University of Kentucky UKnowledge

Theses and Dissertations--Toxicology and Cancer Biology Toxicology and Cancer Biology

2020

THE ROLE OF NEURAL PRECURSOR CELL EXPRESSED DEVELOPMENTALLY DOWN-REGULATED 9 IN ENHANCED AGGRESSIVENESS OF HEXAVALENT CHROMIUM TRANSFORMED BRONCHIAL EPITHELIAL CELLS

Peter Van Wie University of Kentucky, [email protected] Digital Object Identifier: https://doi.org/10.13023/etd.2020.041

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Van Wie, Peter, "THE ROLE OF NEURAL PRECURSOR CELL EXPRESSED DEVELOPMENTALLY DOWN- REGULATED PROTEIN 9 IN ENHANCED AGGRESSIVENESS OF HEXAVALENT CHROMIUM TRANSFORMED BRONCHIAL EPITHELIAL CELLS" (2020). Theses and Dissertations--Toxicology and Cancer Biology. 30. https://uknowledge.uky.edu/toxicology_etds/30

This Doctoral Dissertation is brought to you for free and open access by the Toxicology and Cancer Biology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Toxicology and Cancer Biology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in future works (such as articles or books) all or part of my work. I understand that I am free to register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we verify that this is the final, approved version of the student’s thesis including all changes required by the advisory committee. The undersigned agree to abide by the statements above.

Peter Van Wie, Student

Dr. Isabel Mellon, Major Professor

Dr. Isabel Mellon, Director of Graduate Studies THE ROLE OF NEURAL PRECURSOR CELL EXPRESSED DEVELOPMENTALLY DOWN-REGULATED PROTEIN 9 IN ENHANCED AGGRESSIVENESS OF HEXAVALENT CHROMIUM TRANSFORMED BRONCHIAL EPITHELIAL CELLS

DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Medicine at the University of Kentucky

By Peter Gregory Van Wie Lexington, Kentucky Director: Dr. Isabel Mellon, Professor of Toxicology and Cancer Biology Lexington, Kentucky 2019

Copyright © Peter Van Wie 2019 ABSTRACT OF DISSERTATION THE ROLE OF NEURAL PRECURSOR CELL EXPRESSED DEVELOPMENTALLY DOWN-REGULATED PROTEIN 9 IN INHANCED AGGRESSIVENESS OF HEXAVALENT CHROMIUM TRANSFORMED BRONCHIAL EPITHELIAL CELLS

Hexavalent chromium (Cr(VI)) is classified as a confirmed human carcinogen by the International Agency for Research and Cancer (IARC) and by the U.S. Environmental Protection Agency (EPA). Chronic exposure to (Cr(VI)) causes malignant cell transformation in human bronchial epithelial BEAS-2B cells. These Cr(VI)-transformed cells exhibit a highly aggressive phenotype including increased migration, invasion, and angiogenesis. The Cas family protein neuronal precursor developmentally down regulated protein 9 (NEDD9/Cas-L/HEF1) was dramatically overexpressed in Cr(VI)-transformed cells compared to normal BEAS-2B cells. Knockdown of NEDD9 by its shRNA reduced migration and invasion in vitro measured by migration and invasion assays. shNEDD9 reduced tumor formation in nude mice injected subcutaneously and metastasis in mice injected in the lateral tail vein. NEDD9 is critical for the activation of c-Src kinase (Src) at Y416 and overexpression of kinase (FAK). These interactions with NEDD9, FAK, and Src indicate that NEDD9 was acting upstream from FAK and Src in Cr(VI)- transformed cells. NEDD9 expression or Src activation had downstream effects on migration and invasion. Interestingly β-Catenin activity was positively regulated by the expression of NEDD9 and the activation of Src. NEDD9 is critical for HIF-1α expression which leads to angiogenesis. The NEDD9 mediated angiogenic VEGF, PECAM, ANG1, and MMP proteins are overexpressed in Cr(VI)-transformed cells. NEDD9 may increase angiogenesis by first mediating the of p38 and then HIF-1α. NEDD9 can also bind directly to CREB binding protein (CBP) a critical cofactor for HIF- 1α transcriptional activity. These results lead us to believe that NEDD9 is a driving force in lung cancer aggressiveness by magnifying migration and invasion by facilitating FAK/Src binding and activation of Src kinase, by increasing β-Catenin activity and by increasing angiogenesis through HIF-1α stabilization and overexpression of downstream angiogenic proteins. KEYWORDS: NEDD9, Chromium(VI), FAK, Src, β-Catenin, HIF-1α

Peter Gregory Van Wie

(Name of Student)

12/20/2019 Date THE ROLE OF NEURAL PRECURSOR CELL EXPRESSED DEVELOPMENTALLY DOWN-REGULATED PROTEIN 9 IN INHANCED AGGRESSIVENESS OF HEXAVALENT CHROMIUM TRANSFORMED BRONCHIAL EPITHELIAL CELLS

By Peter Gregory Van Wie

Dr. Isabel Mellon Director of Dissertation

Dr. Isabel Mellon Director of Graduate Studies

12/20/2019 Date TABLE OF CONTENTS

LIST OF FIGURES ...... vi

CHAPTER 1. Introduction to environmental and occupational exposure to hexavalent chromium and tumor aggressiveness ...... 1 1.1 Exposure to Heavy Metal ...... 1 1.2 Tumorigenesis ...... 4 1.3 Aggressiveness ...... 7

CHAPTER 2. Upregulation of NEDD9 promotes migration and invasion through FAK/Src and β- Catenin/E-Cadherin pathways in Chromium(VI)-transformed bronchial epithelial cells...... 13 2.1 Abstract ...... 13 2.2 Introduction ...... 14 2.3 Methods ...... 16 2.3.1 Chemicals and Reagents ...... 16 2.3.2 Cell Culture ...... 16 2.3.3 Stable NEDD9 knockdown cells ...... 17 2.3.4 Immunoblotting analysis ...... 17 2.3.5 Immunoprecipitation ...... 17 2.3.6 Real time PCR ...... 17 2.3.7 Migration and Invasion assays...... 18 2.3.8 ELISA assay ...... 18 2.3.9 Kinase activity assay ...... 18 2.3.10 In vivo tail vein injection assay ...... 18 2.3.11 Statistical analysis ...... 18 2.4 Results ...... 19 2.4.1 Upregulation of NEDD9 in Cr(VI)-transformed BEAS-2B cells ...... 19 2.4.2 Knockdown of NEDD9 reduces migration and invasion in Cr(VI)-transformed cells ...... 19 2.4.3 Knockdown of NEDD9 reduces metastasis in vivo ...... 20 2.4.4 Upregulation of NEDD9 increases aggressiveness by facilitating FAK/Src binding and active Src (Y416) ...... 20 2.4.5 Upregulation of NEDD9 increases aggressiveness by increasing active non-phosphorylated β-Catenin through GSK-3β activity ...... 21 2.4.6 Src and β-Catenin are downstream targets of NEDD9 in regulation of migration and invasion in Cr(VI)-transformed cells ...... 22 2.4.7 Scheme of mechanism of aggressiveness in Cr(VI)-transformed cells ...... 22 2.5 Discussion ...... 23

CHAPTER 3. Upregulation of NEDD9 promotes angiogenesis by increasing HIF-1 transcriptional activity in chromium(VI)-transformed bronchial epithelial cells ...... 40 𝜶𝜶 3.1 Abstract ...... 40 3.2 Introduction ...... 41

iv 3.3 Materials and Methods ...... 42 3.3.1 Chemicals and Reagents ...... 42 3.3.2 Cell Culture ...... 43 3.3.3 Stable NEDD9 knockdown cells ...... 43 3.3.4 Immunoblotting analysis ...... 43 3.3.5 Real-time PCR ...... 43 3.3.6 ELISA ...... 44 3.3.7 Luciferase...... 44 3.3.8 CAM assay ...... 44 3.3.9 Tube formation assay ...... 44 3.3.10 In vivo tumorigenesis and angiogenesis assays ...... 44 3.3.11 Statistical analysis ...... 45 3.4 Results ...... 45 3.4.1 Angiogenesis is increased in Cr(VI)-transformed BEAS-2B cells ...... 45 3.4.2 Inhibition of NEDD9 reduces angiogenesis in Cr(VI)-transformed cells ...... 46 3.4.3 NEDD9 increases tumorigenesis and angiogenesis ...... 46 3.4.4 NEDD9 increases angiogenesis by mediating HIF-1α transcriptional activity ...... 47 3.5 Discussion ...... 47

CHAPTER 4. Conclusions ...... 60 4.1 Environmental and Occupation Hexavalent Chromium ...... 60 4.2 Hexavalent Chromium Carcinogenesis ...... 60 4.3 Hexavalent Chromium Aggressiveness ...... 61

References: ...... 66

VITA ...... 74 Positions and Honors ...... 74 Positions and Employment ...... 74 Other Experience and Professional Memberships ...... 74 Honors ...... 74

Contribution to Science ...... 75 Additional Information: Research Support and/or Scholastic Performance ...... 76 Ongoing Research Support ...... 76 Completed Research Support ...... 77

v LIST OF FIGURES Figure 1.1 Hexavalent chromium penetrates the plasma membrane and increases tumorigenesis...... 4 Figure 1.2 Two critical cellular adhesions ...... 7 Figure 1.3 β-Catenin disassociates from the destruction complex in many cancer-like conditions ...... 9 Figure 1.4 E-cadherin is lost or cleaved in many cancer-like conditions ...... 9 Figure 1.5 HIF-1α activity in normoxic and hypoxic conditions ...... 10 Figure 1.6 VEGF signaling on endothelial and other cell types ...... 11 Figure 2.1 Upregulation of NEDD9 in Cr(VI)-transformed BEAS-2B cells...... 27 Figure 2.2 Knockdown of NEDD9 reduces migration and invasion in Cr(VI)- transformed cells...... 29 Figure 2.3 Knockdown of NEDD9 reduces metastasis in vivo ...... 31 Figure 2.4 Upregulation of NEDD9 increases aggressiveness by facilitating FAK/Src binding and active Src (Y416) ...... 33 Figure 2.5 Upregulation of NEDD9 increases aggressiveness by increasing active non-phosphorylated β-Catenin through GSK-3β activity...... 35 Figure 2.6 Src is a downstream target of NEDD9 in regulation of migration and invasion in Cr(VI)-transformed cells...... 37 Figure 2.7 Scheme of mechanism of aggressiveness in Cr(VI)-transformed cells. ... 39 Figure 3.1 Angiogenesis is increased in Cr(VI)-transformed BEAS-2B cells...... 51 Figure 3.2 Inhibition of NEDD9 reduced angiogenesis in Cr(VI)-transformed BEAS- 2B cells...... 53 Figure 3.3 NEDD9 increases tumorigenesis and angiogenesis in vivo ...... 55 Figure 3.4 NEDD9 increases angiogenesis by mediating HIF-1α transcriptional activity via CBP...... 57 Figure 3.5 Scheme of mechanism of angiogenesis in Cr(VI)-transformed cells...... 59

vi CHAPTER 1. INTRODUCTION TO ENVIRONMENTAL AND OCCUPATIONAL EXPOSURE TO HEXAVALENT CHROMIUM AND TUMOR AGGRESSIVENESS

1.1 Exposure to Heavy Metal Heavy metals are ubiquitously present and can be concentrated in areas through natural or human forces. Their wide spread uses in many industrial applications have caused an increasingly vigilant awareness of the health effects of living near heavy metal hot spots. There are a handful of metals that have essential nutritional value for biochemical and physiological functions including cobalt (Co), copper (Cu), iron (Fe), magnesium (Mg), manganese (Mn) and zinc (Zn) [1]. These elements are found in trace quantities of the magnitude of ppb often in various matrices such as soils, dust, and plants, or can be found in various oxidized states. These can be received in the diet through food or ground water. Heavy metals in large doses can have devastatingly negative health effects and some heavy metals should be avoided as much as possible. The strongest carcinogenic heavy metals are chromium (Cr), arsenic (As), cadmium (Cd), and Nickel (Ni) [2]. Hexavalent chromium (Cr(VI)) has an oxidation state of +6. Each year massive amounts of hexavalent chromium are produced. For example, in 1985 300 thousand pounds of hexavalent chromium was produced [3]. Besides the prolific industrial use of hexavalent chromium, it exists in nature as these common conglomerates: ammonium dichromate, barium chromate, calcium chromate, chromium trioxide, lead chromate, sodium dichromate, strontium chromate, potassium chromate, potassium dichromate, sodium chromate and zinc chromate [4]. One major route of exposure for hexavalent chromium is through drinking water. Awareness for this exposure has become popularized in documentaries and movies such as Erin Brockovich. A second and possibly more dangerous matric is aerosolized Cr(VI). Accumulation of Cr(VI) has been observed in the lungs of chromate workers, leading to increased incidence and severity of lung cancer. Several critical epidemiologic studies illustrate the pressing need to address this issue. A study was conducted in 1987 illustrating multiple occurrences of lung cancer in chromate workers. The average duration of exposure was 24 years, and the primary sites were all in the large bronchi. The incidence of lung cancer in these chromate workers was

1 657.9 per 100,000 compared to 13.3 per 100,000 in the total population [5]. The dose response for those exposed to occupational chromate was reported by Tsuneta et al. in their study published in 1987 [6]. This study showed that increasing doses and longer time intervals of exposure were associated with lung cancer. In 1990, a review of many cases over decades revealed a dose dependent response with increasing lung cancer. This review presents evidence that more soluble chromates are more dangerous. The most potent forms were zinc chromate, calcium chromate, and Cr(VI) [7]. Trivalent chromium (Cr(III)) has a oxidation state of +3. It is the primary resting state that chromium is found in the environment. Trivalent chromium has industrial uses. Cr(III) acetate is used in the textile industry for fixing dyes and photography, and Cr(III) nitrate is used for catalysis, anti-corrosion, and textiles [8]. Cr(III) is a dietary supplement that has uses for blood sugar control in people with prediabetes, type one, and type two diabetes [9]. Theoretically Cr(III) is carcinogenic as it can generate DNA adducts causing increased mutation. However, in physiological pH conditions Cr(III) cannot enter the cell [10]. For this reason not much emphasis has been placed on regulating Cr(III) exposure. Hexavalent chromium is used in similar occupational settings as trivalent chromium. Cr(VI) is used in the production of metals such as stainless steel to increase the hardness, and for resistance to corrosion. Cr(VI) fumes are released during the production of these metals and it exists in welding fumes as well. It is used in paints, dyes, inks, primers, plating for pigmentation, and anticorrosive agent [11]. The industrial applications are most detrimental if Cr(VI) exposure reaches the respiratory system, kidney, liver, eyes or skin. Unlike Cr(III), Cr(VI) can enter the cell at physiological pH. Once Cr(VI) is inside the cell there is a cascade of effects leading to increased oxidative stress, metabolic reprograming, DNA damage and ultimately carcinogenesis. The best known carcinogenic heavy metals are Cr, Cd, Ni, and As. These metals share some similar mechanisms of action for causing cellular damage and carcinogenesis. While they have similarities, each also diverges into its own specialized pathways. Arsenic is classified as a group 1 carcinogen by the International Agency for Research on Cancer (IARC). Inorganic arsenic in drinking water has been solidly linked to bladder, liver, lung, prostate, skin cancer, and other diseases for example, cardiovascular disease, diabetes, and hypertension [12]. Much like Arsenic, Nickel is a group 1 carcinogen by

2 IARC standards. Ni(II) is genotoxic, mutagenic, and generates high levels of reactive oxygen species (ROS) with many downstream consequences. Nickel is most potent when it interacts with other metals in the cell such as Fe(II), Mg(II), Mn(II), Ca(II), and Zn(II) either by interacting with them directly, or affecting their metabolic states [13]. Cd, similar to the aforementioned heavy metals, is classified as a group 1 carcinogen by IARC. Target organs for Cd induced lung, liver, pancreas, and stomach. Most studies of Cd identify only a weak connection with mutagenesis. The mechanism then for Cd is most likely epigenetic by overexpressing oncogenes, pro-survival , inhibiting the expression of tumor suppressors, and apoptosis. Hexavalent and trivalent chromium we have briefly touched on in the previous paragraphs so next I will move to discuss the signaling pathways that these metals mediate. One of overlapping effect of all four metals is the ability to generate reactive oxygen species (ROS). The mechanism by which each metal generates ROS varies between Cr, Cd, Ni, and As. Cr(VI) enters the cells and generates ROS by reducing Cr(VI) to Cr(V), Cr(IV), and Cr(III) and back again releasing hydrogen peroxide, hydroxyl radicals, singlet oxygen, and superoxide radicals [14]. The reduction of Cr(VI) is catalyzed by glutathione, ascorbate, and Fenton. Cd generates ROS and nitric oxide radicals using largely the same enzymes, Fenton metals, glutathione, superoxide dismutase, and catalase but Cd does not undergo the same reduction and oxidation process that Cr(VI) does. Ni and As are processed by the same antioxidants as well producing hydrogen peroxide, hydroxyl radicals, singlet oxygen, and superoxide radicals. Arsenic behave the most similar to Cr in the reduction and oxidation process releasing ROS by reduction of As(V) to As(III). There are many mutagenic pathways that can be set into motion by exposure to heavy metals. Arsenic can cause DNA damage by blocking p53, ATM, ATR, and other important regulators for DNA repair [15]. Chromium can cause harmful DNA damage when reduced from Cr(VI) to Cr(III). The result is base modifications, single-stranded and double-stranded breaks, Cr-DNA adducts, DNA-Cr-DNA adducts, and protein-Cr- DNA adducts [16]. Epigenetic modifications also play a large in metal induced carcinogenesis. Affected pathways have downstream effects on DNA methylation, chromatin modification, and changes in expression of non-coding RNAs [17]. In addition

3 to these mutagenic and epigenetic effects of heavy metal exposure, many of the major pathways in cancer are affected. Cancer signaling pathways including, Wnt/β-Catenin, TNF , NF B, and effects on apoptosis and anoikic resistance, cytoskeletal remodeling,

and 𝛼𝛼 𝜅𝜅 signaling [18]. All of these effects of heavy metals make its study both broad and deep. For the scope of this dissertation we will now focus on Cr(VI) to more deeply describe how it is involved in the carcinogenic process and how it leads to increased tumor aggressiveness. 1.2 Tumorigenesis The initial stages of Cr(VI) induced carcinogenesis involve several mechanisms. Cr(VI) is water-soluble compared to the other oxidative states and can enter the cell by various transporters. Because of its remarkable structural 2- similarity to SO4 and 2- 2- HPO4 Cr(VI) (CrO4 ) Figure 1.1 Hexavalent chromium penetrates the plasma is ushered through the membrane and increases tumorigenesis. cell membrane via ion channels such as the sulfate ion channel and other nonspecific transporters [19, 20]. Most of Cr(VI) is reduced to Cr(III) in the cytosol, but a fraction of Cr(VI) reaches the nucleus. Cr(III) can also be oxidized back into Cr(VI) by oxidizing agents in the cell. Cr(VI) is more highly reactive and it is likely the precursor that gives rise to Cr(III)-DNA adducts [21, 22]. DNA damage and adducts can arise when Cr(VI) is reduced by the major antioxidant proteins in the cell including glutathione, cysteine, and ascorbate which are each highly reactive with Cr(VI), Cr(V), and Cr(IV). The result of these reductions occurring within the nucleus leads to single-stranded and double-stranded breaks, alkali-

4 labile sites, DPCs, DNA amino acid cross-links, Cr-DNA adducts, and protein-Cr(III)- DNA crosslinking [22]. Once inside the cell, Cr(III) can cause DNA damage by a different mechanism by interfering with base-pair stacking. Cr(VI) compounds in the lung have been documented to cause both adenine and guanine mutations in p53 [22]. The process of reduction from Cr(VI) to Cr(V), Cr(IV), and Cr(III) gives rise to ROS with many downstream effects including alterations in cell signaling and cellular metabolism [23]. ROS released during this reduction include super-oxide anions, and hydrogen peroxide. Further generating of ROS continues to produce hydroxyl radicals, singlet oxygen, superoxide, and hydrogen peroxide via Fenton pathways and other antioxidant pathways [22]. Several major pathways including oxidative phosphorylation are altered in cells treated with Cr(VI). Cr(VI)-transformed cells showed a suppression in all five mitochondrial complexes involved oxidative phosphorylation. The complexed that showed the most changes were complex I, II, and V. Changes in mitochondrial complexes led to a reduction of mitochondrial ATP production and non-mitochondrial oxygen consumption was increased [24]. Some of the critical enzymes for ATP production were altered in Cr(VI)-transformed cells from an RNA sequencing analysis. The genes upregulated in these cells included ADP-specific glucokinase (ADPGK), enolase 1 (ENO1), hexokinase (HK2), phosphoglycerate kinase (PGK1), dihydrolipoamide S-acetyltransferase (DLAT), pyruvate dehydrogenase E1 (PDHA1), glucose-6-phosphatase 3 (G6PC3), pyruvate kinase (PKM), aldolase A (ALDOA), and phosphofructokinase (PFKM) [23]. Hexavalent chromium interacts with a subset of phosphatidylinositol 3-kinase binding proteins which can mediate . The peroxide generation capability of Cr(VI) is a contributor in the upregulation of these pathways. One major result of these alterations is a change in MAP kinase which can affect growth and differentiation. This activation results in ERK1 and ERK2 activity and the positive modulation of Ras and downstream Raf-1 phosphorylation [25]. BEAS-2B cells have shown activation of EGFR signaling signified by a marked increase of p-EGFR(1068) when treated with Cr(VI) at 0.25 μM. The EGFR signaling was increased each month that the cells were treated with a peak expression around 4 months. Hydrogen peroxide

5 elevation induced NOX1 activation that was required for the phosphorylation of EGFR. Further signaling pathways were initiated including c-Src/ERK, p38/AKT, and MAPK [26]. Exposure of BEAS-2B cells to Cr(VI) caused apoptosis resistance by decreasing levels of C-PARP and Bax while elevating anti-apoptotic Bcl-2 and Bcl-xL. The inhibition of EGFR resumed apoptosis as normal in these cells by increasing Bax and reducing Bcl-2 expression [26]. It was reported that Cr(VI) increases apoptosis resistance by inhibiting the tumor suppressor p53, then PUMA/NOXA, resulting in Bcl-2 and Bax elevation [27]. However, in lung fibroblasts Cr(VI) was observed to have an opposite effect, transiently activating p53 causing upregulation of pro-apoptotic Bcl-xS and downregulation of anti-apoptotic Bcl-w and Bcl-xL [28]. Cr(VI) can induce autophagy which in some cells can lead to apoptosis, but in A549 cells and BEAS-2B cells, Cr(VI) induced autophagy promoted cell growth and proliferation [29, 30]. Endoplasmic reticulum (ER) stress occurred post Cr(VI) exposure by the upregulation of GRP78, p-PERK, and ATF6. This ER stress resulted in an increase in autophagy to reduce the burden of unfolded proteins. This is thought to be one of the mechanisms that Cr(VI) can reduce cell death in cancer cells [29]. ROS production generated from Cr(VI) exposure can induce mitochondrial dependent apoptosis. The activation of autophagy on Cr(VI)-transformed cells may be a critical component for repairing mitochondrial function and preventing cell damage and apoptosis [31].

6 1.3 Aggressiveness A study found that Cr(VI)-transformed BEAS-2B cells had 409 differently expressed genes compared with normal BEAS-2B cells. Out of these genes, 12 critical Focal adhesion genes were altered [32]. The major components of the desmosome complex DSC2, DSC3, and Prep were increased at least 5 fold in Cr(VI)-transformed cells. Cadherins involved in adherens junctions and tight junctions were upregulated at least 2 fold. L1CAM was increased at least 4 fold. These indicate that Cr(VI) exposure leads to significant changes in focal adhesion [32]. Out of the 409 differently expressed genes identified in Cr(VI)-transformed cells, significant downregulation was found in all cytoskeletal targets influencing cytoskeletal structure and cell junctions [32]. Matrix integrity was altered by downregulation of collagen α2. Cadherins associated with cell differentiation were downregulated. Integrin β4, a major factor in cell-matrix and cell-cell adhesion was downregulated. Zinc binding protein was accumulated in a phosphorylated form at the cell surface. This accumulation plays a role in generating focal adhesion sites and cell signal transduction. Lastly, differences were found upon examining urokinase type plasminogen activator (UPAR) and the CI-B18 . These data point to cell transformation and unusual adhesion states in Cr(VI)-transformed cells [33]. Focal adhesion kinase (FAK) and NEDD9 interact with a

myriad adhesion molecules to increase cellular invasion and

metastasis [34][35, 36]. FAK is a

non-receptor tyrosine kinase that regulates cellular adhesion at the

basal lamina and increases motility, proliferation, and cell survival in cancer [37]. FAK is Figure 1.2 Two critical cellular adhesions initially autophosphorylated at Y397 which allows for further activation and the formation of

7 the FAK/Src complex [37]. c-Src (Src) is a non-receptor tyrosine kinase belonging to a larger family of homologs with the collective name (SFK). Formation of the FAK/Src complex increases Src activation signified by phosphorylation at Y416 [38, 39]. Active Src kinase increases invasion and metastasis by activating multiple downstream targets and induces signal transducers for proliferation, cell growth, cell survival, differentiation, cell shape, motility, migration and angiogenesis [40]. NEDD9 is known to interact with FAK and Src, however; the exact mechanism of this critical interaction has been disputed. It has been reported that NEDD9 was the downstream of FAK/Src complex and its upregulation was dependent on Src activation [41] or FAK activation [42]. It has also been reported that NEDD9 was an upstream event of FAK, Src and other effectors [36, 43, 44]. Thus, some researchers suggest a positive feedback loop between NEDD9 and FAK or Src [34]. The formation of lamellipodia relies on FAK and the recruitment of Src. Lamellipodium at the leading edge respond to migratory signaling and are essential for migration and invasion. Migrating cells are polarized with a broad leading edge and a narrow trailing edge [45]. FAK and Src may be involved in migration by contributing to turnover at the front end of a cell [46-48]. Cells with forced deficiency of focal adhesion proteins were unable to release their trailing edges and lacked the ability to recruit further migration signaling molecules such as Crk and paxillin and a complex for guanine exchange with Rac in the leading edge [49]. The second essential adhesion site for epithelial are the adherens junctions. Figure 2 shows that while FAK/Src interactions govern the adhesion and signaling with the basal laminal extracellular matrix proteins, the adherens junctions govern cell to cell adhesion and signaling [50]. Adherens junctions are formed by E-Cadherin proteins protruding out of the cell and interacting with the E-Cadherin from neighboring cells. E-Cadherin is associated with β-Catenin at these sites as part of normal cellular adhesion [50, 51]. When E-Cadherin is lost or cleaved the adherens junctions are undermined and adhesion is altered [52, 53].

8

Figure 1.3 β-Catenin disassociates from the destruction complex in many cancer- like conditions

Cleaved E-cadherin can function either intercellularly or intracellularly as a signaling molecule. E-cadherin is cleaved in the intercellular space by MMPs and can feedback as a ligand with membrane bound E-cadherin. It can also be cleaved intracellularly by γ-secretase [53]. The intracellular fragments have not been well studied and their mechanism of action has not been well defined. When cleaved E-Cadherin fragments are found inside the cell they have been associated with Wnt signaling and the disassembly of adherens junctions [53]. It is also likely that leaved E-cadherin interacts with β-Catenin and may cause pooling in the cytosol.

Figure 1.4 E-cadherin is lost or cleaved in many cancer-like conditions

Cas family proteins including NEDD9 are necessary for FAK/Src dependent angiogenesis [54]. This process releases or activates several key molecules including RhoA, Rock, Nck2, and Cdc42 that are required for sprouting new vasculature [55-58]. In addition, NEDD9 was linked with the major angiogenic indictable factor HIF-1α [59]. These signaling factors had downstream effects on MMP secretion and membrane protein recycling as a part of tumor cell angiogenesis and invasion of endothelial cells. A tumor can only grow to be about 1-2mm3 before the center of the tumor begins to

9 undergo necrosis [60]. At this point angiogenesis becomes necessary for tumor growth. Without angiogenesis the metabolic and nutritional demands increase and oxygen levels become damagingly low. HIF-1α is the major inducible factor that can respond rapidly to the variable oxygen levels in the cell. Under normoxia HIF-1α undergoes hydroxylation by the PHD family of proteins. HIF-1α is then associated with VHL and ubiquitinated. This keeps HIF-1α levels controlled under normoxia through proteasomal degradation. In hypoxic conditions, PHD1 and PHD3 are degraded which allows for free HIF-1α in the cell. HIF- 1α forms a dimer with HIF-1β and is translocated to the nucleus. CREB-Binding Protein (CBP) and p300 are cofactors that increase association with the DNA and the HIF complex. Angiogenic and erythropoietic genes are transcribed at the hypoxia response element (HRE) including VEGF and about 60 other genes.

Figure 1.5 HIF-1α activity in normoxic and hypoxic conditions

Vascular endothelial growth factor (VEGF) is one of the most important downstream targets of HIF-1α. It is a secreted protein that binds to the VEGF-R to activate several signaling pathways. VEGF can activate Ras/MAPK resulting in cell

10 proliferation. The Ras/Raf cascade is initiated by VEGF-R through the recruitment of Src. The downstream MAP kinases ERK1/ERK2 are activated [61]. VEGF-R activates FAK/paxillin to promote cytoskeletal rearrangement and migration. VEGF promotes FAK activation and localization to cell-cell junctions. FAK binds to the vascular endothelial cadherin (VE-Cadherin) and induces active β-Catenin. This facilitates VE- Cadherin and β-Catenin dissociation as a critical part of cytoskeletal rearrangement [62]. Small GTPase RhoA is also an important downstream target of VEGF. The RhoA/ROCK activation is necessary in aiding the formation of new vasculature and vascular

Figure 1.6 VEGF signaling on endothelial and other cell types

permeability. VEGF also has extended cellular effects on motility, proliferation, and survival [63]. VEGF is regulated not only by HIF-1α but also by p38 which is a MAPK family protein. p38 associates with scaffolding proteins in the Cas family and here we propose the importance of its interaction with NEDD9. The role of p38 as it relates to angiogenesis is that p38 can shift the signaling implications of VEGF to induce angiogenesis or vascular permeability [64]. The activation of p38 causes activation of MAP kinases protein kinase 2/3 and the polymerization of F-actin. These effects on microfilaments induce cytoskeletal rearrangement as a critical part of cell migration and angiogenesis [65, 66].

11 This dissertation will examine the role of NEDD9 in signaling pathways of migration, invasion, and angiogenesis including FAK/Src, E-Cadherin/ β-Catenin, HIF- 1α/VEGF, and MAP kinase p38. We have found significant data to support that NEDD9 is critical in these pathways and their downstream effects on cancer aggressiveness.

12 CHAPTER 2. UPREGULATION OF NEDD9 PROMOTES MIGRATION AND INVASION

THROUGH FAK/SRC AND Β-CATENIN/E-CADHERIN PATHWAYS IN CHROMIUM(VI)-

TRANSFORMED BRONCHIAL EPITHELIAL CELLS. 2.1 Abstract Chronic exposure to hexavalent chromium (Cr(VI)) causes malignant cell transformation in human bronchial epithelial BEAS-2B cells. These Cr(VI)-transformed cells exhibit a highly aggressive phenotype including increased migration and invasion. The Cas family protein neuronal precursor developmentally down regulated protein 9 (NEDD9/Cas-L/HEF1) is dramatically overexpressed in Cr(VI)-transformed cells compared to normal BEAS-2B cells. Knockdown of NEDD9 by its shRNA reduced migration, invasion in vitro and in vivo. NEDD9 is critical for FAK expression and the activation of Src kinase at Y416 through direct binding. These interactions with NEDD9, FAK, and Src indicate that NEDD9 is acting upstream from FAK and Src in Cr(VI)- transformed cells. Src activation had downstream effects on migration and invasion. Interestingly β-Catenin activity was positively regulated by the expression of NEDD9 and the activation of Src, but the canonical EMT Wnt targets Snail, Slug, and Twist were not elevated. These results lead us to believe that NEDD9 is a driving force in migration and invasion by facilitating FAK/Src binding and activation of Src kinase.

13 2.2 Introduction Hexavalent chromium (Cr(VI)) compounds are confirmed human carcinogens by the International Agency for Research on Cancer (IARC) and U.S. Environmental Protection Agency (EPA) [67]. Chronic exposure of human bronchial epithelial (BEAS- 2B) cells to low dose of Cr(VI) induced malignant cell transformation. Our previous studies have demonstrated that those Cr(VI)-transformed cells exhibit reduced capacity of generating reactive oxygen species (ROS) and increased angiogenesis, contributing to tumorigenesis of Cr(VI)-transformed cells [26, 68, 69]. However, the mechanism of aggressiveness of those Cr(VI)-transformed cells is still unknown. This study investigated the underlying mechanism of migration, invasion, and metastasis of Cr(VI)-transformed cells. Neural precursor cell expressed developmentally down-regulated protein 9 (NEDD9) is a scaffolding protein that belongs to the CAS family of adaptor proteins [54, 70]. Growing evidence indicated that NEDD9 is upregulated in cancer and may be linked with other diseases as well [6, 36, 71-79]. Elevated NEDD9 expression has been associated with cancer progression in multiple cancer types including to lung [71], breast [72], melanoma [73, 74], colon [75], liver [36], pancreatic [76, 77], prostate [78], and kidney [79]. NEDD9 facilitates the assembly of many complexes involved in oncogenic signaling. These oncogenic signaling pathways are vitally important in cancer progression. Some of the most important pathways mediated by NEDD9 include Src oncogenic pathways, focal adhesion, checkpoints, lamellipodia formation, and immune control [80]. Inhibition of NEDD9 expression causes a dramatic decrease in tumor size and number and reduces aggressiveness [79-81]. There is evidence that NEDD9 interacts with key focal adhesion molecules to increase cellular invasion and metastasis [34][35, 36]. Focal adhesion kinase (FAK) is a non-receptor tyrosine kinase that regulates cellular adhesion at the basal lamina and increases motility, proliferation, and cell survival in cancer [37]. FAK is initially phosphorylated at Y397 which allows for further activation and the FAK/Src complex is born. [37]. Src is a non-receptor tyrosine kinase belonging to a larger family of homologs with the collective name Src family kinase (SFK). Formation of the FAK/Src complex increases Src activation commonly signified by phosphorylation at Y416 [38, 39]. Active

14 Src kinase increases invasion and metastasis by activating multiple downstream targets including signal transducers for proliferation, cell growth, cell survival, differentiation, cell shape, motility, migration and angiogenesis [40]. NEDD9 is known to interact with FAK and Src, however; the exact mechanism of this critical interaction has been disputed. It has been reported that NEDD9 was the downstream of FAK/Src complex and its upregulation was dependent on Src activation [41] or FAK activation [42]. It has also been reported that NEDD9 was an upstream event of FAK, Src and other effectors [36, 43, 44]. Thus, some researchers suggest a positive feedback loop between NEDD9 and FAK or Src [34]. Additionally, recent studies have shown linkages between NEDD9 and β-Catenin or E-cadherin may also be a major role in NEDD9-mediated aggressiveness [44, 75]. This would indicate that NEDD9 is vital for both basal laminal adhesion and cell adhesion junctions, placing NEDD9 as a critical focal point in cancer cell survival and aggressiveness. However, the mechanism by which these pathways converge is still unknown. Canonically, phosphorylated β-Catenin regularly destroyed by the destruction complex adenomatous polyposis coli (APC), Axin, casein kinase 1 (CK1), protein phosphatase 2A (PP2A), Ser/Thr kinases glycogen synthase kinase 3β (GSK-3β), and β- transducin repeats-containing proteins (β-TrCP) which ubiquitinates β-Catenin for proteasomal degradation [83]. In many cancers when Wnt signaling is activated, non- phosphorylated β-Catenin pools in the cytosol and nucleus to upregulate genes associated with TCF/LEF enhancing cell survival, and at times causing a stem-like phenotypes. Active GSK-3β is a critical kinase in the β-Catenin destruction complex that phosphorylates β- Catenin in preparation for ubiquitination via the E3 ubiquitin ligase β-TrCP. Reduction of GSK-3β can lead to overexpression and pooling of β-Catenin [84, 85]. Reduced E-Cadherin is a recognized marker of cancer progression. E-Cadherin interacts with β-Catenin in cell junctions and it is reduced in aggressive and metastatic tumors [86]. As part of the normal cellular adhesion process, E-Cadherin negatively regulates β-Catenin signaling by sequestering β-Catenin to the cell surface and preventing the Wnt signaling cascade [87]. The loss of E-cadherin causes morphologic changes such as cell-cell recognition, remodeling of the , and loss of surface adhesion [87]. The present study investigates the mechanism of NEDD9 as a key regulator in FAK/Src

15 and Wnt/β-Catenin/E-Cadherin signaling that exacerbates migration, invasion and metastasis in Cr(VI)-transformed cells. 2.3 Methods 2.3.1 Chemicals and Reagents Dulbecco’s Modified Eagle Medium (DMEM), Opti-MEM, fetal bovine serum

(FBS), Lipofectamine 3000, Oligo(dT)20 and puromycin were purchased from Invitrogen (Valencia, CA). HuSH pGFP-V-RS shNEDD9 plasmid was purchased from OriGene (Rockville, MD). Src plasmid was purchased from Addgene and created by Dr. Yamaki [88]. The dual site inhibitor SrcI1 was purchased from Sigma-Aldrich (St Louis, MO). β- Catenin inhibitor IWP4 was purchased from Tocris (Minneapolis, MN). Antibodies against NEDD9, Src, p-Src (Y416), FAK, β-Catenin, non-p-β-Catenin (active), GSK-3β, and p-GSK-3β (21/9) were purchased from Cell Signaling Technologies (Beverly, MA). Antibodies against GAPDH, E-Cadherin, and p-GSK-3β (279/216) were purchased from Santa Cruz (San Diego, CA). Antibodies against p-FAK (Y397) were purchased from Millipore. Secondary mouse, rabbit, and goat antibodies were purchased from Sera Care (Milford, MA). Enhanced chemiluminescence reagent was purchased from GE Healthcare. RNeasy mini kit was purchased from Qiagen (Valencia, CA). Moloney murine leukemia virus (M-MLV) reverse transcriptase and Serine-threonine GSK3-β Kinase Assay kit were purchased from Promega (Madison, WI). qScript cDNA synthesis kit and Perfecta SYBR Green Supermix were purchased from Quanta Biosciences (Gaithersburg, MD). Human Soluble E-Cadherin ELISA kit was purchased from Aviscera Bioscience (Santa Clara, CA). 2.3.2 Cell Culture Human bronchial epithelial (BEAS-2B) cells were purchased from American Type Culture Collection (Rockville, MD). The cells were maintained in DMEM media with 10% fetal bovine calf serum (FBS) and 1% penicillin-streptomycin. Cr(VI)- transformed cells were generated by chronic exposure of BEAS-2B cells to a low dose of Cr(VI). Fresh media were added every 3 days for 24 weeks. Single colonies were isolated using a Soft Agar assay as previously described [26] and continued to grow. Those cells are considered as Cr(VI)-transformed cells. Passage matched normal BEAS-2B cells without Cr(VI) exposure were used as control.

16

2.3.3 Stable NEDD9 knockdown cells Cr(VI)-transformed BEAS-2B cells were seeded at 2 x 106 cells in 10cm cell culture dishes. The cells were transfected with NEDD9 shRNA plasmids using Lipofectamine 3000 in Opti-MEM. After selection with puromycin for 3 weeks, the single clones were isolated and NEDD9 level was confirmed by immunoblotting analysis. 2.3.4 Immunoblotting analysis Whole cell lysate was prepared in RIPA buffer. The protein concentration was assessed using Bradford protein assay at absorbance 595 nm measured on iMark microplate reader (Bio-Rad). Proteins were separated by SDS-PAGE using 10% acrylamide gels followed by overnight incubation in primary antibodies. The blots were then re-probed with secondary antibodies conjugated to horseradish peroxidase. Proteins were visualized using an enhanced chemiluminescence kit. 2.3.5 Immunoprecipitation Briefly, 500 μg of whole cell lysate was pre-cleared with protein G beads at 4°C for 1 hour. The supernatant was incubated in primary antibodies overnight. Protein G beads were added and the targeted protein complexes were precipitated using centrifugation. Protein complexes were analyzed with immunoblotting techniques. 2.3.6 Real time PCR Briefly, RNA was extracted and purified using Qiagen RNeasy mini kit. cDNA

synthesis was performed using Oligo(dT)20 and M-MLV reverse transcriptase. Primers were designed using Primer-Blast with forward sequence (F) and reverse (R) as follows: NEDD9: F-CCCATCCAGATACCAAAAGGACG, R- CACTGGAACTGAAAACACAGGGC GAPDH: F- GTCTCCTCTGACTTCAACAGCG, R-ACCACCCTGT TGCTGTAGCCAA ECadherin: F-GCCTCCTGAAAAGAGAGTGGAAG, RTGGCAGTGTCTCTCCAAATCCG Real time PCR was performed using Perfecta SYBR Green Supermix (Bio-Rad) and the data were analyzed using CFX Manager software (Bio-Rad).

17 2.3.7 Migration and Invasion assays Migration and invasion assays were performed using transwell chambers from Corning. Cells were seeded in serum free media at 8 x 104 cells per chamber with pre- warmed Matrigel coating (invasion) and without Matrigel coating (migration). Chambers were inserted into a 24-well plate containing 20% FBS for 24 hours. The migrated or invaded cells were stained with crystal violet and counted using microscope (Olympus). 2.3.8 ELISA assay Soluble E-Cadherin was detected using a human soluble E-Cadherin ELISA assay kit according to manufacturer instructions. Briefly, 200 μL of supernatant from the cells was added to the wells and incubated for 24 hours. Next biotin and streptavidin were added. TMB One-Step substrate (3,3’,5,5’-tetramentylbenzidine) was added for detection with horseradish peroxidase. The absorbance was measured using iMark microplate reader (Bio-Rad) at 450 nm. 2.3.9 Kinase activity assay GSK-3β kinase activity was analyzed using Serine-threonine GSK3-β Kinase Assay. Briefly, whole cell lysates were prepared in RIPA buffer and incubated with GSK-3β substrate and ATP in 96-well plates. ADP-Glo was added to stop the kinase reaction and to deplete all unconsumed ATP. ADP luminescent detection reagent was added to generate thermostable luciferase. The luminescence was measured by chemiluminescence using Spectra Max GEMINI microplate reader (Molecular Devices). 2.3.10 In vivo tail vein injection assay 6-week-old female athymic nude mice were purchased from The Jackson Laboratory (Bar Harbor, ME). The animals were handled in accordance to the institutional animal care and use committee (IACUC) guidelines and housed in the Chandler Medical Center, University of Kentucky. 0.5 x 106 cells suspended in 150 μL of PBS were injected into the lateral tail vein. At 8 weeks of post injection, mice were

euthanized using CO2 and lungs were isolated. 2.3.11 Statistical analysis Data were expressed as the mean ± standard deviation. Statistical significance of differences between treatment groups was determined by ANOVA when there were

18 multiple independent variables, and Student’s t-test when there was a single variable. Α p < 0.05 was considered statistically significant. 2.4 Results 2.4.1 Upregulation of NEDD9 in Cr(VI)-transformed BEAS-2B cells. Our previous studies have shown that chronic exposure to Cr(VI) causes malignant cell transformation in human bronchial epithelial BEAS-2B cells [26]. These transformed cells exhibit reduced ROS generation and resistance to apoptosis, resulting in increased angiogenesis and tumorigenesis . The present study examines the mechanism of migration and invasion of Cr(VI)-transformed cells. To investigate aggressiveness of these Cr(VI)-transformed cells, a known gene important in migration and invasion was examined. Emerging evidence has suggested that neuronal precursor developmentally down-regulated 9 (NEDD9) is a critical mediator for increased migration, invasion and metastasis [34, 42, 44, 71, 75, 78, 80, 92]. The NEDD9 level in Cr(VI)-transformed cells was measured to see if this scaffolding protein was upregulated in Cr(VI)-transformed cells. The results from Immunoblotting analysis showed that the NEDD9 level was elevated in Cr(VI)-transformed cells (Figure 1A). The results from RT-PCR showed that NEDD9 mRNA level was increased 2.9-fold in Cr(VI)-transformed cells compared to that in passage-matched normal cells (Figure 1B). These results demonstrate that NEDD9 protein and mRNA levels were increased in Cr(VI)-transformed cells. 2.4.2 Knockdown of NEDD9 reduces migration and invasion in Cr(VI)-transformed cells. The scaffolding protein NEDD9 along with other Cas family proteins have been shown in the literature to increase cellular migration and invasion through several different mechanisms [79]. Next, we investigated whether upregulation of NEDD9 is involved in migration and invasion in Cr(VI)-transformed cells. Stable NEDD9 knockdown in Cr(VI)-transformed cells were established. NEDD9 level was measured and the results showed that NEDD9 was markedly reduced in NEDD9 knockdown cells (shNEDD9) compared to that in Cr(VI)-transformed scramble cells (Figure 2A). The results from the Boyden chamber assay showed a 41% decrease in NEDD9 knockdown cells compared to that in Cr(VI)-transformed scramble cells (Figure 2B). Likewise, the results from the invasion assay showed a 73% decrease in NEDD9 knockdown cells

19 compared to that in Cr(VI)-transformed scramble cells (Figure 2C). These results demonstrated that NEDD9 is important in the migration and invasion of Cr(VI)- transformed cells. There was no significant difference in cell proliferation between Cr(VI)-transformed cells and shNEDD9 cells (data not shown). 2.4.3 Knockdown of NEDD9 reduces metastasis in vivo. To study if upregulation of NEDD9 positively regulated metastasis of Cr(VI)- transformed cells, Cr(VI)-transformed cells with or without NEDD9 knockdown were injected into the tail vein of athymic nude mice. Tail vein injections are a well- established approach used in metastasis research with a quicker outcome than subcutaneous or specific site injections [93]. Multiple metastatic tumors were found in the lungs of the animals injected with Cr(VI)-transformed cells (Figure 3A). All six animals injected with Cr(VI)-transformed cells that made it to the endpoint developed tumors in the lungs. 1-59 visible tumors were observed on each lung of the mice injected with Cr(VI)-transformed cells. Among the animals injected with NEDD9 knockdown cells (Figure 3B), 3 animals did not grow visible tumors and 4 grew 1-2 visible tumors on the lungs. Besides the metastatic tumors in the lungs, multi-tumors were observed in the liver of animals injected with Cr(VI)-transformed cells (data not shown). These results demonstrated that NEDD9 is a positive regulator of aggressiveness in vivo of Cr(VI)- transformed cells. 2.4.4 Upregulation of NEDD9 increases aggressiveness by facilitating FAK/Src binding and active Src (Y416). To understand the mechanisms of NEDD9 in regulation of migration and invasion of Cr(VI)-transformed cells, several commonly associated binding partners of NEDD9 were evaluated. The ability of NEDD9 to bind with FAK and Src has been shown to cause increased aggressiveness phenotypes in some cancers, and we examine if this may be true in Cr(VI)transformed BEAS-2B cells. The results from immunoblotting showed that expressions of both FAK and p-Src Y416 were increased in Cr(VI)-transformed cells (Figure 4A). Knockdown of NEDD9 by its shRNA reduced FAK and the phosphorylation of Src (Figure 4A). The results from the co-IP assay showed that binding of NEDD9 with FAK (Figure 4B) and with Src (figure 4C) was increased in Cr(VI)- transformed cells. Co-IP revealed that binding of FAK with Src in Cr(VI)-transformed

20 cells was increased (Figures 4D). Knockdown of NEDD9 by its shRNA dramatically reduced the binding of FAK with Src (Figure 4D). These results demonstrate that NEDD9 is a vital component of FAK and Src interaction and subsequent Src activation. 2.4.5 Upregulation of NEDD9 increases aggressiveness by increasing active non- phosphorylated β-Catenin through GSK-3β activity. β-Catenin interacts with cadherin molecules in adhesion junctions [94]. Loss of E- Cadherin and release of β-Catenin is commonly observed in anchorage independent cancer cell [94]. The results showed that Full length E-Cadherin was increased as we would expect in BEAS-2B cells, and reduced in Cr(VI)-transformed cells (Figure 5A). The mRNA levels were significantly decreased in Cr(VI)-transformed cells compared to those in passage-matched normal BEAS-2B cells (Figures 5B). However, inhibition of NEDD9 by its shRNA did not alter E-Cadherin protein or mRNA levels (Figures 5A and 5B). Interestingly, cleaved E-Cadherin was much higher in Cr(VI)-transformed cells and significantly reduced by NEDD9 knockdown (Figure 5A). Cleaved E-Cadherin functions as a paracrine signaling ligand or an intracellular signaling molecule to promote cancer cell motility, invasion [53] and activation of β-Catenin [95]. This cleaved form of E- Cadherin can be either soluble or intracellular. To discern which cleaved fragment is expressed, an ELISA assay was performed to measure soluble E-Cadherin excreted from the cells (Figure 5C). There was no significant difference of soluble E-Cadherin between Cr(VI)-transformed cells and passage-matched normal cells which implies the observed cleaved E-Cadherin are intracellular fragments (Figure 5C). Next, β-Catenin was measured. Active β-Catenin was elevated in Cr(VI)-transformed cells and knockdown of NEDD9 reduced active β-Catenin (Figure 5D). GSK-3β is a negative regulator for β- Catenin in the β-Catenin destruction complex. The results showed that both GSK-3β phosphorylation (Figure 5D) and kinase activity (Figure 5E) were reduced in Cr(VI)- transformed cells compared to those in passage-matched BEAS-2B cells. Inhibition of NEDD9 by its shRNA increased GSK-3β phosphorylation and kinase activity (Figures 5D and 5E). These results demonstrate that NEDD9 negatively regulates GSK-3β kinase activity, therefore positively regulated β-Catenin, and that Cleaved E-Cadherin seems to pool in Cr(VI)transformed cells having possible effects on the role of β-Catenin in cellular signaling.

21

2.4.6 Src and β-Catenin are downstream targets of NEDD9 in regulation of migration and invasion in Cr(VI)-transformed cells. To explore whether NEDD9 regulates migration and invasion through Src and β- Catenin, Src and β-Catenin were inhibited using the gold standard c-Src inhibitor SrcI1 and the potent Wnt/β-Catenin inhibitor IWP4. Interestingly, active non-phosphorylated β- Catenin was significantly decreased in response to both β-Catenin and Src inhibition (Figure 6A). As expected, active p-Src (Y416) was decreased when treated with SrcI1 (Figure 6A). Cr(VI)-transformed cells treated with either SrcI1 or IWP4 exhibited significantly reduced migration and invasion (Figures 6B and 6C). To confirm that Src was downstream of NEDD9 in the processes of migration and invasion, Src was transfected into NEDD9 knockdown Cr(VI)-transformed cells (Figure 6D). Forced expression of Src increased migration and invasion in Cr(VI)-transformed cells with NEDD9 knockdown (Figures 6E and 6F). These results suggested that both Src and β- Catenin are involved in migration and invasion of Cr(VI)-transformed cells. The decrease in β-Catenin when treated with SrcI1 is indicative of cross talk between the Src and β- Catenin signaling pathways. 2.4.7 Scheme of mechanism of aggressiveness in Cr(VI)-transformed cells. Exposure to Cr(VI) causes malignant cell transformation. These transformed cells have a characteristic decrease of C-PARP and Bax, and increase of Bcl-2, Bcl-xL, and active EGFR. A stable Cr(VI)-transformed cell line was generated from a single clone. These Cr(VI)-transformed cells exhibit increased NEDD9. This increase of NEDD9 facilitated activation of Src kinase, and FAK-Src binding. NEDD9 was able to increase active β-Catenin in these chromium transformed cells likely by reducing GSK-3β kinase activity. There was an elevation of cleaved E-Cadherin which was likely involved in β- Catenin activity and pooling in the cytosol. NEDD9 mediates migration and invasion through Src and β-Catenin in Cr(VI)-transformed cells.

22 2.5 Discussion Cr(VI) exposure has long been known to have carcinogenic effects [67] with strong epidemiologic evidence [7, 96, 97]. Although great progress in understanding mechanisms of Cr(VI) has been made, the mechanism of aggressiveness of Cr(VI)- transformed cells is largely unknown. Our previous study demonstrated that Cr(VI)- transformed cells are tumorigenic [26]. The present study intended to investigate (1) whether migration and invasion are increased in Cr(VI)-transformed cells and (2) what is the mechanism to cause increased migration and invasion of Cr(VI)-transformed cells. This study provided new insights into aggressiveness of Cr(VI)-transformed cells by focusing on cross-talk between the FAK/Src and the Wnt signaling pathways. Our results of NEDD9 upregulation in Cr(VI)-transformed cells agree with previous reports that NEDD9 acts as upstream of FAK and Src kinase [34, 72, 98]. However, several studies indicated that NEDD9 is downstream of FAK and Src [41, 99]. Thus, a positive feedback loop between NEDD9 and FAK or Src activation through phosphorylation was proposed [34]. In Cr(VI)-transformed cells, the presence of NEDD9 is essential for FAK/Src binding as demonstrated by the results in Figure 4D. The direct binding of NEDD9 with FAK and Src, and the inhibition FAK/Src complex when NEDD9 is knocked down indicates that the order of action is NEDD9/FAK/Src or NEDD9/Src/FAK with downstream effects inducing cellular migration and invasion. The interaction between FAK and Src is a common point of convergence for adhesion and extracellular matrix signaling in cancer [38]. Active FAK and Src most often leads to more aggressive tumors [100]. Indeed, FAK and Src are elevated in Cr(VI)- transformed cells, but our results suggested that NEDD9 is vitally important upstream of FAK and Src interaction. It has been reported that Y397 is the primary autophosphorylation site for FAK activation and opening the Src binding pocket for Src phosphorylation at Y416 and further activation of both FAK and Src [101]. The phosphorylation of Src at Y416 was nearly obliterated when NEDD9 was knocked down. It was reported that NEDD9 binds to FAK and Src via the SH3 domain in the N-terminal and SH2 in the serine-rich four helix bundle of the C-terminal domain of NEDD9 [39, 54, 102-105]. Our data showed consistent binding between NEDD9 with FAK, and NEDD9 with Src. FAK has 6 major tyrosine phosphorylation sites, 397, 407, 576, 577, 861, and

23 925 [106]. Phosphorylation of tyrosine 397 opens a binding site for Src SH2 domain and promotes association of Src and FAK [107]. After this initial step, Src can then phosphorylate the additional tyrosine sites to fully active FAK [106]. Our results showed the binding between FAK and Src was NEDD9 dependent. There are two mechanisms for cell migration and invasion in cancer cells, mesenchymal and amoeboid invasion [82]. Previous studies suggested that NEDD9 is associated with the mesenchymal type migration by acting as a scaffolding protein for FAK/Src signaling and β-integrin interactions to pull the cell through the extracellular matrix [80, 82]. Our results suggest that there is indeed direct binding between NEDD9 and FAK, and a characteristic decrease in E-Cadherin and increased β-Catenin expression which is commonly seen in epithelial to mesenchymal transition (EMT). [83]Canonically, phosphorylated β-Catenin is associated with APC, Axin, CK1, PP2A, GSK-3β, and β- TrCP which then ubiquitinated β-Catenin for proteasomal degradation [83]. In many cancers and when Wnt signaling was activated, non-phosphorylated β-Catenin pools in the cytosol and nucleus to upregulate genes associated with TCF/LEF. Interestingly, other EMT markers such as Snail, Slug, and Twist protein levels were decreased Cr(VI)- transformed cells compared to those in passage-matched normal cells (data not shown). The question remains why some EMT markers are increased and others are decreased in Cr(VI)-transformed cells. It is likely that activated β-Catenin in Cr(VI)-transformed cells is important for increased migration and invasion, but not as a with TCF/LEF for Snail, Slug and Twist transcription as seen in classical Wnt/β-Catenin driven EMT [108-110]. E-Cadherin complexes with β-Catenin in normal cellular adhesion junctions [53, 111]. When E-Cadherin expression is lost β-Catenin is released and activates Wnt signaling associated with cancer survival, proliferation, and migration [112]. Cr(VI)- transformed exhibited decreased E-Cadherin, increased cleaved E-Cadherin, and increased active non-phosphorylated β-Catenin. It is likely that intracellular cleaved E- Cadherin is still interacting with β-Catenin to some extent to prevent β-Catenin translocation to the nucleus but allow pooling of β-Catenin and facilitating interactions with proteins close to the cell surface. Previously, active β-Catenin has been observed to accumulate near the cell surface in E-Cadherin knockout conditions but the mechanism

24 for recruitment to the plasma membrane had not been discover [113]. It is possible that interaction with intracellular cleaved E-cadherin is an important factor in β-Catenin recruitment to the plasma membrane. Our results showed GSK-3β kinase activity was reduced in Cr(VI)-transformed cells and increased when NEDD9 was knocked down (Figures 4H and 4I). These results indicate that NEDD9 regulates β-Catenin through GSK-3β. Our results demonstrated the possibility for cross-talk between Src and β-Catenin (Figure 5A). If this crosstalk is significant it will likely be important in multiple diseases including diabetes, cancer, and bipolar disease [114, 115]. There are still many open questions for the importance of NEDD9 in other diseases such as Parkinson’s, Alzymer’s, hypertension, and pulmonary disease [116, 117]. Further investigation is needed to uncover the exact link between NEDD9/FAK/Src and Wnt/β-Catenin signaling pathways.

25

26 Figure 2.1 Upregulation of NEDD9 in Cr(VI)-transformed BEAS-2B cells.

A. Whole cell lysates from BEAS-2B and Cr(VI)-transformed cells were collected for immunoblotting analysis. B. NEDD9 mRNA levels from BEAS-2B and Cr(VI)- transformed cells were analyzed using real time PCR. *, p < 0.05 compared to passage- matched BEAS-2B cells. These results represent three independent repeats.

27

28 Figure 2.2 Knockdown of NEDD9 reduces migration and invasion in Cr(VI)- transformed cells.

A. Cr(VI)-transformed cells with or without NEDD9 knockdown were grown in cell culture medium. Whole cell lysates were collected and subjected to immunoblotting analysis. B. Cr(VI)-transformed cells with or without NEDD9 knockdown were grown in cell culture medium. Migration assay was performed. C. Cr(VI)-transformed cells with or without NEDD9 knockdown were grown in cell culture medium. Invasion assay was performed. *, p < 0.05 compared to Cr(VI)-transformed cells. These results represent three independent repeats.

29

30

Figure 2.3 Knockdown of NEDD9 reduces metastasis in vivo.

Cr(VI)-transformed cells with or without NEDD9 knockdown were injected intravenously into the lateral vein of 6-week-old nude mice. Mice were sacrificed after 8 weeks and lungs were isolated. Pictures of lungs were captured and tumors were counted. n=8 for each group, 2 mice injected with Cr(VI)-transformed cells were lost before the endpoint, and 1 mouse injected with knockdown cells was lost before the endpoint. *, p < 0.05 compared to Cr(VI)-transformed cells.

31

32 Figure 2.4 Upregulation of NEDD9 increases aggressiveness by facilitating FAK/Src binding and active Src (Y416).

A. BEAS-2B cells and Cr(VI)-transformed cells with or without NEDD9 knockdown were harvested for immunoblotting analysis. B. Protein lysate was collected from BEAS- 2B cells and Cr(VI)-transformed cells and immunoprecipitation was performed for FAK and NEDD9 binding. C. Protein lysate was collected from BEAS-2B cells and Cr(VI)- transformed cells and immunoprecipitation was performed for Src and NEDD9 binding. D. Protein lysate was collected from BEAS-2B cells and Cr(VI)-transformed cells with or without NEDD9 knockdown and immunoprecipitation was performed for FAK and Src binding. These results represent three independent repeats.

33

34 Figure 2.5 Upregulation of NEDD9 increases aggressiveness by increasing active non-phosphorylated β-Catenin through GSK-3β activity.

A. Protein lysate was collected from BEAS-2B cells and Cr(VI)-transformed cells for immunoblotting analysis. B. E-Cadherin mRNA levels from BEAS-2B cells and Cr(VI)- transformed cells with or without NEDD9 knockdown were measured using real time PCR. C. Cell culture medium from BEAS-2B cells and Cr(VI)-transformed cells with or without NEDD9 knockdown were collected for measurement of soluble E-Cadherin. D. Whole cell lysates were collected from BEAS-2B cells and Cr(VI)-transformed cells with or without NEDD9 knockdown for immunoblotting analysis. E. Kinase assay was used to detect GSK-3β kinase activity. * and #, p < 0.05 compared to BEAS-2B cells and Cr(VI)- transformed cells, respectively. These results represent three independent repeats.

.

35

36 Figure 2.6 Src is a downstream target of NEDD9 in regulation of migration and invasion in Cr(VI)-transformed cells.

A-C. Cr(VI)-transformed cells were pretreated with 10 μM of Src1, 30 μM of IWP4, or their combination for one hour. Whole cell lysate was collected for immunoblotting analysis (A). Migration (B) and invasion (C) assays were performed. D-F. Cr(VI)- transformed cells with NEDD9 knockdown were transfected with Src expressing vector. Cr(VI)-transformed cells with or without NEDD9 knockdown or with Src overexpression as indicated were subjected to immunoblotting analysis (D), migration (E) and invasion (F) analysis. * and #, p < 0.05 compared to Cr(VI)-transformed cells and Cr(VI)- transformed cells with NEDD9 knockdown, respectively. These results represent three independent repeats.

37

38 Figure 2.7 Scheme of mechanism of aggressiveness in Cr(VI)-transformed cells.

Chronic exposure of human bronchial epithelial cells to low dose of Cr(VI) causes malignant cell transformation. In those Cr(VI)-transformed cells expressions of NEDD9, Src, β-Catenin, and C-E-Cadherin were elevated. NEDD9 acts as an upstream of Src, β- Catenin, and C-E-Cadherin. The signaling of NEDD9/Src/β-Catenin positively regulates migration, invasion, and metastasis of Cr(VI)-transformed cells.

39 CHAPTER 3. UPREGULATION OF NEDD9 PROMOTES ANGIOGENESIS BY INCREASING HIF-

1 TRANSCRIPTIONAL ACTIVITY IN CHROMIUM(VI)-TRANSFORMED BRONCHIAL

𝛼𝛼 EPITHELIAL CELLS 3.1 Abstract Hexavalent Chromium (Cr(VI)) is a group one carcinogen, as defined by International Agency for Research and Cancer (IARC). Once inside the cell Cr(VI) is reduced to Cr(V), Cr(IV), and Cr(III) generating reactive oxygen species, carcinogenic DNA adducts, alterations in epigenetics, and changes in cell signaling. Neural precursor cell developmentally downregulated protein 9 (NEDD9) is a Cas family, scaffolding protein that is upregulated in Cr(VI)-transformed BEAS-2B cells. NEDD9 facilitates the assembly of many oncogenic signaling complexes. HIF-1α is the major inducible factor that responds quickly to changes in available oxygen levels in the cell. HIF-1α and HIF- 1β translocate to the nucleus as a dimer where they link up with their cofactors p300 and CBP and initiate gene transcription of VEGF and other critical genes for angiogenesis and erythropoiesis on the hypoxia response element (HRE). HUVEC cell tubes formed closed loop cell aggregates 42.8% more in those exposed to Cr(VI)-transformed cell serum than in those exposed to BEAS-2B cell serum and 28.4% less in those exposed to Cr(VI)-transformed knockdown NEDD9 cell serum. NEDD9 mediated the expression of PECAM/CD31 (PECAM) which is involved with motility and adhesion during angiogenesis, Angiopoietin 1 which is critical in vascular development and angiogenesis, VEGF which is important in growth, recruitment, and remodeling of vasculature, HIF-1α which is a major inducible transcription factor for angiogenesis, and p38 which is involved in VEGF activity and expression. An in vivo Matrigel plug assay showed that Cr(VI)-transformed cell plugs contained 13.6 fold more hemoglobin than BEAS-2B cell plugs and that Cr(VI)-transformed cell plugs contained 2.8 fold more hemoglobin than Cr(VI)-transformed knockdown NEDD9 cells. HIF-1α transcriptional activity in Cr(VI)- transformed cells was 6.1 fold increase compared to BEAS-2B cells and 34.3 fold increase compared to Cr(VI)-transformed knockdown NEDD9 cells. The transcriptional activity of HIF-1α is mediated by NEDD9 likely through CREB binding protein (CBP) by directing binding to CBP in the nucleus. Additionally, the presence of NEDD9 increases the activity of p38. Both of these will affect the production and secretion of VEGF and other factors which control angiogenesis and vasculature permeability. This understanding is beneficial and places NEDD9 as an important therapeutic target or biomarker for angiogenesis. 3.2 Introduction Hexavalent Chromium (Cr(VI)) is a group one carcinogen, as defined by International Agency for Research and Cancer (IARC). Occupational exposure to aerosolized Cr(VI) often accumulates in the bronchi, leading to increased risk for 2- aggressive lung cancer. Cr(VI) (CrO4 ) enters the cell through the sulfate channel and 2- 2- other nonspecific transporters due to its solubility and its similarities to SO4 and HPO4 [19]. Once inside the cell Cr(VI) is reduced to Cr(V), Cr(IV), and Cr(III) generating reactive oxygen species, carcinogenic DNA adducts, alterations in epigenetics, and changes in cell signaling. The literature has demonstrated with few exceptions that VEGF and angiogenic markers are upregulated in cells treated with Cr(VI) [33, 118, 119]. Neural precursor cell developmentally downregulated protein 9 (NEDD9) is a Cas family scaffolding protein that is upregulated in Cr(VI)-transformed BEAS-2B cells. NEDD9 is overexpressed in many aggressive cancer types including lung [71], breast [72], melanoma [73, 74], colon [75], liver [36], pancreatic [76, 77], prostate [78] and kidney [79]. NEDD9 facilitates the assembly of many oncogenic signaling complexes. The concentration of this paper will be angiogenesis, but NEDD9 has been implemented in focal adhesion, cell cycle checkpoints, lamellipodia formation, and immune control to name a few [80]. In this study we examine how NEDD9 is involved in angiogenesis in Cr(VI)- transformed BEAS-2B cells. NEDD9 was linked with hypoxia inducible factor-1α (HIF- 1α) which is the major inducible transcription factor in the production of angiogenic proteins [59]. It has been linked to MMP secretion and membrane protein recycling as a critical part of angiogenesis and invasion [120]. The depletion of Cas family proteins is accompanied by reduced Src activation and FAK/Src dependent angiogenesis [54]. In addition to these major factors NEDD9 has been linked with the activity of multiple small GTPases such as RhoA, Rock, Nck2, and Cdc42 which are required for the sprouting of new vasculature [55-58].

41 HIF-1α is the major inducible factor that responds quickly to changes in available oxygen levels in the cell. Under normoxia, HIF-1α is hydroxylated by the prolyl hydroxylase domain-containing (PHD) family proteins and associated with von hippel- lindau (VHL). This form of HIF-1α is ubiquitinated and sent to the for degradation. In the absence of oxygen PHD1 and PHD3 are degraded and HIF-1α is set free. HIF-1α and HIF-1β translocate to the nucleus as a dimer where they link up with their cofactors p300 and CBP and initiate gene transcription of VEGF and other critical genes for angiogenesis and erythropoiesis on the hypoxia response element (HRE) [121]. A tumor can only grow to be roughly 1-2 mm3 before there is a critical need for new vasculature. At this point the cells in the center of the tumor may start to necrose as the metabolic demands, nutrients, and oxygen become scarce. At this point hypoxia sets in, and HIF-1α is translocated to the nucleus as the initial stages of angiogenesis. In highly aggressive tumors HIF-1α is elevated as an important part of cell survival, growth, migration, and invasion [121, 122]. The proposal of this paper is to suggest a mechanism for Cr(VI)-transformed cell angiogenesis through NEDD9. NEDD9 was found to enhance HIF-1α transcriptional activity by interaction with the cofactor p300 in colon cancer cell lines LS174T, DLD-1, SW480, HCT-15, and SW620 [59]. We expect to find a similar response in Cr(VI)- transformed cells. 3.3 Materials and Methods 3.3.1 Chemicals and Reagents Dulbecco’s Modified Eagle Medium (DMEM), Opti-MEM, fetal bovine serum

(FBS), Lipofectamine 3000, Oligo(dT)20 and puromycin were purchased from Invitrogen (Valencia, CA). HuSH pGFP-V-RS shNEDD9 vector was purchased from OriGene (Rockville, MD). Antibodies against NEDD9 was purchased from Cell Signaling Technologies (Beverly, MA). GAPDH was purchased from Santa Cruz (San Diego, CA). Secondary mouse and rabbit were from Sera Care (Milford, MA). Enhanced chemiluminescence reagent was from GE Healthcare. RNeasy mini kit was purchased from Qiagen (Valencia, CA). qScript cDNA synthesis kit and Perfecta SYBR Green Supermix were from Quanta Biosciences (Gaithersburg, MD).

42 3.3.2 Cell Culture Human bronchial epithelial (BEAS-2B) cells were purchased from American Type Culture Collection (Rockville, MD). Cells were incubated at 37 °C and 5% CO2. DMEM was supplemented with 10% FBS and 1% penicillin-streptomycin. Cells were passaged when cell density reached 80% confluency or less. Cr(VI)-transformed cells were generated as previously described by chronic low dose exposure of Cr(VI) to BEAS-2B cells [26]. 3.3.3 Stable NEDD9 knockdown cells Cr(VI)-transformed BEAS-2B cells were seeded at 2 x 106 cells in 10cm cell culture dishes. The cells were transfected with NEDD9 shRNA plasmids using Lipofectamine 3000 in Opti-MEM. After selection with puromycin for 3 weeks, the single clones were isolated and NEDD9 levels were confirmed using immunoblotting. 3.3.4 Immunoblotting analysis Whole cell lysate was prepared using RIPA buffer. The protein concentration was quantified by the Bradford protein assay measuring absorbance at 595 nm using iMark microplate reader (Bio-Rad). The proteins were separated by SDS-PAGE and probed for targets overnight in primary antibody incubation at 4°C. The blots were re-probed with secondary antibodies conjugated to horseradish peroxidase. Protein bands were visualized using an enhanced chemiluminescence kit. 3.3.5 Real-time PCR RNA was extracted and purified using Qiagen RNeasy mini kit. The cDNA was

synthesized by using Oligo(dT)20 and M-MLV reverse transcriptase. Primers were designed based on Primer-Blast with the following sequences forward (F) and reverse (R). GAPDH: F-GTCTCCTCTGACTTCAACAGCG R-ACCACCCTGTTGCTGTAGCCAA HIF-1α: F-GGCGCGAACGACAAGAAAAAG R-CCTTATCAAGATGCGAACTCACA Real time PCR was performed with Perfecta SYBR Green Supermix (Bio-Rad) and the data were analyzed with CFX manager software (Bio-Rad).

43 3.3.6 ELISA Soluble VEGF was detected using human VEGF ELISA assay kit. Briefly, 200 μL of supernatant from the cells was added to each well and incubated for 24 hours. Biotin and streptavidin were added. 3,3’, 5,5’-tetramentylbenzidine substrate (TMB One- Step) was added for detection with horseradish peroxidase. Absorbance was measured using iMark microplate reader (Bio-Rad) at 450 nm. 3.3.7 Luciferase Cells were seeded at 1.5 x 106 in 10 cm dishes. The cells were transfected with HIF-1α reporter from Panomics. After 48 hours post transfection the cells were lysed in luciferase cell lysis Buffer. Samples were normalized to protein level using a Bradford assay and 20 μL was added to each well. 100 μL of luciferase assay substrate was added by the plate reader to each well and the luminescence was quantified. 3.3.8 CAM assay Fertilized eggs were received from the University of Kentucky Poultry Research Facility. They were incubated at 37°C. On day four the CAMs were transferred to flasks where they continued to grow until day ten. On day ten each embryo was given two onplants with Cr(VI)-transformed cells and two onplants with Cr(VI)-transformed shNEDD9 cells. The onplants were made from 64% Collagen Type II rat tail, 8% 10x MEM, 8% NaOH, and 20% cells 1.5 x 104 in PBS. Photos were taken each day and onplants were analyzed four days post deployment. 3.3.9 Tube formation assay HUVEC cells were purchased from American Type Culture Collection (Rockville, MD). HUVEC cells were cultured in endothelial cell basal medium-2 supplemented with 10% FBS and 1% penicillin-streptomycin. BEAS-2B cell, Cr(VI)- transformed cell, and Cr(VI)-transformed knockdown NEDD9 cell serum was extracted after 48 hours and applied to the HUVEC medium. 3.3.10 In vivo tumorigenesis and angiogenesis assays 6-week-old female athymic nude mice were purchased from The Jackson Laboratory (Bar Harbor, ME). The animals were handled according to the institutional animal care and use committee (IACUC) guidelines and housed in the Chandler Medical Center, University of Kentucky.

44 3.3.11 Statistical analysis Data were expressed as the mean ± the standard deviation. Statistical significance of the difference between means was determined by ANOVA for multiple independent variables, and by Student’s t-test for single variables. A p < 0.05 was considered to be statistically significant. 3.4 Results 3.4.1 Angiogenesis is increased in Cr(VI)-transformed BEAS-2B cells. To explore angiogenesis in hexavalent chromium (Cr(VI)) transformed cells, new tube formation was measured. BEAS-2B cells and Cr(VI)-transformed cells were grown to 80% confluency and the serum from those cells was added to human umbilical vein endothelial cells (HUVEC). Tubes formed closed loop cell aggregates in those HUVEC cells exposed to Cr(VI)-transformed cell serum 42.8% more than in those cells exposed to BEAS-2B cell serum (Figure 1A). To further solidify our understanding of Cr(VI)- transformed cell angiogenesis an ex ovo Chick Chorioallantoic Membrane (CAM) assay was performed. CAMs were transferred to a dish on day 4 and incubated at 37°C. On day 10 two onplants were added to the CAMs, one harboring BEAS-2B cells while the other harbored Cr(VI)-transformed cells. Images were taken on day 10, 11, 12, 13, and 14 and the vasculature recruited into each onplants was quantified on day 14. A 2.0 fold increase in vascular formation was found in the Cr(VI)-transformed cell onplants Figure 1B). Next, angiogenic protein markers were analyzed by western blot. There was an increased expression of PECAM/CD31 (PECAM) which is involved with motility and adhesion during angiogenesis, Angiopoietin 1 which is critical in vascular development and angiogenesis, VEGF which is important in growth, recruitment, and remodeling of vasculature, and HIF-1α which is a major inducible transcription factor for angiogenesis (Figure 1C). The protein kinase p38 has been found to upregulate several of these angiogenic factors. To see if p38 might be involved in Cr(VI)-transformed cell angiogenesis a western blot was performed. Phosphorylated p38 (T180/Y182) was increased dramatically in Cr(VI)-transformed cells (Figure 1D).

45 3.4.2 Inhibition of NEDD9 reduces angiogenesis in Cr(VI)-transformed cells. To explore the role of NEDD9 in hexavalent chromium (Cr(VI)) transformed cells angiogenesis, new tube formation was measured. Cr(VI)-transformed cells and Cr(VI)-transformed knockdown NEDD9 cells were grown to 80% confluency and the serum from those cells was added to human umbilical vein endothelial cells (HUVEC). Tubes formed closed loop cell aggregates in those HUVEC cells exposed to Cr(VI)- transformed cell serum 28.4% more than in those cells exposed to Cr(VI)-transformed knockdown NEDD9 cell serum (Figure 2A). To further study this phenomenon, an ex ovo Chick Chorioallantoic Membrane (CAM) assay was performed. CAMs were transferred to a dish on day 4 and incubated at 37°C. On day 10, two onplants were added to the CAMs, one harboring Cr(VI)-transformed cells while the other harbored Cr(VI)- transformed knockdown NEDD9 cells. Images were taken on day 10, 11, 12, 13, and 14 and the vasculature recruited into each onplants was quantified on day 14. A 39.7 fold decrease in vascular formation was found in the Cr(VI)-transformed knockdown NEDD9 cell onplants (Figure 2B). Next, angiogenic protein markers were analyzed by western blot. There was a decreased expression of PECAM, Angiopoietin 1, VEGF, and HIF-1α (Figure 2C). To see if p38 might be involved downstream of NEDD9, a western blot was performed. Phosphorylated p38 (T180/Y182) was increased dramatically in Cr(VI)- transformed knockdown NEDD9 cells (Figure 2D). To measure secreted VEGF an ELISA assay was performed. The results showed that Cr(VI)-transformed secreted 99.9% more VEGF than BEAS-2B cells, and that Cr(VI)-transformed cells secreted 49.6% more VEGF than Cr(VI)-transformed knockdown NEDD9 cells. 3.4.3 NEDD9 increases tumorigenesis and angiogenesis. To determine if NEDD9 is involved tumor formation in vivo a subcutaneous, mouse model was used. 4 x 106 cells were injected into the flanks of 2-week-old athymic nude mice. Tumors were harvested 7 weeks post injection. The results showed that Cr(VI)-transformed cells formed tumors that were 5.3 fold larger (Figure 3B) and 3.9 fold heavier (Figure 3C) than Cr(VI)-transformed knockdown NEDD9 cells (Figure 3A). The formation of much larger tumors may be due in large part to increased angiogenesis. To test whether Cr(VI)-transformed cells display greater angiogenesis in vivo a Matrigel plug assay was performed. 5 x 106 cells suspended in Matrigel and PBS were injected

46 into the flanks of 2-week-old athymic nude mice. Plugs were harvested after 10 days. Hemoglobin was quantified using Drabkin’s reagent. The results showed that Cr(VI)- transformed cell plugs contained 13.6 fold more hemoglobin than BEAS-2B cell plugs and that Cr(VI)-transformed cell plugs contained 2.8 fold more hemoglobin than Cr(VI)- transformed knockdown NEDD9 cells (Figure 3D and 3E). 3.4.4 NEDD9 increases angiogenesis by mediating HIF-1α transcriptional activity. HIF-1α transcriptional activity is arguably the most important step for angiogenesis in cancer cells. To determine the role of NEDD9 as it relates to HIF-1α a luciferase assay was performed. The results showed a HIF-1α transcriptional activity in Cr(VI)- transformed cells with 6.1 fold increase compared to BEAS-2B cells and Cr(VI)- transformed cells 34.3 fold increase compared to Cr(VI)-transformed knockdown NEDD9 cells (Figure 4A). The next question would be if HIF-1α is upregulated at the mRNA level. This was measured by real-time PCR. The results showed that Cr(VI)- transformed cells had 54% increased HIF-1α mRNA expression and Cr(VI)-transformed knockdown NEDD9 cells had 99% increased HIF-1α expression compared to BEAS-2B cells (Figure 4B). Since there was not a decrease in HIF-1α mRNA expression in Cr(VI)- transformed knockdown NEDD9 cells the method for reduced transcriptional activity must be examined. To investigate direct binding with NEDD9 and HIF-1α and its cofactor CREB-binding protein (CBP) an immunoprecipitation (IP) assay was performed. The results showed that NEDD9 binds directly with CBP (Figure 4C). Next we investigated whether NEDD9, HIF-1α, and CBP were translocated to the nucleus in each cell type. The results show that NEDD9 can translocate to the nucleus (Figure 4D). CBP was also expressed much higher in the nucleus in Cr(VI)-transformed cell than BEAS-2B or Cr(VI)-transformed knockdown NEDD9 cells. HIF-1α was measured much higher in the nucleus of Cr(VI)-transformed cells than BEAS-2B or Cr(VI)-transformed knockdown NEDD9 cells. 3.5 Discussion Hexavalent chromium (Cr(VI)) can cause the overexpression of multiple proteins leading to an aggressive tumor burden. Cr(VI) can cause these changes in cellular processes by generating reactive oxygen species, carcinogenic DNA adducts, alterations

47 in epigenetics, and changes in cell signaling. Neural precursor cell developmentally downregulated protein 9 (NEDD9) was found dramatically overexpressed in Cr(VI)- transformed BEAS-2B cells. This Cas family scaffolding protein is upregulated in many cancers and its importance in Cr(VI)-transformed cell aggressiveness is evident by the its role in angiogenesis. Arguably the most important transcription factor in angiogenesis is HIF-1α. When HIF-1α is translocated to the nucleus, it has the ability to transcribe some 60 or so genes involved in angiogenesis including VEGF, which is vital for the recruitment of new vasculature into a tumor. This process is vital to the growth and survival of a tumor and also has implications for allowing cells from the tumor to easily enter the circulatory system. NEDD9 was found to be very important in the transcriptional activity of HIF-1α, but the exact mechanism is still not completely clear. This study illustrates clearly that NEDD9 can mediate the transcriptional activity of HIF-1α. While the exact mechanism is not clear, it is obvious that there is direct binding with NEDD9 and CBP but not with HIF-1α. This indicates that the role of NEDD9 in the processes of angiogenesis is likely through activating this cofactor of HIF-1α in the nucleus to increase transcription of angiogenic proteins. CREB-binding protein (CBP) is a homologous transcription adapter with p300, and is active in many transcriptional events [123]. CBP often interacts with the basal transcriptional machinery and various transcription factors to increase transactional efficiency. CBP and p300 have been found to form a DNA binding complex with HIF-1α as well as many other oncogenic factors including jun, fos, SRC-1, and RAR-α to name a few [123]. There is a dramatic increase of HIF-1α transcriptional activity in the presence of NEDD9. Although there was no binding between NEDD9 and HIF-1α directly, the binding of NEDD9 and CBP indicates that this may be the mechanism by which HIF-1α is regulated. This would explain how angiogenesis is greatly reduced when NEDD9 is inhibited by its shRNA. Since CBP is primarily found in the nucleus it is likely that when NEDD9 is highly expressed it is also expressed in the nucleus and the interaction with CBP and NEDD9 would be only moments before its coactivation of HIF-1α.

48 VEGF is one of the major downstream targets for the HIF-1α transcription factor. It is involved in several cellular processes, but is perhaps most notable for its role in angiogenesis. VEGF plays a role in for new vasculature, regulates vasculature permeability, and promotes cell migration, proliferation, and survival [124]. VEGF is a ligand that binds to the VEGF-R resulting in the activation of several key signaling pathways. These pathways include Ras/MAPK for the regulation of cell proliferation, FAK/paxillin to initiate cytoskeletal rearrangement, and RhoA/ROCK to aid in the formation of new vasculature [125, 126]. In Cr(VI)-transformed cells VEGF expression, and excretion was increased. The inhibition of NEDD9 reduced VEGF expression and excretion having downstream effects on the recruitment of new vasculature and likely cell proliferation, survival and vascular permeability as well, though these were not measured in this study. The presence of NEDD9 also seemed to have a dramatic effect in the activation of p38. The protein p38 is a mitogen-activated protein kinase (MAPK) that has been found to increase angiogenesis in both cancer cells and endothelial cell response to angiogenic signaling. When HUVEC cells are treated with VEGF, p38 becomes activated and pharmaceutical inhibition of p38 attenuated VEGF induced cellular migration [65, 127, 128]. Since the knockdown of NEDD9 greatly reduced the phosphorylation of p38, it is possible that NEDD9 is involved in the angiogenic process from two angles. NEDD9 can mediate angiogenesis by reducing the production and release of VEGF form the cancer cells. Secondly, if NEDD9 was targeted systemically the effects would reduce angiogenesis by inhibiting the endothelial response to VEGF though p38. This study shows that NEDD9 can mediate angiogenesis in vitro and in vivo in Cr(VI)-transformed cells. It presents the possible mechanism of action that NEDD9 is increasing HIF-1α transcriptional activity by binding with CBP. Additionally, the presence of NEDD9 increases the activity of p38. Both of these will affect the production and secretion of VEGF and control angiogenesis and vasculature permeability. This understanding is beneficial and places NEDD9 as an important therapeutic target or biomarker for angiogenesis. Further research must be done before NEDD9 can be a viable clinical target, but the evidence in the literature, and the evidence presented here shows that the research on NEDD9 should continue to expand.

49

50 Figure 3.1 Angiogenesis is increased in Cr(VI)-transformed BEAS-2B cells.

A. BEAS-2B and Cr(VI)-transformed BEAS-2B cells were grown for two days to 80% confluency in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. The

cells were incubated in 37°C and 5% CO2. HUVEC cells were cultured in endothelial cell basal medium-2 supplemented with 10% FBS and 1% penicillin-streptomycin. The cells

were incubated in 37°C and 5% CO2. Serum from BEAS-2B and Cr(VI)-transformed cells was added to the HUVEC samples and incubated for less than 12 hours. Closed loop cell aggregates were quantified. B. Fertilized eggs were incubated at 37°C for four days. The CAMs were transferred to flasks where they continued to grow until day ten. On day ten each CAM was given two onplants with BEAS-2B cells and two onplants with Cr(VI)-transformed cells. Photos were taken each day and onplants were analyzed four days post-deployment. C. Whole cell lysates were collected from BEAS-2B and Cr(VI)- transformed cells and angiogenic factors were analyzed by western blot. D. Whole cell lysates were collected from BEAS-2B and Cr(VI)-transformed cells and p38 was analyzed by western blot. * represents statistical significance of p < 0.05. Data were expressed as the mean ± the standard deviation. Difference between means was determined by the Student’s t-test. The results for A and B represent three independent repeats. The results for C and D represent single experiments.

51

52 Figure 3.2 Inhibition of NEDD9 reduced angiogenesis in Cr(VI)-transformed BEAS- 2B cells.

A. Cr(VI)-transformed BEAS-2B cells and Cr(VI)-transformed knockdown NEDD9 BEAS-2B cells were grown for two days to 80% confluency in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and were incubated in 37°C and 5% CO2. HUVEC cells were cultured in endothelial cell basal medium-2 supplemented with 10%

FBS and 1% penicillin-streptomycin and were incubated in 37°C and 5% CO2. Serum from and Cr(VI)-transformed and Cr(VI)-transformed knockdown NEDD9 cells was added to the HUVEC samples and incubated for less than 12 hours. Closed loop cell aggregates were quantified. B. Fertilized eggs were incubated at 37°C for four days. The CAMs were transferred to flasks where they continued to grow until day ten. On day ten each CAM was given two onplants with Cr(VI)-transformed cells and two onplants with Cr(VI)-transformed shNEDD9 cells. Photos were taken each day and onplants were analyzed four days post deployment. C. Whole cell lysates were collected from Cr(VI)- transformed and Cr(VI)-transformed shNEDD9 cells and angiogenic factors were analyzed by western blot. D. Whole cell lysates were collected from Cr(VI)-transformed cells and Cr(VI)-transformed shNEDD9 cells and p38 was analyzed by western blot. E. Serum was collected from BEAS-2B, Cr(VI)-transformed and Cr(VI)-transformed shNEDD9 cells and an ELISA assay was conducted. * represents statistical significance of p < 0.05. Data were expressed as the mean ± the standard deviation. Difference between means was determined by ANOVA for multiple independent variables, and by Student’s t-test for single variables. The results for A, B, and E represent three independent repeats. The results for C and D represent individual experiments.

53

54 Figure 3.3 NEDD9 increases tumorigenesis and angiogenesis in vivo.

A. Cr(VI)-transformed BEAS-2B cells and Cr(VI)-transformed knockdown NEDD9 BEAS-2B cells were grown for two days to 80% confluency in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and were incubated in 37°C and 5% CO2. 6-week-old athymic mice were injected with 4 x 106 cells suspended in PBS in the rear flanks. Tumors were harvested 7 weeks post injection. B. Tumors length and width were measured and volume was calculated mm3 = ½(L X W2). C. Tumors were weighed in grams. D. Cr(VI)-transformed BEAS-2B cells and Cr(VI)-transformed knockdown NEDD9 BEAS-2B cells were grown for two days to 80% confluency in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin and were incubated in 37°C 6 and 5% CO2. 6-week-old athymic mice were injected with 5 x 10 cells suspended in Matrigel in the rear flanks. Plugs were harvested 10 days post injection. E. Hemoglobin was quantified using Drabkin’s reagent. * and # represents statistical significance of p < 0.05. Data were expressed as the mean ± the standard deviation. Difference between means was determined by ANOVA for multiple independent variables, and by Student’s t-test for single variables. The results in Figure A, B, and C represent six mice three were injected with Cr(VI)-transformed cells and three were injected with Cr(VI)-transformed shNEDD9 cells. The results from D and E represent eight mice injected on each flank. Six Cr(VI)-transformed plugs were injected, six Cr(VI)-transformed shNEDD9 plugs were injected, and four BEAS-2B plugs were injected.

55

56 Figure 3.4 NEDD9 increases angiogenesis by mediating HIF-1α transcriptional activity via CBP.

A. BEAS-2B, Cr(VI)-transformed and Cr(VI)-transformed shNEDD9 cells were transfected with HIF-1α luciferase reporter. After 48 hours the transient transfection was complete. Cells were lysed and the luminescence was quantified. B. mRNA was extracted from BEAS-2B, Cr(VI)-transformed, and Cr(VI)-transformed shNEDD9 cells using Quiagen RNeasy mini kit. mRNA levels were quantified using real-time PCR. C. Whole cell lysate was harvested from Cr(VI)-transformed cells and binding partners of NEDD9 were determined by an immunoprecipitation assay. D. A cell fractionation assay was used to harvest proteins from the cytosol and nucleus fractions from BEAS-2B and Cr(VI)-transformed cells. A western blot analysis was used to measure protein concentrations within each cell fraction. E. A cell fractionation assay was used to harvest proteins from the cytosol and nucleus fractions from BEAS-2B, Cr(VI)-transformed, and Cr(VI)-transformed shNEDD9 cells. A western blot analysis was used to measure protein concentrations within each cell fraction. * and # represents statistical significance of p < 0.05. Data were expressed as the mean ± the standard deviation. Difference between means was determined by ANOVA for multiple independent variables. The results for A, B, and D represent three independent repeats. The results from C and E represent individual experiments.

57

58 Figure 3.5 Scheme of mechanism of angiogenesis in Cr(VI)-transformed cells.

Chronic exposure to Cr(VI) leads to malignant cell transformation of BEAS-2B cells. These cells have an increased expression of NEDD9. The inhibition of NEDD9 by its shRNA reduces p38 phosphorylation. NEDD9 can bind directly to CBP. These two factors play a role in HIF-1α translocation to the nucleus and HIF-1α transcriptional activity. The VEGF cytokine is one of 60 angiogenic proteins transcribed by the HIF complex and has been shown to play a huge role in angiogenesis. Inhibition of NEDD9 reduced VEGF transcription and excretion. The presence of NEDD9 in Cr(VI)- transformed cells leads to an increase in angiogenesis in vitro and in vivo.

59 CHAPTER 4. CONCLUSIONS 4.1 Environmental and Occupation Hexavalent Chromium Chromium is ubiquitous on the planet, but it is rarely found in its elemental state. Most chromium deposits are a conglomerate of chromite ores and 20,000 tons of Cr metal is mined each year and used for various industrial endeavors [129]. In metallurgy chromium is used in creating stainless steel and other metal alloys. It is also useful for the processes of leather tanning, chrome plating, dyes, wood treatment, and as a refractory composite in extreme heat resistant bricks [130]. These important industries have been responsible for aerosolized chromium in the atmosphere that is especially dangerous for workers in those industries with long term exposure. Over the years there have been multiple occupational and cohort studies finding that workers exposed to chromium have higher rates of lung cancer. Chromate was found to accumulate primarily in the large bronchi with incidence of lung cancer reported as high as 49.5-fold compared with the non- exposed population in 1978 [5, 7, 96, 131, 132]. In response to the damaging potential of chromium exposure OSHA has established a limit of 0.005 mg/m2 hexavalent chromium in air over an 8-hour work day [133]. The occupational regulation was a great start in dealing with hexavalent chromium exposure, but there is still unregulated chromium exposure evident by the chromium content found in the hair and fingernails of individuals in the U.S., Canada, Poland, Japan and India [134]. Even at low doses hexavalent chromium causes malignant cell transformation [26]. The evidence shows that Chromate workers and those in industries exposed to Cr(VI) are at continual risk of cancer greater than the general population and these data should be considered when assessing the importance and relevance of Cr(VI) induced carcinogenesis. 4.2 Hexavalent Chromium Carcinogenesis For the generation of Cr(VI)-transformed cells in our lab, a low dose of Cr(VI) (0.25μM) was used to transform BEAS-2B cells. The in vitro model dose is consistent with what a worker may be exposed to over the course of several days of work in OSHA 0.5 3 acceptable conditions. If we assume 0.2 12 1 480 = 𝜇𝜇𝜇𝜇 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏ℎ𝑠𝑠 𝐿𝐿 𝑚𝑚 𝑚𝑚𝑚𝑚𝑚𝑚 3 1000 𝑋𝑋 𝑋𝑋 𝑋𝑋 𝑋𝑋 𝑚𝑚 𝑀𝑀𝑀𝑀𝑀𝑀 𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏𝑏ℎ 𝐿𝐿 𝑠𝑠ℎ𝑖𝑖𝑖𝑖𝑖𝑖 0.576 , an average worker might potentially be exposed to 0.011μM of Cr(VI) per 𝜇𝜇𝜇𝜇 𝑠𝑠ℎ𝑖𝑖𝑖𝑖𝑖𝑖 shift. These epithelial cells were treated for 24 weeks. Then individual colonies were established to generate a stable cell line [26]. The resulting transformed cells showed increased activation of EGFR, increased Bcl-2, Bcl-xL, and reduced Bax and C-PARP as markers for complete cell transformation. These cells are resistant to apoptosis and proliferate much more quickly than passage matched BEAS-2B cells. These Cr(VI)- transformed cells were the cause of tumorigenicity when xenograft in nude mice [135]. 4.3 Hexavalent Chromium Aggressiveness In the field of metal carcinogenesis there have been few studies focusing on metal induced aggressiveness relating to migration, invasion and angiogenesis. The effects of Cr(VI) have been largely defined by the ability to produce massive amounts oxidative stress as it is reduced to Cr(V), Cr(IV), and Cr(III) by interacting with iron and other molecules in the cell. Through the reduction process reactive oxygen species are released into the cell. These Chromium compounds can be oxidized and reduced multiple times. This project reveals that Cr(VI)-transformed cells display a highly aggressive phenotype with increased migration, invasion and angiogenesis. It is apparent that NEDD9 is a vital contributor to the aggressive phenotype of these Cr(VI)-transformed cells. For the first time, a clear link between Cr(VI) exposure and migration and invasion has been proposed. NEDD9 was vital for the migration, invasion, and angiogenesis for Cr(VI)-transformed BEAS-2B cells. This establishes NEDD9 as a possible therapeutic target or biomarker as part of a cancer treatment strategy. Two natural chemicals were discovered in the duration of this project to reduce NEDD9 expression without affecting cell viability of normal BEAS-2B cells. Apigenin is an antioxidant that has long been used as a traditional herbal treatment and can be derived from various plants including parsley, celery, and chamomile tea. α-pinene is a second natural chemical that can be derived from coniferous trees and has some history as a treatment for various diseases. These two natural treatments indicate that there should be a safe mechanism to deliver oral or intravenous inhibitors of NEDD9 that can function without causing harmful amounts of cellular damage to healthy tissue. The scope of this dissertation on the role of NEDD9 in Cr(VI)-transformed cells was not exhaustive but rather focused. The study focused on the mechanism of action for how NEDD9 is involved in migration, invasion, and angiogenesis. NEDD9 can also have effects on cell survival, proliferation, and possibly other aspects of cancer progression that we did

61 not delve into. Migration, invasion, and angiogenesis are critical for highly aggressive and invasive tumor types. There are several checkpoints that a cell needs to overcome before in can become fully metastatic. Once the cancer cell has developed a resistance to apoptosis and self-renewal capability, the cell enters into the circulatory system and spreads to distant tissues. In order for this to occur the cell must be effective at remodeling its surrounding extracellular matrix. Then the cell must migrate through the stroma and pass into either the blood system or the lymphatic system. When the cancer cell can survive the journey through circulation, it must have the ability to invade new tissues i.e. bone, liver, brain etc. The goal is to inhibit signaling molecules involved in these cancer cell checkpoints. There may be opportunities to combine the current standard of care with a drug targeting NEDD9 to further impede cancer cells from migration, invasion, and angiogenesis. There is reason to believe that NEDD9 may have a much broader impact and therefore be even more important as a therapeutic target because NEDD9 has been implicated as an upstream factor in multiple signaling pathways. The other two major pathways NEDD9 is involved in are apoptosis and cell cycle progression. NEDD9 is a protagonist during apoptosis. The protein is cleaved specifically by at the DLVD and DDYD cleavage sites. These figments negatively regulate NEDD9 expression and mediate induction of apoptosis [136]. Cells that have developed apoptotic resistance are normally accompanied by much higher levels of NEDD9 without succumbing to apoptosis. In cell cycle progression NEDD9 aids in spindle formation, and when NEDD9 levels are too low cells can get stuck in G1 phase. This arrest leads to apoptosis if the problem is not resolved. Inhibiting NEDD9 by it’s shRNA did not lead to cell death in Cr(VI)-transformed cells as they already have resistance to apoptosis. Neither did the inhibition of NEDD9 slow the cell growth and division rates in Cr(VI)-transformed cells. There may be a threshold level of NEDD9 that was still present in the cells after shRNA knockdown. Additionally, when normal BEAS-2B cells were treated with apigenin or α-pinene the subsequent reduction of NEDD9 did not cause cell death or arrest in G1 phase. The exact cause of NEDD9 overexpression is yet to be determined. One possible pathway would be that ROS induced SMAD2/3 alteration and the reduced capacity for Smurf1 and Smurf2 which are SMAD family HECT-type E3 ubiquitin ligases are directly involved with NEDD9 overexpression. These two ligases are downregulated in Cr(VI)-

62 transformed cells and inhibition of these SMAD family E3 ubiquitin ligases in normal BEAS-2B cells increased the expression of NEDD9. This provides a link between Cr(VI) exposure and the overexpression of NEDD9. Cr(VI) exposure also led to the over expression of NEDD9 mRNA. These two mechanisms are likely the major reasons why NEDD9 is overexpressed in Cr(VI)-transformed BEAS-2B cells. These Cr(VI)-transformed cells exhibited increased migration and invasion. Though the pathway for migration and invasion has been greatly illuminated, there are still additional questions that may be examined for understanding the whole picture. We found that NEDD9 was critical for Src activation and that there is direct binding with NEDD9/FAK and NEDD9/Src. Furthermore, the inhibition of NEDD9 by its shRNA obliterated binding between FAK and Src. This evidence suggests that NEDD9 is a critical mediator in this interaction having downstream effects in cellular adhesion, migration, and invasion. The interaction of FAK and Src is important for basal laminal adhesion, integrin signaling, and migration signaling. Interestingly, in normal cellular conditions FAK is auto-phosphorylated at Y397 as a precursor for Src binding, but in Cr(VI)-transformed cells this phosphorylation was not observed. This would be an interesting and enlightening future direction of study. It is possible that NEDD9 acts as a mediator to induce binding between FAK and Src without the phosphorylation of FAK at Y397 by binding directly to both kinases. The interaction of FAK and Src mediated my NEDD9 may have more than one downstream effect for tumor aggressiveness. First of all, we discovered the migration and invasion effects through the in vitro assays. The literature also suggests that FAK/Src interactions may play a critical role in angiogenesis. It is true that the cellular mechanisms for migration, invasion and angiogenesis overlap in many cases. The signaling cascades initiated from overexpression of NEDD9 may be one of these cases of overlap. FAK/Src has been reported to mediate angiogenesis by activating small GTPase RhoA and subsequently ROCK1 and ROCK2. In addition, DOCK180, Nck2, and Cdc42 were downstream targets of FAK/Src interaction [55-58]. This would seem to indicate that NEDD9 may mediate angiogenesis through multiple pathways. NEDD9 plays a critical role in active β-Catenin and E-Cadherin signaling. We found that NEDD9 can regulate active β-Catenin in Cr(VI)-transformed cells via reducing the

63 kinase activity of glycogen synthase kinase (GSK-3). GSK-3 is the primary kinase in the initiation of β-Catenin degradation. β-Catenin is sequestered by its destruction complex comprised of adenomatous polyposis coli (APC), Axin, casein kinase 1 (CK1), protein phosphatase 2A (PP2A), and GSK-3. GSK-3 phosphorylates β-Catenin which signals for the recruitment of an E3 ubiquitin ligase β-transducin repeats-containing protein (β-TrCP). This ubiquitination marks the end of β-Catenin as it is swiftly targeted for proteasomal degradation. In Cr(VI)-transformed cells active β-Catenin is highly expressed and the inhibition of NEDD9 increased GSK-3 kinase activity while reducing the active non- phosphorylated form of β-Catenin. In some cancers β-Catenin acts as a TCF/LEF transcription factor in the EMT process, however in Cr(VI)-transformed cells the downstream targets of TCF/LEF were not increased. Neither was the TCF/LEF more active as measured by a luciferase assay. It is known that β-Catenin is often associated with E-Cadherin as part of normal noncancer adhesion. In some situations, β-Catenin is glycosylated by DPAGT1 which then localizes CTHRC1 to the leading edge for wound healing and migration. In Cr(VI)-transformed cells it is likely that this mechanism is in play because of the highly elevated and active β- Catenin in combination with the lack of TCF/LEF gene transcription. Interestingly, VEGF can also stimulate β-Catenin to increase tumor aggressiveness. The VEGF-R promotes FAK activation and localized to cell junctions. VE-Cadherin and β-Catenin are dissociated from each other as part of cytoskeletal rearrangement. This has implications for the function of NEDD9. It would seem that NEDD9 then can doubly regulate FAK. First, NEDD9 can bind directly with FAK and assist with the FAK/Src complex formation. Second, by changing the transcriptional activity of HIF-1α, the expression and release of VEGF is altered. When NEDD9 is high there is a high expression of VEGF causing downstream FAK activation and cytoskeletal remodeling. Some studies suggested the NEDD9 expression can be altered downstream of FAK/Src complex. In Cr(VI)-transformed cells NEDD9 was able to regulate the formation of this complex by direct binding. However, when Src was inhibited there was no significant change to NEDD9 expression. This suggests that in Cr(VI)-transformed cells, NEDD9 is acting upstream and regulating the formation of this complex. This has implications in migration and invasion as shown in chapter 2 and in angiogenesis as shown

64 in chapter 3. Though these two pathways can be studied separately it is more likely that the pathways are intertwined as part of a total cellular shift in Cr(VI)-transformed cells. There are a number of interesting future directions that come from these studies of NEDD9. One future direction would be to look at NEDD9’s potential role in proliferation. Although knocking down NEDD9 in Cr(VI)-transformed cells had a negligible effect on proliferation, the overexpression of NEDD9 in BEAS-2B cells was not examined. There is reason to believe that NEDD9 may regulate Ras/MAPK pathways through VEGF or through Src and could increase cellular proliferation. Specifically, it would be interesting to examine ERK1/ERK2 as a downstream target of NEDD9. Additionally, NEDD9 mediates the cell cycle with increased expression during S phase and association with the mitotic spindle. NEDD9 is directly associated with the at the at G2/M phase transition. This is needed for timing and control of [80]. An overexpression of NEDD9 may prove to be critical in enhanced proliferation of early cancer cell transformation. Genomic stability is an interesting application for further study of NEDD9. Since NEDD9 binds to Aurora A and can mediate cyclinB/Cdk1, the overexpression of NEDD9 may cause changes in mitotic spindle formation rushing the process and generating genomic instability. This could be one of driving factors in early transformation of cells treating with Cr(VI). It may also be a mechanism for transformed cells to evade growth suppression signals.

65 REFERENCES:

1. Tchounwou, P.B., et al., Heavy metal toxicity and the environment. Exp Suppl, 2012. 101: p. 133-64. 2. Kim, H.S., Y.J. Kim, and Y.R. Seo, An Overview of Carcinogenic Heavy Metal: Molecular Toxicity Mechanism and Prevention. J Cancer Prev, 2015. 20(4): p. 232- 40. 3. Gerd Anger, J.H., Klaus Hochgeschwender, Christoph Scherhag, Ulrich Korallus, Herbert Knopf, Peter Schmidt, Manfred Ohlinger, Chromium Compounds, in Enclyclopedia of Industrial Chemistry, Ullmann, Editor. 2005, Wiley-VCH: Weinheim. 4. Inventory, N.P., Chromium (VI) compounds, D.o.E.a. Energy, Editor. 2018, Australian Goverment: Australia. 5. Ohsaki, Y., et al., Lung cancer in Japanese chromate workers. Thorax, 1978. 33(3): p. 372-4. 6. Tsuneta, Y., et al., Chromium content of lungs of chromate workers with lung cancer. Thorax, 1980. 35(4): p. 294-7. 7. Langard, S., One hundred years of chromium and cancer: a review of epidemiological evidence and selected case reports. Am J Ind Med, 1990. 17(2): p. 189-215. 8. Inventory, N.P., Hexavalent chromium-induced DNA damage and repair mecahnisms, D.o.t.E.a. Energy, Editor. 2018, Austrialian Government: Australia. 9. Health, N.I.o., Chromium, U.d.o.h.a.h. services, Editor. 2019, US goverment: United States. 10. Adriana Arita, M.C., Environmental Agents and Epigenetics. Handbook of Epigenetics, 2011. 11. OSHA, Hexavalent Chromium, U.S.D.o. Labor, Editor. 2019, occupational safety and health administration: united states. 12. Zhou, Q. and S. Xi, A review on arsenic carcinogenesis: Epidemiology, metabolism, genotoxicity and epigenetic changes. Regul Toxicol Pharmacol, 2018. 99: p. 78-88. 13. Kasprzak, K.S., F.W. Sunderman, Jr., and K. Salnikow, Nickel carcinogenesis. Mutat Res, 2003. 533(1-2): p. 67-97. 14. Guiping Hu, P.Z., Huimin Feng, Guang Jia, Imbalance of oxidative and reductive species imvolved in chromium(VI)-induced toxic effects. ROS, 2017. 3(7): p. 1-11. 15. Muenyi, C.S., M. Ljungman, and J.C. States, Arsenic Disruption of DNA Damage Responses-Potential Role in Carcinogenesis and Chemotherapy. Biomolecules, 2015. 5(4): p. 2184-93. 16. Wise, S.S., A.L. Holmes, and J.P. Wise, Sr., Hexavalent chromium-induced DNA damage and repair mechanisms. Rev Environ Health, 2008. 23(1): p. 39-57. 17. Fragou, D., et al., Epigenetic mechanisms in metal toxicity. Toxicol Mech Methods, 2011. 21(4): p. 343-52. 18. Auston Carver, V.S.G., Heavy Metals and Cancer. In Tech Open, 2017. 70348. 19. Zhitkovich, A., Chromium in drinking water: sources, metabolism, and cancer risks. Chem Res Toxicol, 2011. 24(10): p. 1617-29. 20. Shetty, M.N.K.V., Chromium-Resistant Bacteria and Their Environmental Condition for Hexavalent Chromium Removal: A Review. Critical Reviews in Environmental Science and Technology, 2013. 43:9: p. 955-1009. 21. Levina, A., H.H. Harris, and P.A. Lay, Binding of chromium(VI) to histones: implications for chromium(VI)-induced genotoxicity. J Biol Inorg Chem, 2006. 11(2): p. 225-34. 22. Wang, Y., et al., Carcinogenicity of chromium and chemoprevention: a brief update. Onco Targets Ther, 2017. 10: p. 4065-4079. 23. Clementino, M., X. Shi, and Z. Zhang, Oxidative Stress and Metabolic Reprogramming in Cr(VI) Carcinogenesis. Curr Opin Toxicol, 2018. 8: p. 20-27. 24. Dai, J., et al., Loss of fructose-1,6-bisphosphatase induces glycolysis and promotes apoptosis resistance of cancer stem-like cells: an important role in hexavalent chromium-induced carcinogenesis. Toxicol Appl Pharmacol, 2017. 331: p. 164- 173. 25. Kim, G. and E.J. Yurkow, Chromium induces a persistent activation of mitogen- activated protein kinases by a redox-sensitive mechanism in H4 rat hepatoma cells. Cancer Res, 1996. 56(9): p. 2045-51. 26. Kim, D., et al., Constitutive activation of epidermal growth factor receptor promotes tumorigenesis of Cr(VI)-transformed cells through decreased reactive oxygen species and apoptosis resistance development. J Biol Chem, 2015. 290(4): p. 2213-24. 27. Chiu, A., et al., Review of chromium (VI) apoptosis, cell-cycle-arrest, and carcinogenesis. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev, 2010. 28(3): p. 188-230. 28. Pritchard, D.E., et al., Resistance to apoptosis, increased growth potential, and altered gene expression in cells that survived genotoxic hexavalent chromium [Cr(VI)] exposure. Mol Cell Biochem, 2005. 279(1-2): p. 169-81. 29. Ge, H., et al., Cr (VI) induces crosstalk between apoptosis and autophagy through endoplasmic reticulum stress in A549cells. Chem Biol Interact, 2019. 298: p. 35- 42. 30. Huang, J., et al., Chromium contributes to human bronchial epithelial cell carcinogenesis by activating Gli2 and inhibiting autophagy. Toxicol Res (Camb), 2017. 6(3): p. 324-332. 31. Xie, Y., et al., Activation of autophagy protects against ROS-mediated mitochondria-dependent apoptosis in L-02 hepatocytes induced by Cr(VI). Cell Physiol Biochem, 2014. 33(3): p. 705-16. 32. Sun, H., et al., Comparison of gene expression profiles in chromate transformed BEAS-2B cells. PLoS One, 2011. 6(3): p. e17982. 33. Nigam, A., et al., Cytogenomics of hexavalent chromium (Cr 6+) exposed cells: a comprehensive review. Indian J Med Res, 2014. 139(3): p. 349-70. 34. Sima, N., et al., The overexpression of scaffolding protein NEDD9 promotes migration and invasion in cervical cancer via tyrosine phosphorylated FAK and SRC. PLoS One, 2013. 8(9): p. e74594. 35. Jones, B.C., et al., Dual Targeting of Mesenchymal and Amoeboid Motility Hinders Metastatic Behavior. Mol Cancer Res, 2017. 15(6): p. 670-682.

67 36. Wang, Z., et al., NEDD9 may regulate hepatocellular carcinoma cell metastasis by promoting epithelial-mesenchymal-transition and stemness via repressing Smad7. Oncotarget, 2017. 8(1): p. 1714-1724. 37. Yoon, H., et al., Understanding the roles of FAK in cancer: inhibitors, genetic models, and new insights. J Histochem Cytochem, 2015. 63(2): p. 114-28. 38. Bolos, V., et al., The dual kinase complex FAK-Src as a promising therapeutic target in cancer. Onco Targets Ther, 2010. 3: p. 83-97. 39. Mitra, S.K. and D.D. Schlaepfer, Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr Opin Cell Biol, 2006. 18(5): p. 516-23. 40. Wheeler, D.L., M. Iida, and E.F. Dunn, The role of Src in solid tumors. Oncologist, 2009. 14(7): p. 667-78. 41. Zheng, M. and P.J. McKeown-Longo, Regulation of HEF1 expression and phosphorylation by TGF-beta 1 and cell adhesion. J Biol Chem, 2002. 277(42): p. 39599-608. 42. Natarajan, M., et al., HEF1 is a necessary and specific downstream effector of FAK that promotes the migration of cells. Oncogene, 2006. 25(12): p. 1721-32. 43. Tikhmyanova, N. and E.A. Golemis, NEDD9 and BCAR1 negatively regulate E- cadherin membrane localization, and promote E-cadherin degradation. PLoS One, 2011. 6(7): p. e22102. 44. Kong, C., et al., NEDD9 is a positive regulator of epithelial-mesenchymal transition and promotes invasion in aggressive breast cancer. PLoS One, 2011. 6(7): p. e22666. 45. Tilghman, R.W., et al., Focal adhesion kinase is required for the spatial organization of the leading edge in migrating cells. J Cell Sci, 2005. 118(Pt 12): p. 2613-23. 46. Webb, D.J., et al., FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol, 2004. 6(2): p. 154-61. 47. Ren, X.D., et al., Focal adhesion kinase suppresses Rho activity to promote focal adhesion turnover. J Cell Sci, 2000. 113 ( Pt 20): p. 3673-8. 48. Grewal, S., et al., Human endometrial stromal cell rho GTPases have opposing roles in regulating focal adhesion turnover and embryo invasion in vitro. Biol Reprod, 2010. 83(1): p. 75-82. 49. Abassi, Y.A. and K. Vuori, Tyrosine 221 in Crk regulates adhesion-dependent membrane localization of Crk and Rac and activation of Rac signaling. EMBO J, 2002. 21(17): p. 4571-82. 50. Canel, M., et al., E-cadherin-integrin crosstalk in cancer invasion and metastasis. J Cell Sci, 2013. 126(Pt 2): p. 393-401. 51. Tian, X., et al., E-cadherin/beta-catenin complex and the epithelial barrier. J Biomed Biotechnol, 2011. 2011: p. 567305. 52. Ferber, E.C., et al., A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem, 2008. 283(19): p. 12691-700. 53. David, J.M. and A.K. Rajasekaran, Dishonorable discharge: the oncogenic roles of cleaved E-cadherin fragments. Cancer Res, 2012. 72(12): p. 2917-23.

68 54. Guerrero, M.S., J.T. Parsons, and A.H. Bouton, Cas and NEDD9 Contribute to Tumor Progression through Dynamic Regulation of the Cytoskeleton. Genes Cancer, 2012. 3(5-6): p. 371-81. 55. Kiyokawa, E., et al., Evidence that DOCK180 up-regulates signals from the CrkII- p130(Cas) complex. J Biol Chem, 1998. 273(38): p. 24479-84. 56. Dadke, D., et al., Deregulation of HEF1 impairs M-phase progression by disrupting the RhoA activation cycle. Mol Biol Cell, 2006. 17(3): p. 1204-17. 57. Lee, C.Y. and V.L. Bautch, Ups and downs of guided vessel sprouting: the role of polarity. Physiology (Bethesda), 2011. 26(5): p. 326-33. 58. Funasaka, K., et al., Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing. FEBS J, 2010. 277(17): p. 3502-13. 59. Kim, S.H., et al., Human enhancer of filamentation 1 Is a mediator of hypoxia- inducible factor-1alpha-mediated migration in colorectal carcinoma cells. Cancer Res, 2010. 70(10): p. 4054-63. 60. Bergers, G. and L.E. Benjamin, Tumorigenesis and the angiogenic switch. Nat Rev Cancer, 2003. 3(6): p. 401-10. 61. Bernatchez, P.N., et al., Regulation of VEGF-induced endothelial cell PAF synthesis: role of p42/44 MAPK, p38 MAPK and PI3K pathways. Br J Pharmacol, 2001. 134(6): p. 1253-62. 62. Chen, X.L., et al., VEGF-induced vascular permeability is mediated by FAK. Dev Cell, 2012. 22(1): p. 146-57. 63. Bryan, B.A., et al., RhoA/ROCK signaling is essential for multiple aspects of VEGF-mediated angiogenesis. FASEB J, 2010. 24(9): p. 3186-95. 64. Issbrucker, K., et al., p38 MAP kinase--a molecular switch between VEGF-induced angiogenesis and vascular hyperpermeability. FASEB J, 2003. 17(2): p. 262-4. 65. Rousseau, S., et al., p38 MAP kinase activation by vascular endothelial growth factor mediates actin reorganization and cell migration in human endothelial cells. Oncogene, 1997. 15(18): p. 2169-77. 66. Goel, H.L. and A.M. Mercurio, VEGF targets the tumour cell. Nat Rev Cancer, 2013. 13(12): p. 871-82. 67. Schulte, P., Lentz, T.J., Sofge, C., MacMahon, K., Rice, F., Park, R., Nagy, H., Blade, L.M., Ashley, K., Hatfield, G.H., Wenzl, T., NIOSH Criteria Document: Criteria for a Recommendation Standard for an Occupational Exposure to Hexavalent Chromium, D.o.H.a.H. Services, Editor. 2013, CDC: www.cdc.gov/niosh. 68. Pratheeshkumar, P., et al., Hexavalent chromium induces malignant transformation of human lung bronchial epithelial cells via ROS-dependent activation of miR-21- PDCD4 signaling. Oncotarget, 2016. 7(32): p. 51193-51210. 69. Clementino, M., D. Kim, and Z. Zhang, Constitutive Activation of NAD-Dependent Sirtuin 3 Plays an Important Role in Tumorigenesis of Chromium(VI)-Transformed Cells. Toxicol Sci, 2019. 70. Tikhmyanova, N., J.L. Little, and E.A. Golemis, CAS proteins in normal and pathological cell growth control. Cell Mol Life Sci, 2010. 67(7): p. 1025-48. 71. Chang, J.X., et al., Role of NEDD9 in invasion and metastasis of lung adenocarcinoma. Exp Ther Med, 2012. 4(5): p. 795-800.

69 72. Izumchenko, E., et al., NEDD9 promotes oncogenic signaling in mammary tumor development. Cancer Res, 2009. 69(18): p. 7198-206. 73. Kim, M., et al., Comparative oncogenomics identifies NEDD9 as a melanoma metastasis gene. Cell, 2006. 125(7): p. 1269-81. 74. Rambow, F., et al., Regulation of Melanoma Progression through the TCF4/miR- 125b/NEDD9 Cascade. J Invest Dermatol, 2016. 136(6): p. 1229-1237. 75. Li, Y., et al., HEF1, a novel target of Wnt signaling, promotes colonic cell migration and cancer progression. Oncogene, 2011. 30(23): p. 2633-43. 76. Zhou, R.T., et al., Baicalein inhibits pancreatic cancer cell proliferation and invasion via suppression of NEDD9 expression and its downstream Akt and ERK signaling pathways. Oncotarget, 2017. 8(34): p. 56351-56363. 77. Afsar, C.U., et al., Clinical Significance of Serum NEDD9 Levels in Patients with Pancreatic Cancer. Biomolecules, 2018. 8(4). 78. Morimoto, K., et al., NEDD9 crucially regulates TGF-beta-triggered epithelial- mesenchymal transition and cell invasion in prostate cancer cells: involvement in cancer progressiveness. Prostate, 2014. 74(8): p. 901-10. 79. Shagisultanova, E., et al., Preclinical and clinical studies of the NEDD9 scaffold protein in cancer and other diseases. Gene, 2015. 567(1): p. 1-11. 80. Singh, M., et al., Molecular basis for HEF1/NEDD9/Cas-L action as a multifunctional co-ordinator of invasion, apoptosis and cell cycle. Cell Biochem Biophys, 2007. 48(1): p. 54-72. 81. Loskutov, Y.V., et al., NEDD9/Arf6-dependent endocytic trafficking of matrix metalloproteinase 14: a novel mechanism for blocking mesenchymal cell invasion and metastasis of breast cancer. Oncogene, 2015. 34(28): p. 3662-75. 82. Krakhmal, N.V., et al., Cancer Invasion: Patterns and Mechanisms. Acta Naturae, 2015. 7(2): p. 17-28. 83. Stamos, J.L. and W.I. Weis, The beta-catenin destruction complex. Cold Spring Harb Perspect Biol, 2013. 5(1): p. a007898. 84. Chen, E.Y., et al., Hypoxia activates a platelet-derived growth factor receptor/phosphatidylinositol 3-kinase/Akt pathway that results in glycogen synthase kinase-3 inactivation. Cancer Res, 2001. 61(6): p. 2429-33. 85. Goc, A., et al., Targeting Src-mediated Tyr216 phosphorylation and activation of GSK-3 in prostate cancer cells inhibit prostate cancer progression in vitro and in vivo. Oncotarget, 2014. 5(3): p. 775-87. 86. Petrova, Y.I., L. Schecterson, and B.M. Gumbiner, Roles for E-cadherin cell surface regulation in cancer. Mol Biol Cell, 2016. 27(21): p. 3233-3244. 87. Jeanes, A., C.J. Gottardi, and A.S. Yap, Cadherins and cancer: how does cadherin dysfunction promote tumor progression? Oncogene, 2008. 27(55): p. 6920-9. 88. Ogura, M., et al., Mitochondrial c-Src regulates cell survival through phosphorylation of respiratory chain components. Biochem J, 2012. 447(2): p. 281- 9. 89. Luttrell, L.M., et al., Beta-arrestin-dependent formation of beta2 adrenergic receptor-Src protein kinase complexes. Science, 1999. 283(5402): p. 655-61. 90. Kim, D., et al., Activation of Epidermal Growth Factor Receptor/p38/Hypoxia- inducible Factor-1alpha Is Pivotal for Angiogenesis and Tumorigenesis of

70 Malignantly Transformed Cells Induced by Hexavalent Chromium. J Biol Chem, 2016. 291(31): p. 16271-81. 91. Roy, R.V., et al., Different roles of ROS and Nrf2 in Cr(VI)-induced inflammatory responses in normal and Cr(VI)-transformed cells. Toxicol Appl Pharmacol, 2016. 307: p. 81-90. 92. Feng, J., et al., Involvement of NEDD9 in the invasion and migration of gastric cancer. Tumour Biol, 2015. 36(5): p. 3621-8. 93. Elkin, M. and I. Vlodavsky, Tail vein assay of cancer metastasis. Curr Protoc Cell Biol, 2001. Chapter 19: p. Unit 19 2. 94. Kantak, S.S. and R.H. Kramer, E-cadherin regulates anchorage-independent growth and survival in oral squamous cell carcinoma cells. J Biol Chem, 1998. 273(27): p. 16953-61. 95. Maretzky, T., et al., ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation. Proc Natl Acad Sci U S A, 2005. 102(26): p. 9182-7. 96. IARC, IARC Monographs on the Evaluation of Carcinogenic Risks to Humans: Chromium, Nickel and Welding. 1990, World Health Organization. 97. Halasova, E., et al., Lung cancer incidence and survival in chromium exposed individuals with respect to expression of anti-apoptotic protein survivin and tumor suppressor P53 protein. Eur J Med Res, 2010. 15 Suppl 2: p. 55-9. 98. Singh, M.K., et al., Enhanced genetic instability and dasatinib sensitivity in mammary tumor cells lacking NEDD9. Cancer Res, 2010. 70(21): p. 8907-16. 99. Tachibana, K., et al., Tyrosine phosphorylation of Crk-associated substrates by focal adhesion kinase. A putative mechanism for the integrin-mediated tyrosine phosphorylation of Crk-associated substrates. J Biol Chem, 1997. 272(46): p. 29083-90. 100. van Nimwegen, M.J. and B. van de Water, Focal adhesion kinase: a potential target in cancer therapy. Biochem Pharmacol, 2007. 73(5): p. 597-609. 101. Calalb, M.B., T.R. Polte, and S.K. Hanks, Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases. Mol Cell Biol, 1995. 15(2): p. 954-63. 102. Bouton, A.H., R.B. Riggins, and P.J. Bruce-Staskal, Functions of the adapter protein Cas: signal convergence and the determination of cellular responses. Oncogene, 2001. 20(44): p. 6448-58. 103. Burnham, M.R., et al., Regulation of c-SRC activity and function by the adapter protein CAS. Mol Cell Biol, 2000. 20(16): p. 5865-78. 104. Nasertorabi, F., et al., Molecular basis for regulation of Src by the docking protein p130Cas. J Mol Recognit, 2006. 19(1): p. 30-8. 105. Brabek, J., et al., CAS promotes invasiveness of Src-transformed cells. Oncogene, 2004. 23(44): p. 7406-15. 106. Westhoff, M.A., et al., SRC-mediated phosphorylation of focal adhesion kinase couples actin and adhesion dynamics to survival signaling. Mol Cell Biol, 2004. 24(18): p. 8113-33. 107. Eide, B.L., C.W. Turck, and J.A. Escobedo, Identification of Tyr-397 as the primary site of tyrosine phosphorylation and pp60src association in the focal adhesion kinase, pp125FAK. Mol Cell Biol, 1995. 15(5): p. 2819-27.

71 108. Medici, D., E.D. Hay, and B.R. Olsen, Snail and Slug promote epithelial- mesenchymal transition through beta-catenin-T-cell factor-4-dependent expression of transforming growth factor-beta3. Mol Biol Cell, 2008. 19(11): p. 4875-87. 109. Zucchini-Pascal, N., L. Peyre, and R. Rahmani, Crosstalk between beta-catenin and snail in the induction of epithelial to mesenchymal transition in hepatocarcinoma: role of the ERK1/2 pathway. Int J Mol Sci, 2013. 14(10): p. 20768-92. 110. Wu, Z.Q., et al., Canonical Wnt signaling regulates Slug activity and links epithelial-mesenchymal transition with epigenetic Breast Cancer 1, Early Onset (BRCA1) repression. Proc Natl Acad Sci U S A, 2012. 109(41): p. 16654-9. 111. Orsulic, S., et al., E-cadherin binding prevents beta-catenin nuclear localization and beta-catenin/LEF-1-mediated transactivation. J Cell Sci, 1999. 112 ( Pt 8): p. 1237-45. 112. Cadigan, K.M. and M.L. Waterman, TCF/LEFs and Wnt signaling in the nucleus. Cold Spring Harb Perspect Biol, 2012. 4(11). 113. Hendriksen, J., et al., Plasma membrane recruitment of dephosphorylated beta- catenin upon activation of the Wnt pathway. J Cell Sci, 2008. 121(11): p. 1793-802. 114. Mariappan, M.M., et al., Activation of glycogen synthase kinase 3beta ameliorates diabetes-induced kidney injury. J Biol Chem, 2014. 289(51): p. 35363-75. 115. Beurel, E., S.F. Grieco, and R.S. Jope, Glycogen synthase kinase-3 (GSK3): regulation, actions, and diseases. Pharmacol Ther, 2015. 148: p. 114-31. 116. Nikonova, A.S., et al., CAS proteins in health and disease: an update. IUBMB Life, 2014. 66(6): p. 387-95. 117. Li, Y., et al., Evidence that common variation in NEDD9 is associated with susceptibility to late-onset Alzheimer's and Parkinson's disease. Hum Mol Genet, 2008. 17(5): p. 759-67. 118. Gao, N., et al., p38 Signaling-mediated hypoxia-inducible factor 1alpha and vascular endothelial growth factor induction by Cr(VI) in DU145 human prostate carcinoma cells. J Biol Chem, 2002. 277(47): p. 45041-8. 119. Nickens, K.P., S.R. Patierno, and S. Ceryak, Chromium genotoxicity: A double- edged sword. Chem Biol Interact, 2010. 188(2): p. 276-88. 120. Grauzam, S., et al., NEDD9 stimulated MMP9 secretion is required for invadopodia formation in oral squamous cell carcinoma. Oncotarget, 2018. 9(39): p. 25503-25516. 121. Masoud, G.N. and W. Li, HIF-1alpha pathway: role, regulation and intervention for cancer therapy. Acta Pharm Sin B, 2015. 5(5): p. 378-89. 122. Cimmino, F., et al., HIF-1 transcription activity: HIF1A driven response in normoxia and in hypoxia. BMC Med Genet, 2019. 20(1): p. 37. 123. Arany, Z., et al., An essential role for p300/CBP in the cellular response to hypoxia. Proc Natl Acad Sci U S A, 1996. 93(23): p. 12969-73. 124. abcam, VEGF in angiogenesis, in abcam.com/cancer. 2019. 125. Lee, S., et al., Autocrine VEGF signaling is required for vascular homeostasis. Cell, 2007. 130(4): p. 691-703. 126. Zachary, I., VEGF signalling: integration and multi-tasking in endothelial cell biology. Biochem Soc Trans, 2003. 31(Pt 6): p. 1171-7.

72 127. Yoshizuka, N., et al., A novel function of p38-regulated/activated kinase in endothelial cell migration and tumor angiogenesis. Mol Cell Biol, 2012. 32(3): p. 606-18. 128. Rousseau, S., et al., Vascular endothelial growth factor (VEGF)-driven actin-based motility is mediated by VEGFR2 and requires concerted activation of stress- activated protein kinase 2 (SAPK2/p38) and geldanamycin-sensitive phosphorylation of focal adhesion kinase. J Biol Chem, 2000. 275(14): p. 10661- 72. 129. Stoll, C., Facts about chromium. livescience, 2017. 130. Education, E.H.a.M., Chromium Toxicity What is Chromium. Agency for toxic substances and disease registry, 2013. 131. Kishi, R., et al., Chromium content of organs of chromate workers with lung cancer. Am J Ind Med, 1987. 11(1): p. 67-74. 132. Wong, O., An industry wide mortality study of chemical workers occupationally exposed to benzene. II. Dose response analyses. Br J Ind Med, 1987. 44(6): p. 382- 95. 133. Chromium, T.S.P., Public Health Statement for Chromium, A.f.T.S.a.D. Registry, Editor. 2015: Atlanta, GA. 134. Wilbur, S., et al., in Toxicological Profile for Chromium. 2012: Atlanta (GA). 135. Park, Y.H., et al., Human bronchial epithelial BEAS-2B cells, an appropriate in vitro model to study heavy metals induced carcinogenesis. Toxicol Appl Pharmacol, 2015. 287(3): p. 240-5. 136. Zhang, S. and L. Wu, Roles of neural precursor cell expressed, developmentally downregulated 9 in tumor-associated cellular processes (Review). Mol Med Rep, 2015. 12(5): p. 6415-21.

73 VITA

NAME: Van Wie, Peter eRA COMMONS USER NAME (credential, e.g., agency login): POSITION TITLE: Research Assistant EDUCATION/TRAINING (Begin with baccalaureate or other initial professional education, such as nursing, include postdoctoral training and residency training if applicable.) INSTITUTION AND LOCATION DEGREE Completion FIELD OF STUDY (if Date applicable) MM/YYYY Ahmadu Bello University, Zaria, OTH 05/2008 Fine Art and Pre Kaduna Medicine University of Idaho, Moscow, ID BFA 05/2012 Fine Art and Pre Medicine University of Kentucky, Lexington, MPH 05/2017 Environmental Health KY University of Kentucky, Lexington, PHD Expected 2019 Toxicology KY Positions and Honors Positions and Employment

2012 - 2013 Chemistry TA, University of Kentucky, Lexington, KY 2013 - 2014 Training Grant, NIOSH/University of Kentucky, Lexington, KY 2013 - 2014 Student Senator, University of Kentucky, Lexington, KY 2014 - Current Research Assistant, University of Kentucky, Lexington, KY Other Experience and Professional Memberships 2015 - Current Member, Society of Toxicology

Honors 2009 Dean's List, University of Idaho

74 CONTRIBUTION TO SCIENCE

1. My MPH work focused on mesothelioma survival disparities between Appalachian and Non-Appalachian Kentucky. The Appalachian region of Kentucky is known as one of the lowest socioeconomic regions in the United States having 38 distressed counties. Smoking rates in Appalachian Kentucky are also much higher than the rates throughout the rest of Kentucky. This study reported that mesothelioma survival was greatly reduced in patients who smoke. However, socioeconomic status had little effect on mesothelioma survival. This work contributes to the understanding of socioeconomic status in Appalachian Kentucky by illustrating little effect on mesothelioma survival. a. Van Wie, P.G. (2017). A population-based survival analysis of mesothelioma and smoking in Appalachian and Non-Appalachian Kentucky. Theses and Dissertations-Public Health (M.P.H. & Dr.P.H.). 159. http://uknowledge.uky.edu/cph_etds/159/

2. Hexavalent chromium (Cr(VI)) is a known human carcinogen. Our previous studies have demonstrated that chronic low dose Cr(VI) exposure leads to bronchial epithelial (BEAS-2B) cell transformation. Neural precursor cell expressed developmentally down-regulated protein 9 (NEDD9) is a key regulator in cancer progression involved in several different hallmarks of cancer including migration, invasion, and angiogenesis. This body of work aims to discover the mechanism of NEDD9 cell transformation and aggressiveness. It also aims to inhibit NEDD9 activity by treating with natural compounds. a. Dai, J., Van Wie, P.G., Yenwong Fai, L., Kim, D., Wang, L., Poyil, P., Luo, J., Zhang, Z. (2016). Downregulation of NEDD9 by apigenin suppresses migration, invasion, and metastasis of cells. Toxicology and Applied Pharmacology. Volume 311, 15 November 2016, Pages 106-112 b. Van Wie, P.G. (2017). Positive role of NEDD9 in migration, invasion, and angiogenesis of malignant transformed cells induced by chronic exposure to hexavalent chromium. Annual Meeting of Society of Toxicology. Baltimore, MD.

75 c. Van Wie, P.G. Kim, D., Zhang, Z. (2019). NEDD9 regulates metastasis of Cr(VI)-transformed cells through FAK/Src and E-Cadherin/β-Catenin/Wnt signaling pathways. toxicology and applied pharmacology pending. d. Van Wie, P.G. Zhang, Z. (2019). Angiogenesis is increased in Cr(VI)- transformed cells by increased HIF-1α translocation and transcriptional activity mediated by NEDD9. Toxicology and applied pharmacology pending.

Additional Information: Research Support and/or Scholastic Performance Ongoing Research Support a. Major Advisor: Zhuo Zhang, University of Kentucky, College of Medicine b. Course Work: Toxicology Seminar every semester, Biomolecules and Metabolites, Molecular Biology and Genetics, Practical Statistics, Critical Scientific Readings, Ethics in Scientific Research, Cell Biology and Signaling, Physiological Communication, Research in Toxicology, Special Topics in IBS, Drug Metabolism and Disposition, Environmental and Regulatory Toxicology, Environmental Health, Cancer Epidemiology, Molecular Toxicology and Carcinogenesis, Special Problems in Toxicology, Biology and Therapy of Cancer, and Dissertation Residency. c. Cumulative GPA: 3.40 d. Qualifying Examination: 11/09/2016 e. Presentations: a. NEDD9 is critically involved in the migration of bronchial epithelial cells exposed to hexavalent chromium via the Akt signaling pathway. Presented at the new student orientation for Integrated Biomedical Science College of Medicine. 2016. Lexington, KY. b. Positive role of NEDD9 in migration, invasion, and angiogenesis of malignant transformed cells induced by chronic exposure to hexavalent chromium. Presented at the 56th Annual Meeting of Society of Toxicology. 2017, Baltimore, MD. c. NEDD9 positively regulates cancer aggressiveness by mediating invasion and angiogenesis in Chromium VI transformed bronchial epithelial cells.

76 Presented Seminar to the University of Kentucky College of Medicine. 2019, Lexington, KY. f. Career Development Activities: Ethics in Scientific Research, Completed Research Support OH007547, NIOSH Mannino, D. (PI) 01/01/13-05/01/14 The Southeast Center for Agricultural Health and Injury Prevention at the University of Kentucky. The mission of the Southeast Center for Agricultural Health and Injury Prevention (SCAHIP) is to develop and sustain an innovative program of research, education, and health promotion to prevent work-related illness and injury and to improve the health of agriculture/forestry/fishing industry workers and their families in the southeastern United States. The Southeast Center conducts and supports applied research throughout its 10- state service region: Alabama, Florida, Georgia, Kentucky, Mississippi, North Carolina, South Carolina, Tennessee, Virginia, and West Virginia.

77