SPOTLIGHT Kinase Is Constitutively Activated As a Consequence of Fusion to a Marrow with Granulocytic Hyperplasia

Leukemia (2005) 19, 27–30 & 2005 Nature Publishing Group All rights reserved 0887-6924/05 $30.00 www.nature.com/leu KIAA1509 is a novel PDGFRB fusion partner in imatinib-responsive myeloproliferative disease associated with a t(5;14)(q33;q32)

RL Levine1,2,5, M Wadleigh2,5, DW Sternberg3, I Wlodarska4, I Galinsky2, RM Stone2, DJ DeAngelo2, D Gary Gilliland1 and J Cools4

1Division of Hematology, Brigham and Women’s Hospital and Howard Hughes Medical Institute, Harvard Medical School, Boston, MA, USA; 2Division of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA; 3Division of Hematology/ Oncology, Mount Sinai School of Medicine, New York, NY, USA; and 4Department of Human Genetics – Flanders Interuniversity Institute for Biotechnology (VIB), University of Leuven, Leuven, Belgium

We report the cloning of a novel PDGFRB fusion gene partner in translocations involving PDGFRB in MPDs where the fusion a patient with a chronic myeloproliferative disorder character- partner is not yet known.13 ized by t(5;14)(q33;q32), who responded to treatment with imatinib mesylate. Fluorescence in situ hybridization demon- Imatinib mesylate (Gleevec; Novartis, Basel, Switzerland) is a strated that PDGFRB was involved in the translocation. Long specific tyrosine kinase inhibitor with clinical activity in chronic distance inversion PCR identified KIAA1509 as the PDGFRB myelogenous leukemia, hypereosinophilic syndrome, and gas- fusion partner. KIAA1509 is an uncharacterized gene with a trointestinal stromal tumors.2,14,15 Based on the observation that predicted coiled-coil oligomerization domain with homology to imatinib inhibits the growth of ETV6-PDGFRB transformed cells, the HOOK family of proteins. The predicted KIAA1509-PDGFRb imatinib has been administered to three CMML patients with the fusion protein contains the KIAA1509 coiled-coil domain fused ETV6-PDGFRB fusion; durable responses were seen in all three to the cytoplasmic domain of PDGFRb that includes the 16 tyrosine kinase domain. Imatinib therapy resulted in rapid cases. Similar responses to imatinib have been reported in normalization of the patient’s blood counts, and subsequent patients with the PDE4DIP-PDGFRB and NIN-PDGFRB fusion bone marrow biopsies and karyotypic analysis were consistent genes, and in a patient with the RABEP1-PDGFRB fusion gene with sustained complete remission. with a molecular relapse after allogeneic bone marrow Leukemia (2005) 19, 27–30. doi:10.1038/sj.leu.2403548 transplantation.8,9,17 Published online 21 October 2004 Keywords: translocation; imatinib; myeloproliferative disorder In this report we describe a patient with a myeloproliferative disorder characterized by the chromosomal abnormality t(5;14)(q33;q32). The consequence of the chromosomal translocation is fusion of the coiled-coil domain of KIAA1509 to the tyrosine kinase domain of PDGFRb. Imatinib therapy resulted in Introduction a rapid, complete, and durable hematologic and cytogenetic response. Fusion genes that result in constitutive activation of tyrosine kinases characterize a subset of chronic myeloproliferative disorders. These fusion genes are the result of chromosomal Materials and methods translocations or interstitial deletions.1,2 In chronic myelomonocytic leukemia (CMML), a subset of patients have balanced Study design translocations involving the platelet-derived growth factor receptor beta (PDGFRB) gene. To date, eight PDGFRB fusion In July 2002, a 42-year-old man was incidentally noted to partners (ETV6, CEV14, HIP1, H4/D10S170, RABEP1, Myome- m 3– have a white blood cell count of 64 900/ l with 41% galin/PDE4DIP, NIN, and HCMOGT-1) have been identified. bands, 21% neutrophils, 7% lymphocytes, 5% eosinophils, 10 In each case, chromosomal translocation results in fusion of 12% monocytes, and 4% metamyelocytes. His platelet 0 0 the 3 region of PDGFRB encoding the kinase domain to a 5 count was 176 000/ml and his hemoglobin was 9.0 g/dl. fusion partner with a putative oligomerization domain. It has Physical examination revealed no lymphadenopathy or been demonstrated in most of these that the PDGFRb tyrosine splenomegaly. Bone marrow biopsy revealed a hypercellular SPOTLIGHT kinase is constitutively activated as a consequence of fusion to a marrow with granulocytic hyperplasia. Cytogenetic analysis dimerization or oligomerization motif in the amino-terminal revealed t(5;14)(q31;q32) in 14 of 16 metaphases analyzed partner. For example, fusion of the ETV6 PNT oligomerization and inv(9)(p23;q13) in all metaphases analyzed. The BCR-ABL domain to PDGFRb results in self-association and constitutive fusion gene was not detected. The patient was enrolled tyrosine kinase activity, and both the oligomerization and kinase 11 in a clinical trial using imatinib mesylate in patients domains are required for transformation of hematopoetic cells. with CMML, which was defined as a t(9;22) negative Mice engineered to express the ETV6-PDGFRb fusion protein myeloproliferative disorder associated with a peripheral blood using a lymphoid-specific promoter developed T and B cell monocytosis greater than 1000/ml. Patients on this trial were lymphomas, and treatment with imatinib results in prolonged 11,12 treated with a daily oral dose of 400 mg imatinib and survival in these mice. There are additional reports of were monitored with weekly blood counts and bone marrow examinations every 3 months. Correspondence: Dr D Gary Gilliland, Division of Hematology, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 02115, USA; Fax: þ 1 617 355 9093; E-mail: [email protected] Fluorescence in situ hybridization 5These authors contributed equally to this work. Received 20 July 2004; accepted 25 August 2004; Published online Fluorescence in situ hybridization (FISH) was performed as 21 October 2004 described previously.18 Cosmid probes c4-6, c4-1, and c12 KIAA1509 is a novel fusion partner to PDGFRB RL Levine et al 28 spanning the PDGFRB gene were kindly provided by Dr M WBC Positive Metaphases Dixon (University of Manchester, Manchester, UK). Start Imatinib

180000 100% Molecular cloning of the genomic breakpoint 160000 140000 80% Rapid amplification of cDNA ends (RACE) was performed as 120000 19 60% previously described. Long distance inversion PCR (LDI-PCR) 100000 was performed as previously described.20 EcoRV was chosen for 80000 digestion based on the identification of a single EcoRV 40% restriction site within the kinase domain of the PDGFRB gene WBC (th/ul) 60000 40000 without additional restriction sites within 10Kb of upstream 20% %Positive Metaphases genomic sequence. LDI-PCR was performed using primers 20000 0 0 PDGFRB-LDI1 (5 cctcaatgctaggcagttcc) and PDGFRB-RV1 (5 - 0 0% 0 28 54 90 -35 -16 461 201 231 115 145 173 315 343 545 259 ctgtggccaactgggtctat) in the first PCR and PDGFRB-LDI2 284 0 0 -108 (5 ccaacttgagtccccacact) and PDGFRB-RV2 (5 tcctcagcattat Day

gcaacca) in the nested PCR. The sequence of the LDI-PCR Positive 14 13 16 0 0 0 0 product was analyzed using the BLAST program (http:// Metaphases Metaphases www.ncbi.nlm.nih.gov/BLAST). The genomic breakpoint was 16 13 16 12 6 20 20

SPOTLIGHT Analyzed amplified from patient DNA using primers KIAA1509-F3 (50- cttatttgggatggagccct) and PDGFRB-R1 (50-accaggtagggtact Figure 1 White blood cell count of patient with t(5;14)(q33;q32) cggct). The fusion transcript was amplified using primers before and after initiation of imatinib therapy. The graph shows the KIAA1509-RTF1 (50-ccgggacacagataaga) and PDGFRB-RTR1 patient’s total peripheral white blood cell count and percentage of 0 metaphases positive for t(5;14)q33;q32), measured at the time of (5 -catgatcttcagctccgaca). diagnosis and then subsequently while enrolled in a clinical trial of imatinib therapy in chronic myelomonocytic leukemia. The table specifies the number of positive metaphases and total number of Results and discussion metaphases analyzed for each timepoint where cytogenetic analysis was performed. Response to imatinib

The patient initiated treatment with imatinib in October 2002; by that time his white blood cell count had increased to 168 000/ml, his spun hematocrit had decreased to 25%, and his der(5) der(5) platelet count was 178 000/ml. After 1 month of therapy, he was in a hematologic remission with a normal complete blood count and differential (Figure 1). After 3 months of therapy a bone marrow biopsy showed a hypocellular marrow with one focus of 5 5 hypercellularity and ﬁbrosis. Cytogenetic analysis did not identify the t(5;14)(q33;q32) in any cells analyzed, though inv(9)(p23;q13) was again identiﬁed in all cells analyzed, der(14) der(14) suggesting a constitutional origin of inv(9). At 18 months of follow-up, the patient remains in a cytogenetic remission; his most recent bone marrow examination revealed a normo- cellular marrow with a normal myeloid to erythroid ratio. He Figure 2 Fluorescence in situ hybridization demonstrates a breakpoint within the PDGFRB locus in a patient with has tolerated therapy well with only grade 1 periorbital edema, t(5;14)(q33;q32). Three-color FISH analysis with three cosmid probes and he continues on imatinib 400 mg daily. (c4-6: yellow; c4-1: green; c12-a: red) spanning the PDGFRB gene were used to document a break within PDGFRB.

Molecular cloning of the t(5;14)(q33;q32)

FISH analysis (Figure 2) confirmed that the breakpoint involved mRNA encodes a 1935 amino-acid protein with 73% amino- the PDGFRB locus. Initial attempts to identify the fusion partner acid homology to the mouse 0610010D24Rik (Daple) protein. using RACE were unsuccessful, presumably due to a paucity of Daple was identified based on its interaction with Dvl, and RNA. We then used LDI-PCR to amplify the translocation Daple has been shown to inhibit Wnt-3a-dependent accumula- breakpoint in genomic DNA. A 3Kb PCR product was identified, tion of b-catenin.22 and sequence analysis of this PCR product revealed a fusion The in-frame fusion transcript encodes a 934 amino-acid between intron 9 of KIAA1509 and intron 10 of PDGFRB. The protein composed of the N-terminal 355 amino acids of the fusion was confirmed by PCR on patient DNA and RNA putative KIAA1509 protein and the C-terminal 579 amino acids (Figure 3). of PDGFRb (Figure 3). There is 45% homology between the N- KIAA1509 is a predicted gene (XM_029353) located on terminal region of KIAA1509 and the central coiled coil domain chromosome band 14q32, and a partial cDNA has been cloned of the HOOK family of proteins.23 The coiled coil domain is in a large-scale cloning project.21 Based on data from GeneNote highly conserved between the Drosophila hook protein and the (http://genecards.weizmann.ac.il/cgi-bin/genenote/home_page/ human HOOK proteins, and the Drosophila hook coiled coil pl) KIAA1509 is widely expressed, with highest levels of domain mediates dimerization.24 Analysis using the pepcoil expression in bone marrow, spleen and thymus. The predicted program (http://www.emboss.org/) suggests there is a 99%

Leukemia KIAA1509 is a novel fusion partner to PDGFRB RL Levine et al 29 a breakpoint

KIAA1509 NH2 COOH

HOOK breakpoint

PDGFRβ NH2 COOH extracellular domain split kinase transmembrane domain

KIAA1509-PDGFRβ NH2 COOH

HOOK split kinase breakpoint transmembrane domain

b KIAA1509 PDGFRβ RNA aac gca gac ttg tca gac gcc ttg ccc ttt aag gtg gtg gtg Protein N A D L S D A L P F L V V V

c Pt Cn Water

KIAA1509 850bp

KIAA1509-PDGFRβ 500bp

Figure 3 Cloning of KIAA1509 as a fusion partner to PDGFRB in a patient with t(5;14)(q33;q32). (a) The KIAA1509, PDGFRB, and KIAA1509- PDGFRB proteins are shown. The position of the breakpoint is indicated by arrowheads. (b) The RNA and protein sequence of the KIAA-PDGFRB breakpoint are shown. (c) RT-PCR of patient and normal granulocyte RNA shows the KIAA1509-PDGFRB fusion product in the patient (Pt) with t(5;14)(q33;q32) and shows KIAA1509 in patient (Pt) and control (Cn) granulocyte RNA.

likelihood of a coiled coil domain within the N-terminal Acknowledgements region (residues 128–227) of KIAA1509. It is likely that the coiled coil domain of KIAA1509 mediates homodimerization This paper was supported in part by National Institute of Health and constitutive activation of the PDGFRb tyrosine kinase, as Grants DK50654 and CA66996 to DGG, Grant CA82261 to DWS, has been demonstrated for ETV6-PDGFRb and other PDGFRb and by the Leukemia and Lymphoma Society. DGG is a Doris fusions.11 Duke Foundation Distinguished Clinical Scientist and an Inves- The breakpoint within PDGFRB is within intron 10, which is tigator of the Howard Hughes Medical Institute. JC is a identical to the location of the genomic breakpoints of all postdoctoral researcher of the ’FWO-Vlaanderen’. known PDGFRB fusion genes except for NIN-PDGFRB.3–10,19 It is therefore likely the LDI-PCR strategy described in this case References report can be used to identify novel PDGFRB fusion partners in additional patients, based on the conserved location of 1 Bartram CR, de Klein A, Hagemeijer A, van Agthoven T, Geurts translocation breakpoints within PDGFRB. van Kessel A, Bootsma D et al. Translocation of c-ab1 oncogene In summary, we have identified KIAA1509 as a novel fusion correlates with the presence of a Philadelphia chromosome in SPOTLIGHT partner for PDGFRB in a patient with t(5;14)(q33;q32) and an chronic myelocytic leukaemia. Nature 1983; 306: 277–280. MPD. Treatment with imatinib resulted in a rapid, complete, 2 Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J et al. A tyrosine kinase created by fusion of the PDGFRA, FIP1L1 genes and sustained hematologic and cytogenetic response. Like other as a therapeutic target of imatinib in idiopathic hypereosinophilic PDGFRb fusion proteins associated with a CMML phenotype, it syndrome. N Engl J Med 2003; 348: 1201–1214. is most likely that the KIAA1509-PDGFRb fusion is a constitu- 3 Abe A, Emi N, Tanimoto M, Terasaki H, Marunouchi T, Saito H. tively activated tyrosine kinase that is imatinib-sensitive. In Fusion of the platelet-derived growth factor receptor beta to a support of this hypothesis, imatinib resulted in complete novel gene CEV14 in acute myelogenous leukemia after clonal remission in a patient with the t(5;14)(q33;q32). These data evolution. Blood 1997; 90: 4271–4277. 4 Ross TS, Bernard OA, Berger R, Gilliland DG. Fusion of Huntingtin provide further evidence that patients with a CMML phenotype interacting protein 1 to platelet-derived growth factor beta receptor and translocations involving the PDGFR locus are good (PDGFbetaR) in chronic myelomonocytic leukemia with candidates for therapy with imatinib. However, cloning of these t(5;7)(q33;q11.2). Blood 1998; 91: 4419–4426. chromosomal translocations may be difficult due to lack of RNA 5 Kulkarni S, Heath C, Parker S, Chase A, Iqbal S, Pocock CF et al. and limiting amounts of genomic DNA. Strategies such as LDI- Fusion of H4/D10S170 to the platelet-derived growth factor PCR, in conjunction with new methods for whole-genome receptor beta in BCR-ABL-negative myeloproliferative disorders 25 with a t(5;10)(q33;q21). Cancer Res 2000; 60: 3592–3598. amplification to expand DNA template, should allow for 6 Schwaller J, Anastasiadou E, Cain D, Kutok J, Wojiski S, Williams reliable identification of patients with CMML with PDGFRb IR et al. H4(D10S170), a gene frequently rearranged in papillary rearrangements that may be imatinib responsive. thyroid carcinoma, is fused to the platelet-derived growth factor

Leukemia KIAA1509 is a novel fusion partner to PDGFRB RL Levine et al 30 receptor beta gene in atypical chronic myeloid leukemia with mesylate in advanced gastrointestinal stromal tumors. N Engl J t(5;10)(q33;q22). Blood 2001; 97: 3910–3918. Med 2002; 347: 472–480. 7 Magnusson MK, Meade KE, Brown KE, Arthur DC, Krueger LA, 16 Apperley JF, Gardembas M, Melo JV, Russell-Jones R, Bain BJ, Barrett AJ et al. Rabaptin-5 is a novel fusion partner to platelet- Baxter EJ et al. Response to imatinib mesylate in patients with derived growth factor beta receptor in chronic myelomonocytic chronic myeloproliferative diseases with rearrangements of the leukemia. Blood 2001; 98: 2518–2525. platelet-derived growth factor receptor beta. N Engl J Med 2002; 8 Wilkinson K, Velloso ER, Lopes LF, Lee C, Aster JC, Shipp MA et al. 347: 481–487. Cloning of the t(1;5)(q23;q33) in a myeloproliferative disorder 17 Magnusson MK, Meade KE, Nakamura R, Barrett J, Dunbar CE. associated with eosinophilia: involvement of PDGFRB and Activity of STI571 in chronic myelomonocytic leukemia with a response to imatinib. Blood 2003; 102: 4187–4190. platelet-derived growth factor beta receptor fusion oncogene. 9 Vizmanos JL, Novo FJ, Roman JP, Baxter EJ, Lahortiga I, Larrayoz Blood 2002; 100: 1088–1091. MJ et al. NIN, a gene encoding a CEP110-like centrosomal protein, 18 Dierlamm J, Wlodarska I, Michaux L, La Starza R, Zeller W, is fused to PDGFRB in a patient with a t(5;14)(q33;q24) and an Mecucci C et al. Successful use of the same slide for consecutive imatinib-responsive myeloproliferative disorder. Cancer Res 2004; fluorescence in situ hybridization experiments. Genes Chromo- 64: 2673–2676. somes Cancer 1996; 16: 261–264. 10 Morerio C, Acquila M, Rosanda C, Rapella A, Dufour C, Locatelli F 19 Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF et al. HCMOGT-1 is a novel fusion partner to PDGFRB in juvenile receptor beta to a novel ets-like gene, tel, in chronic myelomo- myelomonocytic leukemia with t(5;17)(q33;p11.2). Cancer Res nocytic leukemia with t(5;12) chromosomal translocation. Cell 2004; 64: 2649–2651. 1994; 77: 307–316. 11 Carroll M, Tomasson MH, Barker GF, Golub TR, Gilliland DG. The 20 Willis TG, Jadayel DM, Coignet LJ, Abdul-Rauf M, Treleaven JG, TEL/platelet-derived growth factor beta receptor (PDGF beta R) Catovsky D et al. Rapid molecular cloning of rearrangements of fusion in chronic myelomonocytic leukemia is a transforming the IGHJ locus using long-distance inverse polymerase chain SPOTLIGHT protein that self-associates and activates PDGF beta R kinase- reaction. Blood 1997; 90: 2456–2464. dependent signaling pathways. Proc Natl Acad Sci USA 1996; 93: 21 Kikuno R, Nagase T, Nakayama M, Koga H, Okazaki N, Nakajima 14845–14850. D et al. HUGE: a database for human KIAA proteins, a 2004 12 Tomasson MH, Williams IR, Hasserjian R, Udomsakdi C, McGrath update integrating HUGEppi and ROUGE. Nucleic Acids Res SM, Schwaller J et al. TEL/PDGFbetaR induces hematologic 2004; 32, (Database issue: D502-4). malignancies in mice that respond to a specific tyrosine kinase 22 Oshita A, Kishida S, Kobayashi H, Michiue T, Asahara T, Asashima inhibitor. Blood 1999; 93: 1707–1714. M et al. Identification and characterization of a novel Dvl-binding 13 Baxter EJ, Kulkarni S, Vizmanos JL, Jaju R, Martinelli G, Testoni N protein that suppresses Wnt signalling pathway. Genes Cells 2003; et al. Novel translocations that disrupt the platelet-derived 8: 1005–1017. growth factor receptor beta (PDGFRB) gene in BCR-ABL-negative 23 Kramer H, Phistry M. Genetic analysis of hook, a gene required chronic myeloproliferative disorders. Br J Haematol 2003; 120: for endocytic trafficking in drosophila. Genetics 1999; 151: 251–256. 675–684. 14 Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford JM 24 Kramer H, Phistry M. Mutations in the Drosophila hook gene et al. Efficacy and safety of a specific inhibitor of the BCR-ABL inhibit endocytosis of the boss transmembrane ligand into multi- tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001; vesicular bodies. J Cell Biol 1996; 133: 1205–1215. 344: 1031–1037. 25 Hosono S, Faruqi AF, Dean FB, Du Y, Sun Z, Wu X et al. Unbiased 15 Demetri GD, von Mehren M, Blanke CD, Van den Abbeele AD, whole-genome amplification directly from clinical samples. Eisenberg B, Roberts PJ et al. Efficacy and safety of imatinib Genome Res 2003; 13: 954–964.

Leukemia