrangementngement through through SCRaMbLE SCRaMbLE (b). The (b). frequency The frequency of ADE2 of ADE2 loss wasloss wasdetermined determined based based on onthe the appearance appearance of ofyeast yeast colonies colonies with with red red pigment pigment ( (cc).). Randomly Randomly selected selected coloniescolonies were were sequenced sequenced using using short-read short-read NGS NGS technology. technology. Custom Custom scripts scripts were were developed developed to ﬁlterto filter out allout reads all notreads originating not originating from the from synthetic the synthetic genomes genomes (d). SCRaMbLEd (d). SCRaMbLEd chromosomes chromosomes were assembled were assembled and assessed for gene loss (e). and assessed for gene loss (e).

2.8.2.8. Genome Genome Sequencing Sequencing TwelveTwelve white white post-SCRaMbLE post-SCRaMbLE EW01-GAL EW01-GAL colonies colonies from from each timeeach pointtime werepoint randomly were randomly selected fromselected the culturesfrom the that cultures had beenthat had plated been onto plated YPD on agarto YPD after agar 2, 4 after and 62, h 4 of an induction.d 6 h of induction. In addition, In twoaddition, red colonies two red from colonies each timefrom point each weretime selected.point were Each selected. selected Each colony selected was growncolony overnightwas grown in YPDovernight broth andin YPD genomic broth DNA and wasgenomic extracted DNA from was eachextracted culture from using each the culture Thermo using Scientiﬁc the Thermo™ Yeast DNAScientific™ Extraction Yeast Kit DNA as per Extraction the manufacturer’s Kit as per instructions.the manufacturer’s Paired-end instructions. whole genome Paired-end sequencing whole wasgenome carried sequencing out at the was Beijing carried Genome out at Institute the Beijing (BGI), Genome Beijing, Institute China (BGI), using theBeijing, Illumina China sequencing using the technologyIllumina sequencing BGISEQ PE100 technology at 30 coverage.BGISEQ PE100 The length at 30x of coverage. each sequencing The length read of aftereach adaptersequencing trimming read × wasafter 100 adapter bp. trimming was 100 bp.

2.9.2.9. Detection Detection of of SCRaMbLE SCRaMbLE EventsEvents HK01,HK01, EW00, EW00, EW01 EW01 and and 48 48 SCRaMbLEd SCRaMbLEdS. S. cerevisiaecerevisiae strainsstrains were sequenced. The The determination determination ofof SCRaMbLE SCRaMbLE events events in in heterozygous heterozygous diploid diploid strains strains such such as as EW01 EW01 is technicallyis technically challenging challenging given given the highthe sequencehigh sequence similarity similarity between between corresponding corresponding synthetic synthetic and ‘native’ and DNA.‘native’ As DNA. such, As it was such, important it was toimportant remove reads to remove originating reads from originating ‘native’ DNAfrom from‘native’ the DNA read poolfrom as the they read cannot pool be as SCRaMbLEd they cannot andbe couldSCRaMbLEd skew the and interpretation could skew of the the interpretation results. A custom of th bioinformaticse results. A custom pipeline bioinformatics was therefore pipeline developed was totherefore remove thesedeveloped sequencing. to remove Briefly, these the sequencing. script (supplementary Briefly, the script material) (supplementary used Bowtie material) 2 [23] to used map allBowtie reads 2 to [23] two to reference map all reads sequences—Syn to two reference III and sequences—Syn VI of the semi-synthetic III and VI of strainthe semi-synthetic EW00, and Chrstrain III andEW00, VI of and the MH-1000-derivedChr III and VI of HK01.the MH-1000-derived Using filtering strategies, HK01. Using reads filtering were isolated strategies, that satisfiedreads were two requirements—firstly,isolated that satisfied they two mappedrequirem withents—firstly, 100% similarity they mapped to Syn with III or 100% VI of similarity EW00, and to secondly, Syn III or they VI didof notEW00, map and with secondly, 100% similarity they did to Chrnot map III and with VI of10 HK01.0% similarity For unpaired to Chr reads III and recovered VI of HK01. this way For in unpaired reads recovered this way in the read pool, their read partner was recovered as well. These the read pool, their read partner was recovered as well. These reads therefore contained sequences reads therefore contained sequences exclusively generated from the synthetic chromosomes and exclusively generated from the synthetic chromosomes and were used to infer subsequent deletion were used to infer subsequent deletion events. For convenience in subsequent analyses, the scripts events. For convenience in subsequent analyses, the scripts were designed to generate a standardized were designed to generate a standardized FASTA formatted file. The bioinformatics procedure is visually represented in Figure A4. For quality control, an additional output of the script is a log file

Microorganisms 2020, 8, 1914 8 of 18

FASTA formatted file. The bioinformatics procedure is visually represented in Figure A4. For quality control, an additional output of the script is a log file containing information from each step of the script, including, for example, the total number of reads and how many mapped to each reference (with and without 100% similarity). The filtered read pool was imported into Geneious Prime 2020.0.4 (https://www.geneious.com) and mapped to a consensus sequence of Syn Chr III and VI. The missing CDS annotations from each strain were compiled, enumerated and visualized in a heat map using GraphPad Prism version 8.01 for Windows, La Jolla California USA, www.graphpad.com.

3. Results

3.1. Heterozygous Diploid S. cerevisiae for Rapid Evolution Detection SCRaMbLE To enable RED in S. cerevisiae strains, at least one functional copy of ADE2 should be present in the genome, flanked by loxP-recombination sites. This was achieved by the introduction of an ADE2 gene cassette into the loxP-flanked YFL019C locus of the semi-synthetic yZY175 ade2∆ strain. This RED-facilitator strain enabled the generation of four semi-synthetic strains through a simple mating procedure with industrially relevant, ADE2-deficient yeast strains. All four RED-enabled heterozygous diploid strains (EW01–EW04) had consistent white-cream colored colonies on YPD agar plates, with no spontaneous red colored colonies or sectoring detected at any stage. The presence of unique, locus-specific PCR-tags (a feature of the synthetic chromosomes [2]) implied the presence of the native and synthetic chromosomes III and VI, in all four RED-enabled heterozygous diploids. Illumina genome sequencing confirmed the presence of intact synthetic chromosomes III and VI, in addition to its native counterparts. No aberrant gene or chromosomal copy-numbers were detected.

3.2. General Stress-Resistance and Ethanol Production of Heterozygous Diploid Strains In general, the semi-synthetic heterozygous diploids shared the combined properties of both synthetic and industrial yeast backgrounds. In addition to the ability to undergo rapid genome evolution, facilitated by the presence of many loxP sites on the synthetic chromosomes III and VI, the fitness of these heterologous diploids was similar to that of their respective parental diploid strains under various stress conditions. The novel diploid strains displayed high tolerance to osmotic stress (up to 1.5 M sorbitol), reducing conditions (up to 25 mM DTT) and presence of alcohol to up to 12% (v/v) ethanol, respectively (Figure3). It is noted that the growth of the haploid industrial parent strains HK03 and HK04 was inhibited under ethanol and reducing conditions; however, the tolerance phenotypes were recovered in their corresponding heterozygous diploid strains. In addition to the general stress tolerance of yeast strains, ethanol production is an important trait for many industrial S. cerevisiae strains; as such, the end-point ethanol production of the generated diploids was assessed. The semi-synthetic nature of the EW03 and EW04 strains did not affect their final ethanol yields compared to their corresponding diploid industrial parent strains (Figure4). EW01 produced significantly less ethanol than its industrial diploid parent (p < 0.02), at just under 6% v/v, compared with the ~8.5% v/v achieved by the MH1000 strain under our culturing conditions. Interestingly, the heterozygous EW02 on average produced up to 1% v/v more ethanol than its corresponding industrial diploid parent, Y-11878.

Microorganisms 2020, 8, 1914 9 of 18

YB-428 Y11878 EW04 EW02 EW01 MH1000 HK03 yZY175 HK02 EW03 Y-582 HK04 HK01

Ethanol 10%

12 % Ethanol % Ethanol 12

25 mM DTT DTT mM 25

1.5 M Sorbitol Sorbitol M 1.5

FigureFigure 3. Fitness 3. Fitness assays assays of of generated generated heterologousheterologous diploid diploid strains strains EW01-04, EW01-04, their their parental parental haploids haploids (HK01-04(HK01–04 and and yZY175) yZY175) and and the the corresponding corresponding diploid diploid strains strains (industrial (industrial diploids). diploids). Spot assaysSpot assays were were performedperformed on onYPD YPD containing containing 10-12% 10–12% (v/v) (v/v) ethanol, ethanol, 25 25 mM mM dithiothreitol dithiothreitol (DTT) (DTT) and 1.5 and M sorbitol1.5 M sorbitol incubatedincubated for for72h. 72 h.

Microorganisms 2020, 8, 1914 10 of 18 Microorganisms 2020, 8, x FOR PEER REVIEW 10 of 18

FigureFigure 4. Ethanol 4. Ethanol production production of S.of cerevisiaeS. cerevisiaeindustrially industrially relevant relevant diploids diploids (MH1000, (MH1000, Y-11878, Y-11878, Y-582 Y-582 andand YB-428) YB-428) and and semi-synthetic semi-synthetic heterozygous heterozygous diploids diploids (EW01-EW04). (EW01-EW04). Ethanol Ethanol concentration concentration was was –l–l measuredmeasured after after cultivation cultivation in in YPD YPD with with high high glucose glucose concentrationconcentration (20 g L L glucose)glucose) at at 30 30 °C◦ Cfor for 120 120h. h. There There was was no didifferencefference inin ethanolethanol productionproduction fromfromsemi-synthetic semi-synthetic strainsstrains compared compared to to the the correspondingcorresponding industrial industrial diploids, diploids, except except for the for EW01 the EW01 strain, strain, compared compared to the parentalto the parental MH1000 MH1000 strain. strain. 3.3. SCRaMbLE Induction and Rapid Evolution Detection 3.3.The SCRaMbLE RED-enabled Induction strains and developed Rapid Evolution in this Detection study provide a viability-independent visual output which reflectsThe RED-enabled the scale of strains genome developed rearrangement in this withinstudy provide a post-SCRaMbLE a viability-independent yeast population. visual Basedoutput on thewhich visibly reflects red the colonies scale of produced genome byrearrangemenade2 mutantst within (due toa post-SCRaMbLE the accumulation yeast of red-pigment population. [Based24]), ouron RED the assayvisibly generates red colonies a visual produced estimation by ade2 of themutants frequency (due to of the Cre-induced accumulation recombination, of red-pigment and [24]), the subsequentour RED geneassay loss generates of the loxP-flankeda visual estimationADE2 ofcassette the frequency (Figure ofA1 Cre-induced). recombination, and the subsequentUsing the gene RED-assay, loss of the we loxP-flanked compared the ADE2 SCRaMbLE cassette (Figure induction A1). dynamics of three promoters, previouslyUsing used the for RED-assay, Cre_EBD expression.we compared The the promoters SCRaMb usedLE induction to drive Cre_EBD dynamics expression of three promoters, were the M/G1previously cell-cycle used phase-activated for Cre_EBD expression.CLB2 promoter The promot [25,26],ers the used daughter to drive cell-specific Cre_EBD expression activated SCW11were the promoterM/G1 cell-cycle [27] and the phase-activated galactose-inducible CLB2 GAL1promoterpromoter [25,26], [28 the]. Indaughter addition cell-specific to the promoter-dependent activated SCW11 expressionpromoter patterns [27] ofand the recombinase,the galactose-inducible estradiol is requiredGAL1 promoter for SCRaMbLE [28]. inductionIn addition to allow to thethe nuclear-localizationpromoter-dependent of theexpression estradiol patterns binding of domain-linked the recombinase, Cre-recombinase estradiol is required [6]. As for unintended SCRaMbLE genomeinduction rearrangement to allow the can nuclear-localization lead to preemptive of genome the estradiol instability, binding the basaldomain-linked recombination Cre-recombinase rate of the EW01[6].strains, As unintended harboring genome either the rearrangement pEW_CLB, pEW_SCW11 can lead to or preemptive the pEW_GAL genome plasmid, instability, were evaluated the basal withrecombination RED (Figure5 ).rate In theof the absence EW01 of estradiol,strains, harb no redoring colonies either werethe pEW_CLB, detected at anypEW_SCW11 evaluated timeor the pointpEW_GAL for the strains plasmid, harboring were evaluated the pEW_CLB with RED or (Figure pEW_GAL 5). In plasmidsthe absence when of estradiol, galactose no was red absentcolonies (Figurewere5 ).detected Surprisingly, at any redevaluated colonies time were point observed for the in strains the EW01 harboring strain the containing pEW_CLB the or pEW_SCW pEW_GAL plasmid,plasmids where when the galactose number of was red absent colonies (Figure remained 5). Su belowrprisingly, 5% of thered populationcolonies were when observed no estradiol in the wasEW01 present strain (Figure containing5). In the the presence pEW_SCW of galactose, plasmid, wh butere no the estradiol, number the of EW01_GALred colonies strainremained showed below a continuous5% of the population increase in when red colonies no estradiol over time,was present reaching (Figure significantly 5). In the higher presence red of colony galactose, formation but no frequenciesestradiol, compared the EW01_GAL to glucose-grown strain showed cells a at continuous 4 h and 6 h increase of growth in (Figure red colonies5). Up toover a quarter time, reaching of the populationsignificantly was higher red after red 6 colony h of galactose formation growth. frequencies compared to glucose-grown cells at 4 h and 6 h of growth (Figure 5). Up to a quarter of the population was red after 6 h of galactose growth. With the exception of the glucose-grown EW01-GAL strain, the rapid generation of red colonies was observed after 2 h of estradiol addition (Figure 5), with more than 65% of the post-SCRaMbLE

Microorganisms 2020, 8, x FOR PEER REVIEW 11 of 18 population being red in the EW01-GAL (grown in galactose) strain after 4 h of estradiol exposure (Figure 5). There was a gradual increase in red colony frequencies for all strains up to the 4 h time point, after which the EW01-SCW and EW01-GAL (grown in galactose) strains had reductions in the ratioMicroorganisms of red colonies2020, 8, 1914 at 6 h after estradiol addition. 11 of 18

Figure 5. Red:white ratio of S. cerevisiae heterozygous diploid EW01 colonies following SCRaMbLE for Figure 5. Red:white ratio of S. cerevisiae heterozygous diploid EW01 colonies following SCRaMbLE up to six hours. Three strains were evaluated (EW01-CLB, EW01-SCW and EW01-GAL) that contained for up to six hours. Three strains were evaluated (EW01-CLB, EW01-SCW and EW01-GAL) that Cre expression plasmids with CRE under the transcriptional control of promoters CLB2p, SCW11p and contained Cre expression plasmids with CRE under the transcriptional control of promoters CLB2p, GAL1p, respectively. Cultures were supplemented with 1 µM estradiol to induce SCRaMbLEing, while SCW11the controlp and cultures GAL1 receivedp, respectively. no estradiol. Cultures EW01-GAL were was supplemented cultivated in bothwith inducing 1 μM (galactoseestradiol into theinduce SCRaMbLEing,absence of glucose) while or non-inducing the control (glucose-containing)cultures received no conditions. estradiol. AtEW01-GAL two-hour time was points cultivated from 0in h, both inducingsamples of (galactose cells were in taken, the absence washed andof glucose) platedonto or non-inducing YPD agar. The (glucose-containing) color of colonies was conditions. recorded At two-hourafter 72 h. time points from 0 h, samples of cells were taken, washed and plated onto YPD agar. The color of colonies was recorded after 72 h. With the exception of the glucose-grown EW01-GAL strain, the rapid generation of red colonies 3.4.was Quantitation observed after of SCRaMbLE 2 h of estradiol Events addition (Figure5), with more than 65% of the post-SCRaMbLE population being red in the EW01-GAL (grown in galactose) strain after 4 h of estradiol exposure (FigureThe5). impact There wasof aSCRaMbLE gradual increase on a ingenomic red colony level frequencies was subsequently for all strains investigated up to the 4 husing time the EW01-GALpoint, after which strain, the since EW01-SCW it had the and greatest EW01-GAL versatility (grown for in galactose)Cre-induction strains options had reductions and demonstrated in the theratio effective of red colonies suppression at 6 h of after SCRaMbLE estradiol addition. in glucose-containing media. Twelve white colonies and two red colonies were randomly selected from each time point after estradiol addition (2, 4 and 6 h) in the3.4. galactose–grown Quantitation of SCRaMbLE EW01-GAL Events strain (Figure 5). At each time point, the total number of colonies obtainedThe impactwas 63, of SCRaMbLE141 and 200, on arespectively. genomic level The was genome subsequently of each investigated colony was using sequenced the EW01-GAL and the syntheticstrain, since portion it had analyzed the greatest with versatility custom for scripts Cre-induction (developed options in this and study) demonstrated to evaluate the etheﬀective level of SCRaMbLEsuppression that of SCRaMbLE occurred. inThe glucose-containing degree of genome media. rearrangement Twelve white was colonies based andon the two number red colonies of genes lostwere per randomly genome selected in each from SCRaMbLEd each time point colony. after estradiol addition (2, 4 and 6 h) in the galactose–grown EW01-GAL strain (Figure5). At each time point, the total number of colonies obtained was 63, 141 and 200, respectively. The genome of each colony was sequenced and the synthetic portion analyzed with

Microorganisms 2020, 8, 1914 12 of 18

customMicroorganisms scripts (developed 2020, 8, x FOR inthis PEER study) REVIEW to evaluate the level of SCRaMbLE that occurred. The degree 12 of 18 of genome rearrangement was based on the number of genes lost per genome in each SCRaMbLEd colony. The analysisThe analysis of sequencing of sequencing data data from from red-pigmented red-pigmented colonies colonies revealedrevealed that, in in general, general, large large amountsamounts of genetic of genetic material material were were lost lost on bothon both synthetic synthetic chromosomes. chromosomes. AtAt least 50%, 50%, and and up up to to 78%, 78%, of all CDSsof all CDSs had been had been deleted deleted in all in analyzed all analyzed red red strains strains (data (data not not shown). shown). ThisThis phenomenon of of large large amountsamounts of DNA of loss DNA in red loss colonies in red was supportedcolonies was by thesupported absence ofby synthetic the absence chromosome-specific of synthetic PCR productschromosome-specific obtained from PCR a largerproducts set ofobtained 24 red from and 24a whitelarger coloniesset of 24 (Figurered and A2 24). white The absence colonies of (Figure A2). The absence of PCR amplification products from targets on both chromosome arms PCR amplification products from targets on both chromosome arms might suggest a high frequency might suggest a high frequency of complete loss of synthetic chromosomes in red colonies. of complete loss of synthetic chromosomes in red colonies. Interestingly, red colonies obtained after Interestingly, red colonies obtained after two hours of SCRaMbLE displayed extensive gene loss, two hourssimilar of to SCRaMbLE those analyzed displayed at the 4 extensiveand 6 h time gene points. loss, similar to those analyzed at the 4 and 6 h time points.With the exclusion of two outlier strains, which had lost the majority of synthetic chromosome WithVI, thea significant exclusion variation of two outlier in gene-loss strains, whichfrequencies had lostwas the observed majority between of synthetic the chromosomewhite colonies VI, a significantevaluated variation at each in time gene-loss point, with frequencies 7–60 gene was dele observedtions per betweenstrain (Figure the white6). On coloniesaverage, evaluatedstrains hadat each time26 deletions point, with after 7–60 2 geneh of deletionsinduction, per which strain increased (Figure6 ).to On 33 average,at 4 h of strains estradiol had 26introduction. deletions after In 2 h of induction,accordance which with the increased RED assay, to 33 the at 4average h of estradiol number introduction. of gene deletions In accordance decreased to with 19 theper REDstrain assay, for the averagethe 6 numberh time point. of gene A genomic deletions heat decreased map (Figure to 19 perA3), strain showing for thethe 6frequency h time point. of gene A genomic loss across heat map (Figuresynthetic A3 ),chromosomes showing the III frequency and VI, revealed of gene a loss non-rand acrossom synthetic distribution chromosomes of gene deletion III and events VI, revealed over a non-randomthe length distribution of both synthetic of gene chromosomes. deletion events over the length of both synthetic chromosomes.

Figure 6. The number of deleted genes in white EW01_GAL colonies obtained after two, four or Figure 6. The number of deleted genes in white EW01_GAL colonies obtained after two, four or six six hourshours of estradiolof estradiol exposure. exposure. Each Each black black dot dot represents represents anan individually individually sequencedsequenced SCRaMbLEd EW01_GALEW01_GAL colony. colony. 4. Discussion 4. Discussion SCRaMbLESCRaMbLE is a novelis a novel genome genome evolution evolution system system associated associated withwith thethe syntheticsynthetic Sc2.0 Sc2.0 strains, strains, allowingallowing the combinatorial the combinatorial deletion, deletion, duplication duplication and translocationand translocation of multiple of multiple genes genes at a at time. a time. Not Not only is SCRaMbLEonly is SCRaMbLE a valuable a valuable tool for tool studying for studying epistatic epista interactionstic interactions between between genes, genes, itit has also also been been demonstrateddemonstrated as a useful as a approachuseful approach to generate to generate large libraries large libraries of novel of strains novel with strains improved with improved industrial phenotypesindustrial [7,12 phenotypes,15,29]. However, [7,12,15,29]. this indiscriminatoryHowever, this indiscriminatory rearrangement rearrangement of functional genomicof functional units frequentlygenomic results units in frequently inviable or results unﬁt phenotypesin inviable or due unfit to phenotypes the loss of essentialdue to the genes loss of or essential the disruption genes or of ﬁtness-relatedthe disruption metabolic of fitness-related pathways. metabolic To harness path SCRaMbLEways. To harness for the SCRaMbLE development for the of development next generation of industrialnext strains, generation precise industrial control strains, is required precise to limitcontrol the is lossrequired of promising to limit the strains loss dueof promising to excessive strains gene due to excessive gene loss. Currently, strategies to indicate the degree of genomic SCRaMbLEing are loss. Currently, strategies to indicate the degree of genomic SCRaMbLEing are based on the evaluation

Microorganisms 2020, 8, 1914 13 of 18 of cell viability and time-consuming whole genome sequencing analysis [8], though both approaches are of limited use in industrial yeast strains, which are predominantly diploid. Here, a simple method called rapid evolution detection (RED) was developed for use in semi-synthetic heterozygous yeast strains. RED allows the qualitative detection of the genomic rearrangements that occurred within a SCRaMbLEd population through the generation of visually distinct red-pigmented yeast colonies. SCRaMbLE-mediated genomic rearrangements occur exclusively in synthetic DNA at the gene-flanking loxP sites. Here, a RED-enabled semi-synthetic haploid strain (EW00) was constructed and used as a modular add-on to generate semi-synthetic heterozygous yeast strains with industrial backgrounds. Similar to other strain-breeding reports [30], the four semi-synthetic diploid strains generated here displayed a minimal loss of beneficial phenotypes (and even heterosis). Although a limited number of phenotypes were evaluated here, our results suggest that the heterozygous synthetic DNA had a low impact on the general fitness of the resulting strains, and that it is possible to introduce SCRaMbLE-capability into any industrial S. cerevisiae strain. To restrict excessive genome rearrangement, SCRaMbLE was originally designed with an inducible control mechanism, whereby Cre-recombinase would only be expressed in newly formed daughter cells and only activated in the presence of estradiol [2]. This was achieved by fusing the Cre-recombinase to the murine estradiol-binding domain (EBD), which sequesters Cre-recombinase in the cytosol. The controlled addition of estradiol to the culture medium facilitates the movement of Cre-EBD into the nucleus, where Cre recombinase is able to act upon the loxP sequences of the synthetic genome [2]. However, reports from our group and other Yeast 2.0 consortium members have suggested that SCRaMbLE might occur even in the absence of estradiol. RED revealed low, but detectable, ADE2 deletion events for strains harboring CLB2p and SCW11p Cre-EBD expression plasmids in the absence of estradiol. Even at a low frequency, this could lead to unintended gene loss or even the loss of whole chromosomes without Cre-induction [6,15], and could affect the long-term stability of strains. Additional evidence of this leakiness was observed in RED-enabled strains grown on agar plates (in the absence of estradiol), with the infrequent appearance of the red sectoring (Figure A1) of otherwise white colonies—a strong indicator of genome instability [31]. The unintended SCRaMbLE initiation in the absence of estradiol is likely to be Cre-EBD concentration-dependent, as the strong induction of the recombinase expression from the GAL1 promoter surpassed the cytosolic sequestering ability of the estrogen-binding domain. This observation shows the versatility of the GAL1p expression system for Cre-induction, by providing options for a stepwise adjustment in SCRaMbLE strength, in addition to the effective suppression of SCRaMbLE in glucose-containing media. The custom bioinformatic pipeline developed in this study was able to effectively differentiate short DNA reads originating from the synthetic portion of heterozygous S. cerevisiae strains, allowing the enumeration of gene deletion events after SCRaMbLE. The genome sequencing data supported the visual RED assay results. Using this simple method to visually report on the frequency of genomic rearrangements in a post-SCRaMbLE population, we were able to detect the leakiness of several Cre-expression systems and establish the induction timeframes for optimal SCRaMbLEing rates. Our results also demonstrated the importance of selecting appropriate sampling times, as prolonged SCRaMbLE induction could ultimately reduce the frequency of genomic rearrangement within the population. One reason for this observation could be linked to the loss of cell viability due to the increased chance of essential gene loss and/or the excessive disruption of cellular metabolism over extended periods of SCRaMbLE. It is thus conceivable that cells with fewer rearrangements or those which have escaped the influence of Cre-recombination (due to plasmid loss or mutations) would have a competitive advantage over cells with rapidly changing genomes. Assuming an equal chance of recombination at any given loxP site, SCRaMbLEd synthetic haploid strains would have lost on average seven to eight genes, upon reaching 90% cell lethality due to essential gene loss. This value was in alignment with previous reports for SCRaMbLEd haploid strains that had up to eight gene deletions per strain [6]. In the heterozygous strains evaluated in this study, SCRaMbLEd populations were generated with, on average, 33 gene deletions per strain. Considering Microorganisms 2020, 8, x FOR PEER REVIEW 14 of 18 evaluated in this study, SCRaMbLEd populations were generated with, on average, 33 gene deletions per strain. Considering that some strains had up to 60 gene deletions, the opportunity to obtain highly modified genomes is significantly enhanced by the higher viability of these strains. SCRaMbLEing in heterozygous diploid strains has been established as a powerful tool to generate novel phenotypes (including in interspecies diploids [9]), but whether this increased genomic diversityMicroorganisms of SCRaMbLEd2020, 8, 1914 heterozygous strains outweighs the potential masking effects of14 ofthe 18 native chromosome remains to be determined. Inthat conclusion, some strains RED had upwas to 60developed gene deletions, as a the modular opportunity system to obtain to highlymonitor modified and genomesreport on the occurrenceis significantly and level enhanced of SCRaMbLEing by the higher in viabilitya population of these that strains. provides SCRaMbLEing information in heterozygous visually without the needdiploid to sequence strains has strains. been established Heterozygous as a powerful diploids tool towere generate developed novel phenotypes by combining (including industrially in relevantinterspecies haploids diploids with a [9 ]),RED-enabled but whether this strain increased containing genomic synthetic diversity of DNA, SCRaMbLEd and were heterozygous shown to be strains outweighs the potential masking effects of the native chromosome remains to be determined. generally as fit as their industrial parent. Through the breeding strategy used here, or protoplast In conclusion, RED was developed as a modular system to monitor and report on the occurrence fusions,and synthetic level of SCRaMbLEing chromosomes in acan population be introduced that provides to informationany industrial visually S. withoutcerevisiae the strain need toand be RED-enabled.sequence Furthermore, strains. Heterozygous RED pr diploidsoved a were valuable developed resource by combining to rapidly industrially evaluate relevant various haploids SCRaMbLE inductionwith systems a RED-enabled and induction strain containing optimizations. syntheticDNA, In future and were studies, shown RED to be could generally be asharnessed fit as to determinetheir industrialthe effects parent. of different Through growth the breeding conditio strategyns or used strain here, backgrounds or protoplast fusions,on the syntheticmagnitude of SCRaMbLEchromosomes in a population, can be introduced or assist to any in future industrial genomeS. cerevisiae minimizationstrain and be efforts RED-enabled. [2]. Furthermore, RED proved a valuable resource to rapidly evaluate various SCRaMbLE induction systems and Supplementaryinduction Materials: optimizations. The In shell future scripts studies, that RED was couldused beto separate harnessed Synthetic to determine Yeast the Illu effminaects of DNA different reads from a growthheterologous conditions or straindiploid backgrounds on thestrains magnitude of SCRaMbLEcan inbe a population,accessed or assist in at https://github.com/HeinrichKroufuture genome minimizationkamp/Wightman-et-al-2020-script. efforts [2].

AuthorSupplementary Contributions: Materials: Conceptualization,The shell scripts E.L.I.W. that was and used H.K.; to separate writin Syntheticg—original Yeast draft Illumina prepar DNAation, reads fromE.L.I.W. a and H.K; writing—reviewheterologous diploid and strains editing, can be E.L.I.W. accessed atH.K., https: I.S.P.,//github.com I.T.P. /HeinrichKroukampand H.K.M.N.; visuali/Wightman-et-al-2020-scriptzation, E.L.I.W., H.K.. and I.S.P. AllAuthor authors Contributions: have read Conceptualization,and agreed to the E.L.I.W. published and H.K.;version writing—original of the manuscript. draft preparation, E.L.I.W. and H.K; writing—review and editing, E.L.I.W., H.K., I.S.P., I.T.P. and H.K.M.N.; visualization, E.L.I.W., H.K. and I.S.P. Funding:All This authors research have read received and agreed no external to the published funding. version of the manuscript.

Acknowledgments:Funding: This researchThe authors received thank no external Liam funding.Elsborne for helpful discussions and for providing access to the HPC. PlasmidAcknowledgments: pLM160_pCLB2_creThe authors wa thanks a gift Liam from Elsborne Leslie for Mitchell helpful discussions (NYU, Sc2.0 and collaborator). for providing access to the HPC. Plasmid pLM160_pCLB2_cre was a gift from Leslie Mitchell (NYU, Sc2.0 collaborator). ConflictsConﬂicts of Interest: of Interest: The Theauthors authors declare declare no no conflict conﬂict ofof interest.interest.

AppendixAppendix A A

FigureFigure A1. A1.HeterozygousHeterozygous diploid diploid S. S. cerevisiae cerevisiaeEW01-GAL EW01-GAL colonies aftercolonies SCRaMbLE. after ASCRaMbLE. clear diﬀerence A clear differencebetween between red and red white and colonies white colonies is observed. is observed.

MicroorganismsMicroorganisms 20202020, 8,, x8, FOR 1914 PEER REVIEW 15 15 of of 18 18 Microorganisms 2020, 8, x FOR PEER REVIEW 15 of 18 Chromosome III Chromosome VI 8 Chromosome III 8 Chromosome VI 8 8 6 6 Native left 6 6 NativeNative left right 4 4 NativeSynthetic right left 4 4 Synthetic left 2 2 Synthetic right Number of strains Number 2 2 Synthetic right Number of strains Number 0 0 246246 246246 0 0 246246 White colonies Red colonies 246246 White colonies Red colonies White coloniesInduction time Red colonies(h) White coloniesInduction time Red colonies(h) Induction time (h) Induction time (h) Figure A2. Detection of PCR markers on the native and synthetic chromosomes of SCRaMbLEd FigureEW01-GALFigure A2. Detection A2. strains.Detection ofRed PCR ofcolonies PCRmarkers markers displayed on the on theanative high native frequencyand and synthetic synthetic of synthetic chromosomes chromosomes chromosome of of SCRaMbLEd SCRaMbLEd loss, while EW01-GAL strains. Red colonies displayed a high frequency of synthetic chromosome loss, while EW01-GALmaintaining strains. native Red chromosome colonies displayed integrity. a high frequency of synthetic chromosome loss, while maintainingmaintaining native native chromosome chromosome integrity. integrity.

Total gene loss in synthetic chromosomes of white SCRaMbLEd strains Total gene loss in synthetic chromosomes of white SCRaMbLEd strains

ChrIII 2 h ChrIII 2 h ChrVI ChrVI

10 ChrIII 10 4 h ChrIII 5 4 h ChrVI 5 0 ChrVI 0

ChrIII 6 h ChrIII 6 h ChrVI ChrVI

FigureFigure A3. A3. HeatHeat maps maps of ofgene gene loss loss frequencies frequencies in in three three sets of randomly selectedselected white white SCRaMbLEd SCRaMbLEd FigureEW01-GAL.EW01-GAL. A3. Heat Each maps Each segment segmentof gene represents representsloss frequencies aa codingcoding in DNAthree DNA sequencesets sequence of randomly (CDS) (CDS) on syntheticselectedon synthetic white chromosomes chromosomes SCRaMbLEd III and III EW01-GAL.andVI, VI, while while Each the the colorsegment color depicts depicts represents the the total total a number coding number ofDN CDS ofA CDSsequence lost bylost SCRaMbLEing; by (CDS) SCRaMbLEing; on synthetic blue segments blue chromosomes segments depict depict sites III andsites VI,of of minimalwhile minimal the deletion color deletion depicts while while redthe red representstotal repres numberents the most ofthe CDS most frequent lost freque by deletion SCRaMbLEing;nt deletion sites. sites. blue segments depict sites of minimal deletion while red represents the most frequent deletion sites.

MicroorganismsMicroorganisms 20202020, 8,, x8, FOR 1914 PEER REVIEW 16 16 of of 18 18

Figure A4. Summary of bioinformatics pipeline to filter sequencing reads of SCRaMbLEd heterozygous Figurediploid A4.S. cerevisiaeSummary. Reads of bioinformatics are mapped to referencepipeline sequencesto filter fromsequencing both parental reads chromosomesof SCRaMbLEd (a) heterozygousand are filtered diploid by reads S. cerevisiae that were. aReads 100% matchare mapped to the reference to reference (b). Pools sequences of reads from are compared both parental and chromosomesreads that uniquely (a) and matchare filtered to the by synthetic reads that reference were area 100% separated match (c to). Thethe reference final read pool(b). Pools is converted of reads areinto compared FASTQ forand convenient reads that direct uniquely use in match other softwareto the synthetic (d). reference are separated (c). The final read pool is converted into FASTQ for convenient direct use in other software (d).

Table A1. Primers used in this study.

Microorganisms 2020, 8, 1914 17 of 18

Table A1. Primers used in this study.

Primer Name Forward HO_ampl-F TCACGGCTAACTCTTACGTTATG HO_ampl-R GTATGTACCAGAAGCACGTGAAG HO_conf-F ATGCTTTCTGAAAACACGACTATTC HO_conf-R ACAGCATCAAACTGTAAGATTCCG Cre-F+PacI CTACTTAATTAAATGTCCAATTTACTGACC Cre-CassetteR GAATTCGATATCAAGCTTATCGA ADE2 F AAGCCGAGAATTTTGTAACACC ADE2 R TCCTCGGTTCTGCATTGAGC ADE2 + YFL019C F CTTTGCTCTATATTCGAGTCAGGCTCCACCAGTCATTTCGTCGCCCAATGTGTCCATCTG ADE2 + YFL019C R ATCATAAAAACCTTACGCCATCTGTGGGACTCGTCATAGGACGAGCCGTTGATGAGGTTA Ura3 F GCGAGGCATATTTATGGTGAAG Ura3 R TGGAACTCTTGTTGTTCTTTGG MatA-F ACTCCACTTCAAGTAAGAGTTTG MatAlpha-F GCACGGAATATGGGACTACTTCG MatLocus-R AGTCACATCAAGATCGTTTATGG NatIII left F TTAGGGACGCATCTGTGAACTC NatIII & SYNIII left R GTTTGGAGACTTTGGATCATCC NatIII right F CTCTTCGGGGTACTCTTTACCT NatIII & SYNIII right R GTTGAAGTCACATCGTCACAGT NatVI left F CAGGATGTACTGATAGGACGTT NatVI left R GTAGCATACGCACTCCGAAC NatVI Right F CCTTGCTAGCATCCAAACTTTC NatVI Right R GATGGACTGGTGACGCAAG SynIII left F TCCGAGATGCTAGCGTTAATAG SynIII right F AGCAGCGGTTATAGCTTGCCA SynVI right CAAGACTGGGTGAACGCTCAA SynVI right GCTTTGGCCTCTATTCAAACCT

References

1. Pretorius, I.S.; Boeke, J.D. Yeast 2.0—Connecting the dots in the construction of the world’s ﬁrst functional synthetic eukaryotic genome. FEMS Yeast Res. 2018, 18, foy032. [CrossRef][PubMed] 2. Dymond, J.S.; Boeke, J.D. The Saccharomyces cerevisiae SCRaMbLE system and genome minimization. Bioengineered 2012, 3, 170–173. [CrossRef][PubMed] 3. Almeida, J.R.; Modig, T.; Petersson, A.; Hähn-Hägerdal, B.; Lidén, G.; Gorwa-Grauslund, M.F. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol. 2007, 82, 340–349. [CrossRef] 4. Kroukamp, H.; den Haan, R.; la Grange, D.C.; Sibanda, N.; Foulquié-Moreno, M.R.; Thevelein, J.M.; van Zyl, W.H. Strain breeding enhanced heterologous cellobiohydrolase secretion by Saccharomyces cerevisiae in a protein speciﬁc manner. Biotechnol. J. 2017, 12, 1700346. [CrossRef][PubMed] 5. De Witt, R.N.; Kroukamp, H.; Van Zyl, W.H.; Paulsen, I.T.; Volschenk, H. QTL analysis of natural Saccharomyces cerevisiae isolates reveals unique alleles involved in lignocellulosic inhibitor tolerance. FEMS Yeast Res. 2019, 19, foz047. [CrossRef][PubMed] 6. Shen, Y.; Stracquadanio, G.; Wang, Y.; Yang, K.; Mitchell, L.A.; Xue, Y.; Cai, Y.; Chen, T.; Dymond, J.S.; Kang, K.; et al. SCRaMbLE generates designed combinatorial stochastic diversity in synthetic chromosomes. Genome Res. 2016, 26, 36–49. [CrossRef][PubMed] 7. Blount, B.; Gowers, H.J.; Ledesma-Amaro, R.; Jovicevic, D.; McKiernan, R.M.; Xie, Z.X.; Li, Y.J.; Yuan, Y.J.; Ellis, T. Rapid host strain improvement by in vivo rearrangement of a synthetic yeast chromosome. Nat. Commun. 2018, 9, 1932. [CrossRef] 8. Jia, B.; Wu, Y.; Li, B.; Mitchell, L.A.; Liu, H.; Pan, S.; Wang, J.; Zhang, H.; Jia, N.; Li, B.; et al. Precise control of SCRaMbLE in synthetic haploid and diploid yeast. Nat. Commun. 2018, 9, 1933. [CrossRef] 9. Shen, M.J.; Wu, Y.; Yang, K.; Li, Y.; Xu, H.; Zhang, H.; Li, B.; Li, X.; Xiao, W.; Zhou, X.; et al. Heterozygous diploid and interspecies SCRaMbLEing. Nat. Commun. 2018, 9, 1934. [CrossRef] 10. Caspeta, L.; Chen, Y.; Ghiaci, P.; Feizi, A.; Buskov, S.; Hallström, B.M.; Petranovic, D.; Nielsen, J. Altered sterol composition renders yeast thermotolerant. Science 2014, 346, 75–78. [CrossRef] 11. Hochrein, L.; Mitchell, L.A.; Schulz, K.; Messerschmidt, K.; Mueller-Roeber, B. L-SCRaMbLE as a tool for light-controlled Cre-mediated recombination in yeast. Nat. Commun. 2018, 9, 1931. [CrossRef][PubMed] Microorganisms 2020, 8, 1914 18 of 18

12. Wightman, E.L.I.; Kroukamp, H.; Pretorius, I.S.; Paulsen, I.T.; Nevalainen, H.K.M. Rapid optimisation of cellulolytic enzymes ratios in Saccharomyces cerevisiae using in vitro SCRaMbLE. Biotechnol. Biofuels 2020, 13, 182. [CrossRef] 13. Dymond, J.S.; Richardson, S.M.; Coombes, C.E.; Babatz, T.; Muller, H.; Annaluru, N.; Blake, W.J.; Schwerzmann, J.W.; Dai, J.; Lindstrom, D.L.; et al. Synthetic chromosome arms function in yeast and generate phenotypic diversity by design. Nature 2011, 477, 471–476. [CrossRef][PubMed] 14. De Witt, R.N.; Kroukamp, H.; Volschenk, H. Proteome response of two natural strains of Saccharomyces cerevisiae with divergent lignocellulosic inhibitor stress tolerance. FEMS Yeast Res. 2019, 19, foy116. [CrossRef] 15. Ma, L.; Li, Y.; Chen, X.; Ding, M.; Wu, Y.; Yuan, Y. SCRaMbLE generates evolved yeasts with increased alkali tolerance. Microb. Cell Factories 2019, 18, 52. [CrossRef] 16. Gietz, R.D.; Schiestl, R.H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2007, 2, 31–34. [CrossRef] 17. Van Wyk, N.; Kroukamp, H.; Espinosa, M.I.; von Wallbrunn, C.; Wendland, J.; Pretorius, I.S. Blending wine yeast phenotypes with the aid of CRISPR DNA editing technologies. Int. J. Food Microbiol. 2020, 324, 108615. [CrossRef] 18. Lõoke, M.; Kristjuhan, K.; Kristjuhan, A. Extraction of genomic DNA from yeasts for PCR-based applications. Biotechniques 2011, 50, 325–328. [CrossRef] 19. Winzeler, E.A.; Shoemaker, D.D.; Astromoff, A.; Liang, H.; Anderson, K.; Andre, B.; Bangham, R.; Benito, R.; Boeke, J.D.; Bussey, H.; et al. Functional characterization of the S. cerevisiae genome by gene deletion and parallel analysis. Science 1999, 285, 901–906. [CrossRef] 20. Mitchell, L.A.; Wang, A.; Stracquadanio, G.; Kuang, Z.; Wang, X.; Yang, K.; Richardson, S.; Martin, J.A.; Zhao, Y.; Walker, R.; et al. Synthesis, debugging, and effects of synthetic chromosome consolidation: synVI and beyond. Science 2017, 355, eaaf4831. [CrossRef] 21. Favaro, L.; Basaglia, M.; van Zyl, W.H.; Casella, S. Using an efficient fermenting yeast enhances ethanol production from unfiltered wheat bran hydrolysates. Appl. Energy 2013, 102, 170–178. [CrossRef] 22. Swezey, J. Agricultural Research Service Culture Collection (NRRL-Northern Regional Research Laboratory) Database; USDA/ARS, National Center for Agricultural Utilization Research: Peoria, IL, USA, 2016. [CrossRef] 23. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [CrossRef] [PubMed] 24. Jones, E.; Fink, G. Regulation of Amino Acid and Nucleotide Biosynthesis in Yeast. In The Molecular Biology of the Yeast Saccharomyces; Metabolism and Gene Expression, 2nd ed.; Cold Spring Harbor: Long Island, NY, USA, 1982; p. 181. 25. Althoefer, H.; Schleiffer, A.; Wassmann, K.; Nordheim, A.; Ammerer, G. Mcm1 is required to coordinate G2-specific transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 1995, 15, 5917–5928. [CrossRef][PubMed] 26. Maher, M.; Cong, F.; Kindelberger, D.; Nasmyth, K.; Dalton, S. Cell cycle-regulated transcription of the CLB2 gene is dependent on Mcm1 and a ternary complex factor. Mol. Cell. Biol. 1995, 15, 3129–3137. [CrossRef] [PubMed] 27. Lindstrom, D.L.; Gottschling, D.E. The Mother Enrichment Program: A Genetic System for Facile Replicative Life Span Analysis in Saccharomyces cerevisiae. Genetics 2009, 183, 413–422. [CrossRef][PubMed] 28. Johnston, M.; Davis, R. Sequences that regulate the divergent GAL1-GAL10 promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 1984, 4, 1440–1448. [CrossRef][PubMed] 29. Luo, Z.; Wang, L.; Wang, Y.; Zhang, W.; Guo, Y.; Shen, Y.; Jiang, L.; Wu, Q.; Zhang, C.; Cai, Y.; et al. Identifying and characterizing SCRaMbLEd synthetic yeast using ReSCuES. Nat. Commun. 2018, 9, 1–10. [CrossRef] 30. Benjaphokee, S.; Hasegawa, D.; Yokota, D.; Asvarak, T.; Auesukaree, C.; Sugiyama, M.; Kaneko, Y.; Boonchird, C.; Harashima, S. Highly efficient bioethanol production by a Saccharomyces cerevisiae strain with multiple stress tolerance to high temperature, acid and ethanol. New Biotechnol. 2012, 29, 379–386. [CrossRef] 31. Strome, E.D.; Wu, X.; Kimmel, M.; Plon, S.E. Heterozygous screen in Saccharomyces cerevisiae identifies dosage-sensitive genes that affect chromosome stability. Genetics 2008, 178, 1193–1207. [CrossRef]

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional aﬃliations.

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).