Low Mitochondrial DNA Variation Among American Alligators and a Novel Non-Coding Region in Crocodilians

JOURNAL OF EXPERIMENTAL ZOOLOGY (MOL DEV EVOL) 294:312–324 (2002) Low Mitochondrial DNA Variation Among American Alligators and a Novel Non-Coding Region in Crocodilians n TRAVIS C. GLENN,1,2 JOSEPH L. STATON,3 ALEX T. VU,1 LISA M. DAVIS,1,2 JAIME R. ALVARADO BREMER,1 WALTER E. RHODES,4 I. LEHR BRISBIN, JR.,2 and ROGER H. SAWYER1 1Department of Biological Sciences, University of South Carolina, Columbia, South Carolina 29208 2Savannah River Ecology Laboratory, University of Georgia, Aiken, South Carolina 29802 3Belle W. Baruch Institute for Marine and Coastal Research, University of South Carolina, Columbia, South Carolina 29208 4South Carolina Department of Natural Resources, Dennis Wildlife Research Center, Bonneau, South Carolina 29431 ABSTRACT We analyzed 1317–1823 base pairs (bp) of mitochondrial DNA sequence beginning in the 5’ end of cytochrome b (cyt b) and ending in the central domain of the control region for 25 American alligators (Alligator mississippiensis) and compared these to a homologous sequence from a Chinese alligator (A. sinensis). Both species share a non-coding spacer between cyt b and tRNAThr. Chinese alligator cyt b differs from that of the American alligator by 17.5% at the nucleotide level and 13.8% for inferred amino acids, which is consistent with their presumed ancient divergence. Only two cyt b haplotypes were detected among the 25 American alligators (693–1199 bp surveyed), with one haplotype shared among 24 individuals. One alligator from Mississippi differed from all other alligators by a single silent substitution. The control region contained only slightly more variation among the 25 American alligators, with two variable positions (624 bp surveyed), yielding three haplotypes with 22, two, and one individuals in each of these groups. Previous genetic studies examining allozymes and the proportion of variable microsatellite DNA loci also found low levels of genetic diversity in American alligators. However, in contrast with allozymes, microsatellites, and morphology, the mtDNA data shows no evidence of differentiation among populations from the extremes of the species range. These results suggest that American alligators underwent a severe population bottleneck in the late Pleistocene, resulting in nearly homogenous mtDNA among all American alligators today. J. Exp. Zool. (Mol. Dev. Evol.) 294:312–324, 2002. r 2002 Wiley-Liss, Inc. DNA studies allow new insights into the genetic because of mutational rate differences along the relationships and evolutionary history of species. molecule (Brown, ’83; Parker et al., ’98). Coding Analysis of orthologous DNA sequences among regions are often used in interspecific phylogenetic species can provide information about phyloge- investigations, whereas noncoding portions of the netic relationships, whereas comparisons of DNA mtDNA (usually non-conserved portions of the within species can furnish information about control region; i.e., domain I and domain III cf. phylogeography, population structure, and population history (Avise, ’94). Mitochondrial DNA Jaime R. Alvarado Bremer’s present address: Department of (mtDNA) is an especially useful portion of the Marine Biology, Texas A&M University, 5007 Ave U., Galveston, Texas 77551 genome to investigate because it is maternally Grant sponsors: US Department of Energy; Grant numbers: DE- inherited, and thus reveals patterns of female FG02-97EW09999 and DE-FC09-96SR18546; Grant sponsor: Univer- sity of South Carolina Research and Development; Grant number: philopatry as well as revealing population differ- 96-E125; Grant sponsor: Savannah River Ecology Lab; Grant number: 96-F111. entiation more quickly than nuclear DNA (Avise, n Correspondence to: Travis C. Glenn, Savannah River Ecology Lab, ’94; Moore, ’95; Parker et al., ’98). PO Drawer E, Aiken, SC 29802. E-mail: [email protected] Different portions of the mtDNA genome can be Received 13 December 2001; Accepted 13 September 2002 Published online in Wiley InterScience (www.interscience.wiley. used for comparison at different hierarchical levels com). DOI: 10.1002/jez.10206 r 2002 WILEY-LISS, INC. ALLIGATOR MITOCHONDRIAL DNA VARIATION 313 Baker and Marshall, ’97) are often appropriate for prior to publication of the alligator mitochondrial the analysis of populations or individuals within a genome by Janke and Arnason (’97), and therefore species (Avise, ’94). Substitutions at 3rd positions initially focussed on the cyt b region given the of protein coding regions may also be informative preponderance of information available to aid in for studies of strongly differentiated populations. primer design for polymerase chain reaction Janke and Arnason (’97) described the complete (PCR). We hypothesized that the non-coding sequence (16646 bp) of the American alligator spacer adjacent to cyt b would contain high levels mtDNA genome from a single specimen from of variation among American alligators. We also Louisiana. Mindell et al. (’99) described 15898 bp sequenced mtDNA of the nearest living relative, of the mtDNA for another specimen of unknown the Chinese alligator, to evaluate inter-specific origin. Recently, Janke et al. (2001) also described variation relative to intra-specific variation of the complete mtDNA of spectacled caiman (Cai- American alligators and to determine if the non- man crocodylus). Partial cytochrome b (cyt b) coding spacer reported in saltwater crocodiles is sequences are available from most other crocodi- present in both alligator species. Following the lian species (White, ’92; Quinn and Mindell, ’96), publication of Janke and Arnason (’97), we designed and a portion of the putative control region has additional primers to obtain sequence information been sequenced for the saltwater crocodile, Cro- from the control region of American Alligators. Due codylus porosus (Quinn and Mindell, ’96). Quinn to the previously described genetic and morpholo- and Mindell (’96) described a non-coding spacer gical variation, we expected mtDNA of American between cyt b and tRNAThr in the saltwater alligators to have a pattern of differentiation similar crocodile that was noted by Janke and Arnason to that found for their nuclear DNA (e.g., Davis (’97). To date, published studies of crocodilian et al., 2001) and in many turtles from the south- mtDNA have concentrated on the use of this eastern US (Walker and Avise, ’98). information for interspecific phylogenetic studies (e.g., White, ’92; Kumazawa and Nishida, ’95). MATERIALS AND METHODS Genetic variation of American alligators has been investigated using allozymes (Gartside et al., American alligator blood or tissues were col- ’77; Menzies et al., ’79; Adams et al., ’80) and lected from specimens throughout much of their microsatellite DNA loci (Glenn et al., ’96, ’98; range (Fig. 1; Table 1). Chinese alligator DNA was Davis et al., 2001). These studies found relatively provided by H. C. Dessauer (sample HCD-5994; low levels of genetic variation within populations voucher tissues in the LSU tissue collection). (see discussion for caveats), but significant varia- Genomic DNA was isolated by standard Protei- tion among populations from the extremes of the nase K digestion, followed by either 1) phenol/ species range (western Louisiana, south Florida, chloroform extraction and ethanol precipitation and South Carolina). The most detailed study (Sambrook et al., ’89) or 2) guanidine thiocyanate (Davis et al., 2001) found evidence of an east/west with diatomaceous earth extraction protocol split among alligator populations, separating (Davis et al., 2001; http://gator.biol.sc.edu). Geno- Louisiana populations from those to the east, mic DNA was used as the template for most PCRs, which is consistent with morphological variation but additional PCRs were performed using pur- in scale patterns (Ross and Roberts, ’79). Male ified alligator mitochondrial DNA isolated from American alligators are known to have much frozen heart tissues (Jones et al., ’88; Sambrook larger home ranges and higher dispersal capability et al., ’89) to ensure that PCR products derive than females (Joanen and McNease, ’70, ’72; from mtDNA and not nuclear pseudogenes (cf. Brisbin et al., ’92). Thus, we undertook this study Quinn ’97). to determine broadly the amount of mtDNA PCR primers for the cyt b region (L14261, Fig. variation among several populations of American 2; and H-Phe, 5’GCATCTTCAGTGCTATGCTTT) alligators from throughout the species range and were designed from partial cyt b sequence (White, therefore estimate the proportion of population ’92) and an alignment of vertebrate tRNAPhe differentiation due to female philopatry. sequences (Vu, ’97). DNA fragments were recov- Because little information exists on mtDNA ered from agarose gel slices using filtered pipette variation within any crocodilian species, we chose tips (Glenn and Glenn, ’94). Fragments were to examine both the cyt b region and control directly sequenced using manual, Licor (Lincoln, region for an investigation of intra-specific varia- Nebraska), and ABI Prism 377 (Applied Biosys- tion of American alligators. We initiated this study tems, Foster City, California) sequencers. We used 314 T.C. GLENN ET AL. Fig.1. Range of American alligators (adapted from Coulson and Hernandez, ’83) and sampling locations used in this study. that sequence information to develop additional et al., 2000) was used to calculate haplotypic (h) primers (Fig. 2) to amplify and sequence a 1246-bp and nucleotide (p) diversities (Nei, ’87, equations fragment (cyt b to tRNAThr) for alligators

Load more