KAP Regulates ROCK2 and Cdk2 in an RNA-Activated Glioblastoma Invasion Pathway

ORIGINAL ARTICLE KAP regulates ROCK2 and Cdk2 in an RNA-activated glioblastoma invasion pathway

HLi1,2,4, X Jiang1,4,YYu1, W Huang1, H Xing1, NY Agar1, HW Yang1, B Yang2, RS Carroll1 and MD Johnson1,3

Aberrant splicing of the cyclin-dependent kinase-associated phosphatase, KAP, promotes glioblastoma invasion in a Cdc2-dependent manner. However, the mechanism by which this occurs is unknown. Here we show that miR-26a, which is often amplified in glioblastoma, promotes invasion in phosphatase and tensin homolog (PTEN)-competent and PTEN-deficient glioblastoma cells by directly downregulating KAP expression. Mechanistically, we find that KAP binds and activates ROCK2. Thus, RNA-mediated downregulation of KAP leads to decreased ROCK2 activity and this, in turn, increases Rac1-mediated invasion. In addition, the decrease in KAP expression activates the cyclin-dependent kinase, Cdk2, and this directly promotes invasion by increasing retinoblastoma phosphorylation, E2F-dependent Cdc2 expression and Cdc2-mediated inactivation of the actomyosin inhibitor, caldesmon. Importantly, glioblastoma cell invasion mediated by this pathway can be antagonized by Cdk2/Cdc2 inhibitors in vitro and in vivo. Thus, two distinct RNA-based mechanisms activate this novel KAP/ROCK2/Cdk2-dependent invasion pathway in glioblastoma.

Oncogene (2015) 34, 1432–1441; doi:10.1038/onc.2014.49; published online 7 April 2014

INTRODUCTION We and others have reported a prominent role for microRNAs in Glioblastoma is the most common and most malignant intrinsic regulating growth and invasion in glioblastoma. MicroRNA 26a brain tumor in adults. At present, it is incurable. Despite maximal (mir-26a) has been reported to be amplified in glioblastoma and treatment, the median survival for glioblastoma patients remains promotes glioblastoma growth by targeting PTEN, RB1 and 8,9 14–16 months.1 Although surgery is an important part of the MEKK2. In lung cancer, miR-26a promotes invasion by targeting therapeutic strategy for glioblastoma, these tumors cannot be PTEN, raising the possibility that a similar phenomenon may occur 10 cured surgically because of extensive invasion of the surrounding in glioblastoma. In nasopharyngeal carcinoma and hepatocel- normal brain by tumor cells. Numerous investigations have lular carcinoma, however, miR-26a inhibits invasion and 11,12 examined the mechanisms underlying glioblastoma cell invasion. metastasis. Thus, the effect of miR-26a on invasion appears Receptor tyrosine kinase-activated signaling pathways, extracel- to be tissue specific, and the effect of miR-26a on glioblastoma lular matrix molecules and other mechanisms have all been shown invasion is unknown. to have a role in this process.2 We show here that both aberrant splicing and direct targeting We recently reported the existence of a Cdc2-dependent of KAP mRNA by miR-26a decrease KAP expression in glioblas- invasion pathway in glioblastoma that is regulated by the cyclin- toma. We provide the first evidence that KAP binds and activates dependent kinase-associated phosphatase, KAP.3 KAP is a dual ROCK2, and that decreased KAP expression leads to decreased specificity phosphatase that dephosphorylates Cdk2, thereby ROCK2 activity, increased Rac1-dependent invasion and increased inhibiting Cdk2 activity and cell cycle progression.4 In breast, cyclin D1 expression. Decreased KAP expression also activates prostate and liver cancers, KAP is overexpressed and reportedly Cdk2, and we show that Cdk2 itself promotes glioblastoma increases tumorigenicity.5–7 This latter result is difficult to explain, invasion via an Rb/E2F/Cdc2-dependent pathway. This RNA- given the inhibitory effect of KAP on cell cycle progression. One regulated KAP/ROCK2/Cdk2 pathway thus promotes invasion possible explanation comes from hepatocellular carcinoma, where and cell cycle progression in PTEN-competent and PTEN- KAP messenger RNA (mRNA) is overexpressed, but aberrantly deficient glioblastoma cells. spliced KAP mRNA transcripts encode KAP proteins that lack Cdk2- dephosphorylating activity.6 In glioblastoma, KAP mRNA is also RESULTS overexpressed, but aberrant splicing of KAP leads to decreased KAP protein expression and the generation of a dominant miR-26a promotes glioblastoma invasion independent of PTEN negative form of KAP.3 The decrease in KAP activity leads to PTEN is a major inhibitor of cell motility, and miR-26a targets PTEN upregulation of Cdc2 expression and an increase in glioblastoma in glioblastoma and other cancers.8–10 Based on this fact, we cell migration that can be antagonized by Cdc2 inhibition. The reasoned that miR-26a promotes invasion in glioblastoma by detailed mechanism underlying this phenomenon, however, has downregulating PTEN. As predicted, miR-26a robustly increased not been determined. invasion in PTEN-competent LN229 human glioblastoma cells. In addition to splicing, posttranscriptional regulation of gene Surprisingly, however, miR-26a also increased invasion in PTEN- expression can be accomplished by RNA-mediated gene silencing. deficient U251 and U87 glioblastoma cells in vitro (Figure 1a,

1Department of Neurosurgery, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA; 2Department of Neurosurgery, The First Afﬁliated Hospital of Zhengzhou University, Zhengzhou, China and 3Program in Neuro-Oncology, Dana Farber/Brigham and Women’s Cancer Center, Boston, MA, USA. Correspondence: Dr MD Johnson, Department of Neurosurgery, Brigham and Women’s Hospital and Harvard Medical School, 75 Francis Street, Boston, MA 02115, USA. E-mail:[email protected] 4These authors contributed equally to this work. Received 7 October 2013; revised 13 December 2013; accepted 6 January 2014; published online 7 April 2014 KAP regulates GBM invasion via ROCK2 and Cdk2 HLiet al 1433

Figure 1. miR-26a promotes glioblastoma invasion with or without PTEN. (a) Phase micrographs (left panels) or quantification of data (right panel) from a Matrigel invasion assay showing effect of miR-26a mimic (100 nM) on LN229, U251 or U87 glioblastoma cell invasion. Mean ± s.e. m., n = 20. *Po0.01, unpaired t-test. Scale is approximately 30 μm. (b) Phase micrographs (left panels) or quantification of data (right panel) from a Matrigel invasion assay showing effect of miR-26 inhibitor (antagomiR) on LN229, U251 or U87 glioblastoma cell invasion. Mean ± s.e. m., n = 20. *Po0.05 unpaired t-test. Scale approximately 30 μm. (c) Fluorescence micrograph of mouse brain section (left) and quantification of data (right) obtained 1 week after transplantation of U251 glioblastoma cells transduced with a control (labeled with DiO, green) or miR-26a (labeled with DiI, red) lentivirus. Quantitated data are mean ± s.e.m. of the ratio of red to green cells in 10 h.p.f., each taken from a series of four sequential concentric fields centered on the injection site. *Po0.01, t-test. Arrows identify invading control cells and arrowheads identify invading miR-26a-expressing cells. Scale is approximately 200 μm. (d) Fluorescence micrographs of U251 glioblastoma cells exposed to miR-26a mimic (100 nM) or a control sequence and stained for F-actin using phalloidin green. Nuclei counter stained with 4′,6-diamidino-2- phenylindole (blue). Scale is approximately 5 μm.

Po0.01, t-test). Conversely, a miR-26a inhibitor decreased regulated invasion pathway in glioblastoma that does not invasion in these cell lines, indicating a role for endogenous require PTEN. miR-26a in regulating glioblastoma invasion in vitro (Figure 1b, Po0.05, t-test). To assess the role of miR-26a on glioblastoma cell invasion in miR-26a promotes glioblastoma invasion by targeting KAP the absence of PTEN in vivo, we transduced human U251 We previously reported that aberrant KAP/CDKN3 mRNA splicing glioblastoma cells with a miR-26a lentivirus or a control lentivirus in glioblastoma leads to decreased KAP expression, increased and labeled each cell population separately with a fluorescent dye glioblastoma cell proliferation and activation of a Cdc2-dependent (DiI (red) for miR-26a and DiO (green) for control. The cells were invasion pathway.3 A review of public databases identified KAP as then mixed in equal numbers and transplanted into the adult a predicted target of miR-26a, which is amplified and over- mouse brain. After 1 week, the brains were harvested and expressed in a subpopulation of glioblastomas.8,9 Indeed, we sectioned to assess glioblastoma cell invasion. Cells overexpres- found that lentiviral-mediated overexpression of miR-26a down- sing miR-26a invaded the brain much more extensively than regulated KAP expression in glioblastoma cells (Figure 2a), and a control cells, as evidenced by the marked predominance of small-molecule miR-26a inhibitor increased KAP expression miR-26a-expressing cells at the invading edge of the transplant (Figure 2b). miR-26a also decreased KAP/CDKN3 mRNA levels (Figure 1c, Po0.01, Proportion Test). (Figure 2c). Fusion of the KAP/CDKN3 3′-untranslated region (UTR) We performed immunofluorescence studies to examine to firefly luciferase conferred regulation by miR-26a, and this the PTEN-independent effects of miR-26a on glioblastoma regulation was abolished by mutation of the specific miR-26a- cell morphology. miR-26a increased lamellipodia and stress binding site (Figure 2d). Thus, these findings identified KAP mRNA fiber formation in PTEN-deficient U251 glioblastoma cells as a direct target of miR-26a in glioblastoma. in vitro (Figure 1d). Similar results were observed in LN229 KAP knockdown using a short hairpin RNA (shRNA; (PTEN-competent) glioblastoma cells (Supplementary Figure 1). Supplementary Figure 2) mimicked the effect of miR-26a, Taken together, these data indicate the existence of a miR-26a- increasing invasion (Figure 2e) as well as lamellipodia and stress

Figure 2. miR-26a targets KAP to promote glioblastoma invasion. (a) Western blot illustrating effect of lentiviral-mediated overexpression of miR-26a on KAP expression in LN229 or U251 glioblastoma cells. (b) Effect of miR-26a inhibitor (100 nM) on KAP expression in U87, LN229 or U251 glioblastoma cells. (c) Real-time PCR analysis of KAP/CDKN3 mRNA expression in human U251 glioblastoma cells after exposure to a miR-26a mimic or miR-26a inhibitor (100 nM). Data shown are mean ± s.e.m. of three replicates. *Po0.05, unpaired t-test. (d) Luciferase reporter assay illustrating the effect of a miR-26a mimic on the activity of firefly luciferase fused to the KAP/CDKN3 3′-UTR or a KAP/CDKN3 3′-UTR in which the miR-26a-binding site was mutated. Data shown are mean ± s.e.m. of six replicates. *Po0.02, unpaired t-test. (e) Matrigel invasion assay illustrating effect of KAP shRNA overexpression on invasion by U87 glioblastoma cells. Scale is approximately 75 μm. (f) Fluorescence micrograph illustrating effect of shRNA-mediated KAP knockdown on the cytoskeleton of human U87 glioblastoma cells. Cells were stained with phalloidin green to identify F-actin. Arrows identify lamellipodia. Scale is approximately 5 μm. (g) Matrigel invasion assay (left) and quantification (right) illustrating effect of KAP overexpression on invasion by U251 glioblastoma cells after exposure to a miR-26a mimic or a control sequence. Scale is approximately 40 μm. Data shown in graph are mean ± s.e.m. of 10 h.p.f. *Po0.05, **Po0.01, unpaired t-test.

fiber formation (Figure 2f and Supplementary Figure 3) in PTEN- some cytoplasmic immunoreactivity was observed for both proteins deficient U87 glioblastoma cells. Importantly, KAP overexpression (Figure 3b). Importantly, shRNA-mediatedknockdown of KAP significantly inhibited the increase in glioblastoma cell invasion increased the cytoplasmic localization of ROCK2 (Figure 3c and evoked by miR-26a (Figure 2g). Taken together, these data Supplementary Figure 4). Using recombinant human KAP and indicate that miR-26a promotes invasion in glioblastoma by recombinant human ROCK2 in an in vitro kinase assay, we found downregulating KAP expression. that KAP significantly increased ROCK2 activity, as measured by its ability to phosphorylate a MYPT1 peptide (Figure 3d). The effect of KAP on ROCK2 activity was not blocked by the phosphatase KAP downregulation decreases ROCK2 activity and activates Rac1 inhibitor, Na3VO4,, indicating that KAP-mediated dephosphorylation The downstream pathway by which KAP regulates glioblastoma of ROCK2 was not involved, and ROCK2 had no effect on KAP cell invasion is not known. To investigate this matter, we activity (Supplementary Figure 5). These findings suggested that immunoprecipitated KAP and analyzed the immunoprecipitate decreased KAP expression leads to decreased ROCK2 activity. using mass spectrometry to identify KAP-interacting proteins. Indeed, inhibition of ROCK activity using the small-molecule Among the proteins identified was ROCK2, a kinase that has an inhibitor, Y27632 (10 μM), mimicked the effect of KAP knockdown important role in cell migration.13 We confirmed that KAP interacts by increasing glioblastoma cell invasion (Figure 3e, Po0.0001, with ROCK2 and with two related kinases, ROCK1 and MRCKβ, unpaired t-test), consistent with a previous report.14 ROCK inhibition using western blot analysis (Figure 3a). also increased lamellipodia and stress fiber formation in glioblas- Immunocytochemistry using cultured human glioblastoma cells toma cells in a manner similar to that observed after miR-26a indicated that both KAP and ROCK2 are primarily nuclear, although overexpression or KAP knockdown (Figure 3f).

Figure 3. KAP binds ROCK2 to regulate glioblastoma invasion. (a) Endogenous KAP was immunoprecipitated from HeLa or HEK 293T whole- cell lysates using a specific anti-KAP antibody, and the immunoprecipitates were then analyzed by western blot analysis for the presence of ROCK1, ROCK2 and MRCK-β expression. An antibody directed against green fluorescent protein (GFP) was used as a control. (b) Confocal fluorescence microscopy illustrating the cellular distribution of KAP and ROCK2 in human LN229 glioblastoma cells. Nuclei counter stained with 4′,6-diamidino-2-phenylindole (DAPI). Scale is approximately 5 μm. (c) ROCK2 immunoreactivity in cultured U87 glioblastoma cells transduced with a KAP shRNA lentivirus or a control lentivirus. Scale is approximately 5 μm. (d) Kinase activity assay illustrating the effect of recombinant human KAP-GST on recombinant human ROCK2. Data shown are mean ± s.e.m. of six replicates. OD, optical density. *Po0.01, unpaired t-test. (e) Phase micrographs from Matrigel invasion assay illustrating effect of a ROCK inhibitor (Y27632, 10 μM) on invasion by U251 glioblastoma cells. Scale is approximately 100 μm. (f) Effect of a ROCK inhibitor (Y27632, 10 μM) on the cytoskeleton of human U87 glioblastoma cells. Cells were stained with phalloidin to identify F-actin. Arrows identify lamellipodia. Scale is approximately 20 μm. (g) Effect of KAP overexpression, KAP knockdown (shKAP) and miR-26a overexpression on Rac1 activity in U251 glioblastoma cells. Data shown are mean ± s.e.m. of four replicates. *Po0.05, **Po0.01, unpaired t-test. (h) Data from Matrigel invasion assay illustrating effect of a Rac1 inhibitor (NSC23766, on invasion by LN229 or U251 glioblastoma cells transduced with a miR-26a lentivirus or a control lentivirus. Data shown are mean ± s.e.m. of 10 h.p.f. *Po0.05, **Po0.01, unpaired t-test.

A previous study reported that ROCK inhibition increases that KAP knockdown and miR-26a regulate glioblastoma cell glioblastoma cell invasion by activating the Rac1 GTPase.14 We invasion through additional, Rac1-independent mechanisms. A therefore reasoned that if mir-26a overexpression and KAP well-known function of KAP is the dephosphorylation and knockdown promote invasion by inhibiting ROCK activity, they inactivation of the cyclin-dependent kinase, Cdk2. We confirmed should also activate Rac1. Indeed, both KAP knockdown and our previous finding3 that KAP overexpression decreases Cdk2 miR-26a overexpression significantly increased Rac1 activity, Thr160 phosphorylation in U87 glioblastoma cells (Figure 4a), and whereas KAP overexpression decreased it (Figure 3g). Moreover, that KAP knockdown increases Cdk2 Thr160 phosphorylation the small-molecule Rac1 inhibitor, NSC23766 (50 μM), partially (Figure 4b). Consistent with our finding that miR-26a down- antagonized the ability of miR-26a to promote invasion in PTEN- regulates KAP expression, a miR-26a mimic increased Cdk2 Thr160 competent LN229 and PTEN-deficient U251 glioblastoma cells phosphorylation in U251 glioblastoma cells (Figure 4c), whereas a (Figure 3h). These findings indicate that RNA-dependent down- miR-26a inhibitor decreased it (Figure 4d). regulation of KAP leads to decreased ROCK2 activity, increased Although Cdk2 expression has been associated with invasion in Rac1 activity and increased migration. other cancers,15,16 direct evidence that Cdk2 promotes invasion in human cancers is limited.17 We therefore examined whether Cdk2 has a role in glioblastoma cell invasion. In order Cdk2 is activated by KAP downregulation and promotes to minimize potentially confounding effects of decreased Cdk2 on invasion proliferation, short-time course (overnight) invasion assays were Although Rac1 inhibition partially antagonized the effect of performed. Knockdown of endogenous Cdk2 inhibited invasion in miR-26a on invasion in PTEN-deficient U251 glioblastoma cells, it PTEN-competent (LN229) and PTEN-deficient (U87) glioblastoma did not block it completely (Figure 3h). This raised the possibility cells. Cdk2 knockdown also antagonized the increase in

Figure 4. KAP regulates invasion by regulating Cdk2 activity. (a) Effect of KAP overexpression on expression of phosphorylated Cdk2 in U87 glioblastoma cells. (b) Effect of small interfering RNA (siRNA)-mediated Cdk2 knockdown on Cdk2 expression and Cdk2 phosphorylation in U87 and LN229 glioblastoma cells. (c) Effect of miR-26a mimic (100 nM) on Cdk2 phosphorylation in U251 glioblastoma cells. (d) Effect of a miR-26a inhibitor (100 nM) on phosphorylated Cdk2 expression in U251 glioblastoma cells. (e) Matrigel invasion assay (left) and quantiﬁcation (right) illustrating effect of Cdk2 knockdown on invasion by U87 and LN229 glioblastoma cells expressing KAP shRNA or a control shRNA. Scale is approximately 30 μm. Data shown are mean ± s.e.m. of 10 h.p.f. *Po0.05, **Po0.01 unpaired t-test. (f) Matrigel invasion assay (left) and quantiﬁcation (right) illustrating effect of Cdk2 knockdown on invasion by U251 glioblastoma cells transduced with a miR-26a lentivirus or a control lentivirus. Scale is approximately 30 μm. Data shown are mean ± s.e.m. of 10 h.p.f. *Po0.05, **Po0.01, unpaired t-test.

glioblastoma cell invasion caused by decreased KAP expression Cdc2.18 Our ﬁnding that KAP knockdown activates Cdk2 in (Figure 4e) and by mir-26a (Figure 4f). Taken together, these data glioblastoma suggested that it may upregulate Cdc2 by increasing indicate that the effect of decreased KAP expression on Cdk2-dependent Rb phosphorylation. Consistent with this notion, glioblastoma cell invasion is mediated both by Cdk2 and ROCK2. KAP knockdown led to Rb hyperphosphorylation on S780, S795 and S807/811 in human glioblastoma cells (Figure 5a). In addition to the observed effect on Cdk2, studies conducted KAP regulates phosphorylationof caldesmon and myosin light here indicated that KAP knockdown also activated Rac1 (Figure 3g). chain (MLC) Previous studies have reported that Rac1 activation upregulates We previously reported that decreased KAP expression promotes expression of the Cdk4/Cdk6 activator, cyclin D1. Cdk2 works glioblastoma invasion by upregulating Cdc2.3 Cdk2 regulates Cdc2 cooperatively with Cdk4 to phosphorylate and inactivate Rb.18 We levels by phosphorylating and inactivating the retinoblastoma observed that both KAP knockdown and ROCK inhibition increased protein (Rb). Hyperphosphorylation of Rb by cyclin-dependent cyclin D1 expression (Figure 5b). Moreover, ROCK inhibition kinases like Cdk2 inactivates the protein and releases the E2F1 increased Rb phosphorylation(Figure 5c) in a manner similar to transcription factor, which, in turn, transcriptionally upregulates that observed after KAP knockdown.

Figure 5. miR-26a and KAP regulate caldesmon and myosin light chain (MLC) phosphorylation. (a) Effect of KAP knockdown (shKAP) on Rb phosphorylationin human LN229 glioblastoma. (b) Effect of KAP knockdown (shKAP) or the ROCK inhibitor, Y27632 (10 μM), on cyclin D1 expression in LN229 glioblastoma cells. (c) Effect of the ROCK inhibitor, Y27632 (10 μM), on Rb phosphorylationin LN229 glioblastoma cells. (d) Effect of KAP knockdown (shKAP) or ROCK inhibition using Y27632 (10 μM) on Cdc2 expression in U87 glioblastoma cells. (e) Effect of overexpressing active ROCK2 (ROCK2-A) or a kinase dead ROCK2 mutant (ROCK2-KD) on Cdc2 expression in U87 glioblastoma cells. (f) Effect of Cdk2 knockdown on Cdc2 expression and KAP shRNA-mediatedCdc2 upregulation in U87 glioblastoma cells. (g) Effect of a miR-26a mimic (100 nM) on Cdc2 expression in U251 glioblastoma cells, or effect of lentivirus-mediated miR-26a overexpression on Cdc2 expression in U87 glioblastoma cells. (h) Effect of a miR-26a inhibitor (100 nM) on Cdc2 expression in U251 glioblastoma cells. (i) Effect of a miR-26a lentivirus or a control lentivirus on caldesmon phosphorylation in U87 glioblastoma cells. (j) Left :Effect of KAP knockdown (shKAP) or the ROCK inhibitor, Y27632 (10 μM), on caldesmon phosphorylation in U87 glioblastoma cells. Right: Effect of overexpressing KAP or a phosphatase dead KAP mutant (KAPC140S) on caldesmon phosphorylation in U87 glioblastoma cells. (k) Left: Effect of overexpressing KAP or a phosphatase dead KAP mutant (KAPC140S) on MLC phosphorylationin U87 glioblastoma cells. Right: Effect of KAP knockdown (shKAP) on MLC phosphorylationin U87 glioblastoma cells.

As predicted from the observed increases in Rb phospho- increased caldesmon phosphorylation (Figure 5i). Likewise, KAP rylation, KAP knockdown and ROCK inhibition upregulated Cdc2 knockdown and ROCK inhibition also increased caldesmon expression in glioblastoma cells (Figure 5d). In contrast, these phosphorylation (Figure 5j). Overexpression of a phosphatase manipulations had no effect on Cdk5 expression (Supplementary dead form of KAP increased caldesmon phosphorylation as well Figure 6). Overexpression of a kinase dead form of ROCK2 also (Figure 5j), providing further evidence that KAP alters cell motility increased Cdc2 levels, providing further evidence that ROCK2 by regulating caldesmon activity. regulates this pathway (Figure 5e). Importantly, Cdk2 knockdown Cdc2 activation also increases MLC phosphorylation, either via partially blocked the increase in Cdc2 levels caused by decreased direct phosphorylation20 or by phosphorylation and activation of KAP expression, providing further evidence that Cdk2 has a role in MLC kinase.21 Whereas overexpression of wild-type KAP decreased KAP-regulated glioblastoma cell migration (Figure 5f). Consistent MLC phosphorylation, overexpression of a phosphatase dead KAP with their ability to downregulate KAP levels, exposure to a mutant or KAP knockdown increased it (Figure 5k). miR-26a mimic or lentiviral-mediated overexpression of miR-26a also increased Cdc2 expression in glioblastoma cells (Figure 5g). Likewise, a miR-26a inhibitor decreased Cdc2 expression Cdk2/Cdc2 inhibition decreases glioblastoma stem-like cell (Figure 5h). invasion We previously reported that decreases in KAP protein levels Glioblastomas contain a subpopulation of neural stem-like cells promote glioblastoma cell motility and invasion in a Cdc2- that display increased tumorigenicity, resistance and invasiveness dependent manner.3 In Schwann cells, Cdc2 has been reported when compared with other cells within the tumor.22 We found to promote migration by phosphorylating and inactivating that KAP knockdown in glioblastoma cancer stem-like cells also caldesmon, a protein that inhibits actomyosin contractility.19 In increased invasion (Figure 6a). We next examined whether glioblastoma cells, we found that overexpression of miR-26a inhibition of Cdk2 and Cdc2 using a small-molecule inhibitor,

Figure 6. The KAP/ROCK2/Cdk2 pathway regulates glioblastoma stem-like cell invasion. Cdk2/Cdc2 inhibitors decrease glioblastoma invasion in vitro and in vivo.(a) Matrigel invasion assay illustrating effect of the Cdk2/Cdc2 inhibitor, purvalanol A (Purv A; 1 μM), on glioblastoma stem- like cell invasion induced by shRNA-mediated KAP knockdown or exposure to the ROCK inhibitor, Y27632 (10 μM). Scale is approximately 80 μm. Quantification of these data is shown to the left. Mean ± s.e.m. of four high-powered fields. * Po0.05, **Po0.01, unpaired t-test. (b) Left: Fluorescence images of mouse brain section after intracranial transplantation of glioblastoma stem-like cells labeled with DiI. Osmotic pumps were implanted to infuse saline (control) or Purv A (5 μM) into the opposite hemisphere. After 1 week, the brains were collected and processed for immunohistochemistry. Invasion distance from the transplantation site was determined by counting the number of cells in a sequential series of radial concentric fields. Third panel shows higher magnification view of a control mouse brain section containing invading DiI-labeled human glioblastoma cells (arrows). Nuclei counterstained with 4′,6-diamidino-2-phenylindole (DAPI) to demonstrate endogenous cells. Data from this experiment are quantified at right. Data shown are the mean ± s.e.m., n = 3. *Po0.05, unpaired t-test.

Figure 7. Summary diagram illustrating the RNA-activated KAP/ROCK2/Cdk2 invasion pathway in glioblastoma.

purvalanol A, decreases KAP-dependent invasion by glioblastoma previously reported that aberrant splicing of KAP mRNA in stem-like cells in a manner similar to that observed for established glioblastoma leads to decreased KAP protein expression and glioblastoma cell lines.3 Purvalanol A significantly decreased increased glioblastoma cell invasion.3 Here we show that KAP glioblastoma stem-like cell invasion in vitro, and it antagonized expression is also decreased in glioblastoma by a different RNA- the increase in invasion caused by KAP knockdown or ROCK based mechanism, namely miR-26a-mediated downregulation. inhibition (Figure 6a). Consistent with these in vitro invasion miR-26a is amplified in a subpopulation of glioblastomas, where it 8,9 studies, infusion of purvalanol A (5 μM) into the mouse brain using promotes growth by targeting PTEN, RB1 and MEKK2. We report osmotic mini-pumps decreased glioblastoma stem-like cell inva- here that, in addition to PTEN, miR-26a targets KAP to promote sion (Figure 6b). Taken together, these data reveal a pathway in invasion in glioblastoma. Previously, we showed that the effect of which RNA-mediated downregulation of KAP expression inhibits KAP on invasion was dependent on upregulation of a cyclin- ROCK2 and activates Rac1, Cdk2 and Cdc2, thereby altering dependent kinase, Cdc2, but the mechanism by which KAP cytoskeletal dynamics and promoting glioblastoma cell invasion regulates Cdc2 levels and how this alters glioblastoma cell (Figure 7). invasion was not determined.3 Here we show that KAP regulates Cdc2-dependent invasion via Cdk2 dephosphorylation and a novel interaction with ROCK2. DISCUSSION The Rho kinases, ROCK1 and ROCK2, are closely related kinases KAP is a dual specificity phosphatase that inhibits cell cycle those have critical roles in cytoskeletal regulation and cell progression by dephosphorylating and inactivating Cdk2.4 We migration. Both kinases are widely expressed in most tissues,

Oncogene (2015) 1432 – 1441 © 2015 Macmillan Publishers Limited KAP regulates GBM invasion via ROCK2 and Cdk2 HLiet al 1439 with ROCK2 being most abundant in the brain.23 Phosphorylation MATERIALS AND METHODS 24,25 of the activation loop is not required for full ROCK activity. Tumor samples and cell lines Instead, the activity of ROCK2 is controlled by autoinhibitory All investigations were performed after informed consent was obtained C-terminal RB and PH domains that bind and inhibit the and in accordance with an institutional review board protocol approved by 26 kinase domain. Binding of Rho-GTP to the RB domain of ROCK2 the Partners Human Research Committee at Brigham and Women's or ROCK1 induces a conformational change that frees and Hospital. Fresh frozen primary glioblastoma or non-tumor brain samples activates the kinase domain. ROCK2 can be activated by binding were obtained from the Brain Tumor Tissue Bank at Brigham and Women's to molecules other than Rho-GTP. Included among these are Hospital. Human glioblastoma cell lines (U87, LN229, U251) were obtained nucleophosmin,27,28 arachidonic acid and phosphatidylinositol from the American Type Culture Collection (Manassas, VA, USA). fi phosphates.29 Here we report the first evidence that KAP Glioblastoma cell lines were cultured in Dulbecco's modi ed Eagle's medium supplemented with 10% fetal bovine serum and penicillin/ binds and activates ROCK2. KAP and ROCK2 are both localized streptomycin and maintained at 37 °C in a 5% CO2 atmosphere. in nuclear and perinuclear regions, and downregulation of KAP Glioblastoma stem-like cells were isolated from surgical glioblastoma expression increased the cytoplasmic localization of ROCK2. specimens and maintained as tumorspheres in serum-free medium as we Recombinant human KAP increased the activity of recombinant have described previously.36 human ROCK2 in an in vitro kinase assay, indicating a direct interaction between these two proteins. This effect did not require the phosphatase activity of KAP, suggesting a direct binding Cloning and lentivirus production Full-length human KAP complementary DNA (cDNA) was cloned from total mechanism of KAP regulation similar to that which has been – observed with other molecules such as nucleophosmin. Interest- RNA extracted from human 293 T cells by reverse transcription PCR and validated by direct DNA sequencing. A myc-KAP fusion protein was created ingly, we found that KAP also interacts with two other kinases that β by cloning full-length KAP into an expression vector that resulted in adding a regulate cell migration, ROCK1 and MRCK- . Additional studies will myc tag to the NH2 terminus of the protein. The KAP phosphatase dead determine whether KAP regulates the activity of these kinases mutant (KAPC140S) was generated by single amino-acid substitution from as well. Cys140 to Ser and a hemagglutinin tag was added to its NH2 terminus. ROCK inhibits Rac1 in glioblastoma cells.14 This helps to explain Myc-KAP and inactive KAPC140S were cloned into a pLenti-IRES-EGFP vector how a decrease in KAP expression activates Rac1. Rac1 regulates (Clontech, Mountain View, CA, USA). A KAP shRNA expression vector directed cell motility and invasion in numerous cell types, including against KAP sequence (5′-534-GCAATACAGACCATCAAGCAA-555-3′)anda glioblastoma.14 Although KAP knockdown activated Rac1 to control shRNA vector (pSM2c) were purchased from Open Biosystems (Huntsville, AL, USA). promote glioblastoma invasion, Rac1 inhibition only partially fl fi The hsa-miR-26a sequence with ~ 320 bp of anking sequence was antagonized the effect of KAP knockdown. Our nding that Cdk2 cloned from human genomic DNA by PCR and confirmed by DNA also regulates glioblastoma cell invasion helps to explain this sequencing. The forward primer was 5′-CGAGGATCCATTGAGGGGAAAAAG observation. Cdk2 overexpression has been associated with tumor TCA-3′, and the reverse primer was 5′- CGAGCTAGCAGGCTTCCAATGGAT 15,16 progression and metastasis. Surprisingly, however, only CAG-3′. The PCR product was transferred into the pLenti-IRES-GFP vector sporadic reports have suggested a direct role for Cdk2 in cell and packaged in 293T cells. A control enhanced green fluorescent protein motility or invasion. In a mouse breast cancer model, tumors (EGFP) lentivirus lacking a microRNA sequence was also prepared. LN229 initiated by constitutive Cdk2 activation were found to contain an and U251 GBM cells were transduced with a control or a miR-26a lentivirus, invasive basal-like component.30 In addition, proteins such as and stable cell lines were selected using blasticidin. cyclin E or cyclin A that regulate Cdk2 activity have been 31 associated with invasion and metastasis. Cdk2-dependent Immunocytochemistry 17 phosphorylation of SIRT2 promotes cell motility. Here we For immunocytochemistry, glioblastoma cells were plated on coverslips present evidence that Cdk2 promotes invasion by phosphorylat- coated with poly-D-lysine (BD, Bedford, MA, USA) and cultured for 48 h. The ing Rb1, upregulating Cdc2, inactivating caldesmon and increas- coverslips were then placed in 1% formaldehyde in phosphate-buffered ing MLC phosphorylation. Decreases in KAP levels because of saline for 30 min at room temperature. After fixation, the coverslips were aberrant splicing or miR-26a expression thus activate this pathway washed and incubated in primary antibody for 60 min at room by increasing Cdk2 activation. These findings help to explain our temperature. The coverslips were then rinsed and incubated in the Alexa observation that the effect of KAP on migration requires its Flour 488 or 594 secondary antibodies (Molecular Probes, Eugene, OR, USA; phosphatase activity.3 Invitrogen, Grand Island, NY, USA) for 45 min at room temperature. The coverslips were again rinsed and incubated in 4',6-diamidino-2-phenylin- Interestingly, Rock inhibition also increased Rb phosphorylation, dole (Molecular Probes, Invitrogen) for 5 min to label the nuclei. The upregulated Cdc2 and promoted caldesmon phosphorylation and immunofluorescence staining was then visualized using a fluorescence MLC phosphorylation. Rac1 has previously been reported to microscope. upregulate the Cdk4/Cdk6 activator, cyclin D1.32 Indeed enhanced green fluorescent protein (EGFP), both miR-26a and KAP knockdown activated Rac1 and upregulated cyclin D1 expression in the Real-time quantitative PCR 37 current study. Thus, KAP alters ROCK2 and Cdk2 activity to Real-time PCR was performed as we have described previously. Briefly, convergently upregulate Cdc2 expression. total RNA was extracted from LN229 or U251 GBM cell lines using Trizol Although the focus of the current study was glioblastoma (Invitrogen, Carlsbad, CA, USA). cDNA was then prepared using random primers or miR-26a and U6-specific primers according to the TaqMan Gene invasion, we showed previously that KAP also inhibits glioblas- 3 Expression Assay or MicroRNA Assay protocols (Applied Biosystems, toma cell proliferation. Under normal conditions, KAP is Carlsbad, CA, USA). Reactions contained 1 μg of total RNA from each expressed in a cell cycle-dependent manner and controls the sample. KAP, miR-26a or U6 TaqMan Real-time PCR probes were purchased G1/S transition. A recent study indicates that KAP dephosphor- from Applied Biosystems/Life Technologies (Carlsbad, CA, USA). Glycer- ylates and inactivates Cdc2 during mitotic exit.33 This effect occurs aldehyde 3-phosphate dehydrogenase or U6 RNA was used as endogen- in addition to the downregulation of Cdc2 expression that we ous controls for normalization. 6 ng of cDNA was used for real-time PCR reported previously.3 Interestingly, ROCK2 regulates cytokinesis34 analysis in a final reaction volume of 20 μl. At least four wells were run for and centrosome number.35 Taken together, these data identify each sample, and experiments were performed in duplicate. KAP as a major regulator of cell division via interactions with numerous target proteins. Our finding that aberrant splicing or Western blot analysis and immunoprecipitation miR-26a decreases KAP expression to promote glioblastoma Western blot analyse is were performed as described previously.3 Briefly, growth and invasion indicates an important role for this total protein was extracted and separated by gel electrophoresis. phosphatase in glioblastoma aggressiveness. The protein was then transferred to nitrocellulose membranes, and

© 2015 Macmillan Publishers Limited Oncogene (2015) 1432 – 1441 KAP regulates GBM invasion via ROCK2 and Cdk2 HLiet al 1440 these were probed overnight using the appropriate primary antibodies. KAP-interacting proteins was then examined to identify proteins that have The antibodies used were directed against KAP, Cdk2, Cdc2, ROCK1, previously been implicated in cell migration. Interaction with KAP was ROCK2, MRCK-β, p-Rb-S780, p-Rb-S795, p-Rb-S807/811 (Cell Signaling confirmed by western blot analysis as described. Technology, Beverly, MA, USA); Cyclin D1, caldesmon, p-caldesmon (Santa Cruz Biotechnology, Dallas, TX, USA); p-MLC, anti-β-actin (Sigma- Aldrich Corp., St Louis, MO, USA). After incubation in the appropriate Luciferase reporter assays secondary antibodies, immunoreactive bands were visualized using ′ chemiluminescence. Full-length human KAP 3 -UTR cDNA fragments containing the miR-26a- For immunoprecipitation, whole-cell lysates prepared from cultured cells binding site were cloned from human genomic DNA by reverse – or from frozen human brain tissues (glioblastoma or non-tumor brain) transcription PCR and validated by direct DNA sequencing. The forward ′ ′ were immunoprecipitated with 1 μg of specific antibody that had been primer was 5 -AAGGAATTCAAATAGCATATATATGACC-3 and the reverse ′ ′ prebound to 30 μl of Protein A-Sepharose 4B beads (Amersham primer was 5 -AGCGGCCGCTGTCAATAAAACTTTAGGA-3 . Two nucleotides Biosciences Corp., Piscataway, NJ, USA) overnight at 4 °C. The beads were within the binding site were mutated using overlapping extension PCR and washed twice and the cold immunoprecipitates were boiled in SDS and validated by direct DNA sequencing. For construction of the mutant ′ processed for western blot analysis using the appropriate antibodies as sequence, the forward primer was 5 -TCAAGCTGAATGTAAATGTACATGTG ′ ′ ′ described above. -3 and the reverse primer was 5 - ATGTACATTTACATTCAGCTTGATAA -3 . KAP 3′-UTR cDNA and mutant KAP 3′-UTR cDNA were fused into the pMIR-reporter luciferase vector (Applied Biosystems) to generate luciferase Invasion assays fused to the 3′-UTR of KAP or the mutated 3′-UTR of KAP. 293T cells were The Matrigel transwell invasion assay was performed as we have described then transfected with these constructs or a control luciferase construct. previously.3 To minimize possible effects of proliferation, assays were A pRL-TK vector was co-transfected to enable normalization for differences performed during a short overnight time period. For each condition, the in transfection efficiency. After 24 h, the cells were exposed to either a number of invading cells in each of 20 random fields was counted using a miR-26a mimic or a mimic control oligonucleotide (100 nM). After an x20 phase objective. Two independent experiments were performed. additional 24 h, the cells were lysed and luminescence was detected using Statistical significance was determined using the unpaired t-test. a luminometer according to the manufacturer’s protocol. Six wells were To assess invasion in vivo, U251 glioblastoma cells transduced with a run for each condition. Experiments were repeated in triplicate. Statistical miR-26a lentivirus or control lentivirus were labeled with, DiI (red) or DiO significance was determined using the unpaired t-test. (green, Life Technologies), respectively. The cells were mixed in a 1:1 ratio, and 2 × 105 cells were then injected intracranially into the frontal lobes of nude mice. After 1 week, the animals were killed and the brains were Rac1 activity assay sectioned and processed for immunofluorescence imaging. The ratio of Rac1 activity was determined using the G-LISA Rac1 activation assay kit invading glioblastoma cells transduced with a miR-26a lentivirus (red) ’ versus a control lentivirus (green) was then assessed in a series of (Cytoskeleton Inc., Denver, CO, USA) according to the manufacturer s fi fl protocol. Briefly, control or experimental glioblastoma cells were first lysed, concentric radial elds using a Nikon TE300 uorescence microscope fi (Nikon, Melville, NY, USA). The experiment was repeated in triplicate, and and the lysates were then incubated in Rac1-GTP antibody af nity plates statistical significance was determined using the t-test. for 30 min. The bound Rac1-GTP was then detected in a colorimetric assay using a microplate reader at 490 nm. There were three replicates, experiments were repeated in duplicate and statistical significance was In vivo delivery of Cdk2/Cdc2 inhibitor determined using the unpaired t-test. Primary human glioma-derived stem-like cells (1 × 105) were labeled with DiI and implanted into the frontal cortex of 6-week-old male nude mice (n = 6). At the time of surgery, the animals were also implanted on the ROCK2 kinase and dual specificity phosphatase activity assays opposite side with osmotic mini-pumps (Alzet Company, Cupertino, CA, Recombinant human ROCK2 and human GST-KAP were purchased from USA) containing saline or the Cdk2/Cdc2 inhibitor, purvalanol A (5 μM, Stratagene (La Jolla, CA, USA). ROCK2 activity was measured using a 96- Sigma-Aldrich Corp.) diluted in saline. After 1 week, the animals were killed well ROCK activity assay kit (Cell Biolabs, San Diego, CA, USA) according to and the brains were harvested for histochemical analysis. Axial brain the manufacturer’s protocol. This enzyme immunoassay is based upon the sections from control and purvalanol A-treated animals were prepared at specific phosphorylationof myosin phosphatase target subunit 1 (MYPT1) the site of tumor cell transplantation and examined under epifluorescence at Thr696 by ROCK. A strip well microtiter plate was pre-coated with a for invading cells. Invasion distance from the injection site was determined recombinant MYPT1 peptide. To determine the effect of KAP on ROCK2 by identifying the number of DiI-labeled cells in a progressive series of activity, GST-KAP was added at increasing concentrations to a reaction concentric radial fields centered on the injection site. Statistical buffer containing recombinant ROCK2. MYPT1 phosphorylated by ROCK significance was determined using the unpaired t-test. was detected using an anti-phospho-MYPT1 (Thr696) antibody and quantitated on a microplate reader at 450 nm. There were six replicates RNAi studies for each condition, and experiments were repeated in duplicate. Statistical fi MicroRNA oligonucleotide mimic and inhibitor for miR-26a, as well as the signi cance was determined using the unpaired t-test. corresponding control oligonucleotides, were purchased from Life For phosphatase activity assays, recombinant GST-KAP (50 U/ml) was dissolved in 50 μl of assay buffer (20 mM Tris, pH 7.5; 5 mM MgCl2;1mM Technologies. Cdk2 small interfering RNA and matched oligonucleotide β control were purchased from Life Technologies. miR-26a mimic or inhibitor EGTA; 0.02% -mercaptoethanol; 0.1 mg/ml bovine serum albumin) and was added to the medium without the use of additional transfection placed in each well of a 96-well plate at room temperature. Fifty microliters of 10 mM p-nitrophenylphosphate (pNPP, also in assay buffer) reagents at a concentration of 100 nM for 48 h before performing experiments. For Cdk2 small interfering RNA experiments, oligofectamine was added to each well. In some experiments, recombinant human ROCK2 (Life Technologies) was used to transiently transfect the cells overnight was added to the reaction mixture at increasing concentrations. The reaction was then allowed to proceed for 30 min at room temperature, and before performing experiments. Experiments were repeated in duplicate μ and statistical significance was determined using the unpaired t-test. was stopped by adding 20 l of 5 N NaOH. After mixing for 30 s, the pNPP reaction product was detected colorimetrically at 405 nm on a microplate reader. In some experiements, phosphatase activity was inhibited using Immunoprecipitation experiments Na3VO4 (10 μM). There were six replicates for each condition, and For KAP immunoprecipitation experiments, whole-cell lysates from experiments were repeated in duplicate. Statistical significance was cultured cells were prepared using a non-denaturing lysis buffer (20 mM determined using the unpaired t-test. Tris HCl pH 8, 137 mM NaCl, 10% glycerol; 1% NP-40, 2 mM EDTA). The lysates were immunoprecipitated with 1 μg of anti-KAP antibody prebound to 30 μl of protein A-Sepharose 4B (GE Healthcare, Pittsburgh, PA, USA, http://www.gelifesciences.com). Appropriate isotype antibodies were used as controls. The beads were washed, and the eluates were digested with CONFLICT OF INTEREST trypsin and analyzed by mass spectrometry. A list of the top 50 potential The authors declare no conflict of interest.

Oncogene (2015) 1432 – 1441 © 2015 Macmillan Publishers Limited KAP regulates GBM invasion via ROCK2 and Cdk2 HLiet al 1441 ACKNOWLEDGEMENTS 18 Berthet C, Kaldis P. Cdk2 and Cdk4 cooperatively control the expression of Cdc2. This work was supported by R01 NS062219 from the National Institute of Neurological Cell Div 2006; 1:10. Disorders and Stroke, a National Institutes of Health Director’s New Innovator Award 19 Han IS, Seo TB, Kim KH, Yoon JH, Yoon SJ, Namgung U. Cdc2-mediated Schwann (DP2OD002319) and a Brain Science Foundation Research Award to MDJ. cell migration during peripheral nerve regeneration. J Cell Sci 2007; 120:246–255. 20 Satterwhite LL, Lohka MJ, Wilson KL, Scherson TY, Cisek LJ, Corden JL et al. Phosphorylationof myosin-II regulatory light chain by cyclin-p34cdc2: a REFERENCES mechanism for the timing of cytokinesis. J Cell Biol 1992; 118:595–605. 21 Morrison DL, Sanghera JS, Stewart J, Sutherland C, Walsh MP, Pelech SL. 1 Mrugala MM. Advances and challenges in the treatment of glioblastoma: a clin- Phosphorylationand activation of smooth muscle myosin light chainkinase ician's perspective. Discov Med 2013; 15:221–230. by MAP kinase and cyclin-dependent kinase-1. Biochem Cell Biol 1996; 74: 2 Kwiatkowska A, Symons M. Signaling determinants of glioma cell invasion. Adv 549–557. Exp Med Biol 2013; 986:121–141. 22 Knights MJ, Kyle S, Ismail A. Characteristic features of stem cells in glioblastomas: 3 Yu Y, Jiang X, Schoch BS, Carroll RS, Black PM, Johnson MD. Aberrant splicing of from cellular biology to genetics. Brain Pathol 2012; 22: 592–606. cyclin-dependent kinase-associated protein phosphatase KAP increases pro- 23 Tawara S, Fukumoto Y, Shimokawa H. Effects of combined therapy with a Rho- liferation and migration in glioblastoma. Cancer Res 2007; 67:130–138. kinase inhibitor and prostacyclin on monocrotaline-induced pulmonary hyper- 4 Hannon GJ, Casso D, Beach D. KAP: a dual specificity phosphatase that interacts tension in rats. J Cardiovasc Pharmacol 2007; 50:195–200. with cyclin-dependent kinases. Proc Natl Acad Sci USA 1994; 91: 1731–1735. 24 Yamaguchi H, Kasa M, Amano M, Kaibuchi K, Hakoshima T. Molecular mechanism 5 Lin WR, Lai MW, Yeh CT. Cyclin-dependent kinase-associated protein phosphatase is overexpressed in alcohol-related hepatocellularcarcinoma and influences for the regulation of rho-kinase by dimerization and its inhibition by fasudil. 14 – xenograft tumor growth. Oncol Rep 2013; 29: 903–910. Structure 2006; : 589 600. 6 Yeh CT, Lu SC, Chen TC, Peng CY, Liaw YF. Aberrant transcripts of the cyclin- 25 Jacobs M, Hayakawa K, Swenson L, Bellon S, Fleming M, Taslimi P et al. The dependent kinase-associated protein phosphatase in hepatocellularcarcinoma. structure of dimeric ROCK I reveals the mechanism for ligand selectivity. J Biol 281 – Cancer Res 2000; 60: 4697–4700. Chem 2006; :260 268. 7 Lee SW, Reimer CL, Fang L, Iruela-Arispe ML, Aaronson SA. Overexpression of 26 Amano M, Chihara K, Nakamura N, Kaneko T, Matsuura Y, Kaibuchi K. The COOH kinase-associated phosphatase (KAP) in breast and prostate cancer and inhibition terminus of Rho-kinase negatively regulates rho-kinase activity. J Biol Chem 1999; 274 – of the transformed phenotype by antisense KAP expression. Mol Cell Biol 2000; 20: : 32418 32424. 1723–1732. 27 Ferretti R, Palumbo V, Di Savino A, Velasco S, Sbroggio M, Sportoletti P et al. 8 Kim H, Huang W, Jiang X, Pennicooke B, Park PJ, Johnson MD. Integrative genome Morgana/chp-1, a ROCK inhibitor involved in centrosome duplication and 18 – analysis reveals an oncomir/oncogene cluster regulating glioblastoma survivor- tumorigenesis. Dev Cell 2010; :486 495. ship. Proc Natl Acad Sci USA 2010; 107: 2183–2188. 28 Ma Z, Kanai M, Kawamura K, Kaibuchi K, Ye K, Fukasawa K. Interaction between 9 Huse JT, Brennan C, Hambardzumyan D, Wee B, Pena J, Rouhanifard SH et al. The ROCK II and nucleophosmin/B23 in the regulation of centrosome duplication. Mol 26 – PTEN-regulating microRNA miR-26a is amplified in high-grade glioma and facil- Cell Biol 2006; :9016 9034. itates gliomagenesis in vivo. Genes Dev 2009; 23: 1327–1337. 29 Yoneda A, Multhaupt HA, Couchman JR. The Rho kinases I and II regulate different 10 Liu B, Wu X, Liu B, Wang C, Liu Y, Zhou Q et al. MiR-26a enhances metastasis aspects of myosin II activity. J Cell Biol 2005; 170:443–453. potential of lung cancer cells via AKT pathway by targeting PTEN. Biochim Biophys 30 Corsino PE, Davis BJ, Norgaard PH, Parker NN, Law M, Dunn W et al. Mammary Acta 2012; 1822: 1692–1704. tumors initiated by constitutive Cdk2 activation contain an invasive basal-like 11 Yang X, Liang L, Zhang XF, Jia HL, Qin Y, Zhu XC et al. MicroRNA-26a suppresses component. Neoplasia 2008; 10: 1240–1252. tumor growth and metastasis of human hepatocellularcarcinoma by targeting 31 Bales E, Mills L, Milam N, McGahren-Murray M, Bandyopadhyay D, Chen D et al. interleukin-6-Stat3 pathway. Hepatology 2013; 58:158–170. The low molecular weight cyclin E isoforms augment angiogenesis and metas- 12 Yu L, Lu J, Zhang B, Liu X, Wang L, Li SY et al. miR-26a inhibits invasion and metastasis tasis of human melanoma cells in vivo. Cancer Res 2005; 65:692–697. of nasopharyngealcancer by targeting EZH2. Oncol Lett 2013; 5:1223–1228. 32 Joyce D, Bouzahzah B, Fu M, Albanese C, D'Amico M, Steer J et al. Integration of 13 Wilkinson S, Paterson HF, Marshall CJ. Cdc42-MRCK and Rho-ROCK signalling Rac-dependent regulation of cyclin D1 transcription through a nuclear factor- cooperate in myosin phosphorylationand cell invasion. Nat Cell Biol 2005; 7: kappaB-dependent pathway. J Biol Chem 1999; 274: 25245–25249. 255–261. 33 Nalepa G, Barnholtz-Sloan J, Enzor R, Dey D, He Y, Gehlhausen JR et al. The tumor 14 Salhia B, Rutten F, Nakada M, Beaudry C, Berens M, Kwan A et al. Inhibition of Rho- suppressor CDKN3 controls mitosis. J Cell Biol 2013; 201:997–1012. kinase affects astrocytoma morphology, motility, and invasion through activation 34 Lowery DM, Clauser KR, Hjerrild M, Lim D, Alexander J, Kishi K et al. Proteomic of Rac1. Cancer Res 2005; 65: 8792–8800. screen defines the Polo-box domain interactome and identifies Rock2 as a Plk1 15 Li JQ, Miki H, Wu F, Saoo K, Nishioka M, Ohmori M et al. Cyclin A correlates with substrate. EMBO J 2007; 26: 2262–2273. carcinogenesis and metastasis, and p27(kip1) correlates with lymphatic invasion, 35 Wang HF, Takenaka K, Nakanishi A, Miki Y. BRCA2 and nucleophosmin coregulate in colorectal neoplasms. Hum Pathol 2002; 33:1006–1015. centrosome amplification and form a complex with the Rho effector 16 Li JQ, Miki H, Ohmori M, Wu F, Funamoto Y. Expression of cyclin E and cyclin- kinase ROCK2. Cancer Res 2011; 71:68–77. dependent kinase 2 correlates with metastasis and prognosis in colorectal 36 Kim TM, Huang W, Park R, Park PJ, Johnson MD. A developmental taxonomy of carcinoma. Hum Pathol 2001; 32:945–953. glioblastoma defined and maintained by MicroRNAs. Cancer Res 2011; 71: 17 Pandithage R, Lilischkis R, Harting K, Wolf A, Jedamzik B, Luscher-Firzlaff J et al. 3387–3399. The regulation of SIRT2 function by cyclin-dependent kinases affects cell motility. 37 Yang HW, Menon LG, Black PM, Carroll RS, Johnson MD. SNAI2/Slug promotes J Cell Biol 2008; 180:915–929. growth and invasion in human gliomas. BMC Cancer 2010; 10: 301.

Supplementary Information accompanies this paper on the Oncogene website (http://www.nature.com/onc)