Molecular Studies of an Alternative Lengthening of Telomeres (ALT) Mechanism

by

Kilian Thomas Perrem

A thesis submitted to the University of Sydney in fulfilment of the requirements for the degree of Doctor of Philosophy

The Children’s Institute Faculty of Medicine University of Sydney

March, 2001

Statement of Originality

The contents of this thesis have not been presented for the award of a degree at this or any other university. The data are the original work of the author except where indicated.

Kilian Perrem

ii

Acknowledgments

This thesis would not have been possible without the scientific, technical and moral support of a large number of people both inside and outside the lab. First and foremost I must thank Roger Reddel for accepting me into his lab and giving me the opportunity to complete a PhD under his expert and diligent, but always good humoured supervision. Thanks also goes to Professor Peter Rowe, Director of the Children's Medical Research Institute, for supporting my PhD candidature and my research and also for allowing me to travel to conferences, both in Australia and overseas, as part of my career development. I must also mention my former mentor, Antony Braithwaite, who employed me as a technician some years ago but always treated me as a colleague. Thank you Antony for starting me on this path. My colleagues in the Research Group both past and present have been invaluable as fellow scientists and friends in helping me through the highs and lows of my scientific endeavours. I must specifically thank Axel Neumann for all his help and patience in undertaking many cytogenetic analyses which are presented here and for his imaging work. All of the wonderful and numerous FISH data in this thesis are due also to Axel’s expertise. Clare Fasching was equally as generous with her time and experience in chromosomal matters for which I am extremely grateful. I am particularly thankful to Clare for her transfer expertise which generated the hybrid clones with neo tagged telomeres in Chapter 4 and also for producing Figures 1-1 and 7-3 and for chromosome painting expertise which generated Figure 7-1. Thanks goes also to Tom Yeager for APB immunostaining analysis and for generating the images used in Figure 4-10. Lorel Colgin was always happy to share her wonderful TRAP and RT-PCR assay abilities with me and analyse samples which are shown in Figures 4-7, 5-3 and 6-2. In addition I am grateful to Lorel for her generosity in letting me use her lines and clones at will to back up my own work and for contributing some of her own data to this thesis, specifically Figures 5-1 and 5- 2. Thanks goes also to Axel, Lorel and Clare and also Lily Huschtscha and Christian Toouli for proofreading and comments on different sections of this thesis. Part of my work was done in collaboration with Professor Rob Newbold and Dr. Andrew Cuthbert of Brunel University, UK. I thank them and members of their research team, Dr. Deborah Trott and Alison Marriott, for providing their chromosome transfer expertise which enabled us to do some exciting work in our search for ALT repressors which is the subject of Chapter 7. Hopefully this aspect of the work and their collaboration will continue in the future.

iii

A special thanks to Lindy Hodgkin for all of her help over the years with computer related disasters and for maintaining the reference database with such vigilance. All of the support staff at the CMRI are also to be thanked for providing a working environment for successful research to take place. I am no doubt spoiled forever by the facilities at the CMRI! Particular thanks goes to Christine Smyth for undertaking the flow cytometry analysis shown in Figure 3-2 and help with that data. Finally I must thank my wife Catherine for all of her love, support and encouragement over the past four years. Quite simply, there are numerous things including this thesis which would never have been made possible without her.

iv

Publications arising from this thesis

Perrem K., Bryan TM., Englezou A., Hackl T., and Reddel RR. Repression of an Alternative Mechanism for Lengthening of Telomeres in hybrids. Oncogene (1999) 18, 3383- 3390.

Perrem K. and Reddel R.R.. Telomeres and Cell Division Potential. Progress in Molecular and Subcellular Biology (1999) Vol 24, 173-184. Springer-Verlag Berlin Heidelberg.

Reddel, R.R., Bryan, T.M., Colgin, L.M., Perrem, K.T., and Yeager, T.R. Alternative lengthening of telomeres in cells. Radiation Res (2001) 155(1), 194-200.

Perrem K., Colgin L.M,, Neumann A.A,, Yeager T. R., and Reddel R.R. Expression of in ALT cells lengthens the shortest telomeres but does not repress ALT. Mol. Cell. Biol. Submitted.

v

Abstracts

Perrem, K., Englezou, A. and Reddel, R.R. A study of an alternative mechanism for lengthening of telomeres using somatic cell hybridisation. Lorne Cancer Conference, Lorne, Vic., February 1998.

Reddel, R.R., Colgin, L., Perrem, K.T., Dunham, M.A., Englezou, A., Bowtell, D.D.L. and Kilian, A. Telomere maintenance in telomerase-negative cell lines. Geron Symposium No. 2: Telomerase and Telomere Dynamics in Cancer and Aging, Maui, August 1998.

Reddel, R.R., Bryan, T.M., Chang, A.C.-M., Colgin, L., Dalla-Pozza, L., Dunham, M.A., Englezou, A., Moy, E.L., Neumann, A.A., Noble, J.R. and Perrem, K.T. Genetic changes during immortalisation of human cells. American Association for Cancer Research Annual Scientific Meeting, New Orleans, March/April, 1998.

Perrem K., Moy E., Bryan T., and Reddel R.R. Evidence for rapid shortening of telomeres in hybrids of telomerase positive X telomerase negative immortalised human cells. Lorne Cancer Conference, Lorne, Vic., February 1999.

Reddel, R., Bonnefin, P., Colgin, L., Englezou, A., Perrem, K., Toouli, C. Telomere maintenance mechanisms and immortalisation of human cells. Conference on Human Cell Transformation, Cork, July 1999.

Perrem K., Yeager T., and Reddel R.R. Telomere length dynamics in human somatic cell hybrids: evidence for a telomere length feedback control mechanism. Miami Nature Winter Symposium, Miami FL, USA, February 2000.

Reddel, R., Colgin, L., Dunham, M., Englezou, A., Fasching, C., Neumann, A., Perrem, K. and Toouli, C. Telomere maintenance mechanisms in immortalised human cells. Lorne Cancer Conference, Lorne, Vic., February 2000.

Perrem K., Colgin L.M,, Neumann A.A,, Yeager T. R., and Reddel R.R. Coexistence of ALT and telomerase. Lorne Cancer Conference, Lorne, Vic., February 2001.

Perrem K., Colgin L.M,, Neumann A.A,, Yeager T. R., and Reddel R.R. Telomerase does not repress the ALT mechanism. ‘Telomeres and telomerase’, Cold Spring Harbor, NY, USA, March 2001.

vi

Summary

Telomeres are specialised structures, consisting of TTAGGG DNA repeats and binding , that cap the ends of human and maintain chromosome integrity. It has been shown that telomeres shorten with each round of cell division in most normal human somatic cells. It has become generally accepted that this shortening is due, in part, to the inability of DNA polymerases to replicate the extreme ends of chromosomes which is a phenomenon known as the “end replication problem”. An intriguing hypothesis that has emerged from these observations is that critically shortened telomeres trigger growth arrest and senescence. This is regarded as a key determining factor in the limited lifespan of normal cells in culture and is commonly known as the “Telomere Hypothesis of Senescence”. In support of this hypothesis it has been demonstrated that immortalised human cells, that have an unlimited lifespan in culture, maintain stable telomere lengths and do not undergo progressive telomere shortening. In most cases this is due to the ribonucleoprotein enzyme telomerase, the activation of which is as a key step in the immortalisation process. Telomerase compensates for sequential telomere shortening by utilising an RNA template to catalyse the addition of repeat sequences by reverse transcription. It is absent from most normal tissue but is present in the germline and is presumably downregulated during development. Significantly, analysis of human tumour cells has shown that a majority also have active telomerase, which supports the importance of immortalisation in tumourigenesis. Previous work in this laboratory has shown that, although the majority of in vitro immortalised cells and tumour cells that have been studied maintain telomeres by reactivation of telomerase, a proportion do not have detectable telomerase activity. These telomerase-negative cells still maintain telomeres, however, and this is via a mechanism(s) yet to be fully elucidated known as Alternative Lengthening of Telomeres (ALT). ALT is characterised, in addition to lack of telomerase activity, by extreme telomere length heterogeneity with telomere lengths ranging from over 50 kilobases (kb) of DNA to almost undetectable. This phenotype is evident, by Southern analysis and fluorescent in situ hybridisation (FISH), in all ALT cells. Alternative mechanisms of telomere maintenance, via retrotransposition and recombination, had already been characterised in lower eukaryotes. It has been shown in this laboratory that ALT cell lines and tumours contain a novel type of PML body, referred to as ALT-associated PML bodies (APBs). APBs have been found in all of the ALT cell lines so far tested and also in archival tumour sections, and contain a number of factors which co-localise. These include PML, TTAGGG repeats, TRF 1 & TRF 2 telomere

vii binding proteins and proteins involved in homologous recombination: RAD51 & RAD52. More recently, it has been shown that the RAD50/Mre11/Nbs1 complex, which is involved in checkpoint control and repair of DNA damage, is also present in APBs. The presence of these RAD proteins in APBs is of great interest as a recombination between telomeres has been proposed as the central mechanism by which ALT lengthens telomeres. Studies in yeast have identified such a mechanism and it was proposed that a similar process occurred in human immortal cells that utilise ALT. It has now been shown by this laboratory that a recombination mechanism is indeed evident at the telomeres of ALT cells. To date all in vitro immortalised cell lines and most tumour cell types that have been studied have a telomere maintenance mechanism either via telomerase or ALT. Targeting telomerase has become a major focus of anti-cancer research as inhibitors have the potential to treat a wide variety of different tumour types. An understanding of ALT and its regulation is likely to be important in such therapeutic strategies, as selective pressure due to telomerase inhibition may result in ALT revertants within the tumour mass. Development of inhibitors of both telomerase and ALT may therefore be required when targeting telomere maintenance. The main focus of this thesis is the understanding of ALT repression in the SV40 immortalised skin cell line GM847, as a means to further understanding the mechanism of ALT. The data presented provide new insights into the repression of ALT and also the relationship between telomerase and ALT which is important for our understanding of telomere maintenance in human cancer. Hybrids formed by fusion of normal cells and ALT cells underwent rapid telomere loss followed by senescence, indicating that normal cells contain factors that repress ALT. This strongly suggests that ALT is recessive and is activated in part by loss or of repressors. Similar experiments were performed with ALT cells and telomerase- positive cells, and the resulting hybrids were all telomerase-positive and ALT repressed. It is possible that the same negative regulators are involved as additional data show that telomerase does not act as an ALT inhibitor. Exogenous expression of telomerase in ALT cells did not repress ALT, but both mechanisms co-existed in these transfected cells. This result provides a further argument for targeting both ALT and telomerase in any future treatments of tumours as it demonstrates in principle that these mechanisms are not mutually exclusive. A serendipitous finding was that a dominant-negative telomerase catalytic subunit caused telomere shortening in ALT cells, had not been reported elsewhere, and indeed was in contrast to previous findings. This provided further evidence for a link between telomerase and ALT as it suggested that there were essential components that were common to both pathways. As a further means to understanding ALT repression, a series of experiments was performed to determine the

viii chromosomal localisation of ALT repressor(s) by microcell mediated chromosome transfer. This was done to facilitate the eventual isolation of repressors. A repressor of ALT in the chemically immortalised fibroblast cell line SUSM-1, had been reported to be localised to chromosome 7. This result could not be repeated in the GM847 cell line, but ALT repression was evident in GM847 cells upon transfer of chromosome 6. Another important question regarding the nature of ALT is the structure and sequence of the long heterogeneous telomeres generated by ALT specific recombination, which is the focus of the final series of data that is presented. ALT telomere length heterogeneity was detected under denaturing conditions, ruling out the possibility that it was an artefact of electrophoresis conditions due to novel secondary structure. Although the hybridisation signal intensity of TTAGGG increases at the onset of immortalisation in ALT cells, it had been demonstrated by restriction digests that degenerate repeats did exist at the telomeres of some ALT cell lines. Sequences containing telomere repeats were cloned from the ALT cell line WI38 VA13/2RA (SV40 immortalised ) and these were found to be interspersed with a number of other sequence fragments. The significance of these sequences in relation to the mechanism of ALT is discussed.

ix

Abbreviations

AEBSF 4-(2-aminoethyl)-benzenesulphonyl fluoride hydrochlorine ALT Alternative Lengthening of Telomeres ATP Adenosine triphosphate bp Base pairs BSA Bovine serum albumin CDK Cyclin dependent kinase CF Cystic fibrosis CHAPS 3-[(3-cholamidopropyl-dimethylammonio]-1-propanesulphonate CMV Cytomegalovirus cpm Counts per minute DAPI 4',6-Diamidino-2-phenylindole dihydrochloride DEPC Diethylpyrocarbonate DME Dulbecco’s modified Eagle’s medium DMSO Dimethylsulphoxide DNA Deoxyribonucleic acid dNTP Deoxyribonucleoside 5’-triphosphate EDTA Ethylenediaminetetraacetate EGTA Ethyleneglycol bis(aminoethylether) N,N,N,N' tetraacetate FBS Foetal bovine serum FITC Fluorescein isothiocyanate FISH Fluorescence in situ hybridisation HBS HEPES-buffered saline HEPES N-2-hydroxethylpiperazine-N'-2- ethanesulphonic acid HPLC High pressure liquid chromatography HPV Human papillomavirus hTER Human telomerase RNA subunit hTERT Human telomerase reverse transcriptase subunit IPTG Isopropylthio-β-D-galactoside kb Kilobases kDa Kilodaltons LFS Li Fraumeni Syndrome LNS Lesch-Nyhan Syndrome

x

LTAg Large T antigen MMCT Microcell mediated chromosome transfer mTER Mouse telomerase RNA subunit PBS Phosphate-buffered saline PCR Polymerase chain reaction PD Population doublings PEG Polyethylene glycol PHA-P Phytohemagglutinin-P PI Propidium iodide PMSF Phenylmethylsulphonylfluoride PNA Peptide nucleic acid PVP Polyvinylpyrrolidone RNA Ribonucleic acid RNase Ribonuclease RPM Revolutions per minute RT Room temperature SDS Sodium dodecyl sulphate SV40 Simian virus 40 T-ag T-Antigen TEMED N,N,N',N'-tetramethylethylenediamide TRAP Telomere repeat amplification protocol TRF Terminal restriction fragment Tris Tris(hydroxymethyl)aminomethane Tween-20 Polyoxyethylene-sorbitan monolaurate UF Ultra-filtered UV Ultraviolet light wt Wild-type X-gal 5’-bromo-4-chloro-3-indolyl-β-D-galactopyranoside XP Xeroderma pigmentosum [γ32P] -dATP deoxyadenosine 5’-(γ-thio)triphosphate [32P] [α32P] -dCTP deoxycytidine 5’-triphosphate [α32P] [α32P] -dTTP deoxythymidine 5’-triphosphate [α32P]

xi

List of Tables

Table 1-1 Stimuli that result in premature senescence …………………………………………………….1-9

Table 1-2 Examples of normal human cells and tissues with telomerase activity ……………....1-11

Table 3-1 DNA fingerprint analyses of HFF5 X GM847 hybrid clones …………………………….3-5 Table 3-2 DNA fingerprint analyses of MRC-5 X GM847 (GMR) and WI38 X GM847 (GWI) hybrid clones ……………………………………………………………………………………………………………3-12 Table 4-1 Measurement of the overall rate of telomere shortening in hybrid clones by sizing of discrete TRF bands ………………………………………………………………………………………………..4-6 Table 5-1 Telomere FISH analyses of detectable telomeres in GM847 and GM847/hTERT cells.………………………………………………………………………………………………………………………...5-11 Table 5-2 Detection of long telomeres on specific chromosomes in metaphase spreads of

GM847/hTERT subclones…………………………………………………………………………………………5-15 Table 5-3 Detection of ALT associated PML bodies (APBs) in GM847/hTERT cells by telomere

FISH using a peptide nucleic acid probe…………………………………………………………5-16 Table 7-1 Survival rate of clones isolated from GM847/H6 and GM847/H7 chromosome transfer experiments…………………………………………………………………………………………………….7-3 Table 7-2 Chromosomal localisation of human telomerase components and telomere binding proteins………………………………………………………………………...…………………………………………..7-20

Table 8-1 G-rich repeats present in Tel-2 and Tel-4 clones…………………………………………..8-15

Table 8-2 Sequence alignments of non G-rich repeats from clones Tel-2 and Tel-4…….…..8-16

xii

List of Figures

Figure 1-1 A model for the proposed recombination based ALT mechanism. ……………..……1-24

Figure 3-1 Growth curves of GM847 X HFF5 hybrid clones. …………………………………………..3-3

Figure 3-2 Flow cytometry analysis of GM847 X HFF5 hybrid clones. …………………..………...3-6 Figure 3-3 Pulsed field TRF analyses of GM847 X HFF5 hybrid clones B, F, I and J. ………………………………………………………………………………………………………………...………3-7 Figure 3-4 Pulsed field TRF analyses of GM847 X HFF5 hybrid clones A, C, D, E,

G and H.………... ………………………………………………………………………………….………………………3-9 Figure 3-5 Pulsed field TRF analysis of GM847 and HFF5 cells and of 1:1 mixtures of

GM847/HFF5. ……………………………………………………………………….………………………………....3-10 Figure 3-6 Pulsed field TRF analysis of GM847 X MRC-5 (GMR) and GM847 X WI38 (GWI) hybrids…………………………………………………………………………………………….……………………….3-13

Figure 4-1 Growth curves of GM847 X T24 and GM847 X HT-1080 hybrid clones. ……..…..4-3 Figure 4-2 DNA fingerprinting of GM847 X HT-1080 (G/HT) and GM847 X T24 (G/T) hybrids with a single locus MS43A probe. ………………………………………………………...…………...4-4 Figure 4-3 Pulsed field TRF analyses of GM847 X HT1080 and GM847 X T24 hybrid clones. ……………………………………………………………………………………………….……………………...4-5 Figure 4-4 TRAP analysis of GM847 X T24 (G/T) and GM847 X HT-1080 (G/HT) hybrid clones. ……………………………………………………………………………………………..……………...4-7 Figure 4-5 DNA fingerprinting of late passage GM847 X HT-1080 (G/HT) and GM847 X T24

(G/T) hybrids with a single locus MS43A probe. …………………………………………………...4-8 Figure 4-6 T-antigen immunostaining of GM847 X HT-1080 (G/HT) and GM847 X T24 (G/T) hybrids. ………………………………………………………………………………………………………...4-10 Figure 4-7 TRAP analysis of clones of hybrids G/HT K (KDN) and G/T L (LDN) generated by expressing dominant-negative hTERT. ………………………………………………………….…………….4-11

Figure 4-8 TRF analyses of KDN and LDN clones. ………………………………..…………………..4-12 Figure 4-9 Phase contrast photomicrographs of G/HT K (KDN) and G/T L (LDN) hybrid clones.

……………………………………………………………………………………………………………..………4-13 Figure 4-10 Detection of ALT-associated PML bodies (APBs) in hybrid clones by immunostaining with to hTRF2. ………………………………………………..………………...4-15

Figure 4-11 Southern detection of neo signal in G/HT K 2C2 subclones. ………...……....4-16

Figure 4-12 Detection of neo signal in G/HT clone K 2C2 subclones by FISH. ……………...... 4-17

xiii

Figure 4-13 Pulsed field TRF analysis of hybrids G/HT clones E and K and G/T clone G. ………….………………………………………………………………………….…………………………….4-19 Figure 4-14 The two possible outcomes of fusions between an ALT cell line and a telomerase- positive cell line from the same complementation group. ……………………………………...………..4-21 Figure 5-1 Telomere repeat amplification protocol (TRAP) analysis of GM847 cells containing both transient and stable expression of hTERT. ……………………………………………………...………5-3 Figure 5-2 Pulsed field TRF analyses of GM847/hTERT stable clones and pCIneo vector control clones. …………………………………………………………………………………………...……………….5-4 Figure 5-3 TRAP analysis of subclones of GM847/hTERT-3 and GM847/hTERT-6, generated by limiting dilution. ……………………………………………………………………………………...……………..5-6 Figure 5-4 Pulsed field TRF analysis of subclones of GM847/hTERT-3 and GM847

/hTERT-6. …………………………………………………………………………………………………………………5-7 Figure 5-5 TRF analysis, comparing subclones of untransfected GM847 cells generated by limiting dilution with parental GM847/hTERT-6 and GM847/hTERT-3 cells. …………………...5-8 Figure 5-6 Telomere length analysis by FISH of GM847/hTERT-3 and GM847/hTERT-6 cells. ………………………………………………………………………………………………..………………………5-10 Figure 5-7 Detection of ALT associated PML bodies (APBs) in nuclei of GM847

/hTERT cells by telomere FISH. …………………………………………………...…………………..……5-13/14 Figure 5-8 Ratio of p arm: q arm telomere lengths on the Y chromosome from 20 metaphase spreads of GM847/hTERT subclones. ……………………..……………………………………………...……5-17 Figure 5-9 Detection of ALT associated PML bodies (APBs) in interphase nuclei of

GM847/hTERT cells by telomere FISH.……………………………………………....………………………5-18

Figure 6-1 Pulsed field TRF analysis of GM847/dn hTERT (GMDN) clones. ……………...…….6-4 Figure 6-2 RT-PCR analysis of dn hTERT 3-1 expression in representative GMDN clones. ………………………………………………………………………………………………………………….…...6-5

Figure 7-1 Painting of chromosomes 6 and 7 on metaphase spreads of GM847 cells. ……..…..7-5 Figure 7-2 Pulsed field TRF analysis of subclones of GM847 generated by MMCT of human HyTK chromosomes 6 (H6) and 7 (H7). ……………………………………………………....……...7-6 Figure 7-3 A representative example of donor chromosome 6 deletions in GM847 cells. …………………………………………………………………………………………………………………...……..7-7

Figure 7-4 Pulsed field TRF analysis of GM847/hTERT-H6 clones.…………………………...…….7-9

Figure 7-5 Telomere length analysis by FISH of GM847/hTERT-H6 clones. …………..………7-10

Figure 7-6 Pulsed field TRF analysis of GM847/hTERT-H7 clones.………………………..……...7-12

Figure 7-7 Pulsed field TRF analysis of GM847/hTERT-H8 clones.………………………..……...7-13

xiv

Figure 7-8 TRAP analysis of GM847/hTERT-H6 clones.………………………………………………7-14 Figure 7-9 Pulsed field TRF analysis of GM847/hTERT-H6 clones at two timepoints.…………………………………………………………………………………………………...…………...7-15 Figure 7-10 Pulsed field TRF analysis of GM847/hTERT-H6 clones showing reversion to ALT.………………………………………………………………………….…………………………………….…...7-17 Figure 8-1 ALT cell TRF analysis (SUSM-1, BET-3M) under denaturing conditions. …………………………………………………………………………………………………………………8-4 Figure 8-2 ALT cell TRF analysis (Saos-2, G292, SK-LU-1, VA13,U-2 OS) under denaturing conditions. ………………………………………………………………..………………………8-5 Figure 8-3 ALT cell TRF analysis and exonuclease treatment under denaturing conditions. …………………………………………………………………………………………………………………8-7 Figure 8-4 TRF analysis of ALT, telomerase-positive and normal cells digested with either Hinf1/Rsa1 or Hph1. …………………………………………………………………………………………..8-8

Figure 8-5 TRF analysis of WI38 VA13/2RA partial digests with Mnl1.…………...…….……….8-11 Figure 8-6 Flow diagram representing the strategy for cloning ALT telomeric sequences from the cell line WI38 VA13/2RA.………………………………..……………………….………………….……….8-12

Figure 8-7 Colony hybridisation with a radiolabelled (TTAGGG)3 probe to cells transformed with pGEM 3Z cloned genomic fragments of WI38 VA13/2RA.…………..……….8-13

Figure 8-8 Sequencing analysis of clones Tel-2 and Tel-4 using Sp6 and T7 primers………...8-14

xv

Table of Contents

1. Chapter One ...... 1-1 General Introduction

1.1 Introduction to telomeres ...... 1-2 1.2 The telomere hypothesis of senescence ...... 1-3 1.3 A brief introduction to telomere maintenance...... 1-4 1.4 Telomere maintenance and unlimited cell division potential...... 1-5 1.5 Telomere maintenance and escape from senescence ...... 1-7 1.6 Correlations among in vivo age, telomere length, and proliferative potential...... 1-9 1.7 Expression of telomerase in normal tissues ...... 1-10 1.8 Evidence that short telomeres may limit proliferation in vivo...... 1-11 1.9 Perspectives on the telomere hypothesis of senescence and aging ...... 1-13 1.10 Telomeres, immortalisation and cancer ...... 1-14 1.11 Alternative lengthening of telomeres (ALT)...... 1-18 1.12 Aims of this project ...... 1-23

2. Chapter Two ...... 2-1 Materials and methods

2.1 Sources of reagents...... 2-3 2.2 Buffers and solutions...... 2-5 2.3 Cell Lines and ...... 2-6 2.4 DNA fingerprinting of somatic cell hybrids ...... 2-10 2.5 Telomere repeat amplification protocol (TRAP) assay...... 2-12 2.6 Extraction of genomic DNA from human cells in culture ...... 2-15 2.7 Preparation of metaphase chromosome spreads...... 2-15 2.8 Terminal restriction fragment Southern analysis (TRF) ...... 2-16 2.9 Telomere length analysis by fluorescence in situ hybridisation ...... 2-18 2.10 Detection of neo signal in human cells ...... 2-19 2.11 Plasmid expression vectors...... 2-20 2.12 Transfection of human cells with plasmid vectors...... 2-21 2.13 Microcell-Mediated Chromosome Transfer...... 2-22 2.14 Chromosome painting of metaphase spreads ...... 2-24

3. Chapter Three ...... 3-1 Normal cells contain repressors of ALT

3.1 Introduction ...... 3-2 3.2 Characterisation and growth analysis of GM847 X HFF5 hybrids...... 3-2 3.3 Telomere dynamics in pre- and post- senescent GM847 X HFF5 hybrids...... 3-4 3.4 Growth and telomere dynamics of additional GM847 X normal hybrids...... 3-11 3.5 Conclusions ...... 3-11

xvi

4. Chapter Four...... 4-1 Telomerase-positive immortalised cells contain repressors of ALT

4.1 Introduction …………………………………………………………………………………………………….4-2 4.2 Telomere dynamics in hybrids of ALT and telomerase-positive cells ……………………..4-2 4.3 Endogenous telomerase is required for the immortal phenotype in somatic cell hybrids of ALT cells and telomerase-positive cells………………………………………………………………..4-6 4.4 ALT-associated PML bodies are lost from the ALT X telomerase-positive hybrids..4-14 4.5 Telomere-telomere recombination does not occur in the ALT X telomerase-positive hybrids………………………………………………………………………………………………………...…4-14 4.6 Endogenous telomerase eventually stabilizes and maintains telomeres in the ALT- telomerase-positive hybrids…………………………………………………………………………………...4-18 4.7 Conclusions……………………………………………………………………………………………………4-18

5. Chapter Five ...... 5-1 Exogenous telomerase activity does not repress ALT but co-exists within the same cell and lengthens the shortest telomeres

5.1 Introduction……………………………………………………………………………………………………..5-2 5.2 Exogenous expression of telomerase in GM847 cells lengthens the shortest telomeres………………………………………………………………………………………………………………5-2 5.3 Telomere fluorescence in situ hybridisation analysis of GM847/hTERT cells………….5-9 5.4 The ALT phenotype is not repressed in GM847/hTERT cells………………………………5-12 5.5 Conclusions……………………………………………………………………………………………………5-19

6. Chapter Six...... 6-1 Evidence for repression of ALT by expression of a dominant-negative telomerase catalytic subunit

6.1 Introduction……………………………………………………………………………………………………..6-2 6.2 Evidence of an ALT-repressed phenotype in clones of GM847 cells expressing a dominant-negative hTERT……………………………………………………………………………………...6-3 6.3 Conclusions……………………………………………………………………………………………………..6-6

7. Chapter Seven...... 7-1 Investigation of the chromosomal localisation of putative ALT repressor(s)

7.1 Introduction……………………………………………………………………………………………………..7-2 7.2 Analysis of ALT repression by chromosome transfer into GM847 cells………………….7-2 7.3 Analysis of ALT repression by chromosome transfer into GM847/hTERT cells………7-8 7.4 Inhibition of telomerase and reversion to ALT in GM847/hTERT cells………………...7-11 7.5 Conclusions……………………………………………………………………………………………………7-16

xvii

8. Chapter Eight...... 8-1 Structural and sequencing analysis of terminal fragments of ALT cells

8.1 Introduction ...... 8-2 8.2 ALT telomere length heterogeneity is detectable with G- and C- strand probes under denaturing conditions ...... 8-3 8.3 Presence of alternate G-rich repeats at the telomeres of a subset of both ALT and telomerase-positive cells ...... 8-6 8.4 Cloning and sequencing of fragments containing telomeric repeats from WI38 VA13/2RA cells...... 8-9 8.5 Conclusions…………………………………………………………………………………………………....8-15

9. Chapter Nine ...... 9-1 Discussion

9.1 Repression of ALT…………………………………………………………………………………………...9-2 9.1.1 The recessive nature of ALT………………………………………………………………………..9-2 9.1.2 Rapid telomere loss in somatic cell hybrids…………………………………………………...9-2 9.1.3 Loss of ALT-associated PML bodies (APBs) in somatic cell hybrids……………….9-4 9.1.4 Telomere loss in ALT cells following expression of dominant-negative telomerase activity…………………………………………………………………………………………….………………..9-5 9.1.5 Evidence for localisation of a putative ALT repressor on chromosome 6………….9-7 9.2 The relationship between the molecular mechanisms of telomerase and ALT telomere maintenance………………………………………………………………………………………………………...9-10 9.3 The sequence of ALT telomeres……………………………………………………………………….9-11 9.4 Future directions……………………………………………………………………………………………..9-12

xviii

To Catherine

1. Chapter One

General Introduction

1. Chapter One ...... 1-1

1.1 Introduction to telomeres...... 1-2 1.1.1 Structure and function ...... 1-2 1.1.2 Telomere binding proteins ...... 1-2 1.2 The telomere hypothesis of senescence...... 1-3 1.3 A brief introduction to telomere maintenance...... 1-4 1.4 Telomere maintenance and unlimited cell division potential...... 1-5 1.4.1 Normal immortality...... 1-5 1.4.2 Immortality and preneoplastic transformation of human somatic cells ...... 1-5 1.5 Telomere maintenance and escape from senescence ...... 1-7 1.5.1 Telomere maintenance is not required for escape from senescence ...... 1-7 1.5.2 Telomere maintenance is sufficient for escape from senescence...... 1-7 1.6 Correlations among in vivo age, telomere length, and proliferative potential ...... 1-9 1.6.1 Correlation between telomere shortening in vivo and age ...... 1-9 1.6.2 Lack of correlation between age and proliferative potential...... 1-10 1.7 Expression of telomerase in normal tissues ...... 1-10 1.8 Evidence that short telomeres may limit proliferation in vivo...... 1-11 1.8.1 Telomere shortening in human vascular endothelial cells ...... 1-11 1.8.2 Telomere shortening and immunoexhaustion ...... 1-12 1.8.3 Telomere shortening and cellular proliferation capacity in the telomerase- negative mouse...... 1-12 1.9 Perspectives on the telomere hypothesis of senescence and aging ...... 1-13 1.10 Telomeres, immortalisation and cancer...... 1-13 1.10.1 The role of senescence and immortalisation in cancer...... 1-13 1.10.2 Telomere maintenance is a fundamental property of both immortalised cells and tumour cells ...... 1-16 1.11 Alternative lengthening of telomeres (ALT)...... 1-17 1.11.1 Telomerase-independent telomere maintenance in lower eukaryotes...... 1-17 1.11.2 Telomere maintenance in immortalised human cells via a telomerase-independent mechanism known as ALT...... 1-18 1.11.3 The incidence of ALT in immortalised human cells...... 1-19 1.11.4 The incidence of ALT in human tumours and tumour derived cell lines...... 1-20 1.11.5 A morphological marker of ALT in human tissue ...... 1-21 1.11.6 ALT in human cells involves telomere-telomere recombination...... 1-22 1.12 Aims of this project ...... 1-23 1.12.1 The importance of ALT as a future target for cancer therapies ...... 1-23 1.12.2 Control of the ALT mechanism ...... 1-25 1.12.3 Identification of ALT inhibitors...... 1-26 1.12.4 Structure and sequence of ALT telomeres ...... 1-27

1-1 General Introduction

1.1 Introduction to telomeres

1.1.1 Structure and function

Telomeres are specialised structures located at the ends of all linear eukaryotic chromosomes that, with few exceptions, consist of G-rich DNA repeat sequences (Blackburn, 1991) and specific telomere binding proteins (see section 1.1.2). All vertebrate chromosome terminal sequences consist of TTAGGG hexanucleotide repeats (reading 5’-3’ centromere to telomere) (Moyzis et al., 1988; Blackburn, 1991), and these have been estimated to range in length from about 4-15 kb in normal human cells (reviewed in Harley, 1991). Unique chromatin arrangements at the telomere are facilitated by interactions between binding proteins and telomeric repeats (Makarov et al., 1993; Tommerup et al., 1994; Lejnine et al., 1995). It was postulated many decades ago without any specific knowledge of their structure that telomeres functioned as a protective cap that prevented chromosomes from end degradation and terminal fusion (Muller, 1938; McClintock, 1941). This was subsequently demonstrated in molecular studies using cloned telomeric sequences (Bourgain and Katinka, 1991). It has also been shown that telomeres have a role in chromosome segregation during mitosis and meiosis (Kirk et al., 1997).

1.1.2 Telomere binding proteins

An important aspect of telomere structure and function is the interaction of the repeat sequences with specific binding proteins and associated factors which are essential for both the regulation of telomere length and the capping function of telomeres. In the yeast Saccharomyces cerevisiae a number of telomere binding proteins that are involved in telomere length regulation have been identified: Rap1p (Conrad et al., 1990; Shore, 1994), Cdc13p (Nugent et al., 1996), Stn1p (Grandin et al., 1997), yeast Ku (Gravel et al., 1998) and Tel2p (Kota and Runge, 1999). In addition a yeast telomere associated meiotic , Tam1, has been characterised that functions in chromosome synapsis and crossover interference (Chua and Roeder, 1997). Rap1p has been shown to be crucial for regulation of telomere length control (Krauskopf and Blackburn, 1996; Krauskopf and Blackburn, 1998) and also to mediate a telomere length feedback control mechanism (Marcand et al., 1997). Additional proteins that interact with yeast telomeres via binding to Rap1p have also been identified, known as Rif1p and Rif2p (Hardy et al., 1992; Wotton and Shore, 1997) and these factors are also involved in telomere size control (Wotton and Shore,

1-2 1997). Yeast Ku has also been shown to have a role in terminal DNA configuration and structure (Gravel et al., 1998). The principal telomere binding proteins in human cells, TRF1 and TRF2, (Chong et al., 1995; Broccoli et al., 1997) have a Myb-like helix-turn-helix domain in their carboxy terminus and a conserved domain that includes sequences involved in homodimerisation, but have no orthologs in budding yeast. An almost identical variant of TRF1, Pin2, has also been characterised and found to differ only by an internal deletion of 20 amino acids and to dimerise with TRF1 (Shen et al., 1997). A human homolog of Rap1p has been isolated (Li et al., 2000) but, unlike its counterpart in yeast, it does not bind the telomeres directly but via its association with TRF2 (Li et al., 2000). Additional factors, tankyrase (Smith et al., 1998) and TIN2 (Kim et al., 1999), have been identified that associate with human telomeres via TRF1. Ku has also been reported to form a complex at the telomere in human cells via its interaction with TRF1 and prevent end joining (Hsu et al., 2000). Expression of truncated forms of TRF1 and its interacting factor TIN2 induce inappropriate telomere elongation in telomerase-positive cells (van Steensel and de Lange, 1997; Kim et al., 1999; Smogorzewska et al., 2000). Inhibition of TRF2 in cultured cells results in “deprotection” of chromosome ends and covalently fused telomeres (van Steensel et al., 1998). Additionally, loss of normal TRF2 function can lead to growth arrest and ATM/p53 mediated (van Steensel et al., 1998; Karlseder et al., 1999). Both TRF1 and TRF2 are characterised as negative regulators of telomere length as overexpression of either results in gradual telomere length decline (van Steensel and de Lange, 1997; Smogorzewska et al., 2000). Telomere binding proteins are therefore critical regulators of telomere length and essential components of the protective structures that are formed at the chromosome ends and maintain chromosome integrity.

In addition to these critically important biological functions described in sections 1.1.1 and 1.1.2, it has been proposed that the telomere has a central role in determining the number of times cells can divide.

1.2 The telomere hypothesis of senescence

Hayflick found that primary human cells were incapable of unlimited division cycles in vitro (Hayflick and Moorhead, 1961; Hayflick, 1965). When the cells eventually ceased proliferation they manifested morphological and other changes that were interpreted as being

1-3 indicative of cellular aging, and they were therefore described as senescent. The maximum number of cell divisions of normal cells in culture is often called the “Hayflick limit”. Olovnikov (Olovnikov, 1971) and Watson (Watson, 1972) independently recognised that the conventional DNA replication apparatus fails to copy a short segment at one end of each linear DNA molecule. This became known as the "end replication problem" (Levy et al., 1992). Olovnikov proposed that the progressive telomeric shortening which would therefore result from each cell division cycle eventually results in (Olovnikov, 1971; Olovnikov, 1973; Harley et al., 1992). Evidence has subsequently been obtained that telomere shortening may also occur due to a process, possibly the action of a putative 5'-3' exonuclease, that creates a 100-200 bp single- stranded overhang at the end of the telomere after each cell division cycle (Wellinger et al., 1996; Makarov et al., 1997). A candidate for this process is the RAD50/Mre11/NBS1 complex which is involved in cell cycle checkpoint control and double strand break repair following DNA damage (Carney et al., 1998). This complex has now been implicated in telomere maintenance in both yeast (Boulton and Jackson, 1998; Nugent et al., 1998; Chamankhah and Xiao, 1999; Ritchie and Petes, 2000) and human cells (Zhu et al., 2000) and can promote DNA unwinding and nuclease activity (Paull and Gellert, 1999). Unrepaired double strand breaks in the telomere would also result in telomere shortening. Under some circumstances yeast telomeres may undergo rapid shortening (Li and Lustig, 1996), and there is evidence that rapid telomeric shortening may sometimes occur in human cells also (Murnane et al., 1994; Perrem et al., 1999). A corollary of the telomere hypothesis of senescence is that unlimited proliferative potential requires a telomere maintenance mechanism. This is supported by a substantial body of empirical data which will be discussed briefly below before returning to an appraisal of the evidence for the telomere hypothesis itself.

1.3 A brief introduction to telomere maintenance

Telomeres may be maintained in some species by retrotransposition (reviewed in Biessmann and Mason, 1997), or by a recombination mechanism (Pluta and Zakian, 1989; Lundblad and Blackburn, 1993; Roth et al., 1997; Dunham et al., 2000) and these will be discussed in more detail in later sections. In most eukaryotic species, however, telomeres are normally maintained through the activity of an enzyme, telomere terminal transferase (telomerase), first identified in Tetrahymena thermophila (Greider and Blackburn, 1985). Telomerase was shown to be a ribonucleoprotein reverse transcriptase complex that utilises an

1-4 RNA component as a template for the de novo synthesis and sequential addition of the G-rich repeats onto the telomeres, thus compensating for telomere shortening during each round of DNA replication (Greider and Blackburn, 1985). Subsequent molecular studies resulted in the cloning and characterisation of the RNA component (TER) of human (Feng et al., 1995) and mouse (Blasco et al., 1995) telomerase. Reverse transcriptase domains of telomerase catalytic subunits from yeast and ciliates (Counter et al., 1997; Lingner et al., 1997) that were conserved in eukaryotes led to the eventual cloning of the human telomerase catalytic subunit hTERT (Harrington et al., 1997a; Kilian et al., 1997; Meyerson et al., 1997; Nakamura et al., 1997). There have been a number of additional components of the human telomerase holoenzyme that have also been isolated; the first of these to be identified was a protein of unknown function, now referred to as TEP1 (telomerase-associated protein 1) (Harrington et al., 1997b; Nakayama et al., 1997). Additional components that have been characterised are p23 and Hsp90 (Holt et al., 1999), dyskerin (Heiss et al., 2000) and more recently, hTER associated proteins hStau and L22 (Le et al., 2000). The precise functions of these factors that associate with telomerase have yet to be elucidated, but hTERT and hTER have been shown to be sufficient for reconstitution of telomerase activity in vitro (Weinrich et al., 1997; Beattie et al., 1998) and are both essential for induction of telomerase activity in telomerase-negative cells (Wen et al., 1998).

1.4 Telomere maintenance and unlimited cell division potential

1.4.1 Normal immortality

Telomere structure and maintenance has been studied in a variety of unicellular eukaryotes such as Tetrahymena (Blackburn and Gall, 1978; Collins et al., 1995), Euplotes aediculatus (Klobutcher et al., 1981; Lingner and Cech, 1996) and S. cerevisiae (Shampay et al., 1984; Wright et al., 1992; Lingner et al., 1997), that have an essentially unlimited proliferative potential in culture. Studies in yeast revealed that senescence and cell death were associated with mutation of a gene that functions in telomere maintenance (Lundblad and Szostak, 1989; Lundblad and Blackburn, 1993). Similarly, the germline of multicellular organisms is functionally immortal, and it has been shown in that germline cells contain telomerase activity and that fertility becomes seriously impaired when telomerase is disrupted (Blasco et al., 1997; Lee et al., 1998). Plant tissues that can be propagated also have telomerase activity (Heller et al., 1996; Fitzgerald et al., 1996). 1.4.2 Immortality and preneoplastic transformation of human somatic cells

1-5 The abnormal acquisition of unlimited division potential in mammalian somatic cells has been most extensively studied in in vitro models of human cell immortalisation, especially following transduction of genes from DNA tumour viruses such as simian virus 40 (SV40) and other polyomaviruses, papillomaviruses, adenoviruses and herpesviruses (reviewed in Bryan and Reddel, 1994). Cells that express these viral genes have been shown to continue dividing beyond the point at which senescence normally occurs and thus exhibit a “lifespan extension”. This proliferation past the usual senescence barrier is temporary, however, and cell division eventually ceases. The cells then reach a state that is commonly known as “crisis” (Girardi et al., 1965) or mortality stage 2 (M2) (Wright et al., 1989). Lifespan extension in fibroblasts may also occur through loss of function of the p53 tumour suppressor gene or its major downstream effector p21 (Bond et al., 1994; Rogan et al., 1995; Brown et al., 1997), and in breast epithelial cells through loss of function of the p16INK4 tumour suppressor gene (Foster et al., 1998; Brenner et al., 1998; Huschtscha et al., 1998). The relationship, if any, between senescence and crisis is currently not well understood and in particular it is not clear to what extent crisis may be a delayed form of senescence (Rubelj and Pereira-Smith, 1994) or an imbalance between cell division and cell death rates resulting in a reduction in cell number (Girardi et al., 1965). Nevertheless, the occurrence of limited lifespan extension clearly indicates that even when the "normal" senescence checkpoint is bypassed there are other growth arrest checkpoints that are still capable of preventing unlimited proliferation (reviewed in Reddel, 1998). Rare clonal outgrowths from populations of transformed cells in crisis may occur and this often results in an apparently unlimited proliferative potential, i.e. an immortal phenotype (Girardi et al., 1965). The link between immortalisation and telomere maintenance was first made by demonstrating that extracts of the immortal cervical carcinoma cell line HeLa contained telomerase activity (Morin, 1989). Many studies have subsequently shown that immortalisation of human cells is usually associated with activation of telomerase: activity of this enzyme was found to be absent from pre-crisis cells and present following escape from crisis (Counter et al., 1992; Counter et al., 1994; Klingelhutz et al., 1994; Kim et al., 1994; Bryan et al., 1995). Some immortalised cells did not exhibit telomerase activity, but were shown to utilise a telomerase- independent telomere maintenance mechanism (Murnane et al., 1994; Bryan et al., 1995), now known as Alternative Lengthening of Telomeres (ALT) (Bryan and Reddel, 1997; Bryan et al., 1997b; Reddel et al., 1997), and further understanding of the molecular mechanisms of ALT is the focus of this thesis (discussed in further detail in section 1.11). No examples have been reported of immortalised human cell lines that do not utilise either telomerase or an ALT telomere

1-6 maintenance mechanism. This is consistent with the idea that crisis is triggered by shortened telomeres and that escape from crisis requires acquisition of a telomere maintenance mechanism. The role of telomeres in immortalisation and cancer is discussed further in section 1.10.2.

1.5 Telomere maintenance and escape from senescence

1.5.1 Telomere maintenance is not required for escape from senescence

As predicted by the telomere hypothesis of senescence, it has been found in a number of studies that telomeres do shorten progressively with proliferation of cells in vitro (Harley et al., 1990; Allsopp et al., 1992; Counter et al., 1992). It is still not entirely clear whether this shortening is responsible for senescence. Cells that escape from senescence temporarily due to viral transformation (Counter et al., 1992; Counter et al., 1994; Klingelhutz et al., 1994) or due to loss of p53 (Rogan et al., 1995) or p21 (Brown et al., 1997) function, continue to undergo telomere shortening during the period of lifespan extension. Thus, telomere maintenance is not necessary for escape from senescence. Two ways of interpreting this are either that the telomere lengths in senescent cells do not pose a barrier to further cell division or alternatively that the signals induced by shortened telomeres to trigger senescence have been overridden through the process of viral transformation.

1.5.2 Telomere maintenance is sufficient for escape from senescence

In support of the interpretation that telomere shortening does normally trigger senescence, it has recently been found that expression of telomerase in some types of normal cells is sufficient for escape from senescence. Transient expression of telomerase catalytic subunit hTERT cDNA in telomerase negative cells was first shown to reconstitute telomerase activity (Counter et al., 1998a; Weinrich et al., 1997; Wen et al., 1998). This suggested that the other components of telomerase were present and that the level of hTERT is the crucial factor in telomerase regulation. Control of hTERT expression appears to be by transcription and possibly also by alternative splicing (Kilian et al. 1997). It was then shown that stable expression of hTERT in normal human fibroblasts and some types of epithelial cells resulted in bypass of senescence (Bodnar et al., 1998; Vaziri and Benchimol, 1998). In some types of epithelial cells, however, functional disruption of the retinoblastoma gene product pRb or of p16INK4a was also required (Kiyono et al., 1998). Many normal cell types expressing hTERT have continued to divide unabated and have been reported to have normal checkpoint controls (Morales et al., 1999; Jiang et al., 1999), which suggests that they are not transformed and can provide an unlimited source of essentially normal cells. A recent

1-7 report however has identified that up-regulation of the oncogene c-myc occurs in hTERT immortalised human mammary epithelial cells (HMEC) and suggests that caution should be used in interpreting such cells as normal (Wang et al., 2000). The highly significant extension of in vitro lifespan achieved in these experiments adds considerable weight to the telomere hypothesis of senescence. There remain a number of caveats, however. It is at least possible that expression of hTERT has effects other than telomere maintenance, such as c-myc activation, and that these are responsible for the lifespan extension. It should be noted that expression of the adenovirus 12 E1B 54K protein (which is not known to have any effects on telomere maintenance) in normal human cells also resulted in lifespan extension of more than 100 PDs in some cases, and when these cells eventually ceased dividing terminal restriction fragment (TRF) analyses revealed insufficient telomere shortening to account for the proliferation arrest (Gallimore et al., 1997). Further, normal human oral keratinocytes senesced in culture without undergoing telomeric shortening (Kang et al., 1998). On the basis of these and other considerations it has been argued elsewhere that there may be more than one "mitotic clock" that can trigger senescence (Reddel, 1998). Another caveat is that the PD level at which the control cells are observed to become senescent in culture could possibly be well below their true proliferative potential. In the case of epithelial cells, culture conditions which do not completely prevent terminal differentiation can result in an artificially low proliferative potential. Further, there are a number of stimuli, including various forms of macromolecular damage other than telomere shortening, that can result in a senescence-like state sometimes referred to as premature senescence (Table 1-1) because it occurs prior to the Hayflick limit. It is very likely that optimal in vitro growth conditions have not yet been achieved for all cell types, in which case the Hayflick limit itself could be a form of premature senescence induced by cell culture-induced stress or damage. Telomeres appear to be particularly vulnerable to DNA damage (Von Zglinicki et al., 1995; Petersen et al., 1998; Sitte et al., 1998), so the effect of expressing telomerase in cultured normal cells could conceivably be to protect cells against this putative cell culture-induced damage. If this is correct, the possibility that there is a "true" Hayflick limit that is determined by something other than telomeric shortening cannot be ruled out yet. It will therefore be very interesting to determine whether the telomerase- expressing cells eventually senesce despite well-maintained telomeres. Normal cells transfected with hTERT are, however, now commercially available and there have been no reports of senescence in any cell types that have an immortal growth phenotype via hTERT transfection.

1-8 TABLE 1-1. Stimuli that result in premature senescence, a senescence-like state at a population doubling level below the Hayflick limit

Reported stimuli References Gamma-irradiation (Di Leonardo et al., 1994) Oxidative stress (Chen and Ames, 1994; Von Zglinicki et al., 1995; Chen et al., 1995; Bladier et al., 1997) Activated Ha-ras oncogene (Hicks et al., 1991; Serrano et al., 1997; Lin et al., 1998) Cross-linked DNA (Weeda et al., 1997) DNA breaks (Robles and Adami, 1998) Ceramide (Venable et al., 1995) Phosphatidylinositol-3-kinase inhibitor (Tresini et al., 1998) DNA demethylating agents (Holliday, 1986; Fairweather et al., 1987) Histone deacetylase inhibitors (Ogryzko et al., 1996; Xiao et al., 1997)

1.6 Correlations among in vivo age, telomere length, and proliferative potential

1.6.1 Correlation between telomere shortening in vivo and age

To answer the question of whether currently available cell culture conditions cause abnormally rapid shortening of the telomeres of normal cells in vitro, it will be necessary to determine the rate at which telomeres shorten per PD under normal conditions in vivo. Technical limitations have made it difficult to obtain such data so far, but it has been possible to examine mean telomere length in various tissues as a function of age. It has been shown that the telomere length of human proliferative somatic cells (from tissues including colonic mucosa, blood and bone marrow) is inversely correlated with age (Harley et al., 1990; Hastie et al., 1990; Lindsey et al., 1991; Vaziri et al., 1993; Slagboom et al., 1994; Vaziri et al., 1994; Iwama et al., 1998). The rate of loss has been estimated to be 31-84 PD/year (Hastie et al., 1990; Vaziri et al., 1993; Slagboom et al., 1994; Iwama et al., 1998). A recent study showed that the rate of telomere loss was most rapid in infants up to the age of four years (>1 kb/year in peripheral blood lymphocytes)

1-9 (Frenck, Jr. et al., 1998), but greater numbers of individuals will need to be examined to confirm this. In contrast to these proliferative tissues, no decrease in telomere length of supposedly non- proliferative brain tissue was seen with age (Allsopp et al., 1995).

1.6.2 Lack of correlation between age and proliferative potential

If telomere length determines proliferative capacity, and telomere length is inversely proportional to age, it would be expected that proliferative capacity would be inversely proportional to chronological in vivo age. A correlation was observed in several studies (Martin et al., 1970; Schneider and Mitsui, 1976; Allsopp et al., 1992; Slagboom et al., 1994), but it was not strong and a large study of healthy individuals has recently found no correlation between age and the proliferative capacity of 124 fibroblast cell strains (Cristofalo et al., 1998). It would be interesting to know whether there was any correlation in these individuals between telomere length and proliferative capacity, as has been seen previously in a less extensive study (Allsopp et al., 1992).

1.7 Expression of telomerase in normal tissues

One factor that potentially may complicate any relationships among age, telomere length, and cellular proliferative capacity is the ability of some normal cells to express telomerase activity (Table 1-2). Some evidence indicated that the amount of telomerase expressed in normal haematopoietic cells was insufficient to prevent telomere shortening (Broccoli et al., 1995; Engelhardt et al., 1997). Recent data suggest that lymphocytes in germinal centres may express telomerase at levels sufficient to lengthen telomeres (reviewed in Weng et al., 1998), which may enable clonal expansion. It is thus possible that expression of telomerase is a hallmark of proliferating cells (Belair et al., 1997; Greider, 1998), and that the relationship between age and proliferative capacity is modulated by the action of telomerase. However, it is unlikely that this accounts for the lack of correlation between age and proliferative capacity of fibroblasts (Cristofalo et al., 1998), because several studies have reported absence of detectable telomerase activity in this cell type (e.g. Bryan et al., 1995). Alternative explanations for the lack of correlation may include heritable differences in telomere lengths (Slagboom et al., 1994), or the action of an ALT telomere maintenance mechanism in fibroblasts.

TABLE 1-2. Examples of normal human cells and tissues with telomerase activity

1-10 Cell Type References Haematopoietic Cells (Broccoli et al., 1995; Counter et al., 1995; Hiyama et al., 1995) Epidermal Keratinocytes (Härle-Bachor and Boukamp, 1996; Yasumoto et al., 1996; Taylor et al., 1996) Hair Follicle Cells (Ramirez et al., 1997) Intestine (Hiyama et al., 1996) Uroepithelial Cells (Belair et al., 1997) Endothelial Cells (Hsiao et al., 1997) Liver (Burger et al., 1997) Endometrium (Kyo et al., 1997; Saito et al., 1997; Brien et al., 1997)

1.8 Evidence that short telomeres may limit proliferation in vivo

The contribution, if any, of senescence to in vivo aging is still uncertain: it is not known whether senescent cells accumulate in aging tissues and thereby contribute to a decline in their functional capacity. This lack of information is at least partly due to the dearth of markers with which to identify senescent cells. One useful marker is senescence-associated beta-galactosidase activity, and an age-dependent increase in this marker was found in dermal fibroblasts and epidermal keratinocytes, supporting the concept that the accumulation of senescent cells may be part of the aging process (Dimri et al., 1995). Regardless of whether senescent cells accumulate in vivo, an important question is whether shortened telomeres may be associated with or causally contribute to aging by resulting in decreased proliferative capacity. As will be discussed, studies of human tissues and of an animal model indicate that this may be the case. 1.8.1 Telomere shortening in human vascular endothelial cells

The TRF length of human vascular endothelial cells decreases with increasing PDs in vitro, and the TRF length of endothelium from arteries subject to high haemodynamic stress declined as a function of age at a greater rate than endothelium from other arteries and from veins (Chang and Harley, 1995). These data are consistent with the hypothesis that endothelial cells

1-11 have a higher rate of turnover and therefore of proliferation, and consequently a faster rate of decline of TRF length with age, in vessels subject to high haemodynamic stress. It has not been possible yet, however, to demonstrate that endothelial cells in these vessels do replicate more frequently than such cells located elsewhere, nor to show directly that the cells with shortened telomeres have reduced proliferative potential.

1.8.2 Telomere shortening and immunoexhaustion

In conditions where immunological function is deficient due to excessive cell turnover and replication, the telomere hypothesis would predict that telomeric shortening would accompany loss of proliferative capacity. This has been studied in the context of HIV-1-induced immune dysfunction, and the results have been complex. CD8(+) T cells were found to have shorter telomeres consistent with an increased turnover of these cells and exhaustion of the CD8(+) T-cell responses in HIV-1 infection. For CD4(+) T cells, telomere length analyses do not seem to provide evidence for replicative exhaustion, although the relationship here between telomere length and turnover remains controversial (reviewed in Wolthers and Miedema, 1998).

1.8.3 Telomere shortening and cellular proliferation capacity in the telomerase-negative mouse

The most compelling evidence for a relationship between telomere length and proliferative capacity in vivo has come from mice rendered telomerase-negative by targeted disruption of the mouse telomerase RNA subunit (mTER) gene (Blasco et al., 1997). Although cells from these mice are readily able to become immortalised in vitro, presumably due to an ALT mechanism, and are able to form tumours following transduction with an activated oncogene (Blasco et al., 1997), progressive telomeric shortening occurred with successive generations and was associated with decreased proliferative potential in the haematopoietic system and the testis (Lee et al., 1998). The presence of senescent cells in these or other tissues was not reported, but there was an increase in apoptosis (Lee et al., 1998). Some chromosome ends in mTER-negative cells lacked a detectable telomeric DNA sequence, and there was evidence for increased end-to-end fusion. These changes, which resemble those in cultured human cells in crisis rather than in senescence, may trigger apoptosis rather than senescence, at least in testicular and haematopoietic tissues. Although this result clearly shows a relationship between extreme telomere shortening and a decreased proliferative potential in vivo, caution must be exercised in drawing conclusions about normal aging where telomere shortening does not occur to this extent.

1-12

1.9 Perspectives on the telomere hypothesis of senescence and aging

The telomere hypothesis of senescence is supported by the observation that telomeres shorten with proliferation of normal human cells in vitro and that expression of telomerase in otherwise normal cells is capable of increasing their proliferative capacity. There are a number of questions that remain to be answered, however, and confirmation of the hypothesis will require more detailed analysis of telomere lengths in individual cells that become senescent, and experimental induction of senescence by shortening of one or more telomeres in young cells. A signalling pathway that leads from shortened telomeres to induction of senescence needs to be elucidated. It is not yet clear to what extent these in vitro observations reflect the situation in vivo. It is possible that in the normal in vivo environment the controlled actions of telomerase and maybe one or more alternative telomere maintenance mechanisms are usually capable of preventing telomere shortening from limiting proliferation. In this regard an important question that needs to be answered is why cells lose telomerase activity when cultured in vitro (Klingelhutz et al., 1996; Kang et al., 1998). It has not yet been clearly demonstrated that cellular senescence contributes to organismal aging, although cells with at least some of the characteristics of senescence have been identified in tissues in vivo. Nevertheless, extreme telomere shortening resulting from lack of telomerase activity for several generations has been shown in a mouse model to result in reduced in vivo proliferation. If it can be shown that telomere shortening-induced reduction in proliferative capacity contributes to aging in some tissues, it is at least possible that some aspects of aging may be able to be ameliorated by the development of treatments that act to restore telomere length. Cells that undergo an abnormal extension of lifespan due to functional deficiency of genes such as p53 or the pRb pathway appear to undergo critical telomere shortening such that continued proliferation is dependent on activation of a telomere maintenance mechanism: telomerase or an ALT mechanism. The immortalisation that thus ensues appears to be an important feature of the cancer phenotype, and inhibitors of the telomere maintenance mechanisms may therefore be useful for treating cancer.

1.10 Telomeres, immortalisation and cancer

1.10.1 The role of senescence and immortalisation in cancer

1-13 It has been proposed that senescence acts as a barrier to tumourigenesis (Newbold et al., 1982; Newbold and Overell, 1983; Sager, 1991; Barrett et al., 1993) which suggested that immortalisation is a key step in the transformation of human cells to the cancer phenotype . The arguments in favour of this proposal have accumulated steadily over a number of years. Some types of cancer, such as , have proved very difficult to explant and culture in vitro suggesting that they were not immortalised, but this may well be due to inadequate culture conditions. Laboratory studies some years ago showed that unlimited serial transplantation of was possible whereas normal tissues could be transplanted only a finite number of times (Daniel et al., 1975). These findings did not preclude the possibility that immortalisation was merely a byproduct of tumourigenesis but it was subsequently reported that immortalisation appeared to be a prerequisite for tumour induction (O'Brien et al., 1986; Reddel et al., 1988). In addition, studies in bronchial epithelial cells revealed that induction of tumourigenicity by the Ki- ras oncogene required an initial immortalisation event via SV40 genes (Reddel et al., 1988; Amstad et al., 1988; Reddel et al., 1995). Other evidence for the central role of immortalisation in cancer is that various strains of human papillomavirus (HPV), that are associated with malignancy, can induce immortalisation of human cells in culture (Schlegel et al., 1988; Pecoraro et al., 1989; Woodworth et al., 1989). Most importantly, it has been shown that the genetic changes associated with immortalisation are also the most important known changes characterised in cancer. Inactivation of the p53 and the pRb/p16INK4a pathways are the most important known loss of function in cancer. The p53 gene product is a tumour suppressor and has a key role in monitoring genomic integrity in human cells (Lane, 1992). The p53 gene is also the most commonly mutated in human cancer, having been found to be inactivated in approximately 60% of all human tumours (Hollstein et al., 1991). p53 was discovered as a 53 kDa protein that binds to the SV40 large T antigen (LTAg) (Lane and Crawford, 1979; Linzer and Levine, 1979) and was also later found to bind to another important viral oncoprotein, HPV E6 (Scheffner et al., 1990; Werness et al., 1990). This suggested that these tumour viruses exerted their effects via abrogation of p53 function and subsequent studies using mutant viral genes provided evidence for this (reviewed in Bryan and Reddel, 1994). Significantly, studies from this laboratory (Whitaker et al., 1995) and from other groups have found that p53 mutations are also common in a wide range of different immortalised cell lines. Consistent with this, loss of p53 function has been shown to confer an extended lifespan, i.e. temporary escape from senescence, in fibroblasts from an affected member of a Li-Fraumeni Syndrome (LFS) family (Rogan et al., 1995). LFS individuals have an inherited germ line mutation in one p53 allele and suffer from a high incidence of cancer due to the concomitant loss of p53 function at a much higher frequency (Malkin et al.,

1-14 1990; Srivastava et al., 1990). Another study showed that expression of a dominant-negative mutant p53 in normal fibroblasts also caused temporary escape from senescence (Bond et al., 1994). In addition to the lifespan extension seen in LFS fibroblasts, the only documented incidences of spontaneous immortalisation of human cells in culture have been in an earlier study of LFS cells (Bischoff et al., 1990) which was later reported also by this laboratory and shown to correlate with loss of p53 function (Rogan et al., 1995). Studies from this laboratory and others have shown that a terminal proliferation arrest (TPA) state exists that is intermediate, in terms of cumulative PDs, between senescence and crisis and is dependent on p53 loss (Bond et al., 1994; Rogan et al., 1995; Duncan and Reddel, 1997; Reddel, 1998; Bond et al., 1999). The p53 pathway is therefore a vital component linking senescence and immortalisation with human tumourigenesis. Disruption of the pRb/p16INK4a pathway is another key event that links immortalisation of human cells with the cancer phenotype. SV40 and HPV oncoproteins have been shown to interact with members of the retinoblastoma (Rb) gene family and cause their inactivation (reviewed in Bryan and Reddel, 1994). In human tumours, mutations in Rb are less common than mutations in p53 but loss of normal p16INK4a expression occurs frequently and there is now a wide body of evidence that this is functionally equivalent to inactivation of pRb by viral oncoproteins. The pRb protein is physiologically active in a hypophosphorylated form in which it acts to inhibit progression through the cell cycle by binding members of the E2F transcription factor family (Ludlow et al., 1993; Sherr, 1996). Cell cycle progression is accomplished by phosphorylation of pRb by a holoenzyme complex containing cyclin D and a cyclin dependent kinase, either cdk4 or cdk6, which releases E2F and promotes DNA synthesis. The p16INK4a protein was identified as an inhibitor of this cyclin D complex (Serrano et al., 1993) and its function is to maintain pRb in its active state. In human tumours, loss of p16INK4a function is a common event due to point mutation, gene deletion and also loss of expression via hypermethylation of the CpG island in the upstream control region of the gene (Huschtscha and Reddel, 1999). In addition, it has been shown that loss of function of pRb or p16INK4a, but not both, occurs in most immortalised cell lines (Okamoto et al., 1994; Whitaker et al., 1995). It is also significant that p16INK4a levels are considerably increased in a number of different human cell types at the onset of senescence, including fibroblasts (Alcorta et al., 1996; Hara et al., 1996; Palmero et al., 1997), epithelial cells (Loughran et al., 1996; Reznikoff et al., 1996) and T lymphocytes (Erickson et al., 1998). Further analysis of the spontaneously immortalised LFS fibroblasts generated by this laboratory found that both copies of p16INK4a gene were deleted and that in other LFS fibroblast cultures there was a temporary life span extension associated also with loss of p16INK4a (Noble et al., 1996). The loss of p16INK4a in addition to the loss of p53 function was shown to have an

1-15 additive effect on lifespan extension such that the cumulative PDs past the point of senescence (Noble et al., 1996) was greater than seen in cells that had lost p53 only (Rogan et al., 1995). This increase in lifespan extension was not sufficient for immortalisation but was similar to the additional number of PDs reported for LFS fibroblast cultures transfected with SV40 genes (Maclean et al., 1994). These studies strongly implicated p16INK4a in the immortalisation process as an early event. The role of p16INK4a in lifespan extension of normal human cells was further strengthened by observations from different groups, including this laboratory, that HMECs undergo spontaneous loss of p16INK4a function via CpG island hypermethylation, and that this allows a temporary escape from senescence for a subset of dividing cells (Brenner et al., 1998; Foster et al., 1998; Huschtscha et al., 1998). The p53 and p16INK4a pathways which are disrupted in a wide variety of human tumours are thus also strongly implicated in senescence and immortalisation. This evidence provides a strong molecular link between the processes of cellular lifespan extension, leading to a rare immortalisation event, and human tumourigenesis. One of the additional molecular pathways that further implicates immortalisation as a fundamental step in tumour formation is the activation of a telomere maintenance mechanism and this is now discussed in the next section.

1.10.2 Telomere maintenance is a fundamental property of both immortalised cells and tumour cells

There are notable examples of normal tissues that express telomerase (shown in Table 1-2) but most normal human somatic cells have low or undetectable levels of telomerase activity. This is consistent with the telomere hypothesis of senescence, as cells grown from explanted normal tissue have a finite lifespan in culture (Hayflick and Moorhead, 1961; Hayflick, 1965). In contrast, it has now been clearly shown that the majority of immortalised cell lines have readily detectable levels of telomerase activity (Counter et al., 1992; Kim et al., 1994; Bryan et al., 1995). The close temporal association between the onset of immortalisation and the activation of telomerase was originally described by Counter et al. (Counter et al., 1992) and confirmed by a later report from this laboratory (Noble et al., 1996). As discussed in section 1.5.2, expression of the catalytic subunit of human telomerase, hTERT, is sufficient to cause lifespan extension in

1-16 some different normal cell types with no onset of senescence or crisis (Bodnar et al., 1998; Vaziri and Benchimol, 1998). Additionally, expression of hTERT in pre-crisis cells causes bypass of crisis (Counter et al., 1998b; Hahn et al., 1999a; Halvorsen et al., 1999; Zhu et al., 1999). Telomerase activity, and consequently telomere maintenance, is therefore a vital event in the immortalisation of human cells. Importantly, it has also been shown that in the majority (85%) of human tumour derived cell lines and tumour samples, telomerase activity is detectable also (Kim et al., 1994; Shay and Bacchetti, 1997). This evidence further implicates immortalisation as a key step in tumourigenesis and suggests that cancer cells require telomere maintenance, and a concomitant immortal phenotype, due to proliferative demands that are comparable to immortalised cells in culture. Significantly, however, not all human immortalised cell lines and tumour cell types have detectable telomerase activity. This allows for the possibility that some tumours are not immortalised (reviewed in Reddel, 2000) but it has been demonstrated that a great many of these cell types do in fact maintain telomere lengths. This phenomenon, known as ALT, is a telomerase-independent telomere maintenance mechanism(s) that exists in a variety of in vitro immortalised (Murnane et al., 1994; Bryan et al., 1995), and tumour cell types (Bryan et al., 1997b). ALT was first identified in this laboratory (Bryan et al., 1995) and the characteristics and molecular mechanisms underlying the ALT phenotype in human cells form the basis of this study.

1.11 Alternative lengthening of telomeres (ALT)

1.11.1 Telomerase-independent telomere maintenance in lower eukaryotes

There have been a number of studies in different eukaryotic organisms showing the existence of telomerase-independent telomere maintenance. Inactivation of telomerase in the yeast Saccharomyces cerevisiae results in senescence and cell death (Lundblad and Szostak, 1989; Lundblad and Blackburn, 1993) which is not a phenomenon associated with a mass culture of unicellular organisms. Surviving cells emerged however, and these survivors were shown to have maintained their telomeres by a RAD52 dependent pathway that involved amplification of subtelomeric elements (Lundblad and Blackburn, 1993). Recombination at the telomeres of yeast cells had already been described in an earlier report (Pluta and Zakian, 1989). Another study found that in the yeast strain, Kluyveromyces lactis, a similar phenotype resulted from abrogation of telomerase activity and telomeres in cells that escaped senescence were maintained via a RAD52 dependent recombination pathway (McEachern and Blackburn, 1996). In that report it

1-17 was suggested that recombinational repair, between telomeres that were no longer capped by telomerase, was a general alternative telomere maintenance pathway in eukaryotes (McEachern and Blackburn, 1996). There were two distinct classes of telomerase-negative S. cerevisiae survivors (Lundblad and Blackburn, 1993) and a more recent study on these cells that utilise an alternative telomere maintenance mechanism has termed these pathways type I and type II (Teng and Zakian, 1999). Type I survivors represent the majority (90%) and have amplified subtelomeric elements at the telomeres followed by short telomeric tracts (Lundblad and Blackburn, 1993; Teng and Zakian, 1999). Type II survivors have much longer telomeres consisting of amplified yeast telomeric repeats (Teng and Zakian, 1999) and this indicates that more than one alternative pathway exists in telomerase-negative yeast survivors. It was subsequently demonstrated that type I survivors arose by a RAD51-dependent process whereas type II survival depends on RAD50 (Teng et al., 2000). This suggested that different recombination pathways can be utilised for alternative telomere maintenance in telomerase-negative yeast survivors. Telomerase-independent telomere maintenance mechanisms have also been identified in both Drosophila (Biessmann et al., 1990; Biessmann et al., 1992) and the mosquito Anopheles gambiae (Roth et al., 1997). In Drosophila the telomeres are maintained by retrotransposition and the transposable elements (HeT-A or TART) are responsible for chromosome end healing and telomere lengthening (Biessmann et al., 1990; Biessmann et al., 1992)(reviewed in Biessmann and Mason, 1997). In the mosquito it has been shown that recombination mechanisms extend and maintain telomeres (Roth et al., 1997) thus providing further evidence for a role for recombination in telomere lengthening in different organisms. As will be discussed in the following sections, such a mechanism exists also in human cells, now known as ALT, and also involves recombination at the telomeres.

1.11.2 Telomere maintenance in immortalised human cells via a telomerase-independent mechanism known as ALT

As previously indicated, not all immortalised human cell lines or tumour cell types had detectable telomerase activity. Utilising a highly sensitive telomerase assay, the PCR based telomere repeat amplification protocol (TRAP) (Kim et al., 1994), it was discovered that some human cell lines immortalised in vitro had no detectable activity (Kim et al., 1994; Murnane et al., 1994; Bryan et al., 1995; Rogan et al., 1995; Whitaker et al., 1995). A number of experiments showed that there were no inhibitors of telomerase activity in these cell lines (Bryan et al., 1995).

1-18 TRF analyses of these telomerase-negative cell lines revealed a striking telomere length phenotype. Separation of terminal fragments using pulsed field gel electrophoresis, which allows resolution of extremely large DNA fragments, followed by hybridisation to a radiolabelled

(TTAGGG)3 oligonucleotide probe, revealed that the telomeres of these cell lines had lengths which was characterised by a smear from the bottom of the gel up to the well (Bryan et al., 1995). In situ hybridisation analysis using telomere specific probes confirmed that this extreme telomere length heterogeneity occurred within individual telomerase-negative cells (Henderson et al., 1996; Lansdorp et al., 1997). Hence the telomere lengths of these cells ranged from very long to very short or undetectable. This phenotype has never been detected in either normal cell types or telomerase-positive immortalised cell lines and was only detectable in telomerase-negative cell lines at the onset of immortalisation, being subsequently maintained over many PDs (Bryan et al., 1995). This was clear evidence that a telomere maintenance mechanism exists in a subset of immortalised human cell lines that is independent of telomerase. This phenomenon is now known as alternative lengthening of telomeres (ALT) (Bryan and Reddel, 1997; Bryan et al., 1997b).

1.11.3 The incidence of ALT in immortalised human cells

The incidence of ALT in a variety of immortalised cell lines has been examined in a number of studies by this laboratory and others. The majority of the in vitro immortalised cell lines that have been assessed have been fibroblasts (cells of mesenchymal origin) that are transformed by SV40 genes and approximately half were found to utilise ALT (Bryan et al., 1995 and unpublished data). Interestingly, studies of fibroblast cell lines derived from a LFS individual following either spontaneous immortalisation or transfection with SV40 or HPV-16 found that 14/14 utilised ALT (Bryan et al., 1995 and unpublished data). Another study from this laboratory also found that 11/25 SV40 immortalised jejunal fibroblast lines from a non LFS individual had an ALT phenotype (unpublished data). The number of epithelial and mesothelial cell lines examined so far is small but the indication is that they are likely to be telomerase-positive as only one in vitro immortalised epithelial cell line and one mesothelial line has been found to have an ALT phenotype (Bryan et al., 1995). These data, collectively, suggest that the prevalence of ALT is significantly higher in immortalised fibroblasts. This is particularly true of cell lines that have been transformed by SV40, although fibroblasts transduced by HPV genes, chemical carcinogens or by ionising radiation can also utilise ALT. The finding in LFS fibroblasts is intriguing as it

1-19 implicates a pre-existing p53 null allele in a strong predisposition to activation of ALT in immortalised cells. The mechanism behind this is not clear but is under investigation, including testing fibroblasts from additional individuals. The lower incidence of ALT in immortalised epithelial cells may be partly explained by studies showing that telomerase is detectable at a low level in some normal epithelial cells (Ramakrishnan et al., 1998; Kolquist et al., 1998) but is usually undetectable in normal fibroblasts. It is noteworthy however, that another study reported that 19/19 SV40 immortalised neonatal foreskin fibroblasts were telomerase-positive (Montalto and Ray, 1996). The reasons for this disparity are not clear but may be to do with the specific cell lineage. There is still good evidence to support the proposal that fibroblasts, particularly those of LFS origin, have a much higher propensity for ALT as a means to becoming immortal and that this is likely to have implications for elucidating the mechanism(s) of ALT.

1.11.4 The incidence of ALT in human tumours and tumour derived cell lines

One of the most important questions regarding ALT was whether it was an in vitro phenomenon only and therefore whether this phenotype had any relevance in vivo. A study from this laboratory has shown that ALT was not restricted to in vitro immortalised cell lines but was identified in 4/57 tumour samples and 4/56 tumour derived cell lines (Bryan et al., 1997b). These findings were highly significant as they pointed to a direct role for ALT in human tumourigenesis and supported the contention that telomere maintenance is a requirement for the cancer phenotype, whether by telomerase or ALT. Of the tumour cell lines that were found to utilise ALT, 3/4 were derived from sarcomas (Bryan et al., 1997b) and this is consistent with the observations that ALT is more prevalent in in vitro immortalised fibroblasts (Bryan et al., 1995). ALT tumour cells are considerably less common however, than in vitro immortalised ALT cells but this may be due in part to the much higher frequency of human cancers of epithelial origin (90%). Further sampling and analysis will be necessary to better document the prevalence of ALT in tumour tissue. There was evidence also of a possible association between ALT and tumours derived from LFS individuals (Bryan et al., 1997b). Because the majority of human tumours are telomerase-positive, and have no functional p53, this suggests the possibility that the order in which mutations such as p53 occur may have a role in determining which telomere maintenance mechanism is activated. It has been documented that SV40 DNA is present in a number of human cancers, particularly mesotheliomas, and this has been attributed to contamination of polio vaccines (reviewed in Butel, 2000). It is not known whether SV40 has an aetiological role in any of these

1-20 tumours. Because there is a high frequency of SV40 immortalised cell lines that have the ALT phenotype a series of analyses has been undertaken in this laboratory of tumour samples of mesothelial origin to assess whether, if SV40 does indeed have an aetiological role, they have a higher incidence of ALT. The results in 42/42 tumour samples (obtained from Dr. Harvey Pass, Detroit, MI, USA) however, did not reveal any incidence of a characteristic ALT phenotype and all were telomerase-positive (T. Hackl et al., unpublished data). Although this does not support the hypothesis that SV40 transformation predisposes cells to activate ALT there is a significant amount of further analysis that will be required to elucidate the ALT/SV40 interrelationship and these studies are ongoing in this laboratory.

1.11.5 A morphological marker of ALT in human tissue

Observations from this laboratory of both normal and immortalised human cells have now revealed that in 1-5% of interphase nuclei of ALT cells, but neither normal nor telomerase-positive immortal cells, there are large nuclear aggregates present. These structures are now referred to as ALT-associated PML bodies (APBs) and contain TTAGGG repeat sequences, telomere binding proteins TRF1 and TRF2, PML protein (involved in a translocation-induced fusion protein in promyelocytic leukaemia), replication factor A and homologous recombination gene products RAD51 and RAD52 (Yeager et al., 1999). In addition it has recently been shown that RAD50/Mre11/Nbs1 protein complexes, which are involved in cell cycle checkpoint control and repair of DNA damage, also localise to APBs (Lombard and Guarente, 2000; Wu et al., 2000). The presence of APBs can be detected by immunostaining cells with antibodies to the proteins that co-localise, such as TRF1 and TRF2 (Yeager et al., 1999). Additionally, telomere fluorescence in situ hybridisation (FISH) with a peptide nucleic acid (PNA) probe also detects APBs in interphase nuclei. APBs have only been detected in ALT cells and the staining pattern seen in the nuclei of all other cell types examined is diffuse with no evidence of such aggregates (Yeager et al., 1999). Importantly, APBs were detectable not only in in vitro immortalised ALT cell lines but also in ALT tumour tissue. A nude mouse tumour formed by EJ-ras transformed ALT fibroblasts had detectable APBs and a significant finding was that a paraffin embedded ALT breast carcinoma also stained positively for APBs (Yeager et al., 1999). The role of APBs in ALT is not currently known but is under investigation in this laboratory. The factors that comprise these aggregates is of particular interest as they include telomeric repeats and telomere binding proteins and this may be of relevance to the mechanism of ALT. PML is detectable in normal cells and its function is largely unknown although it has been

1-21 implicated in both apoptosis (Quignon et al., 1998) and senescence (Jiang and Ringertz, 1997). Of particular interest are the RAD gene products as RAD52 dependent recombination is implicated in alternative telomere lengthening in yeast (section 1.11.1) and, as will be subsequently discussed, telomere-telomere recombination is a principal component of ALT in human cells. It is not yet clear whether the detection of APBs coincides with a particular cell cycle stage (which would be consistent with APB presence in only a proportion of cells) or whether APB-positive cells have in fact permanently ceased cell division. An incidental finding has shown that growth arrest in some, but not all, ALT cells caused by over confluent cultures resulted in a tenfold increase in the prevalence of APBs (~50% nuclei) (T.R.Yeager and R.R. Reddel, unpublished data). Although this suggests that detection of APBs correlates with a growth arrested state, due possibly to accumulation of damage at the telomeres, a recent report has shown that cells with detectable APBs are capable of DNA synthesis and re-entry to the cell cycle (Grobelny et al., 2000). Further work is ongoing to both purify APBs and identify the status of cells that contain them. The earliest methods of detection of ALT required sufficient cells for DNA and protein extraction to undertake TRF Southern and TRAP analysis, respectively. The discovery of APBs as a morphological marker of ALT has enabled detection of ALT in only a small number of cells. In this regard, APB detection can be applied to archival tumour material in paraffin sections (Yeager et al., 1999) and this is of great clinical utility as it facilitates the screening of large numbers of tumours for the presence of ALT. This will allow for clinical correlations to be determined and may also be useful for future decisions regarding choice of anticancer therapy.

1.11.6 ALT in human cells involves telomere-telomere recombination

As mentioned previously (section 1.11.1), telomere maintenance can occur by recombination in both yeast and the mosquito and in the case of yeast type II survivors this involves generation of long telomere tracts which resembles the human ALT phenotype. A study was undertaken in this laboratory to test for recombination at the telomeres of ALT cells as this was also a possible mechanism for the generation of extremely long TTAGGG tracts. It had already been determined that generation of ALT telomeres could not have been due to hyperextension by a mutant form of telomerase as the RNA component hTER is absent from a number of ALT cell lines (Bryan et al., 1997a), and reconstitution of telomerase activity requires both hTERT and hTER in these cells (Wen et al., 1998). To examine the possible role of recombination/copy switching at the telomeres in ALT telomere maintenance, tagged telomeres

1-22 (containing an internal neo signal) were introduced into ALT cells and the signal was monitored over subsequent PDs. At later PDs in these cells the telomere tag was copied onto other telomeres, thus providing direct evidence for recombination as a fundamental component of ALT (Dunham et al., 2000). Importantly, a control tag that had been introduced subtelomerically was not copied to other telomeres and this indicated that the recombination was specific to the telomeres (Dunham et al., 2000). These findings provided a major advance in our understanding of ALT and facilitate the search for genes involved. This evidence suggested that the generation and maintenance of long telomeres in ALT cells may be due to use of a long telomere as a copy template for lengthening of a short telomere via strand invasion (Figure 1-1).

1.12 Aims of this project

1.12.1 The importance of ALT as a future target for cancer therapies

Telomerase has become a major target in the search for new cancer treatments due to its prevalence in a wide variety of tumour types (Kelland, 2000; Lavelle et al., 2000). It is

1-23 TTAGGG

Figure 1-1

A model for the proposed recombination based ALT mechanism. Since each telomere contains the same sequence tandemly repeated, telomeres in ALT cells could use other telomeres, or themselves (following loop-structure formation) as a copy template.

1-24

probable, however, that most of the telomerase inhibitors that are developed will be ineffective against ALT. Because ALT is activated in some human tumours (Bryan et al., 1997b), it is possible that inhibition of telomerase activity will provide a strong selective pressure to activate ALT in tumours that had previously utilised telomerase. Significantly, both telomerase and ALT have been found in some tumours analysed in this laboratory (Bryan et al., 1997b) although it is not possible at present to determine whether this occurred in the same cells. This suggests that such tumours could revert to an ALT phenotype due to outgrowth of ALT survivors from a telomerase inhibited population of cells. There is therefore a need to understand both the mechanism and the control of ALT as future cancer therapies based on telomere maintenance may well require inhibition of both telomerase and ALT to be effective. The focus of this thesis is therefore to advance our understanding of ALT, particularly ALT inhibition.

1.12.2 Control of the ALT mechanism

A number of studies were initially undertaken using somatic cell hybrids to determine the existence of ALT repressors in non-ALT cells and also assess whether ALT is a recessive trait. The ALT cell line GM847 (SV40 immortalised skin fibroblasts) was used for the majority of the experiments due to the robustness of the cells and the ease with which they could be manipulated in culture. GM847 cells were fused with normal cells to suppress the immortal phenotype, due to the recessive nature of immortality as described in the original experiments of this type (Bunn and Tarrant, 1980; Muggleton-Harris and DeSimone, 1980; Pereira-Smith and Smith, 1983). The resulting hybrid clones became senescent as expected and this correlated with a rapid loss of telomeric tracts and repression of ALT. Immortal revertants that arose from the senescent population had reactivated ALT. These results are described in Chapter 3 and indicate that activation of ALT is due to loss of normal repressors and is therefore a recessive trait. This has implications for the search for candidate genes and also identifies the existence of factors in normal cells that inhibit ALT. The rapid loss of telomeres is also discussed in relation to the ALT mechanism. A similar series of experiments was undertaken by analysing fused hybrids of GM847 cells and telomerase-positive cells from the same complementation group (Chapter 4). Each complementation group was defined as a set of different cell lines that would generate immortal hybrids when fused, presumably due to shared genetic pathways to immortalisation, and four such groups (A-D) were originally described (Pereira-Smith and Smith, 1988). The ALT X telomerase- positive hybrid clones under study retained telomerase activity and were immortal but the ALT

1-25

phenotype was repressed. An initial rapid loss of telomeres was also evident in many of these clones. Although in some clones very long telomeres remained, these were shown to shorten at normal rates and reach a stable length characteristic of the parental telomerase-positive cells. In addition there was an almost complete loss of APBs at the earliest timepoints analysed. This suggested the possibility that the same repressors of ALT evident in normal cells were present in telomerase-positive cells also. Another possibility was that telomerase was a repressor of ALT and this is the focus of Chapter 5. To test whether telomerase activity would repress ALT, hTERT was transfected into GM847 cells. It had already been demonstrated that this was sufficient to reconstitute telomerase activity in these cells (Counter et al., 1998a; Wen et al., 1998). The resulting clones (GM847/hTERT) however, were not ALT repressed and there thus appeared to be no effect of telomerase on the ALT telomere phenotype when analysed by TRF at early PDs. At subsequent timepoints however, the shortest telomeres had been lengthened and this was evident both by TRF and telomere FISH analysis (Chapter 5). Significantly, long telomeres characteristic of ALT but not telomerase-positive cells were still maintained after 130-150 PDs and there was no loss of APBs. For the first time telomerase was shown to cause actual telomere lengthening in ALT cells and to co-exist with ALT in the same cell. These results indicated that telomerase was not responsible for ALT repression in the somatic cell hybrids and hTERT was presumably the only component of the telomerase holoenzyme absent from GM847 ALT cells. This has implications for our understanding of the control of both telomerase and ALT.

1.12.3 Identification of ALT inhibitors

A number of inhibitors of telomerase have been identified including a dominant-negative hTERT (dn hTERT) construct which causes telomere shortening and can induce apoptosis (Zhang et al., 1999) or senescence (Colgin et al., 2000) in telomerase-positive cells. Consistent with the hypothesis that ALT and telomerase are distinct mechanisms of telomere maintenance and are controlled separately, it has been reported that dn hTERT expression in GM847 cells has no growth effects (Hahn et al., 1999b). A repeat of this experiment was undertaken and in contrast to this earlier report, there was evidence of telomere shortening in a subset of clones indicating ALT repression (Chapter 6). Additional studies with dn hTERT in other ALT cell lines are underway as this finding has important implications in not only identifying specific repressors of ALT but also as a possible link between the ALT and telomerase pathways which has not been detected previously.

1-26

A putative repressor of telomerase has been localised to both chromosome 3 (Ohmura et al., 1995; Blackmore et al., 1992; Tanaka et al., 1998; Cuthbert et al., 1999) and chromosome 7 (Nakabayashi et al., 1999) by microcell mediated chromosome transfer (MMCT). Experiments were carried out by MMCT of human chromosomes 6 and 7 into GM847 cells to attempt to localise the putative ALT repressor(s) identified in the somatic cell hybrids (Chapter 7). Chromosome 6 was chosen because it has been shown to cause senescence in cell lines from complementation group A (Sandhu et al., 1994)(reviewed in Ozer, 2000), to which GM847 has been assigned (Pereira-Smith and Smith, 1988). Chromosome 7 has been shown to repress ALT in a group D cell line SUSM-1 (Nakabayashi et al., 1997) and it was of interest whether this would be true of GM847 cells. Evidence from a number of repeat MMCT experiments showed that a repressor of ALT in GM847 cells is expressed on chromosome 6 and this will allow for a more refined search for this factor.

1.12.4 Structure and sequence of ALT telomeres

A number of experiments were conducted to ascertain whether the TRF smear, characteristic of ALT, was a true reflection of telomere size or was an artefact caused by novel secondary structure at the telomeres of ALT cells. Denaturing gels showed that ALT telomeres in a number of different representative cell lines are genuinely heterogeneous ranging from very long to very short (Chapter 8). This is also consistent with telomere FISH to ALT cell chromosomes. To learn more about the nature of the ALT telomere repeats themselves, sequences containing TTAGGG repeats were cloned from the ALT cell line WI38 VA13/2RA. The clones obtained localised to specific telomeres by FISH analysis and contained TTAGGG repeats, alternate G-rich repeats and additional sequences. The significance of this finding in relation to further understanding the ALT mechanism is also discussed in Chapter 8.

1-27

2. Chapter Two

Materials and methods

2. Chapter Two...... 2-1 2.1 Sources of reagents...... 2-3 2.1.1 Chemicals and general reagents ...... 2-3 2.1.2 Cell culture reagents...... 2-5 2.2 Buffers and solutions...... 2-5 2.3 Cell Lines and Cell Culture...... 2-6 2.3.1 In vitro immortalised human cell lines used in this study...... 2-6 2.3.2 Tumour derived human cell lines used in this study...... 2-7 2.3.3 Normal human cell strains used in this study...... 2-7 2.3.4 Dulbecco's Modified Eagle's (DME) Medium...... 2-7 2.3.5 Growth of cell cultures...... 2-8 2.3.6 Cryopreservation of mammalian cells...... 2-8 2.3.7 Culturing of A9:Human Monochromosome Hybrids ...... 2-8 2.3.8 Cell-Cell hybridisation ...... 2-8 2.3.9 T-Antigen immunostaining of cell monolayers ...... 2-9 2.3.10 Detection of ALT-associated PML bodies by immunostaining of cell monolayers 2-9 2.3.11 Flow cytometry analysis...... 2-10 2.3.12 Cell imagery...... 2-10 2.4 DNA fingerprinting of somatic cell hybrids ...... 2-10 2.4.1 PCR fingerprinting ...... 2-10 2.4.2 Hybridisation with a single locus fingerprinting probe...... 2-11 2.5 Telomere repeat amplification protocol (TRAP) assay...... 2-12 2.5.1 Assay for telomerase activity...... 2-12 2.5.2 Lysis of cells and tissues ...... 2-13 2.5.3 Measurement of protein concentration...... 2-13 2.5.4 Telomerase and PCR reaction ...... 2-14 2.5.5 Electrophoresis ...... 2-14 2.5.6 Internal PCR standard for the TRAP assay...... 2-14 2.6 Extraction of genomic DNA from human cells in culture ...... 2-15 2.7 Preparation of metaphase chromosome spreads...... 2-15 2.8 Terminal restriction fragment Southern analysis (TRF) ...... 2-16 2.8.1 Digestion of genomic DNA...... 2-16 2.8.2 Quantitation of digested DNA by Fluorometry...... 2-16 2.8.3 Electrophoresis and hybridisation of digested DNA...... 2-16 2.8.4 Pulsed-field gel electrophoresis ...... 2-17 2.8.5 Alkaline agarose gel electrophoresis...... 2-17 2.8.6 Computing Densitometry ...... 2-17 2.8.7 Estimation of telomere shortening rate...... 2-18 2.8.8 Colony hybridisation to a telomere probe ...... 2-18 2.9 Telomere length analysis by fluorescence in situ hybridisation ...... 2-18

2-1

2.10 Detection of neo signal in human cells ...... 2-19 2.10.1 Southern analysis...... 2-19 2.10.2 Fluorescence in situ hybridisation...... 2-20 2.11 Plasmid expression vectors...... 2-20 2.11.1 Plasmids used in this study...... 2-20 2.11.2 Transformation of competent bacteria ...... 2-21 2.11.3 Preparation of plasmid DNA...... 2-21 2.12 Transfection of human cells with plasmid vectors...... 2-21 2.13 Microcell-Mediated Chromosome Transfer...... 2-22 2.13.1 Day 1 - Preparation of chromosome donor cells for microcell production...2-22 2.13.2 Day 2 - Induction of micronucleation ...... 2-22 2.13.3 Day 3 - Preparation of recipient cell monolayers...... 2-22 2.13.4 Day 4 - Production of microcells and fusion with recipient cells ...... 2-22 2.13.5 Day 5 - Selection for chromosome transfer to recipient cells ...... 2-23 2.13.6 Stock solutions ...... 2-23 2.14 Chromosome painting of metaphase spreads ...... 2-24

2- 2

Materials and methods

2.1 Sources of reagents 2.1.1 Chemicals and general reagents

Reagent Source

β-mercaptoethanol (molecular biology grade) Sigma Chemical Co., USA 1,4 Diazabicyclo(2.2.2)octane (DABCO) Sigma, USA 3-[(3-cholamidopropyl-dimethylammonio]-1- Pierce, USA propanesulphonate (CHAPS) 4-(2-aminoethyl)-benzenesulphonyl fluoride hydrochloride ICN Biomedicals, USA (AEBSF) 4',6-Diamidino-2-phenylindole dihydrochloride (DAPI) Sigma, USA 5'-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) Progen, Australia Acetic acid (glacial) British Drug House, Ltd. UK (B.D.H.) Acrylamide (40% acryl/bis 19:1) Amresco Agarose Roche, Switzerland Ammonium persulphate Roche Ampicillin Sigma, USA Bacto-agar Difco Laboratories, USA Boric acid B.D.H. Bovine serum albumin (BSA) Roche Bromocresol green Sigma, USA Bromophenol blue LKB Produkter AB, Sweden Calcium chloride Ajax Chemicals, Australia Calf thymus DNA (ultra pure) Sigma, USA Chloroform B.D.H. Dextran sulphate Amersham Pharmacia Disodium hydrogen orthophosphate B.D.H. Dithiothreitol (DTT) Sigma, USA Ethanol B.D.H. Ethidium bromide Sigma, USA Ethylenediaminetetraacetate (EDTA) B.D.H. Ethyleneglycol bis(aminoethylether) N,N,N,N' tetraacetate Sigma, USA (EGTA) (molecular biology grade) Ficoll-400 Amersham Pharmacia Formaldehyde B.D.H. Formamide B.D.H.

2- 3

Glucose Sigma, USA Glycerol (analytical grade) B.D.H. Glycogen (molecular biology grade) Roche Herring sperm DNA Roche Hydrochloric acid B.D.H. Isopropanol B.D.H. Isopropylthio-β-D-galactoside (IPTG) Progen Magnesium chloride B.D.H. Magnesium sulphate B.D.H. Maleic acid Ajax Methanol B.D.H. N,N,N',N'-tetramethylethylenediamide (TEMED) (ultra pure Amresco grade) N-2-hydroxyethyl-piperazine-N'-2-ethanesulphonic acid Calbiochem-Behring, USA (HEPES) p-Nitro-phenyl disodium orthophosphate B.D.H. PCR nucleotide mix (dNTPs) Roche Phenol Sigma, USA Polyoxyethylene-sorbitan monolaurate (Tween-20) Sigma, USA (molecular biology grade) Potassium chloride Ajax Propanol B.D.H. Propidium iodide Sigma, USA Sodium acetate B.D.H. Sodium chloride B.D.H. Sodium dihydrogen orthophosphate B.D.H. Sodium dodecyl sulphate (SDS) Amresco Sodium hydroxide B.D.H. Tris(hydroxymethyl)aminomethane (Tris) Roche Trisodium citrate B.D.H. Triton-X 100 B.D.H. Trypticase peptone Becton Dickinson, USA Xylene cyanol Ajax Yeast extract Becton Dickinson [γ32P] -dATP New England Nuclear (NEN) Dupont, USA [α32P] -dCTP NEN Dupont

2- 4

2.1.2 Cell culture reagents

Reagent Source

Dimethlysulphoxide (DMSO) Sigma Dulbecco's Modified Eagle (DME) powder (high glucose) Gibco, USA Commonwealth Serum Foetal bovine serum (FBS) Laboratories, Melbourne Geneticin (G418 sulphate) Gibco, USA Gentamicin sulphate Sigma Hygromycin B (50mg/ml in sterile PBS) Roche L15 (Liebowitz) medium Sigma N-2-hydroxyethylpiperazine-N'-2- ethanesulphonic acid (HEPES) Sigma Phenol red British Drug House, Ltd., UK (B.D.H.) TM Phosphate buffered saline (PBS; Multicel ) without calcium and Trace BioScientific, Australia magnesium Polyvinylpyrrolidone (PVP) United States Biochemical Corp.,USA Sodium bicarbonate Sigma Trypsin EDTA solution, 1:250, pH7.0 Life Technologies

2.2 Buffers and solutions

Solution Composition of reagents Preparation and storage

Denaturing solution (agarose 0.5M NaOH Store at room temperature gels) 1.5M NaCl 50xDenhardt’s solution 1% Ficoll-400 Store at -20oC 1% PVP 1% BSA (fraction V) DNA gel loading dye (6 X) 0.25% bromophenol blue In 10ml final volume add 0.025g 0.25% xylene cyanol bromophenol blue/xylene, 3ml glycerol. 30% glycerol Aliquot and store at RT. 1M DTT 0.155mg/ml In 1ml 0.01M sodium acetate, pH 5.2. Store at -20oC Hepes buffered saline (HBS) HEPES 4.76g, NaCl 7.07g, pH to 7.5, final volume adjusted to 1 KCl 0.20g, glucose 1.70g, disodium litre. The solution was filter sterilised hydrogen orthophosphate (0.2µm; Corning, USA) and stored at

(Na2HPO4) 1.022g, room temperature. 0.25ml of 0.05% phenol red LB 10g/litre NaCl pH to 7.0 10g/litre trypticase peptone Sterilise by autoclaving 5g/litre yeast extract LB-agar 1litre LB pH to 7.0 20g bacto-agar Sterilise by autoclaving Neutralising solution (agarose 0.5M Tris/HCL, pH 8.0 Store at room temperature gels) 1.5M NaCl Phenol:chloroform (1:1) Equal volumes of liquid redistilled Equilibrate with 0.1M Tris-Cl pH 8 phenol and chloroform Store under 0.1 volumes 0.1M Tris-Cl

2- 5

pH 8, at 4oC in dark bottles SOC medium 20g/litre tryptone Mix tryptone, yeast and NaCl in 950ml 5g/litre yeast extract water. Add KCl and pH to 7.0 with 0.5g/litre NaCl NaOH. Make up to 1 litre and 10ml/litre 250mM KCl autoclave. Add sterile glucose. Store at (20ml filtered 1M glucose) room temperature. 20xSSC 3M NaCl pH to 7.0 0.3M trisodium citrate 50xTAE 2M Tris-acetate 242g/litre Tris 50mM EDTA 57.1ml/litre glacial acetic acid 100ml 0.5M EDTA pH 8.0 10xTBE 0.9M Tris-borate 108g/litre Tris 20mM EDTA 55g/litre boric acid 40ml/litre 0.5M EDTA, pH 8.0 TE 10mM Tris-Cl pH 8.0 Sterilise by autoclaving 1mM EDTA 10xTNE 0.1M Tris pH to 7.4 10mM EDTA Sterilise by autoclaving 1M NaCl

2.3 Cell Lines and Cell Culture 2.3.1 In vitro immortalised human cell lines used in this study

Method of Cell Line Lineage Source immortalisation skin fibroblast, ataxia- R.A. Gatti, University of AT13LA(SV) SV40 telangiectasia California, Los Angeles

American Type Culture 293 embryonic adenovirus 5 Collection

(De Silva and Reddel, BET-3M bronchial epithelial SV40 1993)

skin fibroblast, Lesch- O. Pereira-Smith, Baylor GM847 SV40 Nyhan Syndrome College of Medicine, USA

jejunal fibroblast, cystic P. Bonnefin, unpublished JFCF-6T/5K SV40 fibrosis data

E. Duncan, unpublished MeT-4A mesothelial SV40 data

M. Namba, (Namba et al., SUSM-1 liver fibroblast 4-nitroquinoline 1981)

American Type Culture WI38 VA13/2RA fibroblast SV40 Collection

2- 6

2.3.2 Tumour derived human cell lines used in this study

Cell Line Lineage Source

G-292 osteosarcoma American Type Culture Collection

HeLa cervical carcinoma American Type Culture Collection

HT-1080 fibrosarcoma American Type Culture Collection

Saos-2 osteosarcoma American Type Culture Collection

SK-LU-1 lung adenocarcinoma American Type Culture Collection

T24 bladder carcinoma American Type Culture Collection

U-2 OS osteosarcoma American Type Culture Collection

2.3.3 Normal human cell strains used in this study

Cell Type Lineage Source

Ralph Böhmer, Ludwig Institute of HFF5 foreskin fibroblasts Cancer Research, Melbourne

Commonwealth Serum Laboratories, MRC-5 embryonal lung fibroblasts Melbourne

Commonwealth Serum Laboratories, WI38 foetal lung fibroblasts Melbourne

2.3.4 Dulbecco's Modified Eagle's (DME) Medium

To prepare DME medium, 133.8g of DME powder and 12g of sodium bicarbonate

(NaHCO3) were dissolved in 8 litres of water, the pH was adjusted to 7.4 with 1M HCl or 1M NaOH and the volume was then made up to 10 litres. The final medium was filter sterilised through a 0.2µm filter unit, and stored in 500ml aliquots at 4°C in glass bottles in the dark. Before use, 55ml of FBS (foetal bovine serum) and 0.55ml of gentamicin sulphate (50mg/ml) were added to the medium.

2- 7

2.3.5 Growth of cell cultures

All cells used in this study were grown as monolayer cultures in disposable plastic cell culture vessels (Iwaki, Japan) in 5.0% carbon dioxide (CO2) humidified air, water-jacketed incubators at 37°C. The growth medium used in each case was Dulbecco's Modified Eagle's (DME) Medium. All solutions added to cell cultures were prewarmed to 37°C and all manipulations were performed aseptically in a Biohazard hood using sterile equipment.

2.3.6 Cryopreservation of mammalian cells

Cells were cryopreserved in liquid nitrogen in a 50:50 mixture of 2 x DMSO and 2 x antibiotic medium:

2 x DMSO medium: PVP stock (40ml; polyvinylpyrrolidone (PVP; 10g) was dissolved in HBS to a final volume of 100ml and stored at -20°C), DMSO (30ml), 1M HBS (4ml; pH7.6) and L15 (126ml) were combined, 0.2µm filter sterilised and stored at -20°C. 2 x antibiotic medium: FBS (40ml), 50mg/ml gentamicin sulphate (0.4ml), 1M HBS (4ml, pH7.6, section) and L15 (Liebowitz) medium (Sigma) (156ml) were mixed, 0.2µm filter sterilised and stored at -20°C.

2.3.7 Culturing of A9:Human Monochromosome Hybrids

A9 monochromosome hybrids were cultured in DME (1000 mg/litre glucose) /10% FBS. For the first 4-5 days after recovery from liquid nitrogen hygromycin B (Roche) was added at 800 µg/ml and then reduced to the standard maintenance concentration of 400 µg/ml. The hybrids never recovered well from liquid nitrogen if grown in hygromycin immediately prior to freezing, therefore before cryopreserving stocks of cells hygromycin was removed from the culture medium for 4-5 days. It was essential to purge the cells in 800 µg/ml Hyg B upon subsequent recoveries from liquid N2. Standard trypsinisation and subcultivation procedures were applied at a ratio of 1:8 to 1:12 every 3-5 days. Cells were refed every three days with medium supplemented with fresh hygromycin and not allowed to become over confluent. Cell densities were limited to 8 x 106/90 mm dish or 75 cm2 flask.

2.3.8 Cell-Cell hybridisation

2- 8

GM847DM ("double mutant", i.e., ouabain and 6-thioguanine resistant) cells were placed into 75-cm2 flasks (2 x 106 cells/flask) 4 h prior to addition of the cells to which they were to be fused (HFF5, HT-1080 or T24; also 2 x 106 cells/flask). After an additional 4 h the culture medium was removed and the cells were fused by treatment for 1 min with 48% polyethylene glycol (Sigma). The cells were then washed three times with DME medium and incubated overnight in DME containing 10% FBS prior to addition of selection reagents. GM847DM universal hybridiser cells are resistant to 10-6M ouabain and sensitive to HAT medium (DME/10% FBS supplemented with 10- 4M hypoxanthine, 4 X 10- 7M aminopterin, 1.6 X 10- 5M thymidine (Sigma)) whereas HFF5, WI38, MRC-5, HT-1080 and T24 cells are sensitive to ouabain and resistant to HAT medium. Selection for fused cells was carried out by incubation with HAT medium supplemented with 10- 6M ouabain (Sigma). Controls were established by self fusion of parental cells for each cell type and also by mixing unfused parental cells; none of the controls survived the selection. After selection, hybrid clones were expanded and passaged continuously in DME to determine their proliferative potential.

2.3.9 T-Antigen immunostaining of cell monolayers

104 cells were seeded per well of a 4 well chamber slide and maintained for 48 h in DME/10% FBS at 37oC. Slides were then washed three times in PBS and cells were fixed in ice cold 100% methanol for 10 min. The slides were washed a further three times in PBS/0.2% Tween 20 (Sigma). The primary was a mouse monoclonal, PAb108, specific for T- antigen and this was diluted 1:500 in 1% BSA/PBS/0.2% Tween 20. The secondary antibody was a FITC-conjugated goat anti-mouse polyclonal (Sigma) and was diluted 1:200 in 1% BSA/PBS/0.2% Tween 20. Cells were incubated with 200µl/well of primary antibody for 30 min at 37oC followed by three washes in PBS/0.2% Tween 20 and a further 30 min incubation with secondary antibody (200µl/well, 30 min at 37oC). The slides were washed with water and air dried and then mounted with antifade solution (2.33% [w/v] DABCO (Sigma) in 90% glycerol/20mM Tris, pH 8.0). T-antigen staining was evaluated on a Leica DMLB fluorescence microscope with appropriate filter sets and images were captured on a cooled CCD camera (SPOT 2, Diagnostics Instruments).

2.3.10 Detection of ALT-associated PML bodies by immunostaining of cell monolayers

ALT-associated PML bodies were detected and visualized by immunostaining methanol fixed cells on chamber slides with a mouse monoclonal hTRF2 antibody for 60 min at 25oC

2- 9 followed by a rabbit anti-mouse FITC secondary antibody for 30min. Images were captured as described in section 2.3.9.

2.3.11 Flow cytometry analysis

Single cell suspensions were stained for DNA analysis using 0.5 to 1.0 x 106 cells added to a solution containing 0.15 ml Triton-X 100, 0.5 mg RNase, 25 µg propidium iodide (Sigma) and PBS to a final volume of 0.5 ml. Cells were incubated for 1h on ice in the dark. The labelled cells were then analysed in a Becton Dickinson FACScan apparatus which has a 488nm argon ion laser to excite the propidium iodide. To identify doublets, pulse height, pulse area (FL-2) and pulse width were collected. The size and internal granularity were described by the forward scatter and side scatter respectively. Increasing channel numbers were recorded for larger size on the forward scatter diode and denser nuclei on the side scatter photo multiplier tube. Frozen and stored aliquots of a diploid DNA peripheral blood mononuclear cells (PBMC) were thawed and stained in a similar manner to the test cells. Stored PBMC were used as the diploid DNA standard for DNA cell cycle analysis. Doublets were eliminated prior to cell cycle analysis because they were recorded in the G2/M peak position. 20,000 events were collected at a flow rate of approximately 100 events per second. Cell cycle analysis was computed using the CELL Quest software program.

2.3.12 Cell imagery.

Cell images were taken at 15X magnification on a phase contrast microscope using 35mm Kodak B/W film.

2.4 DNA fingerprinting of somatic cell hybrids

2.4.1 PCR fingerprinting

Somatic cell hybrids of GM847 cells with HFF5, MRC-5 and WI38 normal cell strains were analysed by DNA fingerprinting using the ABI PRISM STR fluorescently labelled primer set (Perkin Elmer) for the following loci: vWA31 (von Willebrand's factor), THO1 (Tyrosine hydroxylase gene), F13A1 (Coagulation factor XVIII subunit), and FES/FPS (fes/fps proto- oncogene). The primer sequences and fluorescent tag positions (JOE or FAM) are listed below: vWA31 [forward]

2-10

5′ - JOE - CCCTAGTGGATGATAAGAATAATCAGTATG - 3′ vWA31 [reverse] 5′ - GGACAGATGATAAATACATAGGATGGATGG - 3′ THO1 [forward] 5′ - GTGATTCCCATTGGCCTGTTCCTC - 3′ THO1 [reverse] 5′ - FAM -GTGGGCTGAAAAGCTCCCGATTAT - 3′ F13A1 [forward] 5′ - GAGGTTGCACTCCAGCCTTT - 3′ F13A1 [reverse] 5′ - JOE - ATGCCATGCAGATTAGAAA - 3′ FES/FPS [forward] 5′ - GGGATTTCCCTATGGATTGG - 3′ FES/FPS [reverse] 5′ - FAM - GCGAAAGAATGAGACTACAT - 3′

PCR of these four loci from genomic DNA of each of the parental cell types and from the hybrid clones was carried out according to the manufacturer’s protocol. Briefly, 10 ng of genomic DNA was added to a 0.2ml thin walled PCR tube in a final volume of 50µl with PCR buffer (500 mM

KCl, 100mM Tris-HCl), 2.5mM MgCl2, 10mM dNTPs, 10µM forward and reverse primer and 1.25U Ampli Taq Gold DNA polymerase (Perkin-Elmer). The tubes were placed in a thermal cycler and cycled with the following program: Initial step 93oC for 3 min followed by 28 cycles of 94oC for 45 sec, 54oC for 1 min and 72oC for 1 min. Resulting band peaks were analysed by an Applied Biosystems Genescan analyser. Hybrid clones were identified by the appearance of band peaks representing alleles from both parental cell types.

2.4.2 Hybridisation with a single locus fingerprinting probe

Southern fingerprinting was performed using a multi-allelic, single locus probe MS43A (Cellmark Diagnostics, UK). 5µg of genomic DNA digested with Hinf1 and Rsa1 was electrophoresed on a 0.8% agarose gel and transferred to Hybond N+ membrane (Amersham, UK) by capillary transfer in 20xSSC for 12-16h. Probe hybridisation was performed essentially as described in the instructions supplied by the manufacturer. Firstly, the membrane was wet in 1xSSC, and then placed, DNA-side down, in 500ml of prehybridisation buffer at 50°C for 20 min with gentle agitation. 160ml of hybridisation buffer at 50°C was placed in a chamber, and the

2-11 entire contents of the vial containing the probe were added. The membrane was transferred to the hybridisation buffer and floated DNA-side down with agitation for 20 min at 50°C. The hybridisation solution containing the probe was re-used in subsequent hybridisations. After hybridisation the membrane was transferred to 500ml of pre-warmed wash solution 1 and agitated at 50°C for 10 min. This was repeated with fresh wash solution 1. The membrane was then transferred to 500ml of wash solution 2 and agitated for 5 min at RT. This was repeated with fresh wash solution 2. The membrane was then immersed in 1-2ml of Lumi-Phos (Lumigen, USA). The membrane was exposed to Kodak XAR film at 30oC for 6h.

Pre-hybridisation buffer: 0.5M disodium hydrogen orthophosphate (Na2HPO4) pH7.2, 0.1% sodium dodecyl sulphate (SDS). Hybridisation buffer: 900ml/L prehybridisation buffer and 100ml/L membrane blocking solution. Membrane blocking solution: 10% BSA in wash solution 2.

Wash solution 1: 0.01M Na2HPO4 pH 7.2, 0.1% SDS.

Wash Solution 2: 0.12M maleic acid (C4H3O4Na), 0.15M NaCl. The pH was adjusted to 7.5 with concentrated NaOH.

2.5 Telomere repeat amplification protocol (TRAP) assay

The PCR based TRAP assay for telomerase activity was performed essentially as described (Kim et al., 1994) except that there is no incorporation of radioactive nucleotides, use of a wax barrier nor end-labelling of primers. Cell lysates were prepared using the CHAPS detergent lysis method and 2 µg of total protein was used in each assay. The protein concentration of lysates was measured using the BioRad Protein Assay Kit. Amplification products were separated on a 10% non-denaturing polyacrylamide gel, stained with SYBR-green I (Molecular Probes) and visualized using a Storm 860 imager (Molecular Dynamics).

2.5.1 Assay for telomerase activity

The TRAP assay measures enzymatic activity of telomerase if it is present. In the first step of the reaction, crude cell extract is incubated with nucleotides and two PCR primers, M2 (also known as TS) and CX, that can act as a substrate for telomerase-mediated addition of TTAGGG repeats. Following the PCR amplification the reactions are electrophoresed on an acrylamide gel, and if telomerase products are present, they are visible as a 6bp ladder upon staining of the gel with the SYBR-green I fluorescent dye followed by exposure on a PhosphoImager. Since

2-12 telomerase is a ribonucleoprotein, precautions against contamination with RNases were always taken, as well as conventional precautions against contamination with PCR products: filtered pipette tips and dedicated pipettors were used; equipment was UV irradiated and wiped with ethanol prior to use; reactions were set up in a hood; disposable plasticware or baked glassware was used; and the products of the PCR reaction were handled in a separate room to that in which the reactions were set up. All water used in the assay was treated with diethyl pyrocarbonate (DEPC) to rid it of RNases. DEPC was added to water in glass bottles to 0.01%, shaken vigorously and allowed to stand at RT overnight. The bottles were then autoclaved to inactivate the DEPC. Primers used for TRAP assay were manufactured and HPLC purified by Gibco BRL (Mulgrave, VIC, Australia).

Primer M2 (or TS): 5'-AAT CCG TCG AGC AGA GTT Primer CX: 5'- CCC TTA CCC TTA CCC TTA CCC TAA

2.5.2 Lysis of cells and tissues

Cells growing in were harvested and counted and 106 cells aliquoted into microcentrifuge tubes in culture medium. Cells were centrifuged at 3000g for 6 min at 4oC. The supernatant was removed and the pellet flash-frozen on dry ice before transferral to -80oC. The cells were lysed by resuspension in 200µl of ice cold lysis buffer (10mM Tris-HCl, pH 7.5, 1mM

MgCl2, 1mM EGTA, 0.5% CHAPS, 10% glycerol, 5mM β-mercaptoethanol, 0.1mM AEBSF) and incubation on ice for 30 min. The lysate was centrifuged at 15000g for 20 min at 4oC. 160µl of supernatant was carefully removed into a clean microcentrifuge tube, flash-frozen in liquid nitrogen and stored at -80oC. After each thawing, lysates were again flash-frozen.

2.5.3 Measurement of protein concentration

The protein concentration of the extract was measured with the Bradford Protein Assay kit (BioRad, USA), according to the manufacturer’s directions. 1µl of extract was added to 800µl of water and 200µl of concentrated dye solution. BSA was used as a standard, at final concentrations of 1, 2, 5 and 10µg/ml. After vortexing, then standing for 5 min at RT, the OD595 of the samples were measured on a spectrophotometer. Extracts were diluted to 1µg/µl and 2µl used in the TRAP assay.

2-13

2.5.4 Telomerase and PCR reaction

2µl of cell lysate (2µg protein) was added to 48µl of 20mM Tris-Cl, pH 8.3, 1.5mM

MgCl2, 68mM KCl, 0.05% Tween 20, 1mM EGTA, 50µM dNTPs, 1.8µg/ml primers M2 and CX, 2U Taq polymerase (Roche). The telomerase extension reaction was allowed to proceed at RT for 30 min. The tubes were then placed in a PCR machine (Hybaid) at 94oC for 2 min and then cycled according to the following program: 30 cycles of 94oC for 10 sec, 50oC for 25 sec, 72oC for 30 sec; and 1 cycle of 94oC for 15 sec, 50oC for 25 sec, 72oC for 1 min.

2.5.5 Electrophoresis

20µl of each TRAP reaction was added to 4µl of gel loading buffer (0.15% Ficoll-400, 0.0025% bromophenol blue, 0.0025% xylene cyanol and 0.1% SDS in 6xTAE buffer, filtered through 0.45µm) and loaded onto a 10% acrylamide (19:1 acrylamide:bisacrylamide), 0.5xTBE vertical gel (13.5 cm x 13.5 cm x 1.5 mm). The gel was electrophoresed at 180V for 45 min followed by 300V for 1.75h. Gels were stained for 30 min in 100ml SYBR-green I followed by rinsing in distilled/deionised H2O (ddH2O) for 10 min. Bands were visualised on a STORM 860 imager in the blue fluorescence range.

2.5.6 Internal PCR standard for the TRAP assay

As previously described (Wright et al., 1995), this standard consists of a 150bp piece of rat myogenin DNA, that have been amplified using primers that have the TS and CX sequences joined to myogenin sequences. When added to the TRAP assay, the TRAP primers amplified this piece of DNA along with the telomerase products, providing an internal control for the intensity of the telomerase ladder and the presence of any Taq polymerase inhibitors in the cell lysate.

TS-overlap primer: 5'-AATCCGTCGAGCAGAGTTGTGAATGAGGCCTTC CX-overlap primer: 5'-CCCTTACCCTTACCCTTACCCTAATAGGCGCTCAATGTA

500ng of rat genomic DNA was added to a reaction with a final concentration of 1xPCR buffer (Roche), 0.2mM dNTPs, 30µM each primer and 2.5U Taq polymerase in a volume of 50µl, placed in a PCR machine (Hybaid) at 94oC and cycled according to the following program: 35 cycles of 94oC for 30 sec, 55oC for 30 sec, 72oC for 1 min, followed by a final extension of 72oC for 2 min.

2-14

The entire PCR reaction was electrophoresed on a 3.5% low-melting-point agarose gel at 10Vcm-1 for 1h, and the 150bp band excised and purified with a Wizard PCR Prep column (Promega) according to the manufacturer’s protocol. The DNA was quantitated by fluorometry (see section) and 0.1 attograms added to each TRAP assay.

2.6 Extraction of genomic DNA from human cells in culture

Genomic DNA samples used in this study were each extracted from one 75cm2 flask of cells in culture. Cells were harvested by trypsinisation and washed in 10ml of PBS. The cells were resuspended in 5.5ml of lysis solution (50mM Tris-Cl pH 8.0, 20mM EDTA pH 8.0, 2% SDS) and pronase (Sigma, USA) was added to the homogenate to a final concentration of 100µg/ml, which was then incubated at 37oC overnight. The sample was then chilled on ice for 10 min, 2ml of 5M NaCl added, then chilled on ice for a further 5 min. The precipitate was pelleted for 15 min at 2000g at 4oC, and the supernatant transferred to a clean tube. The supernatant was centrifuged once more to remove residual precipitate and transferred again. Ribonuclease A (RNase A; Sigma) was then added to a final concentration of 20µg/ml, followed by incubation at 37oC for 15 min. The DNA was precipitated by the addition of 2 volumes of cold 100% ethanol and inversion. The DNA was washed in 70% ethanol, recentrifuged and finally resuspended in 200µl of TE. Genomic DNA was stored at 4oC.

2.7 Preparation of metaphase chromosome spreads

Cell monolayers were grown in 75cm2 flasks until 80-90% confluent and then treated for one hour at 37oC by addition of 20µl of colcemid (10mg/ml, Roche) to the culture medium. The culture medium and PBS wash were retained during trypsinisation and combined with the harvested cells which were then centrifuged at 400 g in a 50 ml tube for 8 min. The cell pellets were resuspended in 10 ml of hypotonic buffer (0.2% KCl/0.2% tri-Sodium Citrate o (NaC6H5O7.2H2O)) and placed in a 15 ml tube at 37 C for 12 min. This was followed by addition of 1 ml of ice cold fixative (3:1, Methanol:Acetic acid) and a 5 min incubation on ice. Cells were centrifuged again at 400 g for 8 min and resuspended twice more in 10 ml fixative, followed by 5 min incubation on ice and centrifugation. Preparations were stored in 15 ml fixative at –20oC.

2-15

2.8 Terminal restriction fragment Southern analysis (TRF)

2.8.1 Digestion of genomic DNA

20-40 µg of genomic DNA was made up to 85 µl in TE, pH 8.0 and digested in a final volume of 100 µl with Hinf1 and Rsa1 (Roche): Genomic DNA 85µl Buffer A (10X) 10µl BSA 10mg/ml 1µl Hinf1 (40u/µl ) 2µl Rsa1 ″ 2µl

The samples were then incubated overnight at 37oC. Digested DNA was stored at 4oC. For samples that were treated by digestion with Mnl1 or Hph1 (New England Biolabs) the reactions were performed as follows: Hinf1/Rsa1 digested DNA (3µg) 43µl 10X buffer 5µl Hph1/Mnl1 (5u/µl) 1µl BSA (10mg/ml) 1µl

The samples were then incubated overnight at 37oC. Digested DNA was stored at 4oC.

2.8.2 Quantitation of digested DNA by Fluorometry

Concentration standards using calf thymus DNA (Sigma) were made in 0.45µm filtered TNE, (0.1M Tris, 10mM EDTA, 1M NaCl) pH 7.4, at 20, 50, 100, 150 and 200 ng/µl. 2µl of each standard was then mixed with 800µl fluorochrome Hœchst 33258 (Polysciences Inc., USA; 0.1µg/ml in 0.45µm filtered 1xTNE), and read in a luminescence spectrophotometer (Perkin- Elmer, USA) with an excitation wavelength of 365nm and an emission wavelength of 460nm. Digested genomic DNA samples were then measured in the same way and concentrations were calculated from the standard curve.

2.8.3 Electrophoresis and hybridisation of digested DNA

Digested genomic DNA was resolved by electrophoresis in a 0.8% agarose gel in TBE buffer at 47V for 18 h. 1µg of each sample was loaded per lane and size markers used were λ HindIII (Promega, USA) and φX174 HaeIII (New England Biolabs, USA). Marker positions were visualised by ethidium bromide staining and excised from the gel. The gel was vacuum dried at 45oC for 1h, denatured and neutralised for 30 min and prehybridised in 30ml containing 5xSSC,

2-16

5xDenhardt’s solution, and 0.1xP-wash (1xP-wash: 5mM tetrasodium pyrophosphate, 100mM o disodium hydrogen orthophosphate) at 37 C for 4-6h. A (TTAGGG)3 oligonucleotide probe (300ng) was 5' end-labelled with 30µCi of [γ32P]-dATP (3000Ci/mmol), kinase buffer and 10U T4 kinase (New England Biolabs, USA) in a volume of 10µl at 37oC for 30 min. The probe was purified by ethanol precipitation and resuspended in 50µl of TE. 5x106 counts per minute (cpm) of probe was added directly to the prehybridising gel, and incubated at 37oC overnight. The gel was then washed three times in 0.1xSSC for 10 min at 37oC, and autoradiographed on Kodak Biomax MR or MS X-ray film for 4-72h at –80oC.

2.8.4 Pulsed-field gel electrophoresis

The digested DNA samples were loaded onto a 1% agarose gel in 0.5 X TBE buffer, using 48.5 –8.2kb high molecular weight markers (Gibco), and separated by pulsed-field gel electrophoresis using a CHEF-DR II apparatus (BioRad) in recirculating 0.5 X TBE buffer at 14oC with a ramped pulse speed of 1-6 sec at 200V for 14 h. The gel was then stained in ethidium bromide (0.5mg/ml for 20 min at RT) and the marker positions excised from the gel. The gels were dried, denatured and hybridised to the [γ-P32]dATP 5' end labelled telomeric oligonucleotide o probe (TTAGGG)3, and exposed to Kodak Biomax film at –80 C.

2.8.5 Alkaline agarose gel electrophoresis

Alkaline agarose gels were prepared essentially as described by Sambrook et al.(Sambrook et al., 1989). A 0.8% agarose solution was prepared in 9/10 volume ddH2O and allowed to cool to 60oC. The cooled mixture was equilibrated with 1/10 volume 10 X alkaline electrophoresis buffer (0.5M NaOH, 10mM EDTA (pH 8.0)). This was to prevent polysaccharide hydrolysis by addition of NaOH to hot agarose. The DNA samples were mixed with 0.2 volume of 6 X alkaline loading buffer (300mM NaOH, 6mM EDTA, 18% Ficoll-400, 0.15% Bromocresol green, 0.25% Xylene cyanol) prior to loading onto the gel. To prevent the loading dye from diffusing rapidly out of the gel, a perspex plate was placed on top of each gel prior to each run. Electrophoresis was carried out at 40V for 60h.

2.8.6 Computing Densitometry

TRF gel lanes were scanned by a computing densitometer (Molecular Dynamics, USA) and total optical density (OD) of TTAGGG repeats was calculated for each lane. Mean TRF length was calculated as Σ (ODi)/Σ(ODi/Li) where ODi is the densitometer output and Li is the

2-17

DNA length at position i in the lane. This method takes into account the greater intensity of signals from larger DNA fragments. The amount of telomeric DNA was calculated by integrating the volume of each smear in ImageQuant software (Molecular Dynamics, USA).

2.8.7 Estimation of telomere shortening rate.

TRF gel lanes were scanned by a computing densitometer (Molecular Dynamics, Sunnyvale CA, USA). Discrete telomere band sizes in Kilobases of DNA (Kb) were calculated by plotting the relative position on a linear curve generated by regression analysis of molecular weight marker positions. Rates of shortening were calculated by reduction in band sizes over specific PD ranges.

2.8.8 Colony hybridisation to a telomere probe

Ampicillin plates were prepared using 15cm dishes and each was overlayed with a Hybond N+ filter discs (Amersham). Transformed cells were plated onto the filters and grown overnight at 37oC. Duplicate filters were made of each plate by pressing the discs firmly together with a clean sterile filter and punching holes through them to allow alignment of positive clones, and the original was placed back on the agar and incubated for several hours to allow colony recovery. Duplicates were placed, colony side up, on absorbent pads soaked with denaturing solution (1.5M NaCl, 0.5M NaOH) for 5 min followed by pads soaked with neutralising solution (1.5M NaCl, 0.5M Tris-HCl, pH 8.0). All filters were then rinsed in 2 X SSC and UV fixed in a Stratalinker (Stratagene). Hybridisation to a telomere probe was carried out as described for dried agarose gels using a radiolabelled (TTAGGG)3 oligonucleotide (section 2.8.3) except that a temperature of 50oC was used. Positive clones were visualised on Kodak Biomax film at –80oC and aligned to the original filters to allow selection.

2.9 Telomere length analysis by fluorescence in situ hybridisation

Chromosome preparations from colcemid (Roche) arrested cells were obtained according to standard cytogenetic methods. Fluorescence in situ hybridisation (FISH) with a Cy3- conjugated telomere specific peptide nucleic acid (PNA) probe (PE Biosystems, Framingham, MA) was essentially performed according to Lansdorp et al. (Lansdorp et al., 1996). Briefly, slides were treated with RNase A (100µg/ml in 2xSSC) at 37°C for 60 min, rinsed in 2xSSC, equilibrated in 10 mM HCl (pH 2.0) and digested with pepsin (0.01%[w/v] in 10 mM HCl) at 37°C for 10 min. This was followed by three washes with PBS and post-fixation in 1%

2-18 formaldehyde/PBS for 10 min at 25°C. Dehydrated slides were denatured and probed with Cy3- conjugated (C3TA2)3 PNA (0.6 µg/ml in 70% formamide, 1% blocking reagent (Roche) and 10 mM Tris pH 7.2) at 80°C for 3 min on a heating block, followed by hybridisation at 25°C for 2 h. After hybridisation slides were washed at 25°C with 70% formamide/10 mM Tris pH 7.2 and 0.05 M Tris/0.15 M NaCl pH 7.5 containing 0.05% Tween 20. Slides were counterstained with DAPI (0.6µg/ml; Sigma) and mounted with antifade-mounting medium (2.33% [w/v] DABCO (Sigma) in 90% glycerol/20mM Tris, pH 8.0). Metaphases were evaluated on a Leica DMLB fluorescence microscope with appropriate filter sets and images were captured on a cooled CCD camera (SPOT 2, Diagnostics Instruments), merged using SPOT software and further processed using Adobe Photoshop 6.0. Quantitative histogram analysis of fluorescence intensities was performed with ImagePro Plus 4.0 software (MediaCybernetics, Silver Spring, MD) on 24 bit RGB images captured with exposure times of 0.5, 1.0, 1.5 and 2.0 sec with no gamma adjustment. Image bitmap pixel values ranged from 0 (black) to 255 (full scale) following a linear function of a measured intensity with increasing exposure time. Typically four intensity values were recorded for the maximum intensities of the short (p-) and the long (q-) arm of the Y chromosome with the four different exposure times. The ratio of p- to q-arm intensity was plotted as a bar chart on a logarithmic scale.

2.10 Detection of neo signal in human cells

2.10.1 Southern analysis

40µg genomic DNA of each sample was digested overnight at 37oC with 80u of Xba1 (Roche) and 8µg digested DNA was loaded onto a 0.8% agarose gel in Tris-acetate EDTA buffer. DNA size markers were a mixture of λ HindIII and ΦX174 HaeIII DNA (New England Biolabs). Electrophoresis was carried out at 30V for 16h and the gel was subsequently denatured and neutralised. DNA was transferred onto Hybond N+ (Amersham Pharmacia) by capillary blot with 20x SSC overnight and DNA was UV fixed by auto-crosslinking in a Stratalinker (Stratagene). Prehybridisation was carried out in 20mls of 5x SSC, 10x Denhardt’s solution, 0.5% SDS, 50µg/ml sonicated herring sperm DNA at 65oC for 1h. Hybridisation was then carried out overnight at 65oC in 20mls hybridisation solution (50% formamide, 5x SSC, 0.5% SDS, 50µg/ml sonicated herring sperm DNA) containing 2x 106 counts/ml of 32P-dCTP labelled pSXneo plasmid. The filter was washed three times in 2x SSC/0.1% SDS at 65oC and autoradiographed on Kodak Biomax MR or MS X-ray film for 4-72h at –80oC.

2-19

2.10.2 Fluorescence in situ hybridisation

Plasmid pSXneo was labelled with bio-16-dUTP using the Biotin-Nick Translation Mix (Roche) according to the manufacturer’s instructions. Chromosome slide preparations were RNase A treated (100µg/ml 2xSSC; Roche) at 37o C for 60min, rinsed in 2xSSC, briefly equilibrated in 10mM HCl (pH 2.0) and digested with pepsin (0.01%/10mM HCl; Roche) at 37o C for 10 min, followed by three washes with PBS (Mg++, Ca++) and post-fixation in 1% formaldehyde at RT. Approximately 30ng/µl of pSXneo probe was hybridised onto separately denatured chromosome preparations for 16-18 h in a humidified chamber at 37o C. After two brief post-hybridisation washes in 50% formamide/2xSSC at 42o C and 2xSSC at RT, slides were blocked in BSA (5% BSA/ 4xSSC/ 0.2% Tween 20; Roche) at RT for 10-30 min. Detection of the hybridised pSXneo probe was performed with fluorescein-conjugated avidin DCS (5ug/ml 4xSSC/ 0.2% Tween 20; Vector Laboratories) followed by two amplification steps with biotinylated anti-avidin antibody (5ug/ml 4xSSC/ 0.2% Tween 20; Vector Laboratories) and a second and third layer of fluorochrome-conjugated avidin. Chromosomes were counterstained with propidium iodide (PI, 120ng/ml final conc; Sigma) and diamidino-phenyl- indole-dihydrochloride (DAPI, 0.6ug/ml final conc; Sigma) for chromosome identification, and slides were evaluated on a Leica DMLB epifluorescence microscope with appropriate filter sets for UV and blue excitation. Between 50 and 100 metaphases were analysed for each clone, and chromosomes were scored as positive if a signal doublet could be detected on both sister chromatids of the respective chromosome. FITC-, PI- and DAPI-images were captured separately with a cooled CCD (SPOT2, Diagnostic Instruments) camera, merged using SPOT2 software, and further processed using Adobe Photoshop Version 5.5 software.

2.11 Plasmid expression vectors.

2.11.1 Plasmids used in this study

A cDNA insert encoding the human telomerase catalytic subunit hTERT (Kilian et al., 1997) was subcloned into the mammalian expression vector pCIneo (Promega). The construct was verified by DNA sequence analysis. A pIRESneo construct (Clontech) containing a dominant-negative hTERT insert (3-1) was obtained from Dr. Murray Robinson, Amgen Corporation, and has a single aspartate to isoleucine base change in the catalytic core (D712A) and has been described previously (Harrington et al., 1997a). pSXneo plasmid was obtained from Dr. John Murnane, University of California, San Francisco.

2-20

2.11.2 Transformation of competent bacteria

Competent JM109 cells (Promega) were transformed by heat shock treatment. Cells were thawed on ice for 30 min and 50µl aliquots placed in a sterile microcentrifuge tube and gently mixed with 20-200ng DNA. The cells were then incubated on ice for a further 30 min followed by heating at 42oC for 50 sec and a further incubation on ice for 2 min. 1ml SOC medium was added to each tube followed by a 1 hr incubation at 37oC. Aliquots were plated on LB-agar containing the appropriate antibiotics and the plates were incubated overnight at 37oC. Resulting colonies were picked the following day.

2.11.3 Preparation of plasmid DNA

Plasmid DNA was prepared using the RPM® (Rapid Pure Miniprep) kit (BIO 101, CA, USA) according to the manufacturer’s protocol. Briefly, 1.5 ml of bacterial culture was centifuged for 30 sec and resuspended carefully in 50µl Pre-Lysis Buffer. 100µl Alkaline Lysis solution was added to the cell suspension followed by mixing and incubation at RT for 1 min. This was followed by addition of 100µl Neutralising solution, vortexing, and spinning down of white precipitate. The supernatant was placed in a SPINTM filter to which 250µl GLASSMILK® buffer had been added and centifuged. After washing the filter with 350µl Wash solution the DNA was eluted with 50µl TE, pH 8.0.

2.12 Transfection of human cells with plasmid vectors.

Cells were seeded at a density of 106 cells/10 cm dish and incubated overnight. Cells were transfected the following day with 5µg plasmid DNA using 30 µl Fugene-6 transfection reagent (Roche) and 1 ml OPTI-MEM reduced serum medium (Gibco) for 2 h at 37oC, after which time Dulbecco's modified Eagles medium plus 10% FBS was added. Cells were harvested 18-24 h later with Trypsin-EDTA and seeded at a concentration of 104 cells/10 cm dish in media containing 300µg/ml Geneticin (G418 sulphate, Gibco). Individual colonies were isolated after two weeks selection, using 4 mm sterile, trypsin-soaked filter paper discs. All clones were continuously passaged in medium containing Geneticin.

2-21

2.13 Microcell-Mediated Chromosome Transfer

2.13.1 Day 1 - Preparation of chromosome donor cells for microcell production

Chromosome donor cells were replated into multiples of six Nunc 25cm2 flasks (Cat. No. 1-52094A, narrow neck) at 1.5 x 106 cells per flask in 20% FBS so that the cells were 70-90% confluent after 24 h.

2.13.2 Day 2 - Induction of micronucleation

A9 monochromosome hybrids were refed (20% FBS) and treated with colcemid (Sigma cat. no. D7385, demecolcine) to a final concentration of 0.075 and 0.06 µg/ml for human chromosome HyTK 6 & 7, respectively or 20µg/ml for GM847 derived chromosome 2C2 neo. This was followed by incubation for 48 h at 37oC.

2.13.3 Day 3 - Preparation of recipient cell monolayers

Recipient cells were replated in Nunc 90 mm dishes for microcell fusion so that they were 80-90% confluent the next day. Two monolayers were prepared for each experiment (including one as a control).

2.13.4 Day 4 - Production of microcells and fusion with recipient cells

o Six aliquots of ddH2O were weighed out at 75 g (+/- 0.02 g) and warmed to 37 C to act as a cushion for the flasks during centrifugation. The water aliquots were placed into each pot of a 6 x 250 ml fixed angle rotor (30o angle) which had been kept at 37oC overnight. The centrifuge used was a SIGMA 6K-10 (SIGMA Laborzentrifugen GmbH, Osterode am Harz, Germany). After micronucleation was complete, the flasks were aspirated and pre-warmed (37oC) serum-free DME containing Cytochalasin B (Sigma) at 10 µg/ml was added (30 ml per flask). Each flask was weighed and adjusted (+/- 0.02 g) to give 3 pairs and these were placed in the rotor with the top surface facing up and the caps pointing towards the rotor axis. The flasks were carefully aligned so that they were central and horizontal. Centrifugation was at 9,500 x g for 60 minutes at 35oC. Slow acceleration and deceleration rates were used to avoid breakage of the flasks. After centrifugation the pellets containing microcells and cell debris were observable in the corners of flasks (top surface). The cytochalasin was aspirated, leaving about 2 ml in each flask, and the pellets were thoroughly resuspended leaving as few clumps as possible using a plugged fine bore glass Pasteur pipette. The sides of the flasks were washed down to collect material that had not

2-22 pelleted. The crude microcells were purified by sequentially filtering them through sterile 25 mm 8, 5 and 3 µm polycarbonate filters (filters had been placed in Nucleopore (Costar UK Ltd.) swinlock holders (25 mm diameter) and autoclaved for 15 minutes wrapped in foil). One set of filters was used for each 6 flask batch of microcells. Centrifugation was at 3,500 x g for 5 minutes using a swing out rotor. Samples were aspirated and resuspended in 10 ml DME to give a single microcell suspension and centrifuged again at 3,500 x g. 6 ml of DME was prepared with 100 µg/ml PHA-P (phytohemagglutinin-P; Sigma) for each microcell pellet. The microcell pellets were resuspended in 3 ml of the PHA-P containing DME again using a fine bore Pasteur pipette. The remaining DME/PHA-P was used for the control cell monolayer. The recipient monolayers were washed three times with DME at 37oC. The final DME rinse was aspirated from the recipient cells and the microcell suspension was then slowly added. Incubation was at 37oC for 25 min to allow the microcells to agglutinate. The DME/microcells were aspirated and 3 ml of pre-warmed PEG (polyethylene glycol; Sigma) solution was added to the edge of the petri dish. The dish was then agitated to get a complete covering of PEG solution and left for exactly 1 min. The cells were washed thoroughly three times with 10 ml pre-warmed DME using continuous and vigorous agitation and with each wash lasting 1 min. After the final wash normal growth medium was added and cells were cultured for one day before selecting for hybrids.

2.13.5 Day 5 - Selection for chromosome transfer to recipient cells

For selection, cells were replated at 5 x 105 to 1 x 106 cells per 90 mm dish followed by drug selection; 700 µg/ml G418 (Gibco) for K 2C2 clones or 400µg/ml hygromycin B (Roche) for GM847 H6/H7 clones. Colony formation was monitored over a 2-8 week period, re-feeding with fresh selection medium as appropriate.

2.13.6 Stock solutions

Colcemid solution was made up at 50 to 100 µg/ml in dH2O or DME, filter sterilised and stored at -20oC. Cytochalasin B was made up at 10 mg/ml in DMSO and diluted into pre-warmed DME to 5 to 10 µg/ml for use. Debris was centifuged out at 3500 g before filtering and aliquots o were stored in dark glass bottles at 4 C. PHA-P was made up at 2 mg/ml in ddH2O, filter sterilized and stored at -20oC. Aliquots of sterile PEG (Mwt. 1000) were melted at 60oC. 6 ml pre-warmed DME and 1 ml DMSO was added to every 5 g of PEG which was stored at -20oC and subsequently mixed well before adding to cells.

2-23

2.14 Chromosome painting of metaphase spreads

Metaphase spreads were prepared on slides and incubated overnight at 37oC. Painting probes were labelled with bio-16-dUTP using the Biotin-Nick Translation Mix (Roche) according to the manufacturer’s instructions. The following day, for each slide, 200ng probe was resuspended in 20µl hybridisation solution (50% deionised formamide (FA)/ 10% dextran sulphate/ 1% Tween 20/ 2% Denhardt’s/ 2xSSC) and incubated at 75oC for 5-10 min followed by snap cooling on ice for 2 min. The probes were then pre-annealed with 200ng human COT-1 DNA (Gibco) per slide at 37oC for 60 min. Chromosomes were placed in prewarmed denaturing solution (70% FA/ 2xSSC) at 75oC for 2 min. This was immediately followed by rinsing with gentle agitation in each of 70%, 90% and 100% ice cold ethanol for 1 min. Slides were then air dried and placed on a prewarmed heating block at 70oC. Pre-annealed probe was added to each slide in 20µl hybridisation solution and slides were sealed with a coverslip and rubber cement. Slides were placed at 37oC overnight in a humidity chamber. The coverslips were then removed and the slides were washed with gentle agitation in prewarmed 50% FA/ 2xSSC at 42oC for 5 min. This was followed by two washes in 2xSSC at RT with shaking. Primary and secondary antibody solutions were prepared as follows: avidin-FITC (Vector Laboratories, CA, USA) was diluted 1:100 in 3% BSA/ 4xSSC/ 0.2% Tween 20; anti- avidin-FITC (Vector Laboratories) was diluted 1:125 in 3% BSA/ 4xSSC/ 0.2% Tween 20 (200µl of each solution was prepared for each slide). The primary antibody (avidin-FITC) was overlaid onto the slides (200µl/slide) which were covered with parafilm and incubated for 20 min at 37oC. This was followed by two washes in 4xSSC/ 0.2% Tween 20 for 3 min at RT with shaking and a third wash in 4xSSC also for 3 min. The slides were then treated with the secondary antibody (anti-avidin-FITC) in an identical fashion. The slides were then stained for 1 min in 50ml solution containing 4xSSC/ 30µl DAPI (Sigma)/ 10µl PI (Sigma), rinsed quickly in ddH2O, blotted and mounted in 10-20µl antifade solution (2.3% DABCO (Sigma)/ 90% Glycerol/ 20mM Tris-HCl, pH 8.0). Subsequent storage was in the dark at –20oC. Chromosome painting was visualised on a Leica DMLB epifluorescence microscope with appropriate filter sets. FITC-, PI- and DAPI-images were captured separately with a cooled CCD (SPOT2, Diagnostic Instruments) camera, merged using SPOT2 software, and further processed using Adobe Photoshop Version 5.5 software.

2-24 3. Chapter Three

Normal cells contain repressors of ALT

3. Chapter Three...... 3-1 3.1 Introduction ...... 3-2 3.2 Characterisation and growth analysis of GM847 X HFF5 hybrids...... 3-2 3.3 Telomere dynamics in pre- and post- senescent GM847 X HFF5 hybrids...... 3-4 3.4 Growth and telomere dynamics of additional GM847 X normal hybrids...... 3-11 3.5 Conclusions ...... 3-11

3-1 Normal cells contain repressors of ALT

3.1 Introduction

The study of the control of ALT is of particular interest when considering telomere maintenance mechanisms as targets for anti-cancer therapeutics. Although it has now been shown in this laboratory that telomere-telomere recombination occurs in ALT cells and is likely to be central to the ALT telomere maintenance (Dunham et al., 2000), the exact mechanism of ALT is currently still unknown. In order to identify genes involved it was important to determine whether ALT occurs due to a dominant activating mutation or due to the loss of repressors which are present in normal cells. An ALT cell line, GM847, was fused with normal human diploid fibroblasts to examine the proliferative potential and telomere dynamics of the resulting hybrids. About two decades ago experiments involving the fusion of normal and immortal human cells showed that the immortalised phenotype is recessive (Bunn and Tarrant, 1980; Muggleton-Harris and DeSimone, 1980; Pereira-Smith and Smith, 1983). Such somatic cell hybrids have a finite replicative lifespan, presumably due to factors present in the normal cells that are able to reimpose normal proliferation control. A series of similar studies were undertaken to examine whether normal cells contain repressors of ALT.

3.2 Characterisation and growth analysis of GM847 X HFF5 hybrids

Following fusion of the SV40-immortalised cell line GM847, that has the ALT phenotype (Bryan et al., 1995), with HFF5 normal diploid fibroblasts, ten colonies of hybrid cells were selected and cultured individually. Each hybrid clone proliferated for at least 23 population doublings (PDs) before entering a period of growth arrest (Figure 3-1) accompanied by morphological features of senescence. This growth arrest periods were different for each clone, with clones G and J showing the most prolonged period of senescence (Figure 3-1). Escape from senescence occurred in every case due to these revertant subpopulations which have previously been documented to arise at a rate of 2 x 10-6 in normal X immortal somatic cell hybrids (Bunn and Tarrant, 1980). Clones F, H and I showed only marginal retardation of their growth curves which was most likely due to outgrowth of at least one revertant subpopulation at an early time point. This is further evidenced by similar pre- and post- senescent growth rates for these three clones such that revertant subpopulations could

3-2 GM847 X HFF5 hybrids Data KP fus REVISED Fig 1 Data KP fus REVISED Fig 1 90 90

A F

B 75 75 G C H

D I 60 60 E J

45 45

30 30 Population Doublings

15 15

0 0 0 25 50 75 100 125 150 175 200 0 25 50 75 100 125 150 175 200

Days

3-3 begin to take over the mass culture at early PDs (Figure 3-1). Other clones that had proliferation arrest periods of between 25-75 days, had slower growth rates following escape from senescence (Figure 3-1) and this presumably reflects later reversion by slower growing immortal clones that could not outgrow the cultures at earlier PDs. To verify that each clonal culture was a GM847 X HFF5 hybrid, PCR fingerprinting analysis was performed at the vWA31, THO1, F13A1 and FES/FPS loci for pre- and post- senescent cultures. The resulting band peaks are listed in Table 3-1. Each of these contained bands that corresponded to a combination of GM847 and HFF5 alleles at each locus indicating that both genomes are present in these cultures. Analysis of post-senescent cultures (Table 3-1) indicates that all of the GM847 loci were still present but that there had been major loss of HFF5 loci from clones C, D, E and I. No additional alleles were detected in any clone other than the vWA31 149bp marker detected in clones B and I which may be due to chromosomal rearrangements or clonally derived from the parent population (Table 3-1). 6/10 hybrid cultures retained between 6-13 of the markers tested following escape from senescence. DNA flow cytometric analyses showed that the pre-senescent cultures did not consist of mixtures of cells with differing DNA contents (Figure 3-2), thus excluding the possibility that the parental cells were co-existing as an unfused mixed culture. Thus, the data clearly indicate that hybrid cultures were obtained.

3.3 Telomere dynamics in pre- and post- senescent GM847 X HFF5 hybrids

As is characteristic of telomerase-negative immortalised human cells, GM847 cells have terminal restriction fragment (TRF) lengths that range from very short to abnormally long (Bryan et al., 1995). To determine whether normal cells contain factors that repress the telomere maintenance mechanism in these ALT cells, the TRF lengths of pre- and post-senescent hybrid cultures were analysed, using pulsed field gel electrophoresis. The results illustrate the difference in TRF patterns between the GM847 and HFF5 cells (Figure 3-3). The TTAGGG smear pattern present in the GM847 lane is characteristic of ALT cells, and Bal31 nuclease digestion of TRF samples of ALT cell types described previously has revealed that the majority of the hybridisation signal is telomeric (Bryan et al., 1995). Densitometric analyses showed that the HFF5 and GM847 cultures had mean TRF lengths of approximately 5 kb and 20 kb, respectively, and the total (TTAGGG)n hybridisation signal of HFF5 was 23% that of GM847 (Figure 3-3). Fusion of GM847 and HFF5 nuclei would be expected to result in some reduction of hybridisation intensity due to "dilution" of the long GM847 telomeres with HFF5 telomeres. DNA flow cytometry showed that the DNA

3-4 TABLE 3-1. DNA fingerprint analyses of HFF5 X GM847 hybrid clones pre- and post- senescence. Brackets indicate alleles that were not detectable in post-senescent cells.

Allele size (bp) at locusa vWA31 TH01 F13A1 FES/FPS Parental Cells HFF5 140, 153 160, 172 188, 196 223, 227 GM847 144 163, 167 184, 192 211, 227 Hybrids A 140, 145, 153 164, 168, 171 184, 188, 192 211, 223, 227 B 140,145,149,153 (160),164,168,172 184,188,192,196 211, (223), (227) C (140), 144, (153) (160),164,168,(172) 184,(188),192,(196) 211, 227 D (140), 145, (153) (160),164,168,(172) 184,(188),192,(196) 211, (227) E (140), 145, (153) (160),164,168,(172) 184,(188),192,(196) 211, 227 F 140, 145, (153) (160),164,168,(172) 184,(188),192,(196) 211, (223), 227 G 140, 145, 153 (160),164,168,(172) 184,(188),192,196 211, 223, 227 H 140, 145, (153) (160),164,168,(172) 184,(188),192,(196) 211, (223), 227 I (140),145,(149),(153) (160),164,168,(172) 184,(188),192,(196) 211, (224), (228) J 140, 145, (153) (160),164,(168),172 184,188,192,(196) 211, (224), 228 aallele sizes at the indicated loci were determined by PCR amplification as described in Materials and Methods.

3-5 Parental Cells

GM847 HFF5 GM847:HFF5 (1:1)

Hybrid clones

A B C

I J

Figure 3-2

Flow cytometry analysis of GM847 X HFF5 hybrid clones and parental cell controls including a 1:1 mixture. DNA histograms of representative clones indicate an increased DNA content in the hybrid cells showing that the cultures do not consist of a mixture of parental cells.

3-6 B F I J

Population HFF5 GM847 25 56 26 85 26 73 25 41 Doublings

kb 48

10 9.5 8 6.5

Density(%) 100 23 23 115 10 94 24 121 11 146

3-7 content of GM847 cells is 1.3-fold greater than that of HFF5 cells. Assuming that this difference is reflected in telomere numbers, cell fusion would therefore reduce the hybridisation intensity to ([1 X 23%] + [1.3 X 100%])/2.3, or 66% of the GM847 intensity. In 9/10 hybrid clones prior to senescence there was a much more striking reduction in telomeric DNA (Figures 3-3 & 3-4). Densitometry of clone E showed equal tract densities at both PDs tested (Figure 3-4) and this was presumably due to outgrowth of immortal revertants by PD 26 and, consistent with this, the growth curve for clone E indicates a shorter period of growth retardation (Figure 3-1). The total (TTAGGG)n hybridisation signal of all other clones ranged from 27% of that in GM847 cells in pre-senescent hybrid clone H down to 4% in pre-senescent hybrid clone A (Figure 3-3). When these cultures escaped from senescence, however, the TRFs reverted to the ALT pattern. A series of dilutions of GM847 TRF digests and 1:1 mixtures of GM847 and HFF5 TRF digests revealed that the ALT phenotype was still evident, confirming that the loss of TRF signal in the hybrid clones was not due to a dilution effect (Figure 3-5). These data are consistent with repression of the ALT telomere maintenance mechanism in the hybrids, followed by its reactivation in the immortal revertants that escape from growth arrest. Interestingly, the observed telomere loss in the pre-senescent hybrids appears to be greater than would be expected to occur at the rate seen in normal telomerase negative cells. Loss at the rate of 50-200 bp per PD as in normal somatic cells (Cooke and Smith, 1986; Harley et al., 1990; Hastie et al., 1990) would result in 1.3-5 kb loss over the 23-26 PD prior to growth arrest, which would correspond to a reduction in hybridisation intensity to 40-58% of GM847, but there was a greater reduction than this, with some clones having very much greater reductions in TTAGGG hybridisation intensity (Figures 3-3 & 3-4). This suggests that there is an active process causing a more rapid attrition of telomeric DNA. The rate of telomere lengthening in the immortal revertant cultures is difficult to assess because of the small number of cells available immediately after reversion: standard TRF analyses require microgram quantities of DNA and therefore a considerable expansion of the cell population before the first possible time point. Densitometric analyses indicated that the mean TRF length of clone J increased 17 kb between PD 25 and 41, an average lengthening of >1kb/PD. However, this calculation ignores the considerable (but unknown) number of cell divisions required for the immortal revertant cells to overgrow the culture initially. Also, in the absence of TRF analyses at early time points, the data cannot preclude the possibility that very rapid lengthening occurred in the first few PD after reversion to immortality. The results

3-8 A C D E G H Population 23 48 23 69 23 65 26 64 23 45 23 68 Doublings GM847

kb

48 38

19 12 10 8

Density(%) 4 27 17 66 6 61 50 50 19 60 27 62 100

3-9 GM847/HFF5 GM847 HFF5 (1:1) µg DNA 1.0 0.5 0.25 1.0 0.5 0.25 1.0 0.5

kb 48 38

12

8

3-10 indicate that normal cells are able to repress the ALT telomere phenotype and that immortal reversion is associated with reactivation of telomere maintenance via ALT.

3.4 Growth and telomere dynamics of additional GM847 X normal hybrids

Two further sets of ALT X normal hybrid clones were generated by fusing GM847 cells with two other strains of normal human diploid fibroblasts, MRC-5 and WI38, to determine if a similar ALT-repressed phenotype would be obtained. Hybrid clones of GM847 X MRC-5 (GMR) and GM847 X WI38 (GWI) were isolated by the same experimental procedures used for the GM847 X HFF5 hybrids. Eight GMR and seven GWI clones expanded sufficiently to allow extraction of genomic DNA. PCR fingerprinting analyses indicated that each clone contained genetic material from both parents (Table 3-2). TRF analysis of each clone was done at PD 23 at which time sufficient expansion of the cells enabled DNA to be extracted (Figure 3-6). In most cases there was considerable loss of long telomeres and discrete bands were clearly discernible, indicating loss of telomere length heterogeneity (Figure 3-6). Each of the clones had either very slow growth rates or had ceased to divide for a period of 2-3 weeks once PD 23 had been reached but these cells were not passaged further. These findings show that repressors of ALT exist also in MRC-5 and WI38 normal cells. The presence of discrete high molecular weight bands in both GMR and GWI clones (Figure 3-6) suggests the possibility that not all long GM847 telomeres are subject to a rapid deletion mechanism upon repression of ALT in these hybrids. Because these cells are clonal these bands would be detectable due to the isolation and expansion of single cells from a GM847 mass culture which have long telomeres on specific chromosomes.

3.5 Conclusions

These data demonstrate that the ALT telomere phenotype is repressed in hybrids between ALT cells and normal cells and indicates that one or more repressors of ALT exist in normal cells. The telomere loss in the hybrids that initially occurred at a rate greater than that seen in telomerase-negative normal cells raises the possibility that there may be an active telomere shortening mechanism. In support of this suggestion, there is evidence for a rapid telomere deletion mechanism in yeast that may be controlled by telomere binding proteins and involve recombination (Li and Lustig, 1996). Cleavage of long telomeres to wild type size may occur within a single cell division (Li and Lustig, 1996). Further, tagged telomeres in telomerase- negative immortal human cells were occasionally found to undergo rapid shortening and subsequent rapid relengthening, indicating that telomerase activity is not

3-11 TABLE 3-2. DNA fingerprint analyses of MRC-5 X GM847 (GMR) and WI38 X GM847 (GWI) hybrid clones.

Allele size (bp) at locusa vWA31 TH01 F13A1 FES/FPS Parental Cells MRC-5 145 144,168 192,196 ND WI38 161,165 161,167,174 188,200 223 GM847 144 163,167 184,192 211,227 Hybrids GMR-1 144,153 144,164,168 184,192,196 211 GMR-2 140,145 144,164,168 184,192,196 211,227 GMR-3 145 145,164,168 184,192,196 211,227 GMR-4 144 144,164,168 184,192,196 211 GMR-5 144 145,164,168 184,192,196 ND GMR-6 140,145 145,164,168 184,192,196 211 GMR-7 140,144 144,164,167 184,192,196 ND GMR-8 140,152 152,170,174 190,198 ND GMR-9 140,144 144,164,168 184,192,196 ND GMR-10 140,144 144,164,168 184,192,196 ND GWI-1 144,161,165 144,164,167,174 184,188,192,200 ND GWI-2 144,161,165 144,164,167,174 184,188,192,200 ND GWI-3 144,161,165 144,164,168,174 184,188,192,199 ND GWI-4 144,161,165 144,164,168,174 184,188,192,199 ND GWI-5 144,161,165 144,164,167,174 184,188,192,200 211,223 GWI-8 144,161,165 144,164,167,174 184,188,192,199 ND GWI-9 145,161,165 146,165,168,175 184,188,192,200 212,224 GWI-10 145,161,165 144,165,168,175 184,188,192,200 ND

aallele sizes at the indicated loci were determined by PCR amplification as described in Materials and Methods. ND = Not determined.

3-12 8 10 12 38 48 kb

GM847 MRC-5 124568910 GM847 XMRC-5 hybrid clones 8 10 12 38 48 3-13 kb

GM847 WI38 1234589 GM847 XWI38 hybrid clones essential for rapid telomere shortening (Murnane et al., 1994). The telomere loss evidenced in the GM847 X HFF5 hybrids suggests that ALT is also not required for rapid shortening as presumably it has already been repressed. This suggests the possibility that telomere maintenance via ALT primarily involves rapid relengthening to balance out continuing rapid shortening. The exact mechanism(s) responsible for telomere maintenance in ALT cells are currently unknown but recombination between telomeres is involved (Dunham et al., 2000). These data indicate that the activation of such an ALT recombination pathway involves the loss of repressors that are present in normal cells. The evidence also suggests a rapid reduction of telomeric sequence in hybrid cells in which the ALT phenotype has been repressed. This has obvious implications for designing strategies to identify genes involved in ALT and other aspects of telomere length control.

3-14 4. Chapter Four

Telomerase-positive immortalised cells contain repressors of ALT

4. Chapter Four...... 4-1 4.1 Introduction...... 4-2 4.2 Telomere dynamics in hybrids of ALT and telomerase-positive cells ...... 4-2 4.3 Endogenous telomerase is required for the immortal phenotype in somatic cell hybrids of ALT cells and telomerase-positive cells...... 4-6 4.4 ALT-associated PML bodies are lost from the ALT X telomerase-positive hybrids. ...4-14 4.5 Telomere-telomere recombination does not occur in the ALT X telomerase-positive hybrids ...... 4-14 4.6 Endogenous telomerase eventually stabilizes and maintains telomeres in the ALT- telomerase-positive hybrids...... 4-18 4.7 Conclusions...... 4-18

4-1 Telomerase-positive immortalised cells contain repressors of ALT

4.1 Introduction

A series of experiments was undertaken to determine whether repressors of ALT existed in telomerase-positive cells. A number of hybrid clones were generated by fusing the GM847 cell line with two separate telomerase-positive cell lines, HT-1080 and T24. These telomerase- positive cell lines were chosen because they have been assigned to the same immortalisation complementation group as GM847 cells (group A) (Pereira-Smith and Smith, 1988; Whitaker et al., 1995). The resulting hybrid cells would therefore be expected to have an immortal phenotype. The hybrid clones were analysed to determine the effect upon the ALT phenotype and whether telomeres would now be maintained by both ALT and telomerase in these cells. The results have important implications for further understanding the repression of ALT and also the understanding of both telomerase and ALT telomere maintenance mechanisms.

4.2 Telomere dynamics in hybrids of ALT and telomerase-positive cells

To study the effect of fusing telomerase-positive cells with GM847 ALT cells upon both telomerase activity and the ALT telomeres, clones were analysed from two sets of fusions, GM847 X HT-1080 (G/HT) and GM847 X T24 (G/T). All but one of the hybrid clones analysed proliferated without any period of growth arrest (Figure 4-1). A telomere repeat amplification protocol (TRAP) assay showed that each of the four G/HT and five G/T hybrids had telomerase activity (Perrem et al., 1999) and single locus DNA fingerprinting of each clone at the same time point at which this TRAP assay was performed confirmed the presence of both parental alleles in each clone and that they were genuine hybrids (Figure 4-2). To assess the impact of the fusions upon the ALT telomeres in these immortal X immortal hybrids we analysed the TRF lengths of the hybrid clones at various PD levels (Figure 4-3). In almost every case there had been a marked reduction in telomere length by the first time point at which DNA was available for analysis. This was not due to dilution of the long telomeres by the telomeres from the telomerase-positive parent because a mixture of the parental DNAs showed the characteristic ALT TRF pattern (Figure 4-3). Thus the presence of telomerase activity does not prevent shortening of the ALT telomeres. Although there was clear evidence of shortening in each of the hybrids, the amount of shortening seen at the first available PD level varied among the clones with the least amount of shortening being seen in G/HT clone E and the most in G/HT clone K.

4-2 GM847 X T24 hybrids Data KP fus revis ed Fig 3 Data KP fus revisGM847 ed Fig 3 X HT-1080 hybrids 125 125

C C

E E

F H 100 100 G K L

75 75

50 50 Population Doublings Population 25 25

0 0 0 50 100 150 200 0 50 100 150 200 250 Days

Figure 4-1

Growth curves of GM847 X T24 and GM847 X HT-1080 hybrid clones. At day 0 GM847 (ALT) cells were fused with T24 or HT-1080 (telomerase-positive) cell lines and hybrids were selected and passaged as described for Figure 3-1. Cumulative population doublings were cal- culated at each passage.

4-3 Population doublings Population doublings 6 2. kb 2 4. 6. 2 kb . .3 5 3 3 3 5

T24(T) GM847(G)

HT-1080(HT) G M847(G) C 22 429921 G/ 4-4 58 784353 C E C F G L

E HT Hybrid G/T Hybrids

H

s K

of parentalof cell DNA corresponding fusions. toeachsetof gel electrophoresis atthepopulationdoubling TRF analyses GM847 X of andGM847HT1080 X Figure 4-3 kb

GM847 X HT-1080 mix

GM847 X T24 mix 4-5 s indicated.Controls are 1:1mixtures T24 hybrid clones by pulsed-field

Analysis at later PD levels showed continued shortening of TRFs in all clones except G/HT clone K (Figure 4-3). DNA was only available at a single PD time point for analysis of G/HT clone H. The rate of shortening could be quantitated most accurately for the discrete bands, and measured between 35-175 bp/PD (Table 4-1) which is consistent with the rate of normal somatic cell telomere shortening (Cooke and Smith, 1986; Harley et al., 1990; Hastie et al., 1990). G/HT clone K already had short telomeres by PD 32, the earliest PD level for which DNA was available, and this length was maintained at PD 71 and 97. A faint high molecular weight band seen in some lanes of Figure 4-3 was not seen in previous gels, even at long exposures, where these same DNA samples were analysed. This band is therefore likely to be a non specific binding artefact.

TABLE 4-1. Measurement of the overall rate of telomere shortening in the hybrid clones by sizing of discrete TRF bands.

Hybrid clone Population Doubling TRF band size Overall rate of (PD) (kb DNA) telomere shortening (bp/PD)a G/HT clone E 21 31.6 60 26.7 78 21.6 175 G/T clone E 21 26.7 45 25.3 78 24.7 35 G/T clone F 21 24.5 43 22.7 81 G/T clone G 21 26.2 43 24.8 76 22.5 67 G/T clone L 21 9.2 53 7.6 50 acalculated as the reduction in band size divided by the cumulative population doublings.

4.3 Endogenous telomerase is required for the immortal phenotype in somatic cell hybrids of ALT cells and telomerase-positive cells.

Four of the hybrid clones, GM847 X HT-1080 (G/HT) clones E and K, and GM847 X T24 (G/T) clones G and L, were passaged for more than 200 PDs with no occurrence of growth arrest or senescence. These cells were positive in the TRAP assay at each PD level tested, indicating that they retained in vitro telomerase activity throughout this period of growth (Figure 4-4). DNA fingerprinting analysis at later PDs for each clone revealed that alleles from both parental cell lines were still present (Figure 4-5). T-antigen (T-ag) immunostaining of

4-6 LB G/T clone G (PD 139) G/T clone G (PD 189) (PD 188) G/T clone L (PD 244) G/T clone L G/HT clone K (PD 193) G/HT clone K (PD 249) G/HT clone E (PD 196) G/HT clone E (PD 247)

4-7 Doubling Population kb 2.3 9.4 6.5 23 4.3 2

GM847

T24

4-8 HT-1080 T24 clones GM847 X 248 G L 278 1080 clones GM847 XHT- 281 E K 283 each of the four hybrid clones showed expression of T-ag in each cell thus excluding the possibility that the cultures contained mixtures of the parental cells (Figure 4-6). To determine whether telomerase was actually required for continuing growth of the hybrid cells, clones G/HT K and G/T L were transfected with a dominant-negative hTERT (dn hTERT) expression plasmid. This plasmid expresses an hTERT protein which contains an aspartate substitution (D712/A712) within the catalytic core and which has been characterised previously as an inhibitor of telomerase activity (Harrington et al., 1997a). It has also been shown to cause telomere shortening, and can induce apoptosis (Zhang et al., 1999) or senescence (Colgin et al., 2000) following transfection into telomerase-positive human cell lines. Fifteen colonies were isolated from the G/HT K (KDN) and 19 from the G/T L (LDN) dn hTERT transfections. At early PDs, before the colonies had expanded sufficiently to permit harvesting of cells for analysis, three KDN clones and 17 LDN clones ceased dividing, with the cells displaying the large, flat morphology characteristic of senescence. Twelve KDN clones and only two LDN clones underwent sufficient PDs to allow analysis of telomerase activity by TRAP (Figure 4-7). KDN clones 3, 8, 10 and 11 showed complete inhibition of telomerase activity with weak activity detectable in clones 2 and 9. All other KDN clones that could be analysed were telomerase-positive. LDN clones 10 and 11 also showed complete inhibition of telomerase activity (Figure 4-7). TRF analyses of clones, that had expanded sufficiently to allow measurements at different timepoints, were consistent with the TRAP data and are shown in Figure 4-8. KDN 2 and KDN 9 cells show evidence of telomere lengthening (Figure 4-8) and both are weakly telomerase-positive (Figure 4-7). In contrast KDN 8 and LDN 10 cells were both telomerase-negative (Figure 4-7) and both have shortened telomeres at later PDs (Figure 4-8). The inhibition of telomerase in these clones also correlated with the appearance of a senescent phenotype. In contrast, the clones that were telomerase-positive continued to divide with no onset of growth arrest. Representative images of cell morphologies for both senescent and proliferating clones are shown in Figure 4-9. KDN 7 cells (Figure 4-9a), which are telomerase- positive, divide rapidly and grow at high densities, which is characteristic also of the other telomerase-positive KDN clones. In contrast KDN 10 and KDN 11 cells, which are telomerase inhibited, no longer divide and many have become enlarged (Figure 4-9b,c) which was apparent also in LDN clones 10 and 11 (Figure 4-9e,f). Most LDN clones stopped dividing at very early PD levels (when they had formed small colonies) and the few surviving cells also appeared enlarged and senescent (Figure 4-9d). Telomerase is therefore required for continued

4-9 4-10 LDN KDN 10 11 1 2 3 4 5 6 7 8 9 10 11 14 LB

4-11 KDN 2 KDN 8 KDN 9 LDN 10 Population

GM847 23 27 23 33 23 27 23 29 doublings

kb 23 9.4 6.5

4.3

2.3 2

4-12 4-13 cell growth in these hybrids. This result supports the conclusion that ALT had been repressed in these hybrid cells and that telomerase is the sole telomere maintenance mechanism.

4.4 ALT-associated PML bodies are lost from the ALT X telomerase-positive hybrids.

As further evidence that there was no ALT activity in the hybrid cells, three clones were analysed for ALT-associated PML bodies (APBs). APBs are a novel type of PML body that are present in ALT cells but not in telomerase-positive or normal cell types and have been identified recently (Yeager et al., 1999). They contain both telomeric repeats and telomere binding proteins and have been found in a subpopulation of cells within each ALT cell line so far tested, including GM847 (Yeager et al., 1999). Hybrid clones at early and late PDs were immunostained to detect APBs using an antibody to human TRF2 (Figure 4-10). At the earlier PDs, in each case, there were few nuclei that had detectable APBs but most had a punctate staining pattern, characteristic of telomerase-positive cells (Yeager et al., 1999). In contrast, at later PDs there were no APBs detected in any nuclei examined. These data provide further evidence that ALT is fully repressed in the hybrid clones.

4.5 Telomere-telomere recombination does not occur in the ALT X telomerase-positive hybrids

A recent report from this laboratory has identified telomere-telomere recombination as a central component of ALT telomere maintenance (Dunham et al., 2000). In that study a neo tag was incorporated into the telomeres of GM847 cells and was found to be copied between telomeres, giving rise to multiple neo signals at subsequent PDs. Based on these findings, an assay for ALT had been established and was subsequently used to determine the level of telomere- telomere recombination in a variety of cell lines including the ALT-repressed hybrid cells in this study. A chromosome with a neo tagged telomere (2C2) was isolated from a GM847 subclone (GM847/Tel-2 (Dunham et al., 2000)) and used to generate the mouse A9: Human monochromosome hybrid donor cell line, CMC 2C2 (C. Fasching, Cancer Research Group, CMRI). Microcell mediated chromosome transfer (MMCT) of the 2C2 chromosome into G/HT clone K cells at PD 300 was performed (C. Fasching). The resulting clones (K 2C2) were expanded and analysed by Southern blot and fluorescence in situ hybridisation (FISH) for the presence of neo signal. Southern analysis revealed identical neo bands in every clone which indicated that no copying of the neo signal between telomeres had occurred (Figure 4-11). FISH analysis of metaphase chromosomes of K 2C2 clones also showed that the neo signal had not been copied to other telomeres (Figure 4-12). This was in contrast to the parental GM847

4-14 ab

cd

ef

g h

4-15 K 2C2 clones kb 1 2 3 4 5 7 8 9 10 23

9.4

6.5

4.3

2.3 2

4-16 4-17 cells which clearly demonstrated copying of the neo tag between telomeres (Dunham et al., 2000). These data also confirm that ALT is repressed in the ALT X telomerase-positive hybrids as the telomere recombination mechanism that exists in GM847 cells is no longer active. This is consistent with the previous findings in telomerase-positive cells showing no evidence of telomere-telomere recombination (Dunham et al., 2000).

4.6 Endogenous telomerase eventually stabilizes and maintains telomeres in the ALT- telomerase-positive hybrids.

The results from the dn hTERT transfection experiment implied that telomerase activity was important for the survival of the hybrid clones, presumably through its role in telomere maintenance. This further implied that the telomeres of these hybrids would eventually stop shortening. To test this, TRF analysis of hybrid clones G/HT E and K and G/T G and L was performed at later time points up to ~300 PDs (Figure 4-13). It was observed previously, (Figure 4-3), that the long telomeres contributed by GM847 cells were not maintained and were lost from clones K, L and G at an initial rate far greater than is observed in normal telomerase-negative cells. Normal rates of telomere shortening were observed in clones E, G and L at subsequent PDs (Figure 4-3). In clone K, which lost the large TRFs most rapidly, the telomere length continued to fluctuate at later PDs around a mean length below 8 kb indicating telomere maintenance by telomerase (Figure 4-13). Clones E, G and L at later PDs show a phase of continuing telomere shortening, confirming that telomerase did not maintain the long telomeres on the chromosomes contributed to the hybrids by the ALT cells (Figure 4-13). At the latest PD levels in all three of these clones however, the TRF lengths stabilized, indicating telomere maintenance by telomerase.

4.7 Conclusions

These data demonstrate that in somatic cell hybrid clones, generated by fusion of GM847 cells with each of two telomerase-positive cell lines, ALT is repressed and the telomeres are maintained by endogenous telomerase activity. Features of ALT disappeared, i.e., the abnormally long telomeres (Perrem et al., 1999), and APBs, and telomere-telomere recombination was abrogated. Transfection of these cells with dn hTERT demonstrated that their continued survival was dependent on telomerase activity. Repression of ALT has previously been seen in the immortal revertant cells from one hybrid clone formed by fusion of GM847 (immortalisation complementation group A) and BET-1A (group D) cell lines

4-18 GM847 X HT-1080 GM847 X HT-1080 Hybrid (G/HT) clone E Hybrid (G/HT) clone K HT-1080 GM847

(Kb)

48 48 38 38

12 12 10 10 8 8

Population 32 83 143 202 253 283 304 21 60 78 251 131 200 302 Doublings

GM847 X T24 GM847 X T24 Hybrid (G/T) clone L Hybrid (G/T) clone G T24 GM847

(Kb)

48 48 38 38 12 10 12 8 10 8

21 53 Population 103 157 248 278 299 21 43 76 Doublings 103 148 253 300

4-19

(Bryan et al., 1995). The results presented in this study are in contrast to those in a recent report of non-complementary fusions between ALT and telomerase-positive cell lines in group D, in which no evidence for repression of ALT was found (Katoh et al., 1998). A more recent study however has reported the same findings as presented here, in which ALT X telomerase- positive immortal hybrids were telomerase-positive and ALT-repressed (Ishii et al., 1999). Taken together, this suggests at least two possible outcomes resulting from fusions of ALT cells and telomerase-positive cells from the same complementation group (Figure 4-14). The existence of at least two repressors of ALT has been suggested by the observation that ALT cell lines are found in more than one immortalisation complementation group (A and D) (Whitaker et al., 1995). One repressor appears to be located on chromosome 7 because reduction of telomere length has been shown in an ALT cell line, SUSM-1, following transfer of a normal copy of this chromosome (Nakabayashi et al., 1997). Chromosome 7 only causes senescence in cells assigned to group D (Ogata et al., 1993; Ogata et al., 1995), so it is unlikely that it would repress ALT in GM847 cells which are in group A (Pereira-Smith and Smith, 1988). The exact nature of these putative repressors is currently still unknown. One possibility would be that they are transcriptional repressors of genes encoding products that are involved in the ALT process. Recombination at the telomeres, that has been shown to be involved in ALT in GM847 cells (Dunham et al., 2000), is repressed in the hybrid cells (Figures 4-11 & 4- 12) and therefore it is possible that there are telomere binding proteins that can act as repressors of ALT by making telomeric DNA inaccessible to the recombination machinery. Previous studies have shown that human telomere binding proteins hTRF1 (van Steensel and de Lange, 1997; Smogorzewska et al., 2000) and hTRF2 (Smogorzewska et al., 2000) play a direct role in regulation of telomere elongation by telomerase and prevent overextension of telomere tracts. In yeast it has been shown that the telomere binding proteins Rif1 and Rif2 inhibit both telomerase and an ALT mechanism known as type II recombination (Teng et al., 2000). While it remains entirely possible that proteins that regulate both telomerase and ALT in human cells will be found, these somatic cell hybrid data show that ALT and telomerase can be controlled separately. Telomere shortening occurs at normal rates in the hybrid cells despite the presence of telomerase, but this is eventually followed at later PDs by telomere length stabilization at lengths characteristic of telomerase-positive cells. This indicates that, unlike ALT, there appears to be a control mechanism in telomerase-positive cells that prevents maintenance by telomerase of telomeres above a certain length. There is strong evidence for the existence of

4-20 Cell line 1Cell line 2 Hybrid

Tel + ALT + Tel + cell ALT R+ ALT R- ALT R+ X fusion Tel R- Tel R- Tel R-

Cell line 3 Cell line 4 Hybrid

Tel + ALT + ALT + cell ALT R- ALT R- ALT R- X fusion Tel R- Tel R+ Tel R+

4-21 such a regulatory mechanism in yeast (Marcand et al., 1997; Marcand et al., 1999). Studies on telomerase-positive human immortalised cells have also found evidence for telomere length control, and have suggested the existence of an ‘equilibrium mean length’ for individual telomeres above which shortening can occur in the presence of telomerase activity (Sprung et al., 1999). In some cases, telomeres can be maintained by telomerase at subsenescent lengths (Counter et al., 1992; Zhu et al., 1999; Steinert et al., 2000). Also in support of such a proposal are studies that were conducted in this laboratory with telomerase-positive 293 cells which revealed shortening high molecular weight TRF bands (Bryan et al., 1998). Another study of a human thyroid cancer cell line also showed occasional telomere shortening with no variation in levels of telomerase activity over continuing passages in culture (Jones et al., 1998). The question arises why expression of telomerase is not repressed in hybrids between the telomerase-negative GM847 cells and the telomerase-positive HT-1080 or T24 cells. It seems likely that whereas GM847 cells cannot activate telomerase they also cannot repress its activity (Figure 4-14, Cell line 2) and thus separate factors are involved. An alternative explanation is that GM847 cells do in fact contain a telomerase repressor but that this is usually lost from the hybrids shortly after fusion. The data presented here provide important additional insights into repression of ALT and also the regulation of telomere maintenance by both ALT and telomerase in human cells. The exact nature of the ALT repressor(s) that exist both in telomerase-positive cells and normal cells (Chapter 3), and the factors that prevent telomere maintenance by telomerase, is of great interest in the search for inhibitors of both telomere maintenance mechanisms in human cells.

4-22 5. Chapter Five

Exogenous telomerase activity does not repress ALT but co-exists within the same cell and lengthens the shortest telomeres

5. Chapter Five ...... 5-1 5.1 Introduction...... 5-2 5.2 Exogenous expression of telomerase in GM847 cells lengthens the shortest telomeres. 5-2 5.3 Telomere fluorescence in situ hybridisation analysis of GM847/hTERT cells...... 5-9 5.4 The ALT phenotype is not repressed in GM847/hTERT cells...... 5-12 5.5 Conclusions...... 5-19

5-1 Exogenous telomerase activity does not repress ALT but co-exists within the same cell and lengthens the shortest telomeres

5.1 Introduction

The results of Chapter 4 demonstrated that ALT was repressed and telomerase was active in somatic cell hybrids of ALT cells and telomerase-positive cells. These data suggested the possibility that telomerase may be a repressor of ALT. To investigate this further, experiments were performed in which the catalytic subunit of telomerase, hTERT, was expressed in GM847 cells. The resulting clones (GM847/hTERT) were analysed to test whether exogenous telomerase activity would repress ALT. Expression of hTERT was found to reconstitute telomerase activity in GM847 cells in previous reports. It had not however been reported previously whether exogenous telomerase activity had any effect on telomere lengths in ALT cells or on the ALT mechanism. Telomere lengths of GM847/hTERT cells were assessed by both Southern and telomere FISH analysis. Results of this analysis would determine whether telomerase was responsible for the ALT repression seen in telomerase-positive somatic cell hybrids (Chapter 4) and would also test for the possibility that both telomerase and ALT may be able to co-exist in the same cell. These results would provide new insights into repression of both telomerase and ALT and have implications for our understanding of both mechanisms.

5.2 Exogenous expression of telomerase in GM847 cells lengthens the shortest telomeres.

The telomerase catalytic subunit hTERT was transiently expressed in GM847 cells using the pCIneo vector (Promega) and TRAP analysis indicated that this reconstituted telomerase activity, which was absent in vector control and untransfected cells (Figure 5-1a). This finding was consistent with other reports showing activation of telomerase in GM847 cells by both transient (Wen et al., 1998) and stable (Counter et al., 1998a) transfection of hTERT alone. To assess the impact of exogenous telomerase activity upon ALT, 10 stable clones of GM847 cells were generated by transfection of hTERT (GM847/hTERT) and 8/10 were found to be telomerase-positive (Figure 5-1b). The GM847/hTERT stable clones and vector control clones were then analysed, at the earliest timepoints possible, by terminal restriction fragment (TRF) analysis to measure telomere lengths. Telomere lengths of each clone appeared heterogeneous and characteristic of ALT whether or not telomerase activity was detectable (Figure 5-2). There was considerably less hybridisation signal in GM847/hTERT clones 6, 9

5-2 GM847/hTERT a b clones

GM847 untransfected GM847/pCIneo 1 2 3 4 6 7 9 10 11 12 LB GM847/hTERT LB

5-3 GM847/hTERT clones 1 2 3 4 6 7 9 10 11 12 GM847/pCIneo-4 GM847/pCIneo-5

kb 48

12

8

5-4 and 10 but the band smear was still visible up to the well which argued against ALT repression in these clones (Figure 5-2). Thus ALT appeared to be unaffected by exogenous telomerase activity in GM847 cells. It remained possible that the GM847/hTERT clones may contain mixed populations of telomerase-positive and telomerase-negative cells, which would result in detectable telomerase activity but may mask the impact upon the ALT telomere phenotype. It was previously shown that a 1:1 mixture of telomerase-positive and ALT cell genomic DNA resulted in an ALT-like TRF pattern (Chapter 4; Figure 4-3). Subclones were therefore generated by limiting dilution of two telomerase-positive clones, GM847/hTERT-3 and -6, at PD 115 and 143, respectively. TRAP analysis, however, revealed no telomerase-negative subclones (Figure 5-3). These subclones were then subjected to TRF analysis to further assess the effect of exogenous telomerase activity on the ALT telomeres at later PDs. The telomere lengths of GM847/hTERT-3 and -6 clones (at a later passage than Figure 5-2) and their subclones (at PD 25) were compared with those of untransfected GM847 cells (Figure 5-4). In many of the subclones of GM847/hTERT-3 and -6 (especially GM847/hTERT-3 subclones 6, 8 and 9 and GM847/hTERT-6 clones 2, 7, 10 and 11) there was a significant reduction in the amount of low molecular weight material hybridising to the (TTAGGG)3 probe compared with the untransfected GM847 control (Figure 5-4). This was not so readily apparent in the GM847/hTERT-3 and -6 populations from which these subclones were derived. Also, there was considerable variation among the subclones, particularly those of GM847/hTERT-3 which showed varying degrees of reduction in low molecular weight telomere hybridisation intensity. For almost all of the clones in which there was a reduction of low molecular weight TRFs, there was no detectable change in the high molecular weight TRFs. These data indicate that in many of the cells within the hTERT-transfected population of GM847 cells the shortest telomeres have been lengthened. To exclude the possibility that the telomere phenotype evident in the GM847/hTERT cells was due to clonal variation unrelated to the expression of telomerase, we analysed the telomere lengths of subclones of untransfected GM847 cells and compared them with GM847/hTERT-6 cells and also GM847/hTERT-3 cells at three different passages (Figure 5-5). DNA from HFF-5 and MRC-5 normal human fibroblasts, which only have telomeres in the normal length range, was included for comparison. The TRF analysis showed that each subclone of the untransfected GM847 cells has characteristic ALT telomere length heterogeneity (Bryan et al., 1995), including very short telomeres, in contrast to the GM847/hTERT cell TRFs which have less low molecular weight telomeric hybridisation

5-5 GM847/hTERT-3 GM847/hTERT-6 subclones subclones 1 2 3 4 5 6 7 8 9 10 11 12 1 2 4 5 6 7 8 9 10 11 12 LB

5-6 GM847/hTERT-6 GM847/hTERT-3 subclones subclones

parental GM847/hTERT-6 2 7 9 10 11 GM847 untransfected parental GM847/hTERT-3 1 2 4 5 6 7 8 9 10 11 12

kb 48 33 19 12 8

5-7 GM847 (untransfected) GM847 subclones /hTERT-3 HFF-5 MRC-5 4 5 7 11 12 GM847/hTERT-6 (p8) p8 p22

kb

48 29

19 12 8

5-8

(Figure 5-5). These data indicate that the telomere length alteration in the GM847/hTERT cells is due to telomere lengthening by hTERT and not random clonal variation. Expression of hTERT and induction of telomerase activity in GM847 cells therefore lengthens the shortest telomeres. This effect was not readily apparent on TRF analysis of GM847/hTERT clones at early passages. The effect was most noticeable after subcloning, and it seems likely that two factors contributed to this. First, the cells underwent additional population doublings during the subcloning process, during which the lengthening process may have progressed. Second, the change was more noticeable in some subclones than others, and the presence within the original population of cells in which little or no telomere lengthening had occurred may have obscured the effect.

5.3 Telomere fluorescence in situ hybridisation analysis of GM847/hTERT cells.

The telomere lengths of GM847/hTERT-3 and -6 clones and their subclones were then compared with those of untransfected GM847 cells by telomere fluorescence in situ hybridisation (FISH) with a fluorochrome labelled telomere probe (Figure 5-6). GM847 cells show heterogeneous telomere FISH signals ranging from undetectable to very large (Figure 5-6a) and this pattern was apparent in 50/50 metaphase spreads (Table 5-1). There were similar numbers of undetectable telomeres present in each of the nuclei examined amounting to approximately 6% of the total (Table 5-1). This telomere FISH pattern is consistent with the telomere length heterogeneity in GM847 cells documented by TRF analysis (Bryan et al., 1995; Perrem et al., 1999). Analysis of GM847/hTERT-3 cells, however, revealed detectable telomere FISH signals at each chromosome end (Figure 5-6c,d) in the majority of nuclei at both early and late passage. This suggested that the shortest telomeres had been lengthened in the majority of cells within the population. Chromosome ends without a detectable telomere FISH signal were present in only 12/50 GM847/hTERT-3 metaphase nuclei at an early passage and 13/50 nuclei at a later passage (Table 5-1). Approximately one quarter of the GM847/hTERT-3 metaphases examined, therefore, still had the very heterogeneous telomere FISH signals characteristic of untransfected GM847 cells (Figure 5-6b), and this subpopulation persisted with passage in culture (Table 5-1). Although no telomerase-negative subclones of GM847/hTERT-3 were detected, it is possible that hTERT expression had been downregulated in a proportion of cells and this resulted in retention of, or reversion to, a characteristic ALT telomere phenotype.

5-9 abc

def

5-10

TABLE 5-1. Telomere FISH analyses of detectable telomeres in GM847 and GM847/hTERT cells.

Metaphases with Number of undetectable Cell Type undetectable telomeresa telomeresb (%) (%) GM847 untransfected 50/50 (100) 41/704 (6)

GM847/hTERT-3 (PD 42) 12/50 (24)

GM847/hTERT-3 (PD 106) 9/50 (18) 8/690 (1) GM847/hTERT-3 (PD 138) 13/50 (26) GM847/hTERT-6 (PD 46) 13/55 (23) GM847/hTERT-6 (PD 82) 15/50 (30) 1/894 (0.1) GM847/hTERT-6 (PD 150) 13/52 (25) GM847/hTERT-3 subclone 9 1/50 (2) 2/1232 (0.2) GM847/hTERT-6 subclone 11 0/50 (0) 2/1210 (0.2) ametaphases containing at least one chromosome end without a detectable telomere FISH signal b number of undetectable telomeres relative to the total number of chromosome ends analysed in five metaphases

Similar results were obtained for the GM847/hTERT-6 clone, in which most of the short telomeres had also been lengthened. Approximately one quarter (23–30%) of the GM847/hTERT-6 clone cells contained at least one chromosome end with an undetectable telomere signal (Table 5-1). However, it is likely that even in this subpopulation some of the very short telomeres had been lengthened by telomerase activity, because the number of undetectable telomeres was reduced by much more than three quarters compared to the untransfected GM847 cells (Table 5-1). It is noteworthy that some very large signals were still evident in nuclei that had no undetectable telomere signals (Figure 5-6). This indicated that although the number of very short telomeres was reduced in these clones, very long telomeres were still present. FISH analysis of GM847/hTERT-3 subclone 9 (Figure 5-6e) and GM847/hTERT-6 subclone 11 (Figure 5-6f), revealed detectable telomeric signals on every chromosome examined in 49/50 and 50/50 metaphases, respectively (Table 5-1). It is interesting that although cells with undetectable telomeres were present within the GM847/hTERT-3 and -6 populations and persisted at later passages, this phenotype was very rare in the GM847/hTERT-3 and -6 subclones. A reason for this outcome may be that cells within the GM847/hTERT populations that have lengthened the shortest telomeres might have a selective growth advantage during cloning by limiting dilution.

5-11

These FISH data therefore also show that the shortest telomeres have been lengthened in most of the GM847 cells that express exogenous hTERT. The effect was most noticeable after subcloning which again may have been due to the additional population doublings that the cells undergo during the subcloning process, during which time telomere lengthening by telomerase would have progressed. Every metaphase of untransfected GM847 cells that was examined, without exception, had several chromosome ends with an undetectable telomere FISH signal (Table 5-1). This indicates that the lengthening of the shortest telomeres seen in GM847/hTERT cells is due to telomerase rather than random selection of putative pre-existing cells within the untransfected GM847 population that happened to have no very short telomeres. The data were confirmed by FISH examination of additional GM847/hTERT clones, which showed in 5/5 clones that the shortest telomeres had clearly been lengthened; this phenotype was detected in 0/5 GM847 untransfected subclones and in 0/2 vector control clones (data not shown).

5.4 The ALT phenotype is not repressed in GM847/hTERT cells.

FISH analysis of early and late passage GM847/hTERT-3 and GM847/hTERT-6 cells, and subclones derived from them, showed that these cells retained the very large telomere FISH signals characteristic of ALT cells (Figure 5-6). This suggested that ALT was still active in these cells, but, to confirm that this was the case, additional telomere FISH analyses were performed on GM847/hTERT-3 subclones 6 and 9, and GM847/hTERT-6 subclones 2 and 11, that had been obtained by limiting dilution at late passage levels (PD 115 and 143, respectively). Very large FISH signals corresponding to long telomeres were detectable in every metaphase examined (Figure 5-7), indicating that there had been no inhibition of ALT. Further cytogenetic analysis of metaphase nuclei within each subclone revealed a striking heterogeneity in the chromosomal location of the long telomeres (Table 5-2). This pattern was also seen in untransfected GM847 cells, but not in telomerase-positive cells (data not shown). This is consistent with previous data indicating that GM847 cells maintain their telomeres by telomere-telomere recombination and copy switching (Dunham et al., 2000). As the subclones were derived from single cells, this heterogeneity must have been generated subsequent to subcloning, indicating that ALT was still active at least 115 or 143 PD (in GM847/hTERT-3 or GM847/hTERT-6 cells, respectively) after initial transfection with hTERT. We then compared the telomere FISH signals of the p and q arms of the Y chromosome, which was present in single copy in subclones of GM847/hTERT-3 and GM847/hTERT-6, and found that within each subclone there was dramatic variation in the ratio of these signals (Figure

5-12 a b

c d

e f

g h

5-13 5-14

TABLE 5-2. Detection of long telomeres on specific chromosomes in metaphase spreads of GM847/hTERT subclones.

GM847/hTERT-3 subclone 6 (●) and GM847/hTERT-6 subclone 2 (■) and

Chromosome subclone 9 (▲) subclone 11 (◊) b Type (arm) Metaphase nucleusa Metaphase nucleusa 1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10 1 (p) ▲ ● ● 1(q) ■2 ■2 ■ ■2 ■3 ■ ■2 ▲ ● ● ■ ◊3 ◊ ◊2 ◊3 ◊ ◊ ◊ ◊3 1 (p+q) ▲ ▲ 2 (p) ■ ■ 2 (q) ▲ ● ■ ■ ■ ◊ 3 (p or q) ● ● ● ◊ ■ ■ ■ ■ ■ 3 (p+q) ● B group (p) ● ▲ ▲ ▲ ▲ ▲ ■ ◊ ■ ■ ◊ ■ B group (q) ■ ▲ ▲ ●3 ▲ ● ◊ ■ ◊ ◊ B like (p+q) ▲ C group (p) ●2 ■ ● ● ●2 ▲ ◊ ◊ ◊ ■ ◊ ■ ■ ◊ ▲ ◊ C group (q) ■ ▲ ● ● ▲ ■2 ■ ■ ◊ ◊ C group (p+q) ■ 6 (p) ● ● ▲ ◊ 6 (q) ▲ ●2 ● 9 (p) ● ● ● ● ■ ■ ■ ■ ■ 9 (q) ▲ 9 like (q) ■ 11 (p) ■ ■ 11 (q) ◊ ◊ ◊ ◊ 12 like (p) ■ ▲ ▲ ▲ ▲ ■ ■ ■ ◊ ◊ 12 like (q) ■ ◊ ■ ◊ D group (p) ■ ▲ ● ● ▲ ● ● ◊ ◊ ◊ D group (q) ■ ▲ ●2 ● ● ● ■2 ◊ ■ ◊ ◊ ■2 ■2 ◊ D group (p+q) 16 (p) ● ▲ ▲ ◊ ◊ ▲ 16 like (q) ■2 ▲ ◊2 ◊ ◊ 16 like (p+q) ◊ 17 (p) ▲ ▲ ▲ ▲ ■ ▲ ● ■ ■ ■ ■ ■ ◊ ◊ 2 2 2 2 ◊ 17 (q) ●2 ■ ◊ ■3 17 (p+q) ▲ ◊ ■ ◊ ■ ■ ■ ■ 18 (p) ● ■ 18 (q) ◊ ◊ ◊ 17/18 like (p+q) 19 (p) ● ● ● ● ● 19 like (q) ■ ■ ■ 20 (q) ▲ ▲ ▲ ▲ ● ■ ■ ■ ■ ■ ■ ◊ 20 (p+q) ▲ 21 or 22 (q) ● ● ● 22 like (p) ▲ ▲ 22 like (q) ▲ ▲ ▲ Y (p) ▲ ■ ■ ■ ■ ■ ■ ■ acrocentric marker large (p) ◊ ■ ◊ ■ acrocentric marker large (q) ● ● ■ ■ metacentric ▲ ▲ marker small small marker ●4 ●3 ●2 ●4 ■3 ■4 ■4 ■4 ■3 ■5 ■4 ● ● ●3 ● ■ ◊3 ◊3 ▲ ▲ ▲ ▲ ◊ ◊3 ◊3 ◊3 ◊2 ◊3 ◊3 small marker ◊ ◊ ■ (p+q) a ten metaphase nuclei were examined for each subclone; where there was more than one instance of a long telomere on the same chromosome within a single metaphase, this is indicated by a number bchromosomes that could not be identified exactly were assigned to groups based on their size and arm index; Group number (chromosomes): A (1-3), B (4,5), C (6-12, X), D (13-15), E (16-18), F (19,20), G (21,22,Y)

5-15

5-8). This marked fluctuation in p:q ratio must have occurred subsequent to subcloning, consistent with the presence of continuing ALT activity in these cells. We examined the GM847/hTERT cells for the presence of ALT-associated PML bodies (APBs). APBs are PML bodies containing low molecular weight telomeric DNA and telomere- associated proteins, and are present in all ALT cell lines examined to date (including GM847), but not in telomerase-positive or mortal cells (Yeager et al., 1999). In exponentially growing cultures of ALT cells, APBs are present in approximately 5% of the population. Their occurrence has a close temporal correlation with activation of ALT in cell lines immortalized in vitro (Yeager et al., 1999). They are thus an excellent marker of ALT activity, although the role of APBs in the mechanism of ALT is currently unknown. APBs were detectable at all PD levels examined for GM847/hTERT-3 and GM847/hTERT-6 cells and in subclones of these cells (Figure 5-9). The proportion of cells with detectable APBs was maintained within the range characteristic of untransfected GM847 cells (Table 5-3) (Yeager et al., 1999). These data suggest that ALT is not inhibited by exogenous hTERT, and co-exists with telomerase activity as a telomere maintenance mechanism in GM847/hTERT cells.

TABLE 5-3. Detection of ALT associated PML bodies (APBs) in GM847/hTERT cells by telomere FISH using a peptide nucleic acid probe.

Percentage of Cell Type nuclei with detectable APBsa GM847 untransfected 3 GM847/hTERT-3 (PD 42) 4 GM847/hTERT-3 (PD 106) 3 GM847/hTERT-3 (PD 138) 4 GM847/hTERT-6 (PD 46) 5 GM847/hTERT-6 (PD 82) 4 GM847/hTERT-6 (PD 150) 5 GM847/hTERT-3 subclone 6 (PD25) 4 GM847/hTERT-3 subclone 9 (PD25) 2 GM847/hTERT-6 subclone 2 (PD25) 5 GM847/hTERT-6 subclone 11 (PD25) 3 a500 interphase nuclei scored for each cell type

5-16

10.00 10.00

1.00 1.00

0.10 0.10 GM847/hTERT-3 subclone 6 GM847/hTERT-3 subclone 9

ratio signal 10.00 10.00

1.00 1.00

Y chromosome p arm : q arm telomere FISH p telomere : q arm arm Y chromosome 0.10 0.10 GM847/hTERT-6 subclone 2 GM847/hTERT-6 subclone 11

Figure 5-8

Ratio of p arm: q arm telomere lengths on the Y chromosome from 20 metaphase spreads of each GM847/hTERT subclone indicated. Each bar represents the ratio for an individual metaphase. The ratio was calculated using the Y chromosome mean telomere fluorescence signal intensities from captured images of each metaphase nucleus at exposure times of 0.5, 1.0, 1.5 and 2.0 sec.

5-17 acb

def

5-18

5.5 Conclusions

These data indicate that exogenous expression of hTERT in GM847 ALT cells lengthens the shortest telomeres. Although transfection of hTERT into ALT cells has been shown to induce in vitro TRAP activity (Wen et al., 1998; Counter et al., 1998a), it has not been demonstrated previously that this telomerase activity has any effect on the telomeres in vivo. In other circumstances, it has been shown clearly that TRAP activity is not synonymous with in vivo enzyme activity: hTERT that was modified at the carboxyl terminus induced TRAP activity when expressed in telomerase-negative mortal cells, but was not able to maintain the telomeres (Counter et al., 1998b). This study demonstrates that hTERT expression results in telomerase activity that acts on some of the telomeres of GM847 cells, as detected by TRF Southern analysis and by telomere FISH. This effect was most apparent after subcloning and continued passaging, most likely because the telomere lengthening was a gradual process that did not occur equally in all cells within the population. Within the untransfected GM847 population, every metaphase nucleus examined had chromosome ends without a detectable telomere FISH signal. This indicates that the telomere lengthening was due to hTERT expression, and not due to random clonal selection of pre-existing cells within the population in which telomere lengthening had already occurred. As a corollary, the data indicate that the GM847 cells express sufficient levels of whatever factors, other than hTERT, are required for telomerase-mediated lengthening of telomeres. Although telomerase is active in the GM847/hTERT cells, these cells retain hallmarks of ALT activity, that is, persistence of extremely heterogeneous telomeres and of APBs. Additionally, the very long telomeres were present on different chromosomes in clonal populations of late passage GM847/hTERT cells, which is consistent with ALT involving a telomere-telomere recombination mechanism. In contrast, when ALT was repressed in somatic cell hybrids of GM847 with a telomerase-positive cell line, the telomeres rapidly decreased in length and the APBs disappeared (Chapter 4). This indicates that telomerase and ALT are both active in the GM847/hTERT cells and that telomerase is not responsible for ALT repression in the somatic cell hybrids. A previous study in this laboratory reported that some human tumours exhibit both telomere maintenance mechanisms (Bryan et al., 1997b). The present lack of assays suitable for analysis of individual cells within tumours means that it is currently not possible to determine whether these tumours contain subpopulations with one or other telomere maintenance mechanism, or whether there are tumour cells utilizing more than one mechanism. The results presented here do not answer this question regarding tumours, but they do show that it is possible for more than one mechanism to be active in the same cell.

5-19

It has been demonstrated previously in yeast that cells lacking telomerase utilize a recombination pathway to maintain telomeres and continue proliferating (Lundblad and Blackburn, 1993; McEachern and Blackburn, 1996). It has been suggested that this mechanism in yeast, which is dependent on RAD52, may be a general alternative pathway for telomere maintenance in eukaryotes (McEachern and Blackburn, 1996). Some telomerase-negative Saccharomyces cerevisiae cells survive by a mechanism that closely resembles that in human ALT cells: type II survivors have telomeres with extremely heterogeneous lengths (Lundblad and Blackburn, 1993; Teng and Zakian, 1999). The type II mechanism in yeast and ALT in human cells both involve recombination (Teng et al., 2000; Dunham et al., 2000). The data presented here however, suggest that the ALT mechanism in human cells may differ somewhat from that in yeast. In yeast type II survivors, telomere lengthening only occurs on very short telomeres (Teng et al., 2000), and it has been shown that reconstitution of telomerase activity in S. cerevisiae inhibits this ALT-like mechanism and returns the telomeres to wild type lengths over a number of PDs (Teng and Zakian, 1999). In GM847/hTERT cells, however, the hallmarks of ALT activity persist even when the shortest telomeres have been lengthened by telomerase. The data presented here provide further insights into the regulation of telomerase and ALT, and also suggest some possible differences between ALT in human cells and the mechanism in yeast type II survivors. In view of the current interest in developing anti-cancer therapeutics directed against telomerase, it will be of particular interest to determine whether ALT and telomerase sometimes co-exist in individual tumour cells. An understanding of the mechanisms whereby ALT is normally repressed may also identify useful therapeutic targets.

5-20 6. Chapter Six

Evidence for repression of ALT by expression of a dominant-negative telomerase catalytic subunit

6. Chapter Six...... 6-1 6.1 Introduction...... 6-2 6.2 Evidence of an ALT-repressed phenotype in clones of GM847 cells expressing a dominant- negative hTERT...... 6-3 6.3 Conclusions...... 6-6

6-1 Evidence for repression of ALT by expression of a dominant-negative telomerase catalytic subunit

6.1 Introduction

The putative repressor(s) of ALT present in telomerase-positive cells (Chapter 4) was shown not to be telomerase (Chapter 5). Additional factors which form part of the telomerase holoenzyme complex or that interact with the telomeres themselves could well be involved in this repression and are under investigation in this laboratory. Inhibitors of telomerase, via dominant- negative activity, have already been characterised. These dominant-negative inhibitors are mutants of hTERT (dn hTERT) and have base changes in key aspartate residues in the catalytic domain of the enzyme. It had been previously reported that an aspartate mutation (D530) in yeast TERT completely abrogates telomerase activity (Counter et al., 1997; Lingner et al., 1997). A number of dominant-negative hTERT mutants have now been described (Harrington et al., 1997a; Zhang et al., 1999; Hahn et al., 1999b) and one such construct, dn hTERT 3-1, was recently obtained from Dr. Murray Robinson, Amgen Corporation, for further studies in this laboratory. This mutant has a single base change in aspartate 712, (D712A), inhibits telomerase activity in the TRAP assay (Harrington et al., 1997a) and causes telomere erosion and either apoptosis (Zhang et al., 1999) or senescence (Colgin et al., 2000)(Chapter 4, section 4.3) in different telomerase- positive tumour derived and immortalised cell lines. The exact molecular mechanisms involved in this dominant-negative activity are not currently known. It is possible that, due to the use of a strong heterologous promoter and consequent over expression, the much higher levels of the dn hTERT protein sequester necessary components required for telomerase activity. Another study has reported growth inhibition, telomere shortening and eventual apoptosis in a range of tumour derived cell lines expressing another dn hTERT species that has two aspartate residue changes (D710A, D711I) (Hahn et al., 1999b). In that study it was reported that there was no effect of this mutant on the growth or telomere lengths of GM847 cells. An additional study was undertaken with the dn hTERT 3-1 construct to further examine any possible effects of a dn hTERT in GM847 cells and assess whether a different mutant might have a different effect upon ALT.

6-2 6.2 Evidence of an ALT-repressed phenotype in clones of GM847 cells expressing a dominant-negative hTERT

Ten clones of GM847 were established by stable expression of dn hTERT 3-1 and these cells (designated GMDN) were expanded sufficiently to enable genomic DNA extraction and subsequent TRF analysis. A striking result was that the telomere lengths of three clones, GMDN 2, 10 and 13, were significantly reduced (Figure 6-1) and resembled the ALT repressed phenotype described previously in somatic cell hybrids (see Figures 3-3, 3-4 and 4-3). The remaining clones had a characteristic ALT telomere phenotype (Figure 6-1). Three clones were passaged further, including two clones that had shortened telomeres (GMDN 10 and 13) to determine whether telomere shortening would continue and induce growth arrest. Surprisingly, the telomeres of GMDN 10 and 13 had lengthened dramatically over a short number of cell divisions and returned to the ALT telomere length phenotype. There were no growth effects in any of the clones, including those that had shortened telomeres. APBs were still detectable in clones that had undergone telomere loss at an expected frequency (~1%) (data not shown) but any effects of dn hTERT 3-1 on APBs could be masked by the presence of ALT revertants. The TRF analysis suggested that dn hTERT 3-1 has a inhibitory impact on ALT in GM847 and that the lack of inhibition in most clones, and the reversion to ALT in clones GMDN 10 and 13, may have been due to selective deletion or rearrangement of the plasmid. The vector system being utilised, pIRESneo (Clontech), however, is designed so that the gene of interest (in this case dn hTERT) and the selectable marker (neomycin resistance) are translated from the same transcript, which greatly lowers the probability of deletion or mutation of the insert but retention of antibiotic resistance; all GMDN cultures were continuously maintained in selection medium. To test for this possibility however, a series of RT-PCR reactions was performed utilising a nested primer pair for hTERT, HT2026F/HT2428R, under conditions previously described (Kilian et al., 1997; Colgin et al., 2000). These primers cannot distinguish between hTERT and dn hTERT 3-1 but there is no hTERT detectable in GM847 cells by RT-PCR with other nested primers for hTERT (Kilian et al., 1997) or with the HT2026F/HT2428R primers under the same conditions (L.Colgin et al. unpublished data). Interestingly, all of the GMDN clones, including GMDN 10 and 13 at later PDs, showed expression of dn hTERT 3-1 with a product of the expected size obtained in each case (Figure 6-2). RNase treatment of samples prior to reverse transcription resulted in no detectable band, which indicated that the PCR product was not amplified from contaminating genomic DNA (Figure 6-2).

6-3 GM847/ dn hTERT clones

GM847 parental 1 2 3 5 6 6 8 10 10 11 12 13 13

kb 48 33

12 8

population doublings 22 22 22 22 22 31 22 22 31 22 22 22 28

6-4 GM847/dn hTERT clones RNase control bp 3 5 6 6 10 10 12 13 + A R B R 900 692 501 404 320 population 23 23 25 51 25 51 23 40 doublings

6-5 These findings indicated that inhibition and eventual reversion to the ALT phenotype in these clones may be due to loss of a factor which is essential for repression of ALT by dn hTERT 3-1, and not plasmid rearrangement. Another possibility is that the cells acquired resistance to the inhibitory effects of dn hTERT 3-1 via increased expression of a telomere associated factor. Studies are ongoing in this laboratory to ascertain the expression levels of different telomere binding proteins in the revertant GMDN clones.

6.3 Conclusions

The data presented here are in contrast with previous findings that dominant-negative hTERT activity has no effect on the telomeres of GM847 cells (Hahn et al., 1999b) but in agreement with that same study which reported no growth inhibitory effects of dn hTERT in GM847 cells (Hahn et al., 1999b). A different dn hTERT species was used in this study, however, and these base change differences may have significance in understanding the interplay between telomerase and ALT and the repression of both mechanisms. Alternatively, the effect of this dn hTERT species may have been masked by revertants arising in the populations of transfected cells at an early timepoint. Clonal variation is an unlikely explanation for the telomere shortening in Figure 6-1 as 10/10 GM847 untransfected subclones, generated by limiting dilution (plating cells at low density and isolating individual colonies), do not show this phenotype (for representative examples, see Figure 5-5). In addition, the telomere loss is not maintained in clones GMDN 10 and GMDN 13 which indicates that they are not persistent clonal variants in a GM847 cell population. Interestingly, there was no growth arrest in any of the clones which was in clear contrast to the ALT repressed somatic cell hybrids of GM847 and telomerase-positive cells transfected with the same plasmid (LDN and KDN clones; Chapter 4). It is possible that ALT may be only partially inhibited and that cells with shortened telomeres can still divide as no obvious lag time was observed between the two timepoints analysed for GMDN 10 and GMDN 13, during which time these cells reverted to ALT. GM847 cells can obviously still express dn hTERT 3-1 (Figure 6-2) and retain ALT activity so it is also possible that clonal variants exist in which ALT cells can somehow bypass any inhibitory effects of dn hTERT 3-1. This may also be the case for the GM847 cells expressing the dn hTERT species reported previously (Hahn et al., 1999b) These data are not therefore necessarily inconsistent with the interpretation that induction of senescence in KDN and LDN clones by dn hTERT 3-1 is additional evidence of ALT repression in these hybrids (Chapter 4). The findings presented here suggest the possibility that both telomerase and ALT can be inhibited by a similar mechanism, via dn hTERT 3-1. This has implications for our understanding

6-6 of the relationship between the two pathways as it suggests that essential factors are required for both telomere maintenance mechanisms. GM847 cells contain all of the necessary components for actual telomere lengthening by an exogenously expressed hTERT (Chapter 5). Recent studies in this laboratory have shown that SV40 immortalised fibroblasts, that have the same clonal origin, contain a mixture of ALT and telomerase-positive cells (P. Bonnefin et al. unpublished data). This is consistent with the concept that the pathways that activate telomerase and ALT may have many steps in common and that there are common factors essential for both telomerase and ALT activity. The mode of action of dn hTERT 3-1 may therefore be targeting of an essential component of telomere maintenance that is shared by telomerase and ALT. Such factors may include telomere binding proteins such as TRF1 and TRF2 which have central roles in control of telomere length (see section 1.1.2). Because telomere binding proteins and associated factors are present also in normal cells, experiments are underway to test the effects of dn hTERT 3-1 in different normal cell types. Examination of dn hTERT 3-1 expression in other ALT cell lines is also underway in the laboratory as it will be important to determine whether the effects in GM847 cells are characteristic of other cell types that utilise ALT. Elucidation of the exact inhibitory mechanism(s) of dn hTERT 3-1 and other dn hTERT variants will be very useful in contributing to our understanding of telomere maintenance.

6-7 7. Chapter Seven

Investigation of the chromosomal localisation of putative ALT repressor(s)

7. Chapter Seven ...... 7-1 7.1 Introduction...... 7-2 7.2 Analysis of ALT repression by chromosome transfer into GM847 cells...... 7-2 7.3 Analysis of ALT repression by chromosome transfer into GM847/hTERT cells ...... 7-8 7.4 Inhibition of telomerase and reversion to ALT in GM847/hTERT cells ...... 7-11 7.5 Conclusions...... 7-16

7-1 Investigation of the chromosomal localisation of putative ALT repressor(s)

7.1 Introduction

Previous studies have detected the presence of senescence genes on specific chromosomes by microcell mediated chromosome transfer (MMCT) into immortalised human cell lines. A putative repressor of telomerase activity has been localised to chromosome 3, and causes growth arrest and senescence following MMCT into a number of tumour cells and tumour derived cell lines (Ohmura et al., 1995; Oshimura and Barrett, 1997; Horikawa et al., 1998; Tanaka et al., 1998; Cuthbert et al., 1999). Chromosome 7 contains genes that cause senescence in cell lines assigned to immortalisation complementation group D (Ogata et al., 1993; Ogata et al., 1995) and it has been subsequently demonstrated in a group D ALT cell line, SUSM-1, that this proliferation arrest correlated with telomere loss and hence ALT repression (Nakabayashi et al., 1997). Interestingly, it has also been shown that chromosome 7 can cause senescence by inhibiting telomerase activity (Nakabayashi et al., 1999). ALT cell lines have been assigned to two complementation groups (A and D) (Whitaker et al., 1995) and it thus seemed unlikely that chromosome 7 would repress ALT in the SV40 immortalised fibroblast cell line GM847, which has been assigned to group A (Pereira-Smith and Smith, 1988). It has been reported that a gene localised to chromosome 6q causes senescence in a range of SV40 immortalised fibroblasts (Sandhu et al., 1994; Banga et al., 1997; Kim et al., 1998) although this had not been demonstrated specifically for GM847 cells. An important consideration in identifying and characterising the putative repressors of ALT that are present in both normal and telomerase-positive immortal cells (Chapters 3 & 4) is their chromosomal localisation. Based on these previous reports, human chromosomes 6 & 7 were introduced into GM847 cells. Hybrid clones were then subjected to telomere length and growth analysis to test for ALT repression. These MMCT experiments were performed in collaboration with Prof. Rob Newbold and Dr. Andrew Cuthbert at Brunel University, Uxbridge, UK.

7.2 Analysis of ALT repression by chromosome transfer into GM847 cells

To minimise any effects of clonal variation in ploidy, GM847 subclones generated by limiting dilution were analysed and a non-tetraploid clone, designated GM-1, was chosen for the MMCT experiments. Fusions were performed at Brunel University as described (Chapter 2) using mouse A9: human monochromosome hybrid donor cells for chromosomes 6 (H6) and 7 (H7).

7-2 The donor chromosomes contain an integrated HyTK plasmid which confers hygromycin B (hyg) resistance to the recipient cells (Lupton et al., 1991). The monochromosomal hybrid panel from which the H6 and H7 donors were obtained has been characterised and described previously (Cuthbert et al., 1995). Fused cultures, including controls, were expanded in DME medium without selection until they reached confluence in a 75 cm2 flask and subsequently passaged 1:12 into 10 cm dishes. Selection medium was added to each dish after 48 hours (DME/ 400µg/ml hyg) and resulting colonies were picked after 21 days. 24 MMCT clones were isolated into 24 well dishes for each fusion experiment (GM847/H6 and GM847/H7) and expanded by passaging continuously in selection medium. Selection was carried out at both Brunel University and at this laboratory in which all subsequent analyses were performed. Control dishes were grown in selection medium concurrently and no surviving cells were detectable after one month. There were significant differences in the survival rate of the H6 and H7 clones following isolation into 24 well plates (Table 7-1). Both sets of clones were treated and handled identically, but whereas 20/24 GM847/H7 clones were expanded into 75 cm2 flasks, only 12/24 GM847/H6 clones grew to that PD level. Six GM847/H6 clones that ceased dividing had morphological characteristics similar to senescence and a further three appeared necrotic with the remaining three clones failing to plate down. Of the four GM847/H7 clones that did not survive three did not plate down and one clone appeared necrotic. Clones of GM847/H6 that did not proliferate further eventually died after 2-3 weeks in culture. Metaphase chromosome spreads and genomic DNA were made from the proliferating GM847/H6 and GM847/H7 clones at PD 24 and used to test for the presence of the introduced chromosome and for telomere analysis.

TABLE 7-1. Survival rate of clones isolated from GM847/H6 and GM847/H7 chromosome transfer experimentsa

Continued Appeared Did not attach Clones dividing to Senescent (%) necrotic (%) (%) PD 24 (%) GM847/H6 (24 total) 12 (50) 6 (25) 3 (12.5) 3 (12.5)

GM847/H7 (24 total) 20 (83) 0 (0) 1 (4) 3 (12.5) aall clones were isolated in an identical manner under hygromycin B selection

The GM847/H6 and GM847/H7 clones were analysed by chromosome painting for the respective transferred chromosome to test whether the fusions had been successful. Representative examples are shown in Figure 7-1 and indicate that the MMCT clones from each

7-3 experiment contain the introduced chromosome. There were no obvious growth effects or any indication of growth arrest in any of the clones and TRF analysis showed no inhibition of ALT (Figure 7-2). There was some variation in the signal intensities, particularly in GM847/H7 clones IIa and IIIc, but this is consistent with clonal variation previously seen in GM847 cells (data not shown) and is not due to uneven sample loading (Figure 7-2). Interestingly, however, in all of the GM847/H6 clones examined there were obvious deletions in the q arm of the introduced chromosome 6 and a representative example is shown in Figure 7-3. It is noteworthy that although there are three copies of chromosome 6 in the GM847 parental complement, only one copy appears to have no obvious deletions in 6q, thus appearing to be full length (Figure 7-3), although there may be microdeletions that are not detectable cytogenetically. There were no obvious deletions in the donor chromosome 6 in the A9 donor line (data not shown) and therefore the 6q truncation of the donor chromosome has occurred during or subsequent to the transfer into GM847 cells. There were no deletions detectable in the introduced chromosome 7 at the cytogenetic level. This suggested the possibility that chromosome 6q deletions conferred a selective growth advantage for GM847/H6 clones and that the large number of growth arrested colonies from the H6 fusions were due to genes present on 6q. This was consistent with the finding that a senescence gene that causes proliferation arrest in SV40 immortalised fibroblasts localises to 6q26-27, although it was not demonstrated that this was due to repression of a telomere maintenance mechanism such as ALT (Banga et al., 1997) . Repression of ALT by MMCT of chromosome 7 that was reported for SUSM-1 cells (Nakabayashi et al., 1997) was not seen in GM847 cells. The greater number of surviving GM847/H7 clones as compared to GM847/H6 and the lack of detectable deletions in the introduced chromosome 7 also suggest that the ALT pathway in GM847 cells is unaffected by the factors that suppress ALT in SUSM-1 cells. This is consistent with the fact that these cell lines have been assigned to different complementation groups (Whitaker et al., 1995) and raises the possibility that there are different and independently regulated pathways to activation/inactivation of ALT.

7-4 a b

cd

e f

7-5 GM847/H6 clones GM847/H7 clones Ia Id Ie IIIa IVa Va Vc Vd P Ia IIa IIe IIIe IVc VIa IIb IIId

kb 48 29 19 12

8

*

7-6 GM847/chromosome 6 microcell hybrid clone

GM847parental chromosome 6 complement

Introduced chromosome 6

7-7

7.3 Analysis of ALT repression by chromosome transfer into GM847/hTERT cells

The chromosome 6q deletions in GM847/H6 cells suggested the possibility that an ALT repressor was localised to this region and this provided a growth disadvantage to clones that maintained a full length donor chromosome 6. Because of the potential selective pressure for chromosome 6 deletions in GM847 cells that would result, the MMCT experiments were repeated with GM847/hTERT-3 cells (referred to here as GM/hTERT) generated previously (Chapter 5). It was postulated that telomere maintenance by telomerase in these cells would allow ALT-repressed MMCT clones to be obtained as there would be no concomitant growth arrest. In addition to chromosome 7, chromosome 8 was included as a further control that has not been shown to cause senescence in group A cell lines. Three sets of MMCT clones (GM/hTERT-H6, -H7, or-H8) were isolated by dual selection in DME/ hyg (400µg/ml)/ Geneticin (200 µg/ml) and treated exactly as described in Section 7.2. Twenty-four colonies were isolated from each of the GM/hTERT-H6 and GM/hTERT-H7 fusions and a further ten clones were derived from the GM/hTERT-H8 experiment. There were fewer survivors once again for the chromosome 6 MMCT clones with only 12/24 GM/hTERT-H6 clones undergoing sufficient cell divisions for telomere analysis (PD 22). In each case these cells that did not survive were necrotic, or did not plate down after cloning. There were 19/24 GM/hTERT-H7 and 8/10 GM/hTERT-H8 clones that reached PD levels of PD 22-24. All clones were maintained in DME/hyg/Geneticin. There was no growth arrest evident in any clone from the three experiments that could be passaged continuously up to a 75 cm2 flask. . A number of these clones were analysed by chromosome painting and in each case the donor chromosome had been successfully transferred (data not shown). TRF analysis of GM/hTERT-H6 clones revealed that most had a GM847/hTERT telomere phenotype in which the short telomeres had been lengthened (Figure 7-4). Four clones however (C2, E3, F3 and F4) had a distinct TRF pattern in which there was significant loss of long telomeres and overall shortening of telomeres were evident (Figure 7-4). This pattern was indicative of ALT repression (see Figures 3-3, 3-4, 3-6 and 4-3) caused by chromosome 6 although deletions were still evident in the q arm of the donor chromosome in each GM/hTERT-H6 clone (data not shown). GM/hTERT-H6 clones C4 and C5 showed clear evidence of telomere shortening also but their TRF pattern was more characteristic of the parental cells. There may have been repression of ALT in these clones followed by outgrowth of revertants at the timepoints analysed in Figure 7-4. Telomere FISH analysis of the GM/hTERT-H6 clones revealed that a significant number of chromosomes had undetectable telomeres, and very few long telomeres were evident, in clones E3, F3 and F4 (Figure 7-5c, e and f). GM/hTERT-H6 clones C4, D1

7-8 GM847 /hTERT-3 GM/hTERT-H6 clones p8 p16 p22 A1 B1 C2 C4 C5 D1 E1 E3 F2 F3 F4

kb 48 33

12 8

7-9 a b c

d e f

7-10 and F2 had detectable telomeres at each chromosome (Figure 7-5a, b and d). This was consistent with the TRF data for these cells (Figure 7-4). It is noteworthy, however, that APBs were detectable by FISH in 1-5% of nuclei in all of the H6 clones in this experiment indicating that ALT was not fully repressed in clones C2, E3, F3 and F4 (data not shown). TRF analysis of GM/hTERT-H7 clones (Figure 7-6) and GM/hTERT-H8 clones (Figure 7-7) showed phenotypes characteristic of subclones of GM847/hTERT-3 (see Figure 5-4). One exception was GM/hTERT-H7 clone D3 (Figure 7-6) which had low molecular weight telomeres. The reduction in hybridisation intensity and loss of long telomeres evidenced in 4/12 GM/hTERT- H6 clones is therefore unlikely to be due to clonal variation as there were no such clones obtained by limiting dilution of GM847/hTERT-3 cells (see Figure 5-4) and only one evident out of 29 clones generated by MMCT of chromosomes 7 and 8 into the same cells.

7.4 Inhibition of telomerase and reversion to ALT in GM847/hTERT cells

The high proportion of surviving GM/hTERT-H6 clones demonstrating a loss of long telomeres suggested a repressive effect of chromosome 6 MMCT on ALT. The GM/hTERT MMCT clones from the three separate experiments were assayed by TRAP to determine whether telomerase was still active. Each GM/hTERT-H7 and H8 clone that was tested was positive for telomerase activity (data not shown) which was consistent with the fact that almost all of these clones had TRF phenotypes that showed lengthening of short telomeres, characteristic of the parental GM847/hTERT-3 cells. GM/hTERT-H7 clone D3 which had a different TRF phenotype to all of the other GM/hTERT-H7 clones (Figure 7-6) was also telomerase-positive (data not shown). Interestingly, however, each of the GM/hTERT-H6 clones that showed a distinct loss of long telomeres (Figure 7-4) had very weak to negative telomerase activity in the TRAP assay (Figure 7-8). This included GM/hTERT-H6 clone B2, a slower growing clone for which DNA was unavailable for earlier TRF analysis. All other GM/hTERT-H6 clones were telomerase- positive (Figure 7-8) including clone E1 (not shown). The GM/hTERT-H6 clones were passaged further to determine if the downregulation of telomerase and the apparent repression of ALT would result in growth retardation or arrest in comparison to clones that were telomerase-positive. TRF analysis at later timepoints for each clone revealed that telomerase-positive clones A1, B1, C4, C5, D1, E1 and F2 maintained a telomere length phenotype characteristic of GM847 cells that express hTERT, in which the shortest telomeres have been lengthened and the long telomeres persist (Figure 7-9). There also appeared to be further lengthening of telomeres in the telomerase-positive GM/hTERT-H6 clones (Figure 7-9). Telomere lengthening was evident also however in clones B2, C2, E3, F3

7-11 GM/hTERT-H7 clones P A2 A3 B2 C1 C2 C5 D1 D2 D3 D4 D5 D6 E1 E2 E3 F1 F2 F4 F5

kb 48

33

12

8

7-12 GM/hTERT-H8 clones 2 3 4 6 7 8 11 12 A B

kb 48 38

12

8

7-13 GM/hTERT-H6 clones A1 B1 B2 C2 C4 C5 D1 E3 F2 F3 F4

7-14 A1 B1 B2 C2 C4 C5 D1 E1 E3 F2 F3 F4 P 24 40 24 40 28 36 24 38 24 41 24 41 24 39 24 40 24 36 24 40 24 34 24 36 Population doublings

kb 48

29

12

8

7-15 and F4 that had significant repression of telomerase activity and the telomeres in these clones had a more characteristic ALT phenotype at the later PDs (Figure 7-9). Four clones (D1, E3, F3 and F4) were passaged for another 20-25 PDs and TRF analysis of clones E3, F3 and F4 at the latest PD indicated heterogeneous telomere lengths characteristic of ALT (Figure 7-10). Clone D1, in which telomerase was not repressed, maintained telomere lengths that were characteristic of GM847/hTERT cells (Figure 7-10). Inhibition of telomerase activity in GM/hTERT-H6 clones therefore correlated with reversion to an ALT telomere length phenotype at later PD levels. This effect was not simply due to clonal variation within the parental cells as none of the GM/hTERT-H7 or H8 clones exhibited inhibition of telomerase. This was true also of subclones of the GM847/hTERT-3 parental cells which were all telomerase-positive (see Figure 5-3).

7.5 Conclusions

It was postulated that introduction of chromosome 6 by MMCT into GM847 cells may have a growth effect as it had been shown that gene(s) existed on 6q that caused senescence in other SV40 immortalised fibroblasts (Banga et al., 1997; Ozer et al., 1996), reviewed in (Ozer, 2000). In two separate fusion experiments there were fewer viable clones of GM847 obtained following MMCT of chromosome 6 (H6) than chromosome 7 (H7). Surviving H6 clones of GM847 cells were not ALT repressed but had detectable deletions in the q arm of the donor chromosome, suggesting a selective growth advantage for cells with such deletions. It has been previously reported that karyotypic changes involving 6q are evident in post crisis (immortal) SV40 immortalised fibroblasts when compared to matched sets of pre crisis (preimmortal) cells (Hoffschir et al., 1992; Hubbard-Smith et al., 1992; Ray and Kraemer, 1992). Thus MMCT of chromosome 6 did appear to have an anti-proliferative effect in GM847 cells. H7 clones did not show any growth arrest or repression of ALT. This was in contrast to the ALT cell line SUSM-1 which underwent growth arrest and which had evidence of ALT repression upon MMCT of chromosome 7 (Nakabayashi et al., 1997). Because repression of ALT did not occur following chromosome 7 transfer into GM847, and there appeared to be no chromosomal rearrangements, this suggested separately regulated pathways to ALT activation in these two cell lines which is consistent with their assignment to different complementation groups (Whitaker et al., 1995). Although the data presented here strongly suggested that chromosome 6, particularly genes on 6q, caused growth arrest in GM847 cells it was not possible to assess whether this was due to repression of ALT as any non dividing clones did not undergo sufficient PDs to extract

7-16 GM847/hTERT-3 H6 clones D1E3 F3 F4 population 24 39 62 24 36 59 24 34 57 24 36 59 doublings

kb 48 33

12 8

7-17 genomic DNA. GM847/hTERT cells were used in a further experiment to provide an additional telomere maintenance mechanism such that ALT repressed clones resulting from H6 MMCT could continue to divide. The presence of telomerase did not prevent 12/24 H6 clones from failing to expand in culture, however (Table 7-1). Five of 12 surviving hybrid clones had telomere phenotypes characteristic of ALT repression (Figure 7-4), although it did not result in loss of APBs which had been seen previously in ALT repressed somatic cell hybrids (Chapter 4). In addition there were still 6q deletions on the donor chromosome in all of the GM/hTERT-H6 clones. Interestingly, the ALT repressed phenotype in GM/hTERT-H6 cells correlated with downregulation of telomerase activity (Figure 7-8) and this resulted in these clones reverting to a characteristic ALT telomere phenotype at later PDs (Figure 7-10). This phenotype was not evident in the corresponding H7 or H8 clones or in subclones of the parental GM847/hTERT-3 cells (Chapter 5). The only exception was GM/hTERT-H7 clone D3 which did show loss of telomeres but was not telomerase inhibited. It is possible that this clone is simply a rare variant but an intriguing possibility is that the introduced chromosome does repress ALT but has been deleted in most clones. It would be necessary to generate many more clones of this type to fully determine whether the effect was due to chromosome 7. The appearance of an ALT telomere phenotype at later passages in telomerase inhibited GM/hTERT-H6 clones (Figure 7-10) suggests that revertant cells, possessing a growth advantage due to reactivation of ALT, have emerged from these cultures. This finding provides further evidence that ALT was indeed repressed in these clones by the transfer of chromosome 6 as the TRF phenotype, indicating telomere loss, is not maintained which would not be expected if these cells were simply clonal variants. It is likely therefore that deletions of the donor chromosome 6, resulting in loss of the putative ALT repressor(s), have occurred in the revertant cells. The lack of apparent growth inhibition in any of the ALT repressed GM/hTERT-H6 cultures at earlier timepoints may have been due to partial repression of ALT, which caused the cells to grow at only a marginally slower rate and did not result in sufficient telomere loss to induce growth arrest. The presence of APBs, at parental GM847 levels, in these cells at the earlier timepoints suggests that ALT is indeed still active despite detectable telomere loss. Inhibition of telomerase in GM/hTERT-H6 clones suggests that telomerase is also inhibited by chromosome 6 which has not been reported previously. Repression of ALT in GM847 cells by expression of a dominant-negative hTERT (Chapter 6) suggests that common factors may be required for both mechanisms and it is therefore possible that a common repressor may exist. Consistent with this possibility is the fact that chromosome 7 had been found to

7-18 suppress both telomerase (Nakabayashi et al., 1999) and ALT (Nakabayashi et al., 1997) but it did not have an effect on exogenous telomerase in the GM/hTERT-H7 clones. To determine if repressors of telomerase do exist on chromosome 6 it will be necessary to generate many more clones by MMCT using different cell lines. This will also be required to determine the minimal region of 6q that may be involved in ALT repression. Previous reports have identified a number of regions of 6q that cause senescence in a variety of immortalised cells and tumour cells (reviewed in Ozer, 2000) and it will be necessary to determine if the growth inhibitory effects described correlate with ALT repression or telomerase repression in different cell types. Studies in this laboratory are underway to examine whether expression of known genes that localise to the q arm of chromosome 6 and also to chromosome 7 will repress ALT in a variety of cell types. The chromosomal localisation has been determined for most of the known components of telomerase and also telomere binding proteins in human cells but none of these factors is expressed from either chromosome 6 or 7 (Table 7-2). Other factors may well be involved that are unrelated to telomeres or the telomerase holoenzyme and further experiments in this laboratory are currently being designed to both characterise the region(s) of chromosome 6 that are responsible for ALT repression and identify the gene(s) involved. Elucidation of genes involved in ALT activation/inactivation will be important in our understanding of the mechanism of ALT and will facilitate the development of inhibitors of ALT for possible future cancer therapies.

7-19

TABLE 7-2. Chromosomal localisation of human telomerase components and telomere binding proteins.a

Telomerase associated proteins Chromosomal localisation hTERT 5p15.33 hTER 3q21-q28 TEP1 14q11.2 Hsp90 1q21.2 ,4q35, 11p14.1, 14q32.3 (family) p23 NDb dyskerin Xq27-q28 hSTAU 20q13.1 L22 3q26 Telomere binding proteins and associated factors hTRF1 8q13 hTRF2 16q22.1 hRap1p NDb Ku 70 22q13.1-q13.31 Ku 80 2q35 Tankyrase 8q TIN2 NDb adata obtained from The Genome Database (gdbwww.gdb.org) bnot determined

7-20 8. Chapter Eight

Structural and sequencing analysis of terminal fragments of ALT cells

8. Chapter Eight...... 8-1 8.1 Introduction ...... 8-2 8.2 ALT telomere length heterogeneity is detectable with G- and C- strand probes under denaturing conditions ...... 8-3 8.3 Presence of alternative G-rich repeats at the telomeres of a subset of both ALT and telomerase-positive cells ...... 8-6 8.4 Cloning and sequencing of fragments containing telomeric repeats from WI38 VA13/2RA cells...... 8-9 8.5 Conclusions ...... 8-15

8-1 Structural and sequencing analysis of terminal fragments of ALT cells

8.1 Introduction

Some important questions regarding the nature of ALT concern both structural aspects of the telomeres and the telomeric repeat sequences in ALT cells. It has been shown in studies from this laboratory that TTAGGG hybridisation intensity increases significantly with the onset of immortalisation in cells that utilise ALT (Bryan et al., 1995). This increase is associated with the appearance of telomere length heterogeneity and suggests that the majority of the repeats in ALT telomeres are indeed TTAGGG (Bryan et al., 1995). This telomere length heterogeneity characterised by ALT however causes resolution problems for the very long telomeres using standard agarose electrophoresis such that the majority of the terminal restriction fragments quickly reach their limit of mobility, leaving most of the TTAGGG hybridisation signal above the 23 kb size marker (Bryan et al., 1995; Bryan et al., 1997b)(see also Figure 8-4, lanes 3, 13 and 15). Pulsed field gel electrophoresis enabled many of these large fragments to be resolved but the TTAGGG signal obtained still indicated that a proportion of the ALT telomeres were too large to be electrophoresed under the conditions used, resulting in a smear running to the very top of the gel (Bryan et al., 1995; Perrem et al., 1999). Although the simplest explanation of these findings was that a proportion of ALT telomeres consisted of very long (>100 kb) stretches of pure TTAGGG repeats there were possible caveats to this interpretation that were not precluded by the preliminary TRF data. Resolution limits may have been caused by ALT telomere secondary structure that was not disrupted by either genomic DNA extraction procedures or subsequent digestion and electrophoresis. This would have the potential to cause an overestimation of the telomere size range although the hybridisation signal detected by telomere FISH analysis of ALT cells, such as GM847 (see Figure 5-6), was consistent with the TRF length heterogeneity evidenced by Southern analysis. If there are degenerate G-rich repeats interspersed within the TTAGGG repeats these would not be detectable by Southern or FISH analysis with standard telomere probes and could therefore not be excluded either by the early analyses. In direct support of the hypothesis that some ALT telomeres did contain alternative repeat sequences was the finding that the heterogeneous TRF signal from some, but not all, ALT cells could be digested with restriction enzymes Hph1 and Mnl1 (Bryan, TM "An alternative mechanism for telomere lengthening in immortal human cells", PhD thesis, University of Sydney, 1997). These enzymes are non-palindromic cutters that will recognise TGAGGG repeats which are present in the subtelomeric regions of most human chromosomes (Allshire et al., 1989).

8-2 To further analyse ALT telomere structure a series of TRF analyses was undertaken using denaturing alkaline gel electrophoresis to disrupt any possible secondary structures that may exist. Hybridisation was carried out using telomeric probes for both the G-strand and the C-strand and samples were also pre-treated by exonuclease activity to determine whether there were any significant single strand overhangs. In addition, an experiment was designed to clone and sequence the telomeres of the SV40 immortalised fibroblast ALT cell line WI38 VA13/2RA (VA13). The TRF signal of VA13 cells is severely reduced upon digestion with Hph1 and Mnl1 and a series of partial digests were done using Mnl1 to generate telomeric fragments of a size that could be cloned into a plasmid vector for sequencing.

8.2 ALT telomere length heterogeneity is detectable with G- and C- strand probes under denaturing conditions

To assess whether the resolution, and resulting molecular size estimation, of terminal restriction fragments from ALT cells would differ under denaturing conditions, a number of ALT cell telomeres were analysed using alkaline gel electrophoresis. Each series of samples was electrophoresed in duplicate gels which were subsequently hybridised to either a (TTAGGG)3 or a

(CCCTAA)3 radiolabelled oligonucleotide. This was done to detect possible differences between G-strand and C-strand lengths in ALT telomeres. It has been shown that mammalian telomeres contain G-rich overhangs of at least 45 bases (McElligott and Wellinger, 1997) and that this facilitates the formation of telomeric loop structures that are implicated in the protective function of telomeres (Griffith et al., 1999), but it had not been determined whether such overhangs would be greatly enhanced in the hyper- lengthened telomeres of ALT cells. A number of ALT cell types (in vitro immortalised and tumour derived) were initially tested by denaturing TRF analysis and this resulted in a hybridisation pattern extending up to the top of the gel for both telomere strands (Figures 8-1 and 8-2). This hybridisation pattern differed from non-denaturing agarose TRF gels in that a large signal due to mobility limits was no longer detectable at the 23 kb size marker. The denaturing TRF result however confirmed that ALT telomere lengths were extremely heterogeneous. Because of the TRF results on alkaline gels this heterogeneity was shown not to have been due to secondary structure and therefore the previous interpretation that ALT telomeres range in length from very long to very short is correct. The hybridisation signal and intensity detected for the G-strand (Figures 8-1a and 8-2a) and C-strand (Figures 8-1b and 8-2b) were virtually indistinguishable. There was no evidence from these denaturing TRFs that extensive G-rich overhangs existed which would have resulted

8-3 ab SUSM-1 BET-3M SUSM-1 BET-3M

kb kb 23 23

9.4 9.4

6.5 6.5

4.3 4.3

2.3 2.3 2 2

8-4 a Saos-2 G292 SK-LU-1 VA13/2RA WI38 U-2 OS b Saos-2 G292 SK-LU-1 VA13/2RA WI38 U-2 OS

kb kb 23 23

9.4 9.4

6.5 6.5

4.3 4.3

2.3 2.3 2 2

8-5 in an increase in signal intensity and molecular size differences when probing with CCCTAA oligos. To examine this question further, digested DNA (1µg) from three additional ALT cell lines was incubated with T4 DNA polymerase (Roche) in the presence of excess dNTPs to induce the 3'-5' exonuclease activity of the enzyme. This treatment did not alter the result, however, as when each sample was compared by denaturing TRF analyses, no differences were evident (Figure 8-3). This result did not preclude the existence of small overhangs in ALT cells, comparable in size to other mammalian cell types, that could not be detected under the electrophoresis conditions used.

8.3 Presence of alternative G-rich repeats at the telomeres of a subset of both ALT and telomerase-positive cells

As mentioned in section 8.1, it has previously been shown that a number of ALT cell lines have terminal fragments that are digested by the restriction enzymes Hph1 and Mnl1 (Bryan, TM "An alternative mechanism for telomere lengthening in immortal human cells", PhD thesis, University of Sydney, 1997). These included the SUSM-1 and VA13 cell lines and suggested that TGAGGG repeat sequences, that would be recognised by both enzymes, were interspersed within the TTAGGG tracts. This analysis was extended to a further series of cell types and it was found that a number of telomerase-positive cells had severely reduced TRF signals also, upon Hph1 (New England Biolabs) digestion (Figure 8-4). HeLa cells did have some reduction in terminal fragment size and signal intensity but there was a more dramatic decrease for HT-1080, T24 and 293 cells (Figure 8-4). The ALT cell line GM847 shows only a moderate reduction in signal intensity whereas JFCF-6T/5K ALT cells appear to have an intermediate level of Hph1 digestible terminal fragments when compared to SUSM-1 (Figure 8-4). Ethidium bromide staining of the gel prior to hybridisation indicated that the samples were loaded evenly (not shown). This phenotype is not therefore characteristic of all ALT cells, and even differs between cell lines that have been immortalised in the same manner and assigned to the same complementation group (GM847 and VA13). MRC-5 normal diploid fibroblast DNA shows a slight reduction in TTAGGG signal when digested with Hph1 (Figure 8-4) which is consistent with the presence of alternative G-rich repeats such as TGAGGG in subtelomeric regions that would be included in some fragments generated by Hinf 1/Rsa1 (Roche) digestion. This result was found also for HFF- 5 and WI38 normal fibroblasts (data not shown). It has been shown previously that telomerase cannot generate a TGAGGG repeat tract in the TRAP assay when using SUSM-1 or VA13 lysates but a 6bp ladder could be obtained using a HeLa lysate (Bryan, TM "An alternative mechanism for telomere lengthening in immortal

8-6 GM847 JFCF-6T/5K A13 LA(SV) GM847 JFCF-6T/5K A13 LA(SV) ab- T- T - T - T - T - T kb kb 23 23 9.4 9.4

6.5 6.5

4.3 4.3

2.3 2.3 2 2

8-7 Hela SUSM-1 HT-1080 T24 293 MRC-5 GM847 JFCF-6T/5K thth thth th th th th kb 23 9.4 6.5

4.3

2.3 2

1.3

1.0 0.8

0.6

0.3

8-8 human cells", PhD thesis, University of Sydney, 1997). The existence of such repeats at the telomeres of ALT cells is likely therefore to be dependent on the mechanism that generates the long heterogeneous telomeres and could be explained by recombination mechanisms which have now been shown to be directly involved in ALT in the GM847 cell line (Dunham et al., 2000). An ALT mechanism exists in telomerase-null yeast that involves copying of subtelomeric regions between chromosomes (Lundblad and Blackburn, 1993) and these cells are now known as type I survivors (Teng and Zakian, 1999). Type II survivors have also been described and these cells contain long heterogeneous tracts of yeast telomere repeats but not subtelomeric elements (Lundblad and Blackburn, 1993; Teng and Zakian, 1999). It has not been determined whether such separate mechanisms exist to maintain telomeres in human ALT cells but this may be an explanation for the differences between the telomere repeats in GM847 and VA13 cells. Studies of telomerase-null mouse embryonic stem cells have shown that long term survivors had amplified DNA in the subtelomeric region which was possibly due to recombination (Niida et al., 2000). The existence of TGAGGG repeats at the telomeres of telomerase-positive cells suggests the possibility that the average TTAGGG tract lengths of certain telomerase-positive cells may need to be re-evaluated. An active mechanism, either via telomerase or a low level of copy switching between chromosome ends, that intersperses TGAGGG and possibly other degenerate repeats into the TTAGGG tracts of some telomerase-positive human cells has not previously been described but is an intriguing possibility.

8.4 Cloning and sequencing of fragments containing telomeric repeats from WI38

VA13/2RA cells

An experimental strategy was devised to clone telomeric fragments from the VA13 ALT cell line to determine the exact nature of the repeat sequences, making use of the fact that although TTAGGG tracts cannot be digested by any known restriction enzymes, the terminal fragments of VA13 cells are digestible by Hph1 and Mnl1 (section 8.3). The ends of chromosomes are particularly refractory to cloning, as was discovered in the original experiments that identified TTAGGG as the human telomeric sequence (Moyzis et al., 1988; Moyzis, 1991). Using the Mnl1 enzyme, a series of digestions over a limited timecourse, followed by phenol extraction, was undertaken with VA13 genomic DNA that had already been digested with Hinf1 and Sau3A1 (a 4 base cutter used in place of Rsa1; Roche). As expected, this resulted in a progressive reduction in the TRF hybridisation signal with increased enzyme incubation periods (Figure 8-5). A strategy was then employed to allow these partially digested

8-9

VA13 telomeric fragments to be cloned into standard vectors for sequencing analysis (Figure 8-6). The Mnl1 DNA digests (Figure 8-5) were combined and electrophoresed under standard agarose TRF gel conditions (see section 2.8.3) except that low melting point agarose (Roche) was used. DNA fragments between 4.5-9.0 kb in size were excised from the gel and extracted from the agarose using Gelase (Epicentre Technologies, Madison, WI, USA). This purified DNA was then blunt ended by an end repair reaction (Epicentre Technologies), phenol extracted and ligated to Sma1 (Roche) digested pGEM 3Z (Promega) using a Fast link ligase (Epicentre Technologies), and then used to transform JM109 bacterial cells (Promega). A standard colony hybridisation to a

(TTAGGG)3 radiolabelled probe was used to isolate cloned fragments containing telomeric repeats. Two positive clones were isolated (Figure 8-7) and purified plasmid clones were designated Tel-2 (Figure 8-7b) and Tel-4 (Figure 8-7c). The presence of TTAGGG sequences in plasmids extracted from both clones was confirmed by Southern hybridisation (data not shown). Restriction digests of both Tel-2 and Tel-4 revealed that the inserts were 1-1.5 kb for both clones (not shown) which suggested that plasmid rearrangements had occurred as inserts of this size were excluded by gel purification. Sequencing analysis (via Sp6 and T7 primers which flank the cloning site of pGEM 3Z) confirmed that this was the case as both clones contained pGEM 3Z sequence within the cloned inserts (Figure 8-8). Furthermore, in addition to both pure and degenerate human telomeric repeats (Table 8-1) and pGEM 3Z sequences, there were a number of fragments that aligned to different human genes in both clones (Figure 8-8, Table 8-2) and a large stretch of unknown sequence in clone Tel-2 (Figure 8-8). The presence of non-contiguous gene fragments is of interest as it suggests the possibility that these sequences were incorporated due to multiple recombination events at the telomeres. These data do not, however, exclude the possibility that rearrangements have occurred during the cloning procedure, due to the repeat sequences. It is not yet clear, therefore, whether there is any significance to the association of these sequences with G-rich repeats in these clones, although a sequence that aligns to a number of known genes is present in both Tel-2 and Tel-4 (Figure 8-8, Table 8-2). This finding does not, however, exclude random rearrangements during ligation.

8-10 Digestion period (min) 0 5 10 20 30 kb 23

9.4 6.5

4.3

2.3 2

8-11 VA13 genomic DNA Free terminal fragments

Subtelomeric Telomere fragment repeats Hinf1/Sau3A1 digestion

n tio ges di nl1 l M rtia Pa

Digested telomeric Exclusion of small Gel purification of fragments fragments Fragments 4.5-9 kb

ir pa re nd A e DN Blu nt liga tion

of on ati rm sfo ria pGEM3Z vector an cte Tr ba

Colony hybridisation Selection of positive to TTAGGG probe clones

Figure 8-6

Flow diagram representing the strategy for cloning ALT telomeric sequences from the cell line WI38 VA13/2RA (VA13).

8-12 ab c

8-13

TABLE 8-1. G-rich repeats present in Tel-2 and Tel-4 clonesa

Clone G-rich repeats Tel-2 TTAGGG TTCGGG TTACGGG TTAGGGG TCAGGG TCTGGG

Tel-4 TTAGGG TTGGGG TCGGGG TTAGGGG asequences from Figure 8-8 listed in the G-strand orientation

Preliminary FISH with labelled Tel-2 and Tel-4 plasmid (using protocol described in section 2.10.2) using VA13 metaphase spreads resulted in detectable signals at a number, but not all, chromosome ends (data not shown). These signals were significantly reduced in the presence of excess unlabelled (TTAGGG)3 and were also detectable on different chromosome ends in different metaphases. Although it is likely that these signals are partly due to the TTAGGG/CCCTAA repeats within the Tel-2 and Tel-4 clones, the probes did not hybridise to APBs in interphase nuclei (data not shown). The signals may have been due to degenerate G-rich repeats which are present in subtelomeric regions (Brown et al., 1990; de Lange et al., 1990). Analysis of telomeric sequences and their integration and alignment with the working draft of the human genome has revealed that subtelomeric regions on different chromosomes vary significantly in size (8-300 kb) and many are particularly gene rich (Riethman et al., 2001). The presence of identical gene sequences at the ends of different chromosomes in different ALT metaphase spreads would be consistent with a role for subtelomeric regions in a recombination based generation of ALT telomeres, but these analyses are at a very preliminary stage. Further analysis of specific segments from these clones, including those that match known genes, will be required and these experiments are ongoing in this laboratory.

8.5 Conclusions

Elucidation of the structure and sequence of ALT telomeres will be an important advance in our understanding of ALT as it is likely to provide significant insights into how these heterogeneous telomeres are generated. The extreme length heterogeneity in ALT cells is maintained under denaturing conditions and is therefore not an artefact of the TRF procedure or

8-15 TABLE 8-2. Sequence alignments of non G-rich repeats from clones Tel-2 and Tel-4

Significant homology to human Tel-2/Tel-4 Sequencea gene sequencesb ATCTCGAACCCCTTACCAANTCCTGCCTGNAGGTCGA

CTCTAGGAGGATCCCC (Tel-2) AACCCCTTACCAACTCCT Homo sapiens cDNA, 3' end (cloned from moderately differentiated adenocarcinoma)

GAACCCCTTACCAA Homo sapiens cDNA, 3' end (fetal,thymus)

ATCTCGAACCCCTT Homo sapiens mRNA for FLJ00112 protein (spleen)

TGCCTGNAGGTCGACTCTAGGAGGATCCCC

(Tel-2)(Tel-4) TGCCTGCAGGTCGACTCTA-GAGGATCCCC Karyopherin (importin) alpha 2

TGCCTGCAGGTCGACTCTA-GAGGATCCCC Bone morphogenetic protein 4

TGCCTGCAGGTCGACTCTAG Homo sapiens clathrin light chain A gene

TGCCTGCAGGTCGACTCTAG Homo sapiens zinc finger protein (MBLL) mRNA

TGCCTGCAGGTCGACTCTAG Human pancreatic polypeptide receptor mRNA

CTTGCATGCCTGCAGGTCGNCTCTAGGAGGATCCCC (Tel-4) CTTGCATGCCTGCAGGTCG Human butyrophilin (BTF5) mRNA

CTTGCATGCCTGCAGGTC Homo sapiens mRNA for putative 14kD protein containing SHMT homology

CCAATTCCCCCTATACTCGAGCCGTATTACAATTCAC

(Tel-2) CCAATTCGCCCTATAGT-GAGTCGTATTACAATTCAC Antigen identified by monoclonal antibody Ki 67

ATTCCCCCTATACT Homo sapiens mRNA for DNA ligase III

CCAATTCGCCCTATAGT-GAGTCGTATTACAATTCAC Homo sapiens MDM2 gene, intron 9 and exon 10, partial sequence

CACATTCCCCCTCTCCCCAG (Tel-2) TTCCCCCTCTCCCCA Homo sapiens mRNA for KIAA1206 protein (brain)

TCCCCCTCTCCCCAG Homo sapiens protein 4.1-G (skeletal) mRNA

8-16 TTCCCCCTCTCCCC Procollagen, type XIII, alpha 1

CCCCCTCTCCCCAG Homo sapiens mRNA for neuraminidase

TTCCCCCTCTCCCC Homo sapiens mRNA for type XIII collagen

TCCCCCTCTCCCCA Homo sapiens chromosome Y ubiquitin specific protease 9 (USP9Y) mRNA

TCCCCCTCTCCCCA Homo sapiens cDNA FLJ11165 fis (placenta)

CATTCCCCCTCACCCCAG Homo sapiens OS-4 protein (OS-4) mRNA

TTCCCCCTCTCCCC Homo sapiens cytokeratin 2 mRNA

TTCCCCCTCTCCCC Human h-neuro-d4 protein mRNA

CCCCCACCCCCATCCACTC (Tel-2) CCCCCACCCCCATCCA Homo sapiens mRNA for doublecortin

CCCCCACCCCCATCC Proprotein convertase subtilisin/kexin type 4

CCCCCACCCCCATCC Homo sapiens mRNA for KIAA1294 protein (brain)

CCCCCACCCCCATCC Homo sapiens mRNA for peptidylarginine deiminase type III

CCCCCACCCCCATCC Homo sapiens mRNA for MAP kinase phosphatase 4

CCCCCACCCCCATCC Homo sapiens cDNA FLJ20048 (colon)

CCCCCACCCCCATCC Homo sapiens SH3-containing adaptor molecule-1 mRNA

CACCCCCATCCACTC Human mRNA for integrin alpha subunit

TTACAAATNCACTCTCCATTTT (Tel-2) AATCCACTCTCCATTTT Homo sapiens mRNA for KIAA1554 protein (brain) asequence identified by bold text in Figure 8-8 ball data generated by Celera Discovery System BLAST search (www.celera.com)

8-17 due to unique secondary structure. These findings are consistent with both standard TRF data and telomere FISH analysis. In addition, G-strand overhangs are not detectable in ALT cells under the electrophoresis conditions that are required to resolve the very long telomeres. Further studies will be required to determine whether such overhangs, if they exist, are any larger at ALT telomeres. These data confirm, therefore, that ALT generates very long telomeres that contain G-rich repeats. Of great interest is whether the sequence of these telomeres contains repeats other than TTAGGG and preliminary evidence suggests that, at least in some ALT cells, this is indeed the case. Previous analysis of ALT telomeres in this laboratory showed that restriction enzymes recognising TGAGGG sequences, Mnl1 and Hph1, will digest and dramatically reduce the TRF signals of the ALT cell lines SUSM-1, VA13 and MeT-4a (SV40 immortalised mesothelial cell line) (Bryan, TM "An alternative mechanism for telomere lengthening in immortal human cells", PhD thesis, University of Sydney, 1997). This is not true however, of other ALT cell lines that were tested which indicated the possibility of separate mechanisms of telomere generation. Interestingly, a significant reduction of TRF signal intensity was detectable for HT-1080, T24 and 293 telomerase-positive cells following Hph1 digestion (Figure 8-4). There have been no previous reports of either TGAGGG or other degenerate repeats being interspersed within the telomeres of telomerase-positive cells and the possibility of low levels of recombination/copy switching in these cell lines is an intriguing one. The data do not preclude, however, the possibility that telomerase incorporates incorrect bases in repeat sequences at a low rate, but sufficient to generate a detectable number of recognition sites for Hph1. It is possible also that the size of telomeric regions, containing pure TTAGGG repeats, in a number of cell lines may need to be re-evaluated and in some cases the subtelomere/telomere boundaries may be much closer to the ends of the chromosomes than previously thought. An ALT telomere cloning strategy was devised, utilising the observation that VA13 telomeres could be partially digested to a manageable size and subsequently cloned into standard vectors for sequencing analysis. It was hoped that suitably sized fragments would be isolated that would allow useful stretches of sequence to be obtained. The two TTAGGG repeat containing clones that were isolated (Tel-2 and Tel-4) had obvious indicators of plasmid rearrangements, particularly as the inserts were considerably smaller than the genomic DNA fragments used in the ligation reaction and had plasmid sequence within them. This may well have been facilitated by the presence of multiple repeats in the genomic fragments. The sequence obtained was interesting however, as amongst the G-rich repeats were sequences that align to known genes and one particular sequence was present in both clones and matched a number of human gene sequences (Figure 8-8, Table 8-2). It is noteworthy that there were no TGAGGG repeats in either of the

8-18 isolated clones (Table 8-1) but this sequence may not be common in VA13 telomeres or exist as multiple tandem repeats. This would still allow for digestion of long telomeres into much smaller fragments. The significance of the sequences obtained in clones Tel-2 and Tel-4 has yet to be fully tested. The degenerate repeats present in both clones are suggestive of subtelomeric elements which may well become incorporated into the telomeres of ALT cells via recombination, a mechanism that has been demonstrated in yeast telomerase-negative survivors (section 1.11.1). Although preliminary FISH analysis with both clones suggests the possibility that the non TTAGGG sequences are present at the telomeres, further analysis will be necessary to demonstrate this definitively. Various probes for the gene fragments identified in Table 8-2 will be constructed to verify this and these will be tested in a variety of ALT cell lines as well as normal and telomerase-positive cells. Identifying such sequences at the telomeres of ALT cells will contribute greatly to our knowledge of ALT and provide further insights into the molecular mechanism.

8-19 9. Chapter Nine

Discussion

9. Chapter Nine ...... 9-1 9.1 Repression of ALT ...... 9-2 9.1.1 The recessive nature of ALT ...... 9-2 9.1.2 Rapid telomere loss in somatic cell hybrids...... 9-2 9.1.3 Loss of ALT-associated PML bodies (APBs) in somatic cell hybrids...... 9-4 9.1.4 Telomere loss in ALT cells following expression of dominant-negative telomerase activity...... 9-5 9.1.5 Evidence for localisation of a putative ALT repressor on chromosome 6...... 9-7 9.2 The relationship between the molecular mechanisms of telomerase and ALT telomere maintenance ...... 9-10 9.3 The sequence of ALT telomeres ...... 9-11 9.4 Future directions...... 9-11

9-1 Discussion

9.1 Repression of ALT

9.1.1 The recessive nature of ALT

An important consideration in the search for candidate genes that are involved in ALT is whether the activation of ALT is due to a dominant mutation or if it requires the loss of repressors that are present in normal cells. The data in Chapter 3 indicate that ALT is recessive as three different normal cell types were shown to contain repressors of ALT (Figures 3-3, 3-4 and 3-6). Presumably, the putative repressor(s) are lost during the process of immortalisation in ALT cell lines. A number of studies are underway in this laboratory to identify candidate genes involved in ALT using analyses via microarray technology. The hybrid studies shown in Chapter 3 indicate that critical factors will be downregulated in ALT cell lines, although it is possible that activation of specific genes will also be important. The ALT X normal hybrid data are therefore extremely useful in facilitating a more informed approach to elucidating ALT genes.

9.1.2 Rapid telomere loss in somatic cell hybrids

The rapid loss of telomere tracts, indicating repression of ALT, in hybrids of GM847 cells fused to both normal and immortalised cell types (Chapters 3 and 4) has implications for our understanding of the mechanism of ALT. Not only does the ALT repressed phenotype indicate the existence of one or more ALT repressors in both normal and telomerase-positive immortal cells, it provides a further insight into the mechanism by which ALT generates telomeres. It has been previously shown that individual telomeres in ALT cells can rapidly shorten and relengthen (Murnane et al., 1994). This is consistent with the role of telomere-telomere recombination, that has now been shown to occur in GM847 cells (Dunham et al., 2000), as the principal mechanism of ALT telomere maintenance as recombination/copy switching has the potential to generate such telomere length dynamics. The telomere loss in ALT repressed somatic cell hybrids is indicative of an active mechanism of erosion as the rates are far greater than normal rates of telomere shortening (see sections 3.3 and 4.2). It is possible that the rapid shortening and relengthening of ALT telomeres are separate mechanisms and that only lengthening is inhibited in the hybrids. The appearance of dramatically shortened telomeres is unlikely to be due to selection for this phenotype because it does not persist in immortal revertants of GM847 X HFF5 hybrids and in the case of ALT X telomerase positive hybrids there was one clone that had long heterogeneous telomeres, (G/HT clone E; Figure 4-3).

9-2 The mechanism of rapid telomere loss associated with ALT repression in these hybrids may be due to a number of factors that are not necessarily mutually exclusive. One of the main possibilities is that ALT cells lack a telomere-associated protein, present in normal cells and also telomerase-positive immortal cells, that regulates telomere size and causes the dramatic telomere shortening in the somatic cell hybrids. There have been a number of reports in both yeast and human cells that would support this contention. Yeast studies have revealed very striking examples of telomere size control, mediated by an abundant yeast DNA binding protein, Rap1p, that also associates with telomeres (Conrad et al., 1990; Shore, 1994) and that can tightly regulate telomere lengths (Marcand et al., 1997). It has subsequently been shown in yeast that elongated telomeres were present in cells with mutations in Rap1p and also with mutations that caused hyper recombination (Li and Lustig, 1996). Interestingly, rapid deletion of telomeres to wild type lengths, within a single cell division, occurred when either Rap1p function was restored or recombination genes were disrupted (Li and Lustig, 1996). Rif1p and Rif2p proteins that associate with yeast telomeres via interaction with the carboxy terminus of Rap1p (Hardy et al., 1992; Wotton and Shore, 1997) have also been shown to inhibit type II telomere recombination in yeast, which resembles ALT in human cells (Teng et al., 2000). It is possible that in all of these instances there is a direct inhibition of access of recombination machinery to the telomeres. This would be consistent with the observation that telomere-telomere recombination is no longer detectable in ALT X telomerase-positive hybrids (Figures 4-11 and 4-12). It has been proposed that yeast cells utilising recombination as a telomere maintenance mechanism, do so due to loss of a capping function that would normally prevent telomere interactions between non-homologous chromosomes (McEachern and Blackburn, 1996). Restoration of normal telomere capping may well be an important aspect of ALT repression in somatic cell hybrids. Examples of telomere size control in human cells by factors which bind to the telomere repeats have also been reported. Human telomere binding proteins hTRF1 and hTRF2 have been shown to regulate telomere size, and loss of function of these factors have striking effects on telomere lengths (van Steensel and de Lange, 1997; Smogorzewska et al., 2000). Both of these proteins, however, are present in ALT cells (Yeager et al., 1999) but it is possible that related proteins are absent which prevents normal telomere length regulation. An interesting finding in the ALT X telomerase-positive hybrids is that at later passages the telomeres stabilise at lengths characteristic of parental telomerase-positive cells and undergo no further shortening (Figure 4-13). This is suggestive of a feedback mechanism of telomere size control which is consistent with a previous study that reported the existence of an “equilibrium

9-3 mean length” for individual telomeres (Sprung et al., 1999). In that study it was shown that telomeres above this mean length could shorten in the presence of telomerase, and this was presumably due to telomere binding factors that regulate telomere size, analogous to Rap1p in yeast. These proteins may well be absent or unable to properly regulate the telomeres in ALT cells, hence leading to the extreme telomere lengths that characterise ALT. Telomere size control factors could be the direct inhibitors of ALT that are present in the cell types fused to GM847. Elucidating the precise mechanism of rapid telomere loss, and consequently ALT repression, will be important in further understanding the nature of the ALT mechanism and in particular, the nature of ALT-specific recombination. This will also be important in the design and isolation of ALT inhibitors which are likely to be required for tumour therapies that target telomere maintenance (see section 1.12.1)

9.1.3 Loss of ALT-associated PML bodies (APBs) in somatic cell hybrids

Evidence of ALT repression in ALT X telomerase somatic cell hybrids was further evidenced by dramatic loss of APBs, a morphological marker of ALT containing TTAGGG repeats (see section 1.11.5). APBs were detectable in ALT X normal hybrid clones (data not shown) but due to the prevalence of ALT revertants in these cultures, it was not possible to determine whether there was any effect of the repressor(s) in normal cells on APBs. Immortal ALT-repressed hybrids however could easily be assessed for the incidence of APBs, and it was clear in the hybrid clones examined that they were completely lost from the population at late PDs (Figure 4-10). This was further evidence of the close association between APBs and ALT. Interestingly, G/HT clone E had telomere lengths at early timepoints that resembled the ALT telomere phenotype (Figure 4-3), but these telomeres progressively shortened and stabilised at later PDs (Figure 4-13). The existence of very long telomeres in this clone, however, did not affect the severe reduction in APBs at the earliest PD that was examined (Figure 4-10e) and this indicates that APBs are a product of the mechanism of ALT and not simply due to the existence of long heterogeneous telomeres. The fact that a small number of nuclei (~0.1%) in ALT X telomerase-positive hybrid cell cultures still had detectable APBs at early PDs is an interesting finding, as it suggests that the generation of these nuclear bodies still occurred at a low frequency after cell fusion. It may be that APBs are indeed by-products of ALT telomere turnover. If rapid ALT telomere loss in the somatic cell hybrids is separable from telomere lengthening, it may still occur in a small number of cells even though ALT telomere maintenance is repressed. By the same token, the APBs may be formed due to DNA damage induced by telomere turnover which persisted at low levels in the

9-4 hybrids because ALT rapid telomere deletion was still active at chromosome ends in rare cells. This might be predicted to happen on surviving long telomeres but in most clones these shorten at normal rates (Table 4-1) and so a combination of factors may be required, or ALT rapid deletion may only be fully repressed after a certain number of cell divisions. If cells containing APBs have exited the cell cycle, they would eventually be lost from the population at later passages. It has been reported however, that cells with APBs are still cycling (Grobelny et al., 2000) and in the context of the ALT X telomerase somatic cell hybrids this may mean that telomeric debris, that accumulates due to telomere turnover, is disposed of via APBs but not regenerated due to repression of ALT. Studies investigating the structure and function of APBs are ongoing in this laboratory. It will be important to elucidate the role of APBs and isolate any additional components as this will add to our understanding of ALT.

9.1.4 Telomere loss in ALT cells following expression of dominant-negative telomerase activity

An intriguing finding was that 3/10 stable clones of GM847 (designated GMDN) expressing a dominant-negative hTERT construct (dn hTERT 3-1) showed significant loss of telomeric tracts (Chapter 6). There are a number of interesting possibilities that arise from this observation, one being that ALT utilises a component of the telomerase holoenzyme which is sequestered or inhibited by the mutant hTERT protein. This is unlikely to be the RNA component, hTER, as some ALT cell lines do not express this factor (Bryan et al., 1997a; Reddel et al., 2001). It is also possible that dn hTERT functions by repressing the transcription of genes that are required also for ALT activity, due to a feedback regulatory function of hTERT when expressed at high levels. Another possibility, which is not mutually exclusive, is that high levels of dn hTERT 3-1 act to cap the telomeres by restoring a normal telosome that is disrupted in ALT cells. A protective role such as this has been suggested for telomerase previously (Zhu et al., 1999; Blackburn, 2000) and is consistent with the hypothesis derived from yeast studies that ALT is normally prevented by telomere capping which denies the recombination machinery access to the telomeres (McEachern and Blackburn, 1996). The repression of ALT via such a capping mechanism does not occur, however, when exogenous wt hTERT is expressed in GM847 cells (Chapter 5). The aspartate base changes in dn TERT 3-1 may therefore be an important determining factor in its interaction with the telomeres and other associated factors and this is likely to underpin its dominant-negative activity and growth effects in telomerase-positive cells also.

9-5 The absence of any appreciable growth effects, the prevalence of an ALT telomere phenotype in most clones, and clear reversion to ALT in clones that initially showed evidence of telomere erosion, complicates the interpretation of the effects of dn hTERT 3-1 in ALT cells. It may be that GM847 cells are refractory to sustained inhibition by this mutant TERT. Reversion to ALT may be due to loss of a factor that mediates repression by dn hTERT 3-1, expression of which is not lost in revertant cells (Figure 6-2). ALT repressed hybrids of GM847 and normal fibroblasts that have senesced are also invariably outgrown by reimmortalised subclones (Chapter 3). Therefore, there may be genuine growth effects at early PDs in most GMDN clones which are masked by ALT revertants. Additionally, the telomere effects of dn hTERT 3-1 expression may not be sufficient to cause growth arrest, but only a slight increase in cell generation time which is sufficient to confer a selective advantage to ALT revertants. There may also be clonal variation in the susceptibility of GM847 cells to the effects of dn hTERT 3-1. There was no discernible reduction in the frequency of APBs in ALT repressed GMDN clones, but due to the prevalence of revertants this does not disprove the role of dn hTERT 3-1 as an ALT repressor. The putative repression of ALT by dn hTERT 3-1 is also significant because there have been no reports of clonal outgrowths of ALT cells from a telomerase-positive culture that has been growth arrested by either dominant-negative hTERT activity or other inhibitors of telomerase. It is possible that some telomerase inhibitors may also repress ALT. This is pertinent also to the experiments described in Chapter 4 (Figures 4-7, 4-8 and 4-9) in which dn hTERT 3-1 was expressed in ALT repressed, telomerase-positive hybrid clones (KDN and LDN). No ALT revertants were recovered from these senescent populations of cells and outgrowths of dividing cells were invariably telomerase-positive (Figure 4-7) which was consistent with a previous dominant-negative hTERT study in this laboratory (Colgin et al., 2000). The interpretation of these data may be that telomerase is the sole telomere maintenance mechanism in the hybrids due to ALT repression and is required for cell viability. Despite the effects of dn hTERT 3-1 in GM847 cells, this explanation is still valid as it is not certain that dn hTERT can fully repress ALT. The failure to detect ALT revertants may be due to the presence of multiple repressors which would severely reduce the probability of selection for ALT by clonal outgrowths. It will be necessary however to fully determine whether there are any inhibitors of telomerase that can also suppress the ALT pathway. This would have implications for tumour treatment and it is likely that the possibility of resistance to telomerase inhibitors by ALT survivors in vivo will be highly dependent on the cell lineage and the type of cancer. It will be important to test the dn hTERT 3-1 construct in a variety of ALT cell lines and these studies are underway. Confirmation of dn hTERT 3-1 as a repressor of ALT will have great

9-6 significance as it will strengthen the link between the telomere maintenance pathways of ALT and telomerase. In this regard it will be important to elucidate the precise mode of action of this and other dn hTERT molecules and consequently, any telomere associated factors involved.

9.1.5 Evidence for localisation of a putative ALT repressor on chromosome 6

There have been a number of reports of putative senescence genes for different in vitro immortalised and tumour cell types localised to different chromosomes. These experiments were made possible by the microcell mediated chromosome transfer technique (MMCT) which allows whole human chromosomes, tagged with an antibiotic resistance gene, to be transfected into cells to assay for any growth effects in the resulting stable hybrid clones (Saxon and Stanbridge, 1987). In this manner, senescence genes have been localised to chromosome 1 (Yamada et al., 1990; Annab et al., 1992), 2 (Uejima et al., 1998; Tanaka et al., 1999), 3 (Tanaka et al., 1998), 4 (Ning et al., 1991), 6 (Yamada et al., 1990; Negrini et al., 1994; Sandhu et al., 1994), 7 (Ogata et al., 1995; Nakabayashi et al., 1997), 8 (Gustafson et al., 1996), 9 (Yamada et al., 1990; England et al., 1996), 11 (Yamada et al., 1990; Annab et al., 1992; Koi et al., 1993; Negrini et al., 1994) and 17 (Casey et al., 1993; Rinker-Schaeffer et al., 1994; Plummer et al., 1997; Yang et al., 1999). It is significant however that there have been very few reports in which a putative senescence gene has been characterised: MORF-4 on chromosome 4 (Bertram et al., 1999) and RNASE6PL as a candidate for a senescence and tumour suppressor gene on 6q27 (Acquati et al., 2001). Despite the paucity of success in isolating the gene(s) on chromosomes that cause senescence, the MMCT technique has narrowed the search for these factors. A number of studies have subsequently investigated whether the induction of senescence by MMCT correlated with repression of telomere maintenance mechanisms. Repressors of telomerase have been reported on chromosome 3 with evidence for repressors of both telomerase and ALT reported on chromosome 7 (see section 7.1). The MMCT experiments described in Chapter 7 provide evidence in GM847 cells, that repressors of ALT are localised to chromosome 6. This was used as a donor chromosome to test for ALT repression as a number of SV40 immortalised fibroblast cell lines, although not GM847 specifically, have previously been shown to undergo growth arrest and senescence upon MMCT of chromosome 6 (Sandhu et al., 1994) and the putative senescence gene(s) was further localised to 6q regions (Banga et al., 1997; Kim et al., 1998). Additionally, GM847 cells are pseudotriploid for chromosome 6 with only one apparently full length copy (Figure 7-3) which also suggests that deletions in chromosome 6 may be necessary for continuing proliferation in these cells.

9-7 Deletions in the q arm of the introduced chromosome were evident in GM847/H6 MMCT hybrid clones (Figure 7-3) and there was no appearance of growth arrest or telomere shortening (Figure 7-2) in these clones. This finding however, was only suggestive of a growth inhibitory role for 6q in GM847 and as such this evidence was indirect and circumstantial. More importantly, it could not be inferred from these data that repressors of ALT existed on 6q as it has been demonstrated previously that senescence can occur in the presence of telomerase activity after complementary cell-cell fusions (Bryan et al., 1995) and also after MMCT of a number of chromosomes (Tanaka et al., 1999). It was therefore entirely possible that senescence could also occur without repression of ALT. The MMCT experiments were then repeated with GM847 cells expressing exogenous hTERT. It was predicted that the strong selective pressure against retention of donor 6q genes, that had proliferative effects in GM847 cells via ALT repression, would be alleviated by reconstitution of telomerase activity as this would restore telomere maintenance. A further MMCT experiment was undertaken using GM847/hTERT-3 cells. In 4/12 H6 clones there was clear evidence of ALT repression which was not seen in H7 or H8 clones which indicated that this was not due to clonal variation or a non specific effect of MMCT. In addition, there were no subclones of GM847/hTERT-3 cells generated by limiting dilution that had an ALT repressed telomere phenotype (Chapter 5; Figure 5-4). Deletions were still evident however, in the q arm of the introduced chromosome in GM/hTERT-H6 clones including those that had undergone significant loss of telomeres. It may be that additional factors that suppress growth, but do not repress ALT, in GM847 cells are localised to chromosome 6 and must necessarily be lost from the donor in surviving colonies. As a further indication that the telomere loss was not simply clonal variation, there was a reversion to the ALT phenotype at later PDs (Figure 7-10). It is interesting that this correlated with downregulation of telomerase activity in these same clones which was consistent with the absence of the GM847/hTERT phenotype (lengthening of the shortest telomeres) at later timepoints (Figure 7-10). There have been no previous reports of inhibition of telomerase following MMCT of chromosome 6. This inhibition is most likely to occur downstream of transcription, because hTERT is exogenously expressed, or to be specific to another component of the telomerase holoenzyme. However, because the hTERT gene is exogenously expressed, its downregulation may not be specific to telomerase but to the viral promoter driving that expression. Clonal variation is again an unlikely explanation for repression of telomerase as there was no evidence of it in any of the H7 or H8 GM847/hTERT clones or in limiting dilution GM847/hTERT-3 subclones (Chapter 5). The previous finding that an ALT repressor localised to chromosome 7 in SUSM-1 cells (Nakabayashi et al., 1997) was not reproducible in either GM847 or GM847/hTERT cells

9-8 (Chapter 7). This suggests that there are different pathways to ALT activation in these cell lines which is consistent with their assignment to different complementation groups (Whitaker et al., 1995). It is interesting that a repressor of telomerase has also been reported on chromosome 7 (Nakabayashi et al., 1999) which is in contrast to an earlier report that found telomerase inhibitors on chromosome 3 but not on chromosome 7 (Ohmura et al., 1995). There was no evidence of telomerase inhibition in GM/hTERT-H7 cells and this suggests that repression by chromosome 7 is at the transcriptional level and affects the endogenous hTERT promoter. The differing reports of the effects of chromosome 7 on telomerase may be also due to cell line differences. Elucidating the gene(s) on chromosome 7 that impact upon ALT and telomerase will therefore also be important in understanding these mechanisms. Further studies will be required to isolate the putative ALT repressor(s) on 6q and assess also if telomerase repressors also exist in the same or different regions of this chromosome. A large body of evidence implicating regions of chromosome 6 in immortalisation and tumourigenesis has now accumulated. Significantly, a region on 6q26-27 known as SEN6, that is implicated in SV40 immortalisation of fibroblasts, has been defined (Banga et al., 1997). Due to the high incidence of ALT in SV40 immortalised fibroblasts (see section 1.11.3) it will be important to test this region for the existence of ALT repressors. Loss of heterozygosity in 6q26- 27 has also been reported in a variety of cancers such as non-Hodgkins lymphoma, ovarian and mammary tumours, melanomas and mesotheliomas (reviewed in Ozer, 2000). Other regions of 6q have also been reported to cause senescence following MMCT in a variety of tumour cells such as melanoma (Trent et al., 1990), ovarian tumour cells (6q14-21) (Sandhu et al., 1996) and breast tumour cells (6q25-26) (Negrini et al., 1994). Based on the prevalence of donor 6q deletions in GM847 MMCT clones, there is a strong possibility that senescence genes, including a putative ALT repressor(s), are present also in this region. A candidate gene on 6q27, RNASE6PL, that is a member of a family of cytoplasmic RNases has been reported to cause suppression of tumourigenicity in ovarian carcinoma cells (Acquati et al., 2001). It is very possible that more than one GM847 growth suppressor exists on 6q and this may be true also of SEN6 and other loci. It will be necessary therefore to examine whether each growth inhibitor represses ALT. It has not been demonstrated previously that either telomerase or ALT is repressed by genes on chromosome 6. A considerable number of known genes have now been localised to both chromosome 6 and 7, and further characterisation of regions containing putative repressors on these chromosomes, coupled with the rapidly accumulating data on human gene mapping, will allow for candidate gene testing in the near future. Experiments are planned in this laboratory to utilise high throughput technology, such as cDNA microarrays, to narrow the search for ALT

9-9 repressors. Isolation of these genes will be important in understanding repression of ALT and consequently in the development of therapeutic inhibitors.

9.2 The relationship between the molecular mechanisms of telomerase and ALT telomere maintenance

The findings of both Chapter 5 and Chapter 6 suggest that there are essential factors that are required by both telomerase and ALT which link the molecular mechanisms of both. It had been previously been shown that the RNA component of telomerase, hTER, is expressed in GM847 cells, but it is not essential for ALT as it is absent from the ALT cell lines SUSM-1 and WI38 VA13/2RA (Bryan et al., 1997a; Reddel et al., 2001). It will be interesting to examine whether other telomerase-associated factors are involved in ALT, which would necessitate their expression in ALT cells. Expression of hTERT in GM847 cells causes actual lengthening of telomeres, which suggests that all other components of the telomerase holoenzyme are present in these cells (Chapter 5). The evidence for repression of ALT by dominant-negative telomerase activity in GM847 cells (Chapter 6) is further evidence of a link between the pathways of telomerase and ALT. As described in section 9.1.4, elucidating the targets of these mutant telomerase catalytic subunits will therefore be of great interest as they have the potential to increase our understanding of both mechanisms and facilitate the search for, and design of new inhibitors of telomere maintenance. These studies raise the possibility that during the process of cellular immortalisation there are genetic changes that are essential to the activation of both telomerase and ALT. Evidence from a number of studies in this laboratory also suggests that this may well be the case. Assays of tumour samples have found evidence of telomerase and ALT in the same sample (Bryan et al., 1997b), although it is not yet possible to determine whether this is due to a mixed population of cells. The findings presented in Chapter 5 demonstrate, in principle, that both mechanisms can co- exist in the same cell. Immortalisation studies using SV40 transformed jejunal fibroblasts have found that mixed populations of telomerase-positive and ALT cells exist that have the same clonal origin (P. Bonnefin et al. unpublished data), which suggests that a common pathway exists during activation of both telomere maintenance mechanisms. Further studies will be required to elucidate the relationship between telomerase and ALT and of particular interest will be the mechanism of dn hTERT 3-1 repression (section 9.1.4). The existence of telomerase components in GM847 cells that allow telomere lengthening by exogenous hTERT suggests either that ALT requires most factors present in telomerase-positive cells or that their expression is inducible by the presence of hTERT protein. Both of these

9-10 possibilities need to be investigated and this will have important implications for anti-cancer treatment based on telomere maintenance, as it may be possible to target telomerase and ALT with the same inhibitor.

9.3 The sequence of ALT telomeres

The findings presented in Chapter 8, although as yet not fully conclusive, suggest that TTAGGG repeats at the telomeres of ALT cells are associated with alternative G-rich repeats and human gene sequences (Figure 8-8). It will be important to determine whether any of the non- TTAGGG sequences are found at the telomeres of different chromosomes and is therefore due to telomere-telomere recombination, or whether the sequences obtained are predominantly from subtelomeric regions. It will be possible to use some of the gene sequences as probes in TRF and FISH experiments and determine if they localise to the telomeres. This will need to be done on different ALT cell lines and also on telomerase-positive and normal controls. If there are human gene sequences that are commonly found at the telomeres of different ALT cells this will provide an important new insight into the origins of ALT telomeres and hence the mechanism of ALT. The association of alternative repeats with ALT telomeres is consistent with the possibility that subtelomeric regions are involved, as described in yeast type II recombination (section 1.11.1), in the generation of the very long telomere tracts. If specific gene sequences do localise to telomere tracts it will be interesting to determine whether they have been copied only from subtelomeric regions. The inserts contained in clones Tel-2 and Tel-4 (Figure 8-8) have obviously undergone rearrangements. This indicates that contiguous stretches of ALT telomeric sequence may be very difficult to obtain by standard cloning techniques, due not only to the extreme size ranges but also the propensity for recombination events to occur between repetitive sequences. This may also indicate that the non-telomeric sequences associated with the repeats in clones Tel-2 and Tel-4 are simply an artefact and this possibility will have to be examined in further studies. Reagents are being prepared to investigate if the sequences obtained in clones Tel-2 and Tel-4 are located at the telomeres in VA13 cells, particularly the fragment that was identified in both clones (Figure 8-8, Table 8-2).

9.4 Future directions

Future projects principally arising from the studies described in this thesis include the identification and characterisation of candidate ALT repressor genes, the investigation of factors common to the mechanisms of both telomerase and ALT and the characterisation of alternative

9-11 sequences at the telomeres of ALT cells. Each of these studies will aid in the understanding of the molecular mechanism of ALT and also in the design of therapeutic inhibitors. This work will be complementary to additional studies underway in this laboratory which include cDNA microarray approaches to isolate candidate genes that may be involved in ALT, the elucidation of additional components and also the function of APBs and the development of a sensitive recombination based assay for ALT. Additionally, a large number of tumour samples are being obtained and analysed to document the prevalence of ALT in human cancer and correlate these data with clinical outcomes. All of these experiments are designed to determine the role of ALT in human tumourigenesis. Increased knowledge of the mechanism of ALT will provide an increased understanding of telomere maintenance which, as it occurs in a large number of different cancer types, will remain a major target for the development of future treatments. The existence of ALT in human cancer (Bryan et al., 1997b; Yeager et al., 1999) indicates that it is important to elucidate its molecular mechanism(s) as a means to designing and developing such therapies.

9-12 References

Acquati, F., Morelli, C., Cinquetti, R., Bianchi, M., Porrini, D., Varesco, L., Gismondi, V., Rocchetti, R., Talevi, S., Possati, L., Magnanini, C., Tibiletti, M.G., Bernasconi, B., Daidone, M.G., Shridhar, V., Smith, D.I., Negrini, M., Barbanti-Brodano, G. and Taramelli, R. (2001) Cloning and characterization of a senescence inducing and class II tumor suppressor gene in ovarian carcinoma at chromosome region 6q27. Oncogene (In Press)

Alcorta, D.A., Xiong, Y., Phelps, D., Hannon, G., Beach, D. and Barrett, J.C. (1996) Involvement of the cyclin-dependent kinase inhibitor p16 (INK4a) in replicative senescence of normal human fibroblasts. Proc.Natl.Acad.Sci.U.S.A 93, 13742-13747.

Allshire, R.C., Dempster, M. and Hastie, N.D. (1989) Human telomeres contain at least three types of G-rich repeat distributed non-randomly. Nucleic Acids Res. 17, 4611-4627.

Allsopp, R.C., Chang, E., Kashefi-Aazam, M., Rogaev, E.I., Piatyszek, M.A., Shay, J.W. and Harley, C.B. (1995) Telomere shortening is associated with cell division in vitro and in vivo. Exp.Cell Res. 220, 194-200.

Allsopp, R.C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E.V., Futcher, A.B., Greider, C.W. and Harley, C.B. (1992) Telomere length predicts replicative capacity of human fibroblasts. Proc.Natl.Acad.Sci.U.S.A 89, 10114-10118.

Amstad, P., Reddel, R.R., Pfeifer, A., Malan-Shibley, L., Mark, G.E., III and Harris, C.C. (1988) Neoplastic transformation of a human bronchial epithelial cell line by a recombinant retrovirus encoding viral Harvey ras. Mol.Carcinog. 1, 151-160.

Annab, L.A., Dong, J.-T., Futreal, P.A., Satoh, H., Oshimura, M. and Barrett, J.C. (1992) Growth and transformation suppressor genes for BHK Syrian hamster cells on human chromosomes 1 and 11. Mol.Carcinog. 6, 280-288.

Banga, S.S., Kim, S., Hubbard, K., Dasgupta, T., Jha, K.K., Patsalis, P., Hauptschein, R., Gamberi, B., Dalla-Favera, R., Kraemer, P. and Ozer, H.L. (1997) SEN6, a locus for SV40- mediated immortalization of human cells, maps to 6q26-27. Oncogene 14, 313-321.

Barrett, J.C., Annab, L.A. and Futreal, P.A. (1993) Genetic and molecular basis for cellular senescence. Adv.Exp.Med.Biol. 330, 27-43.

Beattie, T.L., Zhou, W., Robinson, M.O. and Harrington, L. (1998) Reconstitution of human telomerase activity in vitro. Curr.Biol. 8, 177-180.

Belair, C.D., Yeager, T.R., Lopez, P.M. and Reznikoff, C.A. (1997) Telomerase activity: A biomarker of cell proliferation, not malignant transformation. Proc.Natl.Acad.Sci.U.S.A 94, 13677-13682.

Bertram, M.J., Bérubé, N.G., Hang-Swanson, X., Ran, Q., Leung, J.K., Bryce, S., Spurgers, K., Bick, R.J., Baldini, A., Ning, Y., Clark, L.J., Parkinson, E.K., Barrett, J.C., Smith, J.R. and Pereira-Smith, O.M. (1999) Identification of a gene that reverses the immortal phenotype of a subset of cells and is a member of a novel family of transcription factor-like genes. Mol.Cell.Biol. 19, 1479-1485.

ref-1 Biessmann, H., Champion, L.E., O'Hair, M., Ikenaga, K., Kasravi, B. and Mason, J.M. (1992) Frequent transpositions of Drosophila melanogaster HeT-A transposable elements to receding chromosome ends. EMBO J. 11, 4459-4469.

Biessmann, H. and Mason, J.M. (1997) Telomere maintenance without telomerase. Chromosoma 106, 63-69.

Biessmann, H., Mason, J.M., Ferry, K., d'Hulst, M., Valgeirsdottir, K., Traverse, K.L. and Pardue, M.-L. (1990) Addition of telomere-associated HeT DNA sequences "heals" broken chromosome ends in Drosophila. Cell 61, 663-673.

Bischoff, F.Z., Yim, S.O., Pathak, S., Grant, G., Siciliano, M.J., Giovanella, B.C., Strong, L.C. and Tainsky, M.A. (1990) Spontaneous abnormalities in normal fibroblasts from patients with Li-Fraumeni cancer syndrome: Aneuploidy and immortalization. Cancer Res. 50, 7979-7984.

Blackburn, E.H. (1991) Structure and function of telomeres. Nature 350, 569-573.

Blackburn, E.H. (2000) Telomere states and cell fates. Nature 408, 53-56.

Blackburn, E.H. and Gall, J.G. (1978) A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena. J.Mol.Biol. 120, 33-53.

Blackmore, P.F., Oakes, S.G. and Somers, K.D. (1992) Altered H1 histamine receptor signaling in Balb/3T3 cells transformed by v-K-ras and v-H-ras oncogenes. Oncogene 7, 2053-2057.

Bladier, C., Wolvetang, E.J., Hutchinson, P., De Haan, J.B. and Kola, I. (1997) Response of a primary human fibroblast cell line to H 2O2: Senescence-like growth arrest or apoptosis? Cell Growth Differ. 8, 589-598.

Blasco, M.A., Funk, W., Villeponteau, B. and Greider, C.W. (1995) Functional characterization and developmental regulation of mouse telomerase RNA. Science 269, 1267-1270.

Blasco, M.A., Lee, H.-W., Hande, M.P., Samper, E., Lansdorp, P.M., DePinho, R.A. and Greider, C.W. (1997) Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 91, 25-34.

Bodnar, A.G., Ouellette, M., Frolkis, M., Holt, S.E., Chiu, C.-P., Morin, G.B., Harley, C.B., Shay, J.W., Lichtsteiner, S. and Wright, W.E. (1998) Extension of life-span by introduction of telomerase into normal human cells. Science 279, 349-352.

Bond, J.A., Haughton, M.F., Rowson, J.M., Smith, P.J., Gire, V., Wynford-Thomas, D. and Wyllie, F.S. (1999) Control of replicative life span in human cells: Barriers to clonal expansion intermediate between M1 senescence and M2 crisis. Mol.Cell.Biol. 19, 3103-3114.

Bond, J.A., Wyllie, F.S. and Wynford-Thomas, D. (1994) Escape from senescence in human diploid fibroblasts induced directly by mutant p53. Oncogene 9, 1885-1889.

Boulton, S.J. and Jackson, S.P. (1998) Components of the Ku-dependent non-homologous end- joining pathway are involved in telomeric length maintenance and telomeric silencing. EMBO J. 17, 1819-1828.

ref-2 Bourgain, F.M. and Katinka, M.D. (1991) Telomeres inhibit end to end fusion and enhance maintenance of linear DNA molecules injected into the Paramecium primaurelia macronucleus. Nucleic Acids Res. 19, 1541-1547.

Brenner, A.J., Stampfer, M.R. and Aldaz, C.M. (1998) Increased p16 expression with first senescence arrest in human mammary epithelial cells and extended growth capacity with p16 inactivation. Oncogene 17, 199-205.

Brien, T.P., Kallakury, B.V.S., Lowry, C.V., Ambros, R.A., Muraca, P.J., Malfetano, J.H. and Ross, J.S. (1997) Telomerase activity in benign endometrium and endometrial carcinoma. Cancer Res. 57, 2760-2764.

Broccoli, D., Smogorzewska, A., Chong, L. and de Lange, T. (1997) Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat.Genet. 17, 231-235.

Broccoli, D., Young, J.W. and de Lange, T. (1995) Telomerase activity in normal and malignant hematopoietic cells. Proc.Natl.Acad.Sci.U.S.A 92, 9082-9086.

Brown, J.P., Wei, W. and Sedivy, J.M. (1997) Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science 277, 831-834.

Brown, W.R.A., MacKinnon, P.J., Villasanté, A., Spurr, N., Buckle, V.J. and Dobson, M.J. (1990) Structure and polymorphism of human telomere-associated DNA. Cell 63, 119-132.

Bryan, T.M., Englezou, A., Dalla-Pozza, L., Dunham, M.A. and Reddel, R.R. (1997b) Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor- derived cell lines. Nat.Med. 3, 1271-1274.

Bryan, T.M., Englezou, A., Dunham, M.A. and Reddel, R.R. (1998) Telomere length dynamics in telomerase-positive immortal human cell populations. Exp.Cell Res. 239, 370-378.

Bryan, T.M., Englezou, A., Gupta, J., Bacchetti, S. and Reddel, R.R. (1995) Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J. 14, 4240- 4248.

Bryan, T.M., Marusic, L., Bacchetti, S., Namba, M. and Reddel, R.R. (1997a) The telomere lengthening mechanism in telomerase-negative immortal human cells does not involve the telomerase RNA subunit. Hum.Mol.Genet. 6, 921-926.

Bryan, T.M. and Reddel, R.R. (1994) SV40-induced immortalization of human cells. Crit.Rev.Oncogenesis 5, 331-357.

Bryan, T.M. and Reddel, R.R. (1997) Telomere dynamics and telomerase activity in in vitro immortalised human cells. Eur.J.Cancer 33, 767-773.

Bunn, C.L. and Tarrant, G.M. (1980) Limited lifespan in somatic cell hybrids and cybrids. Exp.Cell Res. 127, 385-396.

Burger, A.M., Bibby, M.C. and Double, J.A. (1997) Telomerase activity in normal and malignant mammalian tissues: Feasibility of telomerase as a target for cancer chemotherapy. Br.J.Cancer 75, 516-522.

ref-3 Butel, J.S. (2000) Simian virus 40, poliovirus vaccines, and human cancer: research progress versus media and public interests. Bull.World Health Organ. 78, 195-198.

Carney, J.P., Maser, R.S., Olivares, H., Davis, E.M., Le Beau, M., Yates, J.R.I., Hays, L., Morgan, W.F. and Petrini, J.H.J. (1998) The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 93, 477-486.

Casey, G., Plummer, S., Hoeltge, G., Scanlon, D., Fasching, C. and Stanbridge, E.J. (1993) Functional evidence for a breast cancer growth suppressor gene on chromosome 17. Hum.Mol.Genet. 2, 1921-1927.

Chamankhah, M. and Xiao, W. (1999) Formation of the yeast Mre11-Rad50-Xrs2 complex is correlated with DNA repair and telomere maintenance. Nucleic Acids Res. 27, 2072-2079.

Chang, E. and Harley, C.B. (1995) Telomere length and replicative aging in human vascular tissues. Proc.Natl.Acad.Sci.U.S.A 92, 11190-11194.

Chen, Q. and Ames, B.N. (1994) Senescence-like growth arrest induced by hydrogen peroxide in human diploid fibroblast F65 cells. Proc.Natl.Acad.Sci.U.S.A 91, 4130-4134.

Chen, Q., Fischer, A., Reagan, J.D., Yan, L.-J. and Ames, B.N. (1995) Oxidative DNA damage and senescence of human diploid fibroblast cells. Proc.Natl.Acad.Sci.U.S.A 92, 4337-4341.

Chong, L., van Steensel, B., Broccoli, D., Erdjument-Bromage, H., Hanish, J., Tempst, P. and de Lange, T. (1995) A human telomeric protein. Science 270, 1663-1667.

Chua, P.R. and Roeder, G.S. (1997) Tam1, a telomere-associated meiotic protein, functions in chromosome synapsis and crossover interference. Genes Dev. 11, 1786-1800.

Colgin, L.M., Wilkinson, C., Englezou, A., Kilian, A., Robinson, M.O. and Reddel, R.R. (2000) The hTERTα splice variant is a dominant negative inhibitor of telomerase activity. Neoplasia 2, 426-432.

Collins, K., Kobayashi, R. and Greider, C.W. (1995) Purification of Tetrahymena telomerase and cloning of genes encoding the two protein components of the enzyme. Cell 81, 677-686.

Conrad, M.N., Wright, J.H., Wolf, A.J. and Zakian, V.A. (1990) RAP1 protein interacts with yeast telomeres in vivo: Overproduction alters telomere structure and decreases chromosome stability. Cell 63, 739-750.

Cooke, H.J. and Smith, B.A. (1986) Variability at the telomeres of the human X/Y pseudoautosomal region. Cold Spring Harb.Symp.Quant.Biol. 51, 213-219.

Counter, C.M., Avilion, A.A., LeFeuvre, C.E., Stewart, N.G., Greider, C.W., Harley, C.B. and Bacchetti, S. (1992) Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J. 11, 1921-1929.

Counter, C.M., Botelho, F.M., Wang, P., Harley, C.B. and Bacchetti, S. (1994) Stabilization of short telomeres and telomerase activity accompany immortalization of Epstein-Barr virus- transformed human B lymphocytes. J.Virol. 68, 3410-3414.

ref-4 Counter, C.M., Gupta, J., Harley, C.B., Leber, B. and Bacchetti, S. (1995) Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 85, 2315-2320.

Counter, C.M., Hahn, W.C., Wei, W., Dickinson Caddle, S., Beijersbergen, R.L., Lansdorp, P.M., Sedivy, J.M. and Weinberg, R.A. (1998b) Dissociation among in vitro telomerase activity, telomere maintenance, and cellular immortalization. Proc.Natl.Acad.Sci.U.S.A 95, 14723-14728.

Counter, C.M., Meyerson, M., Eaton, E.N., Ellisen, L.W., Dickinson Caddle, S., Haber, D.A. and Weinberg, R.A. (1998a) Telomerase activity is restored in human cells by ectopic expression of hTERT (hEST2), the catalytic subunit of telomerase. Oncogene 16, 1217-1222.

Counter, C.M., Meyerson, M., Eaton, E.N. and Weinberg, R.A. (1997) The catalytic subunit of yeast telomerase. Proc.Natl.Acad.Sci.U.S.A 94, 9202-9207.

Cristofalo, V.J., Allen, R.G., Pignolo, R.J., Martin, B.G. and Beck, J.C. (1998) Relationship between donor age and the replicative lifespan of human cells in culture: A reevaluation. Proc.Natl.Acad.Sci.U.S.A 95, 10614-10619.

Cuthbert, A.P., Bond, J., Trott, D.A., Gill, S., Broni, J., Marriott, A., Khoudoli, G., Parkinson, E.K., Cooper, C.S. and Newbold, R.F. (1999) Telomerase repressor sequences on chromosome 3 and induction of permanent growth arrest in human breast cancer cells. J.Natl.Cancer Inst. 91, 37-45.

Cuthbert, A.P., Trott, D.A., Ekong, R.M., Jezzard, S., England, N.L., Themis, M., Todd, C.M. and Newbold, R.F. (1995) Construction and characterization of a highly stable human:rodent monochromosomal hybrid panel for genetic complementation and genome mapping studies. Cytogenet.Cell Genet. 71, 68-76.

Daniel, C.W., Aidells, B.D., Medina, D. and Faulkin, L.J., Jr. (1975) Unlimited division potential of precancerous mouse mammary cells after spontaneous or carcinogen-induced transformation. Fed.Proc. 34, 64-67. de Lange, T., Shiue, L., Myers, R.M., Cox, D.R., Naylor, S.L., Killery, A.M. and Varmus, H.E. (1990) Structure and variability of human chromosome ends. Mol.Cell.Biol. 10, 518-527.

De Silva, R. and Reddel, R.R. (1993) Similar simian virus 40-induced immortalization frequency of fibroblasts and epithelial cells from human large airways. Cell.Mol.Biol.Res. 39, 101-110.

Di Leonardo, A., Linke, S.P., Clarkin, K. and Wahl, G.M. (1994) DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev. 8, 2540-2551.

Dimri, G.P., Lee, X., Basile, G., Acosta, M., Scott, C., Roskelley, C., Medrano, E.E., Linskens, M., Rubelj, I., Pereira-Smith, O., Peacocke, M. and Campisi, J. (1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc.Natl.Acad.Sci.U.S.A 92, 9363-9367.

Duncan, E.L. and Reddel, R.R. (1997) Genetic changes associated with immortalization. A review. (Mosc) 62, 1263-1274.

ref-5 Dunham, M.A., Neumann, A.A., Fasching, C.L. and Reddel, R.R. (2000) Telomere maintenance by recombination in human cells. Nat.Genet. 26, 447-450.

Engelhardt, M., Kumar, R., Albanell, J., Pettengell, R., Han, W. and Moore, M.A.S. (1997) Telomerase regulation, cell cycle, and telomere stability in primitive hematopoietic cells. Blood 90, 182-193.

England, N.L., Cuthbert, A.P., Trott, D.A., Jezzard, S., Nobori, T., Carson, D.A. and Newbold, R.F. (1996) Identification of human tumour suppressor genes by monochromosome transfer: Rapid growth-arrest response mapped to 9p21 is mediated solely by the cyclin-D-dependent kinase inhibitor gene, CDKN2A (p16INK4A). Carcinogenesis 17, 1567-1575.

Erickson, S., Sangfelt, O., Heyman, M., Castro, J., Einhorn, S. and Grandér, D. (1998) Involvement of the Ink4 proteins p16 and p15 in T-lymphocyte senescence. Oncogene 17, 595- 602.

Fairweather, D.S., Fox, M. and Margison, G.P. (1987) The in vitro lifespan of MRC-5 cells is shortened by 5-azacytidine-induced demethylation. Exp.Cell Res. 168, 153-159.

Feng, J., Funk, W.D., Wang, S.-S., Weinrich, S.L., Avilion, A.A., Chiu, C.-P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J.H., Le, S.Y., West, M.D., Harley, C.B., Andrews, W.H., Greider, C.W. and Villeponteau, B. (1995) The RNA component of human telomerase. Science 269, 1236-1241.

Fitzgerald, M.S., McKnight, T.D. and Shippen, D.E. (1996) Characterization and developmental patterns of telomerase expression in plants. Proc.Natl.Acad.Sci.U.S.A 93, 14422-14427.

Foster, S.A., Wong, D.J., Barrett, M.T. and Galloway, D.A. (1998) Inactivation of p16 in human mammary epithelial cells by CpG island methylation. Mol.Cell.Biol. 18, 1793-1801.

Frenck, R.W., Jr., Blackburn, E.H. and Shannon, K.M. (1998) The rate of telomere sequence loss in human leukocytes varies with age. Proc.Natl.Acad.Sci.U.S.A 95, 5607-5610.

Gallimore, P.H., Lecane, P.S., Roberts, S., Rookes, S.M., Grand, R.J.A. and Parkhill, J. (1997) Adenovirus type 12 early region 1B 54K protein significantly extends the life span of normal mammalian cells in culture. J.Virol. 71, 6629-6640.

Girardi, A.J., Jensen, F.C. and Koprowski, H. (1965) SV40-induced transformation of human diploid cells: Crisis and recovery. J.Cell.Comp.Physiol. 65, 69-84.

Grandin, N., Reed, S.I. and Charbonneau, M. (1997) Stn1, a new Saccharomyces cerevisiae protein, is implicated in telomere size regulation in association with Cdc13. Genes Dev. 11, 512-527.

Gravel, S., Larrivée, M., Labrecque, P. and Wellinger, R.J. (1998) Yeast Ku as a regulator of chromosomal DNA end structure. Science 280, 741-744.

Greider, C.W. (1998) Telomerase activity, cell proliferation, and cancer. Proc.Natl.Acad.Sci.U.S.A 95, 90-92.

Greider, C.W. and Blackburn, E.H. (1985) Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405-413.

ref-6 Griffith, J.D., Comeau, L., Rosenfield, S., Stansel, R.M., Bianchi, A., Moss, H. and de Lange, T. (1999) Mammalian telomeres end in a large duplex loop. Cell 97, 503-514.

Grobelny, J.V., Godwin, A.K. and Broccoli, D. (2000) ALT-associated PML bodies are present in viable cells and are enriched in cells in the G2/M phase of the cell cycle. J.Cell Sci. 113, 4577-4585.

Gustafson, C.E., Wilson, P.J., Lukeis, R., Baker, E., Woollatt, E., Annab, L., Hawke, L., Barrett, J.C. and Chenevix-Trench, G. (1996) Functional evidence for a colorectal cancer tumor suppressor gene at chromosome 8p22-23 by monochromosome transfer. Cancer Res. 56, 5238- 5245.

Hahn, W.C., Counter, C.M., Lundberg, A.S., Beijersbergen, R.L., Brooks, M.W. and Weinberg, R.A. (1999a) Creation of human tumour cells with defined genetic elements. Nature 400, 464- 468.

Hahn, W.C., Stewart, S.A., Brooks, M.W., York, S.G., Eaton, E., Kurachi, A., Beijersbergen, R.L., Knoll, J.H.M., Meyerson, M. and Weinberg, R.A. (1999b) Inhibition of telomerase limits the growth of human cancer cells. Nat.Med. 5, 1164-1170.

Halvorsen, T.L., Leibowitz, G. and Levine, F. (1999) Telomerase activity is sufficient to allow transformed cells to escape from crisis. Mol.Cell.Biol. 19, 1864-1870.

Hara, E., Smith, R., Parry, D., Tahara, H., Stone, S. and Peters, G. (1996) Regulation of p16CDKN2 expression and its implications for cell immortalization and senescence. Mol.Cell.Biol. 16, 859-867.

Hardy, C.F.J., Sussel, L. and Shore, D. (1992) A RAP1-interacting protein involved in transcriptional silencing and telomere length regulation. Genes Dev. 6, 801-814.

Harley, C.B. (1991) Telomere loss: Mitotic clock or genetic time bomb? Mutat.Res. 256, 271- 282.

Harley, C.B., Futcher, A.B. and Greider, C.W. (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-460.

Harley, C.B., Vaziri, H., Counter, C.M. and Allsopp, R.C. (1992) The telomere hypothesis of cellular aging. Exp.Gerontol. 27, 375-382.

Harrington, L., McPhail, T., Mar, V., Zhou, W., Oulton, R., Amgen EST Program, Bass, M.B., Arruda, I. and Robinson, M.O. (1997b) A mammalian telomerase-associated protein. Science 275, 973-977.

Harrington, L., Zhou, W., McPhail, T., Oulton, R., Yeung, D.S.K., Mar, V., Bass, M.B. and Robinson, M.O. (1997a) Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev. 11, 3109-3115.

Hastie, N.D., Dempster, M., Dunlop, M.G., Thompson, A.M., Green, D.K. and Allshire, R.C. (1990) Telomere reduction in human colorectal carcinoma and with ageing. Nature 346, 866- 868.

Hayflick, L. (1965) The limited in vitro lifetime of human diploid cell strains. Exp.Cell Res. 37, 614-636.

ref-7 Hayflick, L. and Moorhead, P.S. (1961) The serial cultivation of human diploid cell strains. Exp.Cell Res. 25, 585-621.

Härle-Bachor, C. and Boukamp, P. (1996) Telomerase activity in the regenerative basal layer of the epidermis in human skin and in immortal and carcinoma-derived skin keratinocytes. Proc.Natl.Acad.Sci.U.S.A 93, 6476-6481.

Heiss, N.S., Bachner, D., Salowsky, R., Kolb, A., Kioschis, P. and Poustka, A. (2000) Gene structure and expression of the mouse dyskeratosis congenita gene, Dkc1. Genomics 67 , 153- 163.

Heller, K., Kilian, A., Piatyszek, M.A. and Kleinhofs, A. (1996) Telomerase activity in plant extracts. Mol.Gen.Genet. 252, 342-345.

Henderson, S., Allsopp, R., Spector, D., Wang, S.-S. and Harley, C. (1996) In situ analysis of changes in telomere size during replicative aging and cell transformation. J.Cell Biol. 134, 1- 12.

Hicks, G.G., Egan, S.E., Greenberg, A.H. and Mowat, M. (1991) Mutant p53 tumor suppressor alleles release ras-induced cell cycle growth arrest. Mol.Cell.Biol. 11, 1344-1352.

Hiyama, E., Hiyama, K., Tatsumoto, N., Kodama, T., Shay, J.W. and Yokoyama, T. (1996) Telomerase activity in human intestine. Int.J.Oncol. 9, 453-458.

Hiyama, K., Hirai, Y., Kyoizumi, S., Akiyama, M., Hiyama, E., Piatyszek, M.A., Shay, J.W., Ishioka, S. and Yamakido, M. (1995) Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J.Immunol. 155, 3711-3715.

Hoffschir, F., Ricoul, M., Lemieux, N., Estrade, S., Cassingena, R. and Dutrillaux, B. (1992) Jumping translocations originate clonal rearrangements in SV40-transformed human fibroblasts. Int.J.Cancer 52, 130-136.

Holliday, R. (1986) Strong effects of 5-azacytidine on the in vitro lifespan of human diploid fibroblasts. Exp.Cell Res. 166, 543-552.

Hollstein, M., Sidransky, D., Vogelstein, B. and Harris, C.C. (1991) p53 mutations in human cancers. Science 253, 49-53.

Holt, S.E., Aisner, D.L., Baur, J., Tesmer, V.M., Dy, M., Ouellette, M., Trager, J.B., Morin, G.B., Toft, D.O., Shay, J.W., Wright, W.E. and White, M.A. (1999) Functional requirement of p23 and Hsp90 in telomerase complexes. Genes Dev. 13, 817-826.

Horikawa, I., Oshimura, M. and Barrett, J.C. (1998) Repression of the telomerase catalytic subunit by a gene on human chromosome 3 that induces cellular senescence. Mol.Carcinog. 22, 65-72.

Hsiao, R., Sharma, H.W., Ramakrishnan, S., Keith, E. and Narayanan, R. (1997) Telomerase activity in normal human endothelial cells. Anticancer Res. 17, 827-832.

Hsu, H.-L., Gilley, D., Galande, S.A., Hande, M.P., Allen, B., Kim, S.-H., Li, G.C., Campisi, J., Kohwi-Shigematsu, T. and Chen, D.J. (2000) Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev. 14, 2807-2812.

ref-8 Hubbard-Smith, K., Patsalis, P., Pardinas, J.R., Jha, K.K., Henderson, A.S. and Ozer, H.L. (1992) Altered chromosome 6 in immortal human fibroblasts. Mol.Cell.Biol. 12, 2273-2281.

Huschtscha, L.I., Noble, J.R., Neumann, A.A., Moy, E.L., Barry, P., Melki, J.R., Clark, S.J. and Reddel, R.R. (1998) Loss of p16INK4 expression by methylation is associated with lifespan extension of human mammary epithelial cells. Cancer Res. 58, 3508-3512.

Huschtscha, L.I. and Reddel, R.R. (1999) p16INK4a and the control of cellular proliferative life span - Commentary. Carcinogenesis 20, 921-926.

Ishii, Y., Tsuyama, N., Maeda, S., Tahara, H. and Ide, T. (1999) Telomerase activity in hybrids between telomerase-negative and telomerase-positive immortal human cells is repressed in the different complementation groups but not in the same complementation group of immortality. Mech.Ageing Dev. 110, 175-193.

Iwama, H., Ohyashiki, K., Ohyashiki, J.H., Hayashi, S., Yahata, N., Ando, K., Toyama, K., Hoshika, A., Takasaki, M., Mori, M. and Shay, J.W. (1998) Telomeric length and telomerase activity vary with age in peripheral blood cells obtained from normal individuals. Hum.Genet. 102, 397-402.

Jiang, W.-Q. and Ringertz, N. (1997) Altered distribution of the promyelocytic leukemia- associated protein is associated with cellular senescence. Cell Growth Differ. 8, 513-522.

Jiang, X.-R., Jimenez, G., Chang, E., Frolkis, M., Kusler, B., Sage, M., Beeche, M., Bodnar, A.G., Wahl, G.M., Tlsty, T.D. and Chiu, C.-P. (1999) Telomerase expression in human somatic cells does not induce changes associated with a transformed phenotype. Nat.Genet. 21, 111- 114.

Jones, C.J., Soley, A., Skinner, J.W., Gupta, J., Haughton, M.F., Wyllie, F.S., Schlumberger, M., Bacchetti, S. and Wynford-Thomas, D. (1998) Dissociation of telomere dynamics from telomerase activity in human thyroid cancer cells. Exp.Cell Res. 240, 333-339.

Kang, M.K., Guo, W. and Park, N.-H. (1998) Replicative senescence of normal human oral keratinocytes is associated with the loss of telomerase activity without shortening of telomeres. Cell Growth Differ. 9, 85-95.

Karlseder, J., Broccoli, D., Dai, Y., Hardy, S. and de Lange, T. (1999) p53- and ATM- dependent apoptosis induced by telomeres lacking TRF2. Science 283, 1321-1325.

Katoh, M., Katoh, M., Kameyama, M., Kugoh, H., Shimizu, M., Oshimura, M. (1998) A repressor function for telomerase activity in telomerase-negative immortal cells. Mol.Carcinog. 21, 17-25.

Kelland, L.R. (2000) Telomerase inhibitors: targeting the vulnerable end of cancer? Anticancer Drugs 11, 503-513.

Kilian, A., Bowtell, D.D.L., Abud, H.E., Hime, G.R., Venter, D.J., Keese, P.K., Duncan, E.L., Reddel, R.R. and Jefferson, R.A. (1997) Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum.Mol.Genet. 6, 2011-2019.

ref-9 Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.C., Coviello, G.M., Wright, W.E., Weinrich, S.L. and Shay, J.W. (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-2015.

Kim, S.-H., Banga, S., Jha, K.K. and Ozer, H.L. (1998) SV40-mediated transformation and immortalization of human cells. Dev.Biol.Stand. 94, 297-302.

Kim, S., Kaminker, P. and Campisi, J. (1999) TIN2, a new regulator of telomere length in human cells. Nat.Genet. 23, 405-412.

Kirk, K.E., Harmon, B.P., Reichardt, I.K., Sedat, J.W. and Blackburn, E.H. (1997) Block in anaphase chromosome separation caused by a telomerase template mutation. Science 275 , 1478-1481.

Kiyono, T., Foster, S.A., Koop, J.I., McDougall, J.K., Galloway, D.A. and Klingelhutz, A.J. (1998) Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396, 84-88.

Klingelhutz, A.J., Barber, S.A., Smith, P.P., Dyer, K. and McDougall, J.K. (1994) Restoration of telomeres in human papillomavirus-immortalized human anogenital epithelial cells. Mol.Cell.Biol. 14, 961-969.

Klingelhutz, A.J., Foster, S.A. and McDougall, J.K. (1996) Telomerase activation by the E6 gene product of human papillomavirus type 16. Nature 380, 79-82.

Klobutcher, L.A., Swanton, M.T., Donini, P. and Prescott, D.M. (1981) All gene-sized DNA molecules in four species of hypotrichs have the same terminal sequence and an unusual 3' terminus. Proc.Natl.Acad.Sci.U.S.A 78, 3015-3019.

Koi, M., Johnson, L.A., Kalikin, L.M., Little, P.F.R., Nakamura, Y. and Feinberg, A.P. (1993) Tumor cell growth arrest caused by subchromosomal transferable DNA fragments from chromosome 11. Science 260, 361-364.

Kolquist, K.A., Ellisen, L.W., Counter, C.M., Meyerson, M., Tan, L.K., Weinberg, R.A., Haber, D.A. and Gerald, W.L. (1998) Expression of TERT in early premalignant lesions and a subset of cells in normal tissues. Nat.Genet. 19, 182-186.

Kota, R.S. and Runge, K.W. (1999) Tel2p, a regulator of yeast telomeric length in vivo, binds to single-stranded telomeric DNA in vitro. Chromosoma 108, 278-290.

Krauskopf, A. and Blackburn, E.H. (1996) Control of telomere growth by interactions of RAP1 with the most distal telomeric repeats. Nature 383, 354-357.

Krauskopf, A. and Blackburn, E.H. (1998) Rap1 protein regulates telomere turnover in yeast. Proc.Natl.Acad.Sci.U.S.A 95, 12486-12491.

Kyo, S., Takakura, M., Kohama, T. and Inoue, M. (1997) Telomerase activity in human endometrium. Cancer Res. 57, 610-614.

Lane, D.P. (1992) Cancer: p53, guardian of the genome. Nature 358, 15-16.

Lane, D.P. and Crawford, L.V. (1979) T antigen is bound to a host protein in SV40-transformed cells. Nature 278, 261-263.

ref-10 Lansdorp, P.M., Poon, S., Chavez, E., Dragowska, V., Zijlmans, M., Bryan, T., Reddel, R., Egholm, M., Bacchetti, S. and Martens, U. (1997) Telomeres in the hematopoietic system. Ciba Found.Symp. 211, 209-218.

Lansdorp, P.M., Verwoerd, N.P., Van de Rijke, F.M., Dragowska, V., Little, M.-T., Dirks, R.W., Raap, A.K. and Tanke, H.J. (1996) Heterogeneity in telomere length of human chromosomes. Hum.Mol.Genet. 5, 685-691.

Lavelle, F., Riou, J.-F., Laoui, A. and Mailliet, P. (2000) Telomerase: a therapeutic target for the third millennium? Crit.Rev.Oncol.Hematol. 34, 111-126.

Le, S., Sternglanz, R. and Greider, C.W. (2000) Identification of two RNA-binding proteins associated with human telomerase RNA. Mol.Biol.Cell 11, 999-1010.

Lee, H.-W., Blasco, M.A., Gottlieb, G.J., Horner, J.W., II, Greider, C.W. and DePinho, R.A. (1998) Essential role of mouse telomerase in highly proliferative organs. Nature 392, 569-574.

Lejnine, S., Makarov, V.L. and Langmore, J.P. (1995) Conserved nucleoprotein structure at the ends of vertebrate and invertebrate chromosomes. Proc.Natl.Acad.Sci.U.S.A 92, 2393-2397.

Levy, M.Z., Allsopp, R.C., Futcher, A.B., Greider, C.W. and Harley, C.B. (1992) Telomere end-replication problem and cell aging. J.Mol.Biol. 225, 951-960.

Li, B. and Lustig, A.J. (1996) A novel mechanism for telomere size control in Saccharomyces cerevisiae. Genes Dev. 10, 1310-1326.

Li, B., Oestreich, S. and de Lange, T. (2000) Identification of human Rap1: Implications for telomere evolution. Cell 101, 471-483.

Lin, A.W., Barradas, M., Stone, J.C., Van Aelst, L., Serrano, M. and Lowe, S.W. (1998) Premature senescence involving p53 and p16 is activated in response to constitutive MEK/MAPK mitogenic signaling. Genes Dev. 12, 3008-3019.

Lindsey, J., McGill, N.I., Lindsey, L.A., Green, D.K. and Cooke, H.J. (1991) In vivo loss of telomeric repeats with age in . Mutat.Res. 256, 45-48.

Lingner, J. and Cech, T.R. (1996) Purification of telomerase from Euplotes aediculatus: Requirement of a primer 3' overhang. Proc.Natl.Acad.Sci.U.S.A 93, 10712-10717.

Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V. and Cech, T.R. (1997) Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276, 561-567.

Linzer, D.I.H. and Levine, A.J. (1979) Characterization of a 54K dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells. Cell 17, 43-52.

Lombard, D.B. and Guarente, L. (2000) Nijmegen breakage syndrome disease protein and MRE11 at PML nuclear bodies and meiotic telomeres. Cancer Res. 60, 2331-2334.

Loughran, O., Malliri, A., Owens, D., Gallimore, P.H., Stanley, M.A., Ozanne, B., Frame, M.C. and Parkinson, E.K. (1996) Association of CDKN2A/p16INK4A with human head and neck keratinocyte replicative senescence: Relationship of dysfunction to immortality and neoplasia. Oncogene 13, 561-568.

ref-11 Ludlow, J.W., Glendening, C.L., Livingston, D.M. and DeCaprio, J.A. (1993) Specific enzymatic dephosphorylation of the retinoblastoma protein. Mol.Cell.Biol. 13, 367-372.

Lundblad, V. and Blackburn, E.H. (1993) An alternative pathway for yeast telomere maintenance rescues est1- senescence. Cell 73, 347-360.

Lundblad, V. and Szostak, J.W. (1989) A mutant with a defect in telomere elongation leads to senescence in yeast. Cell 57, 633-643.

Lupton, S.D., Brunton, L.L., Kalberg, V.A. and Overell, R.W. (1991) Dominant positive and negative selection using a hygromycin phosphotransferase- fusion gene. Mol.Cell.Biol. 11, 3374-3378.

Maclean, K., Rogan, E.M., Whitaker, N.J., Chang, A.C.M., Rowe, P.B., Dalla-Pozza, L., Symonds, G. and Reddel, R.R. (1994) In vitro transformation of Li-Fraumeni syndrome fibroblasts by SV40 large T antigen mutants. Oncogene 9, 719-725.

Makarov, V.L., Hirose, Y. and Langmore, J.P. (1997) Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 88, 657- 666.

Makarov, V.L., Lejnine, S., Bedoyan, J. and Langmore, J.P. (1993) Nucleosomal organization of telomere-specific chromatin in rat. Cell 73, 775-787.

Malkin, D., Li, F.P., Strong, L.C., Fraumeni, J.F., Jr., Nelson, C.E., Kim, D.H., Kassel, J., Gryka, M.A., Bischoff, F.Z., Tainsky, M.A. and Friend, S.H. (1990) Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 250, 1233-1238.

Marcand, S., Brevet, V. and Gilson, E. (1999) Progressive cis-inhibition of telomerase upon telomere elongation. EMBO J. 18, 3509-3519.

Marcand, S., Gilson, E. and Shore, D. (1997) A protein-counting mechanism for telomere length regulation in yeast. Science 275, 986-990.

Martin, G.M., Sprague, C.A. and Epstein, C.J. (1970) Replicative life-span of cultivated human cells. Effect of donor's age, tissue, and genotype. Lab.Invest. 23, 86-92.

McClintock, B. (1941) The stability of broken ends of chromosomes in Zea mays. Genetics 26, 234-282.

McEachern, M.J. and Blackburn, E.H. (1996) Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomerase. Genes Dev. 10, 1822-1834.

McElligott, R. and Wellinger, R.J. (1997) The terminal DNA structure of mammalian chromosomes. EMBO J. 16, 3705-3714.

Meyerson, M., Counter, C.M., Eaton, E.N., Ellisen, L.W., Steiner, P., Dickinson Caddle, S., Ziaugra, L., Beijersbergen, R.L., Davidoff, M.J., Liu, Q., Bacchetti, S., Haber, D.A. and Weinberg, R.A. (1997) hEST2, the putative human telomerase catalytic subunit gene, is up- regulated in tumor cells and during immortalization. Cell 90, 785-795.

ref-12 Montalto, M.C. and Ray, F.A. (1996) Telomerase activation during the linear evolution of human fibroblasts to tumorigenicity in nude mice. Carcinogenesis 17, 2631-2634.

Morales, C.P., Holt, S.E., Ouellette, M., Kaur, K.J., Yan, Y., Wilson, K.S., White, M.A., Wright, W.E. and Shay, J.W. (1999) Absence of cancer-associated changes in human fibroblasts immortalized with telomerase. Nat.Genet. 21, 115-118.

Morin, G.B. (1989) The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59, 521-529.

Moyzis, R.K. (1991) The human telomere. Sci.Am. 265, 48-55.

Moyzis, R.K., Buckingham, J.M., Cram, L.S., Dani, M., Deaven, L.L., Jones, M.D., Meyne, J., Ratliff, R.L. and Wu, J.-R. (1988) A highly conserved repetitive DNA sequence, (TTAGGG)n, present at the telomeres of human chromosomes. Proc.Natl.Acad.Sci.U.S.A 85, 6622-6626.

Muggleton-Harris, A.L. and DeSimone, D.W. (1980) Replicative potentials of various fusion products between WI-38 and SV40 transformed WI-38 cells and their components. Somatic Cell Genet. 6, 689-698.

Muller, H.J. (1938) The remaking of chromosomes. Collecting Net 13, 181-198.

Murnane, J.P., Sabatier, L., Marder, B.A. and Morgan, W.F. (1994) Telomere dynamics in an immortal human cell line. EMBO J. 13, 4953-4962.

Nakabayashi, K., Ogata, T., Fujii, M., Tahara, H., Ide, T., Wadhwa, R., Kaul, S.C., Mitsui, Y. and Ayusawa, D. (1997) Decrease in amplified telomeric sequences and induction of senescence markers by introduction of human chromosome 7 or its segments in SUSM-1. Exp.Cell Res. 235, 345-353.

Nakabayashi, K., Ogino, H., Michishita, E., Satoh, N. and Ayusawa, D. (1999) Introduction of chromosome 7 suppresses telomerase with shortening of telomeres in a human mesothelial cell line. Exp.Cell Res. 252, 376-382.

Nakamura, T.M., Morin, G.B., Chapman, K.B., Weinrich, S.L., Andrews, W.H., Lingner, J., Harley, C.B. and Cech, T.R. (1997) Telomerase catalytic subunit homologs from fission yeast and human. Science 277, 955-959.

Nakayama, J.-I., Saito, M., Nakamura, H., Matsuura, A. and Ishikawa, F. (1997) TLP1: A gene encoding a protein component of mammalian telomerase is a novel member of WD repeats family. Cell 88, 1-20.

Namba, M., Nishitani, K., Fukushima, F., Kimoto, T., Utsunomiya, J. and Hayflick, L. (1981) Neoplastic transformation of human diploid fibroblasts treated with chemical carcinogens and Co-60 gamma rays. GANN Monogr.Cancer Res. 27, 221-230.

Negrini, M., Sabbioni, S., Possati, L., Rattan, S., Corallini, A., Barbanti-Brodano, G. and Croce, C.M. (1994) Suppression of tumorigenicity of breast cancer cells by microcell-mediated chromosome transfer: Studies on chromosomes 6 and 11. Cancer Res. 54, 1331-1336.

Newbold, R.F. and Overell, R.W. (1983) Fibroblast immortality is a prerequisite for transformation by EJ c-Ha-ras oncogene. Nature 304, 648-651.

ref-13 Newbold, R.F., Overell, R.W. and Connell, J.R. (1982) Induction of immortality is an early prerequisite event in malignant transformation of mammalian cells by carcinogens. Nature 299, 633-635.

Niida, H., Shinkai, Y., Hande, M.P., Matsumoto, T., Takehara, S., Tachibana, M., Oshimura, M., Lansdorp, P.M. and Furuichi, Y. (2000) Telomere maintenance in telomerase-deficient mouse embryonic stem cells: Characterization of an amplified telomeric DNA. Mol.Cell.Biol. 20, 4115-4127.

Ning, Y., Weber, J.L., Killary, A.M., Ledbetter, D.H., Smith, J.R. and Pereira-Smith, O.M. (1991) Genetic analysis of indefinite division in human cells: Evidence for a cell senescence- related gene(s) on human chromosome 4. Proc.Natl.Acad.Sci.U.S.A 88, 5635-5639.

Noble, J.R., Rogan, E.M., Neumann, A.A., Maclean, K., Bryan, T.M. and Reddel, R.R. (1996) Association of extended in vitro proliferative potential with loss of p16INK4 expression. Oncogene 13, 1259-1268.

Nugent, C.I., Bosco, G., Ross, L.O., Evans, S.K., Salinger, A.P., Moore, J.K., Haber, J.E. and Lundblad, V. (1998) Telomere maintenance is dependent on activities required for end repair of double-strand breaks. Curr.Biol. 8, 657-660.

Nugent, C.I., Hughes, T.R., Lue, N.F. and Lundblad, V. (1996) Cdc13p: A single-strand telomeric DNA binding protein with a dual role in yeast telomere maintenance. Science 274 , 249-252.

O'Brien, W., Stenman, G. and Sager, R. (1986) Suppression of tumor growth by senescence in virally transformed human fibroblasts. Proc.Natl.Acad.Sci.U.S.A 83, 8659-8663.

Ogata, T., Ayusawa, D., Namba, M., Takahashi, E., Oshimura, M. and Oishi, M. (1993) Chromosome 7 suppresses indefinite division of nontumorigenic immortalized human fibroblast cell lines KMST-6 and SUSM-1. Mol.Cell.Biol. 13, 6036-6043.

Ogata, T., Oshimura, M., Namba, M., Fujii, M., Oishi, M. and Ayusawa, D. (1995) Genetic complementation of the immortal phenotype in group D cell lines by introduction of chromosome 7. Jpn.J.Cancer Res. 86, 35-40.

Ogryzko, V.V., Hirai, T.H., Russanova, V.R., Barbie, D.A. and Howard, B.H. (1996) Human fibroblast commitment to a senescence-like state in response to histone deacetylase inhibitors is cell cycle dependent. Mol.Cell.Biol. 16, 5210-5218.

Ohmura, H., Tahara, H., Suzuki, M., Ide, T., Shimizu, M., Yoshida, M.A., Tahara, E., Shay, J.W., Barrett, J.C. and Oshimura, M. (1995) Restoration of the cellular senescence program and repression of telomerase by human chromosome 3. Jpn.J.Cancer Res. 86, 899-904.

Okamoto, A., Demetrick, D.J., Spillare, E.A., Hagiwara, K., Hussain, S.P., Bennett, W.P., Forrester, K., Gerwin, B., Serrano, M., Beach, D.H. and Harris, C.C. (1994) Mutations and altered expression of p16INK4 in human cancer. Proc.Natl.Acad.Sci.U.S.A 91, 11045-11049.

Olovnikov, A.M. (1971) [Principle of marginotomy in template synthesis of polynucleotides]. Doklady Akademii Nauk SSR 201, 1496-1499.

ref-14 Olovnikov, A.M. (1973) A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J.Theor.Biol. 41, 181-190.

Oshimura, M. and Barrett, J.C. (1997) Multiple pathways to cellular senescence: Role of telomerase repressors. Eur.J.Cancer 33A, 710-715.

Ozer, H.L. (2000) SV40-mediated immortalization. Prog.Mol.Subcell.Biol. 24, 121-153.

Ozer, H.L., Banga, S.S., Dasgupta, T., Houghton, J., Hubbard, K., Jha, K.K., Kim, S.-H., Lenahan, M., Pang, Z., Pardinas, J.R. and Patsalis, P.C. (1996) SV40-mediated immortalization of human fibroblasts. Exp.Gerontol. 31, 303-310.

Palmero, I., McConnell, B., Parry, D., Brookes, S., Hara, E., Bates, S., Jat, P. and Peters, G. (1997) Accumulation of p16INK4a in mouse fibroblasts as a function of replicative senescence and not of retinoblastoma gene status. Oncogene 15, 495-503.

Paull, T.T. and Gellert, M. (1999) Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13, 1276-1288.

Pecoraro, G., Morgan, D. and Defendi, V. (1989) Differential effects of human papillomavirus type 6, 16, and 18 DNAs on immortalization and transformation of human cervical epithelial cells. Proc.Natl.Acad.Sci.U.S.A 86, 563-567.

Pereira-Smith, O.M. and Smith, J.R. (1983) Evidence for the recessive nature of cellular immortality. Science 221, 964-966.

Pereira-Smith, O.M. and Smith, J.R. (1988) Genetic analysis of indefinite division in human cells: Identification of four complementation groups. Proc.Natl.Acad.Sci.U.S.A 85, 6042-6046.

Perrem, K., Bryan, T.M., Englezou, A., Hackl, T., Moy, E.L. and Reddel, R.R. (1999) Repression of an alternative mechanism for lengthening of telomeres in somatic cell hybrids. Oncogene 18, 3383-3390.

Petersen, S., Saretzki, G. and Von Zglinicki, T. (1998) Preferential accumulation of single- stranded regions in telomeres of human fibroblasts. Exp.Cell Res. 239, 152-160.

Plummer, S.J., Adams, L., Simmons, J.A. and Casey, G. (1997) Localization of a growth suppressor activity in MCF7 breast cancer cells to chromosome 17q24-q25. Oncogene 14, 2339-2345.

Pluta, A.F. and Zakian, V.A. (1989) Recombination occurs during telomere formation in yeast. Nature 337, 429-433.

Quignon, F., De Bels, F., Koken, M., Feunteun, J., Ameisen, J.-C. and De Thé, H. (1998) PML induces a novel caspase-independent death process. Nat.Genet. 20, 259-265.

Ramakrishnan, S., Eppenberger, U., Mueller, H., Shinkai, Y. and Narayanan, R. (1998) Expression profile of the putative catalytic subunit of the telomerase gene. Cancer Res. 58, 622-625.

ref-15 Ramirez, R.D., Wright, W.E., Shay, J.W. and Taylor, R.S. (1997) Telomerase activity concentrates in the mitotically active segments of human hair follicles. J.Invest.Dermatol. 108, 113-117.

Ray, F.A. and Kraemer, P.M. (1992) Frequent deletions in nine newly immortal human cell lines. Cancer Genet.Cytogenet. 59, 39-44.

Reddel, R. (1998) A reassessment of the telomere hypothesis of senescence. BioEssays 20, 977-984.

Reddel, R.R. (1998) Genes involved in the control of cellular proliferative potential. Ann.N.Y.Acad.Sci. 854, 8-19.

Reddel, R.R. (2000) The role of senescence and immortalization in carcinogenesis. Carcinogenesis 21, 477-484.

Reddel, R.R., Bryan, T.M., Colgin, L.M., Perrem, K.T. and Yeager, T.R. (2001) Alternative lengthening of telomeres in human cells. Radiat.Res. 155, 194-200.

Reddel, R.R., Bryan, T.M. and Murnane, J.P. (1997) Immortalized cells with no detectable telomerase activity. A review. Biochemistry (Mosc) 62, 1254-1262.

Reddel, R.R., De Silva, R., Duncan, E.L., Rogan, E.M., Whitaker, N.J., Zahra, D.G., Ke, Y., McMenamin, M.G., Gerwin, B.I. and Harris, C.C. (1995) SV40-induced immortalization and ras-transformation of human bronchial epithelial cells. Int.J.Cancer 61, 199-205.

Reddel, R.R., Ke, Y., Kaighn, M.E., Malan-Shibley, L., Lechner, J.F., Rhim, J.S. and Harris, C.C. (1988) Human bronchial epithelial cells neoplastically transformed by v-Ki-ras: Altered response to inducers of terminal squamous differentiation. Oncogene Res. 3, 401-408.

Reznikoff, C.A., Yeager, T.R., Belair, C.D., Savelieva, E., Puthenveettil, J.A. and Stadler, W.M. (1996) Elevated p16 at senescence and loss of p16 at immortalization in human papillomavirus 16 E6, but not E7, transformed human uroepithelial cells. Cancer Res. 56, 2886-2890.

Riethman, H.C., Xiang, Z., Paul, S., Morse, E., Hu, X.-L., Flint, J., Chi, H.-C., Grady, D.L. and Moyzis, R.K. (2001) Integration of telomere sequences with the draft human genome sequence. Nature 409, 948-951.

Rinker-Schaeffer, C.W., Hawkins, A.L., Ru, N., Dong, J., Stoica, G., Griffin, C.A., Ichikawa, T., Barrett, J.C. and Isaacs, J.T. (1994) Differential suppression of mammary and by human chromosomes 17 and 11. Cancer Res. 54, 6249-6256.

Ritchie, K.B. and Petes, T.D. (2000) The mre11p/Rad50p/Xrs2p complex and the tel1p function in a single pathway for telomere maintenance in yeast. Genetics 155, 475-479.

Robles, S.J. and Adami, G.R. (1998) Agents that cause DNA double strand breaks lead to p16INK4a enrichment and the premature senescence of normal fibrolasts. Oncogene 16, 1113- 1123.

Rogan, E.M., Bryan, T.M., Hukku, B., Maclean, K., Chang, A.C.M., Moy, E.L., Englezou, A., Warneford, S.G., Dalla-Pozza, L. and Reddel, R.R. (1995) Alterations in p53 and p16INK4 expression and telomere length during spontaneous immortalization of Li-Fraumeni syndrome fibroblasts. Mol.Cell.Biol. 15, 4745-4753.

ref-16 Roth, C.W., Kobeski, F., Walter, M.F. and Biessmann, H. (1997) Chromosome end elongation by recombination in the mosquito Anopheles gambiae. Mol.Cell.Biol. 17, 5176-5183.

Rubelj, I. and Pereira-Smith, O.M. (1994) SV40-transformed human cells in crisis exhibit changes that occur in normal cellular senescence. Exp.Cell Res. 211, 82-89.

Sager, R. (1991) Senescence as a mode of tumor suppression. Environ.Health Perspect. 93, 59-62.

Saito, T., Schneider, A., Martel, N., Mizumoto, H., Bulgay-Moerschel, M., Kudo, R. and Nakazawa, H. (1997) Proliferation-associated regulation of telomerase activity in human endometrium and its potential implication in early cancer diagnosis. Biochem.Biophys.Res.Commun. 231, 610-614.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: A laboratory manual, 2 edn. New York: Cold Spring Harbor Laboratory Press.

Sandhu, A.K., Hubbard, K., Kaur, G.P., Jha, K.K., Ozer, H.L. and Athwal, R.S. (1994) Senescence of immortal human fibroblasts by the introduction of normal human chromosome 6. Proc.Natl.Acad.Sci.U.S.A 91, 5498-5502.

Sandhu, A.K., Kaur, G.P., Reddy, D.E., Rane, N.S. and Athwal, R.S. (1996) A gene on 6q 14- 21 restores senescence to immortal ovarian tumor cells. Oncogene 12, 247-252.

Saxon, P.J. and Stanbridge, E.J. (1987) Transfer and selective retention of single specific human chromosomes via microcell-mediated chromosome transfer. Methods Enzymol. 151, 313-325.

Scheffner, M., Werness, B.A., Huibregtse, J.M., Levine, A.J. and Howley, P.M. (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-1136.

Schlegel, R., Phelps, W.C., Zhang, Y.-L. and Barbosa, M. (1988) Quantitative keratinocyte assay detects two biological activities of human papilloma virus DNA and identifies viral types associated with cervical carcinoma. EMBO J. 7, 3181-3187.

Schneider, E.L. and Mitsui, Y. (1976) The relationship between in vitro cellular aging and in vivo human age. Proc.Natl.Acad.Sci.U.S.A 73, 3584-3588.

Serrano, M., Hannon, G.J. and Beach, D. (1993) A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366, 704-707.

Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D. and Lowe, S.W. (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593-602.

Shampay, J., Szostak, J.W. and Blackburn, E.H. (1984) DNA sequences of telomeres maintained in yeast. Nature 310, 154-157.

Shay, J.W. and Bacchetti, S. (1997) A survey of telomerase activity in human cancer. Eur.J.Cancer 33, 787-791.

ref-17 Shen, M., Haggblom, C., Vogt, M., Hunter, T. and Lu, K.P. (1997) Characterization and cell cycle regulation of the related human telomeric proteins Pin2 and TRF1 suggest a role in mitosis. Proc.Natl.Acad.Sci.U.S.A 94, 13618-13623.

Sherr, C.J. (1996) Cancer cell cycles. Science 274, 1672-1677.

Shore, D. (1994) RAP1: a protean regulator in yeast. Trends Genet. 10, 408-412.

Sitte, N., Saretzki, G. and Von Zglinicki, T. (1998) Accelerated telomere shortening in flbroblasts after extended periods of confluency. Free Radic.Biol.Med. 24, 885-893.

Slagboom, P.E., Droog, S. and Boomsma, D.I. (1994) Genetic determination of telomere size in humans: A twin study of three age groups. Am.J.Hum.Genet. 55, 876-882.

Smith, S., Giriat, I., Schmitt, A. and de Lange, T. (1998) Tankyrase, a poly(ADP-ribose) polymerase at human telomeres. Science 282, 1484-1487.

Smogorzewska, A., van Steensel, B., Bianchi, A., Oelmann, S., Schaefer, M.R., Schnapp, G. and de Lange, T. (2000) Control of human telomere length by TRF1 and TRF2. Mol.Cell.Biol. 20, 1659-1668.

Sprung, C.N., Sabatier, L. and Murnane, J.P. (1999) Telomere dynamics in a human cancer cell line. Exp.Cell Res. 247, 29-37.

Srivastava, S., Zou, Z., Pirollo, K., Blattner, W. and Chang, E.H. (1990) Germ-line transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumeni syndrome. Nature 348, 747- 749.

Steinert, S., Shay, J.W. and Wright, W.E. (2000) Transient expression of human telomerase extends the life span of normal human fibroblasts. Biochem.Biophys.Res.Commun. 273, 1095- 1098.

Tanaka, H., Horikawa, I., Kugoh, H., Shimizu, M., Barrett, J.C. and Oshimura, M. (1999) Telomerase-independent senescence of human immortal cells induced by microcell-mediated chromosome transfer. Mol.Carcinog. 25, 249-255.

Tanaka, H., Shimizu, M., Horikawa, I., Kugoh, H., Yokota, J., Barrett, J.C. and Oshimura, M. (1998) Evidence for a putative telomerase repressor gene on the 3p14.2-p21.1 region. Genes Chrom.Cancer 23, 123-133.

Taylor, R.S., Ramirez, R.D., Ogoshi, M., Chaffins, M., Piatyszek, M.A. and Shay, J.W. (1996) Detection of telomerase activity in malignant and nonmalignant skin conditions. J.Invest.Dermatol. 106, 759-765.

Teng, S.-C., Chang, J., McCowan, B. and Zakian, V.A. (2000) Telomerase-independent lengthening of yeast telomeres occurs by an abrupt Rad50p-dependent, Rif-inhibited recombinational process. Mol.Cell 6, 947-952.

Teng, S.-C. and Zakian, V.A. (1999) Telomere-telomere recombination is an efficient bypass pathway for telomere maintenance in Saccharomyces cerevisiae. Mol.Cell.Biol. 19, 8083-8093.

Tommerup, H., Dousmanis, A. and de Lange, T. (1994) Unusual chromatin in human telomeres. Mol.Cell.Biol. 14, 5777-5785.

ref-18 Trent, J.M., Stanbridge, E.J., McBride, H.L., Meese, E.U., Casey, G., Araujo, D.E., Witkowski, C.M. and Nagle, R.B. (1990) Tumorigenicity in human melanoma cell lines controlled by introduction of human chromosome 6. Science 247, 568-571.

Tresini, M., Mawal-Dewan, M., Cristofalo, V.J. and Sell, C. (1998) A phosphatidylinositol 3- kinase inhibitor induces a senescent-like growth arrest in human diploid fibroblasts. Cancer Res. 58, 1-4.

Uejima, H., Shinohara, T., Nakayama, Y., Kugoh, H. and Oshimura, M. (1998) Mapping a novel cellular-senescence gene to human chromosome 2q37 by irradiation microcell-mediated chromosome transfer. Mol.Carcinog. 22, 34-45. van Steensel, B. and de Lange, T. (1997) Control of telomere length by the human telomeric protein TRF1. Nature 385, 740-743. van Steensel, B., Smogorzewska, A. and de Lange, T. (1998) TRF2 protects human telomeres from end-to-end fusions. Cell 92, 401-413.

Vaziri, H. and Benchimol, S. (1998) Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr.Biol. 8, 279-282.

Vaziri, H., Dragowska, W., Allsopp, R.C., Thomas, T.E., Harley, C.B. and Lansdorp, P.M. (1994) Evidence for a mitotic clock in human hematopoietic stem cells: Loss of telomeric DNA with age. Proc.Natl.Acad.Sci.U.S.A 91, 9857-9860.

Vaziri, H., Schächter, F., Uchida, I., Wei, L., Zhu, X., Effros, R., Cohen, D. and Harley, C.B. (1993) Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am.J.Hum.Genet. 52, 661-667.

Venable, M.E., Lee, J.Y., Smyth, M.J., Bielawska, A. and Obeid, L.M. (1995) Role of ceramide in cellular senescence. J.Biol.Chem. 270, 30701-30708.

Von Zglinicki, T., Saretzki, G., Döcke, W. and Lotze, C. (1995) Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: A model for senescence? Exp.Cell Res. 220, 186-193.

Wang, J., Hannon, G.J. and Beach, D.H. (2000) : Risky immortalization by telomerase. Nature 405, 755-756.

Watson, J.D. (1972) Origin of concatemeric T7 DNA. Nat.New Biol. 239, 197-201.

Weeda, G., Donker, I., De Wit, J., Morreau, H., Janssens, R., Vissers, C.J., Nigg, A., Van Steeg, H., Bootsma, D. and Hoeijmakers, J.H.J. (1997) Disruption of mouse ERCC1 results in a novel repair syndrome with growth failure, nuclear abnormalities and senescence. Curr.Biol. 7, 427- 439.

Weinrich, S.L., Pruzan, R., Ma, L., Ouellette, M., Tesmer, V.M., Holt, S.E., Bodnar, A.G., Lichtsteiner, S., Kim, N.W., Trager, J.B., Taylor, R.D., Carlos, R., Andrews, W.H., Wright, W.E., Shay, J.W., Harley, C.B. and Morin, G.B. (1997) Reconstitution of human telomerase with the template RNA component hTR and the catalytic protein subunit hTRT. Nat.Genet. 17, 498-502.

ref-19 Wellinger, R.J., Ethier, K., Labrecque, P. and Zakian, V.A. (1996) Evidence for a new step in telomere maintenance. Cell 85, 423-433.

Wen, J., Cong, Y.-S. and Bacchetti, S. (1998) Reconstitution of wild-type or mutant telomerase activity in telomerase negative immortal human cells. Hum.Mol.Genet. 7, 1137-1141.

Weng, N.-P., Hathcock, K.S. and Hodes, R.J. (1998) Regulation of telomere length and telomerase in T and B cells: A mechanism for maintaining replicative potential. Immunity 9 , 151-157.

Werness, B.A., Levine, A.J. and Howley, P.M. (1990) Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76-79.

Whitaker, N.J., Bryan, T.M., Bonnefin, P., Chang, A.C.M., Musgrove, E.A., Braithwaite, A.W. and Reddel, R.R. (1995) Involvement of RB-1, p53, p16INK4 and telomerase in immortalisation of human cells. Oncogene 11, 971-976.

Wolthers, K.C. and Miedema, F. (1998) Telomeres and HIV-1 infection: In search of exhaustion. Trends Microbiol. 6, 144-147.

Woodworth, C.D., Doniger, J. and DiPaolo, J.A. (1989) Immortalization of human foreskin keratinocytes by various human papillomavirus DNAs corresponds to their association with cervical carcinoma. J.Virol. 63, 159-164.

Wotton, D. and Shore, D. (1997) A novel Rap1p-interacting factor, Rif2p, cooperates with Rif1p to regulate telomere length in Saccharomyces cerevisiae. Genes Dev. 11, 748-760.

Wright, J.H., Gottschling, D.E. and Zakian, V.A. (1992) Saccharomyces telomeres assume a non-nucleosomal chromatin structure. Genes Dev. 6, 197-210.

Wright, W.E., Pereira-Smith, O.M. and Shay, J.W. (1989) Reversible cellular senescence: Implications for immortalization of normal human diploid fibroblasts. Mol.Cell.Biol. 9, 3088- 3092.

Wright, W.E., Shay, J.W. and Piatyszek, M.A. (1995) Modifications of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity. Nucleic Acids Res. 23, 3794-3795.

Wu, G., Lee, W.-H. and Chen, P.-L. (2000) NBS1 and TRF1 colocalize at promyelocytic leukemia bodies bodies during late S/G2 phases in immortalized telomerase-negative cells: Implication of NBS1 in alternative lengthening of telomeres. J.Biol.Chem. 275, 30618-30622.

Xiao, H., Hasegawa, T., Miyaishi, O., Ohkusu, K. and Isobe, K. (1997) Sodium butyrate induces NIH3T3 cells to senescence-like state and enhances promoter activity of p21WAF/CIP1 in p53-independent manner. Biochem.Biophys.Res.Commun. 237, 457-460.

Yamada, H., Wake, N., Fujimoto, S., Barrett, J.C. and Oshimura, M. (1990) Multiple chromosomes carrying tumor suppressor activity for a uterine endometrial carcinoma cell line identified by microcell-mediated chromosome transfer. Oncogene 5, 1141-1147.

Yang, X., Tahin, Q., Hu, Y.-F., Russo, I.H., Balsara, B.R., Mihaila, D., Slater, C., Barrett, J.C. and Russo, J. (1999) Functional roles of chromosomes 11 and 17 in the transformation of human breast epithelial cells in vitro. Int.J.Oncol. 15, 629-638.

ref-20 Yasumoto, S., Kunimura, C., Kikuchi, K., Tahara, H., Ohji, H., Yamamoto, H., Ide, T. and Utakoji, T. (1996) Telomerase activity in normal human epithelial cells. Oncogene 13, 433- 439.

Yeager, T.R., Neumann, A.A., Englezou, A., Huschtscha, L.I., Noble, J.R. and Reddel, R.R. (1999) Telomerase-negative immortalized human cells contain a novel type of promyelocytic leukemia (PML) body. Cancer Res. 59, 4175-4179.

Zhang, X., Mar, V., Zhou, W., Harrington, L. and Robinson, M.O. (1999) Telomere shortening and apoptosis in telomerase-inhibited human tumor cells. Genes Dev. 13, 2388-2399.

Zhu, J., Wang, H., Bishop, J.M. and Blackburn, E.H. (1999) Telomerase extends the lifespan of virus-transformed human cells without net telomere lengthening. Proc.Natl.Acad.Sci.U.S.A 96, 3723-3728.

Zhu, X.-D., Küster, B., Mann, M., Petrini, J.H.J. and de Lange, T. (2000) Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat.Genet. 25, 347- 352.

ref-21