DOCSLIB.ORG

SPOTLIGHT Kinase Is Constitutively Activated As a Consequence of Fusion to a Marrow with Granulocytic Hyperplasia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SPOTLIGHT Kinase Is Constitutively Activated As a Consequence of Fusion to a Marrow with Granulocytic Hyperplasia Leukemia (2005) 19, 27–30 & 2005 Nature Publishing Group All rights reserved 0887-6924/05 $30.00 www.nature.com/leu KIAA1509 is a novel PDGFRB fusion partner in imatinib-responsive myeloproliferative disease associated with a t(5;14)(q33;q32) RL Levine1,2,5, M Wadleigh2,5, DW Sternberg3, I Wlodarska4, I Galinsky2, RM Stone2, DJ DeAngelo2, D Gary Gilliland1 and J Cools4 1Division of Hematology, Brigham and Women’s Hospital and Howard Hughes Medical Institute, Harvard Medical School, Boston, MA, USA; 2Division of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, USA; 3Division of Hematology/ Oncology, Mount Sinai School of Medicine, New York, NY, USA; and 4Department of Human Genetics – Flanders Interuniversity Institute for Biotechnology (VIB), University of Leuven, Leuven, Belgium We report the cloning of a novel PDGFRB fusion gene partner in translocations involving PDGFRB in MPDs where the fusion a patient with a chronic myeloproliferative disorder character- partner is not yet known.13 ized by t(5;14)(q33;q32), who responded to treatment with imatinib mesylate. Fluorescence in situ hybridization demon- Imatinib mesylate (Gleevec; Novartis, Basel, Switzerland) is a strated that PDGFRB was involved in the translocation. Long specific tyrosine kinase inhibitor with clinical activity in chronic distance inversion PCR identified KIAA1509 as the PDGFRB myelogenous leukemia, hypereosinophilic syndrome, and gas- fusion partner. KIAA1509 is an uncharacterized gene with a trointestinal stromal tumors.2,14,15 Based on the observation that predicted coiled-coil oligomerization domain with homology to imatinib inhibits the growth of ETV6-PDGFRB transformed cells, the HOOK family of proteins. The predicted KIAA1509-PDGFRb imatinib has been administered to three CMML patients with the fusion protein contains the KIAA1509 coiled-coil domain fused ETV6-PDGFRB fusion; durable responses were seen in all three to the cytoplasmic domain of PDGFRb that includes the 16 tyrosine kinase domain. Imatinib therapy resulted in rapid cases. Similar responses to imatinib have been reported in normalization of the patient’s blood counts, and subsequent patients with the PDE4DIP-PDGFRB and NIN-PDGFRB fusion bone marrow biopsies and karyotypic analysis were consistent genes, and in a patient with the RABEP1-PDGFRB fusion gene with sustained complete remission. with a molecular relapse after allogeneic bone marrow Leukemia (2005) 19, 27–30. doi:10.1038/sj.leu.2403548 transplantation.8,9,17 Published online 21 October 2004 Keywords: translocation; imatinib; myeloproliferative disorder In this report we describe a patient with a myeloproliferative disorder characterized by the chromosomal abnormality t(5;14)(q33;q32). The consequence of the chromosomal trans- location is fusion of the coiled-coil domain of KIAA1509 to the tyrosine kinase domain of PDGFRb. Imatinib therapy resulted in Introduction a rapid, complete, and durable hematologic and cytogenetic response. Fusion genes that result in constitutive activation of tyrosine kinases characterize a subset of chronic myeloproliferative disorders. These fusion genes are the result of chromosomal Materials and methods translocations or interstitial deletions.1,2 In chronic myelomo- nocytic leukemia (CMML), a subset of patients have balanced Study design translocations involving the platelet-derived growth factor receptor beta (PDGFRB) gene. To date, eight PDGFRB fusion In July 2002, a 42-year-old man was incidentally noted to partners (ETV6, CEV14, HIP1, H4/D10S170, RABEP1, Myome- m 3– have a white blood cell count of 64 900/ l with 41% galin/PDE4DIP, NIN, and HCMOGT-1) have been identified. bands, 21% neutrophils, 7% lymphocytes, 5% eosinophils, 10 In each case, chromosomal translocation results in fusion of 12% monocytes, and 4% metamyelocytes. His platelet 0 0 the 3 region of PDGFRB encoding the kinase domain to a 5 count was 176 000/ml and his hemoglobin was 9.0 g/dl. fusion partner with a putative oligomerization domain. It has Physical examination revealed no lymphadenopathy or been demonstrated in most of these that the PDGFRb tyrosine splenomegaly. Bone marrow biopsy revealed a hypercellular SPOTLIGHT kinase is constitutively activated as a consequence of fusion to a marrow with granulocytic hyperplasia. Cytogenetic analysis dimerization or oligomerization motif in the amino-terminal revealed t(5;14)(q31;q32) in 14 of 16 metaphases analyzed partner. For example, fusion of the ETV6 PNT oligomerization and inv(9)(p23;q13) in all metaphases analyzed. The BCR-ABL domain to PDGFRb results in self-association and constitutive fusion gene was not detected. The patient was enrolled tyrosine kinase activity, and both the oligomerization and kinase 11 in a clinical trial using imatinib mesylate in patients domains are required for transformation of hematopoetic cells. with CMML, which was defined as a t(9;22) negative Mice engineered to express the ETV6-PDGFRb fusion protein myeloproliferative disorder associated with a peripheral blood using a lymphoid-specific promoter developed T and B cell monocytosis greater than 1000/ml. Patients on this trial were lymphomas, and treatment with imatinib results in prolonged 11,12 treated with a daily oral dose of 400 mg imatinib and survival in these mice. There are additional reports of were monitored with weekly blood counts and bone marrow examinations every 3 months. Correspondence: Dr D Gary Gilliland, Division of Hematology, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 02115, USA; Fax: þ 1 617 355 9093; E-mail: [email protected] Fluorescence in situ hybridization 5These authors contributed equally to this work. Received 20 July 2004; accepted 25 August 2004; Published online Fluorescence in situ hybridization (FISH) was performed as 21 October 2004 described previously.18 Cosmid probes c4-6, c4-1, and c12 KIAA1509 is a novel fusion partner to PDGFRB RL Levine et al 28 spanning the PDGFRB gene were kindly provided by Dr M WBC Positive Metaphases Dixon (University of Manchester, Manchester, UK). Start Imatinib 180000 100% Molecular cloning of the genomic breakpoint 160000 140000 80% Rapid amplification of cDNA ends (RACE) was performed as 120000 19 60% previously described. Long distance inversion PCR (LDI-PCR) 100000 was performed as previously described.20 EcoRV was chosen for 80000 digestion based on the identification of a single EcoRV 40% restriction site within the kinase domain of the PDGFRB gene WBC (th/ul) 60000 40000 without additional restriction sites within 10Kb of upstream 20% %Positive Metaphases genomic sequence. LDI-PCR was performed using primers 20000 0 0 PDGFRB-LDI1 (5 cctcaatgctaggcagttcc) and PDGFRB-RV1 (5 - 0 0% 0 28 54 90 -35 -16 461 201 231 115 145 173 315 343 545 259 ctgtggccaactgggtctat) in the first PCR and PDGFRB-LDI2 284 0 0 -108 (5 ccaacttgagtccccacact) and PDGFRB-RV2 (5 tcctcagcattat Day gcaacca) in the nested PCR. The sequence of the LDI-PCR Positive 14 13 16 0 0 0 0 product was analyzed using the BLAST program (http:// Metaphases Metaphases www.ncbi.nlm.nih.gov/BLAST). The genomic breakpoint was 16 13 16 12 6 20 20 SPOTLIGHT Analyzed amplified from patient DNA using primers KIAA1509-F3 (50- cttatttgggatggagccct) and PDGFRB-R1 (50-accaggtagggtact Figure 1 White blood cell count of patient with t(5;14)(q33;q32) cggct). The fusion transcript was amplified using primers before and after initiation of imatinib therapy. The graph shows the KIAA1509-RTF1 (50-ccgggacacagataaga) and PDGFRB-RTR1 patient’s total peripheral white blood cell count and percentage of 0 metaphases positive for t(5;14)q33;q32), measured at the time of (5 -catgatcttcagctccgaca). diagnosis and then subsequently while enrolled in a clinical trial of imatinib therapy in chronic myelomonocytic leukemia. The table specifies the number of positive metaphases and total number of Results and discussion metaphases analyzed for each timepoint where cytogenetic analysis was performed. Response to imatinib The patient initiated treatment with imatinib in October 2002; by that time his white blood cell count had increased to 168 000/ml, his spun hematocrit had decreased to 25%, and his der(5) der(5) platelet count was 178 000/ml. After 1 month of therapy, he was in a hematologic remission with a normal complete blood count and differential (Figure 1). After 3 months of therapy a bone marrow biopsy showed a hypocellular marrow with one focus of 5 5 hypercellularity and fibrosis. Cytogenetic analysis did not identify the t(5;14)(q33;q32) in any cells analyzed, though inv(9)(p23;q13) was again identified in all cells analyzed, der(14) der(14) suggesting a constitutional origin of inv(9). At 18 months of follow-up, the patient remains in a cytogenetic remission; his most recent bone marrow examination revealed a normo- cellular marrow with a normal myeloid to erythroid ratio. He Figure 2 Fluorescence in situ hybridization demonstrates a breakpoint within the PDGFRB locus in a patient with has tolerated therapy well with only grade 1 periorbital edema, t(5;14)(q33;q32). Three-color FISH analysis with three cosmid probes and he continues on imatinib 400 mg daily. (c4-6: yellow; c4-1: green; c12-a: red) spanning the PDGFRB gene were used to document a break within PDGFRB. Molecular cloning of the t(5;14)(q33;q32) FISH analysis (Figure 2) confirmed that the breakpoint involved mRNA encodes a 1935 amino-acid protein with 73% amino- the PDGFRB locus. Initial attempts to identify the fusion partner acid homology to the mouse 0610010D24Rik (Daple) protein. using RACE were unsuccessful, presumably due to a paucity of Daple was identified based on its interaction with Dvl, and RNA. We then used LDI-PCR to amplify the translocation Daple has been shown to inhibit Wnt-3a-dependent accumula- breakpoint in genomic DNA. A 3Kb PCR product was identified, tion of b-catenin.22 and sequence analysis of this PCR product revealed a fusion The in-frame fusion transcript encodes a 934 amino-acid between intron 9 of KIAA1509 and intron 10 of PDGFRB.
Load more

Recommended publications
  • Rabbit Anti-RABEP1 Antibody-SL19721R
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-RABEP1 antibody SL19721R Product Name: RABEP1 Chinese Name: RABEP1蛋白抗体 Neurocrescin; Rab GTPase binding effector protein 1; RAB5EP; Rabaptin 4; Rabaptin Alias: 5; Rabaptin 5alpha; RABPT5; RABPT5A; Renal carcinoma antigen NY REN 17; Renal carcinoma antigen NYREN17. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat, ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100-500IF=1:100- 500（Paraffin sections need antigen repair） Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 99kDa Cellular localization: The cell membrane Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human RABEP1:501-600/862 Lsotype: IgGwww.sunlongbiotech.com Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. PubMed: PubMed RABEP1 is a Rab effector protein acting as linker between gamma-adaptin, RAB4A and RAB5A. It is involved in endocytic membrane fusion and membrane trafficking of Product Detail: recycling endosomes. Stimulates RABGEF1 mediated nucleotide exchange on RAB5A.
    [Show full text]
  • Identification of Key Genes and Pathways for Alzheimer's Disease
    Biophys Rep 2019, 5(2):98–109 https://doi.org/10.1007/s41048-019-0086-2 Biophysics Reports RESEARCH ARTICLE Identification of key genes and pathways for Alzheimer’s disease via combined analysis of genome-wide expression profiling in the hippocampus Mengsi Wu1,2, Kechi Fang1, Weixiao Wang1,2, Wei Lin1,2, Liyuan Guo1,2&, Jing Wang1,2& 1 CAS Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy of Sciences, Beijing 100101, China 2 Department of Psychology, University of Chinese Academy of Sciences, Beijing 10049, China Received: 8 August 2018 / Accepted: 17 January 2019 / Published online: 20 April 2019 Abstract In this study, combined analysis of expression profiling in the hippocampus of 76 patients with Alz- heimer’s disease (AD) and 40 healthy controls was performed. The effects of covariates (including age, gender, postmortem interval, and batch effect) were controlled, and differentially expressed genes (DEGs) were identified using a linear mixed-effects model. To explore the biological processes, func- tional pathway enrichment and protein–protein interaction (PPI) network analyses were performed on the DEGs. The extended genes with PPI to the DEGs were obtained. Finally, the DEGs and the extended genes were ranked using the convergent functional genomics method. Eighty DEGs with q \ 0.1, including 67 downregulated and 13 upregulated genes, were identified. In the pathway enrichment analysis, the 80 DEGs were significantly enriched in one Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, GABAergic synapses, and 22 Gene Ontology terms. These genes were mainly involved in neuron, synaptic signaling and transmission, and vesicle metabolism. These processes are all linked to the pathological features of AD, demonstrating that the GABAergic system, neurons, and synaptic function might be affected in AD.
    [Show full text]
  • Entrez ID 1 Symbol 1 Entrez ID 2 Symbol 2 Data Source (R
    Supporting Information Table 4. List of human protein-protein interactons. Entrez ID 1 Symbol 1 Entrez ID 2 Symbol 2 Data Source (R: Rual et al; S: Stelzl et al; L: Literature curation) 1 A1BG 10321 CRISP3 L 2 A2M 259 AMBP L 2 A2M 348 APOE L 2 A2M 351 APP L 2 A2M 354 KLK3 L 2 A2M 567 B2M L 2 A2M 1508 CTSB L 2 A2M 1990 ELA1 L 2 A2M 3309 HSPA5 L 2 A2M 3553 IL1B L 2 A2M 3586 IL10 L 2 A2M 3931 LCAT L 2 A2M 3952 LEP L 2 A2M 4035 LRP1 L 2 A2M 4803 NGFB L 2 A2M 5047 PAEP L 2 A2M 7045 TGFBI L 2 A2M 8728 ADAM19 L 2 A2M 9510 ADAMTS1 L 2 A2M 10944 SMAP S 2 A2M 55729 ATF7IP L 9 NAT1 8260 ARD1A L 12 SERPINA3 351 APP L 12 SERPINA3 354 KLK3 L 12 SERPINA3 1215 CMA1 L 12 SERPINA3 1504 CTRB1 L 12 SERPINA3 1506 CTRL L 12 SERPINA3 1511 CTSG L 12 SERPINA3 1990 ELA1 L 12 SERPINA3 1991 ELA2 L 12 SERPINA3 2064 ERBB2 L 12 SERPINA3 2153 F5 L 12 SERPINA3 3817 KLK2 L 12 SERPINA3 4035 LRP1 L 12 SERPINA3 4485 MST1 L 12 SERPINA3 5422 POLA L 12 SERPINA3 64215 DNAJC1 L 14 AAMP 51497 TH1L S 15 AANAT 7534 YWHAZ L 18 ABAT 7915 ALDH5A1 L 19 ABCA1 335 APOA1 L 19 ABCA1 6645 SNTB2 L 19 ABCA1 8772 FADD L 20 ABCA2 55755 CDK5RAP2 L 22 ABCB7 2235 FECH L 23 ABCF1 3692 ITGB4BP S 24 ABCA4 1258 CNGB1 L 25 ABL1 27 ABL2 L 25 ABL1 472 ATM L 25 ABL1 613 BCR L 25 ABL1 718 C3 L 25 ABL1 867 CBL L 25 ABL1 1501 CTNND2 L 25 ABL1 2048 EPHB2 L 25 ABL1 2547 XRCC6 L 25 ABL1 2876 GPX1 L 25 ABL1 2885 GRB2 L 25 ABL1 3055 HCK L 25 ABL1 3636 INPPL1 L 25 ABL1 3716 JAK1 L 25 ABL1 4193 MDM2 L 25 ABL1 4690 NCK1 L 25 ABL1 4914 NTRK1 L 25 ABL1 5062 PAK2 L 25 ABL1 5295 PIK3R1 L 25 ABL1 5335 PLCG1 L 25 ABL1 5591
    [Show full text]
  • Lipopolysaccharide Treatment Induces Genome-Wide Pre-Mrna Splicing
    The Author(s) BMC Genomics 2016, 17(Suppl 7):509 DOI 10.1186/s12864-016-2898-5 RESEARCH Open Access Lipopolysaccharide treatment induces genome-wide pre-mRNA splicing pattern changes in mouse bone marrow stromal stem cells Ao Zhou1,2, Meng Li3,BoHe3, Weixing Feng3, Fei Huang1, Bing Xu4,6, A. Keith Dunker1, Curt Balch5, Baiyan Li6, Yunlong Liu1,4 and Yue Wang4* From The International Conference on Intelligent Biology and Medicine (ICIBM) 2015 Indianapolis, IN, USA. 13-15 November 2015 Abstract Background: Lipopolysaccharide (LPS) is a gram-negative bacterial antigen that triggers a series of cellular responses. LPS pre-conditioning was previously shown to improve the therapeutic efficacy of bone marrow stromal cells/bone-marrow derived mesenchymal stem cells (BMSCs) for repairing ischemic, injured tissue. Results: In this study, we systematically evaluated the effects of LPS treatment on genome-wide splicing pattern changes in mouse BMSCs by comparing transcriptome sequencing data from control vs. LPS-treated samples, revealing 197 exons whose BMSC splicing patterns were altered by LPS. Functional analysis of these alternatively spliced genes demonstrated significant enrichment of phosphoproteins, zinc finger proteins, and proteins undergoing acetylation. Additional bioinformatics analysis strongly suggest that LPS-induced alternatively spliced exons could have major effects on protein functions by disrupting key protein functional domains, protein-protein interactions, and post-translational modifications. Conclusion: Although it is still to be determined whether such proteome modifications improve BMSC therapeutic efficacy, our comprehensive splicing characterizations provide greater understanding of the intracellular mechanisms that underlie the therapeutic potential of BMSCs. Keywords: Alternative splicing, Lipopolysaccharide, Mesenchymal stem cells Background developmental pathways, and other processes associated Alternative splicing (AS) is important for gene regulation with multicellular organisms.
    [Show full text]
  • Identification and Genomic Analysis of Pedigrees with Exceptional Longevity Identifies Candidate Rare Variants
    medRxiv preprint doi: https://doi.org/10.1101/2020.03.02.20030197; this version posted March 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC 4.0 International license . Identification and genomic analysis of pedigrees with exceptional longevity identifies candidate rare variants Justin B. Miller1†, Elizabeth Ward1†, Lyndsay A. Staley1, Jeffrey Stevens2, Craig C Teerlink2, Justina P. Tavana1, Matthew Cloward1, Madeline Page1, Louisa Dayton1, Alzheimer's Disease Genetics Consortium3, Lisa A. Cannon-Albright 2*, John S.K. Kauwe1* 1 Department of Biology, Brigham Young University, Provo, UT 84602, USA 2Genetic Epidemiology, Department of Internal Medicine, University of Utah, Salt Lake City, UT 84132, USA. 3Membership of the Alzheimer's Disease Genetics Consortium is provided in the Acknowledgments †The authors wish it to be known that, in their opinion, the first two authors should be regarded as co-first authors *The authors wish it to be known that, in their opinion, the last two authors should be regarded as co-last authors Correspondence should be addressed to John S.K. Kauwe, Ph.D. at [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.03.02.20030197; this version posted March 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Promoterless Transposon Mutagenesis Drives Solid Cancers Via Tumor Suppressor Inactivation
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.17.254565; this version posted August 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Promoterless Transposon Mutagenesis Drives Solid Cancers via Tumor Suppressor Inactivation 2 Aziz Aiderus1, Ana M. Contreras-Sandoval1, Amanda L. Meshey1, Justin Y. Newberg1,2, Jerrold M. Ward3, 3 Deborah Swing4, Neal G. Copeland2,3,4, Nancy A. Jenkins2,3,4, Karen M. Mann1,2,3,4,5,6,7, and Michael B. 4 Mann1,2,3,4,6,7,8,9 5 1Department of Molecular Oncology, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 6 2Cancer Research Program, Houston Methodist Research Institute, Houston, Texas, USA 7 3Institute of Molecular and Cell Biology, Agency for Science, Technology and Research (A*STAR), 8 Singapore, Republic of Singapore 9 4Mouse Cancer Genetics Program, Center for Cancer Research, National Cancer Institute, Frederick, 10 Maryland, USA 11 5Departments of Gastrointestinal Oncology & Malignant Hematology, Moffitt Cancer Center & Research 12 Institute, Tampa, FL, USA 13 6Cancer Biology and Evolution Program, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 14 7Department of Oncologic Sciences, Morsani College of Medicine, University of South Florida, Tampa, FL, 15 USA. 16 8Donald A. Adam Melanoma and Skin Cancer Research Center of Excellence, Moffitt Cancer Center, Tampa, 17 FL, USA 18 9Department of Cutaneous Oncology, Moffitt Cancer Center & Research Institute, Tampa, FL, USA 19 These authors contributed equally: Aziz Aiderus, Ana M.
    [Show full text]
  • Detection of H3k4me3 Identifies Neurohiv Signatures, Genomic
    viruses Article Detection of H3K4me3 Identifies NeuroHIV Signatures, Genomic Effects of Methamphetamine and Addiction Pathways in Postmortem HIV+ Brain Specimens that Are Not Amenable to Transcriptome Analysis Liana Basova 1, Alexander Lindsey 1, Anne Marie McGovern 1, Ronald J. Ellis 2 and Maria Cecilia Garibaldi Marcondes 1,* 1 San Diego Biomedical Research Institute, San Diego, CA 92121, USA; [email protected] (L.B.); [email protected] (A.L.); [email protected] (A.M.M.) 2 Departments of Neurosciences and Psychiatry, University of California San Diego, San Diego, CA 92103, USA; [email protected] * Correspondence: [email protected] Abstract: Human postmortem specimens are extremely valuable resources for investigating trans- lational hypotheses. Tissue repositories collect clinically assessed specimens from people with and without HIV, including age, viral load, treatments, substance use patterns and cognitive functions. One challenge is the limited number of specimens suitable for transcriptional studies, mainly due to poor RNA quality resulting from long postmortem intervals. We hypothesized that epigenomic Citation: Basova, L.; Lindsey, A.; signatures would be more stable than RNA for assessing global changes associated with outcomes McGovern, A.M.; Ellis, R.J.; of interest. We found that H3K27Ac or RNA Polymerase (Pol) were not consistently detected by Marcondes, M.C.G. Detection of H3K4me3 Identifies NeuroHIV Chromatin Immunoprecipitation (ChIP), while the enhancer H3K4me3 histone modification was Signatures, Genomic Effects of abundant and stable up to the 72 h postmortem. We tested our ability to use H3K4me3 in human Methamphetamine and Addiction prefrontal cortex from HIV+ individuals meeting criteria for methamphetamine use disorder or not Pathways in Postmortem HIV+ Brain (Meth +/−) which exhibited poor RNA quality and were not suitable for transcriptional profiling.
    [Show full text]
  • 5. Rab Proteins
    Rabaptin5 is recruited to endosomes by Rab4a and Rabex5 to regulate endosome maturation Inauguraldissertation zur Erlangung der Würde eines Doktors der Philosophie vorgelegt der Philosophisch-Naturwissenschaftlichen Faktultät der Universität Basel von Simone Kälin aus Einsiedeln (SZ) Basel, 2014 Genehmigt von der Philosophisch-Naturwissenschaftlichen Fakultät auf Antrag von Prof. Dr. Martin Spiess Prof. Dr. Kurt Ballmer Basel, den 18. Februar 2014 Prof. Dr. Jörg Schibler Dekan 3 Acknowledgments I would like to express my sincerest thanks to the following people: Martin Spiess for giving me the opportunity to work on this project and for his continuous support. My thesis committee members, Kurt Ballmer and Markus Rüegg, for your time, helpful dis- cussions and advice. David Hirschmann for data contributions and experimental advice Nicole Beuret, who had always an open ear for technical questions and for always offering a helping hand. All the past and present members of the Spiess group for a great working atmosphere, an- swering questions, giving input and relaxing coffee and lunch breaks: Cristina Baschong, Julia Birk, Dominik Buser, Erhan Demirci, Franziska Hasler, Sonja Huser, Tina Junne, Lucyna Kocik, Deyan Mihov and Barry Shortt. Andrijana Kriz and Philipp Berger for introducing me to the MultiLabel system Aurélien Rizk for helping me with the quantitation of the endosome size 4 Summary Membrane trafficking between organelles is fundamental to the existence of eukaryotic cells. A multitude of proteins is involved in membrane trafficking, acting as building blocks for transport carriers, regulators of transport, and targeting and fusion factors. One important group of regulators are the Rab GTPases. They serve as multifaceted organizers of almost all membrane trafficking related processes in eukaryotic cells.
    [Show full text]
  • Rabbit Anti-GGA1/FITC Conjugated Antibody-SL13343R-FITC
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-GGA1/FITC Conjugated antibody SL13343R-FITC Product Name: Anti-GGA1/FITC Chinese Name: FITC标记的γ-衔接蛋白相关蛋白1抗体 4930406E12Rik; ADP ribosylation factor binding protein 1; ADP ribosylation factor binding protein GGA1; ADP-ribosylation factor-binding protein GGA1; ARF binding protein 1; ARF-binding protein 1; Gamma adaptin related protein 1; gamma ear- containing; Gamma-adaptin-related protein 1; GGA 1; GGA1; GGA1 protein; Alias: GGA1_HUMAN; Golgi associated gamma adaptin ear containing ARF; Golgi associated gamma adaptin ear containing ARF binding protein 1; Golgi localized gamma ear containing ARF binding protein 1; Golgi-localized; OTTHUMP00000028975; OTTHUMP00000042200. Organism Species: Rabbit Clonality: Polyclonal React Species: Human,Mouse,Rat,Dog,Pig,Cow,Sheep, ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 70kDa Cellular localization: Thewww.sunlongbiotech.com cell membrane Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human GGA1 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 ℃ for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20℃. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 ℃.
    [Show full text]
  • GGA2 and RAB13 Regulate Activity-Dependent Β1-Integrin Recycling
    bioRxiv preprint doi: https://doi.org/10.1101/353086; this version posted June 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GGA2 and RAB13 regulate activity-dependent β1-integrin recycling Pranshu Sahgal1, Jonna Alanko1,#, Ilkka Paatero1, Antti Arjonen1,$, Mika Pietilä1, Anne Rokka1, Johanna Ivaska1,2,* 1Turku Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku FIN-20520, Finland 2Department of Biochemistry and Food Chemistry, University of Turku, Turku FIN- 20520, Finland # Current address: IST Austria, Klosterneuburg 3400, Austria $ Current address: Misvik Biology, Turku FIN-20520, Finland * corresponding author: [email protected] Abstract β1-integrins mediate cell-matrix interactions and their trafficking is important in the dynamic regulation of cell adhesion, migration and malignant processes like cancer cell invasion. Here we employ unbiased RNAi screening to characterize regulators of integrin traffic and identify the association of Golgi-localized gamma ear-containing Arf-binding protein 2 (GGA2) with β1-integrin and its role in recycling of the active but not inactive β1-integrins. Silencing of GGA2 limits active 1-integrin levels in focal adhesions and decreases cancer cell migration and invasion congruent with its ability to regulate the dynamics of active integrins. Using the proximity-dependent biotin identification (BioID) method, we identify two RAB family small GTPases, RAB13 and RAB10, associating with GGA2 and β1-integrin. Functionally, RAB13 silencing triggers the intracellular accumulation of active β1-integrin, identically to GGA2 depletion, indicating that both facilitate recycling of active β1-integrins to the plasma membrane.
    [Show full text]
  • Intracellular Localization of GGA Accessory Protein P56 in Cell Lines and Cen- Tral Nervous System Neurons
    Biomedical Research (Tokyo) 39 (4) 179–187, 2018 Intracellular localization of GGA accessory protein p56 in cell lines and cen- tral nervous system neurons 1 1 2 1 1 Takefumi UEMURA , Naoki SAWADA , Takao SAKABA , Satoshi KAMETAKA , Masaya YAMAMOTO , and Satoshi 1 WAGURI 1 Department of Anatomy and Histology, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, Fukushima 960-1295, Japan and 2 Department of Plastic and Reconstructive Surgery, Fukushima Medical University School of Medicine, 1 Hikarigaoka, Fukushima, Fukushima 960-1295, Japan (Received 14 May 2018; and accepted 24 May 2018) ABSTRACT Adaptor protein complex-1 (AP-1) and Golgi associated, γ-adaptin ear containing, Arf binding proteins (GGAs) are clathrin adaptors that regulate membrane trafficking between the trans-Golgi network (TGN) and endosomes. p56 is a clathrin adaptor accessory protein that may modulate the function of GGAs in mammalian cell lines. However, the precise relationship between p56 and the three GGAs (GGA1–3), as well as the physiological role of p56 in tissue cells, remain unknown. To this end, we generated an antibody against p56 and determined its cellular localization. In ARPE-19 cells and mouse embryonic fibroblasts, p56 was found to be localized as fine puncta in the TGN. Interestingly, the depletion of each clathrin adaptor by RNAi revealed that this localiza- tion was dependent on the expression of GGA1, but not that of GGA2, GGA3, or AP-1. Using immunohistofluorescence microscopy in the mouse central nervous system (CNS), p56 was clearly detected as scattered cytoplasmic puncta in spinal motor neurons, cerebellar Purkinje cells, and pyramidal neurons of the hippocampus and cerebral cortex.
    [Show full text]
  • GGA2 and RAB13 Promote Activity-Dependent Β1-Integrin Recycling
    bioRxiv preprint doi: https://doi.org/10.1101/353086; this version posted February 25, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. GGA2 and RAB13 promote activity-dependent β1-integrin recycling Pranshu Sahgal1, Jonna Alanko1,#§, Jaroslav Icha1,§, Ilkka Paatero1, Hellyeh Hamidi1, Antti Arjonen1,$, Mika Pietilä1, Anne Rokka1, Johanna Ivaska1,2,* 1Turku Centre for Biotechnology, University of Turku and Åbo Akademi University, Turku FIN-20520, Finland 2Department of Biochemistry and Food Chemistry, University of Turku, Turku FIN- 20520, Finland # Current address: IST Austria, Klosterneuburg 3400, Austria $ Current address: Misvik Biology, Turku FIN-20520, Finland § These authors contributed equally * corresponding author: [email protected] Abstract β1-integrins mediate cell-matrix interactions and their trafficking is important in the dynamic regulation of cell adhesion, migration and malignant processes like cancer cell invasion. Here we employ an RNAi screen to characterize regulators of integrin traffic and identify the association of Golgi-localized gamma ear-containing Arf-binding protein 2 (GGA2) with β1- integrin and its role in recycling of the active but not inactive β1-integrin receptors. Silencing of GGA2 limits active β1-integrin levels in focal adhesions and decreases cancer cell migration and invasion congruent with its ability to regulate the dynamics of active integrins. Using the proximity-dependent biotin identification (BioID) method, we identify two RAB family small GTPases, RAB13 and RAB10, associating with GGA2 and β1-integrin.
    [Show full text]