Enterococcus Spp. in Ragusano PDO and Pecorino Siciliano Cheese Types: a Snapshot of Their Antibiotic Resistance Distribution T
Total Page：16
File Type：pdf, Size：1020Kb
Food and Chemical Toxicology 120 (2018) 277–286 Contents lists available at ScienceDirect Food and Chemical Toxicology journal homepage: www.elsevier.com/locate/foodchemtox Enterococcus spp. in Ragusano PDO and Pecorino Siciliano cheese types: A snapshot of their antibiotic resistance distribution T ∗ Nunziatina Russoa, Cinzia Caggiaa, , Alessandra Pinoa, Teresa M. Coqueb,c,d, Stefania Ariolie, Cinzia L. Randazzoa a Dipartimento di Agricoltura Alimentazione e Ambiente (Di3A), University of Catania, Italy b Servicio de Microbiología, Istituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Hospital Universitario Ramón y Cajal, Madrid, Spain c Centro de Investigación Biomédica en Red de Epidemiología y Salud Pública (CIBER ESP), Madrid, Spain d Unidad de Resistencia a Antibióticos y Virulencia Bacteriana asociada al Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain e Department of Food Environmental and Nutritional Science (DeFENS), University of Milan, Italy ARTICLE INFO ABSTRACT Keywords: In the present study, 110 enterococci were isolated from two Sicilian cheese types, Ragusano PDO and Pecorino Enterococci Siciliano. Isolates, firstly identified by MALDI-TOF/MS and a multiplex PCR assay, were tested for susceptibility Antibiotic resistance to the most relevant clinical antibiotics. Clonal relationships among isolates were evaluated by pulsed-field-gel PFGE electrophoresis (PFGE) analysis and the presence of vanA and vanB genes, in vancomycin resistant enterococci MIC (VRE), was investigated. Overall, E. faecalis, E. durans (35% for each species) and E. faecium (28%) were the Cheese major identified species. Different occurrence between cheese types was revealed. Most isolates from Ragusano PDO cheese were identified as E. durans (46%) and/or E. faecalis (43%), while E. faecium (605) was mainly detected in Pecorino Siciliano cheese. High incidence of resistance (97% of total strains) was detected for ri- fampicin, erythromycin and ampicillin. Moreover, 83 isolates (75%) exhibited multidrug-resistant phenotypes and the one VRE (vanB) isolate was identified as E. durans. PFGE analysis clustered isolates into 22 genotypes and the presence of the same PFGE types, for both E. durans and E. faecalis, in the two cheese types, suggest the link between enterococci and geographical area of production. Results of present study raise concerns about possible role of dairy enterococci as reservoirs of antibiotic resistance. 1. Introduction and Serror, 2008) and, contrarily to other lactic acid bacteria, as op- portunistic pathogens, being a major cause of nosocomial infections In recent years, there is a growing concern for the antibiotic re- (Vergis et al., 2001; Guzman Prieto et al., 2016). Although these bac- sistance of food-related enterococci, no more regarded as GRAS teria were considered to have low virulence, the high documented (Generally Recognized as Safe) organisms. Enterococci are highly mortality rates have been related to the increasing of acquired anti- widespread microorganisms, thanks to their strong adaptability and biotic resistance (Na et al., 2012). Indeed, for most enterococci, the resistance to adverse environmental conditions. They are present in resistance to several antimicrobial agents is a remarkable species- soil, water, and food, such as meat, milk and cheese, but the gastro- characteristic and the emergence and spread of Vancomycin Resistant intestinal tract of humans and animals remains the larger reservoir of Enterococci (VRE) has focused greater attention on this genus (Franz enterococci (Aarestrup et al., 2002a; Gilmore et al., 2013; Hugas et al., et al., 1999). Enterococci are intrinsically resistant to several antibiotics 2003; Ogier and Serror, 2008). Enterococci have extensively been stu- and can readily accumulate mutations and exogenous genes conferring died for their ability to carry out beneficial technological effects, in additional resistances (Guzman Prieto et al., 2016; Bocanegra-Ibarias different fermented food, especially in traditional Mediterranean et al., 2016; Rossi et al., 2014). The acquisition of resistance genes often cheeses (Bonacina et al., 2017). occurs via conjugation with plasmids or conjugative transposons that Enterococcus species are also known to produce bacteriocins active can potentially carry multiple antibiotic resistance genes (Arias and against many human pathogens (Izquierdo et al., 2009; Ness et al., Murray, 2012; Clewell et al., 2014; Coque et al., 1998). 2014). Nevertheless, they have been revealed as food spoilers (Ogier Recently, antimicrobial resistance and virulence factors have been ∗ Corresponding author. E-mail address: [email protected] (C. Caggia). https://doi.org/10.1016/j.fct.2018.07.023 Received 1 March 2018; Received in revised form 21 June 2018; Accepted 12 July 2018 0278-6915/ © 2018 Published by Elsevier Ltd. N. Russo et al. Food and Chemical Toxicology 120 (2018) 277–286 Table 1 PCR primers, products and reference strains for Enterococcus spp. Reference strains Primer Sequence (5′-3′) Product size (bp) Multiplex group Reference Enterococcus spp. E1 TCAACCGGGGAGGGT 733 1 and 2 Deasy et al., 2000 E2 ATTACTAGCGATTCCGG E. casseliflavus CA1 TCCTGAATTAGGTGAAAAAAC 288 2 Jackson et al., 2004 CA2 GCTAGTTTACCGTCTTTAACG E. durans DU1 CCTACTGATATTAAGACAGCG 295 1 Jackson et al., 2004 DU2 TAATCCTAAGATAGGTGTTTG E. faecalis FL1 ACTTATGTGACTAACTTAACC 360 1 Jackson et al., 2004 FL2 TAATGGTGAATCTTGGTTTGG E. faecium FM1 GAAAAAACAATAGAAGAATTAT 215 1 Jackson et al., 2004 FM2 TGCTTTTTTGAATTCTTCTTTA E. gallinarum GA1 TTACTTGCTGATTTTGATTCG 173 2 Jackson et al., 2004 GA2 TGAATTCTTCTTTGAAATCAG detected in retail foods including cheeses (Hammad et al., 2015; 2.2. Enterococci identification Koluman et al., 2009), being food chain one of the main routes of an- tibiotic resistance dissemination. In most cases, studies focused on E. 2.2.1. Identification by MALDI-TOF/MS faecalis and E. faecium species (Aarestrup et al., 2002b), which re- The identi fication of the 140 isolates was performed by matrix-as- present, about 75% and 20% of enterococcal-related infections in the sisted laser desorption/ionisation time-of-flight mass spectrometry world (Sánchez Valenzuela et al., 2008; Peel et al., 2011). MALDI-TOF/MS (Bruker Daltonics, Germany). Sample preparation, Moreover Enterococcus species were found able to transfer antibiotic data processing and analyses were carried out as previously described resistance genes to Staphylococcus aureus and Listeria spp. in human or by Freiwald and Sauer (2009). Mass spectra were acquired using a animal intestinal tract, in environment, and in food (Walsh et al., 2001; Microflex™ mass spectrometer (Bruker Daltonik) and identified using Pesavento et al., 2010; Sparo et al., 2011). In addition, E. faecium has the manufacturer's software MALDI BioTyper™ 3.0. Standard Bruker been classified as one of the key problem bacteria (named as ESKAPE), interpretative criteria were applied; scores ≥ 2.0 were accepted for by the Infectious Diseases Society of America (Bonten et al., 2001) and, species assignment and scores ≥ 1.7 but ≤ 2.0 for genus identification. most recently has not been included in the qualified presumption of safety (QPS) list, by European Food Safety Authority (EFSA, 2017), 2.2.2. Identification by multiplex PCR according to the putative virulence profile (Freitas et al., 2018). Genomic DNA from isolates was extracted from a loopful of over- Based on the above considerations the aim of the present study was night BHI cultures and transferred to lysis buffer (0.25% SDS and 0.05M to evaluate the prevalence of antibiotic resistance of enterococcal iso- NaOH). The suspension was incubated at 95–100 °C for 5 min and lates from Sicilian cheeses in order to assess their role in the risk of centrifuged for 5 min at 13,000 rpm. Then, 180 μL of Tris-HCl 10 mM dissemination of antibiotic resistance in animal origin food. For this (pH = 8.5) were added and the suspension was centrifuged for 7 min at purpose, the biodiversity and the antibiotic resistance profile of en- 13,000 rpm. The supernatant was transferred into clean eppendorf and terococcal population from Ragusano PDO and Pecorino Siciliano, at stored at −20 °C until use. different ripening stages, were tested. Genus- and species-specific multiplex PCR were applied in order to distinguish isolates into most common species of enterococci, such as E. faecalis, E. faecium, E. durans, E. casseliflavus, and E. gallinarum. For 2. Materials and methods species-specific identification, the manganese-dependent superoxide dismutase gene (sodA) was chosen (Poyart et al., 2000). Six sets of PCR 2.1. Sample collection and enterococci isolation primers (Table 1) were used, as previously reported (Deasy et al., 2000; Jackson et al., 2004). Two PCR reactions, consisting of different primer Samples of Ragusano PDO and Pecorino Siciliano cheese, at dif- sets, were prepared: the first included E. durans ATCC19432, E. faecalis ferent ripening stages (90 and 180 days) were collected from two dairy ATCC19433, and E. faecium ATCC19434; and the second consisted of E. factories located in Western Sicily region (South Italy). Samples were casseliflavus ATCC25788 and E. gallinarum ATCC49673. The master mix transported to the Laboratory of Food Microbiology of University of EconoTAQ plus 2X was used and 0.5 μL of each genus primer was Catania and for the isolation of enterococci, cheese samples (25 g) were added, with the exception of E. faecalis (FL1, FL2 primers), and E. gal- taken with sterile borer (1 cm in diameter)