University of Groningen

Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum Polli, Fabiola

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record

Publication date: 2017

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA): Polli, F. (2017). Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum. University of Groningen.

Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

The publication may also be distributed here under the terms of Article 25fa of the Dutch Copyright Act, indicated by the “Taverne” license. More information can be found on the University of Groningen website: https://www.rug.nl/library/open-access/self-archiving-pure/taverne- amendment.

Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum.

Download date: 06-10-2021 Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum

PhD thesis

to obtain the degree of PhD at the University of Groningen on the authority of the Rector Magnificus Prof. E. Sterken and in accordance with the decision by the College of Deans.

This thesis will be defended in public on

Friday 23 June 2017 at 09.00 hours

The research described in this thesis was carried out in the Department of Molecular Microbiology of the Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, The ­Netherlands. It was financially supported by the biobased ecologically balanced sustainable industrial chemistry (BE-BASIC) and DSM Sinochem Pharmaceuticals Netherlands B.V. (The Netherlands). by

Cover design, layout and printing: Lovebird design. www.lovebird-design.com

ISBN (print): 978-90-367-9934-8 Fabiola Polli ISBN (digital): 978-90-367-9934-8 born on 24 April 1986 Copyright © 2017 by F. Polli. All rights reserved. No parts of this book may be reproduced or transmitted in any form or by any means without prior permission of the author. in Frascati, Italy Supervisors Prof. dr. A.J.M. Driessen Prof. dr. R.A.L. Bovenberg

Assessment Committee Prof. dr. L. Dijkhuizen Prof. dr. D.B. Janssen Prof. dr. A.F.J. Ram

To my parents...

... Ai miei geniitori per essere stati presenti in ogni momento e per aver sempre sostenuto ogni mia scelta... Grazie! TABLE OF CONTENTS

CHAPTER 1 Synthetic biology tools for metabolic engineering of the filamentous fungus Penicillium chrysogenum 9

CHAPTER 2 Towards a secondary metabolite deficient strain of Penicillium chrysogenum 33

CHAPTER 3 New promoters for strain engineering of Penicillium chrysogenum 55

CHAPTER 4 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 79

CHAPTER 5 Summary and concluding remarks 99 Samenvatting 107

Appendix 111 Acknowledgments 115 List of publications 117 References 119 SYNTHETIC BIOLOGY TOOLS FOR METABOLIC ENGINEERING OF THE FILAMENTOUS FUNGUS PENICILLIUM CHRYSOGENUM

Fabiola Polli INTRODUCTION

The discovery of penicillin by Alexander Fleming in 1928 generated a first understanding of the wide spread nature of the production of antibiotics 1 and other bioactive compounds by filamentous fungi and encouraged research in this direction. While initial research was focused on natural product discovery and classical strain improvement (CSI), later on, it also became possible using recombinant DNA (rDNA) techniques to express heterologous genes in filamentous fungi for the production of semisyn- ABSTRACT thetic antibiotics, such as cephalosporins 1. One of the most important cell factories in antibiotics production is Since the application of penicillin and other antibiotics, bacterial resis- the filamentous fungusPenicillium chrysogenum. The initial isolate fungus Penicillium fungus Penicillium chrysogenum tance to antibiotics developed hand in hand with their use in combating P. notatum­ , did not produce enough of the antibiotic for mass produc- infectious disease. Therefore, there is an urgent need for novel mole- tion, and this initially slowed down the introduction of penicillins as anti-­ cules with unique structures to combat resistance towards existing infectives. Therefore, classical strain improvement (CSI) through radiation antibiotics and that target new essential biological functions for antimi- and chemical mutation followed by selection, has led to strains that pro- crobial therapies. With the recent developments towards an advanced duced increased levels of β-lactams allowing the commercial application of synthetic biology toolbox for filamentous fungi, novel strategies can be this class of compounds and the exploitation of this fermentative process applied for the discovery, production and modification of natural prod- at industrial scale 2. The CSI resulted in many genomic alterations, such ucts into effective antibiotics. as: amplification of the penicillin biosynthetic gene cluster 3, increased Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic amino acid metabolism 4, proliferation of microbodies that harbor the key enzymes involved in β-lactam synthesis 5, overexpression of various transporters and morphological changes that contribute to the efficiency of large scale fermentation 6. Interestingly, the CSI also resulted in the re- pression and inactivation of other secondary metabolites gene clusters 7, likely to divert nitrogen and carbon sources towards the increased pro- duction of the non-ribosomal peptide precursor of β-lactams, as well as to reduce pigment formation interfering in penicillin product recovery and purification. Recently, Penicillium species have been described that secrete a variety of secondary metabolites 8; 9, but most have not been fully char- acterized or explored for possible pharmaceutical applications 10; 11; 12; 13; 14; 15. Additionally, a potentially interesting feature of the CSI improved P. chrysogenum strains is that they provide a great platform for the fermentative production of semi synthetic antibiotics, as exemplified by a metabolic engineering project on fermentative production of adi- poyl-cephalosporins 16; 17. This was realized by the introduction of a novel, heterologous enzyme, adipoyl-7-aminodeacetoxy-cephalosporanic acid synthase and the feed of adipate as (β-lactam) side chain precursor, al- lowing the rapid development of a new generation of production strains of adipoyl-cephalosporins 18; 19; 20.

Introduction 11 REVIEWS

fluoroacetate resistance selects for mutants that lack etate, for example, can no longer use acetate — the acetyl CoA synthetase activity15,16. The value of these natural substrate for acetyl CoA synthetase — as the systems is that they allow two-way selection for loss- sole carbon source. Mutants that have regained and regain-of-function mutations in the same gene. enzyme function can then be selected by their ability Mutants that are selected for resistance to fluoroac- to grow on acetate.

Box 1 | Life cycle of Aspergillus nidulans The fungal mycelium of One drawback of the use of P. chrysogenum is the poorly developed A. nidulans is a web of branched filaments Ascospore genetic toolbox. In recent years, major advancements have been made (hyphae) of connected compartments or cells, to increase the efficiency of transformation and gene deletion, as well as which each contain several Cleistothecium of the use of plasmids to express heterologous genes. In this thesis, we nuclei (see centre figure). This mycelium, or 1 Ascus 1 will focus on the discovery of novel fungal compounds by deletion of two homokaryon, which develops from a single Conidiospore highly expressed groups of genes involved in secondary metabolites pro- haploid spore, Ascospore differentiates many duction and on the application of different synthetic biology techniques identical asexual spores currently available for genetic engineering of filamentous ascomycetes, known as conidia or conidiospores (see the Meiosis and in particular P. chrysogenum. We will also discuss how these tech- asexual cycle in the figure). A. nidulans is homothallic, niques can be applied to further develop these organisms as cell factories which means that it is self- for secondary metabolite production. fertile, but crosses can be Ascogenous initiated by hyphal fusions hypha between homokaryons

with genetically different fungus Penicillium chrysogenum nuclei (shown by white and dark green nuclei). The 1. FILAMENTOUS FUNGI resulting heterokaryons are Haploid homokaryon not stable, but can be forced to maintain a Filamentous fungi are eukaryotic organisms and in the taxonomic group balanced ratio of the component nuclei by of Ascomycota, there is the extensive and important genera that includes Mitotic including complementing ++ nuclear Aspergillus, Penicillium, Fusarium, and Claviceps species 21. They can be auxotrophic mutations in division the parental nuclei and Haploidization found in soil, air, fruits and even in extreme environments such as the forcing growth without the Antarctic ice core 22; 23. Recently, new Penicillium species were found in corresponding Fusion supplements. Sexual cycle of the filamentous engineering Synthetic biology tools for metabolic marine environments, living in symbiosis with algae Laurencia and with A. nidulans can also Asexual cycle reproduce sexually (see the Parasexual cycle sponges Ircinia fasciculata and Chondrosia reniformis 24; 25. figure). In the fruiting body, which produces the Heterokaryon Filamentous Ascomycota are characterized by vegetative cells called sexual spores, a pair of hyphae and by sexual and asexual life cycles (Figure 1) 26. The hyphal cells nuclei that is destined for meiosis divides in synchrony to form a mass form compartments, which harbor various organelles, like nuclei, mito- Figure 1. Filamentous fungi A. nidulans life cycle.­ Unstable of cells known as the but can be chondria and organelles with specialized functions like peroxisomes, gly- ascogenous hypha. These In the asexual cycle (orange arrows), from a veg- maintained Diploid homokaryon hyphae are highly 27 etative mycelium (hypha), a spore called conidio- oxysomes and woronin bodies . branched and each tip cell becomes an ascus (a specialized cell) in which the two haploid nuclei fuse. The diploid nucleus undergoes meiosis followed by a These special organelles are also generically called microbodies and post-meiotic mitosis, which resultsphore in the(haploid formation nuclei) of eight is released.haploid ascospores. In presence The fruiting of body, called the cleistothecium, can hold tens of thousands of ascospores, which are released into the environment when the cleistothecium bursts open. next to their structural function they play a role in several metabolic pro- In addition to an asexual cyclefavourable and sexual cycle,conditions a parasexual the sporescycle offers germinates the genetic andbenefits of meiosis achieved through a mitotic route93. The parasexual cycle is initiated when haploid nuclei fuse in the vegetative cells of a heterokaryon and continue to divide mitotically. Crossing over might cesses including primary carbon and nitrogen metabolism (e.g. fatty ac- occur between homologues andnew random mycelium chromosome called loss homokaryon restores the haploid is formed. chromosome In number,is formed. which By is eightinduction in the case of ofspecialA. nidulans conditions. These in ids, methanol, alkanes, d-amino acids and purines), hyphal growth, spore events can be used to map genethe orders sexual and assign cycle new (pink genes arrows), to the eight in linkagea ascogenous groups. Many theclosely parental related fungi nuclei, of economic a balanced or medical ratio importance, of nuclei is such as A. niger, A. fumigatus, Fusarium oxysporum and Penicillium chrysogenum, have no sexual cycle but are exploited experimentally or genetically 28; 29; 30 germination and sexual spore formation . Microbodies are also in- using technologies developed forhypha, A. nidulans sexual94. spores (haploid nuclei) fuse to- ensured and the heterokaryon is maintained. If volved in the production of secondary metabolites 31; 32. In specific fungi gether. After meiosis and post-meiotic mitosis like genetics nuclei are combined a parasexual cy- like P. chrysogenum and Aspergillus nidulans the final steps of theβ -lactam 686 | SEPTEMBER 2002 | VOLUMEhaploid 3 ascospores, eight in the case of A. nidu- cle (green arrows) occur.www.nature.com/reviews/genetics The diploid homokaryon © 2002 Nature Publishing Group biosynthesis are catalyzed by microbody localized enzymes 33; 34; 35. lans, are formed and released from a structure continue the cycle by mitosis followed by meiosis Ascomycota are characterized by the presence of a special structure called cleistothecium. Haploid nuclei carrying and the resulting haploid homokaryon can con- called ascus where fusion of haploid nuclei and meiosis take place during different genetics nuclei (black and white nuclei) tinue to develop in the sexual and asexual cycle. sexual reproduction. However, an asexual cycle can also occur. Specif- can fuse together and an unstable heterokaryon Figure from 26 with permission. ically, from a hyphal tip a single haploid spore called conidiophores is developed. Condiaspores are dispersed by the wind and under suitable

Filamentous fungi Filamentous fungi  13 12 conditions will germinate to form new mycelia. Furthermore, a so-called 1.2. SECONDARY METABOLITES parasexual cycle can be present as observed for the first time in Asper- gillus niger 36. Specifically, such cycle occurs when two homokaryons While primary metabolites are essential and directly derived from central 1 carrying haploid like nuclei fuse together and the resulting heterokaryon metabolism, secondary metabolites are not required for primary meta- 1 continues to divide first mitotically and then meiotically 37. A new haploid bolic processes and growth of the cells 57. Production of secondary me- mycelium is formed and a new sexual or asexual cycle can begin again 26. tabolites often occurs in a late phase of growth and is usually connected Furthermore, if different nuclei of haploids fuse together, the resulting to sporulation, colony formation or other forms of cell differentiation58 . heterokaryon is unstable and a series of events, like haploidtion and/or For example, in Alternaria alternate and Aspergillus nidulans, linoleic and somatic crossing-over, occur to ensure the maintenance of the genome 38. melanins acid derivatives are required for sporulation 59; 60; 61; 62. During sporulation also toxic metabolites, such as mycotoxins are secreted 63; 64. Furthermore, inhibition of sporulation has been associated with reduced 1.1. PENICILLIUM CHRYSOGENUM aflatoxins production65; 66. In some Aspergillus species, the production of secondary metabolites is associated with the regulation of asexual and fungus Penicillium chrysogenum Penicillium chrysogenum is a filamentous fungus that belongs to the ge- sexual spore development 67; 68. Additionally, some secondary metabolites nus Penicillium 39. In nature, it is a widely distributed mold often found appear only after conidiation has been intiated69; 70. Examples of second- on foods and in indoor environments 40. Under laboratory condition, the ary metabolites and related functions are shown in Table 1. majority of this genus menbers reproduce asexually through chains of vegetative spores, called conidiospores, formed on the extension of spe- cialized hyphae, the brush-shaped conidiophores 41. Nevertheless, under Table 1. Some functionally diverse fungal secondary metabolites very specific conditions, such as oatmeal agar supplemented with biotine, Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic Secondary Refer- Penicillium species are able to sexually reproduce by induction of mating-­ Fungal producer Function metabolite ence(s) 42; 43; 44 type (MAT) loci . Butyrolactone I Aspergillus terreus Sporulation induction 71 P. chrysogenum forms a complex network of branched hypha, has green Cephalosporin Cephalosporium acremonium Antimicrobial activity 72 conidia, and sometimes secretes a yellow pigment 45; 46; 47. It can be used Cyclosporin Beauveria nivea Immunosuppressant 73 Echinocandin Aspergillus nidulans echinulatus Antifungal 74 48 49 to produce secondary metabolites like roquefortine C , secalonic acids , Ergotamine Claviceps species Vasoconstrictor 75 50 51 52 53 54 meleagrin , chrysogine , PR-toxin , sorrentanone , xanthocillin X but Fumagillin Aspergillus fumigatus Antitumor 76 is most famous for the production of several natural penicillin, β-lactam Fusarin C Fusarium moniliforme Mutagen 77 78 antibiotics 55, especially for commercial production of penicillins G and V. Gliotoxin Aspergillus fumigatus Genotoxicity Integric acid Xylariasp. HIV-1-integrase inhibitory activity 79; 80 The P. chrysogenum genome contains 13,653 ORF distributed over Linoleic acid Aspergillus nidulans Spore formation and development 61; 60 32.19 Mb 6. The genome shows significant similarities with genomes of Lovastatin Aspergillus terreus Cholesterol-lowering 81 Lysergic acid Claviceps species Hallucinogenic 75 other filamentous fungi. Of the 13,653 predicted proteins, approximately ­diethyl amide (LSD) 60% could be attributed to functional protein classes as defined for ge- Melanin analogs Alternaria alternata; Cochliobolus Spore survival and protection; 62; 82 nome sequences, e.g. related to metabolism, energy, cellular transport heterostrophus; Aspergillus fumigatus Virulence 50 and other defined classes. Meleagrin Penicillium ssp. Antimicrobial activity Mycotoxin Aspergillus spp., Penicillium ssp. Mycotoxicosis activity 66; 83; 84 In recent years, P. chrysogenum has been renamed as P. rubens, but Patulin Penicillium urticae Antimicrobial activity 85 since the fungus is used for commercial purposes, the new name finds Penicillin Penicillium ssp. Antimicrobial activity 55; 86 only slow acceptance in the field 56. Roquefortine C Penicillium ssp. Antimicrobial activity 87 Siderophor Penicillium ssp. Affects fungal growth 88 Sorbicillinoid Penicillium ssp., Aspergillus parasticus, Antimicrobial activity 89; 90; 91 Tricoderma ssp, Phaeoacremonium ssp Zearalenone Fusarium graminearum Sporulation induction 92

14 Filamentous fungi Secondary metabolites 15 Historically, the systematic study of fungal metabolites started in 1922 with the identification of more than 200 compounds by Harold Raistrick ­ 57; 93; 94;. However, it was only after the discovery by Alexander 1 Fleming of the first natural antibiotic Penicillin by the fungus P. notatum 1 in 1928 that, extensive research on fungal metabolites began 55. Penicil- lin was widely used to cure wound infections during the second world war however, the early discovery of penicillin-resistant staphylococci strains 95 followed by more antibiotic resistant strains 96 led to a decrease of penicillin use and to a search for alternative antibacterial agents 97. Further β-lactam compounds were discovered such as Cephalosporin C from a marine fungus, Cephalosporium acremonium 72. Between 1970 and 2010 many new bioactive compounds were isolated and characterized with antibiotic, antitumor, antifungal activity and found use as medicines, fungus Penicillium chrysogenum hormones or toxins, for human applications 13; 14; 98. There is a large and complex diversity of secondary metabolites and associated biosynthetic pathways. A method for classification is based on carbon and nitrogen sources, together with precursors derived from primary metabolism such as acetyl-CoA and amino acids that are utilized in the secondary metabolites pathways 99. Essentially, secondary metabolites can be classified in three main Figure 2. Schematic overview of secondary metabolites and related gene clusters in filamentous Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic groups: 1. Amino acid derivatives and non-ribosomal peptides (NRP); fungi. Penicillium chrysogenum (first, core half circle) and selected secondary metabolites are shown. 2. Fatty acids derived compounds and polyketides; 3. Terpenes and Indole Specifically, the Penicillin G, Chrysogine and Roquefortine C (second half circles) produced by penicillin, alkaloids 99. In the first group, proteogenic and non-proteogenic amino chrysogine and melagrine gene clusters, respectively (third half circle). The multi modular enzymes acids are utilized by large multi domain nonribosomal peptide synthetase NRPS present in the respective gene cluster (white gene square) and a minimal NRPS module structure, (NRPS) enzymes to synthesized non-ribosomal peptides (NRP). Ribo- which consist of an adenylation (A), thiolation (T) and condensation (C) domains are illustrated. somes are not involved in the formation of NRP, and these NRPs can have different lengths, be linear or cyclic, and further be modified by accessory enzymes. Examples are peptaibols 100 and cyclosporine 101 as well as a In nature, secondary metabolites may be mediators for communication, variety of mycotoxins called roquefortines, and analogues like melagrin growth inhibitors and habitat protectors. Indeed, fungi live in complex and glandicolin (Figure 2) 50. ecosystems where they interact with other fungi and organisms, such as In the second group, acetyl-CoA and malonyl-CoA are utilized by bacteria, algae, protozoans and metazoans and plants. Secretion of sec- polyketide synthetase (PKS) enzymes to synthesize corresponding ondary metabolites with toxic properties provide a potential competitive polyketides. A few examples are the hypolipidemic agent compactin and advance over other organisms 110; 111. lovastatin 102 or the pigments fusarubin and bikaverin 103; 104. The meva- Genes responsible for the production of secondary metabolites are lonate pathway provides isoprene units that are used by terpene cyclases often clustered 112; 113. Most likely, filamentous fungi obtained such gene to form terpenoids, the third class of secondary metabolites. They can be clusters or parts thereof from bacterial sources through horizontal trans- linear or cyclic, such as carotenoids and gibberellins 105; 106; 107. The aromatic fer 114; 115. Mutation and natural selection contributed to the diversifica- amino acid tryptophan and dimethlyallyl pyrophosphate are used to pro- tion of the compounds produced 116. Examples of mutations that induced duce indole alkaloids and related compounds, that are mainly produced diversity were found in the terpene gene cluster 117; 118 and in genes that by the fungus Penicillium and the parasitic Claviceps 75; 108; 109. code for the multi modular NRPS and PKS enzymes 119.

16 Filamentous fungi Secondary metabolites 17 Often, gain or loss of function mutations together with mutations hybrid NRPS-PKS enzymes. A few examples of hybrid NRPS-PKS enzyme that are responsible for specificity or selectivity changes in these mul- products are rapamycin 133, yersiniabactin 134, myxovirescin (also known as tifunctional enzymes, occur at the catalytic residues 120; 121. However, the antibiotic TA) 135, the cyclic pentapeptide myxochromides S1−3 136 and the 1 promiscuity of the PKS enzymes is most likely connected to intragenic antitumor agent epothilone 137; 138. 1 rearrangements, and represents the first mechanism for evolution of this The availability of fungal genome sequences in combination with mod- group of enzymes 122; 123. ern gene prediction software like SMURF (www.jcvi.org/smurf/) and AntiSMASH (http://antismash.secondarymetabolites.org/) have led to a quick identification of numerous genes and gene clusters, putatively 1.3. SECONDARY METABOLITES GENE CLUSTERS responsible for secondary metabolite production 139; 140. Recently, a sys- tematic deposition and retrieval system on data on biosynthetic gene Mostly secondary metabolite gene clusters encompass 10-25 KB 124; 125 clusters has been established, i.e., the minimum information about a and are co-located on a single chromosome, although there are excep- Biosynthetic Gene cluster (MIBiG) data standard 141. This will prevent re- tions. For the biosynthesis of meroterpenoids by A. nidulans two separate dundancy and serves as a quick resource to determine if compounds have fungus Penicillium chrysogenum gene clusters are needed that are located on different chromosomes126 . been described before. Interestingly, a large proportion of the identified Importantly, there is an enormous diversity of biosynthetic gene clusters gene clusters are not expressed under typical laboratory culture condi- and these are mostly not common in all fungi. tions 142. For example, the genome of P. chrysogenum encodes ten NRPS, Fungal secondary metabolites gene clusters are readily recognized twenty PKS and two hybrid NRPS-PKS genes, but only four NRPS genes by the presence of genes encoding for the key enzyme, which is either are expressed under standard laboratory conditions, the Pc21g21390 a NRPS, PKS, terpene cyclase, or prenyltransferase 127; 128; 129. These are (­pcbAB), Pc21g15480 (roqA), Pc21g12630 (chryA) respectively from peni- individual classes of enzymes, but each consists of a conserved archi- cillin, roquefortine, chrysogine gene cluster and Pc16g04690 (hcpA) that Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic tecture that can be easily recognized by bioinformatics means. Adjacent encodes a fungisporin 6; 51; 127; 143. Three out of these four genes are involved genes are responsible for the further tailoring of the primary product, in the production of the mycotoxin roquefortine, the cyclic tetrapeptide and this may include reactions like oxidation, reduction and methylation. fungisporin, and the yellow pigment chrysogenin, which inspired the sci- Additional genes are needed for regulation and the secretion of the sec- entific name of this fungus51 . Therefore, classical methods to identify new ondary metabolites. metabolites and their corresponding biosynthetic genes, such as gene in- Multi modular enzymes consist of domains that are responsible for activation and comparative metabolic profile analysis are not suitable for various sub reactions that work in concert. For example, a minimal NRPS the so-called cryptic or silent gene clusters 144. Nevertheless, the devel- ,module consists of an adenylation (A) domain responsible for amino acid opment of new genetic tools now ofers novel solutions for the discovery activation, and a thiolation (T) domain also known as peptidyl carrier pro- optimization and production of bioactive molecules as it will be discussed tein (PCP) that serves as an anchor for the growing peptide chain and in the next section. a condensation (C) domain that is responsible for transfer and peptide growth (Figure 2) 130; 131. There can be further domains, such as a thioester- ase (TE), methyltransferase (MT) or epimerisation (E) domain. Similarly, 2. GENETIC TOOLS TO STUDY FILAMENTOUS FUNGI PKS enzymes contain a ketoacyl synthase (KS) domain for decarbox- ylation of the extender unit, an acyl carrier protein (ACP) for extender Filamentous fungi have a large impact on human life since they have been unit loading and an acyltransferase (AT) domain for extender unit selec- widely used for the industrial production of diverse enzymes or metab- tion and transfer. Additionally, domains encoding enoyl reductase (ER), olites. However, due to typical filamentous fungal features, such as the β-­ketoacyl reductase (KR), methyltransferase (MT), thioesterase (TE) and multicellular and multinuclear mycelium morphology, and because of the dehydratase (DH) activity can be present to further process the polyketide lack of sufficient suitable selection marker and plasmids, genetic engi- synthesized 132. PKS and NRPS units (modules) can cooperate in so-called neering approaches for filamentous fungi are less efficient compared to

18 Filamentous fungi Secondary metabolites gene clusters 19 those available for bacteria and yeast 145. Nevertheless, the availability of on protoplasts and conidia resulting in 50% of cell death, which influence complete genome sequences 6; 146; 147, and the deletion of proteins involved the transformation efficiency159 . The gene gun method exhibits increased in non-homologous end joining (NHEJ) pathway have vastly contributed targeted delivery and genetic stability, due to the direct delivery of DNA 1 to improve the precise design and generation of genetically modified in the cell by using super-speed tungsten or gold particles. However, the 1 strains. The generation of new experimental transformation strategies tedious optimization of numerous factors negatively influence the trans- for the specific and unspecific integration of DNA sequences into the ge- formation efficiency 160. nome and the development of several novel CRISPR/Cas genome editing methods have allowed the specific manipulation of gene expression and function in a variety of filamentous fungi. Furthermore, new synthetic 2.2. SELECTION MARKERS biology tools have been exploited for modular assembly of genes and pathways, such as novel promoters and terminators libraries as well as An important requirement for efficient transformation and transformants autonomously, stable replicating plasmids, which can be used as a vector selection are specific marker genes. A series of marker genes are available for synthetic pathway reconstruction. for filamentous fungi. For instance, marker genes niaD (encodes nitrate fungus Penicillium chrysogenum The genetic tools currently available for metabolic engineering of Peni- reductase) and pyrG (encodes orotidine-5-phosphate decarboxylase) have cillium strains are discussed in the following sections. been widely used in transformation of Aspergillus species 161; 162; 163. However, to use these markers, host strains are required that either have inactive gene variants or lack these genes to allow for selection on 2.1. METHODS FOR GENETIC TRANSFORMATION nitrate or uracil respectively. Acetamidase encoded by the amdS gene of A. nidulans allows fungi to use acetamide as sole nitrogen source. This With the understanding that filamentous fungi are a useful resource for gene was used for the first time in transformation of A. nidulans 164 and Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic novel bioactive compounds such as the penicillins, further research fo- A. niger 165. Fungi transformed with the amdS and pyrG genes are sensitive cused on understanding of physiological and genetic aspects of industri- to fluoroacetamide and 5-fluoroorotic acid (5-FOA), respectively. Thus, ally important fungi. Initially, this meant the development of methods for these selection markers can be eliminated by counter selection and the highly efficient genetic transformation to facilitate uptake of exogenous resultant strain can then be used for further transformation. On the other DNA and to have more control to direct metabolism and other features hand, marker selection and counter selection are not straightforward of these fungi. In 1973, the first transformation of Neurospora crassa procedures, as often many rounds of sporulation are needed followed by was reported 148, which a decade later was followed by transformation growth on selective medium for strain purification, because of the multi methods for A. nidulans 149; 150; 151. DNA uptake was achieved mainly by nuclei features of filamentous fungi36; 166. Further selection markers are

using protoplast and Polyethylene glycol/CaCl2. Protoplasts are readily based on bacterial antibiotic resistance genes such as ble (phleomycin), obtained from fungal mycelium by means of enzyme cocktails contain- hph (hydromycin) and nat (nourseothricin) that are placed under con- ing various cell-wall degrading enzymes 152. To increase the DNA delivery, trol of a fungal promoter 167; 168; 169. Such dominant selection markers can protoplasts were also fused to liposomes, synthetic lipid vesicles that readily be used but also spontaneous resistance to the drugs may occur, have been shown to enhance transformation efficiency 153. However, not while proper growth conditions need to be used to prevent significant all filamentous fungi show efficient formation and regeneration rates of background growth. Therefore, fungal transformation and selection can protoplast 154. Therefore, new types of transformation protocols were in- be laborious, time consuming and with low reproducibility. troduced utilizing lithium acetate (LiAc) treatment 148, electroporation 155 The restricted number of selectable marker genes that are available for or a biolistic particle delivery system methods (gene gun) 156; 157. filamentous fungi hampers multiple gene modifications. This drawback has LiAc treatment does not depend on protoplast formation, but on cell been addressed using site-directed recombination technology tools such permeability induced by Li+ ions thereby, increasing the transformation as the yeast FLP/FRT 170, β-rec/six 171 and the bacteriophage Cre-loxP re- efficiency 158. Electroporation is based on the application of high voltage combination system 172 or the CRISPR/Cas9 system 173; 174 (See section 2.6).

20 Genetic tools to study filamentous fungi Selection markers 21 2.3. CHROMOSOMAL DNA INTEGRATION 2.4. SPECIFIC CHROMOSOME EDITING METHODS

To introduce DNA into the fungal genome, homologous or heterologous To study gene and protein functions and interactions, a set of molecu- 1 recombination events are used. Homologous integration may occur via lar tools and strategies are available 191. For example, mutagenesis is an 1 a single or double cross-over event, using DNA fragments carrying the efficient method to investigate gene function and to observe related upstream and downstream flanking sequences of the target gene and the phenotypic changes in fungi. Considerable mutant frequencies may be selection marker gene. In this way, it is possible to realize gene disruption achieved by increasing the target sites for recombination by means of a or deletion events. Often, this process occurs with a very low frequency, restriction enzyme mediated integration (REMI) mutagenesis strategy. In compared to heterologous integration, and typically long flanking regions the REMI procedure, mutations can be generated by random insertions are required (>1000 kbase) 175. To increase the efficiency of homologous of DNA fragments into the fungal genome that has been treated with integration, Agrobacterium tumefaciens-mediated transformation (AMT) the same restriction enzymes used to generate the exogenous fragments. was developed. Specifically, this Gram negative soil bacterium contains This technique, which relies on protoplast transformation, was applied for a plasmid with a so called T-DNA which is able to introduce desired gene the first time with S. cerevisiae and later used widely for the simultane- fungus Penicillium chrysogenum sequences into the host genome. Agrobacterium tumefaciens-mediated ous mutagenesis and tagging of genes in filamentous Ascomycete such as transformations (AMT) resulted to be 600 times more efficient than PEG ­Cochliobolus heterostrophus 192; 193. transformation and is therefore used in filamentous fungi for gene over- A functional equivalent of the REMI procedure is Transposon arrayed expression, gene knockouts, gene complementation studies, as well as for gene knockout (TAGKO). The TAGKO technique is based on the use of generating random genome integrations 176; 177. homologous or engineered heterologous transposons (TE) which are Consequently, the need to understand the molecular mechanism of the ubiquitous mobile genetic elements that can be easily transferred into ATM transformation led to the characterization of the non-homologous heterologous hosts and therefore, do not require a high frequency fungal Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic end-joining (NHEJ) DNA-repair pathway. A multi-subunit complex, where transformation approach 194; 195. Ku70, Ku80 protein dimers are involved in the direct ligation of the double Specific and targeted DNA modification tools are very useful for the stranded break ends of DNA 178. precise editing of the genome. For this purpose, enzymes derived from In a NHEJ deficient strain179 the efficiency of homologous recombi- bacteria and fungi that are able to induce site-specific recombination nation is markedly increased, up to 100% 180 while shorter homologous events can be used. Recombinases, such as CRE/FLP, are able to specif- flanking regions (~500 bps) can be used181; 182; 183; 184; 185. ically recognize short nucleotide target sequences. With LoxP/FRT this Heterologous recombination in filamentous fungi is relatively efficient concerns an asymmetric 8 bp spacer flanked by 13 bp inverted repeats and leads to mitotic stability. However, this method has the risks that and when two of such structures are present, specific recombination multiple copies of a specific gene are incorporated while expression is events can be induced (Figure 3) 172; 196; 197; 198; 199. not only affected by the copy number but also influenced by the inte- These techniques were successfully used for genetic engineering in gration position 186. Multi copy transformants can be obtained by co-­ yeast, mammals and filamentous fungi, since they can be used to intro- transformation of non-selected plasmids carrying the target sequence duce insertions, deletions, inversions and translocations at specific sites and a plasmid that harbors the selection marker. This can result in higher in the genome 200; 201; 202; 203. levels of expression and mitotic stability 187. The disadvantage is that the Another strategy to induce specific targeting and modification of de- copy number cannot be controlled and chromosomal integration occurs fined DNA sequences in vivo is by site-specific nucleases. Specifically, at undefined sites188; 189; 190. these engineered nucleases induced double-strand breaks at a target site location in the genome that is then successively repaired by the nonho- mologous end-joining (NHEJ) or homologous recombination (HR) systems resulting in a specific mutation. There are four classes of engineered nucleases that are frequently used

22 Genetic tools to study filamentous fungi Specific chromosome editing methods 23 The TAL effector proteins, provides a DNA-binding domain with less strin- gent binding requirements compare to ZFNs but they may also causing off-target mutations. Moreover, ZFNs and TALEN-based approaches can 1 be used to modify defective genes in the genome, which is a so-called gene 1 therapy practice. Examples of in vivo and in vitro gene corrections are the repair of the interleukin-2 receptor common gamma chain (­IL-2Rγ) 211 and the X-linked severe combined immunodeficiency (X-SCID) 212 in mammals. Although the aforementioned studies with nucleases provide very effi- cient genome editing techniques, a main breakthrough was achieved by a RNA guided double-strand break induction system named CRISPR­ ­/Cas9 system (clustered regularly interspaced short palindromic repeats (CRISPR associated). This bacterial based system relies on DNA recognition medi- ated by a single guide RNA (sgRNA) and on nuclease Cas9 that is directed fungus Penicillium chrysogenum to the target DNA sequence by the sgRNA (Figure 4) 213; 214. In filamentous fungi, the CRISPR/Cas9 system can be carried by an AMA fungal vector and it can lead to nonspecific mutations or to specific gene integration at the genomic locus of interest by the non-homologous end-joining (NHEJ) Figure 3. Schematic representation of the LoxP recognition sequence and recombination reactions. or by the homologous recombination (HR) systems, respectively. In the Panel A. An 8 bp spacer (bold) is flanked by 13 bp inverted repeats. The grey arrows indicate the di- latter case, donor DNA is co-transformed with the AMA fungal vector rection of the sequences. Panel B. Based on the direction of the loxP sequences, site-specific CRE (section 2.5) 174. Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic recombinase can execute three type of reactions. If sequences (grey triangles) are orientated in the In fungi, only few RNA polymerase III promoters responsible for sgRNA same direction, a segment of DNA is excited and a single recombination site is left behind. With the expression have been identified. Therefore, the sgRNA is expressed as a reverse mechanism, DNA can also be inserted. Conversely, when recombination sequences have op- chimeric larger RNA transcript by RNA polymerase II and then later con- posite orientation an inversion reaction occur. If recombination sites are situated in two separate DNA verted by ribonuclease cutting on sites engineered in the sgRNA expres- molecule, a translocation reaction take place. sion construct 25; 215. Moreover, there are several types of Cas nucleases that have been used and probably many more types remain to be dis- covered. Since they can cleave nearly any DNA sequence complementary for this purpose: Meganucleases, Zinc finger nucleases (ZFNs), Transcrip- to the guide RNA, they make gene editing very simple. Therefore, the tion Activator-Like Effector-based Nucleases (TALEN), and the ­CRISPR/Cas CRISPR/Cas system was successfully applied in numerous organisms as system 174; 204; 205. Meganucleases recognize a stringent DNA sequence diverse as humans, plants, parasites 216; 217 and microbes, including several (>14bp) thus, they cause less toxicity in cells compared to non-specific filamentous fungi173; 174; 204; 218. nucleases. However, the number of specific meganucleases is limited and their construction to cover all possible sequences is a costly and time-consuming activity 206; 207. Therefore, alternative approaches using 2.5. DNA ASSEMBLY zinc finger nucleases (ZFNs) and engineered meganuclease were devel- oped 208. These methods are based on the recognition of specific nucleo- To build genomic libraries or biosynthetic gene clusters, often several tides by a complex of a zinc finger protein and a nonspecific DNA-cleaving smaller DNA elements such as promoters, ORFs and terminator se- enzyme fused to a FokI sequence-specific recognition endonuclease209; 210. quences, have to be carefully assembled together into larger functional Lately, an alternative and readily programmable DNA binding domain gene or biosynthetic gene cluster expression units. This laborious process was used, the Transcription Activator-like Effector Nucleases (TALENs). requires highly efficient, simple and cost-effective assembly strategies.

24 Genetic tools to study filamentous fungi DNA assembly 25 incomplete digestion/ligation 221. Nevertheless, these methods have been used for a wide range of applications from plasmid library construction to synthetic metabolic pathway assembly in several organism, including 1 filamentous fungi 222. 1 The system that ensures the best performance with multiple (>25) long (up to several hundred bps) fragments is based on the use of recombinase or exonuclease in vivo 223; 224. The first in vivo recombination system was used in E. coli to construct a bacterial artificial chromosome (BAC) vec- tor followed by more efficient recombination systems in yeast that were used to construct a yeast artificial chromosome (YAC) vector225; 226. Only very short homologous sequences (>25 bps) are needed for homologous recombination in S. cerevisie and this can be easily achieved by PCR. In recent years, efficient and accurate in vitro recombinase-based technol- fungus Penicillium chrysogenum ogies have led to new cloning systems such as In-Fusion, Gateway™ E.G. Clonetech™, and BioCatTM Cold-Fusion. In addition, fusion PCR or over- lap extension PCR (OE-PCR) methods were developed 227. In recent years even simpler and highly effective cloning methods were developed such as PIPE (polymerase incomplete primer extension) 228, SHA (successive hybridization assembly) 229 and OSCAR (one-step con- struction of Agrobacterium-recombination-ready plasmids 230. These PCR Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic methods are successful in building gene targeting cassettes with large homologous flanking regions (>1 Kb), that can be used for the transfor- mation of filamentous fungi176; 231. Figure 4. Schematic representation of the CRISPR/Cas system in filamentous fungi. Another in vitro assembly method based on a PCR reaction is the Cutting sites are indicated by small scissors. A) A genomic target sequence is cut at the PAM site ­Gibson isothermal assembly. In this method DNA fragments carrying by Cas9guided RNA (sgRNA). B) Chimeric sgRNA construct carrying hammerhead (HH) ribozyme, 20-40 bps overlaps are mixed with exonuclease, DNA polymerase, and sgRNA and hepatitis delta virus ribozyme (HDV). C) Left side: AMA1 fungal vector containing Cas9 and DNA ligase and incubated at 50°C for up to one hour, resulting in a unique sgRNA genes is transformed into fungus. Site-specific double strain breaks (DSB) are induced by the DNA assembly fragment 232. This powerful cloning method shows a high Cas9/sgRNA system and repaired by NHEJ resulting in mutation (yellow spot). Right side: Cotransfor- efficiency when it concerns large (>20 Kb) assemblies 233, but it is costly mation of AMA1 fungal vector and of donor DNA (both in linear or circular form) into fungus. The DSB and recombinase dependent 234 However, the combination of Gibson clon- are repaired by HR resulting in target integration (orange spot). Figure from 215 ing with in vivo recombination in YACs allowed the creation of the first artificial Mycoplasma genitalium genome 232. Successful applications of the aforementioned modular assembly tools In this regard, in recent years several methods have been developed to concern the multi modular polyketides (PKS) and non-ribosomal (NRPS) rapidly assemble two or three fragments into a linear gene expression enzymes. In fact, to expand the molecular diversity of the pharmacolog- cassette. A common and widely used method is based on restriction ically important produced metabolites, a variety of modular combination enzyme-based assembly. Because of its simplicity, this method is used and modifications have been investigated 235; 236; 237 employing modular for more complex assemblies and scar-less systems such as Golden Gate, assembly techniques. BioBrick™ and BglBricks 219; 220. The implemented assembly systems show good performance with multiple fragments, but a major drawback is still

26 Genetic tools to study filamentous fungi DNA assembly 27 2.6. PROMOTORS AND TERMINATORS 2.7. AUTONOMOUSLY REPLICATING PLASMIDS

Important elements of a synthetic biology toolbox are promoters and termi- Many bacteria and yeast species harbour natural plasmids that carry 1 nators that vary in strength. Many studies aim to improve the level of pro- autonomously replicating sequences (ARSs) allowing the replication of 1 tein expression 238. This depends on the use of strong promotors. Typically, the plasmid. These plasmids can be used with an appropriate selection both endogenous and exogenous promoters have been used for this pur- marker to introduce new genes into the host cell with high frequency 249. pose. Specifically, during the past two decades, gene (open-reading-frame, In contrast, in filamentous fungi, plasmids are almost completely absent. orfs) sequences from higher eukaryotes, such as mammals and plants and A. nidulans possess an ARSs termed AMA sequence 250 that confers au- even bacteria, have been expressed in Aspergillus and in Trichoderma. For tonomous replication of plasmid vectors in several filamentous fungal instance, the mammalian chymosin gene has been expressed in A. nidulans, species 249; 251; 252. However, this type of plasmid was used so far only to a using the A. niger glucoamylase promoter (glaA) 239 or lysozyme 240 and glu- limited extent, because of poor stability and the risk that the plasmid in- coamylase 241 were expressed in A. niger employing the A. nidulans glycer- tegrates into the genome 165; 187; 252; 253; . Furthermore, to obtain more stable aldehyde-3-phosphate dehydrogenase promoter (gpdA). Recently, a set of plasmids, centromeric and telemeric sequences were investigated in fila- fungus Penicillium chrysogenum promoters was tested and characterized on, inducibility, timing and level of mentous fungi 254; 255; 256. Linear plasmids containing telomeric sequences expression, using a reporter system that can be used in P. chrysogenum 242. were constructed and have been shown to increase the transformation However, often strong expression is not recommended, especially for efficiency of the filamentous ascomycete Fusarium oxysporum and ­Nectria the production of bioactive natural products like antibiotics and toxins. haematococca several thousand fold. However, the autonomous plas- Then, the expression of a gene needs to be tightly tuned. One of the pro- mids were unstable without selection and they were poorly transferred moters of the alcohol regulon is the alcohol dehydrogenase alcA which is during cell division 257; 258. One potential application of these telomeric easily regulated by the presence of alcohols/ketones and lactose/glycerol sequences was to combine them with centromere sequences (and, or Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic that induce or repress, product formation respectively. This system was AMA sequences) to construct artificial fungal chromosome vectors, like used successfully to express endoglucanase and interferon α2 in A. nidu- the well-known yeast artificial chromosomes (YAC) vectors. Such vectors lans 243. Another example of a tunable expression system that uses metab- would allow the use of large fragments of DNA in the construction of olism-independent promoters is the Tet-on/off. The system was applied genomic libraries for biosynthetic gene clusters and redesigned metabolic for several model fungi like A. niger 244 and A. fumigatus 245. The tetracycline pathways. However, not many fungal centromere sequences have been transactivator (tTA) or the reverse tetracycline transactivator (rtTA2s-M2) identified and characterized so far 259; 260. are controlled by metabolism-independent promoters like xyl (xylose) or Generally, plasmid can be maintained by the use of a selective marker, gpdA (glyceraldehyde-3-phosphate dehydrogenase) and are able to bind which has the downside to be costly due to the continuous use of antibi- to DNA at specific TetO operator sequences that are usually upstream the otic into the medium. Additionally, only a series of marker genes are avail- promoter of interest. The presence or absence of the antibiotic tetracy- able for filamentous fungi (section 2.3). Therefore, the design of novel cline or one of its derivatives (e.g. doxycycline) regulates the binding of type of mitotic stable plasmids that are marker independent represent tTA and rtTA2s-M2 to the TetO sequences. This artificial gene expression one of the future tools in fungal synthetic biology research. system can be envisioned for many applications such as gene therapy and for controlled protein production in microbial production strains 244; 246. Besides promoters, terminator sequences are other important features CONCLUDING REMARKS in the construction of gene expression systems for homologous and het- erologous proteins expression. Therefore, terminator sequences from sev- The battle against multidrug resistant bacteria provokes an urgent need eral filamentous fungi have been investigated and used in the construction for novel antibiotics based on novel, unique core structures. Filamen- of expressing cassettes. Selected examples are the A. nidulans trpC 247, the tous fungi fulfil an important role in industrial biotechnology because N. crassa arg-2 248 and the A. nidulans AN4594.2 and AN7354.2 242. of their use for the production of a broad range of enzymes and natural

28 Genetic tools to study filamentous fungi Autonomously replicating plasmids 29 products 238. For about two decades, molecular genetic tools have enabled gene cluster. Moreover, the secondary metabolite deficient strain pro- us to engineer these organisms for production metabolites and enzymes duces novel metabolites that have not yet been associated with a specific by expressing extra copies of both endogenous and exogenous gene. secondary metabolite gene cluster. 1 However, despite their importance only few model fungi have been stud- 1 ied in detailed and only relatively few genetic tools are currently available Chapter 3 presents an inventory of possible promoters and their strength For that reason, a challenge for the future is to develop and use more for use in P. chrysogenum. This inventory is based on a modular reporter advanced synthetic biology tools for a broader range of fungi. In fact, system employing the red fluorophore DsRed under control of a specific these tools can be applied to engineer novel filamentous fungal strains Aspergillus and Penicillium promoter, which acts as an internal standard for the expression of newly designed biosynthetic pathway, to discover, and the green fluorescent protein gene under control of one of the se- modify and characterize novel natural products, hopefully including novel lected promoters. These vectors were constructed as synthetic pathways structures with antimicrobial-antibiotic activities. using Golden gate and in vivo homologous recombination in the yeast Saccharomyces cerevisiae, and transferred into P. chrysogenum. Subse- quent strains were analyzed in the Biolector system, which provides a fungus Penicillium chrysogenum SCOPE OF THIS THESIS semi high throughput fermentation system that allows on-line monitor- ing of various parameters. The inventory of promoter strengths adds to Classical strain improvement (CSI) has had a big impact on the devel- the synthetic toolbox development. opment of Penicillium chrysogenum as an industrial strain. This involved mostly random mutagenesis and selection. However, as of now new Chapter 4 describes the refactoring of the penicillin biosynthetic gene synthetic biology methods have hardly been applied to enhance the cluster in a P. chrysogenum strain lacking this cluster. In addition, the industrial potential of this fungus. In this thesis, we aim to expand the chapter describes an AMA plasmid based expression system that is stably Synthetic biology tools for metabolic engineering of the filamentous engineering Synthetic biology tools for metabolic set of genetic tools for metabolic engineering of the filamentous fungus maintained in cells due to the presence of an essential gene. This plasmid Penicillium chrysogenum. Furthermore, we describe the design of an effi- acts as a novel platform for metabolic engineering approaches. Herein, cient host strain that can be used for the identification of novel secondary the β-lactam pathway which comprises three genes (pcbAB, pcbC and metabolites and for the production of natural and unnatural compounds. penDE) was reassembled from large DNA fragments using in vivo recom- bination in P. chrysogenum. The pathway was targeted into original pen Chapter 1 describes an introduction to filamentous fungi with the specific locus, an alternative chromosomal location and the AMA vector, and pen- emphasis on P. chrysogenum, and gives some insights on the metabolites icillin production levels were compared. The pathway refactoring is a first produced by the secondary metabolism of filamentous fungi and the ge- step toward the modification of the penicillin biosynthetic gene cluster netics behind these metabolites production. This chapter also describes for the production of alternative β-lactam antibiotics. the genetic toolbox available for engineering ranging from DNA assem- bling and editing methods to promoter parts and autonomously replicat- Chapter 5 provides a summary and presents future perspectives of the ing plasmids. work described in the thesis.

Chapter 2 describes a method for the generation of a secondary metab- olite free strain by deletion of two highly express secondary metabolites gene clusters, chrysogine and roquefortine in a strain of P. chrysogenum that was already cleared from its multiple penicillin gene clusters. The engineered strain shows that the deletion of the chrysogine gene cluster resulted in increased levels of roquefortine metabolite production with- out affecting the expression of the core NRPS enzyme of the roquefortine

30 Scope of this thesis Scope of this thesis 31 TOWARDS A SECONDARY METABOLITE DEFICIENT STRAIN OF PENICILLIUM CHRYSOGENUM

Fabiola Polli1, Annarita Viaggiano1, Oleksander Salo1, Peter Lankhorst2, Rob van der Hoeven2, Roel. A. L. Bovenberg2,3, Arnold J. M. Driessen1

1Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands 2DSM Biotechnology Centre, Delft, The Netherlands 3Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands 1. INTRODUCTION

Microbes produce many metabolites including products that are termed secondary metabolites. These compounds are usually formed at the late stages of cell growth and development 58 and often have an ecological function like defense mechanism(s), for instance by serving as antibiot- ics or pigments, that protect the cell against radiation damage 99. Fungi produce a multitude of low-molecular-mass metabolites of the unique biosynthetic pathways encoded in the gene clusters 261. Such genomic ABSTRACT sequences can stretch up to more than 10,000 bases 125 and are usually 2 located on a single chromosome 126. Some of these gene clusters are com- Secondary metabolism of the filamentous fungus Penicillium chrysoge- mon to most fungi, but their occurrence can also be limited to a spe- num has been intensively explored to relate specific secondary metabo- cific subset of species. Secondary metabolites gene cluster are readily lites to their respective biosynthetic gene clusters. We have removed the identified in fungi as they often include a gene encoding a large multi three main biosynthetic gene clusters that specify the antibiotic penicil- modular enzymes such as the non-ribosomal peptide synthetases (NRPS) lin, the mycotoxin roquefortine and the yellow pigment chrysogine, in or polyketide synthases (PKS) 127; 129. Often these core genes are sur- order to generate a secondary metabolite deficient strain. This strain rounded by other genes that fulfil specific functions in tailoring the basic chrysogenum Penicillium produces increased levels of other secondary metabolites some of chemical scaffold. Therefore, many gene clusters specify a multitude of which have not been detected before. structurally related compounds. The genome of the filamentous fungus Penicillium chrysogenum contains 10 NRPS, 20 PKS and 2 hybrid NRPS- PKS encoding genes. DNA microarray analysis of an industrial variant of this fungus revealed that only four NRPS genes are expressed under Towards a secondary of metabolite deficient strain Towards standard laboratory conditions 6. These are the gene clusters responsible for the production of the antibiotic penicillin, the mycotoxin roquefortine, the cyclic hydrophobic tetrapeptide fungisporin, and the yellow pigment chrysogine 51; 127; 143. These compounds dominate in the secondary metab- olome for this particular P. chrysogenum strain 7. Here, we have constructed a strain that lacks three main secondary metabolite gene clusters, i.e., penicillin, roquefortine and chrysogine. Consequently, the secondary metabolome of this strain is highly reduced, but the removal resulted in the production of compounds that were not observed and characterized before. Our data suggests an altered expres- sion profile of secondary metabolite genes and a redistribution of the nitrogen flux because of the loss of specific secondary metabolite path- ways, contribute to this phenomenon. Furthermore, we propose that the secondary metabolite deficient strain will be an excellent generic host for the production of other secondary metabolites.

Introduction 35 2. MATERIALS AND METHODS oligonucleotides designed according to the gateway guidelines and listed in Table S1 of Supplementary information. The acetamidase gene (amdS) 2.1. CHEMICALS and the phleomycin resistance gene (ble) were used as selection marker for the deletion of chrysogine and roquefortine gene clusters, respectively. HPLC-grade acetonitrile and formic acid were purchased from Biosolve Primer sequences necessary for the amplification of the selection markers (The Netherlands). in line with the gateway procedure are listed in Table S1 of Supplementary information. The phleomycin resistance cassette was PCR amplified from a pENTRI-phleo plasmid kindly donated by Mr. Jeroen G. Nijland while amdS 2.2. STRAINS, MEDIA, AND CULTURE CONDITIONS was synthesized by PCR from the pENTRI221-amdS plasmid. 2 P. chrysogenum DS68530 in which the 8 copies of the penicillin biosyn- 2 Escherichia coli DH5α strain, restriction enzymes, DNA polymerase, and T4 thesis genes have been removed was transformed with 1.5 µg linearized DNA ligase used in this study were purchased from New England Biolabs amdS deletion cassette 262. Transformants termed DS68530∆chy, were se- (Beverly, MA, USA). Penicillium chrysogenum DS68530 (∆hdfA, ∆pen-cluster) lected on regeneration plates containing 0.1% acetamide supplemented was kindly provided by DSM Sinochem Pharmaceuticals Netherlands B.V. medium as sole nitrogen source to select for the presence of the amdS To obtain mycelium of P. chrysogenum for transformation and DNA isola- gene. DS68530∆chy transformants were subsequently transformed with tion, fresh (108) conidiospores were inoculated into YGG medium contain- 1.5 µg of the linearized phleo deletion cassette 262, and transformants

ing (in g/liter): KCl, 10.0; glucose, 20.0; yeast nitrogen base (YNB), 6.66; termed DS68530∆chy∆roq were selected on phleomycin (50 mg/l) plates. chrysogenum Penicillium

citric acid, 1.5; K2HPO4, 6.0; and yeast extract, 2.0. After inoculation, cul- tures were incubated for 24 h in a rotary incubator at 200 rpm at 25°C. For analysis and RNA extraction spores were inoculated in secondary metab- 2.4. CHROMOSOMAL DELETION ANALYSIS olites production (SMP) medium with the following reagents (in g/liter)

glucose, 5.0; lactose, 36; urea 4.5; Na2SO4, 2.9; (NH4)2SO4, 1.1; K2HPO4, For the determination of the integration of the deletion cassette into Towards a secondary of metabolite deficient strain Towards 4.8; KH2PO4, 5.2; supplemented with 10 ml of a trace element solution the selected genomic regions, genomic DNA (gDNA) was isolated after containing (in g/l): FeSO4·7H2O, 24.84; MgSO4·7H2O, 0.0125; EDTA, 31.25; 48 h of growth in YGG medium using a modified yeast genomic DNA iso- 263 C6H6Na2O7, 43.75; ZnSO4·7H2O, 2.5; CaCl2·2H2O, 1.6; MgSO4·H2O, 3.04; lation protocol in which the fungal mycelium is broken in a ­FastPrep H3BO3, 0.0125; CuSO4·5H2O, 0.625; Na2MoO·2H2O, 0.0125; CoSO4·7H2O, FP120system (Qbiogene, Carlsbad, CA, USA). Diagnostic primers for ge- 0.625. All chemicals were from Merck. Solution was adjusted to pH 6.5. The nomic integration site check are listed in the Table S1 of Supplementary mycelium was grown in a shaking incubator at 200 rpm for 168 h at 25°C. information. To analyse the expression of all the nrps/pks genes in the DS68530∆chy and DS68530∆chy∆roq strains, total RNA of the host strains was isolated after 168 hours of growth in secondary metabolites 2.3. DELETION CASSETTE CONSTRUCTION production medium using Trizol (Invitrogen), with additional DNase treat- ment using the Turbo DNA-free kit (Ambition). Total RNA was measured Multisite Gateway Three-Fragment Vector Construction kit (Invitrogen) with the NanoDrop ND-1000 and concentrated to 500 ng per cDNA reac- was used to build the different deletion cassettes as described262 . The tion. cDNA was obtained using the iScript cDNA synthesis kit (Bio-Rad) upstream regions of Pc21g12570 (chryE) and the downstream regions of in a final volume of 10 µl. The expression levels were analyzed in tripli- Pc21g12640 (chryR) (named 5’FR chy and 3’FR chy, respectively) and the cate with a MiniOpticon system (BioRad). The SensiMix SYBR mix (Bioline, upstream regions of Pc21g15420 (roqT) and the downstream regions of Australia) was used as a master mix for the quantitative PCR (qPCR) with Pc21g15480 (roqA) (named 5’FR roq and 3’FR roq, respectively), were used for 0.4 µM of primers. The following thermocycler conditions were used: targeted genomic integration of the deletion cassette. These regions were 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and synthesized by PCR from P. chrysogenum DS68530 genomic DNA using the 72°C for 30 s. Subsequently, a melting curve was generated to determine

36 Materials and methods Chromosomal deletion analysis 37 the specificity of the qPCR reactions. Theγ -actin (Pc20g11630) was used 2.6. IDENTIFICATION OF STRUCTURAL CLASSES OF as control for normalization while a negative reverse transcriptase (RT) METABOLITES control was used to determine the gDNA contamination in isolated total RNA. The expression ofγ -actin gene in DS68530∆chy∆roq, DS68530∆chy The identification of unknown compounds was performed using high res- and DS68530 showed Ct values of: 19.98 ± 0.20, 19.27 ± 0.09, 19.7 ± 0.14, olution mass spectrometry and 1H-NMR. NMR spectra were recorded on 19.96 ± 0.15, demonstrating comparable expression levels in the different a Bruker Avance III 700 MHz spectrometer with a 3 mm TCI cryoprobe. strains. Diagnostic primers for qPCR analysis are listed on Table S2 of 250-300K were used as sample ranged temperature. 1D 1H spectra, COSY, Supplementary information. TOCSY, HSQC and HMBC spectra were recorded at 300 K with standard Bruker pulse sequences. To perform MS analysis, NMR samples were di- 2 luted 100× in 50/50/0.1 MQ/ACN/FA. The continuous infusion (5µ l/min) 2 2.5. METABOLOMICS PROFILING has been applied on an Orbitrap (Thermo Scientific) in positive mode at 7500 resolution in profile mode (See Supplementary information). Liquid chromatography–mass spectrometry (LC-MS) was used for mo- lecular analysis. Triplicate shake flasks cultivations were performed with P. chrysogenum DS68530 and the derived strains. Samples were centri- 3. RESULTS fuged (14,000 × g for 5 minutes) and the supernatant was filtered using

0.2 µm syringe filters with polypropylene housing (VWR International 3.1. DELETION CASSETTE ASSEMBLING STRATEGY chrysogenum Penicillium Ltd.) 60 µL of supernatant was transferred to an auto sampler vial. For separation, the Accella 1250™ HPLC system coupled in-line to an ESI-MS P. chrysogenum strain DS68350 is derived from strain Wisconsin 54-1255 Orbitrap Exactive™ (Thermo Fisher Scientific, San Jose, CA) was used. through classical stain improvement, and in this strain the highly ampli- A scan range between m/z 80 and m/z 1600 in positive ione (4.2 kV spray, fied penicillin biosynthetic gene cluster has been removed genetically 7; 264. 87.5 V capillary and 120 V of tube lens) mode, with capillary tempera- This strain also lacks the hdfA gene that is involved in the non-homol- Towards a secondary of metabolite deficient strain Towards ture set at 325°C was used. Separation was performed on a Shim-Pack ogous end joining recombination process to facilitate homologous re- XR-ODS™­ c18 column (3.0 × 75 mm, 2.2 µM) (Shimadzu, Kyoto, Japan). combination. Previously, in this strain elevated levels of roquefortine The elution was performed using a linear gradient. It started with 90% of and chrysogine-related compounds were observed which was attributed solvent A (100% water) and 10% solvent C (100% acetonitrile) for 5 min to a redistribution of the nitrogen flux because of the lack of penicillin at flow rate of 300 µL/min. The solvent C after 30 minutes reached 60% production 7. To obtain a secondary metabolite deficient strain, the en- and increased up to 95% after 35 min. The column was equilibrated again tire gene clusters for roquefortine and chrysogine biosynthesis were using a washing step of 10 min using solvent C at 90%. Formic acid 2% deleted from the chromosome. The chrysogine gene cluster (~25.5 Kb) was continuously used as solvent D in a final concentration of 0.1%. Raw consists of seven genes the NRPS Pc21g12630 (chyA), Pc21g12570 (chyE), files were processed using SIEVE software (Thermo Fisher Scientific, San Pc21g12590 (chyH), Pc21g12600 (chyC), Pc21g12610 (chyM), Pc21g12620 Jose, CA). The appearing peak tables were used as target list and each (chyD), Pc21g12640 (chyR) (unpublished). The roquefortine gene cluster feature was integrated in every individual sample. Later, the Excalibur 2.1 (~23Kb) also consists of seven genes namely the NRPS Pc21g15480 (roqA), (Thermo Fisher Scientific, San Jose, CA) processing tool was used for a Pc21g15470 (roqR), Pc21g15460 (roqM), Pc21g15450 (roqO), Pc21g15440 more accurate integration. Peaks were auto integrated using base peak (roqN), Pc21g15430 (roqD), Pc21g15420 (roqT) 143; 265. Together these gene traces in a mass range of 2 ppm and retention time window of 60 seconds. clusters are responsible for the production of more than 24 secondary me- tabolites. The chrysogine gene cluster was replaced by the amdS selection marker, while the roquefortine gene cluster was replaced by the phleo- mycin selection marker (ble) in order to obtain strain DS68530∆chy∆roq. Deletion plasmids were constructed with the 3’ and 5’ flanking regions

38 Materials and methods Identification of structural classes of metabolites 39 2 2

Figure 1. Inactivation of chrysogine and roquefortine gene clusters. (A) Chrysogine inactivation cas- sette, 5’ and 3’ flanking regions of chrysogine gene cluster were fused to the amdS selection marker under the control of gpdA promoter of A. nidulans gpdA gene. (B) Roquefortine inactivation cassette, 5’

and 3’ flanking regions of roquefortine gene cluster were fused to the ble selection marker under the chrysogenum Penicillium control of IPNS promoter of P. chrysogenum pcbC gene. (C) PCR analysis of chrysogine and roquefort- ine integration sites. Latin numbers (1 to 8) indicate the oligonucleotides used to generate fragments used to verify the correct integration of the chrysogine and roquefortine deletion cassette into the Figure 2. Quantitative Real Time PCR analysis of the expression of nrps/pks in strains DS68530∆chy P. chrysogenum genome. Three independent colonies were analyzed (1, 2, 3) and expected fragments (∆nrps9) and DS68530∆chy∆roq (∆nrps9∆nrps10). Expression was determined after 168 h of fungal were: ~3.3 and ~2.3 Kb for DS68530∆chy, and ~3.2 and ~2.1 Kb for DS68530∆chy∆roq. ‘ M ’ represents growth. Data is calculated as fold change. The ratio was calculated from the mean values of the expres- Towards a secondary of metabolite deficient strain Towards the Molecular Weight Marker (GeneRuler TM 1Kb DNA Ladder, Fermentas, ). sions levels of the DS68530∆chy and DS68530∆chy∆roq strains relative to that of the DS68530 strain (WT). The error bars represents the standard error of the mean of two biological samples including technical duplicates. of the chrysogine or roquefortine gene clusters (Figure 1A, B), and used for transformation. Transformants were selected through the selection marker and after purification verified for the correct genomic target inte- and of the parental strain (DS68530) were analyzed by qRT-PCR after gration by PCR analysis (Figure 1, C and D). This yielded the single (∆chy) 5 days of growth in SMP medium. Transcriptome data on DS68530∆chy and double (∆chy∆roq) deletion of the chrysogine and roquefortine gene showed that most genes involved in secondary metabolites production cluster in the DS68530 strain. Neither the single nor double deletion had remained unaffected in their expression, except for nrps2 (Pc13g14330), any effect on growth or sporulation. nrps4 (Pc16g03850), nrps7 (Pc21g01710), nrps8 (Pc21g10790), pks12 (Pc21g05070) and pks15 (Pc21g12450) genes that were up to ~2 fold up- regulated (Figure 2). With pks18 (Pc22g08170) an up to 6-fold upregu- 3.2. TRANSCRIPTOME OF SECONDARY METABOLITE lation occurred for DS68530∆chy strain. With strain DS68530∆chy∆roq, GENE ANALYSIS the expression of 11 genes was altered significantly. Specifically, nrps4 and pks15 were up to 6-fold upregulated. No expression was observed To further examine the effects of the multiple gene cluster inactivation for nrps9 (Pc21g12630) and nrps10 (Pc21g15480) which correspond to the on the expression of remaining secondary metabolite genes, shaken core NRPS genes of the chrysogine and roquefortine gene clusters, which flask cultures of deletion strains (DS68530∆chy, DS68530∆chy∆roq) is consistent with the deletion of these genes.

40 Results Transcriptome of secondary metabolite gene analysis 41 3.3. DETERMINATION OF SECONDARY METABOLITES Table 1. The secondary metabolite production by the P. chrysogenum DS68530, DS68530∆chy and DS68530∆chy∆roq strains. After 7 days of fungal growth, the ratio was calculated from the arith- To identify the effect of the gene cluster deletion on secondary metabo- metic mean values of the concentration of the metabolites detected in the culture broth of each of lism, the culture media of the strain DS68530∆chy, DS68530∆chy∆roq, the DS68530∆chy and DS68530∆chy∆roq strains compared with calculated values of the parental and the parental strain DS68530 were analyzed after 7 days of growth by DS68530 strain (WT). Abbreviations: m/z [H]+, mass to charge ratio of the protonated metabolites; RT, means of LC-MS. The metabolite profiling analysis indicated that strain retention time; Novel, compounds not detected in DS68530; Unknown, compounds with not known DS68530∆chy is indeed deficient in the production of the chrysogine empirical formula; NA, compounds without structural data. related metabolites, while the levels of roquefortine/meleagrine related Ratio of the metabolite compounds increased 2 to 140 folds (Table 1, Figure 3). Subsequently, m/z RT Empirical Ref concentration Compound [H]+ (min) formula 2 in strain DS68530∆chy∆roq, both chrysogine and roquefortine related ∆chy/WT ∆chy∆roq/WT 2 metabolites were eliminated (Figure 3). The most notable changes in the 1 191.08 12.08 0 0 C10H10O2N2 Chrysogine 2 250.12 11.04 0 0 C12H15O3N3 Chrysogine B resulted metabolite profile were also analyzed with respect to the num- 3 294.11 11.02 0 0 C13H15O5N3 Chrysogine C ber of over represented peaks (27-42), as well as four newly emerged 4 207.08 9.58 0 0 C10H10O3N2 N-pyrovoylanthranilamid 5 337.15 8.02 0 0 C15H20O5N4 Chrysogine related compounds (23-26) detected in the culture medium of P. chrysogenum. 6 277.08 11.01 0 0 C13H12O5N2 Chrysogine related These are molecules with a m/z [H]+ 232.15, RT 3.45 min; m/z [H]+ 281.15, 7 295.11 11.01 0 0 C13H14O6N2 Chrysogine related + + 8 338.13 12.48 0 0 C15H19O6N2 Chrysogine related RT 6.9 min; m/z [H] 862.85, RT 11.52 min and m/z [H] 346.18, RT 20 min, 9 276.1 12.44 0 0 C13H13O4N3 Chrysogine related respectively. To elucidate the structures of the over produced molecules, 10 413.15 15.53 0 0 C20H20O6N4 Chrysogine related chrysogenum Penicillium the mixed fraction (F) of the corresponding peaks (38-40) was collected 11 336.11 8.98 0 0 C15H18O6N3 Chrysogine related 12 434.18 16.69 2.1 0 C23H23O5N4 Meleagrine by means of preparative HPLC at a sufficient quantity to perform NMR 13 324.15 5.23 7.4 0 C17H17N5O2 HTD and fragmentation MS/MS analysis (Supplementary information). As 14 322.13 6.23 53 0 C17H15N5O2 DHTD 15 404.17 14.68 31.4 0 C22H21N5O3 Glandicoline A + a result, among others a linear tetrapeptide (40) FVVY m/z [H] 527.28 16 420.17 15.74 82.1 0 C22H21N5O4 Glandicoline B was identified in the fraction. This molecule has been previously reported 17 390.19 18.32 26.5 0 C22H23N5O2 Roquefortine C 18 392.21 15.88 6.7 0 C22H25N5O2 Roquefortine D a secondary of metabolite deficient strain Towards as one of the variants of the hydrophobic tetrapeptide fungisporin (43) 19 420.2 19.44 59.7 0 C23H25N5O3 Roquefortine F cyclo-FFVV, produced by a non-canonical, tetramodular NRPS HcpA in 20 422.18 16.21 60.3 0 C22H23N5O4 Roquefortine M 266 21 440.19 13.27 49.8 0 C22H25N5O5 Roquefortine N P. chrysogenum . Further, we quantify other known fungisporin related 22 436.19 16.69 139.1 0 C23H26N5O4 Neoxaline tetrapeptides and their possible degradation products based on the ex- 23 232.15 3.45 Novel Unknown NA 24 281.15 6.89 Novel Unknown NA act molecular mass and MS/MS fragmentation analysis. The structure of 25 862.85 11.52 Novel Unknown NA the next abundant molecule (38) was determined as the linear tripeptide 26 346.18 20.00 Novel Unknown NA VVF m/z [H]+ 364.22 that represents a degradation product of fungis- 27 188.09 4.63 176 Unknown NA 28 892.84 9.19 336 Unknown NA porin (Supplementary information). Regarding the possibility for further 29 281.15 10.29 28 Unknown NA degradation of the cyclic tetrapeptides, two elevated peaks (33, 34) with 30 785.79 10.51 42 Unknown NA 31 413.14 10.68 17 Unknown NA + identical m/z [H] 265.15 where assigned to the dipeptides VF and FV, 32 277.12 12.75 250 Unknown NA respectively. The last molecule (39) with a m/z [H]+ 307.16 was collected 33 265.15 13.19 906 C14H20N2O3 Dipeptide VF/(FV) 34 265.15 13.50 753 C14H20N2O3 Dipeptide FV/(VF) in a fraction, but remained uncharacterized in this study together with 35 304.16 14.27 4106 Unknown NA several of the remaining peaks (23-32, 35-37). It is important to stress 36 279.17 15.78 40 Unknown NA 37 543.28 17.28 158 Unknown NA that the described LC-MS method is not optimal for the detection of the 38 364.22 17.74 8 C19H29N3O4 Tripeptide VVF vast majority of the hydrophobic cyclopeptides (43) 266 which are also 39 307.16 18.30 143 Unknown NA relatively insoluble. Thus, linear derivatives are more readily detected. 40 527.28 18.96 9 C28H38N4O6 Linear tetrapeptide VYFV 41 507.28 19.72 6 C29H38N4O4 Cyclo-tetrapeptide FFVI Therefore, only the tetrapeptides, that were detected and overproduced 42 511.29 22.12 2 C28H38N4O5 Linear tetrapeptide FFVV / VFFV in the DS68530∆chy∆roq strain, are shown in Table 1. 43 493.28 26.54 1 C28H36N4O4 Cyclo-tetrapeptide FFVV (Fungisporin)

42 Results Determination of secondary metabolites 43 products remain unknown. Furthermore, several of these gene clusters collected mutations during the classical strain improvement programme and thus do not produce compounds 7. In contrast, the gene clusters specifying penicillin, roquefortine, chrysogine and fungisporin production are highly expressed and thus their removal should result in a strain that is deficient in secondary metabolite formation. Such a strain is of poten- tial interest as it could be used to express other secondary metabolite pathways of interest. Also, removal of highly expressed clusters may re- sult in higher production levels of the metabolites produced by the low 2 expressed gene clusters and may facilitate further identification of novel 2 bioactive molecules in this fungus. Here, we describe a first step towards the generation of a secondary metabolite deficient strain of P. chrysoge- num DS68530 lacking the eight copies of the penicillin biosynthetic gene, as well as the highly expressed chrysogine and roquefortine gene clusters. The extracellular metabolome profiles, obtained and analyzed in this study, show that twenty compounds (23-42) are significantly overproduced in the

double deletion mutant DS68530∆chy∆roq compare to the parental strain. chrysogenum Penicillium This includes four novel compounds (23-26) that now for the first time were observed in the spent medium of P. chrysogenum (Figure 3, Table 1). The second largest group of overproduced molecules belongs to fungisporin related tetrapeptides, as well as their degradations products identified by means of NMR and MS analysis as tripeptide VVF and dipeptides VF and FV, Towards a secondary of metabolite deficient strain Towards respectively. These compounds are likely proteolytic degradation products of fungisporin. Although, we were not able to quantify the production of the vast majority of the highly hydrophobic fungisporin-like cyclic peptides, Figure 3. Total ion chromatogram of liquid cultures of deletion strains DS68530∆chy, the metabolome profiles clearly indicate that their linear forms and proteo- DS68530∆chy∆roq and host strain DS68350. Cultures were grown for 7 days on SMP medium. The lytic tri- and dipeptide derivatives are present at the increased levels in the chrysogine (1-11) and roquefortine (12-22) related compounds eliminated from the secondary metab- culture broth of the deletion strains (Figure 3). olism of DS68350, as well as the novel (23-26) and over represented (27-42) metabolites produced by To putatively link the novel products to secondary metabolites genes, DS68530∆chy∆roq strain are indicated according to the Table 1. the expression levels of the core NRPS, PKS and hybrid enzymes were determined by qPCR. In the DS68530∆chy∆roq, the expression levels of two NRPS genes (Pc13g14330 and Pc16g03850) was up-regulated 2 and 4. DISCUSSION 6-fold, respectively (Figure 2). Nrps2 (Pc13g14330) shows 97% identity with an HC-toxin synthetase 2 (HTS-2) of Cochliobolus carbonum 270 and it The filamentous fungus Penicillium chrysogenum produces a wide range has been reported as one of the two tetrapeptide synthetases present in of natural products such us penicillin, roquefortine and glandicoline the genome of P. chrysogenum 266. Previously, we reported the successful which have useful pharmaceuticals properties 143; 267; 268; 269. The genome overexpression of this low expressed gene using the strong Isopenicillin of P. chrysogenum contains multiple gene clusters that are responsible N synthase pcbC gene promoter. However, regardless an overexpression for secondary metabolite formation. However, most of these gene clus- by up to 500 fold, the product could not be detected (Samol, unpublished ters are low expressed under standard laboratory conditions 6 and their data). This supports our earlier conclusion266 , that all the tetrapeptides

44 Discussion Discussion 45 overproduced in DS68530∆chy∆roq strain, originate from the second amino acids may also have caused the elevated levels of the four novel tetramodular nrps5 named HcpA (Pc16g04690). The latter gene was not metabolites of unknown origin, but this assumption requires the struc- altered in expression in the analyzed mutants. This NRPS features mi- tural characterization of these compounds. croheterogeneity in the substrate specificity of its adenylation domains In conclusion, the industrially improved strain of P. chrysogenum that and assembles a set of structurally diverse hydrophobic tetrapeptides, is optimized for the high level fermentative production of penicillin and including cyclo-FFVV fungisporin 266. Subsequent degradation of the in which the highly expressed NRP-related gene clusters (chrysogenine, cyclic peptides leads to the accumulation of the corresponding tri- and roquefortine and penicillin) have been removed may in the future serve dipeptides in the culture medium of P. chrysogenum. Among others, the as a host for the heterologous expression of other secondary metabolite NRPS4 gene (Pc16g03850) also named PssA belongs to a gene cluster pathways. Complete implementation, however, also necessitating the de- 2 that is potentially involved in extracellular siderophores biosynthesis 6 letion of the hcpA (Pc16g04690) gene that encodes for the NRPS involved 2 and participates in the production of coprogen B, under iron starvation in fungisporin production. conditions (Samol, unpublished data). Additionally, nine PKS genes (Pc16g11480, Pc21g04840, Pc21g05080, Pc21g12450, Pc21g15160, Pc21g16000, Pc22g08170, Pc22g22850, Pc22g23750) were found to be upregulated. However, for most of these PKS proteins, no function has been defined yet. Pks13 (Pc21g05080)

belongs to a gene cluster responsible for sorbicillinoids biosynthesis — chrysogenum Penicillium a group of structurally diverse yellow pigments that were eliminated from the metabolism of P. chrysogenum due to the mutational impact of the industrial strain improvement 7. Pks17 (Pc21g16000) is a naphthopy- rone synthase involved in the formation of the green conidial pigment in P. chrysogenum and has recently been used successfully as a marker Towards a secondary of metabolite deficient strain Towards for phenotypic screening of fungal transformants 174. Finally, pks18 (Pc22g08170) has been characterized as 6-methylsalicylic acid synthase (Salo, unpublished data), — a known precursor for patulin biosynthesis in P. chryseofulvum. This mycotoxin, however, is not produced by the P. chrysogenum due to absence of the crutial isoepoxydon dehydroge- nase (PatN) encoding gene in this fungus. The multiple secondary metabolite gene cluster deletion reveals an interesting metabolic feature. Deletion of the chrysogine gene cluster results in higher levels of roquefortine related metabolites in the culture broth (Table 1), whereas expression of roqA (nrps10) was not altered. A possible explanation for this phenomenon could be a redirection of cel- lular resources most notably amino acids to enhance roquefortine and, possibly, fungisporin production as evidenced by the higher level of fungisporin derived degradation products in the culture broth. A similar phenomenon was previously observed upon the deletion of the multiple penicillin gene clusters that resulted in higher levels of roquefortine and chrysogine-related metabolites whereas it did not change the expression levels of the respective biosynthetic genes 7. This proposed redirection of

46 Discussion Discussion 47 Table S2. Primer used for qRT-PCR SUPPLEMENTARY INFORMATION

Target Sequence ( 5’-> 3’) Gene Table S1. Primer used in this study NRPS1Fw GCAGACCTGTATCCATCGCAA Pc13g05250 NRPS1Rv GGAGGCAAGTGAAGGTGTGTT Pc13g05250 NRPS2Fw GCGACAGCCGCCGGAGTAACTATGG Pc13g14330 Target Sequence ( 5’-> 3’) Purpose NRPS2Rv GAGAGACGGGGACACGCGTGATG Pc13g14330 P107-5’FR Chy_NotI_Att4 GGGGACAACTTTGTATAGAAAAGTTGGCGGCCGCTGC pDon4-1 construction, NRPS3Fw ACGTACGCTCGAGCTGGACT Pc14g00080 AGCAAAGACGACATTC chrysogine NRPS3Rv GCCGTCGCGTTGATAATTGG Pc14g00080 P123-5’FRchy_ Att1 GGGGACTGCTTTTTTGTACAAACTTGGCAGTGGCTGT pDon4-1 construction, NRPS4Fw TGGTTGAAAGAGGGCAGTCTC Pc16g03850 CAGAATAG chrysogine NRPS4Rv CGCGAACATACACAACACCAC Pc16g03850 P124-3’FRchy_Att2 GGGGACAGCTTTCTTGTACAAAGTGGCATGCACGATG pDon2-3 construction, NRPS5Fw CTTTCCAGAACAGTTGGCTGGT Pc16g04690 TGGTCATATG chrysogine NRPS5Rv GCTGCATCTTACCCAGGTAATTG Pc16g04690 P114-3’FRChy_MluI_Att3 GGGGACAACTTTGTATAATAAAGTTGACGCGTTTTCT pDon2-3 construction, NRPS6Fw CCACCCTTGTTCAGCCGCTGAATTCC Pc16g13930 CGACGTCCGATCA chrysogine NRPS6Rv GGACGAGGCGAACAACATCGGAC Pc16g13930 2 P115- 5’FRRoq_NotI_Att4 GGGGACAACTTTGTATAGAAAAGTTGGCGGCCGCTTC pDon4-1 construction, NRPS7Fw GCTATCTCGGTGGAGGATCTTCTGTCC Pc21g01710 2 AAGGGTGAGGATGTTCC NRPS7Rv GTGCTGCTGAGAACACGGGATTGT Pc21g01710 P125-5’FRroq_Att1 GGGGACTGCTTTTTTGTACAAACTTGCAGTCCAGCCC pDon4-1 construction NRPS8Fw GTGAGGCAGCTTTGTTCAACACCATT Pc21g10790 AGTTATTG NRPS8Rv TTCTGCAGCAGGCTGTCGGCCTGAG Pc21g10790 P179-3’FRroq_Att2 GGGGACAGCTTTCTTGTACAAAGTGGTGAGCAACGC pDon2-3 construction NRPS9Fw GAGCCAACTCTGTTGTCTACG Pc21g12630 TTGGAGTC NRPS9Rv CAGGGCAATTTGCCTCATTCTG Pc21g12630 P180-3’FR Roq_MluI_Att3 GGGGACAACTTTGTATAATAAAGTTGACGCGTGATGT pDon2-3 construction NRPS10Fw CTTGGTGGATGCAGCGAAGG Pc21g15480 CGGTGGCTGTCTATG NRPS10Rv CTGTGAGAGAGGCTCTTGAGTA Pc21g15480 P158-amdS_Att1 GGGGACAAGTTTGTACAAAAAAGCAGGCCATATAACT pDON221-amds NRPS11Fw TTCGCGAACATCCGAAGAAGC Pc22g20400 TCGTATAGCATACATTATACGAACGGTAGCTCTGTACAG construction NRPS11Rv TCGGGCGAAGACACTGTTCA Pc22g20400 TGACCGGTGAC S1FwA GCTACAGCCCTGACGCCATGG Pc12g05590 P159- amdS_Att2 GGGGACCACTTTGTACAAGAAAGCTGGGACTACCGT pDON221-amds S1RvA CTGCGCAGGTCTACATCGGTACC Pc12g05590 TCGTATAGCATACATTATACGAAGTTATTGGTATGGGG construction S2FwA CCGAAGATGCCGGCGACGG Pc13g04470 chrysogenum Penicillium CCATCCAGAGT S2RvA CGCTGGTCTGCGATGTGGCC Pc13g04470 P160-phleo_ Att1 GGGGACAAGTTTGTACAAAAAAGCAGGCCATATAAC pDON221-phleo S3Fw CGAGAGACCAGGATAAGGTTCTTGGC Pc13g08690 TTCGTATAGCATACATTATACGAACGGTACCCCTCGA construction S3Rv GGTGGTCTGTCACCACTCTTCCC Pc13g08690 GGTCGACTACATG S4Fw CATGGTCAGCACCCTCAGTGCC Pc16g00370 P161-phleo_ Att2 GGGGACCACTTTGTACAAGAAAGCTGGGCAGTGGTAC pDON221-phleo S4Rv CCAGGTCAGGCGTCGTACGC Pc16g00370 CGTTCGTATAGCATACATTATACGAAGTTATGCAAATTA construction S5Fw CGGGTGCTGCATAGATGTACTACGC Pc16g03800 AAGCCTTCGAGCGTC S5Rv GCTGGCCACGGAAGACAACGC Pc16g03800 P272-5’FRchy CCATGTCGGGTGTAGATCG 1- Forward integration S6Fw CCTATTCGCGCCCTGATTATGGGC Pc16g04890 site check chrysogine

S6Rv CGAGATTTGTCTTCACAGAACCCACC Pc16g04890 a secondary of metabolite deficient strain Towards P211- amdS GCTGCCCGTTTACAGAATG 2- Reverse integration S7Fw CACGATTTTAGCAAGTCAACCAGCGCG Pc16g11480 site check chrysogine S7Rv CTCGCTCTCCCAGAATGTCAAGGC Pc16g11480 PP200- amdS CATGCCATGCTACGAAAGAG 3- Forward integration S8Fw GCCACACTCATCGGCACCACG Pc21g00960 site check chrysogine S8Rv GCTCCACAGAGCAACCAACCCG Pc21g00960 P271-3’FRchy GGCTCAAACTTGCGCTTAG 4- Reverse integration S9Fw GACGTGGCCGGTGATGCCG Pc21g03930 site check chrysogine S9R GCGATGTTGCGGACGAGGCC Pc21g03930 P270-5’FRroq CAGACGGCTTGCTGAATAAC 5- Forward integration S10FwA CAGCGCCGAGTCCTACAGCC Pc21g03990 site check melagrine S10RvA GTGGACCTTGGAGGATGTCTTGC Pc21g03990 PRvF-phleo GCAGATGACAATGAGTGAAGA 6- Reverse integration S11FwA CCTTGACGAATATCCGCACTCCG Pc21g04840 site check melagrine S11RvA CAAGCCACAGCTGATGAAGCGC Pc21g04840 P202-phleo CTTACATTCACGCCCTCCC 7- Forward integration S12Fw GTCGGAGGCAATTCGGGAAGGC Pc21g05070 site check melagrine P269-3’FRroq ACTGATGCCCTCAACCTGTC 8- Reverse integration S12Rv GCAAAGTTCCACCACAATGCCGCG Pc21g05070 site check melagrine S13Fw CCGAGGATCTCCGCCAGGC Pc21g05080 S13Rv GGTTGTGCAGGTTCCAGGTGCC Pc21g05080 S14Fw GCACCACCATCAGCCAAAGCATACC Pc21g12440 S14Rv CCGAGGTCCATTGGAACTATGCGC Pc21g12440 S15Fw CCAGTTGTCTGCAGCCGGCC Pc21g12450 S15Rv GCCCAGATCACCGCCGTACG Pc21g12450 S16Fw CAGCCGCGTAGTTTGCCTGGC Pc21g15160 S16Rv GCACAGTGTGCTGAGGTTACGGC Pc21g15160 S17FwA CTTGTCATCAGCAGCCCAGAGG Pc21g16000 17RA CAATTTGCGGTGGCTGAGACGC Pc21g16000 S18Fw CGTTCACCCTCTGCATACCCCTC Pc22g08170 S18Rv CAGTCAAAGTCCTCCAGGCGATCG Pc22g08170 S19Fw CGGTCAACCAGGGATCCAACTGC Pc22g22850 S19Rv CTGAAGCGGTCTCTGTGTGGCC Pc22g22850 S20FwA CGGTAATGTCCAGCTGGCACTCG Pc22g23750 S20RvA CTTCAGGCACTTCTGTACCGGG Pc22g23750 p306-γ-actin cDNAFw CTGGCGGTATCCACGTCACC Pc20g11630 p307-γ-actin cDNARv AGGCCAGAATGGATCCACCG Pc20g11630

48 Supplementary information Supplementary information 49 2 2

Figure S1. Map of the deletion constructs for chrysogine and roquefortine gene clusters which were used for deletion. Features: Amp, Ampicillin resistance gene for the selection in E. coli; ori pUC origin of replication; amdS, A nidulans acetamide gene for the selection of fungal transformants; phleo, Figure S3. COSY spectrum of Fraction F. The low-field doublet at 8.4 ppm is the amide proton of a Phleomicin resistance gene for selection of fungal transformants. valine (V2), and the high-field doublet at 8.4 ppm is the amide proton of the phenylalanine (F3). Penicillium chrysogenum Penicillium Towards a secondary of metabolite deficient strain Towards

Figure S2. 1H NMR spectrum of fraction F. Sample was dissolved in 200 µl H2O/D2O 80/20 and trans- fer to a 3 mm NMR tube. The main compound is a tripeptide containing V (2x) and F (1x). The sequence (VVF) was derived from the COSY (Figure S3) and HMBC (Figure S4) spectrum. Figure S4. HMBC spectrum of fraction F, carbonyl region only. The amide proton of the phenylal- anine is coupled to the carbonyl of a valine (V2). The amide proton of the same V2 is coupled to the carbonyl of V1. At the same time the carbonyl of the phenylalanine (F3) is not coupled to an amide proton. Derivative sequence is V(1)-V(2)-V(3).

50 Supplementary information Supplementary information 51 2

Figure S5. MS/MS spectrum of the collected fraction F. A linear tripeptide VVF m/z [H]+ 364.22 was identified.

Figure S6. MS/MS spectrum of the collected fraction F. A linear tetrapeptide FVVY m/z [H]+ 527.28 has been identified.

52 Supplementary information NEW PROMOTERS FOR STRAIN ENGINEERING OF PENICILLIUM CHRYSOGENUM

Published in Fungal Genetics and Biology (2015). 1. INTRODUCTION

Filamentous fungi fulfil an important role in industrial biotechnology be- cause of their long history and widespread use for the production of a broad range of compounds such as antibiotics, metabolites and enzymes 238. Typically, transcriptional and translational signals are functional across a range of filamentous fungal hosts. For example, Aspergillus nidulans was used to express the first heterologous gene encoding for the mammalian protein chymosin under control of the A. niger glucoamylase promoter 239. Over the years, many promoters have been characterized in Aspergillus and ABSTRACT in Trichoderma but relatively few examples exist for the β-lactam antibiotics producer Penicillium chrysogenum 271. For instance, the constitutive promoter Filamentous fungi such as Aspergillus and Penicillium are widely used of the phosphoglycerate kinase gene (pgkA), the phosphate-repressible as hosts for the industrial products such as proteins and secondary acid phosphatase (phoA) and promoters that are sensitive to carbon and metabolites. Although filamentous fungi are versatile in recognizing nitrogen catabolite repression such as the endo-xylanese (xylP) and the transcriptional and translational elements present in genes from other isopenicillin-N-synthetase (pcbC) promoter have been used to express the 3 filamentous fungal species, only few promoters have been applied and β-glucuronidase (uidA) gene, phleomycin selection marker and penicillin compared in performance so far in Penicillium chrysogenum. Therefore, biosynthesis genes 272; 273; 274; 275; 276; 277. The A. nidulans glyceraldehyde-3-phos- a set of homologous and heterologous promoters were tested in a re- phate dehydrogenase gene (gpdA) and the A. niger (1,4)-β-D-arabinox- porter system to obtain a set of potential different strengths. Through ylan-arabinofuranohydrolase gene (axhA) promoter regions 259; 278 have been in vivo homologous recombination in Saccharomyces cerevisiae, twelve used as heterologous promoters for gene expression in Penicillium. For fur- Aspergillus niger and P. chrysogenum promoter–reporter pathways were ther metabolic engineering and improvement of fungal production strains, constructed that drive the expression of green fluorescent protein a larger set of promoters of different strengths and expression profiles is chrysogenum Penicillium while concurrent expression of the red fluorescent protein was used as needed. This requires a more systematic analysis of the performance of ho- an internal standard and placed under control of the PcPAF promoter. mologous and heterologous promoters.

The pathways were integrated into the genome of P. chrysogenum and An aspect in strain improvement programs is the optimization of the fer- of engineering for strain New promoters tested using the BioLector system for fermentation. Reporter gene mentation process for yield, speed and maximum productivity. Tradition- expression was monitored during growth and classified according to ally, microtiter plates (MTP) or shake flasks are used for high-throughput promoter strength and expression profile. A set of novel promoters was screening applications 279. Since the monitoring of the fermentation per- obtained that can be used to tune the expression of target genes in formance typically occurs at the end of the experiment, important kinetic future strain engineering programs. parameters for biomass and product formation are not measured during the screening. Because of these limitations, online monitoring systems for continuously shaken MTPs were developed 280; 281. This BioLector system allows for the on-line monitoring of fermentation parameters like biomass 282 formation, pH, O2 concentration and fluorescent reporter proteins . Since then, it has been widely used to characterize bacterial and yeast fermentations 283 but so far was not applied to fermentations of filamen- tous fungi because of the morphological complexity of these organisms 284. Here, we have used in vivo homologous recombination in Saccharomy- ces cerevisiae to engineer promoter–reporter pathways, and expressed

Introduction 57 these pathways in P. chrysogenum. The performance of the various pro- Golden Gate cloning was performed according to the One-Pot DNA Shuf- moters was tested during fermentations using the BioLector system. fling Method Based on Type IIs Restriction Enzymes287 . Twelve GFP expression cassettes were generated combining six A. niger and six P. chrysogenum promoters to the open reading frame of the green fluo- 2. MATERIALS AND METHODS rescent protein (GFP) venus variant and to the A. nidulans we. The com- plete nucleotide sequences are shown in the Supporting Information S1. 2.1. STRAINS, MEDIA, AND CULTURE CONDITIONS A single RFP expression cassette was made by fusion of P. chrysogenum paf gene promoter (Pc24g00380, antifungal protein precursor PcPAF) and Escherichia coli DH5α, restriction enzymes, DNA polymerase, and T4 DNA li- A. nidulans AN7354.2 terminator (40S ribosomal subunit protein) to the gase used in this study were purchased from New England Biolabs (­Beverly, peroxisome-targeted fluorescent protein (DsRed.SKL, termed red fluores- MA, USA). S. cerevisiae CEN.PK113-7D 285 and P. chrysogenum DS68530 (ΔhdfA cent protein RFP) open reading frame (Figure 1) 1; 288. PcPAF was chosen as ΔPen-cluster) 264 were used in this study. The latter strain is derived from an internal control as it is well expressed in P. chrysogenum 289. the industrial strain DS17690 in which the multiple penicillin gene clusters The amdS gene was used as selection marker for fungal transforma- were removed 264 as well as the hfdA gene which encode a homolog of the tion. The downstream region of Pc20g07090 and the upstream region of Ku70 protein involved in non-homologous end-joining and the amdS selec- Pc20g07100 genes (named 5’ IGR and 3’ IGR, respectively) were used for 3 tion marker used to deleted the β-lactam biosynthetic genes cluster 184. targeted genomic integration of the promoter–reporter pathways. These 3 All plasmids containing the promoter, open reading frame and terminator regions were synthesized by PCR from the pENTRI221-amdS plasmid and sequences used in the Golden Gate cloning system were kindly provided from P. chrysogenum DS68530 genomic DNA using the oligonucleotides by DSM Sinochem Pharmaceuticals Netherlands B.V. Yeast was grown on listed in Supplementary Information S1. E. coli clones with the GFP and YEP medium containing 2% glucose as described 286. To obtain mycelium RFP expression cassettes, the selection marker amdS, and the 5’ IGR and 3’ of P. chrysogenum for DNA isolation, fresh spores (108 conidiospores immo- IGR regions, were used as PCR templates to generate DNA fragments with bilized on 25 rice grains) were used to inoculate 25 ml of YGG medium con- recombination linkers of 50 bps for the in vivo recombination in yeast 290. taining in g/l: KCl, 10.0; glucose, 20.0; yeast nitrogen base (YNB), 6.66; citric Primer sequences necessary for construction of the cassettes (Figure 1) chrysogenum Penicillium

acid, 1.5; K2HPO4, 6.0; and yeast extract, 2.0. Cultures were incubated for are listed in the Supplementary Information S2. Co-Transformation­ of 24 h in a rotary incubator at 200 rpm at 25°C. For BioLector analysis, this S. cerevisiae CEN.PK1137D with the DNA fragments and acceptor vector 291 292 pre-grown mycelium was inoculated in a glucose-limited defined medium pRS417 was performed as described using recombination-mediated of engineering for strain New promoters for secondary metabolites production containing the following reagents in PCR-directed plasmid construction in vivo to generate the different path- 293 g/l: glucose, 5.0; lactose, 36; urea 4.5; Na2SO4, 2.9; (NH4)2SO4, 1.1; K2HPO4, way promoter clones . Plasmid DNA was isolated, amplified in E. coli 4.8; KH2PO4, 5.2; supplemented with 10 ml of a trace element solution NEB 10 beta (New England Biolabs) and analyzed by restriction analysis. containing (in g/l): FeSO4∙7H2O, 24.84; MgSO4∙7H2O, 0.0125; EDTA, 31.25; Next, the plasmids were used as PCR templates for the bi-partite target- 294; 295 C6H6Na2O7, 43.75; ZnSO4∙7H2O, 2.5; CaCl2∙2H2O, 1.6; MgSO4∙H2O, 3.04; ing strategy in P. chrysogenum . PCR fragments 1 and 2 were gener- H3BO3, 0.0125; CuSO4∙5H2O, 0.625; Na2MoO∙2H2O, 0.0125; CoSO4∙7H2O, ated which each contain part of the amdS gene (Figure 1) (Supplementary 0.625. All chemicals were from Merck. Solution was adjusted to pH 6.5. The Information S2). mycelium was grown in a shaking incubator at 200 rpm for 168 h at 25°C. The two generated fragments have a 690 bp overlap at the amdS gene that once recombined in the genome will form a functional amdS gene (Figure 1). P chrysogenum DS68530 was transformed with 1.5 μg of each 2.2. PROMOTER PATHWAY CONSTRUCTION of the bi-partite fragments. Transformants were selected on regeneration plates containing 0.1% acetamide as sole nitrogen source to select for the E. coli plasmid DNA of promoters, ORFs and terminators listed in ­Table 1 presence of the amdS gene 262. were extracted and concentrated to 75 ng/ml with double distilled water.

58 Materials and methods Promoter pathway construction 59 Table 1. Promoters, reporters and terminators used to build expression cassettes.

Promoter Associated gene Reporter Terminator An02g10320 glaA, glucoamylase eGFP Anid_AN4594.2 An04g06380 mAspAT, mitochondrial aspartate aminotransferase An04g08190 Ortholog(s) ATPase activity An07g01960 Putative stearoyl-CoA desaturase An11g02040 gndA, 6-phosphogluconate dehydrogenase An16g01830 gpdA, glyceraldehyde-3-phosphate dehydrogenase Pc16g00620 glaA, glucoamylase Pc16g11100 proton-transporting ATP synthase Pc20g15140 strong similarity to secreted serine protease Pc21g21380 pcbC, isopenicillin N synthase Pc21g21390 pcbAB, α-aminoadipyl-cysteinyl-valine synthetase Pc22g16370 SHO1, osmosensor Pc24g00380 PcPAF, paf, antifungal protein DsRed.SKL Anid_AN7354.2 3 (RFP) 3 2.3. PROMOTER PATHWAY CHROMOSOMAL ANALYSIS

For the determination of the integration of the promoter–reporter path- ways into the selected intergenic region and to evaluate the gene copy numbers, genomic DNA (gDNA) was isolated after 48 h of growth in YGG 263

medium using a modified yeast genomic DNA isolation protocol in which chrysogenum Penicillium the fungal mycelium is broken in a FastPrep FP120 system (­Qbiogene, Carlsbad, CA, USA). Diagnostic primers for genomic integration site check and for gene copy number analysis of GFP, DsRed.SKL, NiaD, and γ-actin­ (Pc20g11630) are listed in the Supplementary Information S2. Gene copy of engineering for strain New promoters numbers using gDNA were analyzed in duplicate with a MiniOpticon sys- tem (Bio-Rad). The SensiMix SYBR mix (Bioline, Australia) was used as a master mix for the quantitative PCR (qPCR) with 0.4 μM of primers. The following thermocycler conditions were used: 95 C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Subse- quently, a melting curve was generated to determine the specificity of the qPCR reactions. The efficiency of the primers used for the copy number Figure 1. Promoter pathway assembling strategy. The pentagon and chevron symbols indicate the determination was assessed through the use of serial dilutions of gDNA. recombination linkers used for in vivo recombination in yeast. Latin letters (A–D) indicate the oligonu- The γ-actin reference gene, niaD, GFP and RFP genes showed efficiencies cleotides used for the overlapping PCR to generate the fragments needed for the bi-partite integration of 98.62% (R2 = 0.9999), 95.23% (R2 = 0.996), 92.39% (R2 = 0.999), 92.47% of the promoter pathways into the P. chrysogenum genome. (R2 = 0.9992), respectively.

60 Materials and methods Promoter pathway chromosomal analysis 61 2.4. BIOLECTOR 48 WELLS FERMENTATION WITH To generate the promoter–reporter pathways, an approach was chosen ONLINE MONITORING wherein the selected promoters were used to drive the expression of GFP while the paf promoter was used to drive the expression of RFP to form To follow the performance of the promoter pathways, the BioLector bench an internal standard which allows for corrections in growth and biomass top microbioreactor system (M2Plabs, Baesweiler, Germany) was used 281. differences (Figure 1). The GFP and RFP expression cassettes were gen- It performs high-throughput fermentations together with online moni- erated by using the Golden gate cloning technique and GFP/venus was toring of the most common fermentation parameters (biomass, pH, DO combined with the aforementioned 12 different promoters (Biobricks and fluorescent molecules) and runs 48 fermentations simultaneously in of six homologous and six heterologous promoters) and the A. nidulans 1 ml wells. Pre-grown mycelium (42 h) of the different strains was diluted AN4594.2 terminator (Table 1). RFP, which acts as internal reference 8 times in 1 ml of glucose-limited defined medium to yield a cell mass of was combined with the P. chrysogenum paf promoter and the A. nidulans about 0.25–0.4 g/l. Cells were grown for 168 h in the BioLector at 800 rpm AN7354.2 terminator. To generate multiple overlapping DNA fragments, at 25°C. Biomass was measured via scattered light at 620 nm excitation the amdS selection marker, GFP and RFP expression cassettes and the in- without an emission filter. The fluorescence of GFP and RFP was measured tergenic regions, 5’ IGR and 3’ IGR for chromosomal targeting, were used every 30 min with 486/589 nm excitation filter and 510/610 nm emission in a PCR reaction together with recombination linker oligonucleotides. All filter, respectively. All experiments were conducted as duplicates and the fragments were successfully assembled in vivo in S. cerevisiae into the 3 mean value was calculated. In experimental repeats, different signal inten- yeast vector pRS417, and the different clones were recovered from yeast 3 sities were obtained since the sensitivity of the photomultiplier (gain) was and used as template for bi-partite fragment amplification.P. chrysogenum adjusted accordingly but relative variations were similar. DS68530 was subsequently transformed with the bi-partite fragments using the split marker (amdS) approach and the pathways were success- fully integrated in the chromosomal site between the Pc20g07090 and 3. RESULTS Pc20g07100 genes 294. All twelve biosynthetic promoter-reporter path- ways were obtained in P. chrysogenum transformants and were verified for 3.1. PROMOTER PATHWAY ASSEMBLY STRATEGY correct assembly by PCR analysis (data not shown). chrysogenum Penicillium

To obtain a set of variable promoter strengths and expression profiles to

be used for gene expression in the filamentous fungus P. chrysogenum, 3.2. GENE COPY NUMBER ANALYSIS of engineering for strain New promoters information about A. niger and P. chrysogenum promoters was collected from literature and from transcriptome data 6; 264. For instance, the pro- In order to determine whether the promoter–reporter pathway integra- moter of the starch-regulated (glaA) gene from A. niger has been used tion events were correctly targeted to the intergenic region between to express several proteins like α-interferon in A. nidulans 243, GFP 296 or Pc20g07090 and Pc20g07100, genomic DNA was isolated from the new bacterial hygromycin phosphotransferase (Hyg) in Ustilago maydis 297. Fila- P. chrysogenum promoter strains and used in PCR reactions to validate mentous fungal promoters involved in primary and secondary metabolism the correct insertion (data not shown). However, in some cases, clonal were also selected. These include theA. niger glyceraldehyde-3-phos- isolates from a single transformation harboring the same promoter–­ phate dehydrogenase gene (gpdA) and the isopenicillin N-synthase (pcbC) reporter pathway showed large differences in the RFP fluorescence signal gene of P. chrysogenum 298; 299. A list of all tested promoters is presented whereas this would not be expected for single copy transformants. To in Table 1. For chromosomal expression, the location of the integration further investigate this phenomenon, isolated gDNA was used to perform site is important since it may influence gene expression186 . Hence, the quantitative PCR analysis on the GFP and RFP genes to determine their P. chrysogenum array data 264 was used to select an intergenic region of copy number, using the γ-actin and the niaD gene as references for single about 1 kb between genes Pc20g07090 and Pc20g07100 that both show copy genes 6. For most promoter–reporter pathways, single copy integra- medium expression levels. tions were observed at the expected locus, some of the pathways showed

62 Results Gene copy number analysis 63 increased copy numbers of integration of up to two. However, the ratio is only linear during the exponential growth phase 300. Biomass devel- of the GFP and RFP gene copy number was always one (Figure 2). This opment was followed during 180 h and showed the same trend as the suggests that in individual cases, a double integration of the introduced growth curve of a unicellular organism, but as expected differences were pathways had occurred. However, since the GFP to RFP ratios remained observed between the biological replicates due to the aforementioned the same, these transformants were further used for comparison of pro- filamentous fungal growth behaviour as exemplified for the intermedi- moter strengths and expression profiles. ate A. niger 16g01830 (gpdA) (Figure 3A), and stronger P. chrysogenum 21g21390 (pcbAB) (Figure 3D).

3 3 Penicillium chrysogenum Penicillium

Figure 2. Quantification of the copy number of the GFP and RFP genes in P. ­chrysogenum trans- of engineering for strain New promoters formants bearing a promoter–reporter pathway. Gene copy numbers vary from one to two. Strain DS68530 was used as a control that does not carry the GFP and RFP genes.

3.3. PROMOTER-REPORTER PATHWAY FERMENTATION ANALYSIS

The BioLector 48 wells fermentation system with online monitoring was used to assess the differences in promoter expression strength of each of the promoter pathways. For ten pathways, two biological replicates Figure 3. Development of biomass (A, D), RFP (B, E) and GFP (C, F) fluorescence in time during (individual transformants) were analyzed as well as two technical rep- growth of P. chrysogenum harboring the promoter pathways of A. niger 16g01830 (gpdA) (A–C), and licates each. For filamentous fungi, the mycelial biomass is either freely P. chrysogenum 21g21390 (pcbAB) (D–F). Data shown is for two biological replicates (individual trans- dispersed throughout the medium, or aggregated into clumps. Therefore formants) analyzed as two technical replicates. Growth was in the BioLector system, and biomass was the correlation between the optical density and biomass concentration monitored by light scattering at 620 nm.

64 Results Promoter-reporter pathway fermentation analysis 65 were similar (Figure 3C and F). For instance, with the promoter of the Pc21g21390 (pcbAB­ ) gene that drives the expression of the α-aminoadipyl-­ cysteinyl-valine synthetase involved in β-lactam formation, the expres- sion increased exponentially after the first 20 h of growth, then became more stable and in the stationary phase declined again (Figure 3F). Sim- ilar trends were observed for other transformants and this likely reflects a complex regulation of the promoters during the shift from glucose to lactose-based­ growth until the final depletion of sugar after about 80–100 h of fermentation. Based on these observations, we decided not to include the first and the last 40 h of analysis to catalogue the various promoters in order to have most comparable biomass development and reproducible measurements. Using the RFP signal generated by the PcPAF promoter as a control, profiles of promoter strengths were generated for each of the tested pro- moters during growth (Figure 4). By taking the ratio of the GFP and RFP 3 fluorescence, differences in growth or other variables in the analysis are 3 eliminated. The promoter strength was analyzed in a time window of up to 180 h of fermentation. The results show that the various promoters cover a broad range of GFP/RFP ratios expressed in a log scale from 0 up to 2. There is more noise in the analysis during the first 100 h whereupon signals became more stable. All heterologous promoters were found to be functional in P. chrysogenum. A box-plot graph of two smaller time windows with an average time of chrysogenum Penicillium 40 h each was used to further catalogue the differences in the strength of the promoters (Figure 5). In this analysis, the newly investigated

Pc20g15140 promoter appears to be the strongest and active in the vari- of engineering for strain New promoters ous growth phases, while the An02g10320 promoter is the weakest. The Figure 4. Activity of a range of P. chrysogenum (A) and A. niger (B) promoters in time during fermen- An04g08190 promoter shows a similar strength as the highly express- tation in the BioLector system. The promoter activity is expressed as the logarithmic values of the ing Penicillium promoter Pc21g21390 (pcbAB) 4. The Pc22g16370 and averaged GFP/RFP fluorescence ratios of two technical replicates. For Pc20g15140 and Pc22g16370, Pc21g21380 (pcbC) promoters showed about 2-fold higher transcriptional only one biological sample is shown. activity compared to the A. niger gpdA promoter.

Fluorescence was measured over a period of up to 180 h. An increases 4. DISCUSSION in the expression of the internal reference RFP was detected around 20–30 h, when the glucose repression on the PcPAF promoter was re- Many efforts have been made to improve the industrial production of pep- leased, and increased linearly to 80 h when it reaches a stable plateau tides and proteins with antimicrobial activities 301. One of the approaches (Figure 3B and E). GFP gene expression showed a similar trend for the that has been used and it showed various successes it is the production technical replicates while in some cases differences were noted between of heterologous proteins by filamentous fungi302; 303. In biotechnology, the the biological replicates per promoter–reporter pathway although trends main producer of β-lactam antibiotics P. chrysogenum is regarded as safe

66 Results Discussion 67 as transcription, translation, folding and degradation and often also ex- cretion. The most controllable aspect of gene expression is transcription, i.e., the production of mRNA. One of the prerequisites to build a gene expression system is the availability of suitable promoters. Here, we have analyzed six constitutive promoters from A. niger, namely An02g10320, An04g06380, An04g08190, An07g01960, and An11g02040, An16g01830 and four from P. chrysogenum, Pc16g00620, Pc16g11100, Pc20g15140, and Pc22g16370. For benchmarking, we added to this set, two P. chrysogenum promoters that drive the expression of genes involved in penicillin production, Pc21g21380 (pcbC) and Pc21g21390 (pcbAB) 305. For each promoter, a reporter-expression system was constructed in which the GFP/venus gene was placed under control of one of the se- lected promoters. For comparison and internal calibration; we also in- tegrated into the same expression cassette the gene encoding the RFP protein with the microbody targeting sequence, SKL, under control of the 3 PcPAF promoter. This allowed us to use the GFP/RFP expression ratio as 3 a measure of the strength of the tested promoter. By rationing, poten- tial interferences by variations in growth are eliminated which is one of the main difficulties with growth of filamentous fungi. However, this also allowed us to deal with variable gene copy numbers. Although most con- structs were integrated by single recombination events into the genomic intergenic region between Pc20g07090 and Pc20g07100 genes, a couple of constructs showed a double integration as confirmed by gene copy chrysogenum Penicillium number analysis. This was unexpected as the strain used for transforma- tion, P. chrysogenum DS68530, lacks the hdfA gene involved in the non-ho- 306 mologous end joining recombination system (NHEJ) and thus only the of engineering for strain New promoters targeted integration event should occur with high efficiency 184; 307. It is not clear how such double integrations may have occurred. Possibly, in the ΔhdfA strain still some random integration occurs. Alternatively, the Figure 5. Ranking of the strength of 12 promoters (including biological replicates) during the time marker AmdS may have stimulate multicopy integration due to the way window of growth in the BioLector system from 40 to 80 h (A) and 80 to 120 h (B). The promoter of selecting. The presence of a multicopy marker might have a growth activity is expressed as the logarithmic values of the averaged GFP/RFP fluorescence ratios of at least advantage of a stronger phenotype under selection conditions. two technical replicates. For the internal control the red fluorescent protein RFP, a promoter of one of the most intensively studied antifungal peptides, PAF from P. Chrysogenum was used 289. This protein is produced in high amounts by the United States Food and Drug Administration and the existence and has severe effects on target organisms such as growth inhibition, in- of a well-established technology for large-scale fermentation makes this terference with cellular metabolism and promoting oxidative stress and mold an interesting platform for recombinant antifungal protein produc- apoptosis 308; 309. Significant sequence homology (42%) of PAF is detected tion 275; 304. However, gene expression is a multifaceted process and the with the antifungal protein sequence of AFP from Aspergillus giganteus 310. factual protein production depends on many aspects in this chain such While the afp gene and it expression were studied in great detail also

68 Discussion Discussion 69 the expression of the paf gene has been studied 276; 311. The paf promoter strengths covered a dynamic range of 12-fold. However, it should be em- contains a TATAA box, four PACC motifs and two CCAAT consensus se- phasized that in this analysis the promoters of only well and medium quences for the binding of a HAPlike complex 312; 313. The paf transcription expressed genes were included, while it was not the objective to reach and protein yield is maximum during the growth phase after 70–90 h of the widest dynamic range and weak promoters were not included in the cultivation 276. Its expression is regulated by carbon and nitrogen catabo- analysis. Importantly, the promoters could be benched marked against lite repression 276. In the paf 5′-upstream region, four putative CREA and the well-known AngpdA, PcpcbAB and PcpcbC promoters. two GATA factor binding sites are present which might play a role in gene Summarizing, we demonstrated the application of the BioLector fer- repression in the presence of glucose and nitrogen, respectively 314. mentation system, for promoter strength analysis in the filamentous In this work we used conditions that are relevant for industrial produc- fungus P. chrysogenum and we provide a set of Aspergillus and Penicillium tion of β-lactams as a medium containing only small amounts of glucose promoters that now can be used for developing a more versatile synthetic while lactose was the key carbon source. Thus, the expression of the RFP biology toolbox for P. chrysogenum and other filamentous fungi 315. protein occurred once the glucose was depleted from the medium. This meant that during the early stages, RFP is low expressed resulting in the peak in the GFP/RFP ratio in the first 20 h of the fermentation (Figure 4), but a stable expression signal that increased with growth was obtained 3 during the time window 20–100 h, followed by a plateau accordingly 3 with literature studies 311; 314. An analogous behavior was observed for the ­pcbAB and pcbC promoters that are also glucose repressed. Most pro- moters showed a similar expression trend over time with characteristic features. The fluorescence levels increased in time consistent with the increase in biomass. However, there are two phases related to metabolic changes, i.e., the depletion of glucose followed by the consumption and exhaustion of the lactose (Figure 3). As discussed above, the depletion chrysogenum Penicillium of glucose has a strong effect on the RFP expression and hence on the GFP/RFP ratio, but to a much lesser extent affected the expression of

most tested promoters although a small bump is observed in the GFP of engineering for strain New promoters expression. Also the depletion of lactose caused with the majority of the promoters a small decline in expression followed by a recovery phase (Figure 4). Because of these phenomena and for classification purposes, we analyzed the promoter activity in smaller time windows. The first and last windows, i.e., 0–40 and 120–160 h are less reliable because of the glucose repressing effect on the RFP expression and the death phase, re- spectively. Therefore, these periods were not included in the analysis. In the period of 40–120 h, a much more stable classification was obtained although small differences in the time dependent expression profile re- sulted in slight alterations in the ranking of the different promoters. Nev- ertheless, the promoter belonging to Pc20g15140, which is a secretory protein belonging to the cerato-platanin family of phytotoxins, appeared the strongest under the conditions tested within the indicated time win- dows, while the promoter of An02g10320 was always the weakest. These

70 Discussion Discussion 71 Short Biobricks Primer sequence (5’->3’) SUPPLEMENTARY INFORMATION description An07g01960 GGTCTCGGTGCAGTGGTGCTACTCCGAGCAGGCAATACTTTGATGCGGAAAAG Promoter GAAACCGTCCCGCAATCCCAATCGGGATGGATAGCCACAGTCAAGCCACCCGAG used Table S1. Nucleotide sequences of the biobricks used in this study CAATGACACCAGCCACACAGAGCGATCAAGGGGCAAAAAACGTTGGGGATTCAAC for eGFP GAATGGTTGAACTGTTCTGATTGGTGGTCCGCTCCCGACCTTACCCAAAGCGG expression CAGCTTCTGGCCGAGCAGCGCCATCGAATCAGAGGGAGCCCAACAAGCTTAGTTG Short GAGGAACAGGCGGCGCTGTATGGTTGGAGATACTCCGGCCATTTGCCATCGCG Biobricks Primer sequence (5’->3’) description GATACACTCTGCCATCCGGACACCTTCCAGACGTGCCTGGATAATACTGTGGTAG TAGTCCCCTTCCTCACGCTCCCTTTCTTGTGTCTGTTGAACCGTCGGCCACTTTGG An02g10320 GGTCTCGGTGCTCCGGTTGTTGAGACTAGCCTGGCCAACCATATAGAGTTGAGT Promoter GACCTCGGGATCTCATGATTACTTCACTGATCTACCAGTGAACTTGCCGTCAGGCCAC CATAATAACCTTGTCCGTTGTGCTTCCGAGCGGGTCTAGAAGCGGGGGAGAGGAT used CCTTCTTAACTTATTCCATGCGGGTGTCCTCATAGTCGCATCATTATCATTGATTGTC GAGACAAGGTTCATGATGAGGTGGTTACTGCTGGAGAACCGGAAAAGAACGCCAG for eGFP CGCCTTGCTTTTCCCCAACCATCATCCGCCGGTGGACCCTGGTAGAGTTCAACT GAGCACACCACTCCGGCGACAGGATCTCCAATGAGGCATCTGCTTCGTTTTCGTGGGG expression GCCTCCGAATTTTCCCTCCTTCACTGGCTCAGATCTGCCGCTTACTTCTTCGG GTCCTGGATGTGTTTCTCGGTGAGGGAAGACGACAATCGCGGATCCTAACTTAGTA CCTTTCGATTGCATTCCCCACCCTTTTTCTCCGTCTATTTTTTATCGCTCGCCTC GTGGGGGTTTAGTCCAGGGTCTAGCTTGACCCCGCTGCTTCCCATTTATGCCAC CGGCTCTTATCTTTAAACCCACCCTCTCCCGCACGCATCCTTCTCCTCCTCATC GTCTTCTCCCTCCTCTCTCGCTTGCTTTCCTTTCCCTTCATCTTCCCATCTTCTCAC CGAACCATACTGCAGGGGTCGACAATACACACGAACACCGTCAAAATGGGAGACC TATCTATCTTCAGTTATATTGTTTCCGAATAACTTACTTCTTCTTCCCCAACAACTTCCTC GTTAACCGTCCGGTACGACTCACAATGAGGCCGCGCACGCAGGATCAGACTCCG GGTCTTTTCGCTATGGGTTCAGATGGGTCAAGGTATCGTACAATAGTATAACAGT An11g02040 GGTCTCGGTGCTCTTGCGTTACGGGCGTATTTTGCTGCGGCCGGTGGTGCCCCTC Promoter CACTGCTCGCGCATGACAGGTGTTCGGCTCGTGCTTCTGTTCCTTTCCTTCT CATGCCCCGCCATCTTTCAAAGCTCCTGGCGACGCCGTCATCTCCGAACATTCTC used GGTTTGGACAGGAGCGCGGTCGTTCTGAGATTATACTGTCAAAACTT CCCCCAAAGGAATCAATTGGCAATTGGAGTCTAGTAAAGTGGTGTTTGTCATCAGTA for eGFP GATCTAGATAATACTAGCGAAAGGACATGCGTGGCACTGATTGTCCCCTACTATTT AGGAGTTGGTGAAACTACAATCTTCCATCATGAAGAGAAGGGATATTTTTGGG expression GACCTACAGAAGACGAGAGGGATCTCGCATCCCTCTCTGTTGCTGACAGTTTC GTTGTATTTTACGATGAAGGTACTGGAAATGGTGGGGGTTTTTATAGCAGTAG CAGACCTTTGCAATTACCCTCGACCTGAGTGTATCACCGTCAAAATGGGAGACC ACAGTCAGTCAGTAAGTAGTATGCTTGTTGTATTACCCAAACCAGATCAATC CAAAGAAAGCCTGACAGACAGCCATCAATAGATACTACTTCGTACTATAGTTAC CCACCTAACCATATTACTCAAAAAGCATCTATCTATCCGCGGGCTTCCATGCATGTC An04g06380 GGTCTCGGTGCCTACCGAGGATATCAAGAACGTAGTTAGCAGAAGGGGAATG Promoter CCGGTAGCAAACTCCTCCCACCGGTGTAGTACTCTTTGGTTAGTAGTCTTGTTCACCG GAGTCAATGCTGCAGATTTATATACAAGTAGTAGTTGATGGTGAGATGATGG used 3 GAGGACTCTGCTCCTCTCCTGCTCAGGTGCTGCCCCGCCCTCCGTCCCACCATGAC 3 GAAGTGGTGACTAGCAAGTGGTAGGGGGGTGTAGATTAATTACCCCAACTCCTC for eGFP GGAAGAGATGCTCCGTAAGCCGTCCAGTTGCAACGAATCCTGCTCTGACATCTTC GTGAGGGGAAGGCCAACCTCAGCCCATCCATGGATTTTCCCTCGATACTAAAA expression GAACGCCTTCTCCCTTTCGCTCGCTTCTCTGCCTCTTTCCTCTCTTCCCTTTCCTTC GAGTTCACCGGGGAGAGCGGGACGGGCTCATCATTTGTGGTGCGATCTGTCAAT CCCTCCAAACTAAACCTTCCTCCTTTTCTCCATCATCCTCTAGGCAGTTG GAGGGAATCCACGCTCCGTGATGATGACATTTGACATCTCATGTTAATCAGATAG GTTCTTCCTGACTGTACATATATCCACCACCTCCCCCCTCTATTCTTCCACCTCTTC TAGTCAATCAGTTAGGACTTAGTAGAGATATATACAATTCTATTCAAGATGCCATT CATATCTCCTTCTCCAGAGTTCATACCCCCCACACCGTCAAAATGGGAGACC GAATAAATAATATACTACGATGGAGTTGCATCCAAGGGATAATATGTGCAGCCT GCTTCTTGCTTCCTGCTTCCTGCTTCCTGCAGCTGCCAGCCATGCCATGCAAAC CAGCCAAACAAGCAAAAAGTCACCTGCTGGCAATGCGGAGGGCGTGGCCAATC Pc16g00620 GGTCTCGGTGCAACTCTCTGGAAATGAAGGCAGCCCCGAAGTTTTGGGATACTAG Promoter CGATGCCTCCCGCGTTTCTCCCCGGAAACTCCCTACAGGACTAACTCGACTAGTC CGATCCTAGGCACTGCACCAGTCTTGAAGAGGGTCATCTCTCCGGAGATTAGTC used CAAAGGCAGTTCCAGTGACTCAAAAAATAAAATAACTATCGCCGACCTCGTCTATC CATCTGTGGCATTGTTTATACTTTCACACCTCCAGAACAACATGGAAGTCAAG for eGFP CCGCTCGTCTACTCCCCCGATTCCAGCCTTCATTCAAGTACTTCTTGCCAGCTC GAATGTGGTATCAGACTCACAACCAAGAGATTTCTCACCAAAGCGCTAGTTCCAAG expression CCTTGGCCCCGGCCTTTTCTTCTGATCATCTCCTCCCTGGTCTATTGGAGT GCAGGTCTAGCGTGCTGACGATGGGGATAATTTAGCCGGCTAATTGGTGGACATC chrysogenum Penicillium GCTTGCTCATTTCCTCCTCTTCTTTCTTCTCTTCCCTGTTTTCCATCCCACCGT CGCCACCACCCCAGATTAAACGGTGGAGATGACAGGGGGCGGAGATTCAACGGGA CAAAATGGGAGACC TTAAATATCGGAGATGAAGACTCGGCATCTGCTTGAGGCAGTTAGTGCTTGATGCA ACTTGTGGTCGGTCGAAGCGATTGGCATGGTGATCAACGATCGGATAATAAGACCTCCCATGTG CCTCGGGGGATATTCGATCCGCCTGCTGAAGAGAGTAATGATGGACCTGATACTTG An04g08190 GGTCTCGGTGCAAGGGAGGGACCCGTAGAGACAAGACAAGAATGTTTTT Promoter CAGAATCTGAACTGAAGCCCTTGACTAGCGCTGGAACTAAATTTCAAGCTAACGGT TTCTCTCCTTTTTGTGACGACACGAGGGAAAAAAGGAATTGAACGGAAGGGATC used GATGCAGCAGAAGGATGACGATCTTTTCCTAACGGATTTCTCCGCAGACCCCCGAG of engineering for strain New promoters GGTTCATACAAGTGTAAAATACACACACGACTACGGAATAATCCCATCAGATGCAG for eGFP CGCATTCTGCAATACCATGCACCTTTCATGCACCTTTCATGCAAGTTCCATG CAATGGGTTATCTGAAGGGGAAGGAGATGTGTGAGTGAATGAGAGAGTAAGC expression CAACTCCCACACATGTGCATTAATATGCCTTAGCTCTCTCGAATGAACTTTCACGT CAATGCTCCATCGCGGACCAGCACGGTCAGGTGAAGACCCTGAAACCATTGGCT GGCTTAAGTCCCCTCACCTGCACCCATATAAAAGCCAAGTTCTTCCCCCACGATGA GTACCAGTAGTAACTCCCCTGGTTACCCCCATCCCGAGTGATCCCGAAGGGTGTG CACCAACCCCAACTCACCTTCCACCGTCAAAATGGGAGACC TATGTGTGTATGTGTACACAGTATGTGTAAGGAAGTGTGGTAAGTGTGTATGTGCG GTGGAATGCCCACTGCTTTCCCGGGGGAAGGAAAAAGGATGATGAGCCAAAAAC GAGGCGCCAAACACGGTGTAAGGGAAAAAGAAGGGAAAGGATAAACTAGGGA Pc16g11100 GGTCTCGGTGCACCGCGGACTGCAAATATTAATTACCCAATGGCACTCAGCG Promoter TAACGGATGATACCAAAGACAGACACAAACAGGAAAAACAGGAACAATACAATA CCTGTGGTTTAATTCATTAATGTTGAAGCTTGAGGTCATAGTGTGTATAGCCCTG used CAAACAAACGGTGCCAAAACACCAAACAAAAAAGTAGGTAGGGCTTTTTTTTCT GAGCTACCGAGTGGAAACGATACAGGACAGGTTACAGCAAATGGACGGACAAC for eGFP GGTCCCAACAAAGCGCACTAACACCCGACGGGGGGGCTGGGTGGGAAAAGGG CGACTTGAATATATCAGCTACTCTCATAATGATGATCGAGTGCCGCACCTCTTC expression CAAAAAACCGCGAAAATTTAGCGGGAGAGTATTTATGTCCCGGGGGGCCTTCT GCCAGGTGTTGAAAATACGTTTGTTCCATGGATGTATCAAATCAACGGAATGC GTTGTCACTTTTCCTCCAGCTTTTTCCTCCAGAAAAGTTCTCCTTCCTTCTTTC CCAGCTGTATACCGCAGATACCGATGTGTTTGAGGCGGTTCTTTGCATACCTAAT CCTTCCCAATCCCATCATTTTCTAGAGAAACTCCTCTCTCAGAACCACCACACAC CATGGGATGTTGTCAAAATAAACGCTAGTCATGTGACAGCAAGCGCTTATCAA CGTCAAAATGGGAGACC TCTGCACCGGACTAATGTTCTTCCGCCGCATTTGTTAGGTTTAACAGCACTA AAGAAGATGGCATCGTACTCGACCAAATAATGTATGAGATACATGAGAGACTA GAGGGTTATAGTAGTTCTAATTGAATCGGATGATATAATACAAATCTAGGATCT CAACCCTTTTAAGTACGGAAACCTTGGACACAAGCGCCGTAGCCGCTTATCGATC TATATCGGACTAACGTTCTTCCACCAGCATGCTCCTGCATCACGTGCTCTCTG GCCATCGAACCGAGCAAATCCTCACCGCCATGGTTGTCACCGCCTTCCCAAGC CAGATCTCTCCCCACGTGATCTTGTCATCCCGATCCTCCGAAGTCGAACGCTTC CAAACTCACCCGAACCGTTTTCACCCCTTCAATCGAACCATACCTCCCACATCAC CGTCAAAATGGGAGACC

72 Supplementary information Supplementary information 73 Short Short Biobricks Primer sequence (5’->3’) Biobricks Primer sequence (5’->3’) description description Pc20g15140 GGTCTCGGTGCTACTTGAGCAACATCATACGTCAACTAATTGGCACTCT Promoter An16g01830 GGTCTCGGTGCTAAGAATGGGGAAGGCGAAGGTACCGCCTTTGGGGTCCAG Promoter TACTTTATATCTGATATGTGGTCATTGCACTAAGTAATATAATTGTCCTCGTCTAT used CCACGCGACTCCAACATGGAGGGGCACTGGACTAACATTATTCCAGCACCGGGAT used TCAACAAGCATGTCTCCGTGGCGCAATTGGTTAGCGCGTCTGACTGTTAATCAG for eGFP CACGGGCCGAAAGCGGCAAGGCCGCGCACTGCCCCTCTTTTTGGGTGAAAGAGCT for eGFP GAGGTTGGAAGTTCGAGCCTTCCCGGGGACGTTTCTTTTTTTCCCTTCTTTTTTTC expression GGCAGTAACTTAACTGTACTTTCTGGAGTGAATAATACTACTACTATGAAAGACCG expression TACTCATTAGACAGCTACTTTGTCCTTTTCTTTTTTTCTTTTGGTTTATTGAGGT CGATGGGCCGATAGTAGTAGTTACTTCCATTACATCATCTCATCCGCCCGGTTCCTC CAGCTTATTGATATAATATTACATTGTGATTCAAACTCAGACGAAAATAAAATGT GCCTCCGCGGCAGTCTACGGGTAGGATCGTAGCAAAAACCCGGGGGATAGAC GGCTATGGTTATGTCCGCTCGGAGTATTTCGATGCAACCTCGGATGCAGTTGC CCGTCGTCCCGAGCTGGAGTTCCGTATAACCTAGGTAGAAGGTATCAATTGAAC CCTATACCGTCGCATAGCGGGAGTCGCGCTGTTCTGTGGGTCGACCATGTAATGTA CCGAACAACTGGCAAAACATTCTCGAGATCGTAGGAGTGAGTACCCGGCGTGAT ATGCTTCTGCAGATCTCGTGGAAATGGCAGCCAAGATATACCATGTCTCAGCCTG GGAGGGGGAGCACGCTCATTGGTCCGTACGGCAGCTGCCGAGGGGGAGCAG CCTGCATGCTTCCTCGTGGACCCCACAATAGTCCTCGGCCTTATTGCACCGGTTTCT GAGATCCAAATATCGTGAGTCTCCTGCTTTGCCCGGTGTATGAAACCGGAAAGGACT GGAGGGGTATCTATTATGGGAGTATCGGCTGACGATGGGCCTGGTATGAAGG GCTGGGGAACTGGGGAGCGGCGCAAGCCGGGAATCCCAGCTGACAATTGAC CATCCTATTTGGGCCGTGTCACCTGTGAGTCTAAGACCTTCTTCTAAGACCTGCAA CCATCCTCATGCCGTGGCAGAGCTTGAGGTAGCTTTTGCCCCGTCTGTCTC CAAACGCAGCCTGCCAGTAAAGGGAAATAGAACAATATTAGACGGAAGCCTGTT CCCGGTGTGCGCATTCGACTGGGCGCGGCATCTGTGCCTCCTCCAGGAGCG GAATGGAGATATATAAACCTCGCCGGGGAGGGGACAAAACGTATACAACTAGCAAC GAGGACCCAGTAGTAAGTAGGCCTGACCTGGTCGTTGCGTCAGTCCAGAGGTTC CAAAATATTCCACACTCTCTCAAAGTATCATCAATTCCACCGTCAAAATGGGAGACC CCTCCCCTACCCTTTTTCTACTTCCCCTCCCCCGCCGCTCAACTTTTCTTTC CCTTTTACTTTCTCTCTCTCTTCCTCTTCATCCATCCTCTCTTCATCACTTC Pc21g21390 GGTCTCGGTGCCTTACTGGATGGGGCCGCTGGAGCCAGTGTAAAATTAGTAAC Promoter CCTCTTCCCTTCATCCAATTCATCTTCCAAGTGACTCTTCCTCCCCATCTGTCCCTC CGTATCTCGAAGTCGGAGGGTCTTTGGTGGTCTGAGATTTCAGTCGGTCCGCAC used CATCTTTCCCATCATCATCTCCCCTCCCAGCTCCTCCCCTCCTCTCATCTCCTCAC CGTGGCATTTGCAGACGGTGCGATCAGGCCAATCGTTGATGCTCGGGCAGAG for eGFP GAAGCTTGACTAACCATTACCCCGCCACATAGACACACCGTCAAAATGGGAGACC CAACACTCCCCCGCTCGAAGACTAGTAAGTACTTATCATTACCGTGCCAGAAAAC expression GGGGCCATAGATACCCAAGTAACACCGTCGAGTCAATCGGGCTCGTGGGCCCAG eGFP GGTCTCGaatgAGCAAGGGTGAAGAACTCTTCACTGGTGTTGTTCCCATTCTTGTT eGFP CCAAGCCACGAGAGAGTAGGCAACGTGCACTCAACGACGGCGATGTTCCAAGG GAGCTTGACGGTGATGTCAACGGCCACAAGTTCTCCGTCAGCGGTGAGGGC enhanced TAAACCGGCACGTAGAAAATGTCCGGACCACCTTGGCTCTCGTTGCAGCGTGTT GAGGGTGATGCCACCTACGGCAAGTTGACTCTCAAGCTGATCTGCACCACTGG Green GAATCTTCAGCCACCGTAAGTCGATAGCATCCGGTTAGAGTGCAACGTGGGTCT CAAGCTTCCTGTTCCTTGGCCCACCCTCGTCACCACCCTCGGATACGGTCTGCAGT Fluorescent GTCTCATTCTTCTCGGTTCTTGGCACCAGAATCGGGCGTAGTTTGCCCACTGC GCTTCGCTCGTTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCAT Protein 3 CAAGTCGCGGGGCCGCTTGGCTGTCCCTGTGGTGGGATTTCCCGATGCAACATG GCCCGAGGGCTACGTGCAGGAGCGCACCATCTTCTTCAAGGATGACGGCAAC (Venus) 3 CAGATACATGTAGTCGACAGTTGACAGAGCCAATGGCATCGGATCTGCCCTAGAC TACAAGACCCGTGCCGAGGTCAAGTTCGAGGGTGACACCCTCGTCAACCGCATT (Aequorea CGTGCTAGACGAAAGTCTCCATCTTGTCTGCGGGCAGTGCTTCAGTCGCCCAGAT GAGCTGAAGGGTATCGACTTCAAGGAAGATGGCAACATCCTTGGCCACAAGCTG victoria) TCTCGATGGAGATTGGCCAGGTCAGCCATATATACCCTGCAATGGCAGACCAATG GAATACAACTACAACTCTCACAACGTCTACATCACCGCCGACAAGCAGAAGAACGG CAGCAGGCCCAGTATAAGGAATTCCCCTCGAGCTTGTCTGTGATTGCGTTTTTTCTA CATCAAGGCCAACTTCAAGATCCGCCACAACATTGAGGATGGTGGTGTGCAGCTG ACACTTGTTGTTGCATCCGATCCGTCCCTACCAATTATTGGTCCACCGTCAAAATGG GCGGACCACTACCAGCAGAACACCCCCATCGGTGATGGACCTGTGTTGCTCCCCG GAGACC ACAACCACTACCTGTCCTACCAGTCTGCTCTCTCCAAGGACCCCAACGAGAAGC GTGACCACATGGTCCTCCTCGAGTTCGTCACTGCTGCTGGTATCACCCACGGAATG Pc22g16370 GGTCTCGGTGCATGGTATTTTGGCCGATTTAAGGTATCAAGAAGATCGCCTCTCATA Promoter GATGAGCTGTACAAAtaaaGGAGACC ATATGGCCTATGGAATACTACCTCAGGTAGCTACCTAAGACACAAAGCGGAGGT used GACTAACCGGATATTTATAGATTTCCAGATCGAGTTCATTTTCATTGTTTATGTTTA for eGFP Anid_ GGTCTCGtaaaAATAGTTCATATTCCACTCTGGAAGGAGGGAAATGAACTGGC Used as

GAGAATGAGGAAAAGTAAATAGACTAATGTAAACAGTTAGAATCATTCTCCAAT expression AN4594 GCCCGCATCAACCCTTAGCTGGGTTCATGACGGTGTGGTTGTCGATGGGCTTG terminator chrysogenum Penicillium TATTTATTCTATTCTCAAACCGATCAAGTCCAAGCAATTTCCATTGAAATTTCCTTA terminator CAGAAGATCTAGCAACGCTGGGTCGACTTCGATACCCGTTAAAAACAGTCATA for eGFP ATTTCCAAAGAGAATCGAGACAGTCGATTTCCAGGGGGCCCGGACTCCACTGCG sequence AAAATGGAAGAGTTGCAAAGCGTATACTATATATAGCTCCTATCGCTTTCGTATTGT (A.nidulans TATCTGCCACTTTTCCTCCTTTTTATCTTTCCCTCTCTCTCCTCCTCTCTTTCAAACT GACTTAACTATTGTAGAGCCTGGTAGAGAAGAGTAGAACACTTGACCGCAT terminator, GTCAATCTTATCCACTCTTTTATTCTTTTCTTTTTATTGATTGATTCT TATATCTGGTATTCTACAAAGCCAGTGCACCCTCGGCTAACAGAcctcGGAGACC possible GTCTCTTGTTTCTTTTTCCAGCCTGGTGCTGTCTTTTTCTCTCGCAAGGAGAT ribosomal

TCTTTTCTTTTGACTCCCAACCTCTTACCATCCCCACGGATTGTCTCTGAAC proteins of engineering for strain New promoters CCACTCCGGTTTTAGGTACTGTAATCCTATTATCTTTCTATGTCTTTCTTTTATATC S10a) GCTCTATTTCATTGCCACATGCAGTCACACCTGTCGTTCCCACACTAACTAACCG CAGTCACTCCTTCCCGTCCGCCTCGTTCAGGACCCGGCAATCAACAACTCTTATATA CAAGCGCATCGCTCATCACCCATCGCCATTCCCTCTTTTTCTTCGATTATTTCATAC CAATTCCATTCCACAGCCTAACCCAATCCGCACCGTCAAAATGGGAGACC

Pc21g21380 GGTCTCGGTGCGTCGACTACATGTATCTGCATGTTGCATCGGGAAATCCCACCA Promoter CAGGGACAGCCAAGCGGCCCCGCGACTTGGCAGTGGGCAAACTACGCCCGATTCT used GGTGCCAAGAACCGAGAAGAATGAGACAGACCCACGTTGCACTCTAACCGGAT for eGFP GCTATCGACTTACGGTGGCTGAAGATTCAACACGCTGCAACGAGAGCCAAGGTG expression GTCCGGACATTTTCTACGTGCCGGTTTACCTTGGAACATCGCCGTCGTTGAGT GCACGTTGCCTACTCTCTCGTGGCTTGGCTGGGCCCACGAGCCCGATTGACTC GACGGTGTTACTTGGGTATCTATGGCCCCGTTTTCTGGCACGGTAATGATAAG TACTTACTAGTCATCGAGCGGGGGAGTGTTGCTCTGCCCGAGCACAACGATTGG CCTGATCGCACCGTCTGCAAATGCCACGGTGCGGACCGACTGAAATCTCAGAC CACCAAAGACCCTCCGACTTCGAGATACGGTTACTAATTTTACACTGGCTCCAG CGGCCCCATCCAGTAAGCATCTGGGCTGCAAGCGTATAATGTCTCCAGGTTGTCT CAGCATAAACACCCCGCCCCCGCTCAGGCACACAGGAAGAGAGCTCAGGTC GTTTCCATTGCGTCCATACTCTTCACTCATTGTCATCTGCAGGAGAACTTCCCCT GTCCCTTTGCCAAGCCCTCTCTTCGTCGTTGTCCACGCCTTCAAGTTTTCACCAT TATTTTCACCGTCAAAATGGGAGACC

74 Supplementary information Supplementary information 75 Short Table S2. Oligonucleotide sequences used in this study Biobricks Primer sequence (5’->3’) description Pc24g00380 GGTCTCGGTGCACTTTTTTGGTCCTGATTGAAAATGGTAGCGTGGTCTAGGA P.chrysoge- Pc Paf.pro GAGGTGAAGGAAGATCTAGCACTGCTTGATAACGGGTGCAATTGTCCAGTA num Oligo Primer sequence (5’->3’) Purpose AAGAAAGGCGTGCCTATCGTGCGATTGAAACAGAGAGCGGATGATATGTGGCG promoter 5-5 IGR AAGCGACTTCCAATCGCTTTGCATATCCAGTACCACAC- Forward for 5’ IGR cassette GATCTCCCAGTACAAGGCATGTTACATCTCTCCCCTAGTCGTAATTGCAAGGAT sequence CCACAGGCGTTTCTAGGCTAAGGTCCGTTATC CAAACGTTGGGTCAATGGAATTCAGAGAGCTTTTCGTACGAAGTGCGTAATGTAC Pc24g00380 a-5 IGR AAAGCAAAGGAAGGAGAGAACAGAGGAGTACTTGTAC- Reverse for 5’ IGR cassette GTAGCATTTTATGGTAGCATGCAAAGCACATTTTGCTGCAACCCCAATTTAATGC antifungal GTTCGATGGGCAAGACTAAATCGGCTACTAGGC GGTCCTGCTCAATAATTGATCTGCACTAAGGCCTTGGCGATGGGGCCAGAAAAG protein d-3 IGR AACGTTGTCCAGGTTTGTATCCACGTGTGTCCGTTCCG- Forward for 3’ IGR cassette GGTTGTTCAGTGGTGTGTACTCCGTAATGGTCAAGCCGATTTCGAGAATGACCG precursor CCAATATTCCGCGATAGGTCTTCGGAGATAGAAG TAGTGTTCATTCATCAGTGCGATATTAAATCAGTTAGCTACTCTATCTGAAAGCTA paf 3-3 IGR ACTTAGTATGGTCTGTTGGAAAGGATTGTGGCTTCG- Reverse for 3’ IGR cassette ATAAATTTCTTTACCACTAACAATACTCTTCTCTGACTGAAAGTACCTTTTC CATACAGGCTTTCTGATTCTCGTCGGAAGTACG CACTCCCCTCATACTTCATGTTTTAAGCTCAACCGTAGGAAAGCCTGTATATCT b-Amds CGGATCGATGTACACAACCGACTGCACCCAAACGAACA- Forward for amdS cassette TAAAAGATTTGGATTTACTCTTCCAGCGCTTACTGTCTGCTCTTTCGGCCGAGC CAAATCTTAGCAAAGCAGGCTCCTGGATCC GAACCTTGGCAGTATGATCGGACTATGTACTTTGTTACACAAAAGGAGAAGCGGG c-Amds CAACAGGAGGCGGATGGATATACTGTGGTCTGGAAGAT- Reverse for amdS cassette GCTGCCACTGAGGACAACCCCTGTTCAAGGGCTAGCATCCCGCTGTAAGCCCAC GCCGGAAAGCGTGTACCGCTCGTACCATGG CCATCCCACCTTGAAGTATGCAACTTTTGACCGCCTAGACCATGTGAGCTTAT A ACCTAGGCTAAGGTCCGTTATC Forward overlap GFP fragment GTTACTGAAATACTACCCGCGAATCATTTCCTAATTTGCTTTGGCTCGAATCCAC CCCAGCCCTACGTAACACAACCGGGAGCTGCCTTACAGCTTGGCTGTATCACAG B AGGGCATCAAGCTCACTAAC Reverse overlap GFP fragment TATCACATAGATACATACATAGTATAGTGCCTTTGCCTTTTCGACCTATAAGCATCCG CCATATGCTAAACCTTCTCATATACCAACATTTTGGATTTGGAGATCATTTCCTAGT C TCCGCCTCTTCACCAAATCC Forward overlap DsRed.SKL GAAACAACTTTATCAAATGCAATGCAGCCATCGTCCTTTGCAGATCCGAGTGGC fragment CCAGTCACCGTGTCAACGTGTCAGCCGTTTTCTCTGCTTTTTAGGAAATGATTAC D GATTCTCGTCGGAAGTACGGC Reverse overlap DsRed.SKL CACTAGGTAAGCCCAAAAATATCTTCCTGGTAAACAAGTAGTGCATCTTACCCCG fragment GAGGCTGAAGCAGGTAAGGGATTTTGGAGAGAGCCCACCCGTAAGAATATACCAG 5 IGR fw GGATCCGGTCGCTAATATCG Forward integration site check, CCAAGAGGTCCAGTATCCTGAAGTATGTGAGGCATTAATGTCATTGGAGAAGTCAT overlap GFP fragment GCAATCCATAAGCTGCCACCCCCAAGATGACTGCATTGGACCTGAGCATTGTATGT GFP rv GGTGTCACCCTCGAACTTG Reverse integration site check, 3 GTCACCTTTCACACAGAGCTCATGATCTGGTTTATAAAGGCGGCTTCATGACCCT overlap GFP fragment 3 CAATTCCATATAGTATCACTCCCATCACAGCATTTCGATATCTTCAACCACTTTA DsRed.SKL fw GCTTCAAGGTCCGCATGGAAGG Forward integration site check, ACCTTCTCCAGAGGATCATCATCTCAACACCGTCAAAATGGGAGACC overlap DsRed.SKL fragment 3 IGR rv CTACCTCGTGGGATAGTCAG Reverse integration site check, DsRed GGTCTCGaatgGCCTCCAGCGAAGATGTCATCAAGGAGTTCATGCGCTTCAAG RFP (Red overlap DsRed.SKL fragment GTCCGCATGGAAGGATCCGTCAACGGCCACGAGTTCGAGATTGAGGGTGAGGGT Fluorescent γ actin gDNA fw TTCTTGGCCTCGAGTCTGGCGG Forward for copy number GAGGGCCGCCCCTACGAAGGCACCCAGACTGCCAAGCTCAAGGTCACCAAGG Protein) GTGGTCCTCTCCCCTTCGCTTGGGATATCCTGTCTCCTCAGTTCCAGTACGGCTC from γ actin gDNA rv GTGATCTCCTTCTGCATACGGTCG Reverse for copy number CAAGGTCTACGTCAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTTTCTTTC Discosoma eGFP fw CCACCTACGGCAAGTTGAC Forward for copy number CCCGAGGGTTTCAAGTGGGAGCGTGTCATGAACTTCGAGGATGGTGGTGTTGT species GACCGTTACTCAGGACAGCAGCTTGCAGGATGGCTCTTTCATCTACAAGGT with a 12 aa eGFP rv GGTGTCACCCTCGAACTTG Reverse for copy number

CAAGTTCATTGGTGTCAACTTCCCCTCCGACGGCCCTGTCATGCAGAAGAAGAC ‘SKL’ tag for chrysogenum Penicillium CATGGGCTGGGAAGCGTCGACTGAGCGTCTGTACCCCCGTGACGGTGTTCT peroxisomal Ds Red-Skl fw ATAAAGGCGGCTTCATGACC Forward for copy number CAAGGGTGAGATCCACAAGGCTCTCAAGCTCAAGGACGGTGGTCACTACCTTGTT targeting. GAGTTCAAGTCCATCTACATGGCCAAGAAGCCTGTGCAGCTGCCCGGATACTAC Codon pair Ds Red-Skl rv AGTCTGGGTGCCTTCGTAG Reverse for copy number TACGTGGACTCCAAGCTTGACATCACCTCCCACAACGAAGACTACACCATTGTT optimized NiaD fw TGATGGCTCCTCCAGGATG Forward for copy number GAGCAGTACGAGCGTGCTGAGGGCCGCCACCACCTCTTCCTGACCCACGGAATG for ex-

GATGAGCTGTACAAGTCGAAACTAtaaaGGAGACC pression in NiaD rv CGGGTGGATGGAAAGAGTC Reverse for copy number of engineering for strain New promoters filamentous fungi

Anid_ GGTCTCGtaaaTAAATGGTTTGCGTTGCGATTGACTGAAACGAAAAAAAGCGAAAAT Used as AN7354.ter GATTCTGGGAATGAATTGATAAAGCGCGGGCTCTGCGGTACGGTTACGGTTGCG terminator GTCGCGGACGAATGGACTGGGCTGAGCTGGGCTGGAGGAAGTCCATCGAACAAG for DsRed GACAAGGGGTGGAATATGGCACGGGTCGATTTTGTTATACATACCCTACCATC (A.nidulans CATCTATCCATTTAAATACCAAATGAGTTGTTGAATGGATTCGCGGTCTTCTCG terminator GTTTATTTTTGCTTGCTTGCGTGCTTAAGGGATAGTGTGcctcGGAGACC from possible ribosomal proteins L32)

76 Supplementary information Supplementary information 77 PENICILLIN BIOSYNTHESIS PATHWAY RECONSTRUCTION IN PENICILLIUM CHRYSOGENUM

Fabiola Polli1, Jan A. K. W. Kiel1, Remon Boer 2,3, Roel. A. L. Bovenberg2,3, Arnold J. M. Driessen1

1Molecular Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands 2DSM Biotechnology Centre, Delft, The Netherlands 3Synthetic Biology and Cell Engineering, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Groningen, The Netherlands ABSTRACT During thelastdecade,major improvements have beenmadetowards we have reprogrammed penicillinbiosynthesis inP. re chrysogenum by to enablefuture pathway remodeling. tion andby expressing thispathway from anextrachromosomal vector, the development of agenetic toolbox for P chrysogenum.Inthisstudy locating thepenicillinbiosynthetic pathway toadifferent genomic loca - - 1. The filamentous fungusPenicillium chrysogenum is used for the indus- Due totheir excellent therapeutic effectiveness, limitedtoxicity and Fermentation of penicillinGisthebasisfor theproduction of semi- tous fungihave provided themeanstoengineer fungal strains inamore trial production of penicillinandcephalosporin that some of thehost. synthetic but recent developments of recombinant DNAtechniquesin filamen- by chromosomal location be easily manipulated and isolated without interfering with the chromo- bling inSaccharomyces cerevisiae be further amplifiedinvitro, invivo assembly methodscanbeused. For into account, like the required enzymes, their expression level, regulation investigated inP. chrysogenum . instance, refactoring of the instance, thefungal AMA plasmidscarryautonomously replicating se- and activity, but also product export, energetic and co-factor require- affordable pricing, ous classesof at high copy numbers in filamentous fungi cluster, theuseof different promoter elements,or thelocation of ge- optimized by different strategies, by usingheterologous enzymesfrom opment of anefficientbiosynthetic pathway whichtakes variousaspects ements. In recent years, effective in vitro assembling methods have been efficient reconstruction of biosynthetic pathways usingmodular DNAel quences (ARSs) extrachromosomal autonomousreplicating plasmidscanbeused. For different sources, by changingtheorder of the genes arranged ina gene developed rational manner mutagenesis has been the main methodology for strain improvement nomic integration. Geneexpression, for example, isstrongly influenced ments andpotential sideactivities.Biosynthetic pathways canbefurther produced by P. chrysogenum pounds suchaspravastatins andcephalosporins could beefficiently Successful genetic andmetabolicengineeringdependsonthedevel One of the key enablingtechnologies for metabolicengineering isthe INTRODUCTION P. chrysogenumisanexcellent platform for β 224; 232; 320; 321 -­ lactams, like ampicillinandamoxicillin. Inthepast,classical natural products 250 204; 218;317 that allow replication of the plasmid and maintenance β -lactams are broadly usedaround theworld . However, when such pathway constructs cannot 318; 319 . For instance, by genetic engineeringcom- M. genitaliumgenome involved in vivo assem- strains andthiscapabilitydemonstrated . As an alternative to genomic integration, 16; 17;315 223 . Sofar, suchmethodshave not been . 249 . Additionally, plasmids can the production of vari- β -lactam antibiotics. Introduction 316 - - . ­ 4 81 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 82 The performance of thepenicillinbiosynthesis pathway inthesedifferent 24.84; MgSO 2.5; CaCl 2YT medium enrichedwith0.6% agar2YT medium was usedtomake atopagar layer. 2.1. 2. AMA plasmidtorealize extra-chromosomal plasmid-basedexpression. yeast nitrogen base(YNB), 6.66;citricacid,1.5;K ways inP. chrysogenum,we have examined thepenicillinbiosynthesis 5.0; K vided by DSM-Sinochem Pharmaceuticals, The Netherlands. To obtain (in g/liter) glucose, 5.0;(in g/liter) lactose,75;urea 4.0; Na (∆hdfA, ∆ku70, ∆Pen-cluster derivative of DS54466) (PAA), 2.5(g/l)and10mlof atrace elementsolution (in g/l):FeSO DNA Polymerases, and T4 DNAligase usedinthisstudywere purchased ­Na DS47274 (single copy Pen-cluster derivative of DS54466) andDS68530 Scientific. from Thermo o days at 25°C. The bioassay analysis was performedfor using penicil 7 to pH 6.5. The mycelium was grown inashakingincubator at200rpm genetic arrangements was assessedasafirst steptowards complex met- Escherichia coli strain DH5 lated inapenicillinproduction medium(PPM) withthefollowing reagents lin production medium+PAA withtheadditionof 0.6% agar. Micrococcus incubator at200rpm25°C.For shake flaskanalysis spores were inocu- introduced into its original chromosomal locusaswell as intoanectopic in 2YT medium (Bactotrypton, 16 g/l; yeast extract 10 g/l; NaCI, 5 g/l). in 2YT medium(Bactotrypton, 16g/l;yeast extract 10g/l;NaCI, 5 g/l). ulated into YGG mediumcontaining (in g/liter): KCl, 10.0; glucose, 20.0; extract, 2.0. After inoculation,cultures were incubated for 24hina rotary abolic pathway engineeringinP. chrysogenum. chromosomal position.Inaddition,thepathway was assembledintoan mycelium of P. chrysogenum for DNAisolation,fresh spores were inoc pathway. Through aninvivo assembly technique,thispathway was re-­ luteus was usedasindicator strain for penicillinformation andgrown Materials andmethods As afirst steptowards the construction of complex biosynthetic path- 2 MoO·2H MATERIALS ANDMETHODS 2 STRAINS, MEDIA, AND CULTUREMEDIA, STRAINS, CONDITIONS HPO 2 ·2H 4 2 , 2.12;KH O, 0.0125; CoSO 2 4 O, 1.6;MgSO ·7H 2 O, 0.0125; EDTA, 31.25; C

2 PO P. chrysogenumDS54466 4 α 4 ·H , 5.1;supplementedwithphenylacetic acid , restriction enzymes, Phusion High-Fidelity 2 4 O, 3.04; H ·7H 2 O, 0.625. The solution was adjusted 3 BO 6 3 H , 0.0125; CuSO 6 Na (eight copy Pen-cluster), 2 2 O SO 2 HPO 7 ,

4 322 43.75; ZnSO4·7H , 4.0; CH were kindly pro- 4 , 6.0; andyeast 4 ·5H 3 2 COONH O, 0.625; 4 ·7H 2 2 O, O, O, O, 4 - - , The flankingsequences tothepenicillin genecluster (3’ from thepenDEgene THE CHROMOSOME 2.2. flanking regions totarget the reassembled flanking region was recovered from pFP usingthePac were generated usingprimers combination P034/P035andP338/P339 ( Kanamycin (Kan) resistance gene for selectioninE.coli andoripUC origin P054 containing Not Pc20g07100 (named 5’IGR and 3’IGR, respectively) were used for the tar to construct the plasmid backbone, herein after named pFP. Oligonu- taining thepcbC stream of Pc21g21390 (pcbAB) (named 5’OFR and3’OFR, respectively) In vivo penicillingene cluster reconstruction intoP. DS68530 chrysogenum geted genomic integration of thefragments. The 5’OFR,and 5’IGR regions Pac hereafter referred toas Fragment 1. between genes Pc20g07090 andPc20g07100 were usedashomologous and 3’from thepcbAB gene), representing theoriginallocus,andregion used tocutpcbAB ufacturer’s protocol (Invitrogen). Restriction enzymesPac and cloned into TOPO® blunt-end cloning vector according to the man- cleotides P056(Pac of replication. The PCR product was phosphorylated and then self-ligated chromosome was done using two different chromosomal integration sites. and clonedintopFP_pcbCpenDE creating pFP_pcbCpenDE_5’OFR and and thedownstream region of Pc20g07090 andupstream region of uct of was subsequently clonedintotheplasmidbackboneusingAat and P039were usedinthePCRreaction toamplifyaDNAfragment con- containing rare restriction sites,were usedfor amplificationandto for a minator sequence of pcbAB product was thenclonedinto pFP originatingpFP_Tacvs. pFP_pcbCpenDE_5’IGR, respectively. The DNAfragment pcbCpenDE_5’ plate multiple cloningsiteinpFP. penDE-pcbC-pcbAB) togetheramdS withthe The The chromosomal regions upstream of Pc21g21370 (penDE) and down- Plasmid pDon221-Amds was usedtoamplifyasequence containing the Chromosomal DNAfrom P. chrysogenumDS17690 I restriction sitesgenerating thepFP_pcbCpenDE plasmid. for theamplification of penicillin gene cluster genes. Primer P038 pcbAB (Pc21g21390) gene was amplifiedusingoligo P040andP041 PENICILLIN PATHWAY RECONSTRUCTION INTO (Pc21g21380) andpenDE(Pc21g21370) genes. The prod - gene from pFP, henceforth calledFragment 2. The ter I, I andHindIIIrestriction sites,respectively. The PCR HindIII gene was amplified usingprimers P053and SacII, SbfI, Penicillin reconstruction pathway chromosome intothe Acl gene for transformant selection. β I) andP057(Aat -lactam biosynthetic pathway I andAat was usedastem- I and II, II sitesand NheI, Not I were II and Not I) I) - - 4 83 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 84 These regions were amplified byPCR from P. chrysogenumDS54465ge - 2.3. was recovered from pFP using was usedtobuildtheP. chrysogenumtif35deletioncassettesasde- variants. Transformants were selectedon0.1% acetamide regeneration (overlap 1)andatthe Supplementary information. transformed with1.5 Multisite Gateway Three-Fragment Vector Construction kit (Invitrogen) selected on acetamide plates(Figure 2). P. chrysogenum DS68530 was scribed sulting 5’sequence was recombined intopDONR P4-P1R yieldingplasmid gestion withSacIIandSbfIresulting inpFP_Tacvs_amds_Tact. The 3’OFR gene were used for targeted genomic integration of thedeletioncassette. guidelines andlistedin Table S1of Supplementaryinformation. The re- gene (amdS)was usedasselectionmarker for the deletionof tif35gene. ble amount of linearized Fragment 2, for both chromosomal fragment in thegenome, willform afunctionalpenicillingene cluster thatcanbe as Fragment 3.Primer sequences usedcloningare listedinthe Table S1of correspondingly. The DNAfragment Tacvs_amds_Tact_3’ flanking region erating pFP_Tacvs_amds_Tact_3’OFR andpFP_Tacvs_amds_Tact_3’IGR, and P340/P341 clonedusingSbfIandAcl and 3’ IGR regions were generated using primers combination P048/P058 using primers P044andP045insertedintopFP_Tacvs_amds by di- a derivative of pDon221 withniaDF1–Panid_gpdA-Anid_amdS-niaDF2 plates toselectfor thepresence of theamdSgene F_av_ms The ­pFP_Tacvs_amds. pFP_Tacvs usingHindIIIandSacIIrestriction enzymesinorder tocreate plified from pDon221-Amds usingprimers P055andP043clonedinto marker for fungal transformation. The amdS cassette was kindly donatedby Dr. Jan A. K.W. Kiel. The acetamidase CONSTRUCTION nomic DNAusingtheoligonucleotides designedaccording tothegateway ­resulting inpDSM-JAK-121 plasmid. The pENTR221-niaDF1 amdS-niaDF2, pDSM-JAK-102 while the 3’ sequence was cloned into pDONR P2R-P3, Materials andmethods The three generated fragments have a750bp overlap atthePpcbC The acetamidase gene (amdS)fromA. nidulanswas usedasselection P.CASSETTEDELETION CHRYSOGENUM TIF35 262 . The upstream anddownstream regions of Pc22g19890 (tif35)

act terminator was PCRamplifiedfrom ­ μ TpcbAB g of linearized Fragment 1and3withdou- Not (overlap 2)genes that,once recombined I and Acl I intopFP_Tacvs_amds_Tact gen- I sitesand hereafter referred to gene sequence was PCRam- 262 . pDSM-JAK-108 To complement thedeletionof thechromosomal tif35gene, ­ 2.5. 2.4. first plasmid creates a chromosomal deletion of the essential Pc22g19890 vector, carryinganadditionalcopy of tif35, (tif35) gene inP. chrysogenum while,thesecond vector complements the (ATCC38163) genomic DNAastemplate. The AN0465PCRproduct was For thein vivo reconstruction of thepenicillinbiosynthetic pathway into gested with the same restriction enzymes. The resulting plasmid was E. coli/P. chrysogenumpDSM-JAK-108 shuttlevector. ing plasmidDSM-JAK- 203andDSM-JAK- 204containing MluIandSma bone pDSM-JAK-107 usingNot ing primers DSM-JAK-201 andDSM-JAK-202 usingA.nidulansFGSC A4 a derivative of theE.coli shuttlevector withAMA1region pAMPF21 using oligo DSM-JAK-111 andDSM-JAK-112. The PCRproduct was subse- a stableAMA1plasmid,pFP-phleo-122 andpDSM-JAK-108 were used. The quently digested withNot digested withAsp718iandBamHIinsertedinpBBK-001 digested withHindIII(bluntedby Klenow treatment) andKpn pDSM-JAK-202 usingtheHpaIandKpn pDSM-JAK-201 originatingpDSM-JAK-202. restriction sites, respectively. The PCR product was then cloned into named pDSM-JAK-201. plate for theamplification of Pc22g19890 (tif35)gene was amplified pDSM-JAK-107 plasmid. promoter of theAspergillus nidulansAN0465gene was PCRamplifiedus- CONSTRUCTION pDSM-JAK-122 plasmid. plasmids were recombined withvector pDEST R4-R3generating the PFP-PEN-108 VECTOR The DNAfragment P AN0465_DsRed.SKL_Tact was recovered from The terminator of theA.nidulansact(AN6542)gene was amplifiedus- The pDSM-JAK-102, pENTR221-niaDF1-amdS-niaDF2 and Chromosomal DNAfrom P. chrysogenumDS54465was usedastem- PENICILLIN PATHWAY RECONSTRUCTION ON AMA1 VECTORPDSM-JAK-108, I andBamHclonedintotheplasmidback I andBglIIrestriction sitesgenerating the I sitesandclonedintopAMPF21*, was constructed asfollow. The pDSM-JAK-108, AMA1 vectorconstruction pDSM-JAK-108 ­pDSM-JAK-121 I resulting 323 alsodi- 324 - , 4 85 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 86 Tact terminator region was usedasthe3’JAKintegration site. The DNA (Figure 1of Supplementaryinformation). This setupallows for stable (named 5’JAKand3’JAK,correspondingly) were usedfor targeted inte- PCR amplified using primers P352 and P353 from the fragment Tacvs_amds_Tact was recovered from pFP usingNot the terminator of the sites andusedasFragment 3. scribed above. The promoter of theribosomalprotein S8(AN0465) and gration of the penicillingene cluster intothepDSM-JAK-108 vector. by invivo recombination of theDNAfragments. ing into pFP_pcbCpenDE resulting in pFP_pcbCpenDE_5’JAK. The DNA se- absence of thisessentialgene by carryinganextra copy of thetif35 gene quence corresponding topcbCpenDE_5’JAK was recovered from pFP us- promoter of the 6-phospho-gluconate dehydrogenase (gndA) gene was maintenance of pDSM-JAK-108 as backbone for pathway reconstruction Materials andmethods together withtheamdSmarker andthepenicillincluster genes. P. chromosome genome whileacomplementing copy of tif35willbepresent onplasmidpPF-Pen-108, way reconstruction. After transformation theblegene willhave replacedtif35 the the penicillinpathway reconstruction and pDSM-JAK-108 thatwillfunctionasplatform for thepath- essential gene, the DNA fragment 1 (pcbCpenDE_5’JAK), 2 (pcbAB gene) and 3 (Tacvs_amds_3’ JAK) for lin gene cluster. Figure 1.Generation of thestablepFP-Pen-108 transformants carryingthereconstructed penicil The plasmid pFP-phleo-122 to delete The 5’JAK region was generated usingprimers P036/P037andligated Plasmids providing “Fragment 1”, “2”and“3”were designedasde- Pac I andAat P. chrysogenumwas cotransformed withadeletioncassettefor thePc22g19890 (tif35) II sitesandusedasFragment 1. The previously descripted

γ -actin gene(AN652)from Aspergillus nidulans, tif35 was created as follow: the P. chrysogenum essential gene inthe I andSbf -

The deletioncassette for tif35was extracted from pFP usingApaI,puri- Table S1of Supplementaryinformation. P. chrysogenumDS68530was 2YT supplemented with0.6% agar. An overlay of 2 ml was added on each 2.7. 2.6. After transformation, An11g02040 promoter pathway strain fied usingGenElute™ GelExtraction Kit (Sigma Aldrich) andusedduring was designatedpFP-phleo-122 (Figure 1of Supplementaryinformation). were selectedonphleomycin (50mg/l)and0.1% acetamide regeneration with thesamerestriction enzymes. The resulting plasmid was usedas PPM+PAA platesaround thecolonies andafter solidification theplates P357. The For thedeterminationof thecorrect assemblingandintegration of the fungal mycelium ishomogenized inaFastPrep FP120system (Qbiogene, for thetransformation, yieldingtransformants putatively containing the ­ template for amplification of thegndA-phleogene withprimers P356and transformed usingtentimes more linearized DNAof thetarget chro - Carlsbad, CA,USA ).Diagnosticprimers for genomic integration siteused lin production medium(PPM) agar plates supplementedwithphenylacetic isolated from thetransformants after 48h of growth in YGG medium tif35 deletioncassetteandpDSM-JAK-108 were usedasDNA“cocktail” using amodified yeast genomic DNAisolationprotocol are listedinthe Table S1of Supplementaryinformation. co-transformation. Oligonucleotides usedinthiswork are listedinthe acid (PAA), 2.5(g/l)at 25°Cfor 3days. Micrococcus luteus was grown over downstream region sequence of Pc22g19890 (tif35),was replaced by the digested withXhoIandNco penicillin biosynthetic pathway intotheselectedregions, total DNAwas plates toselectfor thepresence of thebleandamdSgenes, respectively mosomal transformations night at30°Cin2YT mediumandthenext day dilutedtoOD gndA-phleo genes usingrestriction enzymesNot pFP-Pen-108 vector andtif35chromosomal deletion. Transformants CHROMOSOMAL ANALYSIS BIOASSAY OF PENICILLINPRODUCTION amdS gene of pDSM-JAK-122, localized between theupand P. chrysogenum transformants were grown on penicil 262 I andinsertedinpDON221-phleo, digested . Specifically, “Fragment 1”, “2”and“3”plus 242 . The gndA PCRproduct was I andPml 263 Chromosomal analysis I. The plasmid I. The inwhichthe 600 of 0.01 in 262 - - . 4 87 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 88 The column was equilibrated again usinga washing step of 10minusing 1250™ 120 Vof tubelens) mode,withcapillarytemperature setat325°Cwas 2.8. Acetonitrile (solvent C)inaratio of 90%and10%,respectively for 5minat filters with polypropylene Housing (VWR International Ltd.) and 60 filtrate were transferred toanautosampler vial. For separation, ­ 90% of solvent C.Formic acid(2%)was continuously usedassolvent D were incubatedovernight at30°C.Ascontrols, singleandzero Pen-cluster were autointegrated using basepeaktraces inamassrange of 10 ppm (3.0 ×75mm,2.2 (Thermo Fisher Scientific, San Jose, CA) was used. Ascan range between Jose, CA)processing toolwas usedfor amore accurate integration. Peaks Production of penicillinGandconsumption of PAA was assessedby LC/MS for 5 minutes). Supernatant fractions were filtered using 0.2 0.1% acetamide plateassolenitrogen source. transformants were in a next step selected onPhleomycin (50 mg/l) and software (ThermoFisher Scientific,San Jose,CA). Theappearing peakta- strains DS47274 andDS68530were used. The putative penicillin restored samples were collected from thecultures andcentrifuged (14,000 ×g bles were usedastarget list and eachfeature was integrated inevery individual sample.Later, theExcalibur 2.1(ThermoFisher Scientific,San in afinal concentration of 0.1%. Raw files were processed usingSIEVE using culture supernatants.P. chrysogenum control strains andthevari- a flow rate of 300 used for the elution. It started with 100% water (solvent A) and 100% used. Separation was performed onaShim-Pack XR-ODS™ and retention timewindow of 60seconds. ous transformants were grow in triplicates and after 3, 5, 7 days of growth, m/z 80andm/z 1600inpositive ione(4.2 kV spray, 87.5 Vcapillaryand PRODUCTION Materials andmethods

DETERMINATIONMETABOLITE OF HPLC system coupled in-linetoanES-MS­ µ µ

L/min. The solvent Cincreased upto 95%after 35min. M) (Shimadzu, Kyoto, Japan). Alinear gradient was Orbitrap Exactive™

c18 µ m syringe

column Accella µ L of L of

The 3.1. 3. tional promoter region STRATEGY Penicillium genome andare therefore not includedinthisstudy in Fragment ‘1’. The pcbAB targeting of thepenicillinpathway integration. position of theoligonucleotides usedtoverify thecorrect assemblingof thefragments andappropriate quences that were usedasoverlapping DNAfragments (overlap 1and2).Numbers (1to8) indicatethe Figure 2.Penicillinpathway assemblingstrategy. The dashedline rounded rectangles indicate the se- unique DNAfragment thatwas subsequently ligated with5’FRresulting are not clustered withtheother biosynthetic genes, butspread over the ods were used. The pcbCandpenDEgenes were amplifiedtogether asa cluster inP. chrysogenum , regular and TOPO® blunt-endcloningmeth- rate promoter, pcbC genes are expressed in opposite directions from a 1.16-kb bidirec phl gene isrequired for penicillinbiosynthesis. However, thephl penDE whichform asinglecluster locatedonchromosome I To obtain asetof fragments for reconstruction of thepenicillingene P. chrysogenumpenicillinpathway contains thegenes pcbAB, RESULTS PENICILLIN GENECLUSTERREASSEMBLING 328; 329 In additionto these genes also a CoA ligase encoding 325; 326;327 gene, duetoitsconsiderable lengthwas cloned . The penDE gene isexpressed from asepa- Penicillin genecluster reassembling strategy 6 . PcbAB and 330; 331 pcbC and genes . - 4 89 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 90 The deletionplasmid pFP-phleo-122 was designedtocreate adeletion were transformed totheP. chrysogenumDS68530strain (∆hdfA , ∆penclus- was used as terminator sequence for the acetamidase gene (amdS) and as vector was combined together withthepFP-phleo-122 plasmid(Figure 1). fungal cells can be screened for the absence of DsRed fluorescence. Addi- fragment (overlap 1)for thechromosomal andpDSM-JAK-108 vector tar the re-occurrence of homologybetween thefragments andchromosomal the cells onacetamide andphleomycin regeneration medium. To prevent tionally, correct pathway reassembling canbeassessedby thegrowth of ter) that lacks the hdfA gene involved in the non-homologous end-joining Consequently, whenthepathway iscorrectly integrated intotheplasmid, the reconstructed penicillin gene cluster, the multi copy pDSM-JAK-108 substituted withtheAn11g02040 (gndA)promoter. sequence gions of Pc22g19890 were usedfor thetargeted genomic replacement of geted integration of fragments 1and2(Figure 2). The terminator by theblunt-endmethodandusedasindependentFragment ‘2’. The bi- between genes Pc20g07090 andPc20g07100 thatwe previously usedto by DNAsequencing(data not shown). For chromosomal integration, we and its3”terminator sequence were usedasplasmidintegration sites. an additionalcopy of tif35(Figure 1of Supplementaryinformation). For tif35 withthephleomycin resistance gene (ble).The integrate heterologous pathways in integration region (3’JAK). The correct plasmidassemblies were verified complement thedeletionof thechromosomal tif35gene by carrying initiation factor 3subunitg(eIF3g) chose theoriginal penicillin gene cluster locusandtheintergenic region directional of of of regions, thepcbCpromoter normally usedtoexpress thephleogene was plasmid integration, the5” upstream region of theDsRed.SKL cassette recombination process andthat is devoid of thepenicillingene cluster. plasmid selectionbasedonfluorescence recombination site(overlap 2). The terminator region of the num pDSM-JAK-108 shuttlevector contains thefungal replication AMA1 Results pcbAB was insertedupstream of the For thegeneration of thestablepFP-Pen-108 transformants carrying P. chrysogenum

190; 249 pcbAB-pcbC promoter sequence was used asoverlapping DNA andthe DsRed.SKL expression cassette that allows for tif35 gene (Pc22g19890) thatencodes thetranslation 332 P. chrysogenum . Therefore, upanddownstream re- amdS 242 . This plasmid was usedto gene to create a second 242 . These constructs . These E. coli/P. chrysoge- γ -actin gene region - 3.2. the culture broth was analyzed by HPLC-MS. Introduction of the transformed strains and of thehoststrain grown for 3, 5and7days and In order toconfirm the restored penicillinproduction, liquid cultures of obtained with(A)Originalpenicillinlocustransformants, (B) intergenic locustransformants and(C) and ~1.7 and~1Kbfor (C). Extra bandswere present duetonon-specificamplification. to confirm by PCR the integration of the penicillin gene cluster into ping recombination sites (O1 andO2)between the fragments and correspond tothepositionsindicated pFP-Pen-108 transformants. Numbers 3to6indicatetheoligonucleotides usedtoverify theoverlap- pFP-Pen-108 vector. The predicted PCRproducts were: ~1.3and~1.6Kb for (A);~1.4and~2.3Kb for (B) in Figure 2 yielding the expected PCR products of 1 kb. Numbers 1, 2, 7 and 8 indicate the primers used Figure 3.Characterization of thereconstructed penicillinpathways transformants from P. chrysoge- num. DNA obtained by various PCRreactions was resolved on0.8% agarose gel showing theresults DETERMINATIONPENICILLIN OF P. chrysogenumgenome and into the Determination of penicillin penicillin of Determination β -lactam 4 91 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 92 transformants. cates thedifferent pFP-Pen-108 cus luteus.Latinnumbers indi- of growth inhibition of G production hascreated zones pFP-Pen-108 strains (A).Penicillin gle pencluster) andP. chrysogenum results obtained for DS47274 (sin - The plates show bioactivity assay used asindicator microorganism. with PAA. Micrococcus luteuswas (PPM) agar platesupplemented Penicillin production medium of PenicillinG.Bottom view of Figure 5. Bioassay for detection used are DS68530(zero pen cluster), DS47274 (single pen cluster) andDS54466(eight pen clusters). the penicillinproduction levels were determinedafter 5(blackbars) and7(gray bars) day. Control strain tergenic locus(I) were grown onPPM mediumsupplementedwithphenylacetic acid(PAA), 2.5(g/l)and DS68350 strains witharestored penicillinbiosynthetic gene cluster intheoriginallocus(O) andthein- Figure 4.PenicillinGproduction by thereconstructed penicillinpathways P. chrysogenumstrain. biosynthetic pathway (penDE-pcbC-pcbAB) and PAA consumption (data not shown) thatapproached thelevels found and Pc20g07100 resulted inlevels of penicillinGproduction (Figure 4) cluster locusor intotheintergenic region between genes Pc20g07090 Results

Micrococ -

into theoriginalpenicillingene The with afungal selectionmarker. By theuseof different flanking regions, (single pencluster) strains was usedaspositive control. Penicillin Gpro- fast, cheapandefficient ways todealwithlarge DNA sequences for thesinglepenicillincluster copy strain DS47274.Small growth differ that was usedpreviously for heterologous pathway integration toassess these constructs were targeted totheoriginalpenicillingene cluster locus the performance of thepenicillinbiosynthetic gene cluster hasonly been tools for genome editinghave become available suchastheCRISPR/Cas9 tial tofurther increase thepenicillinproductivity, inparticular since new the tions. Geneticengineeringontheother hand hasbeenusedtoredirect the surface of a penicillinbioactivityassay plate.P. chrysogenumDS47274 Classical strain improvement cycles using extensive mutagenesis has been system andmethodstoreconstruct pathways usingmodular cloningstrat- 4. homologous recombination system bacterium, Micrococcus luteus(Figure 5). biosynthetic pathway intoadifferent chromosomal locus. For synthetic in 2YT mediumandusedasindicator tomake atop2YT agar layer on and theintergenic region between Pc20g07090 andPc20g07100 genes ined for penicillinproduction inshakingflaskcultures and the respective assessed for itsoriginalchromosomal gene locus.Here, we assessedthe egies. Chromosomal expression of genes islocus–dependent,andsofar, alosporins and pravastatin. Genetic engineering has therefor great poten- a main strategy in improving combination system inP. chrysogenumfor pathway reconstruction into two els withdryweight measurements. ences were taken intoaccount by correcting thePenicillin production lev ever, suchfragments canalsobeefficiently fusedtogether bytheinvivo different chromosomal integration sides.Inthisstudy we reassembled the duction was detectedby thepresence of zones of growth inhibitionof the detected only by bioactivityassay. Micrococcus luteus was grown oneday penicillin biosynthesis pathway genes (pcbAB, pcbC,penDE,22Kb) together promoter strength inP. chrysogenum pathway reconstruction several invitro methodshave beendeveloped as potential of synthetic pathway reconstruction by re-locating thepenicillin For thepFP-Pen-108 transformants, thepenicillinGproduction was DISCUSSION β -lactam biosynthetic pathway for high value products such as ceph- β -lactam production in industrial applica- 223; 290;333 242 . The resultant strains were exam - . Thus, we usedtheinvivo re- Discussion 224 - How . - - 4 93 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum 4 94 yields were comparable to those observed for the single penicillin cluster were performed onthepFP-Pen-108 transformants, heterogeneity inthe DNA fragments canbeusedsuccessfully for biosynthetic pathway re - transcript levels of penicillingenes (pcbAB, pcbCandpenDE)mustbedeter this needstobeassessedby further gene expression analysis. Specifically, Moreover, infilamentousfungionly few markers are available representing these plasmidsare mitotically unstableandselectionmarkers are gener tile. To bypass thisproblem, we testedalsoamitotically maintainedAMA strains needfurther purificationbefore anaccurate quantitative statement sequences (ARS) AMA1 from A.nidulansthat somewhat smaller thanthatof thepositive control DS47274 (one penicillin served around thecolonies of pFP-Pen-108 transformants, butitssize was low performance inshake flask fermentation could betheuse of thestan- be thereason for theapparently low penicillinGdetection. Therefore, these improved production of its maintenance. We used aninvivo reassembling strategy toengineer the can bemadeontheir performance. Afurther possibleexplanation for the a limitingfactor inplasmiddesign. To overcome thisissue,adeletionof the ally neededfor maintenance, resulting inacontinuous useof antibiotics. can alsobelaborious cluster was successful and opens the way to engineer this cluster for the copy strain DS47274. This shows thattheinvivo reconstruction of the construction in P. chrysogenum.Furthermore, we provide anAMA1stable dard growth conditions for thelarge (33Kb) pFP-Pen-108 vector. However, cluster copy). However, thisassay could only beusedtoassespenicillin only bedemonstrated inabioactivityassay. Aclear halo(Figure 5) was ob- extra copy of thegene was addedintopDSM-JAK-108, AMA1vector, ensuring chromosomal essentialgene tif35was performed whilesimultaneously an pression inP. chrysogenum. plasmid strategy as a novel technology for facile gene and pathway ex mined andcorrelated torelative protein levels. multicellular andmultinuclear mycelium of thisfilamentousfungus could production butnot itsquantification.Since only few rounds of purifications plasmid expression of thepenicillinbiosynthetic gene cluster inP. chrysoge- plasmid anditstransformation athighfrequency infungi pathways infungi. The AMAplasmid contains theautonomously replicating plasmid thatcanbeusedasvector for future stableexpression of synthetic num. For the pFP-Pen-108 based penicillin production, production could Discussion Summarizing, thisstudyshows thattheinvivo reassembly of large Reconstructing large gene clusters through chromosomal integration

334 β , whilethechromosomal integration islessversa- -lactam antibiotics. allows thereplication of the 249; 335 . However, However, . - - - Table S1.Primer used in thisstudy SUPPLEMENTARY INFORMATION Target P056 P057 P368 P371 P365 P336 P335 P334 P286 P284 P283 DSM-JAK-112 P370 P337 P285 DSM-JAK-111 DSM-JAK-107 DSM-JAK-104a DSM-JAK-103a P357 P356 P353 P352 P341 P340 P058 P048 P037 P036 P339 P338 P035 P034 P045 P044 P043 P055 P054 P053 P041 P040 P039 P038 DSM-JAK-204 DSM-JAK-203 DSM-JAK-202 DSM-JAK-201 DSM-JAK-123 TTACAGTTAATTAACAAGCTTCCGCGGCCTGCAGGAACGTTT TTACATGACGTCGCTAGCTTGCGGCCGCTTAGCGGTAATACG TGTCATGCGGTTTGACGAG TGGCCAGTGGCTTATTACTC TGACGTCCTGCAGGTCGGTCACGGACGTAAGAG TTAAGAGACGTCGCGCTTGGCGTAATCATGG TGAAGTGCTAGCTTCAGCAGAGCGCAGATAC TGAAGTGACGTCGACTAAATCGGCTACTAGGC TGAATAGACGTCAGCGCCTCATCACCCATTCTC TGAAGTGCTAGCCAACGCCTTCTTGAACGTC TGAATACCGCGGCGTAGCATGGCATGGTCAC TTACATGCGGCCGCTGGCGACACCTTTAGTTAGCC TTACTTGCGGCCGCTCGGCAACGAGAGGTATG TGAAGTGACGTCTCCCTACTATCCCTCGATAGC TTGCAGATCTGC TCACCCTGTCTCGACTTCCTTGTC AAATGCCTGAGGCCAGTTTG AGAGGATCCGAGGAAGACGTGATCAGAGTAAGC AGTGCTTCG AGAACGCGTTAACGCAGGGTTTGAGAACTCCGATC AGAGGATCCGTTTGCTGTCTATGTGGGGGACTG AGAGGTACCGAGTTATAGACGGTCCGGCATAGG GCCATCCAGCTGATATCC GTTATCCAC GAATAGACGGCCGGTTTAGGG CAACCGACTCCGTCTTCAC GGTTCGCGGGCTAAAGTATC GTTATCGGACGGAGACTCAG CAGGCAAGCGAAATTCGAAG GGCGGAGAAGGTACGAAAC CGGACGATGGAAGTGATGG CTGGCGTTCAGGGATGTAG CCTGCAGATGACAATGAGTG GAAAGCGGCCGCGGTACCGTGCTTGGGATG TTCCATGGTAGC GGGAAACTAACCACGTGCTTGTACG GGGGACAGCTTTCTTGTACAAAGTGGAT GGGGACTGCTTTTTTGTACAAACTTGCTATCCCATCCAGATG GGGGACAACTTTGTATAGAAAAGTTGAGCATATTCTTTCACTG CAGGTGCACGTGAGTGGTACCGTTCGTATAGC CATTGGCGGCCGCAAAGCAGGCCATATAACTTCG GCGTTCCATGGCATTTTGACGGTGTGGGG CATTGCTCGAGAGTGCTCTTGCGTTACGG GGACATGGAACGTTGATTCTCGTCGGAAGTACG GACGTCCTGCAGGTGATAGGTCTTCGGAGATAGAAG GGATCAACGTTAGCTGCAGAGACTGCGATAGAC GTAGTGCTAGCTCTAGGCTAAGGTCCGTTATC CTCATACCTGCAGGAAGCTAACGCAGGGTTTG CTTGATCCGCGGTGGGGTGCTTCTAAGGTATG GGACATAAGCTTGGCCGCTCTAGAACTAGTG CTGGATCAAGCTTCTCGGCAACGAGAGGTATG GTGGAGTTAATTAAGTTGCAGCCCAGATGCTTAC GTGGAGTTAATTAAGACGGATCGGATGCAACAAC GGGGTGCTTCTAAGGTATGAGTCGCAA GGGGACAACTTTGTATAATAAAGTTGTGGGCCC Sequence (5’-> 3’) Supplementary information Supplementary TpcbAB amplification Tact amplification/ Tact amplification/3’JAK TpcbAB amplification 7-OFR/IGR/AMA 4- Overlap 1amplification 1-IGR 1- OFR 1-AMA 2-OFR 2-IGR/AMA 3- Overlap 1amplification 3’OFR amplification 3’IGR amplification 3’IGR amplification 3’OFR amplification 3’JAK/8-AMA gndA-phleo amplification gndA amplification gndA amplification gndA-phleo amplification AN0465 amplification AN0465 amplification act (AN6542)amplification amdS amplification amdS amplification act (AN6542)amplification pcbAB amplification pcbC-penDE amplification pcbAB amplification pcbC-penDE amplification 6- Overlap 2amplification 5- Overlap 2amplification 5’JAK amplification 5’JAK amplification 5’IGR amplification 5’OFR amplification 5’OFR amplification 5’IGR amplification pFP costruction 8-IGR 8-OFR pFP costruction pDSM-JAK-102 (pDONR pDSM-JAK-102 (pDONR pDSM-JAK-121 (pDONR pDSM-JAK-121 (pDONR tif35 amplification tif35 amplification P4-P1R) construction P4-P1R) construction P2R-P3) construction P2R-P3) construction Purpose 4 95 Penicillin biosynthesis pathway reconstruction in Penicillium chrysogenum Figure S1. (A) Map of the deletion construct for P. chrysogenum tif35 gene (Pc22g1890) used for de- letion. (B) Map of for P. chrysogenum tif35 gene (Pc22g1890) complementation. Features construct A: Amp, Ampicillin resistances genes for the selection in E. coli; gndA, promoter of the 6-phospho-­ gluconate dehydrogenase (gndA) gene from A. nidulans; phleo, Phleomicin resistance gene for selec- tion of fungal transformants. Features construct B: Cam, Chloramphenicol resistances genes for the selection in E. coli; AMA1, fungal replication AMA1 sequence; Pan0465, ribosomal protein S8 (AN0465)

promoter from A. nidulans; Tact, terminator of γ-actin gene (AN652) from A. nidulans.

4

96 Supplementary information SUMMARY AND CONCLUDING REMARKS Additionally, thegeneral transcription network for secondary metabolism, wealth of genomic information, apowerful genetic toolbox isrequired to fermentation features andhighlevels of penicillin production fectious disease from arange of sources fermentation characteristics of this filamentous fungi by altering its to perform suchscreens genome wide tance (AMR) that lastedseveral decadesandthatresulted instrains withthedesired this process, mostmutationsoccurred untargeted, andstatistically no that the majority of secondary metabolite gene clusters in typical fungal SUMMARY Current industrialproduction processes of penicillinantibiotics by the Velvet complex was hit by mutationscausingthedown-­ specificity could be found inthedistribution of mutations over genomic secondary metabolites,like polyketides strains were shown tobean interesting platform for theproduction of genomes are not transcribed under laboratory conditions andpossibly P. chrysogenum are based on classical strain improvement (CSI) programs lin gene cluster ics basedonuniquechemicalscaffolds. Inthis respect, large screening icillin biosynthetic pathway reside antibiotics activity. Genomesequencingand bioinformatics now allows clone thecorresponding large gene clusters, modulatetheir expression use of antibiotics alsohasledtothedevelopment of antimicrobial resis- encode unknown molecules with unique bioactivities chromosome alterations thatoccurred could bedirectly linked tothehigh of other secondary metabolitegene clusters coloured metabolitesinthefermentations suchasthesorbicillinoids of improved strains alsoincludedaselectionagainst theproduction of other of many secondary metabolismgenes. Other mutationsimproved the programs have been developed to identify novel natural products with performance of thesestrains, like thetandemamplification of thepenicil proliferation of microbody regions or biochemicalfunctionalgroups pounds ingeneral andhasledtothediscovery of many other antibiotics morphology, increasing theaminoacidmetabolism The antibiotic penicillinhasprovided major improvements incare of in- β -lactam antibiotics 341 thusproviding astrong urge toidentifynovel antibiot- 3 andtheinactivation of genes involved intheexpression 338 . Furthermore, itraised interest towards natural com - 339; 340 16; 18;19;20;264 5 , organelles inwhichkey enzymesof thepen- . However, theextensive andimmoderate 337 andpossibly even for other typeof . The CSI-improved. The 315 139; 140 7 . However, somemutationsand . 7 . Furthermore, theselection , resulting inthediscovery 4 andincreasing the 6; 142 . To exploit the P. chrysogenum 9; 336 regulation Summary . During 7 - . 5 101 Summary and concluding remarks and eventually use this information to assemble novel biosynthetic path- apparent in the strain in which additionally the chrysogine cluster was re- ways. For this approach, however, the genetic toolbox available for the moved. This effect was even further exuberated in the DS68530∆chy∆roq fungus P. chrysogenum is rather limited. Although transcriptional and strain which shows the accumulation of a range of fungisporin-derived translational elements are functional across a range of filamentous fungal metabolites, likely degradation products of the original NRPS products. In hosts, only few promoters have been applied in P. chrysogenum and com- this strain that lacks the three highest expressed NRPS gene clusters also pared in performance. Furthermore, DNA manipulation is a key element novel compounds were detected. However, this awaits further structural for further metabolic engineering and improvement of fungal production characterization to link these compounds to one or more of the secondary strains. Recently, the CRISPR/Cas9 DNA system for genome engineering metabolite gene clusters that are still expressed in this strain. Because of method was developed for P. chrysogenum 174. However, other strategies the accumulation of the fungisporin derived metabolites it will be neces- and methods for pathway reconstruction using large pieces of DNA still sary to also delete the corresponding NRPS gene in order to generate a need to be developed and exploited. This includes the use of the autono- secondary metabolite deficient strain that in the future can be used as a mously replicating plasmids carrying (ARSs) sequences 250 that are poorly generic production platform for secondary metabolites. developed for filamentous fungi due to their low stability and high risk of Chapter 3 presents a study that classifies a range of homologous and chromosome integration 165; 187; 249; 252; 253. heterologous promoters in terms of expression strength. Specifically, a set Chapter 1 gives an overview of the molecular biology of filamentous of six constitutive promoters from A. niger, and four from P. chrysogenum fungi and focusses on secondary metabolites produced by the filamen- were tested in combination with two terminators derived from A. nidulans. tous fungus P. chrysogenum with an emphasis on nonribosomal peptide Additionally, two P. chrysogenum promoters were tested that drive the synthetase (NRPS) and polyketide synthase (PKS) derived natural prod- expression of pcbC and pcbAB genes involved in penicillin production, and ucts and their genetics. It also discusses the classical strain improvement these were used for benchmarking 305. A modular promoter–reporter sys- (CSI) program and the genetic toolbox available for the engineering of this tem was constructed using the Golden gate cloning technique and in vivo fungus that is further expanded in the following chapters of the thesis. homologous recombination in the yeast, Saccharomyces cerevisiae. The Chapter 2 describes the impact of the deletion of two highly ex- promoters were used to drive the expression of green fluorescent GFP pressed secondary metabolites gene clusters that specify the metabolites protein while microbody targeted red fluorescent protein RFP was used chrysogine and roquefortine in a strain of P chrysogenum that is already as an internal standard. The synthetic pathways were transferred into devoid of the penicillin biosynthetic gene cluster. A method is described P. chrysogenum and growth was performed in the BioLector fermentation for the deletion of the aforementioned large gene cluster (>20Kb) in the system, which is a semi high throughput fermentation system that allows

genome of P. chrysogenum using Gateway cloning for the construction of on-line monitoring of fermentation parameters like biomass formation, Summary remarks and concluding 282 the large deletion cassettes. The resultant secondary metabolite deficient pH, O2 concentration and fluorescence of the reporter proteins . We strain was further analyzed by metabolite and gene expression profiling. focused only on high and medium expressed genes employing growth The DS68530∆chy strain in which the chrysogine gene cluster was re- conditions relevant for industrial production of β-lactams. The data pro- moved, showed higher levels of produced roquefortine-related metab- vides a catalog of promoter strengths with a promoter of a secretory pro- 5 olites whereas the expression of this gene cluster remained unaltered. tein belonging to the cerato-platanin family of phytotoxins, Pc20g15140, 5 Additionally, in this strain, fungisporin derived degradation products were being the strongest while the An02g10320 promoter of glucoamylase detected in the culture broth, while also expression of the fungisporine was the weakest in this analysis. With this catalog of different promoter NRPS gene was unaltered. Earlier studies have shown that the deletion strength, it will be possible to better tune the expression of target genes of the multy-copy penicillin gene clusters resulted in the complete loss of in future strain engineering programs. penicillin production that was accompanied with the simultaneous high A strategy to combine and use such new promoter is illustrate in Chap- level production of roquefortine and chrysogine-related metabolites 7. It ter 4. It describes the refactoring of the penicillin biosynthetic gene cluster was suggested that in this strain, a redistribution of amino acids into alter- (pcbAB, pcbC, penDE) in a P. chrysogenum strain lacking this cluster. This in- native secondary metabolites occurred, a phenomenon that also appears cluded the restoration of the pathway into its original locus as well as into

102 Summary Summary 103 the intergenic region between Pc20g07090 and Pc20g07100 genes that and shows that the in vivo assembly of pathways from DNA fragments was also used in Chapter 3 for the promoter pathway genome integration. can be effectively employed. Furthermore, the acquired knowledge on The pathway was constructed from three modules and integrated in the functional new promoters and terminators can be combined with the in genome using the in vivo recombination of overlapping DNA fragments vivo recombination, to construct new synthetic metabolic pathways in in P. chrysogenum. In addition, based on the efficiency of AMA plasmids Penicilium. Additionally, a further optimized secondary metabolites defi- reported in previous studies, a mitotically stable AMA plasmid system cient strain can be used as natural cell factory and they could provide new was developed as new platform for pathway refactoring and expression. natural products. This strategy was based on the maintenance of an AMA replicating plas- Concluding, the novel strategies can be in applied for more efficient mid by complementation of an essential gene function. Specifically, this discovery, production and modification of natural products that can be method relies on the simultaneous use of a deletion cassette for an es- used to treat/combat multi drug resistant bacterial infections. sential gene, in our case Pc22g19890 encoding for the tif35 gene involved in the expression of the translation initiation factor 3 subunit g (eIF3g) 332 and an AMA plasmid carrying a complementing copy of the essential gene. Transformation of the aforementioned deletion cassette and AMA plas- mid results in the inactivation of the essential gene whose function is complemented by the plasmid-encoded gene. This results in stable main- tenance of the plasmid (J. Kiel, personal communications). The penicillin biosynthetic pathway encoded on three DNA fragments was assembled in vivo by Penicillium into the AMA plasmid. In our design, the AmdS selec- tion marker was used in one of the fragments to select for the presence of the assembled pathway in the AMA plasmid. For plasmid maintenance, there is no need to use this marker. With the refactored pathways, the chromosomal targeting resulted in similar penicillin G production levels compared to the single copy strain DS47274, showing a successful in vivo assembly of the pathway from the distinct DNA fragments. On the other hand, with the AMA approach, penicillin G production was evident only

from the bioassay analysis, whereas very low levels were found in the Summary remarks and concluding culture broth using LC-MS. This low performance is unexpected but could be related to several issues. First, the regular fermentation condition was perhaps not optimal for the expression of the large (33Kb) AMA plasmid. In fact, the use of a lower growth temperature or different pH 342 could 5 improve the pcbAB, pcbC and penDE expression and therefore, the pen- 5 icillin production. Second, filamentous fungal strains exhibit a multinu- clear morphology and since only few rounds of selection were performed on AMA::PEN cluster transformants this could have affected the clonal purification and subsequently the performance of the AMA::PEN cluster containing strain. Therefore, future analysis should focus on the nuclear composition, growth and expression conditions of the strain. Taken together, the presented pathway refactoring is a first step to- ward the rapid implementation of novel pathways into P. chrysogenum

104 Summary Summary 105 van verbeterde stammenvond ookplaatsopbasis van gekleurde metabo- van antibiotica geleid tot deontwikkeling van resistentie van micro- van nieuwe antibiotica metunieke eigenschappen. Ditheeft geleid tot De huidige productie processen van oppenicillinegebaseerde antibio- De verbeterde P. chrysogenum productiestammen vormen eeninteressant fectieziekten gezorgd formatica geeft onsnude kans omgrote onderzoeken over het gehele ten zoals polyketides SAMENVATTING trokken bij deexpressie van andere secundaire metabolieten tica door P. chrysogenumzijngebaseerd opklassieke stamverbeterings- tiplicatie van hetpenicillinegencluster schillende bronnen schimmels niettot expressie komen onder laboratorium condities. Deze schillende genomische regio’s of functionelegroepen specificiteit worden ontdektindedistibutie van demutaties over de ver schappen enhoge penicillineconcentraties genoom tedoen grote programma’s omnieuwe natuurlijke producten met antibiotische gelinkt aandehoge productiecapaciteit van deze stammen, zoals demul P. chrysogenum, doordat demorfologie enhetaminozuur metabolismezijn heeft dat geleid tot deontdekking van vele andere antibiotica uit ver kunnen sommige mutatiesenchromosomale modificatiesdirect worden hebben geresulteerd instammenmetdegewenste fermentatie eigen- lieten, zoals sorbicillines laagd. Andere mutatiesverbeterden defermentatie karakteristieken van algemene transcriptie netwerk voor secundaire metabolieten,hetVelvet organismen enkele belangrijke enzymenvan hetpenicillinegencluster bevinden aangepast complex, waardoor deexpressie van vele secundaire metabolietenisver activiteit teontdekken. Het ontrafelen van deDNAsequentieenbioin- er interesse kwam voor natuurlijke verbindingen eninhetalgemeen deel van degenclusters welke coderen voor secundaire metabolietenin den demeestemutatiesongericht plaats.Statistisch gezien kan er geen mogelijk zelfs voor deproductie van andere typensecundaire metabolie- platform voor deproductie van andere programma’s welke tientallenjaren hebbengeduurd. Deze programma’s Penicilline heeft voor grote verbeteringen indebehandeling van in- 4 endeverhoogde ontwikkeling van peroxisomen 341 . Hierdoor iser eendrang ontstaanvoor deontwikkeling 139; 140 339; 340 , ditheeft geleid tot de ontdekkingdathetgrootste 315 338. . 7 Daarnaast heeftpenicillineer voor gezorgd dat . Desalniettemin,heefthet extensieve gebruik endaarnaastvond er eenmutatieplaatsinhet β 3 -lactam antibiotica endeinactivatie van genen be- 9; 336 . Tijdens ditproces von- 7 . Desalniettemin 16; 18; 19; 20;264 5 7 , waarin zich . Deselectie Samenvatting en 337 - - - - . ­ 5 107 Summary and concluding remarks genclusters coderen mogelijk voor onbekende moleculen met unieke in het volledige verlies van de penicilline productie, terwijl er grote hoe- (actieve) eigenschappen 6; 142. Om de grote hoeveelheid aan informatie veelheden roquefortine en chrysogine gerelateerde metabolieten werden goed te kunnen gebruiken is er een goede genetische ‘gereedschapskist’ geproduceerd 7. Een suggestie is dat er in deze stam een herverdeling nodig om de lange genetische clusters tot expressie te kunnen bren- van aminozuren in alternatieve secundaire metabolieten plaatsvindt, een gen en de informatie te kunnen gebruiken om nieuwe biosynthetische fenomeen dat ook lijkt plaats te vinden in de stam waarin het chrysogine clusters te kunnen samenstellen. De ‘gereedschapkist’ om dit te kunnen cluster is verwijderd. Het effect wordt vergroot in de DS68530∆chy∆roq doen in P. chrysogenum is relatief beperkt. Ondanks dat er transcriptie stam waarin de opbouw van fungisporine gerelateerde metabolieten, en translatie elementen zijn voor andere filamenteuze schimmels, zijn waarschijnlijk degradatie producten, verder toeneemt. In deze stam, er maar enkele toegepast in P. chrysogenum. Daarnaast speelt DNA mo- welke de drie hoogst tot expressie gebrachte NRPS genclusters mist, zijn dificatie een belangrijke rol in verdere engineering en verbetering van ook nieuwe moleculen ontdekt. Deze moleculen zullen verder moeten schimmels voor de productie van secundaire metabolieten. Recentelijk worden onderzocht om ze aan één of meerdere secundaire metaboliet is het CRISPR/Cas9 DNA modificatie systeem ontwikkeld voor toepas- genclusters te kunnen koppelen. Vanwege de opbouw van fungisporine sing in P. chrysogenum 174. Ondanks dat zullen er echter ook nog andere gerelateerde producten, zal het ook nodig zijn om het corresponderende mogelijkheden moeten worden ontwikkeld voor de reconstructie van NRPS gen uit te schakelen om een secundaire metaboliet arme stam te metabolische routes met grote stukken DNA, inclusief het gebruik van creëren, welke in de toekomst kan worden gebruikt als een productie autonoom replicerende plasmides 250, wellke slecht zijn ontwikkeld voor platform voor gewenste secundaire metabolieten. filamenteuze schimmels vanwege hun lage stabiliteit en de hoge kans op Hoofdstuk 3 is een studie welke homologe en heterologe promoters integratie in het genoom 165; 187; 249; 252; 253. classificeert naar expressieniveau. Een set van zes constitutieve promo- Hoofdstuk 1 geeft een inzicht in de moleculaire biologie van filamen- toren uit A. niger en vier uit P. chrysogenum zijn getest in combinatie met teuze schimmels en op de productie van secundaire metabolieten door twee terminatoren uit A. nidulans. Daarbovenop zijn de twee promoters P. chrysogenum. Het hoofdstuk is gefocust op Non Ribosomale Peptide uit P. chrysogenum welke verantwoordelijk zijn voor de expressie van pcbC Synthetases (NRPS) en Polyketide Synthases (PKS) afgeleide producten en en pcbAB getest en gebruikt als referentie 305. Er is een modulair promoter-­ hun genetica. Ook wordt het klassieke stamverbeteringsprogramma en de reporter systeem gemaakt door gebruik te maken van de Golden gate genetische ‘gereedschapkist’ beschikbaar voor de modificatie van deze fila- klonerings techniek en door middel van in vivo homologe recombinatie menteuze schimmel en uitgebreid in de volgende hoofdstukken besproken. in Saccharomyces cerrevisiae. De promoters zijn gebruikt om Green Flu- Hoofdstuk 2 beschrijf de impact van de deletie van twee hoog tot orescent Protein (GFP) tot expressie te brengen, terwijl Red Fluorescent

expressie komende secundaire metaboliet genclusters welke coderen Protein (RFP) gericht tegen microbodies werd gebruikt als interne stan- Summary remarks and concluding voor chrysogenine en roquefortine in een stam van P. chrysogenum welke daard. Deze synthetische routes zijn geïntroduceerd in P. chrysogenum geen penicilline gencluster meer heeft. Daarnaast wordt er een methode en de groei is beoordeeld in een BioLector fermentatiesysteem. Dit sys- beschreven voor de verwijdering van het eerder genoemde penicilline teem kan worden gebruikt om op grote schaal fermentatie experimen- gencluster (>20Kb) uit het genoom van P. chrysogenum door middel van ten te doen, waarbij fermentatieparameters zoals de ontwikkeling van 282 5 Gateway klonering voor de constructie van grote deletie cassettes. De biomassa, pH, O2 concentratie en fluorescentie van reporter-eiwitten 5 resulterende metabolieten arme stam is verder geanalyseerd door mid- online kunnen worden gemonitord. Gedurende deze studie is er gefo- del van metabolieten en genexpressie profilering. De DS68530∆chy stam cust op gemiddeld en hoog tot expressie komende genen tijdens groei waarin het chrysogine gencluster is verwijderd, produceert meer roque- condities welke relevant zijn voor de industriële productie van β-lactam fortine gerelateerde metabolieten, terwijl de expressie van dit genclus- antibiotica. De data levert een catalogus op van verschillende promoter ter hetzelfde blijft. Daarnaast zijn er fungisporine degradatie producten sterktes, waarin een promoter van een secretie eiwit welke behoort tot gedetecteerd in het medium, terwijl ook de expressie van het fungispo- de cerato-platanine familie van phytotoxines, Pc20g15140, het sterkste is, rine NRPS eiwit is veranderd. Eerdere studies hebben aangetoond dat de terwijl de An02g10320 promoter van glucoamylase het zwakst is gedu- verwijdering van alle kopieën van het penicilline gencluster resulteerde rende deze analyse. Deze catalogus van verschillende promoter sterktes

108 Samenvatting Samenvatting 109 maakt het mogelijk om de expressie van genen beter te aan te passen aan oorzaken hebben. De reguliere fermentatie condities zijn misschien niet de gebruikte condities in toekomstige stamverbeterings-programma’s. optimaal voor de expressie van het grote (33 Kb) AMA plasmide. Het kan In hoofdstuk 4 wordt een strategie beschreven om één van deze goed mogelijk zijn dat het gebruik van een lagere incubatie temperatuur nieuwe promoters te combineren en te gebruiken. Het hoofdstuk be- en een andere pH 342 de expressie van pcbAB, pcbC en penDE verbetert en schrijft de herintroductie van het penicilline gencluster (pcbAB, pcbC en daarmee de productie van penicilline G. Ten tweede hebben filamenteuze PenDE) in een P. chrysogenum stam waar dit gencluster niet aanwezig is. schimmels een multi kern morfologie en aangezien er maar enkele rondes Het cluster is geïntroduceerd op de originele locatie als ook in de inter- van selectie zijn uitgevoerd op AMA::PEN cluster transformanten, kan het genetische regio tussen Pc20g07090 en Pc20g07100, welke ook is ge- mogelijk zijn dat de zuivering van de verschillende transformanten niet bruikt in hoofdstuk 3 voor het introduceren van de promoter-reporter optimaal is. Verdere analyse van deze stammen zal moeten focussen op genomische integraties. Het gencluster is opgebouwd uit drie modules de kernsamenstelling, groei en expressie condities van deze stam. en geïntegreerd in het genoom door gebruik te maken van in vivo recom- Samengevat is de gepresenteerde herintroductie van metabolische rou- binatie van overlappende DNA fragmenten in P. chrysogenum. Daarnaast tes een eerste stap richting de implementatie van nieuwe metabolische is, gebaseerd op de efficiëntie van AMA plasmides aangetoond in eerdere routes in P. chrysogenum en er is aangetoond dat metabolische routes in studies, een mitotisch stabiel AMA plasmide systeem ontwikkeld als een vivo kunnen worden samengesteld uit verschillende DNA fragmenten. De nieuw platform voor de herintroductie en expressie van metabolische rou- opgedane kennis van functionele nieuwe promoters en terminators kan tes. Deze methode is gebaseerd op het behoudt van een AMA replicerend worden gecombineerd met in vivo recombinatie om nieuwe metabolische plasmide door de complementatie van een essentiële genfunctie. In dit routes samen te stellen in Penicillium. Daarnaast kan de verder geopti- geval is de methode gebaseerd op het gelijktijdig gebruik van een deletie- maliseerde secundaire metabolietenarme stam worden gebruikt als een cassette voor een essentieel gen (in dit geval Pc22g19890 coderend voor natuurlijk platform voor de productie van secundaire metabolieten, als het tif35 gen welke is betrokken bij de expressie van de translatie initiatie ook een bron van mogelijk nieuwe natuurlijke producten. factor subunit g (elF3g) 332 en een AMA plasmide welke een complemen- In conclusie kunnen de nieuwe strategieën worden toegepast voor ef- terende kopie van het essentiële gen bevat. Transformatie van de eerder ficiëntere ontdekking, productie en modificatie van natuurlijke produc- genoemde deletiecassette en het AMA plasmide resulteert in de inactiva- ten welke kunnen worden gebruikt om resistente bacteriële infecties te tie van het essentiële gen waarvan de functie wordt gecomplementeerd behandelen. door het gen gecodeerd op het AMA plasmide. Dit heeft tot gevolg dat het plasmide stabiel behouden blijft in P. chrysogenum (J. Kiel, personal

communication). Het penicilline gencluster gecodeerd op drie verschil- Summary remarks and concluding lende DNA fragmenten is geassembleerd in vivo door Penicillium op het AMA plasmide. In ons ontwerp is de AmdS selectie marker gebruikt in één van de fragmenten om te kunnen selecteren op de aanwezigheid van het gencluster op het AMA plasmide en deze marker is niet nodig om het AMA 5 plasmide in P. chrysogenum te kunnen behouden. Door herintroductie van 5 het penicilline gencluster op chromosomale locaties zijn de penicilline G productieniveaus vergelijkbaar met het productieniveau van de stam met één enkele kopie van het gencluster (DS47274), wat aantoont dat de in vivo herintroductie van het gencluster succesvol is. Wanneer het penicil- line gencluster geherintroduceerd wordt op het AMA plasmide, is penicil- line G productie alleen maar aantoonbaar door middel van een bioassay. Uit LC-MS analyse blijkt dat de penicilline G concentraties in het medium erg laag zijn. Deze lage productie is onverwacht, maar kan verschillende

110 Samenvatting Samenvatting 111 APPENDIX A specialthankyou tothemembers of thereading committee: Also, my dear paranimfen, MartenandReto. Nothing canreplace your A specialthanksgoes tomy dear fellow PENmatesfor allthevaluable ACKNOWLEDGMENTS who tookthetimetoassessmy thesis. writing phasesof thisthesis. rf d. ArnoldJ.M.Driessenfor theopportunitieshegave me:the dr. Prof. Firstly, Iwould like toexpress my sincere gratitude tomy mentor Prof. Next, Iwould like tothankStefan for beingavery good supervisor and friend. Thank you for taking your timetotranslate thethesissummary for helpingmeinvarious ways. friendship andsupportthrough alltheseyears. Thank you for standing feedback anddiscussions duringtheproject meetings. My heartfelt appreciation goes alsototheco-authors of thepapers in- tience andsmilewere agreat encouragement! tive conversations, suggestions, and assistance. Thank you for teaching My sincere thanksalsogo toProf. dr. Roel A.L. Bovenberg for theproduc the labapleasantworking environment. Bea,ManonandAnmara thanks support, motivation, andimmenseknowledge. Your guidance helped giving methespace todevelop my own ideasandfor your valuable green project for sharingtheir knowledge, experiences andideas. I amgrateful toallthepeopleinDSMthatwere involved intheAmoxi- I would also like to thank the members of the Molmic group for making into Dutch. cluded inthisthesisfor thevaluable insightsandcontributions. pursuit first my master thesisandthena PhD position. Thank you for me throughout thethesis,from thestartinlaboratory tothefinal me toplanefficiently andto examine problems infinedetail. Your pa- next tomeonthisimportantday of my life. dr. D.B. Janssen, Prof. dr L.Dijkhuizen, andProf. dr. Arthur Ram Acknowledgments -

A 115

Appendix And finally last,but by nomeansleast,toall my friendshere andback And totherest of my family, thankyou for always beingthere for melike Fabiola support andlove thatIneed! I mustexpress my very profound gratitude tomy parents for providing home. Many thanksfor allthefunwe hadtogether andfor providing the nobody elsecan. me withunfailing supportandcontinuous encouragement alongtheway. Appl. Environ. Microbiol. 78,7107–7113. Weber, S.S.,Polli, F., Boer, R.,Bovenberg, R.A.L.,Driessen,A.J.M., 2012. Bovenberg, R.A.L.,Driessen,A.J.M., Anengineered two component Nonri- Polli, F., Zwahlen, R.D., Crismaru, G.C., Lankhorst, P., van der Hoeven, R., R.A.L., Driessen,A.J.M., Towards asecondary metabolitedeficientstrain Polli, F., Viaggiano, A.,Salo,O., Lankhorst, P., van der Hoeven, R.,­ Biol. S1087-1845(15)30051-7. Polli, F., Meijrink, B., Bovenberg, R.A.L., Driessen, A.J.M., 2015. New pro- strains viabalanced overexpression of Isopenicillin NAcyltransferase. Increased penicillinproduction inPenicillium chrysogenumproduction linkers. MANUSCRIPT INPREPARATION bosomal peptide synthetase (NRPS) producing anovel peptide-like com- of Penicilliumof chrysogenum.MANUSCRIPT INPREPARATION pound inP. chrysogenum,usingnon-native NRPSinter-communicating moters for strain engineeringof Penicillium. Fungal chrysogenum Genet LIST OF PUBLICATIONSLIST OF List of publications List of Bovenberg, A 117

Appendix 4. REFERENCES 7. 11. 1. 10. 16. 15. 14. 13. 12. 2. 3. 9. 6. 8. 5.

Weber, S.S.,Bovenberg, R.aL.&Driessen,A.J.M. García-Rico, R.O., Chávez, R.,Fierro, F. &Martín,J.F. Borel, J.F. Historyof thediscovery of cyclosporin and Theilgaard, H., van Den Berg, M., Mulder, C., Bovenberg, Alberti, F., Foster, G.D. &Bailey, A.M.Natural prod - Veiga, T. Büttel, Z.etal.Unlocking thepotential of fungi:the Cantwell, C.,Beckmann,R.,Whiteman,P., Queener, Kiel, J.A.K.W., van der Klei,I.J.,van denBerg, M.A., Nijland, J. G. Regueira, T.B. Newman, D. J.&Cragg, G. M.Natural products as Newman, D. J.,Cragg, G.M. & Snader, K.M. The influ- Laich, F., Fierro, F., Cardoza, R.E.&Martin,J.F. Organi- Salo, O. V. van denBerg, M.aetal.Genomesequencingandanaly 493–500 (2017). 225–36 (2012). 2010. J.Nat. Prod. 75,311–35 (2012). sources of new drugsover the30years from 1981to sis of thefilamentousfungus Penicillium chrysogenum. 1236–40 (1999). 123–129 (2009). chrysogenum transformants: construction of a new of itsearly pharmacological development. Wien. Klin. chrysogenum Wis54-1255 transformants overexpress- erologous expression. Appl.Microbiol. Biotechnol. cephalosporin biosynthesis. Metab.Eng. chrysogenum. ence of natural products upondrugdiscovery (Antiq- on dose effect onpenicillin production by Penicillium gal Genet.Biol.42,154–164 (2005). antibiotics inPenicillium chrysogenum. Biotechnol. J. zation of the gene cluster for biosynthesis of penicillin a singleprotein, Pc-Pex11p, results in2-fold enhanced acid biosynthesis in Penicillium brevicompactum. ucts from filamentous fungi and production by het- uity tolate1999). Nat. Prod. Rep. 17, 72, 379–88(2001). production inPenicillium roqueforti. Int. Microbiol. nidia germination, stress response, androquefortine C Genomics 16,937(2015). penicillin production by Penicillium chrysogenum. Fun Wochenschr. 114,433–7 (2002). S. W. &Abraham, E.P. Isolation of deacetoxycepha- Biosynthetic concepts for theproduction of Effect of aheterotrimeric Gprotein QuantFung project. Fungal Biol.Biotechnol. 2,6(2015). R. &Nielsen,J.Quantitative analysis of Penicillium Penicillium chrysogenum for improved semi-synthetic Bovenberg, R.A.L.&Veenhuis, M.Overproduction of (2012). (2010). Environ. Microbiol. 77, Nat. Biotechnol. 26,1161–1168 (2008). ing thepenicillinbiosynthetic genes. Biotechnol. Bioeng. in cured drysausages. Appl.Environ. Microbiol. in Penicillium nalgiovense andantibiotic production impact of theclassicalstrain improvement program losporin Cfrom fermentation broths of Penicillium β –lactam producing Penicillium chrysogenum. et al.Metabolicengineeringof et al. Genomic mutational analysis of the et al. Nonlinear biosynthetic gene cluster et al.Molecular basisfor mycophenolic Appl. Environ. Microbiol. 3035–43(2011). 215–234 (2000). α subunitonco - β 14, 437–448 76, 7109–15 -oxidation in β -lactam BMC Appl. 101, 65, 12, 7, - -

19. 18. 20. 17. 28. 26. 25. 27. 29. 24. 30. 23. 22. 31. 21.

Robin, J.,Bonneau,S.,Schipper, D., Noorman, H.& Robin, J., Jakobsen, M., Beyer, M., Noorman, H. & Niel Maxwell, D. P., Armentrout, V. N.&Graves, L.B.Mi- Boisnard, S.,Zickler, D., Picard, M.&Berteaux-Lecel Griffin, D.Fungal physiology.(1996). Casselton, L.&Zolan, M. The artanddesign of genetic Gao, Y. &Zhao, Y. Self-processing of ribozyme-flanked Gutiérrez-Correa, M.,Ludeña, Y., Ramage, G. &Villena, Crawford, L.etal.Production of Cephalosporin In- Carson, D. B. & Cooney, J. J. Microbodies in fungi: a Bringmann, G.etal.SorbicillactoneA:astructurally Harris, D. M.etal.Engineering of Penicillium chrysoge- Foreman, C.M.et al. Whenahabitatfreezes solid:mi - Henk, D. A.etal.Speciationdespiteglobally overlap- Taylor, J.W. MakingtheDeuteromycota redundant: 231–53 (2003). sporanic acidproduction. Appl.Microbiol. Biotechnol. sen, J.Physiological characterisation of Penicillium screens: filamentousfungi.Nat. Rev. Genet. strain expressing the expandase gene from Streptomy 1235–53 (2012). 125–137 (2009). 357–362 (2001). chrysogenum strains expressing the expandase gene crobodies inPlant Pathogenic Fungi. Annu. Rev. Phyto- 343–349 (2014). oylated cephem antibiotic precursor. Metab.Eng. defects of afungal peroxisomal mutantbutintroduces coastal Antarctic lake. FEMSMicrobiol. Ecol. croorganisms over-winter withintheice column of a continuous cultivations of aPenicillium chrysogenum ces clavuligerus. Metab.Eng. 5,42–48 (2003). gen concentrations onthe gus. Mol.Ecol. 20, a sponge-derived fungus.Prog. Mol.Subcell. Biol. a practical integration of mitosporicandmeiosporic unprecedented bioactive novel-type alkaloid from pansion Activity. Bio/Technology 13,58–62(1995). review. J.Ind.Microbiol. 6,1–18 (1990). num for fermentative production of anovel carbam- pleiotropic cellular effects. Mol.Microbiol. population genetics of Alexander Fleming’s luckyfun- ping distributionsinPenicillium chrysogenum: the pathol. 15,119–134 (1977). from Streptomyces clavuligerus duringbatchcultiva- for industrial uses.Appl.Biochem.Biotechnol. G. K.Recent advances onfilamentousfungal biofilms Nielsen, J.Influence of theadipateanddissolved oxy Penicillium chrysogenum Strains Expressing RingEx PR-mediated genome editing.J.Integr. Plant Biol. RNAs into guide RNAs in vitro and in vivo for CRIS- fungal biosynthetic pathway. Proc. Biol.Sci. tions. Growth andadipoyl-7-aminodeacetoxycephalo- fungi. Can. J.Bot. (2011). (2002). termediates by Feeding Adipic Acid toRecombinant (2003). transporter similarly suppresses the differentiation (2011). (1992). lier, V. Overexpression of ahumanandfungal ABC 4288–301 (2011). β -lactam production during References 49, 248, 283–9 3, 683–697 76, 401–12 1287–96 167, 56, 37, 57, 11, - - - - -

A 119

Appendix A 120 43. 42. 41. 44. 40. 46. 45. 49. 48. 47. 39. 38. 37. 36. 35. 34. 33. 32. References 50.

Ropars, J.et al. Inductionof sexual reproduction and Böhm, J.etal.Sexual reproduction andmating-­ Dyer, P. S.&O’Gorman, C.M.Afungal sexual revolu- Woo, P. C. Y. etal.Genomic and experimental evidence Scott, J., Untereiner, W. A.,Wong, B., Straus, N.A.& Samson, R. A., Hadlok, R. & Stolk, A. C. A taxonomic Cram, D. Moldmetabolites.II. The structure of sor Cram, D. & Tishler, M.Moldmetabolites.I.Isolation of Strømnæs, Ø. &Garber, E.D. Heterocaryosis andthe Pontecorvo, G.&Kafer, E.Geneticanalysis basedon Pontecorvo, G. The Parasexual Cycle in Fungi. Overy, D. P., Nielsen,K.F. &Smedsgaard, J.Roque - Steyn, P. S. The isolation,structure andabsolute con- Wagener, R.E.,Davis, N.D. &Diener, U. L.Penitrem A Moyer, J.,Stodola, H.,Wachtel, L.&Coghill, D. Pe- Opaliński, Ł.,Kiel,J.A.K.W., Homan, T. G.,Veenhuis, Müller, W. H.etal.Involvement of microbodies inpenicil Müller, W. H.et al. Localization of thepathway of the Meyer, V. Geneticengineering of filamentousfungi-­ 2373–2390 (2005). study of the Penicillium chrysogenum series. several compounds from clinicalpenicillin.J.Am.Chem. 1105 (2004). 3409–3416 (2006). dimorphic fungusPenicillium marneffei. FEBSLett. genetic diversity inthecheesefungusPenicillium Acad. Sci.U. S.A.110, 1476–81(2013). Appl. Environ. Microbiol. 39, roqueforti. Evol. Appl.7, and Roquefortine Production by Penicillium commune. producing fungus Penicillium chrysogenum. figuration of secalonic acid D, thetoxic metabolite of Soc. (1948). Opin. Microbiol. 14,649–654(2011). num from indoor environments. mitotic recombination. Adv.Genetics 9, nitrinic acid,anew pigmentfrom Penicillium notatum. notatum. J.Am.Chem.Soc.(1948). Van Leeuwenhoek 43,169–175 (1977). membrane thatisimportant for penicillinproduction. penicillin biosynthesis in Penicillium chrysogenum. progress, obstaclesandfuture trends. Biotechnol. Adv. 26, 177–85 (2008). 653–662 (1963). Microbiol. 10, Malloch, D. Genotypic variation inPenicillium chysoge - for a potential sexual cycle in the pathogenic thermal M. & Van Der Klei, I. J. Penicillium chrysogenum type-mediated strain development inthepenicillin-­ Implications for Competitive Fitness.J.Chem.Ecol. fortine/Oxaline Biosynthesis Pathway Metabolites in tion: Aspergillus andPenicillium show theway. Curr. Penicillium ser. Corymbifera: InPlanta Production and J. Biol.Chem.159, 67–70 (1945). Parasexual Cycle inAspergillus Fumigatus. Genetics Pex14/17p Penicillium oxalicum. Tetrahedron 26,51–57 (1970). FEBS J.277, 3203–3218 (2010). EMBO J.10, bicillin, apigmentproduced by themoldPenicillium lin biosynthesis. Biochim.Biophys.Acta — anovel component of theperoxisomal 489–95 (1991). 393–400(1956). 433–441(2014). 882–7 (1980). Mycologia 1116, 210–3 (1992). 71–104 (1958). 96, 1095– Proc. Natl. Annu. Rev. Antonie 580, 48, 31, - - 69. 68. 67. 63. 66. 65. 64. 62. 61. 60. 58. 57. 59. 54. 55. 56. 53. 52. 51.

Bird, B.A.,Remaley, A. T. &Campbell,I.M.Breviana- Calvo, A. M., Hinze, L. L., Gardner, H. W. & Keller, N. P. Alspaugh, J.A.,Perfect, J.R.&Heitman, J.Cryptococcus Hicks, J.K., Yu, J.H.,Keller, N.P. &Adams, T. H.Aspergil Reiss, J. Development of Aspergillus parasiticus and Guzmán-de-Peña, D. &Ruiz-Herrera, J.Relationship be- Trail, F., Mahanti, N. &Linz,J.Molecular biology of af Kawamura,C., Tsujimoto, T.& Tsuge, T. Targeteddis- Champe, S.P., Rao, P. &Chang,A.Anendogenous in- Champe, S.P. &el-Zayat, A.Isolation of asexual Calvo, A.M.,Gardner, H.W. &Keller, N.P. Genetic Calvo, A.M.,Wilson,R.A.,Bok,J.W. &Keller, N.P. Re - Turner, W. Fungal metabolites.(Academic Press., 1971). Vesonder, R.F. Xanthocillin,AMetaboliteof Eupenicillium Fleming, A.OntheAntibacterialAction of Cultures of a Houbraken, J.,Frisvad, J.C.&Samson,R.A.Fleming’s Miller, R.F. &Huang,S.Isolation andStructure of Wei, R.,Schnoes,H.K.,Hart, P. A.&Strong, F. M. The Hikino, H., Nabetani, S. & Takemoto, T. Structure and 236–8 (1982). 25766–74 (2001). signaling pathway. EMBOJ. sporulation hormonefrom Aspergillus nidulans.J.Bac sporulation inAspergillus nidulans.J.Biol.Chem. structure of PRtoxin, a mycotoxin from Penicillium 3206–17 (1997). development andUVtolerance intheJapanese pear connection between fatty acid metabolism and ducer of sexual development inAspergillus nidulans.J. chrysogenum. Yakugaku Zasshi 93,619–23 (1973). gillus parasiticus. Fungal Genet.Biol. Antibiot. (Tokyo). 48,520–521(1995). mides AandBAre Formed Only After Conidiation Has velopment of Aspergillus spp. Appl. Environ. Microbiol. neoformans mating and virulence are regulated by the pathotype of Alternariaalternata.Mol.Plant. Microbe. ruption of amelaninbiosynthesis gene affects conidial num butP. rubens.IMAFungus 2,87–95 (2011). penicillin producing strain isnot Penicillium chrysoge- Gen. Microbiol. 133,1383–7 (1987). roqueforti. Tetrahedron 31,109–114 (1975). pathology 10, Sporogenic effect of polyunsaturated fatty acidsonde- teriol. 171,3982–8 (1989). Sorrentanone G-protein alphasubunitGPA1 andcAMP. Genes Dev. formation of aflatoxin B1under theinfluence of con- Isolation of B.influenzæ.Britishjournalof experimental Development. Egyptiacum NRRL 1022.J.Nat. Prod. Penicillium, withSpecialReference totheir Use inthe tween aflatoxin biosynthesis and sporulation in Asper (2002). Interact. 12,59–63(1999). 65, 3668–73 (1999). idiogenesis affecting compounds. inactivation of theFadA Galphaprotein-­ lus sporulationandmycotoxin production both require latoxin biosynthesis. Microbiology lationship between Secondary Metabolism andFungal biosynthesis of chrysogine, a metabolite of Penicillium 226(1929). : ANew Tetrasubstituted Quinone.J. Microbiol. Mol.Biol.Rev. 16, 4916–23 (1997). 141, 755–765 (1995). Arch. Microbiol. 21, 198–205 (1997). 42, 232–233 (1979). 66, 447–459, dependent dependent 276, 133, 11, - - - - 75. 74. 73. 72. 71. 70. 77. 76. 79. 78. 86. 85. 84. 83. 80. 82. 81.

Schardl, C. L., Panaccione, D. G. & Tudzynski, P. Ergot Nyfeler, R.&Keller-Schierlein, W. Metabolitesof Lawen, A.,Dittmann,J.,Schmidt,B.,Riesner, D. & Abraham, E. P. & Newton, G. G. The structure of Schimmel, T. G.,Coffman, A. D. & Parsons, S.J. Effect Sim, S.C.Characterization of genes inthesterigmato- Chu, M.etal.Structure of Sch528647:ANew Antitu- Gelderblom, W. C.&Snyman, S.D. Mutagenicity of Raper, K.B.,Alexander, D. F. &Coghill, R.D. Penicillin: II. Sekiguchi, J.&Gaucher, G.M.Conidiogenesis andsec Land, C.J.,Hult,K.,Fuchs, R.,Hagelberg, S.&Lund- Dorner, J.W., Cole, R.J.&Diener, U. L. The relationship Singh, S. B. Nieminen, S.M.,Mäki-Paakkanen, J.,Hirvonen, M.-R., Singh, S.B.,Felock, P. &Hazuda, D. J.Chemicaland Tsai, H.F., Chang, Y. C.,Washburn, R.G.,Wheeler, M. Kennedy, J.et al. Modulationof polyketide synthase 235–8 (2000). sarium moniliforme. ström, H. Tremorgenic mycotoxins from Aspergillus sp. Tetrahedron Lett. 40, synthesis. Science 284,1368–72 (1999). cephalesporin C.Biochem.J.79, of butyrolactone Iontheproducing fungus,Aspergillus cystin gene cluster andtheir role infitness of Aspergil 161–70 (2002). Appl. Environ. Microbiol. 42,521–5 (1981). ondary metabolisminPenicillium urticae.Appl.Environ. of Aspergillus flavus andAspergillus parasiticus with enzymatic modifications of integricacidandHIV-1 in- eremophilane sesquiterpenoidproduced by aXylaria alkaloids--biology andmolecular biology. Alkaloids. and analogues.Biochimie74, acid. Mycopathologia 87, a secondary metabolite of Aspergillus fumigatus, ina nulatus: isolation and structural components. peptide-antibiotic from Aspergillus nidulansvar. echi- microorganisms. 143.Echinocandin B,anovel poly alb1 gene of Aspergillus fumigatus: itsrole inmodula- activity by accessory proteins duringlovastatin bio- mor Antibiotic Related toFumagillin. J.Antibiot. (Tokyo). potentially carcinogenic mycotoxins produced byFu- Chim. Acta 57, Chem. Biol.63,45–86(2006). notatum andAlliedSpecies.J.Bacteriol. reference toproduction of aflatoxins andcyclopiazonic 180, 3031–8 (1998). Begun inSolidCultures of Penicillium brevicompactum. Kleinkauf, H.Enzymatic biosynthesis of cyclosporin A terreus. Microbiol. 33,147–58 (1977). fumigatus asapossibleoccupational healthproblem Natural Variation andPenicillin Production inPenicillium Roponen, M.&von Wright, A.Genotoxicity of gliotoxin, H. &Kwon-Chung, K.J. The developmentally regulated tion of conidial morphologyandvirulence. J.Bacteriol. tegrase inhibitoryactivity. Bioorg. Med.Chem.Lett. lus nidulans.(Texas A&MUniversity, 2001). in sawmills. Appl.Environ. Microbiol. istry of HIV-1 integrase inhibitor integric acid. A novel battery of short-term testsystems. Mutat. Res. 54, 1096–1099 (2001). Appl. Environ. Microbiol. et al. Structure and absolute stereochem- 2459–77 (1974). Mycotoxin Res. 7, 8775–8779(1999). 13–15 (1984). 511–6 (1992). 377–393 (1961). 64, 3707–3712 (1998). 53, 787–790 (1987). 48, 639–59(1944). 46–52(1991). Helv. 520, 10, - - -

105. 104. 103. 102. 100. 101. 98. 97. 99. 95. 96. 94. 93. 92. 91. 90. 89. 87. 88.

Avalos, J.etal. Limón, M.C.,Rodríguez-Ortiz, R.&Avalos, J.Bikaverin Ammar, M.S.,Gerber, N.&McDaniel, L.E.New an- Campbell, C. D. & Vederas, J. C. Biosynthesis of lovasta- Keller, N.P., Turner, G.&Bennett,J.W. Fungal second - Kong, K.F., Schneper, L.&Mathee,K.Beta-lactamanti- Demain, A. L. & Fang, A. The natural functions of sec Wei, X., Yang, F. &Straney, D. C.Multiplenon-ribo- Haq, I.U. &Elsas,J.D. Van. Biosynthesis and Molecu- Rammelkamp, C.H.&Maxon, T. Resistance of Staph- Finland, M.Emergence of antibiotic-resistant bacteria. Raistrick, H. A region of biosynthesis. Cole, R.,Schweikert, M.&Jarvis, B.Handbook of sec Wolf, J.C.&Mirocha, C.J.Regulation of sexual repro- Abe, N.,Arakawa, T., Yamamoto, K.&Hirota, A.Biosyn- Abe, N., Yamamoto, K.&Hirota, A.Novel fungal me- Cram, D. J.Moldmetabolites;thestructure of sor Kopp-Holtwiesche, B. &Rehm, H. J.Antimicrobial ac Boukhalfa, H.&Crumbliss, A.L.Chemicalaspectsof 725–34 (1973). 423–9 (2005). 41–4 (1981). 2090–9 (2002). solani (Mart.) Sacc. I.Fermentation, isolation,andanti- synthesis in Trichoderma virens. somal peptide synthetase genes determinepeptaibol siderophore mediatediron transport. Biometals don. Ser. B,Biol.Sci.136,481–508, 4pl(1950). 1–39 (2000). ondary metabolites.Adv. Biochem.Eng. Biotechnol. ondary fungal metabolites,3-volume set.(2003). evidence for the biosynthetic pathway, via sorbicilli- duction inGibberella zeae (Fusarium roxeum ‘gram- 325–39 (2002). Apmis 118,1–36 (2010). ylococcus aureus totheAction of Penicillin. Exp.Biol. ary metabolism-from biochemistrytogenomics. Nat. and bisorbicillinolide.Biosci.Biotechnol. Biochem. C, Zeilinger S (eds) Biosynthesis andMolecular Genetics production andapplications.AppliedMicrobiology and microbial activities.J.Antibiot. (Tokyo). nol, of sorbicillin,bisorbicillinol,bisorbibutenolide, notatum. J.Am.Chem.Soc.70, technol. Biochem.64,620–2 (2000). Metabolites 2,(Springer, 2015). Med. 51,386–389 (1942). PKS enzymes.Biopolymers 93,755–63(2010). tibiotic pigmentsrelated tofusarubinfrom Fusarium tin andrelated metabolitesformed by fungal iterative Biotechnology 87, thesis of bisorbicillinoidin Trichoderma sp. USF-2690; tabolites, demethylsorbicillin and oxosorbicillinol, tion of roquefortine. Biosynthesis and Molecular Genetics of Fungal Secondary N. Engl. J.Med.253,909–22; contd (1955). Rev. Microbiol. 3,937–47 (2005). inearum’) by F-2 (Zearalenone). isolated from Trichoderma sp. USF-2690. Biosci.Bio- lar Geneticsof Fungal Secondary Metabolites, Volume 2. biotics: From antibiosistoresistance andbacteriology. bicillin, apigmentproduced by themoldPenicillium Carotenoids. InMartínJM,García-Estrada 21–29 (2010). J. Environ. Pathol. Toxicol. Oncol. 4240–3 (1948). Can. J.Microbiol. Can. J.Microbiol. 32, 679–84(1979). Proc. R.Soc.Lon- References 66, 69, 10, 19, 51, 15, - - - -

A 121

Appendix A 122 123. 122. 121. 120. 119. 118. 117. 116. 115. 114. 113. 112. 111. 110. 109. 108. 107. 106. References Jenke-Kodama, H.,Börner, T. &Dittmann,E.Natural Fischbach, M.A.,Walsh, C. T. &Clardy, J. The evolu- Wu, K., Chung, L., Revill, W. P., Katz, L. & Reeves, C. Crawford, J.M.& Townsend, C.A.New insightsinto Fischbach, M.A.&Walsh, C. T. Assembly-line enzymol Phillips, D. R.,Rasbery, J.M.,Bartel,B.&Matsuda,S. Yoshikuni, Y., Ferrin, T. E.&Keasling, J.D. Designed Olson, M.V. Whenlessismore: gene lossasanengineof Liras, P., Rodríguez-García, A.&Martín,J.F. Evolution Ingolia, T. D. &Queener, S.W. Betalactambiosynthetic Richards, T. A., Leonard, G., Soanes, D. M. & Talbot, Fox, E.M.&Howlett, B.J.Secondary metabolism:reg Losada, L.,Ajayi, O., Frisvad, J.C., Yu, J.&Nierman, W. Goh, E.-B. etal. Transcriptional modulationof bacterial Wallwey, C.,Li,S.-M. &Keller, U. Ergot alkaloids: Hulvová, H.,Galuszka, P., Frébortová, J.&Frébort, I. Studt, L.& Tudzynski, B.in209–238 (Springer New Avalos, J. & Carmen Limón, M. Biological roles of fungal 4601–8 (2008). 2014). doi:10.1007/978-1-4939-1191-2 structure diversity, biosynthetic gene clusters and York, 2014). doi:10.1007/978-1-4939-1191-2_10 1078–82 (2006). of Fungal Secondary Metabolites.(Springer New York, chemical innovation. Proc. Natl. Acad. Sci.U. S.A. 3468–96 (2006). ogy for polyketide and nonribosomal Peptide antibiot- evolutionary change. Am.J.Hum.Genet. of theclusters of genes for beta-lactamantibiotics: a divergent evolution of enzymefunction.Nature of secondary metabolitesinAspergillus species.Med. carotenoids. Curr. Genet. 61,309–324 (2015). genes. Med.Res. Rev. 9, gene expression by subinhibitoryconcentrations of anti- ulation androle infungal biology. Curr. Opin. Microbiol. model for evolutive combinatorial assembly of new Comput. Biol.2,e132(2006). Gene 251,81–90 (2000). Curr. Opin.Plant Biol.9, 98–110 (2011). 11, 481–7 (2008). 28, 496–510(2011). Microbiol. 8,879–89(2010). Mycol. 47, 31, 79–89(2013). for biosynthesis of unusualpolyketide extender units. D. The FK520 gene cluster of Streptomyces hygroscop- P. Biosynthetic diversity inplanttriterpene cyclization. C. Effect of competition ontheproduction andactivity tion of gene collectives: How natural selectiondrives the formation of fungal aromatic polyketides. Nat. Rev. N. J.Genetransfer intothefungi.Fungal Biol.Rev. functional proof of biosynthetic genes. the actinobacteriumStreptomyces avermitilis. PLoS Parasitic fungusClaviceps asasource for biotechno- ics: logic,machinery, andmechanisms.Chem.Rev. icus var. ascomyceticus (ATCC 14891)contains genes biocombinatorics inthepolyketide synthase genes of beta-lactams. Int.Microbiol. 1,271–8 (1998). biotics. logical production of ergot alkaloids. Biotechnol. Adv. Proc. Natl. Acad. Sci.U. S.A. S88–S96 (2009). 305–14 (2006). 245–264 (1989). 99, 17025–30 (2002). 64, 18–23 (1999). Nat. Prod. Rep. 440, 106, 105, 25, - - 139. 128. 127. 126. 125. 138. 137. 136. 124. 135. 134. 133. 132. 131. 130. 129. The first geneinthebiosynthesis of thepolyketide an- Khaldi, N.etal.SMURF: Genomicmappingof fungal Lin, H.-C. etal. The fumagillinbiosynthetic gene cluster Ali, H.etal.Abranched biosynthetic pathway isinvolved Lo, H.-C. etal. Two separate gene clusters encode the Trail, F. Molnár, I.etal. The biosynthetic gene cluster for the Höfle, G.etal.Epothilone AandB—Novel 16-Mem- Wenzel, S.C.etal.Structure andbiosynthesis of myxo- Medema, M.H.etal.antiSMASH:rapid identification, Paitan, Y., Alon,G.,Orr, E.,Ron, E.Z.&Rosenberg, E. Gehring, A.M.,Mori,I.,Perry, R.D. &Walsh, C. T. The Aparicio, J.F. etal.Organization of thebiosynthetic Cane, D. E.Introduction: Polyketide andNonribosomal Walsh,C. T. Strieker, M., Tanović, A.&Marahiel, M.A.Nonribo- Winter, J.M.etal.Identification andcharacterization 736–41 (2010). 2673 (1995). secondary metabolite clusters. sequences. synthesis gene clusters inbacterialandfungal genome somal peptides duringandafter chainelongation on NRPS somal peptide synthetases: structures anddynamics. chemistry 37, cyclase involved intheformation of chromides S1-3 inStigmatella aurantiaca: evidence for gew. ChemieInt.Ed. English 35,1567–1569 (1996). of thechaetoviridin and chaetomugilin gene cluster in gene cluster for rapamycin inStreptomyces hygroscop- and dehydroaustinol inAspergillus nidulans.J.Am. aflatoxin pathway. aflatoxin gene cluster inAspergillus parasiticus and an iterative bacterialtypeIpolyketide synthase andfor annotation andanalysis of secondary metabolitebio- assembly lines.Curr. Opin.Chem.Biol. ative highly-reducing polyketide synthase. J.Am.Chem. microtubule-stabilizing agents epothilones Aand Soc. 134,17900–3 (2012). module skippinginnonribosomalpeptide biosynthesis. nonribosomal peptide synthetase HMWP2 forms a Chem. Soc.134,4709–20 (2012). Chembiochem 6,375–85(2005). polyketide synthase. Gene169, 9–16 (1996). Curr. Opin.Struct. Biol.20, 97–109 (2000). functional disruption of agene involved early inthe B from Sorangium cellulosum Soce90. Chem.Biol. Crystal Structure, andConformation inSolution.An- PKS modulecoupled toapeptide synthetase. J.Mol. Chaetomium globosum reveal dual functions of an iter tibiotic TA of Myxococcus xanthuscodes for aunique thiazoline ring duringbiogenesis of yersiniabactin, an Polypeptide Biosynthesis. From Collie toColi. Chem. Biol. 286,465–74 (1999). tene. J.Am.Chem.Soc.135,4616–9 (2013). Rev. in Aspergillus fumigatus encodes acryptic terpene in Penicillium chrysogenum. PLoS One in production of roquefortine andrelated compounds iron-chelating virulence factor of Yersinia pestis.Bio- icus: analysis of theenzymaticdomainsinmodular biosynthetic pathway for themeroterpenoids austinol bered Macrolides withCytotoxic Activity: Isolation, 97, 2463–2464 (1997). et al. Physical and transcriptional map of an et al. Tailoring enzymesthatmodifynonribo- Nucleic Acids Res. 11637–11650 (1998). Appl. Environ. Microbiol. 234–40(2010). 39, Fungal Genet. Biol. W339–W346 (2011). 5, 525–534(2001). β 8, e65328(2013). -trans-bergamo- 61, 2665– 47, 7, -

144. 143. 146. 145. 142. 158. 141. 140. 157. 155. 153. 156. 154. 152. 149. 151. 150. 148. 147. Chiang, Y.-M. Ries, M.I.etal.Novel key metabolitesreveal further Chakrabortti, A.,Li,J.&Liang,Z.-X. Complete Genome Jiang, D. et al. Molecular toolsfor functionalgenomics Brakhage, A.&Schroeckh, V. Fungal secondary me- Olmedo-Monfil, V., Cortés-Penagos, C.& Herrera-Es - Medema, M.H.etal.MinimumInformation aboutaBio- Weber, T. Klein, T. M.,Wolf, E.D., Wu, R.&Sanford, J.C.High-­ Chakraborty, B.N.,Patterson, N.A.&Kapoor, M.An Kamoun, S.Molecular genetics of pathogenic oomy Barcellos, F. G.etal.Geneticanalysis of Aspergillus nid- Liu, Z.&Friesen, T. L.Polyethylene glycol (PEG)-medi- Sánchez, O., Navarro, R. E. & Aguirre, J. Increased Ballance, D. J.,Buxton,F. P. & Turner, G. Transformation Yelton, M.M.,Hamer, J.E.& Timberlake, W. E. Trans- Tilburn, J.etal. Transformation by integration inAsper Dhawale, S.S.,Paietta, J.V&Marzluf, G.A.Anew, Galagan, J.E.etal. The genome sequence of the 297–313 (2004). synthetic Genecluster. Nat. Chem.Biol. of Ochratoxin A. erdijkiae Reveals thePutative Biosynthetic GeneCluster emericellamide biosynthetic pathway. Chem.Biol. concepts andapplications.MethodsMol.Biol. clusters. NucleicAcids Res. 43,W237-43 (2015). enzyme-mediated integration (REMI). electroporation-based system for high-efficiency cetes. Eukaryot. Cell 2,191–9 (2003). gies. Biotechnology Advances 31,1562–1574 (2013). of Aspergillus nidulansby theorotidine-5’-phosphate decarboxylase gene of Neurospora crassa. Biochem. gillus nidulans.Gene26,205–21 (1983). Aspergillus secondary metabolome: discovery of the ated transformation infilamentousfungal pathogens. ulans unstable transformants obtained by the biolistic pathway. J.Biol.Chem.288,37289–95 (2013). velocity microprojectiles for delivering nucleic acids resource for thegenome miningof biosynthetic gene process. Can. J.Microbiol. 44,1137–41 (1998). filamentous fungus Neurospora crassa. Nature mental genes in Aspergillus nidulans by restriction mid. Proc. Natl. Acad. Sci.U. S.A.81,1470–4(1984). rospora. Curr. Genet.8,77–9 (1984). rapid andefficient transformation procedure for Neu- Sequence of theFilamentousFungus Aspergillus west- 258, 89–94 (1998). 527–32 (2008). Methods Mol.Biol.835,365–75 (2012). fungi. Can. J.Microbiol. 37, tabolites -strategies toactivate silentgene clusters. trella, A. Three decades of fungal transformation: key formation of Aspergillus nidulansby usingatrpCplas- transformation of germinated conidia of filamentous Fungal Genet.Biol.48,15–22 (2011). 859–868 (2003). transformation frequency andtagging of develop- in filamentousfungi: Recent advances andnew strate- Biophys. Res. Commun. 112,284–9 (1983). into livingcells. Nature 327, 70–73 (1987). branching of the roquefortine/meleagrin biosynthetic et al.antiSMASH3.0 –acomprehensive et al.Molecular genetic miningof the Genome Announc. 858–63(1991).

4, e00982-16 (2016). 11, 625–631(2015). Mol. Gen.Genet. 422, 267, 15, - - 175. 174. 173. 172. 171. 169. 167. 170. 168. 166. 165. 164. 163. 159. 162. 161. 160. Chaveroche, M. K., Ghigo, J.M.&d’Enfert, C.A Pohl, C., Kiel, J.A.K.W., Driessen,A.J.M.,Bovenberg, Liu, R.,Chen,L.,Jiang, Y., Zhou,Z.&Zou, G.Efficient ge- Kopke, K.,Hoff, B.& Kück, U. Application of theSac Hartmann, T. Punt, P. J.,Oliver, R.P., Dingemanse, M.A.,Pouwels, Austin, B.,Hall, R.M.& Tyler, B.M.Optimized vectors Abremski, K. & Hoess, R. Bacteriophage P1 site-specific Krügel, H.,Fiedler, G.,Smith,C.&Baumberg, S.Se- Pontecorvo, G.&Sermonti,Parasexual Recombina- Kelly, J.M.&Hynes, Transformation of Aspergillus Kelly, J. M. & Hynes, M. J. Multiple copies of the amdS Whitehead, M.P. etal. Transformation of anitrate reduc Kawai, S., Hashimoto, W. & Murata, K. Transformation D’Enfert, C. Selectionof multiple disruption events in Daboussi, M.J.etal. Transformation of seven speciesof Herzog, R.W., Daniell, H.,Singh,N.K.&Lemke, P. A. 754–764 (2016). system. Appl.Environ. Microbiol. 76,6313–7 (2010). crobiol. Biotechnol. 45,333–337 (1996). combinase protein. J.Biol.Chem. of Aspergillus basedonthehygromycin Bresistance charomyces cerevisiae FLP/FRT recombination system quence andtranscriptional analysis of thenourseo - 4, 475–9 (1985). of conidia and a more conventional procedure using 395–403 (2010). of Saccharomyces cerevisiae andother fungi:methods Appl. Environ. Microbiol. 76,4664–74 (2010). gene of Aspergillus nidulanscausetitration of trans- and Aspergillus nidulans to bleomycin and phleomycin and selectionfor transformation of Neurospora crassa acting regulatory proteins. Curr. Genet. ylase gene, pyrG, asauniquetransformation marker. using theCRISPR/Cas9system. Cell Discov. and possibleunderlying mechanism.Bioeng.Bugs Aspergillus fumigatus using theorotidine-5’-decarbox Aspergillus nidulans.Curr. Genet.15,453–456(1989). A comparative studyonthetransformation of As- rapid methodfor efficient gene replacement inthe nome editinginfilamentousfungus Trichoderma reesei ploying thebeta-rec/six site-specific recombination recombination. Purification andproperties of the Cre re- marker from Escherichiacoli. Gene resistance. Gene93,157–162 (1990). niger by theamdSgene of Aspergillus nidulans.EMBO J. filamentous fungiusingthenitrate reductase gene of niaD genes. protoplasts treated withpolyethyleneglycol. Appl. Mi- pergillus nidulansby microprojectile bombardment Curr. Genet.30, 94–104 (1954). Streptomyces noursei. Gene127, 127–131 (1993). Editing of Penicillium chrysogenum. ACS Synth. Biol. R. A.L.&Nygård, Y. CRISPR/Cas9BasedGenome P. H.&van denHondel, C.A.M.J. Transformation tion of knockout strains devoid of heterologous genes. thricin acetyltransferase-encoding gene nat1from tion inPenicillium chrysogenum. J.Gen.Microbiol. the corresponding Aspergillus niger andA.nidulans tase deficientmutant of Penicillium chrysogenum with in filamentous fungi for marker recycling and construc in thehumanpathogen Aspergillus fumigatus by em- Mol. Gen.Genet.MGG et al.Validation of aself-excising marker 76–82(1996). 259, 1509–1514 (1984). 216, 408–411 (1989). 56, 117–124 (1987). 12, 21–31 (1987). References 1, 15007(2015). 11, 5, 1, - - - - ­ A 123

Appendix A 124 191. 188. 187. 190. 189. 186. 185. 184. 183. 182. 181. 180. 179. 178. 176. 177. References Mishra, N.C.& Tatum, E.L.Non-Mendelian inheritance Jeenes, D. J.,Mackenzie, D. a,Roberts, I.N.&Archer, Wernars, K.et GeneamplificationinAspergillusal. nid- Ruiz-Díez, B.Strategies for thetransformation of fila- Punt, P. J.,Zegers, N.D., Busscher, M., Pouwels, P. H. Bryant, J.A.,Sellars, L.E.,Busby, S.J.W. &Lee, D. J. Takahashi, T., Masuda, T. & Koyama, Y. Enhanced gene Snoek, I.S.et al. Construction of anhdfA Penicillium Ninomiya, Y., Suzuki, K., Ishii, C. & Inoue, H. Highly Nayak, T. Krappmann, S.,Sasse,C.&Braus, G.H.Genetar Carvalho, N.D. S.P., Arentshorst, M.,JinKwon, M., Arentshorst, M.,Ram,A.F. J.&Meyer, V. Using non-ho- Critchlow, S.E.&Jackson, S.P. DNAend-joining:from Michielse, C.B.,Arentshorst, M.,Ram,A.F. J.&Van de Groot, M.J.,Bundock,P., Hooykaas, P. J.&Beijer system for Aspergillus nidulans.Genetics ses. 11392 (2014). & van denHondel, C.A.Intracellular andextracellular sbergen, A.G.Agrobacterium tumefaciens-mediated of DNA-induced inositolindependence inNeurospora. 1566 (2006). of expression signals of the highly expressed Aspergil end-joining andanalysis of itspotential for functional chrysogenum strain impaired in non-homologous efficient gene replacements in Neurospora strains de- end-joining-deficient genetic background. efficiency inAspergillus awamori. Fungal Genet.Biol. amdS gene. Curr. Genet.9, geting inAspergillus fumigatus by homologous 42, 9–19 (2005). gene analyses infilamentousfungi.MethodsMol.Biol. analysis studies.Fungal Genet.Biol. ulans by transformation withvectors containing the yeast toman.Trends Biochem.Sci.23,394–398 (1998). ficient for nonhomologous end-joining.Proc. Natl. Acad. mentous fungi.J.Appl.Microbiol. 92,189–95 (2002). Sci. U. S.A.101,12248–12253 (2004). production of proteins inAspergillus under thecontrol Genet. Genomics275,460–470(2006). filamentous fungi:establishment of complementation filamentous fungusAspergillus nidulans.NucleicAcids Cell recombination isfacilitated inanonhomologous vectors andrecipient strains for advanced gene analy mologous end-joining-deficient strains for functional 16, 839–842(1998). fungi. Biotechnol. Genet.Eng. Rev. 9, Chromosome positioneffects on gene expression D. B. Heterologous protein production by filamentous tants of Aspergillus sojaeandAspergillus oryzae.Mol. targeting frequency inku70andku80disruption mu- Meyer, V. &Ram,A.F. J.Expandingtheku70toolbox for Proc. Natl. Acad. Sci.U. S.A.70, Den Hondel, C.A.M.J.Agrobacterium-mediated in Escherichiacoli K-12. NucleicAcids Res. transformation of filamentousfungi.Nat. Biotechnol. transformation leadstoimproved gene replacement Res. 28,E97(2000). lus nidulansgpdAgene. J.Biotechnol. 17, 835, 133–150 (2012). 5, 212–215 (2006). Appl. Microbiol. Biotechnol. et al.Aversatile andefficient gene-targeting 361–368 (1985). 87, 3875–9 (1973). 1463–1473 (2010). 46, 418–426(2009). 327–367 (1991). 19–33 (1991). 42, 11383– 172, 1557– Eukaryot. - - - - 199. 198. 197. 196. 195. 200. 194. 193. 192. 211. 210. 209. 208. 207. 206. 205. 204. 203. 202. 201. Bloemendal, S.etal. Tools for advanced andtargeted Sternberg, N.&Hamilton, D. Bacteriophage P1 Mack, A., Sauer, B., Abremski, K. & Hoess, R.Stoichi - Hoess, R.,Wierzbicki,A.&Abremski, K.Isolation and Argos, P. et al. The integrase family of site-specific re- Hamer, L.et Genediscoveryal. andgene function Daboussi, M.-J. &Capy, P. Transposable elementsin Weld, R.J.,Plummer, K.M.,Carpenter, M.&Ridgway, Lu, S.etal. Tagged mutationsatthe Tox1 locusof Co- Lombardo, A.etal.Geneeditinginhumanstemcells Pabo, C.,Peisach, E.&Grant, R.DesignandSelection of Carroll, D. Genomeengineeringwithzinc-finger nucle- Baker, M.Gene-editing nucleases.Nat. Methods de Souza,N.Primer: genome editingwithengineered Smith, J.etal.Acombinatorial approach tocreate Tan, W. S.,Carlson,D. F., Walton, M.W., Fahrenkrug, Matsu-ura, T., Baek,M.,Kwon, J.&Hong, C.Efficient Kilby, N.J.,Snaith,M.R.&Murray, J.A.H.Site-specific Sauer, B.&Henderson, N. Targeted insertionof ex Fukushige, S. &Sauer, B. Genomic targeting with a 23–26 (2012). site-specific recombination. I. Recombination between 12649–53 (1994). ometry of the cre recombinase bound to the lox recom - combination. characterization of intermediatesinsite-specific re- combinases: regional similaritiesandglobaldiversity. chliobolus heterostrophus by restriction enzyme-me- diated integration. Proc. Natl. Acad. Sci. U. S. A. genetic manipulationof the quences. NucleicAcids Res. 34,e149(2006). ogenous DNAintotheeukaryotic genome by theCre ducer Acremonium chrysogenum. J.Biotechnol. assignment infilamentousfungi.Proc. Natl. Acad. Sci. gene editinginNeurospora crassa withCRISPRtech- ases. Genetics188,773–782 (2011). artificial homingendonucleasescleaving chosense- filamentous fungi.Annu. Rev. Microbiol. using zincfinger nucleasesandintegrase-defective 70, nucleases. Nat. Methods9, nology. Fungal Biol.Biotechnol. 2,4(2015). recombinases: toolsfor genome engineering.Trends Genet. 9, reproducible gene expression inmammaliancells. Proc. positive-selection lox integration vector allows highly recombinase. New Biol. 2,441–9 (1990). U. S. A. 98,5110–5115(2001). S. C.&Hackett, P. B.Precision Editing of Large Animal (1987). fungi. Cell Res. 16,31–44 (2006). (2003). H. J.Approaches tofunctionalgenomics infilamentous Novel Cyc2His2 ZincFinger Proteins. AnnuRev Biochem Genomes. Adv. Genet.80, EMBO J.5,433–40(1986). 51–62 (2014). Natl. Acad. Sci.U. S.A.89, loxP sites.J.Mol.Biol.150, 467–486 (1981). bining site.NucleicAcids Res. 20, 313–340 (2001). 413–421(1993). Proc. Natl. Acad. Sci.U. S.A. 37–97 (2012). 7905–9 (1992). 27–27 (2011). β -lactam antibiotic pro- 4451–4455 (1992). 57, 84, 6840–4 275–299 169, 91, 9, -

224. 223. 222. 230. 226. 225. 229. 228. 227. 221. 220. 219. 218. 215. 214. 217. 216. 213. 212. ­Tarleton, R.L.CRISPR-Cas9-mediated single-gene and Gibson, D. G.etal.Enzymatic assembly of DNAmole - Gibson, D. G.etal.One-stepassembly inyeast of 25 Hihlal, E.,Braumann, I.,van denBerg, M.&Kempken, Paz, Z.etal.OneStep Construction of Agrobacterium-­ Takken, F. L.W. etal.Aone-stepmethodtoconvert Clarke, L.&Carbon,J.Isolation of ayeast centromere Jiang, X.et al. Invitro assembly of multipleDNA Klock, H.E.,Koesema, E.J.,Knuth, M.W. & Lesley, S. Szewczyk, E.et al. Fusion PCRandgene targeting in You, C.,Zhang,X.-Z. &Zhang, Y.-H. P. Simplecloning Ellis, T., Adie, T. &Baldwin,G.S.DNAassembly for Anderson, J.C.etal. BglBricks:Aflexible standard for Katayama, T. Nødvig, C. S., Nielsen, J. B., Kogle, M. E. & Mortensen, Mali, P. etal.RNA-guidedhumangenome engineering Zhang, C.etal.Efficient editing of malariaparasite genome Peng, D., Kurup, S.P., Yao, P. Y., Minning, T. A.& Cong, L.etal.Multiplex genome engineeringusing Dupuy, A. 2332–6 (2011). somes. Nature 287, 504–509(1980). synthetic biology:from partstopathways andbeyond. cules up to several hundred kilobases. overlapping DNAfragments toform acomplete syn- e30267 (2012). 343–5 (2009). croscreening toaccelerate structural genomics efforts. e02097-14 (2015). genesis inAspergillus niger. Appl.Environ. Microbiol. 306 (2007). gene family disruption in Trypanosoma cruzi. MBio and construction of functionalsmallcircular chromo- A. Combining thepolymerase incomplete primer ex Aspergillus nidulans.Nat. Protoc. 1,3111–20 (2006). Sci. U. S.A.105,20404–9 (2008). vectors intobinaryvectors suitedfor Agrobacterium- via direct transformation of PCRproduct (DNA Mul using theCRISPR/Cas9system. MBio mediated transformation. Curr. Genet. via Cas9. Science 339, 823–6(2013). pigmentosum cells usingmeganuclease and TALEN™. fragments using successive hybridization. F. Suitability of Vader for transposon-mediated muta- Recombination-ready-plasmids (OSCAR), an efficient thetic Mycoplasma genitalium genome. Proc. Natl. Acad. tension methodfor cloningandmutagenesis withmi- timer) toEscherichiacoli andBacillussubtilis. Appl. CRISPR/Cas systems. Science 339, 819–23 (2013). Filamentous Fungi. PLoS One10, trial filamentousfungusAspergillus oryzae.Biotechnol. technique usingtheCRISPR/Cas9system intheindus- Environ. Microbiol. 78,1593–5(2012). Proteins Struct. Funct. Genet.71, 982–994 (2008). Integr. Biol.(Camb). 3,109–18 (2011). Lett. 38,637–42 (2016). PLoS One8,e78678(2013). U. H.ACRISPR-Cas9 System for GeneticEngineering of biological partassembly. J.Biol.Eng. 4,1(2010). lentiviral vector delivery. Nat. Biotechnol. et al. Targeted gene therapy of xeroderma et al.Development of agenome editing e0133085(2015). 5, e01414-14 (2014). 45, 242–8 (2004). Nat. Methods PLoS One 25, 1298– 77, 6, 6, 7, - -

­ doi:10.1016/j.fgb.2015.12.003 237. 234. 236. 235. 233. 232. 231. 247. 246. 244. 243. 245. 241. 242. 240. 239. 238. Stemmer, W. P. C.,Crameri, A.,Raillard, S.-A. &Bermu- Engler, C.,Kandzia,R.&Marillonnet,S.Aonepot, one Patten, P. A.,Howard, R.J.&Stemmer, W. P. Applica- Cane, D. E.,Walsh, C. T. &Khosla,C.Harnessing the Merryman, C.&Gibson,D. G.Methodsand applica- Gibson, D. G.etal.Creation of aBacterialCell Con- Bundock, P. & Hooykaas, P. J. J. Integration of Agro- Gritz, L.&Davies, J.Plasmid-encoded hygromycin B Gossen, M.etal. Transcriptional activation by tetracy Meyer, V. etal.Fungal gene expression ondemand: Gwynne, D. I.,Buxton,F. P., Williams,S.a.,Garven, S. Vogt, K., Bhabhra, R., Rhodes, J. C. & Askew, D. S. Doxy Gwynne, D. I.et al. Current useandcontinued devel Polli, F., Meijrink,B.,Bovenberg, R.A.L.&Driessen,J. Archer, D., Roberts, I.&MacKenzie, D. Heterologous Cullen, D. etal.Controlled expression andsecretion of Saunders, G.,Picknett, T. M., Tuite, M.F. &Ward, M. Trends Biotechnol. 7, 713–719 (1987). 288–291 (1998). species accelerates directed evolution. step, precision cloningmethodwithhighthroughput 15272–15275 (1996). & Wayne Davies, R. Genetically Engineered Secretion capability. PLoS One3,e3647(2008). dez, E.DNAshuffling of a family of genes from diverse 329, 52–56 (2010). cerevisiae Genome by illegitimate recombination. clines inmammaliancells. Science 268,1766–9 (1995). expression system for Aspergillus niger. Appl.Environ. canase from Aspergillus Nidulans. of Active HumanInterferon andaBacterialEndoglu- chrysogenum. Fungal Genet.Biol.(2015). cycline-regulated gene expression intheopportunistic opment of anexpression system derived from theeth- and robust toolfor ATMT basedgene deletionconstruc and Saccharomyces cerevisiae. Gene an inducible,tunable,andmetabolism-independent anol utilizationregulon of Aspergillus nidulans.Found. nol. 34,(1990). Source Proc. Natl. Acad. Sci.United States Am.Genet. Curr. Opin.Biotechnol. 8,724–733 (1997). mutations. Science 282, (1998). resistance: thesequence of hygromycin Bphospho- phate-buffered batchculture. Appl. Microbiol. Biotech- protein secretion from Aspergillus niger inphos- 14, 196–204 (2012). Microbiol. 77, M. New promoters for strain engineeringof Penicillium fungal pathogen Aspergillus fumigatus. BMCMicrobiol. tions of DNAshufflingtopharmaceuticals and vaccines. tions for assemblinglarge DNAconstructs. Metab. Eng. trolled by aChemically Synthesized Genome.Science tion infungi.Fungal Genet.Biol. transferase gene anditsexpression inEscherichiacoli Heterologous gene expression infilamentousfungi. Biotech. Ind.Ferment. Res. (1989). biosynthetic code: combinations, permutations,and bacterium tumefaciens T-DNA intheSaccharomyces bovine chymosin in Aspergillus nidulan. 5, 1(2005). 2975–83(2011). 283–287 (1989). 48, 677–684 (2011). 25, 179–88(1983). Bio/Technology References 5, 1–8 (1987). Nature 391, 93, 5, - - - -

A 125

Appendix A 126 265. 264. 263. 262. 261. 260. 259. 258. 257. 256. 255. 254. 253. 252. 251. 250. 249. 248. References García-Estrada, C.etal.Asinglecluster of coregulated Harris, D. M.etal.Exploringanddissectingge- Harju, S., Fedosyuk, H.& Peterson, K. R. Rapidisolation Kovalchuk, A.,Weber, S.S.,Nijland,J.G.,Bovenberg, R. Keller, N.P. &Hohn, T. M.Metabolicpathway gene Doelle, H.W., Rokem, S.&Berovic, M.(Marin). Bio- Vinetsky, Y.P. Powell, W. A. & Kistler, H. C. Invivo rearrangement of Kistler, H.C.&Benny, U. Autonomously replicating Wu, C. Smith, K.M.,Galazka, J.M.,Phatale, P. A.,Connolly, Schechtman, M. G. Characterization of telomere DNA Durrens, P., Green, P. M.,Arst, H.N. &Scazzocchio, C. Fierro, F., Laich,F., García-Rico, R.O. &Martín,J.F. High Aleksenko, A.&Clutterbuck,J.AutonomousPlasmid Stinchcomb, D., Struhl, K.&Davis, R. Yeast Chromo- Gems, D., Johnstone, I.L.&Clutterbuck,A.J.Anau- Allgaier, S.,Weiland, N.,Hamad, I.&Kempken, F. Ex self-replicating plasmids.J.Bacteriol. somal Replicator. Nature (1979). 1–16 (2012). 17–29 (1997). chrysogenum tophenylacetic acidconsumption and of yeast genomic DNA:Bustn’ Grab. BMCBiotechnol. clusters infilamentousfungi.Fungal Genet.Biol. canescens. Biochem.Biokhimii ͡a 74, genes encodes thebiosynthesis of the mycotoxins eration of new deletionsassociatedwithtransforma - efficiency transformation of Penicillium nalgiovense gene-activator xlnR of Aspergillus niger inPenicillium A. L.&Driessen,J.M.Fungal ABCtransporter dele- num. Chem.Biol.18,1499–1512 (2011) roquefortine CandmeleagrininPenicillium chrysoge- penicillinG production. BMCGenomics10, nome-wide gene expression responses of Penicillium plasmids andchromosome rearrangement during with integrative andautonomously replicating plas- filamentous fungus Neurospora crassa. Chromosome Research 20, mids. Int.J.Food Microbiol. 90, nidulans athighfrequency. Gene98,61–67 (1991). pression of ribonucleaseAandN1inthe technology- Vol III-Geneticengineering of fungalcells. 181, 1129–45(2009). 8 (2004). foreign DNA by fusarium oxysporum produces linear tion andlocalizationanalysis. MethodsMol.Biol. ( 81–89 (1992). (1990). the UNESCO, 2009). 544–549 (1986). from Neurospora crassa. Gene88,159–165 (1990). transformation of Nectria haematococca. Gene L. R. & Freitag, M. Centromeres of filamentous fungi. the filamentousfungus Neurospora crassa. Genetics Heterologous insertionof transforming DNAandgen- Elements. Fungal Genet.Biol.21,373–387 (1997). Replication in Aspergillus nidulans:AMA1 and MATE tion in Aspergillus nidulans. tonomously replicating plasmidtransforms Aspergillus Biotechnol. 85,1041–1049 (2010). ­EOLSS Publishers, developed under theauspices of et al. Characterization of chromosome ends in et al.Regulatory activity of heterologous 635–656(2012). MGG Mol.Gen.Genet. 237–248 (2004). 882–7 (2009). 172, 3163–3171 Appl. Microbiol. 75(2009). 203, 835, 117, 21, 4, - 282. 281. 280. 279. 278. 276. 277. 275. 274. 271. 273. 272. 270. 269. 268. 267. 266. Kensy, F., Engelbrecht, C. & Büchs, J. Scale-up from Samorski, M.,Müller-Newen, G.&Büchs,J.Quasi-con- Funke, M.etal.Microfluidic biolector-microfluidic- bio Hevekerl, A., Kuenz, A. & Vorlop, K.-D. Filamentous Kolar, M.,Punt, P. J.,van denHondel, C.A.M.J.& Marx, F. etal.Cloning,structural organization andreg Weber, S. S., Polli, F., Boer, R., Bovenberg, R. a L. & Graessle, S.et al. Regulated system for heterologous Hoskins, I.C.&Roberts, C.F. Expression of the Hondel, C. Van den & Punt, P. Heterologous gene ex Haas, H.,Redl, B.,Friedlin, E.&Stöffler, G. Isolation Feng, B., Friedlin, E. & Marzluf, G. A. A reporter gene Walton, J. D. HC-toxin. Ferreira Koolen, H.etal.Anantimicrobial diketo- Hendrickson, L.etal.Lovastatin biosynthesis inAs- Clark, B.,Capon,R.J.,Lacey, E., Tennant, S. &Gill,J.H. Ali, H.etal.ANon-Canonical NRPSIs Involved inthe surements: anovel measurement techniquefor shaken sion of anEscherichiacoli lacZfusiongene. Gene synthase gene. Chem.Biol.6,429–439(1999). online monitoringtechniquesof growth and protein 127–134 (1988). chrysogenum. 3-phosphoglycerate kinasegene (pgkA) of Penicilllum 396–428 enzyme activitiesandamultifunctionalpolyketide gene expression inPenicillium chrysogenum. Appl. Appl. Environ. Microbiol. 78,7107–7113 (2012). gene encoding asecreted phosphate-repressible acid gen andglucose catabolite repression. Appl. Environ. anced overexpression of isopenicillinnacyltransferase. and analysis of thePenicillium chrysogenum phoA analysis of penicillinbiosynthesis gene expression in microtiter platetolaboratory fermenter: evaluation by ulation of expression of thePenicillium chrysogenum microtiter plates.Biotechnol. Bioeng. with antifungal activity. Gene167, 167–171 (1995). process control inmicrotiter plates.Biotechnol. Bioeng. num usingdominantselectionmarkers andexpres- paf gene encoding an abundantly secreted protein penicillium chrysogenum production strains viabal phosphatase. Gene113,129–133 (1992). pression infilamentousfungi.More geneManip.fungi phytic strain of Gliocladiumisolatedfrom Strychnos cf. piperazine alkaloid andco-metabolites from anendo- pergillus terreus: Characterization of blocked mutants, 107, 497–505 (2010). One 9, Schwab, H. Transformation of Penicillium chrysoge- Microbiol. Biotechnol. 98,6983–9 (2014). fungi inmicrotiter plates-aneasy way tooptimize Microbiol. 60, Synthesis of Fungisporin andRelated Hydrophobic tinuous combined scattered lightandfluorescence mea - Driessen, A.J.M.Increased penicillinproduction in Penicillium chrysogenum anditsregulation by nitro- (2006). Cyclic Tetrapeptides inPenicillium chrysogenum. PLoS nio. Microbiol. 63,753–6(1997). ­Environ. toxifera. B3-Nat. Prod. Res. 26,2013–2019 (2012). Roquefortine E,adiketopiperazine from anAustralian iso- itaconic acidproduction withAspergillus terreus. Appl. late of Gymnoascus reessii. J.Nat. Prod. e98212(2014). 4432–4439 (1994). MGG Mol.Gen.Genet. Phytochemistry 243, 270–276 (1994). 68, 1661–4 (2005). 92, 61–8 (2005). 67, 1406–1413 62, - - - 296. 295. 298. 297. 294. 293. 292. 291. 290. 289. 288. 287. 286. 285. 284. 283. Ganzlin, M.&Rinas,U. In-depth analysis of theAspergil Nielsen, M. L., DeJongh, W. A., Meijer, S.L.,Nielsen, Menne, S.,Walz, M. &Kück, U. Expression studieswith Smith, T.L. de Boer, P. etal.Highly efficient genetargeting in- Pen Oldenburg, K. R., Vo, K. T., Michaelis, S. & Paddon, C. Re- Gietz, R.D. &Schiestl,R.H.High-efficiency yeast Sikorski, R.S.&Hieter, P. Asystem of shuttlevectors Raymond, C.K.,Pownder, T. A.&Sexson, S.L.General Batta, G.etal.Functional aspectsof thesolutionstruc Herrero, S., Takeshita, N.&Fischer, R. The Aspergillus Engler, C.,Gruetzner, R.,Kandzia,R.&Marillonnet,S. Bussey, H.,Sherman,D. &Somers, J.M.Action of yeast Nijkamp, J.F. etal.Denovo sequencing,assembly Papagianni, M. Fungal morphology and metabolite pro- Gorochowski, T. E., van den Berg, E., Kerkman, R., 2875–2890 (2009). 19–27 (1989). erative gene targeting of aprototrophic fungus.Appl. cultivation techniques.J.Biotechnol. coding gene of Aspergillus niger functionsinUstilago combination-mediated PCR-directed plasmidconstruc ∆lig4 or ∆ku70mutants.Fungal Genet. Biol. e5553 (2009). 36 (2012). Appl. Microbiol. Biotechnol. 42, 57–66 (1994). expression inEscherichiacoli andHansenula polymor duction insubmerged mycelial processes. Biotechnol. Acremonium chrysogenum using reporter gene fusions. and yeast hoststrains designedfor efficientmanipula- Adv. ACS Synth. Biol.3,129–139 (2014). and analysis of thegenome of thelaboratory strain maydis. Gene88,259–262 (1990). method. Nat. Protoc. 2,31–4 (2007). recombination. Biotechniques 26,134–141 (1999). method for plasmidconstruction usinghomologous chrysogenum. FEBS J. protein from Penicillium protein CENP-H atthekinetochore. Mol.Microbiol. nidulans CENP-E kinesinmotor KipA interacts with plasts. J.Bacteriol.113,1193–7 (1973). modern industrial biotechnology. pha fermentations. Microb. Cell Fact. 8,68(2009). 981–94 (2011). 846 (2010). Saccharomyces cerevisiae CEN.PK113-7D, a modelfor the bidirectional pcbAB-pcbC promoter region from tion invivo inyeast. NucleicAcids Res. tion of DNAinSaccharomyces cerevisiae. Genetics transformation usingtheLiAc/SS carrier DNA/PEG Golden gate shuffling:aone-pot DNAshufflingmethod ture anddynamicsof PAF -a highly-stable antifungal Environ. Microbiol. 73,7240–7245 (2007). J. &Mortensen,U. H. Transient marker system for it- the fungal homologueof thecentromere-associated Protein Expression Characteristics of Escherichiacoli. Biological Parts andMicrobioreactors toExplore the Roubos, J.A.&Bovenberg, R.A.L.Using Synthetic ing high-throughput screening andcontrolled bioreactor icillium chrysogenum usingthebi-partiteapproach in lus niger glucoamylase (glaA)promoter performance us- killer factor: aresistant mutantwithsensitive sphero- based ontypeIIs restriction enzymes.PLoS One 22,189–259 (2004). et al. The promoter of theglucoamylase-en- Microb. Cell Fact. 135, 266–271 (2008). 25, 451–452 (1997). 47, 839– 276, 122, 80, 11, 4, - - - -

299. 304. 305. 306. 303. 302. 301. 300. 314. 307. 313. 312. 311. 309. 310. 308. Bourdichon, F. etal.Food fermentations: Microor Gutiérrez, S.,Fierro, F., Casqueiro, J.&Martín,F. Gene Takata, M.etal.Homologous recombination and Nijland, J.G.,Kovalchuk, A.,van denBerg, M.a,Boven- Su, X.,Schmitz,G.,Zhang,M.,Mackie,R.I.&Cann,K. Nevalainen, K.M.H., Te’o, V. S.J.&Bergquist, P. L. Döbeli, H.etal.Recombinant Fusion Proteins for the Gibbs, P. A., Seviour, R. J. & Schmid,F. Growth of fila- Trends Biotechnol. 23,468–74 (2005). Marx, F. Small,basicantifungal proteins secreted Goins, C.L.,Gerik,K.J.&Lodge, J.K.Improvements Brakhage, A.etal.HAP-Like CCAAT-Binding Com- Ballance, D. J.Sequences importantfor gene expres- Meyer, V., Wedde, M.&Stahl, U. Transcriptional regula- Kaiserer, L.etal. Characterization of thePenicillium Wnendt, S.,Felske-Zech, H.,Henze, P. P. C.,Ulbrich,N.& Leiter, É.etal.Antifungal protein PAF severely affects sible solutions.Crit.Rev. Biotechnol. 1415–21 (2008). organization andplasticity of thebeta-lactamgenes in different filamentousfungi.AntonieVan Leeuwenhoek chrysogenum increases cephalosporin production ganisms withtechnologicalbeneficialuse.Int.J.Food Adv. Appl.Microbiol. 81,1–61 (2012). sion infilamentousfungi.Yeast 2,229–236 (1986). sarcin, aribosome-inactivating protein secreted by As- 133–142 (2004). 75, 81–94 (1999). non-homologous end-joiningpathways of DNAdou cus neoformans: absence of Ku proteins increases cells. EMBOJ. 17, mentous fungiinsubmerged culture: problems andpos- chrysogenum antifungal protein PAF. Arch. Microbiol. 12, 404–414(1998). Microbiol. 154,87–97 (2012). O. Heterologous GeneExpression inFilamentousFungi. Industrial Production of DisulfideBridge Containing regarding expression, structure, functionandpo- Heterologous protein expression infilamentousfungi. Formation, and Selective Cleavage. Peptides: Purification, Oxidation without Concatamer nology. Fungal Genet. Biol.27, plexes inFilamentousFungi: Implicationsfor Biotech- transporter encoded by thecefT gene of Acremonium nidulans andinduces anapoptosis-like phenotype. An- maintenance of chromosomal integrityinvertebrate pergillus giganteus. Gene in Penicillium chrysogenum. Fungal Genet.Biol. 180, 204–10 (2003). timicrob. Agents Chemother. 49, Stahl, U. Characterization of thegene encoding Mol. Genet.Genomics266,747–757 (2002). berg, R.aL.&Driessen,A.J.M.Expression of the from filamentousascomycetes: a comparative study 531–44 (2006). tential application. Appl.Microbiol. Biotechnol. to gene deletioninthefungal pathogen Cryptococ tion of theAntifungal Protein inAspergillus giganteus. the integrityof theplasmamembrane of Aspergillus tation of deletionphenotypes. Fungal Genet.Biol. independent DNAmoleculesallows rapid complemen- homologous recombination, andco-transformation of ble-strand break repair have overlapping roles inthe 5497–5508 (1998). 124, 239–244 (1993). 243–252 (1999). 2445–2453 (2005). 20, Protein Expr. Purif. References 17–48 (2000). alpha- 45, 43, 65, - - -

­ A 127

Appendix 315. McLean, K. J. et al. Single-step fermentative production phenylacetyl-CoA ligase gene of Penicillium chrysoge- of the cholesterol-lowering drug pravastatin via repro- num encoding an aryl-capping enzyme that supplies gramming of Penicillium chrysogenum. Proc. Natl. Acad. phenylacetic acid to the isopenicillin N-acyltransferase. Sci. U. S. A. 112, 2847–52 (2015). Biochem. J. 395, 147–55 (2006).

316. Van Boeckel, T. P. et al. Global antibiotic consumption 332. Phan, L. et al. Identification of a translation initiation 2000 to 2010: an analysis of national pharmaceutical factor 3 (eIF3) core complex, conserved in yeast and sales data. Lancet Infect. Dis. 14, 742–750 (2014). mammals, that interacts with eIF5. Mol. Cell. Biol. 18, 4935–46 (1998). 317. Gutiérrez, S., Casqueiro, J. & Martín, J. F. Filamentous fungi as cellular factories: Biodiversity of secondary 333. Prado, F. & Aguilera, A. New in-vivo cloning methods metabolites. Rev. Iberoam. Micol. 17, S54-60 (2000). by homologous recombination in yeast. Curr. Genet. 25, 180–3 (1994). 318. Chiou, C.-H., Miller, M., Wilson, D. L., Trail, F. & Linz, J. E. Chromosomal location plays a role in regulation 334. Bird, D. & Bradshaw, R. Gene targeting is locus depen- of aflatoxin gene expression in Aspergillus parasiticus. dent in the filamentous fungus Aspergillus nidulans. Appl. Environ. Microbiol. 68, 306–15 (2002). Mol. Gen. Genet. 255, 219–25 (1997).

319. Palmer, J. M. & Keller, N. P. Secondary metabolism in 335. Kurtz, M. B., Cortelyou, M. W., Miller, S. M., Lai, M. & Kirsch, fungi: does chromosomal location matter? Curr. Opin. D. R. Development of autonomously replicating plasmids Microbiol. 13, 431–436 (2010). for Candida albicans. Mol. Cell. Biol. 7, 209–17 (1987).

320. Dillon, P. J. & Rosen, C. A. A rapid method for the 336. Elander, R. P. Industrial production of beta-lactam an- construction of synthetic genes using the polymerase tibiotics. Appl. Microbiol. Biotechnol. 61, 385–92 (2003). chain reaction. Biotechniques 9, 298, 300 (1990). 337. Meijer, W. H. et al. Peroxisomes are required for effi- 321. Weber, E., Engler, C., Gruetzner, R., Werner, S. & cient penicillin biosynthesis in Penicillium chrysoge- ­Marillonnet, S. A Modular Cloning System for Stan- num. Appl. Environ. Microbiol. 76, 5702–9 (2010). dardized Assembly of Multigene Constructs. PLoS One 6, e16765 (2011). 338. Kardos, N. & Demain, A. L. Penicillin: The medicine with the greatest impact on therapeutic outcomes. Ap- 322. Harris, D. M. et al. Enzymic analysis of NADPH plied Microbiology and Biotechnology 92, 677–687 (2011). metabolism in beta-lactam-producing Penicillium chrysogenum: presence of a mitochondrial NADPH 339. Coates, A. R., Halls, G. & Hu, Y. Novel classes of antibi- dehydrogenase. Metab. Eng. 8, 91–101 (2006). otics or more of the same? British Journal of Pharmacol- ogy 163, 184–194 (2011). 323. Kiel, J. A. K. W. et al. Matching the proteome to the genome: the microbody of penicillin-producing Pen- 340. Waksman, S. A. Streptomycin: background, isolation, icillium chrysogenum cells. Funct. Integr. Genomics 9, properties, and utilization. Science 118, 259–66 (1953). 167–84 (2009). 341. Spellberg, B. et al. The Epidemic of Antibiotic-Resistant 324. Fierro, F., Kosalková, K., Gutiérrez, S. & Martín, J. F. Infections: A Call to Action for the Medical Community Autonomously replicating plasmids carrying theAMA1 from the Infectious Diseases Society of America. Clin. region inPenicillium chrysogenum. Curr. Genet. 29, Infect. Dis. 46, 155–164 (2008). 482–489 (1996). 342. Wang, L., Ridgway, D., Gu, T. & Moo-Young, M. Biopro- 325. Barredo, J. L., Cantoral, J. M., Alvarez, E., Díez, B. & cessing strategies to improve heterologous protein Martín, J. F. Cloning, sequence analysis and transcrip- production in filamentous fungal fermentations. Bio- tional study of the isopenicillin N synthase of Penicil- technology Advances 23, 115–129 (2005). lium chrysogenum AS-P-78. Mol. Gen. Genet. 216, 91–8 (1989).

326. Díez, B. et al. The cluster of penicillin biosynthetic genes. Identification and characterization of the pcbAB gene encoding the alpha-aminoadipyl-cysteinyl-valine synthetase and linkage to the pcbC and penDE genes. J. Biol. Chem. 265, 16358–65 (1990).

327. MacCabe, A. P. et al. Delta-(L-alpha-aminoadipyl)-L-­ cysteinyl-D-valine synthetase from Aspergillus nid- ulans. Molecular characterization of the acvA gene encoding the first enzyme of the penicillin biosynthetic pathway. J. Biol. Chem. 266, 12646–54 (1991).

328. Barredo, J. L. et al. Cloning and characterization of the acyl-coenzyme A: 6-aminopenicillanic-acid-acyl- transferase gene of Penicillium chrysogenum. Gene 83, 291–300 (1989).

329. Martin, J., Gutiérrez, S. & Demain, A. β-Lactams. Fungal 91–127 (1997).

330. Koetsier, M. J., Jekel, P. a, van den Berg, M. a, Bovenberg, R. a L. & Janssen, D. B. Characterization of a pheny- A lacetate-CoA ligase from Penicillium chrysogenum. Biochem. J. 417, 467–76 (2009).

331. Lamas-Maceiras, M., Vaca, I., Rodríguez, E., Casqueiro, J. & Martín, J. F. Amplification and disruption of the

128 References