Use of Dna Aptamers for Targeted Delivery of Chemotherapeutic Agents

USE OF DNA APTAMERS FOR TARGETED DELIVERY OF CHEMOTHERAPEUTIC AGENTS

CHRISTOPHER H. STUART

A Dissertation to the Graduate Faculty of

WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES

In Partial Fulfillment of the Requirements

for the Degree of

DOCTOR OF PHILOSOPHY

Molecular Medicine and Translational Science

May, 2016

Winston-Salem, North Carolina

Approved by:

William H. Gmeiner Ph.D., Advisor

George J. Christ Ph.D., Chair

Akiva Mintz, MD., Ph.D.

Timothy D. Pardee, MD., Ph.D.

Michael C. Seeds, Ph.D.

Acknowledgements

I would like to graciously acknowledge the guidance provided by my advisor, Dr.

William Gmeiner. He has given me the opportunity to grow into a successful young scientist, the freedom to learn independently and mentorship when I was lost. I will be forever grateful for his guidance.

Of course, no Ph.D is earned alone. There have been so many friends that have helped me along the way, and to try to list them all would require a second dissertation in itself.

Leah, Hugo, Daniel and Kadie, thank you all for your friendship and good times we shared over the years. I would especially like to thank Ryne and Joanna. They have been my most loyal and sincere friends and the appreciation I have for their support, though the best and worst of times, cannot be understated.

Finally, I would like to thank my family. My brothers, Joey and Jacob, and my oldest friend Matt have listened to me even when they have no idea what I am rambling on about, and have given me the encouragement I needed, not only in pursuit of this dissertation but in life as well. My loving parents, Bob and DeeAnn, instilled a curiosity and conviction in me from a young age. They are the reason I am the man I am today.

Every success I have had is because of their dedication as parents, confidants, counselors and friends.

Table of Contents

List of Figures……………………………………………………………………………vii

List of Tables……………………………………………………………………………...x

List of Abbreviations……………………………………………………………………..xi

Abstract………………………………………………………………………………….xiv

Chapter I

General Introduction

I.1 Introduction of Chemotherapeutic Concepts: Balancing the Cure and its Cost…...... 1

I.2 Increasing Drug Efficacy through Targeted Therapy……………...…………………..9

I.3 DNA as a Structure: The use of DNA for Drug Targeting……………………….….17

Chapter II

Site-Specific DNA–Doxorubicin Conjugates Display Enhanced Cytotoxicity to

Breast Cancer Cells

II.1 Abstract…………………………………………………………..….……………...39

II.2 Introduction……………………………………………………..…….…………….40

II.3 Experimental Section………………………………………………………………..47

iii

II.4 Discussion…………………………………………………………………………...53

II.5 Conclusions………………………………………………………………………….56

II.6 Supporting Information……………………………………………………………...57

II.7 Acknowledgments…………………………………………………………………..58

Chapter III

PSMA-Targeted Liposomes Specifically Deliver the Zn2+ Chelator TPEN Inducing

Oxidative Stress in Prostate Cancer Cells

III.1 Abstract…………………………………………………………………………….65

III.2 Background……………………………………………………………………...... 66

III.3 Methods……………………………………………………………………………68

III.4 Results……………………………………………………………………………...75

III.5 Discussion………………………………………………………………………….82

III.6 Future Directions…………………………………………………………………..98

Chapter IV

Selection of a New Aptamer Against Vitronectin Using Capillary Electrophoresis

and Next Generation Sequencing

IV.1 Introduction……………………………………………………………………….107

IV.2 Methods…………………………………………………………………………...110

IV.3 Results…………………………………………………………………………….116

IV.4 Discussion………………………………………………………………………...120

Chapter V

Discussion and Future Directions

V.1 Aptamers as Therapeutics………………………...………………………………..139

V.2 Aptamer Complexes and Multifunctional Aptamers………………………………141

V.3 Improving Aptamer Selection……………………………………………………...146

V.4 Conclusions…………………………………………...…………….……………...148

Appendix

Dimeric DNA Aptamer Complexes for High-capacity–targeted Drug Delivery Using

pH-sensitive Covalent Linkages

A1.1 Abstract…………………………………………………………………………...159

A1.2 Introduction……………………………………………………………………….160

A1.3 Results…………………………………………………………………………….162

A1.4 Discussion………………………………………………………………………...167

A1.5 Materials and Methods……………………………………………………………176

A1.6 Supplementary Material…………………………………………………………..182

A1.7 Acknowledgment…………………………………….…………………………...186

Curriculum Vitae……………………………………………………………………...190

LIST OF FIGURES

Chapter I

Figure 1: Structure of Doxorubicin………………………………………………………5

Figure 2: Trastuzumab FAB fragment binding to HER2…………………...…………………..12

Chapter II

Figure 1: Graphical Abstract…………………………………………………………….40

Figure 2: Reaction of Doxorucin with DNA……………………………………………43

Figure 3: Physical analysis of Dox:DNA hairpins…………….……….……………….44

Figure 4: 3D representation of Dox:DNA hairpin………………………………………45

Figure 5: Fluorescence quenching of Dox in DNA hairpins……………………..……..46

Figure 6: Fluorescence microscopy of cells after DCH treatment……………….….….46

Figure 7: Viability of Cells treated with DCH…………………………………………..47

Figure 8: 2D NMR of Dox:DNA Hairpin molecules...……..…………………………..57

Figure 9: Dox Absorbance after extractions…………...………………………………..57

Figure 10: Internalization of DCH molecules into cells………………………………..58

Chapter III

Figure 1: TPEN induces significant oxidative stress in PCa cells …………….……….88

vii

Figure 2: Time-dependence of Cu2+ and Zn2+ rescue ……………..……………………89

Figure 3: Characterization of aptamer targeted liposomes…………….…….………….90

Figure 4: Targeted cell binding and delivery of aptamer-targeted liposomes …….……90

Figure 5: Selective cytotoxicity of aptamer-targeted liposomes to C4-2 cells ….……...91

Figure 6: TPEN delivered via aptamer-targeted liposomes induces cell death ………...92

Figure 7: Liposomal loading results in reduced hepatotoxicity ………………….....…..93

Figure 8: Aptamer-targeted liposomes specifically kill targeted tumors …………..….. 94

Figure 9: Mitochondria size quantification……………………………………………...95

Figure 10: Leakage of TPEN from liposomes…………………………………………..96

Figure 11: Scheme of Liposome formation……………………………………………..97

Figure 12: Size distribution of liposomes after dialysis………………………………...97

Chapter IV

Figure 1: Selection of VBA-01 via CENGS………………….…. …………………...128

Figure 2: Structure of DVBA-01…………………... …….………..…………………129

Figure 3: Physical characteristics of VBA-01 and its derivatives ….………………...129

Figure 4: Effects of DVBA-01 on BC cells……………………….. ………….………130

Figure 5: Flow cytometry of cells plated on VN and treated with DVBA-01-Dox …..131

Figure 6: Histology of DCIS tissue using VBA-01…………………………… …...…132

viii

Figure 7: Sequences of the various aptamers identified via NGS …..………………...132

Figure 8: Phylogenetic tree of aptamer sequences…………….. …………………….. 133

Appendix

Figure 1: Secondary structure of the dimeric aptamer complex ……………………...171

Figure 2: Physical characterization of DAC and DAC-D ………………..…...…….…172

Figure 3: Fluorescence of cells treated with DAC……… ….……….………………...173

Figure 4: Endosomal uptake of DAC…….……………………….. ………….………174

Figure 5: Specificity of DAC complexes for PSMA+ cells …………………….……..175

Figure 6: Cytotoxicity of DAC-D on PCa Cells………………………………. …...…176

Figure 7: The sequence of the SZTI01 aptamer …..………………………………...... 182

Figure 8: Physical Characterization of DAC complexes….. ……………...... ………. 182

Figure 9: Standard Curve of Dox absorbance………………………………………….183

Figure 10: Flow cytometry of cells treated with DAC………………………………..183

Figure 11: Cytotoxicity on cells treated with DAC for 24hr………………………….184

Figure 12: Relative binding of SZTI01 versus the A10 aptamer………………………185

LIST OF TABLES

Appendix

Table 1: Absorbance values for DAC-D complexes………………………………….185

LIST OF ABREVIATIONS

ATM Ataxia telangiectasia Mutated

ATP Adenosine Triphosphate

BC Breast Cancer

CE Capillary Electrophoresis

CHK2 Checkpoint kinase 2

CML Chronic Myelogenous Leukemia

Col Collagen

CRPC Castration Resistant Prostate Cancer

DAC Dimeric Aptamer Complex

DCH Doxorubicin Conjugated Hairpin

DCIS Ductal Carcinoma In Situ

DLS Dynamic Light Scattering

DNA Deoxyribonucleic Acid

DOX Doxorubicin dsDNA Double Stranded Deoxyribonucleic Acid

ECM Extra Cellular Matrix

EGFR Epidermal growth factor receptor

NGS Next Generation Sequencing

ER Estrogen Receptor

FA Folic Acid

FBS Fetal Bovine Serum

FN Fibronectin

HER2 Human Epidermal Growth Factor Receptor 2

MALA Multiple Aptamers with Low Affinity mRNA Messenger Ribonucleic Acid

MUC1 Mucin 1, Cell Surface Associated

NHS N-Hydroxysuccinimide

NMR Nuclear Magnetic Resonance

NTA Nanotracking Analysis

PBS Phosphate Buffered Saline

PCa Prostate Cancer

PCR Polymerase Chain Reaction

PSMA Prostate Specific Membrane Antigen

RNA Ribonucleic Acid

xii

ROS Reactive Oxygen Species

SELEX Systematic Evolution of Ligands by Exponential Enrichment siRNA Small Interfering Ribonucleic Acid

SOD1 Superoxide Dismutase 1 ssDNA Single Stranded Deoxyribonucleic Acid

TEM Transmission Electron Microscopy

TOPI Topoisomerase I

TOPII Topoisomerase II

TPEN N,N,N',N'-tetrakis(2-pyridylmethyl)ethane-1,2-diamine

TS Thymidylate Synthase uPAR Urokinase Receptor

VN Vitronectin

xiii

Abstract

The development of safe and efficacious chemotherapeutics has been the goal of cancer researchers for decades. Many different methods have been used to pursue this goal ranging from small molecules that act targets to large biomolecules such as antibodies.

Aptamers are a new class of biomolecules similar to antibodies in that they fold into 3D shapes which specifically bind to a target of interest, but differ in that they are composed of single stranded RNA or DNA. Aptamers are selected for using the SELEX method and can be designed to bind nearly any target the researcher desires. Aptamers are chemically and thermally more stable than proteins and can be modified in a variety of ways to alter their function. This can include cytotoxic nucleotides, phosphorothioate backbones to increase enzymatic resistance, dyes, and chemically reactive groups as a few of the possibilities. Other nucleic acids, such as siRNA can be delivered via aptamers. This adaptability makes aptamers ideal candidates for drug delivery purposes.

Collectively, the work described herein demonstrates the versatility of aptamers as drug delivery vehicles and seeks to expand the ways in which they can be used as such.

In this dissertation we demonstrate a novel way to link a chemotherapeutic to DNA for delivery purposes using a reversible covalent linkage. This novel chemistry is used to modify aptamer with chemotherapeutic drugs and deliver it specifically to prostate cancer cells. We then show the same aptamer can be used to treat prostate cancer tumors in vivo by delivering nanoparticles containing a zinc chelator. A new method of SELEX, which utilizes capillary electrophoresis and next generation sequencing, allows for rapid selection of aptamers is described. This method of SELEX is used to identify a new aptamer against Vitronectin, a protein which may be linked to breast cancer malignancy,

xiv

and the application of the aforementioned chemistry results in a cytotoxic aptamer with high affinity to its target.

Chapter I General Introduction

I.1 Introduction of Chemotherapeutic Concepts: Balancing the Cure and its Cost

Nearly every physician in the United States takes some form of the Hippocratic

Oath before beginning their journey as a medical practitioner. In ancient times part of the oath, translated from Greek, read “With regard to healing the sick, I will devise and order for them the best diet, according to my judgment and means; and I will take care that they suffer no hurt or damage.” This oath has been modernized by Luis Lasagna, with the corresponding section of the modern version of this oath stating “I will apply, for the benefit of the sick, all measures which are required, avoiding those twin traps of overtreatment and therapeutic nihilism”. The first of these “twin traps”, overtreatment, can be interpreted to mean not to treat a patient when no treatment is necessary. Why is this idea so important to our medical practice that it is ingrained into the foundation of medical ethics today? A likely reason for the inclusion of this line in the oath, even thousands of years ago, is that with every treatment comes a risk, whether inherent to the treatment or as a side effect. Reinforcing this idea is one the most common statements made about practicing medicine, erroneously attributed to the Hippocratic Oath is “first do no harm”. While a cursory interpretation of this would suggest that physicians are to cause no damage to their patients, often the treatments themselves can carry deleterious side effects, and some cases even lead to death. However, these treatments are still prescribed to patients despite the risks because the risks of the treatment are out weight

by the possible befits. The dichotomy of this struggle is perhaps best exemplified in the treatment of cancer.

In cancer treatment, toxic agents are selectively and carefully administered to patients in a hope that the drugs eliminate the malignancy before the patient’s body succumbs to the treatment itself. The list of potential side effects of chemotherapy is long and varied, including but not limited to; hair loss, weakness, loss of appetite, nausea, vomiting, diarrhea, shortness of breath, liver and kidney damage, reduced mental facilities, cardiac damage, neutropenia and even secondary malignancies. Both the mental and physical side effects of receiving chemotherapy can be incredibly taxing on a patient and their family. And the risks of these side effects can be high. In a study of leukemia patients receiving chemotherapy, nearly 30% developed pneumonia, and 17% died from the infection1. And while these side effects are severe, chemotherapeutics are still prescribed to patients. These drugs and other related treatments such as radiation therapy are the best tools at our disposal to deal with the myriad of diseases we group under the term “cancer”. Cancer is a highly heterogeneous group of diseases which all can be described by saying they are “A patient’s own cells which through random mutation, chemical exposure, or other initiating factor have lost control of their regulatory functions, no longer function as they were intended, and grow uncontrollably”. Cancers can be categorized by tissue or origin, common mutations, physical chrematistics, genetic heritage, surface markers, and biochemical signatures, and although the drugs we use to treat them are varied and have evolved over the decades, most still rely on the same premise as the earliest chemotherapeutics, that cancer cells grow at a faster rate than

healthy cells. However, this is only partially true and still leaves healthy tissue which normally has dividing cells at risk of being damaged by the drugs.

Many chemotherapeutics target mechanisms active in diving cells because malignant cells divide rapidly. This provides a differential response between healthy and disease cells. For example, taxanes inhibit the depolymerization of microtubules, preventing the affected cells from completing mitosis. Gemcytabine is a nucleoside analog that can be misincorporated into the DNA during replication and halts polymerase activity after its incorporation. Other nucleoside analogs can also halt DNA replication in a similar but unique fashion, and additionally inhibit enzymes required to synthesize the native nucleotides used during DNA replication. A plethora of anti-folate derivatives exist as well, with the primary drug being methotrexate. These drugs are structurally similar to folate, which is used in many biochemical pathways. Anti-folates generally function by binding to enzymes responsible for synthesizing nucleotides which normally bind folate or one of its metabolites as co-factors. Thymidylate synthase, dihydrofolate reductase, and glycinamide ribonucleotide formyltransferase, which are all involved in the synthesis of nucleotides necessary for DNA replication, are the primary targets of anti-folates. Anthracyclines function by inserting between the base pairs of DNA and prevent the unwinding of DNA by topoisomerases. While not an exhaustive list of chemotherapeutics by any means, most traditional therapies function by targeting cellular replication, often at the DNA level, however this is not always true. Many newer drugs target mutated or fusion proteins which can result in accelerated growth or reduced cell death in cancer. One such example is the drug imatanib, which prevents the action of a fusion protein that is a product of the fusion of the BCR and ABL genes which results in a

constitutively active tyrosine kinase which activates proteins responsible for cell growth via phosphorylation. Despite the arrival of drugs that act through other mechanisms that are used by dividing cells, most patients will receive some form of chemotherapy that acts through disruption of cellular replication. However, replication is not a feature that is exclusive to malignant cells, placing these healthy cells and patients in harm’s way.

Many of the body’s normal cells also replicate at a high rate, exposing them to the effects of chemotherapy. This explains why cancer patients often lose their hair as a result of chemotherapy, as the hair follicles which are growing and dividing are killed by the drugs. While this side effect is emotionally challenging for patients and their families, it is one of the least serious side effects of traditional chemotherapy. Perhaps one of the more concerning systems affected by chemotherapy is the immune system through depletion of immune cells. Patients can become immune deficient during treatment because immune precursor cells are constantly dividing, making them particularly susceptible to drugs that target replicative processes active in cancer cells. Additionally, when a person becomes infected with a pathogen clonal expansion of B and T cells is required to mount an effective immune response. Patients undergoing chemotherapy are monitored for their absolute neutrophil count during treatment, and drugs are often assessed for their nadir, or the time at which the immune system is at its lowest after treatment. The depletion of the immune system during chemotherapy is perhaps the most dangerous immediate side-effect, however some drugs also carry a risk of possibly fatal, long term effects as well.

Doxorubicin is the parent drug of the anthracycline group of drugs,

Figure 1: Illustration of Doxorubicin showing the tetracene and daunosamine ring systems which are categorized by their tetracene ring system, which gives the drug its deep red color, and exogenous daunosamine sugar ring (Figure 1). Anthracyclines are some of the most prescribed chemotherapeutic agents used in the clinic today, and are listed as a core medicine on WHO’s list of essential medicines for healthcare. They are used to treat a wide range of malignancies, including lymphoma, lung, ovarian, stomach, uterine, bladder, breast cancer, and leukemia. However, the use of anthracyclines has decreased in recent years with the introduction of new drugs which have fewer side-effects, anthracyclines are still used as a front line treatment in many malignancies including leukemia2,3. Initially isolated from a mold found in a 13th century castle in Italy in the

1950’s, the antibiotic was quickly identified to have anti-tumor activity and was in clinical use by the 1960’s4. However, after less than a decade in clinical use anthracyclines were identified to have irreversible cardiotoxicity by 19675. Further investigation showed that this effect was dose dependent6. This cardiotoxicity is especially detrimental in young patients with about 60% of all childhood cancer patients

receiving anthracyclines7. About 10% of children receiving a cumulative dose of

≤300mg/m2 Dox develop congestive heart failure8. While the exact reasons for anthracycline cardiotoxicity are still currently unknown, it is speculated that the drugs induce apoptosis in cardiomyocytes through a variety of pathways, including free radical production via the tetracene ring system interacting with iron9,10. This is supported by the use of an iron chelator, dexrazoxane, reducing cardiotoxicity in patients receiving anthracycline treatment11. Interestingly, this mechanism is unique from the mechanism that is responsible Dox’s anti-cancer effects.

Anthracyclines are highly lipophilic and can pass freely through the cell membrane. Once internalized into the cell the drug localizes to the nucleus where the tetracene ring system intercalates into the DNA, while the daunosamine sugar rests in the minor groove, with binding affinity of ≈100nM at 37°C12. Once intercalated into the

DNA Dox prevents the replication of DNA through poisoning of Topoisomerase II.

Topoisomerases are responsible for nicking, unwinding, and religating DNA during replication. Without the function of topoisomerases DNA can become supercoiled during replication, preventing the process from proceeding. Dox, and other anthracyclines, function by halting the progress of TopII by stabilizing the DNA-TopII complex at the site of intercalation after the DNA is cleaved by the enzyme13,14. These topoisomerase-

DNA-Drug adducts are referred to topoisomerase cleavage complexes. Once formed

TopIICC’s can elicit cell death in multiple ways, the primary mechanism that is responsible for activity is currently debated and likely varies from cell type to cell type.

Cleavage Complexes can result in double stranded DNA breaks can, which must be repaired by the cell. The accumulation of these breaks can result in fatal mutation if the

break is repaired improperly. Large amounts of breaks beyond the repair capacity of a cell can result in signaling the cell to undergo apoptosis. Interestingly, it appears that many of the enzymes responsible for signaling for repair, such as Ataxia Telangiectasia

Mutated, ATM. ATM functions to halt the cell cycle when double strand breaks are detected by phosphorylating CHK2, which leads to downstream signaling and halts the cell from proceeding through replication. However, if ATM is bound to the DNA for an extended period of time it can phosphorylate MDM, the inhibitor of P53, and begins a signal cascade resulting in apoptosis. Cells can gain resistance to anthracyclines through a variety of methods. MCF7 cells exposed to increasing levels of Dox had elevated levels of both type I and type II cytochrome p450 genes, which can metabolize the drug to an inactive form, as well as an increase in drug eflux pump genes. Resistant MCF-7 cells also down regulated TopII by 200 fold, reflecting the importance of TopII to the mechanism of anthracyclines15. While treating cancer cells through TopII poisoning has proven effective, it also carries with it a risk of inciting a secondary malignancy. Healthy cells exposed to the drug are generally replicating at a slower rate than the cancer, giving them more time to repair the lesions. However, DNA repair is imperfect, and can result in mutations that increase the odds of developing cancer later in life, commonly leukemia16,17. While anthracyclines are effective and their mechanism of action well understood they still possess serious side-effects, leaving researchers to develop new therapeutics that are safer and more effective than what is currently available.

The search for more effective chemotherapeutics has two end points; the development of drugs that are more potent, in that they are better at eradicating the malignancy and prevent recurrence, and developing therapies that have fewer side-

effects. These goals are not mutually exclusive, and can be accomplished through multiple means including using existing drugs in new applications, chemically modifying existing drugs, the development of entirely new drugs, or targeting drugs to the malignancy through a variety of methods.

While creating entirely novel drugs may result in the discovery of a generational leap in cancer treatment, this method requires the most resources from start to finish, has unpredictable effects, and has a very high likelihood of failure. Modifying current chemotherapeutics is a route that has been commonly exercised by researchers and pharmaceuticals alike, and has resulted in a plethora of drugs that all have similar mechanisms, but they possess slightly different properties such as potency, side-effects, and pharmacological factors . Examples include anthracyclines, (doxorubicin, daunorubicin, epirubicin, etc) and anti-folates (methotrexate, pemetrexed, raltitrexed, etc). This route of drug development rarely leads to breakthroughs in treatment, but is still a valuable component of drug discovery. Perhaps the most expeditious route to developing new therapies it to test current drugs, or drugs that failed to improve outcomes in one type of malignancy, against other types of cancers. The genetic, phenotypic, and physiological differences between cancers can result in drugs being ineffective in some cases, and highly effective in others, however any side-effects of the drug will still be present. A fourth route to developing better drugs is to target them specifically to malignant cells so that healthy cells receive a much lower exposure of the drug than the targeted cancer. This can be done by synthesizing new drugs that only act on targets expressed by cancer cells, or by linking current chemotherapeutics to a

delivery system. Drugs targeted directly to cancer cells allow for reduced side-effects while also being more potent than untargeted drugs.

I.2 Increasing Drug Efficacy through Targeted Therapies

While anthracyclines such as Dox have been used in the clinic for decades, their role is becoming diminished by drugs that have fewer and less severe side-effects than the heart failure and secondary malignancy. There are two methods in which more effective drugs with a higher therapeutic index can be made. The first method involves creating new small molecule drugs that act on processes that are only active in malignant cells, such as the BCR-ABL fusion protein specific imatinib. For the purposes of this work, this method will be referred to as “passive targeting” as the drug is still free to diffuse throughout the body and could possibly have off target effects elsewhere. The second method uses molecules, both small and macro scale, to deliver existing therapies to the site of the tumor, reducing the dose needed to treat the tumor. In some cases the targeting molecule can be therapeutic in its own right, such as trastuzumab which bind to and block signaling through the Her2 protein in breast cancer. This second method will be referred to as “active targeting” for the purpose of this work, as the drugs are being actively delivered to the site where they are desired.

Passively targeted drugs take advantage of processes that are unique to or critical to a cancer’s development, but not necessarily in normal cells. One of the earliest passively targeted drugs is tamoxifen, a drug that once metabolized competes with endogenous estrogen for binding to estrogen receptors on breast cancer cells18.

Tamoxifen was initially studied as a contraceptive, but it proved to be ineffective in this use, but it was found to have chemotherapeutic properties in the 1970’s19. Tamoxifen was later found to act on both estrogen receptor α and β, as a partial against/antagonist against

ER-α and pure antagonist through ER-β20. While estrogen receptors are expressed throughout the body it is hypothesized that the differential expression co-factors which regulate DNA binding and gene expression, which associate with ER’s are responsible for tamoxifen’s activity in breast tissue21. However, because ER’s are expressed throughout the body, side-effects can occur, including increased risk endometrial cancer due to altered ER activity in those tissues with treatment22. Tamoxifen is also used in otherwise healthy women to promote fertility and ovulation, further establishing off target effects of the drug23. A more recent example of a passively targeted drug is the

BCR-ABL tyrosine kinase inhibitor, imatinib. Imatinib functions by inhibiting the kinase activity of the constitutively active BCR-ABL fusion protein24. BCR-ABL is the product of a gene fusion event between chromosome 9 and 11 forming an aberrant chromosome, known as a Philadelphia chromosome, and is thought to be the driving oncogenic factor of chronic myelogenous leukemia25. The BCR-ABL protein has many downstream targets which it phosphorylates, including RAS/MAPK, PI/PI3K, and JACK/STAT pathways which all play a role in cell survival and proliferation26. Imatinib function by inserting into the ATP binding site of the BCR-ABL kinase, preventing the phosphorylation of the target proteins. The introduction of imatinib was highly successful, improving the prognosis of CML patients an average of 3-5 years to ≥ 90% survival after 8 years27. Imatinib is also generally well tolerated in patients, although nausea, headaches, diarrhea, and immune suppression are common. However, it is

possible for cancer cells to acquire immunity against imatinib via additional mutation to the BCR-ABL protein Imatinib bind near the ATP binding site of the kinase activity site in BCR-ABL and stabilizes the protein in an inactive form, however recent research has identified that mutation to the kinase domain of the protein alters the binding pocket of imatinib, resulting in a protein which remains in the active confirmation despite imatinib binding28.

Another way to specifically target drugs to cancer cells is to design molecules that actively seek out and bind to targets expressed on the cell surface. One of the most successful examples of this is the antibody trastuzumab, a monoclonal antibody against

HER2, which is over expressed in some subtypes of breast cancer. HER2 is a transmembrane protein with intracellular tyrosine kinase domains and an extracellular epidermal growth factor receptor domain. Over expression of HER2 results in increased signaling through increased dimerization, which autophosphorylate and being signaling through a variety of pathways including PI3K, MAPK, RAS, PKC, and SRC29. About

30% of breast cancers over express HER2, making it an attractive target for therapy30.

Combination therapy with trastuzumab and chemotherapy enhanced survival by 37% compared to chemotherapy alone in a meta-analysis of over 4000 patients with a median follow up time of 8.4 years31. Trastuzumab recognizes the extra cellular EGFR domain of

HER2 and blocks the binding of the ligand, preventing downstream signaling32 (Figure

2).

Figure 2: Trastuzumab FAB fragment (blue) binding to HER2; obtained from PDB entry 1N8Z Trastuzumab and other antibody based therapies can also aid in eliciting an immune response against the cell they are bound to through recognition of the Fc region of the antibody33. Trastuzumab is not the only antibody based therapy, and direct blockage of binding sites is only one way in which antibodies can be used as a therapy. Antibodies can be irradiated, and once administered they collect at the site which express the antibodies’ target, resulting in a much larger dose to the targeted tissue than healthy tissue34. Antibodies are also being explored to target nanosized particles as well to increase their efficacy.

Nanoparticles are a unique from other types of therapy in that they can be developed to accomplish multiple therapeutic goals simultaneously. Nanoparticles encompass a wide variety of molecules, and an exact definition of what a nanoparticle is, is still not entirely decided. Generally, nanoparticles are loosely defined as a large molecule or group of molecules that form a particle between 1 and a few hundred

nanometers. This definition could include single antibodies if applied liberally, however this is generally not accepted. Some examples of nanoparticles are; liposomes, buckeyballs, quantum dots, carbon nanotubes, and dendrimers to name a few. The myriad of materials and shapes that can be used to make nanoparticles allows for a wide variety of applications, but also makes the field difficult to detail exhaustively. Some nanoparticles elicit their effects directly, while other are used as a delivery system for conventional drugs. However, there are some similarities that most nanoparticles share which make them attractive therapeutic candidates. One of the most discussed of these attributes is the enhanced permeability and retention effect (EPR). The EPR effect is a result of increased vascular growth in tumors. Once tumors grow beyond ≈ 0.5mm3 they become vascularized to supply oxygen and nutrients to the tumor center35. These vessels are not as well organized or tightly structured as normal vasculature, although they contain most of the components of normal vasculature36. Endotheolial cells play a major role in controlling the influx and efflux of blood from the vessels and must maintain a tight monolayer in order to do so. In cancer associated vasculature endothelial cells are present but they fail to form a strong barrier, resulting in leaky vessels37. In healthy, non- leaky vessels nanoparticles are maintained within the vasculature, precluding them from extravasating into the tissue. In tumor vasculature, the lack of organized vessels allows the nanoparticles to extravasate into the tumor and collect there. This facilitates an increased efficacy of drugs delivered via nanoparticles than if they are administered as the free drug38. When doxorubicin was incorporated into a polyacrylamide particle it displayed reduced side-effects, and some anti-tumor effects in refractory tumors when examined in a phase I clinical trial, largely due to EPR39. Beyond EPR, nanoparticles also

have an extended plasma half-life when compared to small molecules. This is primarily due to reduced renal excretion of the nanoparticles. Particles greater than 15nm are not readily cleared by the kidney as they are too larger to pass through the glomerulus of the kidney40. While this increases plasma retention, require lower or less frequent dosing, it can also result in toxicities. This can be partially avoided by the development of biodegradable nanoparticles.

One of the earliest and most clinically successful nanomaterials are liposomes.

Liposomes are primarily composed of a mixture of a phospholipid bilayer, with other lipid components such as cholesterol incorporated into the bilayer for stability. Drugs can be encapsulated in the aqueous lumen of the liposome, or lipophilic drugs and be contained in the bilayer itself, although this may change the properties of the liposome.

The stability, size, melting temperature, and charge can all be controlled in liposomes by altering the membrane components. Additionally, liposomes can be modified on the surface by polyethyleneglycol or antibodies to extend half-life, reduce immunogenicity, or target the complex. Liposomes are well tolerated in vivo, and do not have significant long term toxicity due to the use of biodegradable materials. One of the most successful liposomal drugs used in the clinic is Doxil, a pegylated liposomal formulation of doxorubicin. Doxil is approved by the FDA for use in Kaposi sarcoma, ovarian cancer, multiple myeloma, and is in clinical trials as a treatment for metastatic breast cancer, with reduced cardiotoxic risk when compared to free doxorubicin despite having a 73 hour plasma half-life when compared to a 10 minute half-life of the free drug41, 42. Although,

Doxil does have a propensity to collect in the capillaries of the hands and feet, palmar- plantar erythrodysesthesia, which is redness, swelling, and peeling of the palms and soles

of the foot which is not associated with free doxorubicin. Myocet is an additional liposomal formulation of doxorubicin which does not have a PEG coating and is approved for use in Europe against metastatic breast cancer. It has equal efficacy to free doxorubicin when used in combination with cyclophosphamide, although having less side effects. Only 6% of patients receiving myocet versus 21% of patients treated with doxorubicin experienced cardiotoxicity44. While nanoparticles such as liposomes can increase the efficacy of a drug by altering its plasma half-life, stability, and distribution profile, they are still not actively targeted to a specific site, but rely on inherit properties based on their size to localize to a tumor site.

In order to further increase the efficacy of nanoparticles can be modified by appending a variety of targeting molecules to their surface. One of the most basic molecules that has been used for this purpose is folic acid (FA), which is utilized in one carbon transfers in the synthesis of nucleotides. There are multiple folate receptors that are expressed on the surface of cells that are used for importing the nutrient into cell which have picomolar affinity for the vitamin, providing a high affinity binding target for drug delivery44. Because malignant cells are dividing at a rapid rate they have increased metabolic requirements, and upregulate folate receptors in order to help meet the needs of high DNA replication rates. High folate receptor levels have been identified in ovarian, breast, lung, bladder, and pancreatic cancers, but some normal tissues also express high levels of folate receptor as well, limiting its specificity against malignant cells45. None the less, there are many preclinical and clinical trials that are examining folate targeted drugs46,47,48. Folate targeting has also been used on nanoparticles as well, which results in increased delivery to cells and better tumor growth inhibition than either free drug or

untargeted liposomes49,50. In addition to the pharmacological effects of liposomal delivery, encapsulating drugs in liposomes and targeting the liposomes allows researchers to target drugs that cannot be directly modified. However, because folate receptors are also expressed throughout the body, folate targeting can also result in an increase in normal tissue uptake versus free drug. Another method to target liposomes and other nanoparticles is through the use of antibodies. During oncogenic transformation many cancer cells alter expression of many proteins, including surface proteins which can be used as a target for delivery purposes. Surface proteins such as the previously discussed

HER2 in breast cancer allow antibodies to be produced which specifically bind to cells over expressing the target of interest. Other markers are being constantly identified, and the use of next generation sequencing has quickened the rate at which new targets can be identified51, 52, 53. Trastuzumab was linked to the surface of a liposome via an amide bond formed by reacting N-Hydroxysuccinimide linked to lipids on the surface of the liposome with primary amines on the antibody. These liposomes were then used to deliver an additional nanoparticle to HER2+ cancer cells, increasing delivery significantly over untargeted liposomes54. However, some research has indicated that targeting liposomes with antibodies does not increase localization to the tumor site, but increases efficacy by enhancing internalization into the cells55. This suggests that the EPR and other effects related to size drive the particles to accumulate at tumor sites regardless of targeting, but targeted particle bind directly to cells, holding them in positions that facilitate the large particles entering into cells at greater rates than untargeted particles.

Another cancer antigen, Prostate Specific Membrane Antigen (PSMA) is beginning to take hold as a candidate for targeted delivery as well. PSMA is expressed on

the surface prostate cells, and becomes more highly expressed in prostates cancer. PSMA has even been used to assess the likelihood of disease progression and recurence56, 57.

PSMA has also been shown to be upregulated in the vasculature of and in tumors of non- prostatic origin58. In order to capitalize on this J591, and antibody specific to PSMA was developed in the late 1990’s and recognizes the extracellular portion of PSMA59, 60.

Radiolabeled J591 has shown promise in preclinical trials and is currently being evaluated in clinical trials, demonstrating the viability of PSMA as a target61, 62, 63. J591 has also been used to target liposomes as well64. However, antibodies have some limitations for targeted delivery. If they are produced in non-human cells they must be humanized to reduce immunogenicity. Antibodies also must go through rigorous purification processes because they are produced in animals or cells and must be purified before use. Antibodies are also very sensitive to temperature changes and can become degraded if stored above 4°C. While antibodies have proven to be, and will continue to be, a promising avenue for targeted therapies there are other biomacromolecules that can also specifically recognize antigens on cancer cells as well which have a number of advantages over traditional antibodies.

I.3 DNA as a Structure: The use of DNA for Drug Targeting

DNA has been explored as a drug delivery agent for many decades, stretching back over 40 years. Anthracyclines were complexed with DNA before IV administration, resulting in increased plasma half-life, reduced toxicity, and altered efficacy, as the DNA acted as a carrier molecule for the drugs65. Similar to antibodies, DNA can be used to

target specific antigens expressed on cell surfaces as well. In the 1990’s it was discovered by Lary Gold that single stranded RNA, and later DNA, could fold into defined 3D shapes that could recognize a variety of ligands, including proteins, small molecules, and even metal ions66, 67, 68.

DNA is composed of a phosphodiester-deoxyribose backbone which one of four bases, guanine, adenine, cytosine, or thymidine, per unit. These bases can pair via hydrogen bonding with their commentary base, forming a double helix structure. Double stranded DNA can adopt one of three confirmations, A, B, and Z, with B-DNA being the most prevalent biologically. Both A- and B-DNA are rotate to the right, with the major difference being alterations in the rise per base pair and angles of the base pairs compared to the internal axis of the DNA. A-DNA appears to be the confirmation that DNA takes when either desiccated or when tightly packed69, 70. In contrast, Z-DNA has a left handed turn and other geometric changes when compared to B-DNA71. The biological purpose of

Z-DNA is still unknown, although it may play a role in strain relief during transcription72.

Base pairing with a complementary strand of DNA places structural and geometric restrictions on the confirmations that DNA can take, however, many of these restrictions are removed when there is only a single strand of DNA, allowing for a much wider range of 3D shapes to be formed.

In the case of aptamers, single stranded DNA is heated and cooled, resulting the single strands base pairing with themselves, forming stems and loops, loops, bulges, and other secondary structures which can bind to other molecules. These single stranded

DNA molecules are referred to as aptamers, and are designed via an iterative process known as SELEX, or Serial Evolution of Ligands by EXponential enrichment73. In

SELEX, a library of DNA is synthetically produced to contain known 3’ and 5’ sequences between 10 and 20 base pairs which are used as primers for PCR at later steps of SELEX. The interior region of the DNA sequences contains a random sequence of nucleotides, which can range from as few as 10 to as many as 40 bases, although nearly all possible combinations of sequences can be achieved with 25 random bases in a library of 1015 sequences, a typical number of sequences used in SELEX, although 1020 has been reported74. Once the library is synthesized, the nucleotides are run against a target of interest. Traditionally this is achieved by binding a protein to a column and running a solution of aptamers down the column. The column is then washed thoroughly and increasing concentrations of salt, change in pH, or increased temperature will remove weak binding sequences. Fractions are collected, with stronger binders being collected in later fractions. However, there are multiple ways to perform the selection step of SELEX, including magnetic bead binding, cell binding, and capillary electrophoresis75, 76, 77. The selection step of SELEX can even be performed in vivo by injecting an aptamer library into mice and isolating aptamers that localize to tumors or cross the blood brain barrier78,

79. After the selection step is complete, sequences are amplified by PCR, purified, and refolded using the same heating and cooling procedure that was performed on the parent structure so that the aptamers fold into the same shapes as they were in during the first step. This process is repeated a number of times, sometimes incorporating negative selection to remove non-specific binding aptamers. After the selection process is complete aptamers are cloned into bacteria, isolated and sequenced. Recently, next generation sequencing (NGS) has been used to remove the trial and error of cloning, making the aptamer identification step much more high throughput75. NGS can also be

used to monitor the evolution of an aptamer library after each selection80. Once aptamers are identified they are synthesized and assessed for binding to the target.

SELEX allows for the creation of aptamers that have low nanomolar to picomolar affinity, similar to antibodies, but their creation and production can be entirely abiotic.

Being chemically produced as opposed to biologically also allows for a myriad of modifications to be made to aptamers that would be difficult to achieve with antibodies.

Modifications of aptamers can be made in very specific locations, at the ends of the aptamer, or inserted exactly between any two bases that the researcher desires. For example, Aptamers can be fluorescently labeled at any point in the sequence, with exact stoichiometry, even allowing for different dyes to be inserted at specific locations on the aptamer. In antibodies, labeling is a result of dyes reacting with either cystines or glutamines, resulting in multiple dyes reacting randomly over the surface of the antibody.

Aptamers are also inherently non-immunogenic, although if an immune response is desired they can be engineered to stimulate a response81, 82. Aptamers can also be modified during SELEX for enhanced stability or increased variability. Recently an expanded genetic alphabet was used to select aptamers, increasing the possible sequences

83 signifcantly . Natural DNA utilizes the D isomer of glucose, however, the L isomer can also be used in the synthetic synthesis of DNA as well. Aptamers that are made of L isomer sugars are referred to as spiegelmers, and are resistant to nucleases because the enzymes do not recognize the mirror sugars used in these aptamers84. This is achieved by using the mirror of the target and a natural D isomer aptamer for selection and PCR, as L isomer based nucleic acids are not recognized by polymerases. When finally produced, L isomer sugars are used which recognize the natural target and not the mirror image that

was used for selection. Aptamers can also be modified for stability after selection as well by replacing natural phosphodiester bonds with phosphorothio bonds, which are much more resistant to nuclease degradation. Unnatural sugars and bases can also be introduced, as well as terminal PEG molecules all increase the plasma stability of aptamers. Aptamers can also have a variety of reactive groups incorporated that can be used for conjugation to other molecules of interest. Amines, thiols, azides, alkynes, NHS, and maleimide can all be incorporated into aptamers to link them to other molecules.

Aptamers have been used to target a variety of molecules, from directly linking drugs to the aptamer, all the way to targeting nanosized particles. Aptamers have been commonly used to target dox, mostly by taking advantage of the drugs natural affinity to intercalate into DNA85, 86, 87. However, relying on intercalation alone allows for doxorubicin to leak out of the complex, limiting the efficacy of these constructs. The use of reversible covalent linkages can greatly increase the stability of these complexes and will be addressed in later chapters. Other drugs such as gemcitabine have also been delivered via aptamers by using streptavidin-biotin conjugation88. While these conjugates often result in reduced cytotoxicity against cells when compared to free drug, targeting small molecule drugs in this way increases the specificity of the drugs against cancer cells while sparing healthy cells. General reduced cytotoxicity likely occurs due to decreased passive diffusion of drugs across membranes when they are aptamer bound, however reduced non-specific uptake ideally results in reduced side-effects and increased therapeutic index89. Alternatively, aptamers can also be used to target much larger particles. In these cases multiple, dozens to hundreds, of aptamers are bound to a single particle for delivery purposes. Multimerization of aptamers has been shown to increase

the avidity of the complex to the target90. Aptamers have been used to target many different types of nanoparticles, including carbon nanotubes, gold nanoparticles, and liposomes91, 92, 93.

Aptamers fill a similar role as antibodies in specific delivery, but the ability to rapidly develop new aptamers against nearly any target, alter the stability of the aptamers, select aptamers that have inherent activity such as BBB permeability or receptor blocking, their high degree of chemical malleability, and their relatively low cost to produce one they are identified makes them ideal candidates as drug delivery agents.

While chemotherapy has progressed a great deal since its beginnings in the 1940’s there is still a long road ahead. Chemotherapy drugs are not benign, and cancer treatment can carry risks that are as threatening as the disease itself. Side-effects of chemotherapy result from nonspecific uptake of drugs into healthy cells and can limit a patient’s treatment options. DNA based aptamer delivery represents an exciting avenue to target not only existing drugs, but also the burgeoning family of nanoparticles, increasing the therapeutic index of these therapies. Additionally, the original patent on SELEX technology has recently expired, opening the floodgates for new academic and industrial exploration of this technology. In the proceeding chapters many of these aspects will be discussed, including loading DNA and aptamers with doxorubicin with a novel reversible linker, targeting zinc chelating liposomes with the PSMA specific SZTI01 aptamer, as well as improving the aptamer selection process, reducing the selection time from months to a matter of weeks.

References:

1. Garcia, J.B., Lei, X., Wierda, W., Cortes, J.E., Dickey, B.F., Evans, S.E., and Ost,

D.E. (2013). Pneumonia during remission induction chemotherapy in patients

with acute leukemia. Ann Am Thorac Soc 10, 432–440.

2. Giordano, S.H., Lin, Y.-L., Kuo, Y.F., Hortobagyi, G.N., and Goodwin, J.S.

(2012). Decline in the Use of Anthracyclines for Breast Cancer. JCO

JCO.2011.40.1273.

3. Padron, E., and Fernandez, H. (2012). Anthracycline dose intensification in young

adults with acute myeloid leukemia. Ther Adv Hematol 3, 17–27.

4. Weiss, R.B. (1992). The anthracyclines: will we ever find a better doxorubicin?

Semin. Oncol. 19, 670–686.

5. Tan, C., Tasaka, H., Yu, K.-P., Murphy, M.L., and Karnofsky, D.A. (1967).

Daunomycin, an antitumor antibiotic, in the treatment of neoplastic disease.

Clinical evaluation with special reference to childhood leukemia. Cancer 20, 333–

353.

6. Lefrak, E.A., Piťha, J., Rosenheim, S., and Gottlieb, J.A. (1973). A

clinicopathologic analysis of adriamycin cardiotoxicity. Cancer 32, 302–314.

7. Heymans, H.S., and Caron, H.N. (2001). Childhood cancers in the Netherlands

(1989-1997). Ned Tijdschr Geneeskd 145, 1442–1444.

8. Van Dalen, E.C., van der Pal, H.J.H., Kok, W.E.M., Caron, H.N., and Kremer,

L.C.M. (2006). Clinical heart failure in a cohort of children treated with

anthracyclines: a long-term follow-up study. Eur. J. Cancer 42, 3191–3198.

9. Delemasure, S., Vergely, C., Zeller, M., Cottin, Y., and Rochette, L. (2006).

Preventing the cardiotoxic effects of anthracyclins. From basic concepts to

clinical data. Ann Cardiol Angeiol (Paris) 55, 104–112.

10. Gammella, E., Maccarinelli, F., Buratti, P., Recalcati, S., and Cairo, G. (2014).

The role of iron in anthracycline cardiotoxicity. Front Pharmacol 5.

11. Lyu, Y.L., Kerrigan, J.E., Lin, C.-P., Azarova, A.M., Tsai, Y.-C., Ban, Y., and

Liu, L.F. (2007). Topoisomerase IIβ–Mediated DNA Double-Strand Breaks:

Implications in Doxorubicin Cardiotoxicity and Prevention by Dexrazoxane.

Cancer Res 67, 8839–8846.

12. Schneider, Y.J., Baurain, R., Zenebergh, A., and Trouet, A. (1979). DNA-binding

parameters of daunorubicin and doxorubicin in the conditions used for studying

the interaction of anthracycline-DNA complexes with cells in vitro. Cancer

Chemother. Pharmacol. 2, 7–10.

13. Tacar, O., Sriamornsak, P., and Dass, C.R. (2013). Doxorubicin: an update on

anticancer molecular action, toxicity and novel drug delivery systems. J. Pharm.

Pharmacol. 65, 157–170.

14. Yang, F., Teves, S.S., Kemp, C.J., and Henikoff, S. (2014). Doxorubicin, DNA

torsion, and chromatin dynamics. Biochim Biophys Acta 1845, 84–89.

15. AbuHammad, S., and Zihlif, M. (2013). Gene expression alterations in

doxorubicin resistant MCF7 breast cancer cell line. Genomics 101, 213–220.

16. Pullarkat, V., Slovak, M.L., Dagis, A., Bedell, V., Somlo, G., Nakamura, R.,

Stein, A.S., O’Donnell, M.R., Nademanee, A., Teotico, A.L., et al. (2009). Acute

leukemia and myelodysplasia after adjuvant chemotherapy for breast cancer:

durable remissions after hematopoietic stem cell transplantation. Ann Oncol 20,

2000–2006.

17. Kaplan, H.G., Malmgren, J.A., and Atwood, M.K. (2011). Increased incidence of

myelodysplastic syndrome and acute myeloid leukemia following breast cancer

treatment with radiation alone or combined with chemotherapy: a registry cohort

analysis 1990-2005. BMC Cancer 11, 260.

18. Desta, Z., Ward, B.A., Soukhova, N.V., and Flockhart, D.A. (2004).

Comprehensive Evaluation of Tamoxifen Sequential Biotransformation by the

Human Cytochrome P450 System in Vitro: Prominent Roles for CYP3A and

CYP2D6. J Pharmacol Exp Ther 310, 1062–1075.

19. Cole, M.P., Jones, C.T., and Todd, I.D. (1971). A new anti-oestrogenic agent in

late breast cancer. An early clinical appraisal of ICI46474. Br. J. Cancer 25, 270–

275.

20. Barkhem, T., Carlsson, B., Nilsson, Y., Enmark, E., Gustafsson, J., and Nilsson,

S. (1998). Differential response of estrogen receptor alpha and estrogen receptor

beta to partial estrogen agonists/antagonists. Mol. Pharmacol. 54, 105–112.

21. Ring, A., and Dowsett, M. (2004). Mechanisms of tamoxifen resistance. Endocr

Relat Cancer 11, 643–658.

22. Fisher, B., Costantino, J.P., Redmond, C.K., Fisher, E.R., Wickerham, D.L.,

Cronin, W.M., and Contributors, O.N. (1994). Endometrial Cancer in Tamoxifen-

Treated Breast Cancer Patients: Findings From the National Surgical Adjuvant

Breast and Bowel Project (NSABP) B-14. JNCI J Natl Cancer Inst 86, 527–537.

23. Boostanfar, R., Jain, J.K., Mishell Jr., D.R., and Paulson, R.J. (2001). A

prospective randomized trial comparing clomiphene citrate with tamoxifen citrate

for ovulation induction. Fertility and Sterility 75, 1024–1026.

24. Deininger, M.W.N., and Druker, B.J. (2003). Specific targeted therapy of chronic

myelogenous leukemia with imatinib. Pharmacol. Rev. 55, 401–423.

25. Daley, G.Q., Etten, R.V., and Baltimore, D. (1990). Induction of chronic

myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia

chromosome. Science 247, 824–830.

26. Weisberg, E., Manley, P.W., Cowan-Jacob, S.W., Hochhaus, A., and Griffin, J.D.

(2007). Second generation inhibitors of BCR-ABL for the treatment of imatinib-

resistant chronic myeloid leukaemia. Nat Rev Cancer 7, 345–356.

27. Gambacorti-Passerini, C., Antolini, L., Mahon, F.-X., Guilhot, F., Deininger, M.,

Fava, C., Nagler, A., Della Casa, C.M., Morra, E., Abruzzese, E., et al. (2011).

Multicenter independent assessment of outcomes in chronic myeloid leukemia

patients treated with imatinib. J. Natl. Cancer Inst. 103, 553–561.

28. Gambacorti-Passerini, C.B., Gunby, R.H., Piazza, R., Galietta, A., Rostagno, R.,

and Scapozza, L. (2003). Molecular mechanisms of resistance to imatinib in

Philadelphia-chromosome-positive leukaemias. The Lancet Oncology 4, 75–85.

29. Bose, R., Molina, H., Patterson, A.S., Bitok, J.K., Periaswamy, B., Bader, J.S.,

Pandey, A., and Cole, P.A. (2006). Phosphoproteomic analysis of Her2/neu

signaling and inhibition. PNAS 103, 9773–9778.

30. Cho, H.-S., Mason, K., Ramyar, K.X., Stanley, A.M., Gabelli, S.B., Denney,

D.W., and Leahy, D.J. (2003). Structure of the extracellular region of HER2 alone

and in complex with the Herceptin Fab. Nature 421, 756–760.

31. Perez, E.A., Romond, E.H., Suman, V.J., Jeong, J.-H., Sledge, G., Geyer, C.E.,

Martino, S., Rastogi, P., Gralow, J., Swain, S.M., et al. (2014). Trastuzumab Plus

Adjuvant Chemotherapy for Human Epidermal Growth Factor Receptor 2–

Positive Breast Cancer: Planned Joint Analysis of Overall Survival From NSABP

B-31 and NCCTG N9831. JCO 32, 3744–3752.

32. Slamon, D.J., Godolphin, W., Jones, L.A., Holt, J.A., Wong, S.G., Keith, D.E.,

Levin, W.J., Stuart, S.G., Udove, J., and Ullrich, A. (1989). Studies of the HER-

2/neu proto-oncogene in human breast and ovarian cancer. Science 244, 707–712.

33. Clynes, R.A., Towers, T.L., Presta, L.G., and Ravetch, J.V. (2000). Inhibitory Fc

receptors modulate in vivo cytotoxicity against tumor targets. Nat. Med. 6, 443–

446.

34. Srinivasan, A., and Mukherji, S.K. (2011). Tositumomab and Iodine I 131

Tositumomab (Bexaar). AJNR Am J Neuroradiol 32, 637–638.

35. Thompson, W.D., Shiach, K.J., Fraser, R.A., McIntosh, L.C., and Simpson, J.G.

(1987). Tumours acquire their vasculature by vessel incorporation, not vessel

ingrowth. J. Pathol. 151, 323–332.

36. Morikawa, S., Baluk, P., Kaidoh, T., Haskell, A., Jain, R.K., and McDonald,

D.M. (2002). Abnormalities in pericytes on blood vessels and endothelial sprouts

in tumors. Am. J. Pathol. 160, 985–1000.

37. Hashizume, H., Baluk, P., Morikawa, S., McLean, J.W., Thurston, G., Roberge,

S., Jain, R.K., and McDonald, D.M. (2000). Openings between Defective

Endothelial Cells Explain Tumor Vessel Leakiness. Am J Pathol 156, 1363–1380.

38. Matsumura, Y., and Maeda, H. (1986). A New Concept for Macromolecular

Therapeutics in Cancer Chemotherapy: Mechanism of Tumoritropic

Accumulation of Proteins and the Antitumor Agent Smancs. Cancer Res 46,

6387–6392.

39. Vasey, P.A., Kaye, S.B., Morrison, R., Twelves, C., Wilson, P., Duncan, R.,

Thomson, A.H., Murray, L.S., Hilditch, T.E., Murray, T., et al. (1999). Phase I

Clinical and Pharmacokinetic Study of PK1 [N-(2-

Hydroxypropyl)methacrylamide Copolymer Doxorubicin]: First Member of a

New Class of Chemotherapeutic Agents—Drug-Polymer Conjugates. Clin Cancer

Res 5, 83–94.

40. Choi, H.S., Liu, W., Misra, P., Tanaka, E., Zimmer, J.P., Ipe, B.I., Bawendi,

M.G., and Frangioni, J.V. (2007). Renal Clearance of Nanoparticles. Nat

Biotechnol 25, 1165–1170.

41. O’Brien, M.E.R., Wigler, N., Inbar, M., Rosso, R., Grischke, E., Santoro, A.,

Catane, R., Kieback, D.G., Tomczak, P., Ackland, S.P., et al. (2004). Reduced

cardiotoxicity and comparable efficacy in a phase III trial of pegylated liposomal

doxorubicin HCl (CAELYXTM/Doxil®) versus conventional doxorubicin for first-

line treatment of metastatic breast cancer. Ann Oncol 15, 440–449.

42. Safra, T., Muggia, F., Jeffers, S., Tsao-Wei, D.D., Groshen, S., Lyass, O.,

Henderson, R., Berry, G., and Gabizon, A. (2000). Pegylated liposomal

doxorubicin (doxil): Reduced clinical cardiotoxicity in patients reaching or

exceeding cumulative doses of 500 mg/m2. Ann Oncol 11, 1029–1033.

43. Batist, G., Ramakrishnan, G., Rao, C.S., Chandrasekharan, A., Gutheil, J.,

Guthrie, T., Shah, P., Khojasteh, A., Nair, M.K., Hoelzer, K., et al. (2001).

Reduced Cardiotoxicity and Preserved Antitumor Efficacy of Liposome-

Encapsulated Doxorubicin and Cyclophosphamide Compared With Conventional

Doxorubicin and Cyclophosphamide in a Randomized, Multicenter Trial of

Metastatic Breast Cancer. JCO 19, 1444–1454.

44. Kamen, B.A., and Capdevila, A. (1986). Receptor-mediated folate accumulation

is regulated by the cellular folate content. Proc. Natl. Acad. Sci. U.S.A. 83, 5983–

5987.

45. Parker, N., Turk, M.J., Westrick, E., Lewis, J.D., Low, P.S., and Leamon, C.P.

(2005). Folate receptor expression in carcinomas and normal tissues determined

by a quantitative radioligand binding assay. Analytical Biochemistry 338, 284–

293.

46. Leamon, C.P., Reddy, J.A., Vlahov, I.R., Westrick, E., Dawson, A., Dorton, R.,

Vetzel, M., Santhapuram, H.K., and Wang, Y. (2007). Preclinical antitumor

activity of a novel folate-targeted dual drug conjugate. Mol. Pharm. 4, 659–667.

47. Reddy, J.A., Dorton, R., Westrick, E., Dawson, A., Smith, T., Xu, L.-C., Vetzel,

M., Kleindl, P., Vlahov, I.R., and Leamon, C.P. (2007). Preclinical evaluation of

EC145, a folate-vinca alkaloid conjugate. Cancer Res. 67, 4434–4442.

48. Sausville, E., LoRusso, P., Quinn, M., Forman, K., Leamon, C., Morganstern, D.,

Bever, S., and Messmann, R. (2007). A phase I study of EC145 administered

weeks 1 and 3 of a 4-week cycle in patients with refractory solid tumors. ASCO

Meeting Abstracts 25, 2577.

49. Wang, C., Feng, L., Yang, X., Wang, F., and Lu, W. (2013). Folic acid-

conjugated liposomal vincristine for multidrug resistant cancer therapy. Asian

Journal of Pharmaceutical Sciences 8, 118–127.

50. Goren, D., Horowitz, A.T., Tzemach, D., Tarshish, M., Zalipsky, S., and Gabizon,

A. (2000). Nuclear delivery of doxorubicin via folate-targeted liposomes with

bypass of multidrug-resistance efflux pump. Clin. Cancer Res. 6, 1949–1957.

51. Beltran, H., Yelensky, R., Frampton, G.M., Park, K., Downing, S.R., MacDonald,

T.Y., Jarosz, M., Lipson, D., Tagawa, S.T., Nanus, D.M., et al. (2013). Targeted

next-generation sequencing of advanced prostate cancer identifies potential

therapeutic targets and disease heterogeneity. Eur. Urol. 63, 920–926.

52. Hardt, O., Wild, S., Oerlecke, I., Hofmann, K., Luo, S., Wiencek, Y., Kantelhardt,

E., Vess, C., Smith, G.P., Schroth, G.P., et al. (2012). Highly sensitive profiling of

CD44+/CD24− breast cancer stem cells by combining global mRNA

amplification and next generation sequencing: Evidence for a hyperactive PI3K

pathway. Cancer Letters 325, 165–174.

53. Ley, T.J., Mardis, E.R., Ding, L., Fulton, B., McLellan, M.D., Chen, K., Dooling,

D., Dunford-Shore, B.H., McGrath, S., Hickenbotham, M., et al. (2008). DNA

sequencing of a cytogenetically normal acute myeloid leukaemia genome. Nature

456, 66–72.

54. Jang, M., Yoon, Y.I., Kwon, Y.S., Yoon, T.-J., Lee, H.J., Hwang, S.I., Yun, B.L.,

and Kim, S.M. (2014). Trastuzumab-Conjugated Liposome-Coated Fluorescent

Magnetic Nanoparticles to Target Breast Cancer. Korean J Radiol 15, 411–422.

55. Kirpotin, D.B., Drummond, D.C., Shao, Y., Shalaby, M.R., Hong, K., Nielsen,

U.B., Marks, J.D., Benz, C.C., and Park, J.W. (2006). Antibody Targeting of

Long-Circulating Lipidic Nanoparticles Does Not Increase Tumor Localization

but Does Increase Internalization in Animal Models. Cancer Res 66, 6732–6740.

56. Perner, S., Hofer, M.D., Kim, R., Shah, R.B., Li, H., Möller, P., Hautmann, R.E.,

Gschwend, J.E., Kuefer, R., and Rubin, M.A. (2007). Prostate-specific membrane

antigen expression as a predictor of prostate cancer progression. Hum. Pathol. 38,

696–701.

57. Ross, J.S., Sheehan, C.E., Fisher, H.A.G., Kaufman, R.P., Kaur, P., Gray, K.,

Webb, I., Gray, G.S., Mosher, R., and Kallakury, B.V.S. (2003). Correlation of

primary tumor prostate-specific membrane antigen expression with disease

recurrence in prostate cancer. Clin. Cancer Res. 9, 6357–6362.

58. Haffner, M.C., Kronberger, I.E., Ross, J.S., Sheehan, C.E., Zitt, M., Mühlmann,

G., Ofner, D., Zelger, B., Ensinger, C., Yang, X.J., et al. (2009). Prostate-specific

membrane antigen expression in the neovasculature of gastric and colorectal

cancers. Hum. Pathol. 40, 1754–1761.

59. Chang, S.S., Reuter, V.E., Heston, W.D.W., Bander, N.H., Grauer, L.S., and

Gaudin, P.B. (1999). Five Different Anti-Prostate-specific Membrane Antigen

(PSMA) Antibodies Confirm PSMA Expression in Tumor-associated

Neovasculature. Cancer Res 59, 3192–3198.

60. Liu, H., Moy, P., Kim, S., Xia, Y., Rajasekaran, A., Navarro, V., Knudsen, B.,

and Bander, N.H. (1997). Monoclonal Antibodies to the Extracellular Domain of

Prostate-specific Membrane Antigen Also React with Tumor Vascular

Endothelium. Cancer Res 57, 3629–3634.

61. Pandit-Taskar, N., O’Donoghue, J.A., Divgi, C.R., Wills, E.A., Schwartz, L.,

Gönen, M., Smith-Jones, P., Bander, N.H., Scher, H.I., Larson, S.M., et al.

(2015). Indium 111-labeled J591 anti-PSMA antibody for vascular targeted

imaging in progressive solid tumors. EJNMMI Res 5.

62. Pandit-Taskar, N., O’Donoghue, J.A., Durack, J.C., Lyashchenko, S.K., Cheal,

S.M., Beylergil, V., Lefkowitz, R.A., Carrasquillo, J.A., Martinez, D.F., Fung,

A.M., et al. (2015). A Phase I/II Study for Analytic Validation of 89Zr-J591

ImmunoPET as a Molecular Imaging Agent for Metastatic Prostate Cancer. Clin.

Cancer Res. 21, 5277–5285.

63. Tagawa, S.T., Milowsky, M.I., Morris, M., Vallabhajosula, S., Christos, P.,

Akhtar, N.H., Osborne, J., Goldsmith, S.J., Larson, S., Taskar, N.P., et al. (2013).

Phase II Study of Lutetium-177–Labeled Anti-Prostate-Specific Membrane

Antigen Monoclonal Antibody J591 for Metastatic Castration-Resistant Prostate

Cancer. Clin Cancer Res 19, 5182–5191.

64. Bandekar, A., Zhu, C., Jindal, R., Bruchertseifer, F., Morgenstern, A., and Sofou,

S. (2014). Anti–Prostate-Specific Membrane Antigen Liposomes Loaded with

225Ac for Potential Targeted Antivascular α-Particle Therapy of Cancer. J Nucl

Med 55, 107–114.

65. Trouet, A., and Campeneere, D.D.-D. (1979). Daunorubicin-DNA and

doxorubicin-DNA a review of experimental and clinical data. Cancer Chemother.

Pharmacol. 2, 77–79.

66. Gold, L., Janjic, N., Jarvis, T., Schneider, D., Walker, J.J., Wilcox, S.K., and

Zichi, D. (2012). Aptamers and the RNA World, Past and Present. Cold Spring

Harb Perspect Biol 4, a003582.

67. Wrzesinski, J., and Ciesiolka, J. (2005). Characterization of Structure and Metal

Ions Specificity of Co2+-Binding RNA Aptamers†. Biochemistry 44, 6257–6268.

68. Kammer, M.N., Olmsted, I.R., Kussrow, A.K., Morris, M.J., Jackson, G.W., and

Bornhop, D.J. (2014). Characterizing aptamer small molecule interactions with

backscattering interferometry. Analyst 139, 5879–5884.

69. Whelan, D.R., Hiscox, T.J., Rood, J.I., Bambery, K.R., McNaughton, D., and

Wood, B.R. (2014). Detection of an en masse and reversible B- to A-DNA

conformational transition in prokaryotes in response to desiccation. J R Soc

Interface 11, 20140454.

70. Harvey, S.C. (2015). The scrunchworm hypothesis: transitions between A-DNA

and B-DNA provide the driving force for genome packaging in double-stranded

DNA bacteriophages. J. Struct. Biol. 189, 1–8.

71. Mitsui, Y., Langridge, R., Shortle, B.E., Cantor, C.R., Grant, R.C., Kodama, M.,

and Wells, R.D. (1970). Physical and enzymatic studies on poly d(I-C)-poly d(I-

C), an unusual double-helical DNA. Nature 228, 1166–1169.

72. Champ, P.C., Maurice, S., Vargason, J.M., Camp, T., and Ho, P.S. (2004).

Distributions of Z-DNA and nuclear factor I in human chromosome 22: a model

for coupled transcriptional regulation. Nucleic Acids Res. 32, 6501–6510.

73. Tuerk, C., and Gold, L. (1990). Systematic evolution of ligands by exponential

enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249,

505–510.

74. Gold, L. (1995). Oligonucleotides as Research, Diagnostic, and Therapeutic

Agents. J. Biol. Chem. 270, 13581–13584.

75. Riley, K.R., Gagliano, J., Xiao, J., Libby, K., Saito, S., Yu, G., Cubicciotti, R.,

Macosko, J., Colyer, C.L., Guthold, M., et al. (2015). Combining capillary

electrophoresis and next-generation sequencing for aptamer selection. Anal

Bioanal Chem 407, 1527–1532.

76. Stoltenburg, R., Reinemann, C., and Strehlitz, B. (2005). FluMag-SELEX as an

advantageous method for DNA aptamer selection. Anal Bioanal Chem 383, 83–

91.

77. Sefah, K., Shangguan, D., Xiong, X., O’Donoghue, M.B., and Tan, W. (2010).

Development of DNA aptamers using Cell-SELEX. Nature Protocols 5, 1169–

1185.

78. Mi, J., Liu, Y., Rabbani, Z.N., Yang, Z., Urban, J.H., Sullenger, B.A., and Clary,

B.M. (2010). In vivo selection of tumor-targeting RNA motifs. Nat Chem Biol 6,

22–24.

79. Cheng, C., Chen, Y.H., Lennox, K.A., Behlke, M.A., and Davidson, B.L. (2013).

In vivo SELEX for Identification of Brain-penetrating Aptamers. Mol Ther

Nucleic Acids 2, e67.

80. Schütze, T., Wilhelm, B., Greiner, N., Braun, H., Peter, F., Mörl, M., Erdmann,

V.A., Lehrach, H., Konthur, Z., Menger, M., et al. (2011). Probing the SELEX

process with next-generation sequencing. PLoS ONE 6, e29604.

81. Avci-Adali, M., Steinle, H., Michel, T., Schlensak, C., and Wendel, H.P. (2013).

Potential Capacity of Aptamers to Trigger Immune Activation in Human Blood.

PLoS ONE 8, e68810.

82. Avci-Adali, M., Steinle, H., Michel, T., Schlensak, C., and Wendel, H.P. (2013).

Potential Capacity of Aptamers to Trigger Immune Activation in Human Blood.

PLoS ONE 8, e68810.

83. Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S., and Hirao, I. (2013).

Generation of high-affinity DNA aptamers using an expanded genetic alphabet.

Nat Biotech 31, 453–457.

84. Vater, A., and Klussmann, S. (2015). Turning mirror-image oligonucleotides into

drugs: the evolution of Spiegelmer® therapeutics. Drug Discovery Today 20,

147–155.

85. Subramanian, N., Raghunathan, V., Kanwar, J.R., Kanwar, R.K., Elchuri, S.V.,

Khetan, V., and Krishnakumar, S. (2012). Target-specific delivery of doxorubicin

to retinoblastoma using epithelial cell adhesion molecule aptamer. Mol Vis 18,

2783–2795.

86. Bagalkot, V., Farokhzad, O.C., Langer, R., and Jon, S. (2006). An Aptamer–

Doxorubicin Physical Conjugate as a Novel Targeted Drug-Delivery Platform.

Angewandte Chemie International Edition 45, 8149–8152.

87. Zhu, G., Zheng, J., Song, E., Donovan, M., Zhang, K., Liu, C., and Tan, W.

(2013). Self-assembled, aptamer-tethered DNA nanotrains for targeted transport

of molecular drugs in cancer theranostics. Proc Natl Acad Sci U S A 110, 7998–

8003.

88. Ray, P., Cheek, M.A., Sharaf, M.L., Li, N., Ellington, A.D., Sullenger, B.A.,

Shaw, B.R., and White, R.R. (2012). Aptamer-Mediated Delivery of

Chemotherapy to Pancreatic Cancer Cells. Nucleic Acid Ther 22, 295–305.

89. Schrand, B., Berezhnoy, A., Brenneman, R., Williams, A., Levay, A., Kong, L.-

Y., Rao, G., Zhou, S., Heimberger, A.B., and Gilboa, E. (2014). Targeting 4-1BB

Costimulation to the Tumor Stroma with Bispecific Aptamer Conjugates

Enhances the Therapeutic Index of Tumor Immunotherapy. Cancer Immunol Res

2, 867–877.

90. Mallikaratchy, P.R., Ruggiero, A., Gardner, J.R., Kuryavyi, V., Maguire, W.F.,

Heaney, M.L., McDevitt, M.R., Patel, D.J., and Scheinberg, D.A. (2011). A

multivalent DNA aptamer specific for the B-cell receptor on human lymphoma

and leukemia. Nucleic Acids Res 39, 2458–2469.

91. Zhang, H., Hou, L., Jiao, X., Yandan, J., Zhu, X., Hongji, L., Chen, X., Ren, J.,

Xia, Y., and Zhang, Z. (2014). In vitro and in vivo evaluation of antitumor drug-

loaded aptamer targeted single-walled carbon nanotubes system. Curr Pharm

Biotechnol 14, 1105–1117.

92. Javier, D.J., Nitin, N., Levy, M., Ellington, A., and Richards-Kortum, R. (2008).

Aptamer-Targeted Gold Nanoparticles As Molecular-Specific Contrast Agents for

Reflectance Imaging. Bioconjug Chem 19, 1309–1312.

93. Alshaer, W., Hillaireau, H., Vergnaud, J., Ismail, S., and Fattal, E. (2015).

Functionalizing Liposomes with anti-CD44 Aptamer for Selective Targeting of

Cancer Cells. Bioconjugate Chem. 26, 1307–1313.

Chapter II

Site-Specific DNA–Doxorubicin Conjugates Display Enhanced

Cytotoxicity to Breast Cancer Cells

Christopher H. Stuart†‡, David A. Horita§, Michael J. Thomas§, Freddie R. SalsburyJr.∥,

Mark O. Lively§, and William H. Gmeiner*†‡

Author Affiliations:

†Department of Cancer Biology, ‡Department of Molecular Medicine and Translation

Science, Wake Forest School of Medicine, and §Department of Biochemistry, Wake

Forest School of Medicine, Winston-Salem, North Carolina 27157, United States, ∥

Department of Physics, Wake Forest University, Winston-Salem, North Carolina 27109,

United States

Corresponding Author:

William H. Gmeiner, Hanes Building, Room 5044, Medical Center Boulevard, Winston

Salem, NC 27157.

Phone: 336-716-6216; Fax: 336-716-0255; E-mail: [email protected]

This chapter is composed of a published manuscript. The stylistic differences between this chapter and other portions of this dissertation are due to requirements of the journal.

CS and WG conceived and designed the project. CS preformed the experiments. DH aided in NMR spectroscopy. MJ aided in MS experiments. FS aided in 3D modeling. CS wrote the manuscript with editorial input from WG.

Bioconjugate Chemistry, 2014, 25(406-413), DOI: 10.1021/bc4005427

II.1 Abstract:

Doxorubicin (Dox) is widely used for breast cancer treatment but causes serious side effects including cardiotoxicity that may adversely impact patient lifespan even if treatment is successful. Herein, we describe selective conjugation of Dox to a single site in a DNA hairpin resulting in a highly stable complex that enables Dox to be used more effectively. Selective conjugation of Dox to G15 in the hairpin loop was verified using site-specific labeling with [2-15N]-2′-deoxyguanosine in conjunction with [1H–15N] 2D

NMR, while 1:1 stoichiometry for the conjugate was validated by ESI-QTOF mass spectrometry and UV spectroscopy. Molecular modeling indicated covalently bound Dox also intercalated into the stem of the hairpin and stability studies demonstrated the resulting Dox-conjugated hairpin (DCH) complex had a half-life >30 h, considerably longer than alternative covalent and noncovalent complexes. Secondary conjugation of

DCH with folic acid (FA) resulted in increased internalization into breast cancer cells.

The dual conjugate, DCH-FA, can be used for safer and more effective chemotherapy with Dox and this conjugation strategy can be expanded to include additional anticancer drugs.

II.2 Introduction:

Doxorubicin (Dox) is widely used for treating breast cancer and other malignancies; however, serious toxicities, including an occasionally lethal cardiotoxicity, counter the therapeutic benefit of Dox, resulting in a search for chemical modifications that attenuate systemic toxicities while maintaining strong antitumor activity.(1) The principal cytotoxic mechanism of Dox is poisoning of DNA topoisomerase 2 (Top2) which results in generation of lethal DNA double strand breaks (DSBs).(2) Dox also undergoes

REDOX cycling and increases oxidative stress following cell uptake. Recent studies have indicated that Dox cardiotoxicity results from an on-target effect, the poisoning of Top 2 in cardiomyocytes.(3) Hence, strategies to improve the therapeutic index of Dox require prolonged sequestration of Dox while in circulation and efficient Dox release following selective uptake into targeted cancer cells. We describe here a new approach for Dox delivery to cancer cells that takes advantage of the selective chemical reactivity of a single-site in a DNA hairpin to create a novel Dox-conjugated DNA hairpin (DCH) with

favorable Dox retention and release properties and that is targeted to breast cancer cells via folic acid conjugation.

DNA is central to biological function as the repository of genetic information, but DNA also has tremendous potential as a material with diverse potential functions, including drug delivery. Our laboratory has demonstrated the utility of DNA for delivery of cytotoxic nucleotide analogs with F10, a polymer of the thymidylate synthase (TS) inhibitory nucleotide 5-fluoro-2′-deoxyuridine-5′-O-monophosphate (FdUMP) displaying enhanced antileukemic activity and reduced systemic toxicity relative to conventional fluoropyrimidine drugs such as 5-fluorouracil (5-FU).(4, 5) We recently demonstrated the potential for DNA hairpins to be useful for drug delivery with involvement of both the major and minor grooves as well as the duplex region of the hairpin. We have shown that cytotoxicity can be modulated by inclusion of minor groove binding ligands, such as netropsin or distamycin, while Zn2+, a metal ion that displays anticancer activity, can occupy the major groove in DNA hairpins appropriately substituted with FdU nucleotides in the stem.(6, 7) Hence, not only are the chemical properties of DNA of potential use for drug delivery, but its structural diversity may also be utilized for drug delivery applications.

Dox interacts with DNA via intercalation of the tetracene ring system between the planar base pairs of duplex DNA and occupation of the minor groove by the daunosamine sugar moiety.(8) Noncovalent binding of Dox to DNA is, however, readily reversible, and noncovalent complexes have relatively short half-lives (t1/2 ∼ minutes). Nonetheless, in clinical trials noncovalent association of Dox with calf-thymus DNA reduced Dox cardiotoxicity and improved the therapeutic index.(9) Dox also forms covalent adducts

with DNA that are more stable but require an aldehyde precursor to link the daunosamine sugar of Dox to the exocyclic amine of guanine with the reaction proceeding via a Schiff base intermediate.(10, 11) Dox–DNA covalent adducts are more cyotoxic than noncovalent complexes, and covalent adducts have been synthesized and used as end- points in studies of anthracycline cytotoxicity.(12) Formaldehyde is used in the formation of Dox–DNA adducts, and exogenous formaldehyde promotes Dox covalent adduct formation to genomic DNA. Dox–formaldehyde conjugates have been prepared and used for delivery of an activated form of Dox that favors covalent adduct formation to genomic DNA.(13)

We describe here the synthesis of a covalent conjugate of Dox to a single site of a DNA hairpin and demonstrate that this conjugate can be targeted to breast cancer cells. Dox covalent binding to DNA occurs primarily at N2 of guanines with sequence specificity for 5′-dGpC sites, suggesting a 3D conformation that facilitates covalent binding.(14)

Our studies utilized a 25mer DNA hairpin that included a GAA hairpin-promoting sequence closed by a CG base pair with the stem consisting of 10 dA-dT base pairs

(Figure 1). Although the hairpin included two dG sites, using 2D NMR in conjunction with site-specific labeling we determined only G15 in the GAA hairpin promoting motif formed a covalent adduct with Dox (Figure 2). Molecular modeling suggested that G15

N2 was not engaged in alternative interactions stabilizing the hairpin and that the tetracene ring system intercalated between the CG and first AT base pairs (Figure 3). The

Dox-conjugated hairpin was exceedingly stable with a half-life of ∼30 h at physiological pH while the noncovalent complex had a half-life of minutes (Figure 4). Dox was however efficiently released at the acidic pH of endosomes following cell uptake (Figure

5). Folic acid conjugation of the hairpin resulted in cell-specific uptake into breast cancer cells and selective cytotoxicity toward targeted cells (Figure 6). These results demonstrate the utility of DNA hairpin conjugates for the improved delivery of Dox and other anticancer drugs.

Figure 1. Reversible reaction between Doxorubicin and the exocyclic amino of Guanine in DNA mediated through formaldehyde. Red “G” in the secondary structure of the hairpin denotes potential sites of Dox reactivity.

Figure 2. (A) UV–vis absorbance spectra for equmiolar amounts of Dox and DCH. Equal absorbance at 480 nm is consistent with the DCH complex being of 1:1 stoichiometry.

(B) M-Dox peak of MW 7727 corresponds to the unreacted parent DNA, while the M+ peak of MW 8283 is obtained by the addition of Dox (MW 543) and CH2 (MW 14) −2H lost as water. (C) Overlay of 1H–15N HSQC displaying the N2 of G12 and G15 from

two independent singly labeled samples. Blue and green peaks represent the G12 amino before and after reaction with Dox, respectively. Black and red peaks represent the G15 amino before and after reaction, respectively.

Figure 3. Secondary structure and molecular model of the DCH. Dox is bound to N2 of

G12 and intercalated between the G15:C11 and A10:T16 base pairs. The lower 9 AT base pairs of the stem have been truncated for simplicity. Structures are colored as follows: guanine, green; adenine, red; thymine, yellow; cytosine, blue; Dox, light blue; methylene linker, white; DNA backbone, brown. (A–C) 3D modeling of the DCH structure. (D) 3D model of the unreacted hairpin.

Figure 4. Fluorescence quenching of DCH displays a ∼50% reduction in fluorescence after 30 h, while noncovalent complexes display greater than 50% reduction in fluorescence within 1 h (data not shown). Error bars represent standard deviation of the mean of three measurements. Assuming zero-order kinetics, the rate constant is k = 1.15

× 10–11 M/s.

Figure 5. (A) Fluorescence microscopy of 4T1 cells treated with either untargeted or folate-targeted DCH. (B) Quantification of Dox fluorescence from 4T1 cells. Error bars represent standard deviation from the mean of at least 30 measurements. A Student’s two-tailed t test was used to determine significance.

Figure 6. Targeting DCH with folic acid (DCH-FA) significantly increases the cytotoxicity of the DCH construct toward 4T1 breast cancer cells. Error bars represent standard deviation from the mean with four replicates of each condition. A Student’s two- tailed t test was used to determine significance (i.e., p < 0.05)— *significantly different from control; Δ significantly different from DCH-FA.

II.3 Experimental Section:

Materials

All nonlabeled hairpin DNA sequences were synthesized by IDT (Coralville, Iowa,

USA). Isotopically labeled hairpins were synthesized by the DNA core lab at Wake

Forest University. Clinical samples of doxorubicin (Dox) used for cell assays and DCH synthesis were obtained from the Wake Forest Baptist hospital pharmacy. Cu2+-Tris[(1- benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Cu2+-TBTA) was obtained from Lumiprobe

(Hallandale Beach, Florida, USA). All media for cell culture was obtained from the Wake

Forest University Cell and Viral Vector Core Lab. All other chemicals were obtained from Sigma-Aldrich and used as received.

Synthesis of DCH

A 0.37% (by weight) solution of formaldehyde was prepared by dissolving paraformaldehyde in Dulbecco’s Phosphate Buffered Saline without calcium or magnesium (PBS) pH 7.4. Doxorubicin was added to 4 °C formaldehyde–PBS to obtain a final doxorubicin concentration of 250 μM. DNA hairpin loops were prepared as previously reported(6) by heating and flash-cooling of the DNA to favor intramolecular hairpin formation over dimerization. Hairpins were added to the Dox–formaldehyde solution to obtain a final hairpin concentration of 100 μM. Reactions were allowed to proceed at 10 °C in the dark for 48 h. DCHs were purified by extracting twice with phenol/chloroform and twice with chloroform. This extraction removes unreacted dox from the solution. After extraction, DCHs were ethanol-precipitated and recovered by centrifugation. Pellets were rinsed twice with 70% ethanol and 100% ethanol to remove any residual formaldehyde. Pellets were then evaporated to dryness under reduced pressure. The red–pink pellets were then resuspended in water. A Beckman Coulter DU

800 was used to measure absorption at 260 nm. Yields were typically 70–80% for the conjugate as measured by UV absorbance at 260 nm. All products were stored at −20 °C.

Synthesis of Alkyne Functionalized Folic Acid

Alkyne functionalized folic acid was synthesized similarly to previously reported methods.(15, 16) Briefly, folic acid (100 mg, 0.227 mmol) was dissolved into 10 mL of

DMF and stirred with a magnetic stirrer and cooled in an ice bath for 30 min before

proceeding. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide HCl (EDC) (38.7 mg, 0.249 mmol) was added to the stirred solution and allowed to react for 30 min. N-

Hydroxysuccinimide (NHS) (31.4, 0.272 mmol) was then added to the reaction vessel and stirred for an additional 30 min. Propargyl amine (25 mg, 0.454 mmol) was then added to the reaction, which was warmed to room temperature and allowed to react for 24 h. 10 mL of 1:1 diethyl ether/chloroform was added to the reaction vessel, which precipitated the yellow–orange product. This was collected and washed three times with chloroform, diethyl ether, and water. The product was dried under vacuum overnight.

Yield 69 mg (64%). 1H NMR (DMSO-d6, ppm): 11.06 (−OH), 8.64 (PteridineC7 H),

8.29–8.24 (−CONH-CH2C≡CH), 8.04 (−CONHCHCO2H), 7.67–7.65 (Ph–C2H and Ph–

C6H), 6.94 (−NH2), 6.64 (Ph–C3H and Ph–C5H), 4.48 (PteridineC6–CH2NH-Ph), 4.31

(−CONHCHCO2H), 3.81 (−CONH-CH2C≡CH), 3.08 (−CONH–CH2C≡CH), 1.98–1.96

(−CHCH2CH2), 1.87–1.85 (−CHCH2CH2, 2H).

Synthesis of FA-DCH

Hairpin with a 5′ terminal azide was used for the synthesis of FA-DCH. 45 μL of a 100

μM solution of the hairpin was added to a 500 μL centrifuge tube. To this 10 μL (pH = 7,

2 M) of triethylamine/acetic acid buffer was added and mixed. 45 μL DMSO was then added to the solution and mixed well. 4.5 μL of a 10 mM solution of alkyne functionalized folic acid was added to the solution, mixed, and bubbled with Ar for 15 min. 10 μL of 5 mM ascorbic acid in water was added to the solution followed by 5 μL of

Cu2+-TBTA. The reaction was mixed and bubbled with Ar for 15 min before sealing the tube and being placed in the dark at room temperature for 24 h. FA-DCH was purified similarly to DCH. The hairpin was precipitated using 4× volume ethanol and 25 μL PBS

and was cooled at −20 °C for 30 min. The hairpin was recovered by centrifugation at

13 000 × g for 30 min. The pellet was rinsed 2× with 70% EtOH and 2× with 100% EtOH and dried under reduced pressure. The pellet was resuspended with 500 μL PBS and was dialyzed against PBS using a Slide-a-Lyzer 2 kDa MW cutoff dialysis cassette (Pierce) for 6 h to remove unreacted propargyl-folate. The retained solution was collected and quantified via UV–vis spectroscopy, with a final yield of 53%.

Doxorubicin–DNA Conjugate Ratio Measurements

DNA samples were prepared to 10 μM in dH2O and absorbencies were measured from

200 to 800 nm using a Beckman Coulter DU800 spectrophotometer. A standard curve of

Dox was established between 1 μM and 10 μM by using absorbance at 494 nm. To assess the amount of Dox covalently bound to DNA, the samples were heated to 85 °C before measuring the absorbance at 494 nm. The 260 nm wavelength was used to determine the

DNA content in the sample and to determine the Dox:DNA ratio.

Mass Spectrometry

Negative ion mass spectra were acquired using a Waters Q-TOF API-US mass spectrometer equipped with an Advion Nanomate source. Samples were diluted to about

5 μM with methanol/water/2-propanol (49:49:2, v:v:v). Backing pressure and sprayer voltage were optimized for each analysis, but were usually about 0.8 psi and 1.2 kV, respectively. The cone voltage was 35 V. The scan range from 525 m/z to 1600 m/z with an acquisition time of 1.2 s. Spectra were summed for 0.5 min for MaxEnt transform. The nucleotide GCATCCTGGAAAGCTACCTT, M– = 6366.1, at 0.6 μM was used to monitor instrument performance. Spectra were analyzed using MassLynx 4.0.

NMR Spectroscopy

NMR samples were prepared in 50 mM sodium phosphate buffer, pH 7.0, with 10%

D2O, and a final volume of 250 μL. All NMR spectra were acquired using a Bruker

Avance 600 MHz spectrometer at 10 °C using a TXI Cryoprobe. NOESY spectra were acquired with a 100 ms mixing time and 3–9–19 Watergate water suppression with a 220

μs interpulse delay. HSQC spectra were acquired using a 110 μs 3–9–19 interpulse delay and the 15N transmitter set to 150 ppm for imino groups and to 75 ppm for amino groups

(indirectly referenced to water at 4.7 ppm). Data were processed using NMRPipe(17) and analyzed using NMRView.(18)

3D Modeling of DCH

A PDB file of the hairpin molecule was obtained from the Protein Data Base under entry

1JVE.(19) A PDB file of Dox was obtained from the Protein Data Base under entry

DM2. Files were loaded into Pymol,(20) and the hairpin was modified to contain only 5′-

ACGAAGT-3′. The models were then manipulated spatially to allow for a covalent bond to form between the N2 amino of G12 and the daunosamine of Dox. Hydrogens were added to the entire model using the Molefacture plugin vmd.(21) The doxorubicin was then geometry optimized in the presence of the DNA using PM6(22) as implemented in

Gaussian 09.(23)

Dox Transfer from DCH

Samples of 2.5 μM (approximately 2 μg in 100uL) DCH, doxorubicin, or hairpin+doxorubicin were prepared in DPBS with or without a 100-fold by weight (200

μg) excess of Salmon Sperm DNA and incubated at 37 °C. Fluorescence intensity was determined by Typhoon-9210 variable mode imager with excitation set to 532 nm and the emission filter at 610 nm.

Acid Dissociation of Dox from DCH

DCH was suspended in either pH 7.4 PBS or pH 4 PBS buffer and incubated at 37 °C for

1 h. After incubation, the solutions were extracted with 2× volume phenol/chloroform and twice with 2× volume chloroform. The absorbance of the aqueous phase at 498 nm was measured. The experiment was repeated in triplicate. The results were normalized to the pH 7.4 sample with error bars representing the standard deviation of the mean of the three replicates.

Microscopy

4T1 cells were seeded at 20 000 cells/well in 8-well Lab-Tek II chambered #1.5 German

Coverglass System (Thermo Fisher Scientific, Waltham, MA), and incubated at 37 °C under 5% CO2 for 24 h prior to treatment. Cells were incubated with 1 μM of DCH, FA-

DCH, or Dox in DMEM medium with 10% dialyzed fetal bovine serum for either 1 or 4 h at 37 °C. Cells were then washed with fresh media and Dulbecco’s PBS. Cells were visualized using a Zeiss LSM510 confocal microscope (Carl Zeiss, Oberkochen,

Germany) using Dox as the fluorescent probe. Internalization of Dox was quantified using ImageJ software with at least 30 observations per treatment. Fluorescence intensity

values were then converted to % controls using nontreated cells. The mean of the intensities was found and standard deviation was determined. Significance was determined using a two-tailed Student’s t test.

Cytotoxicity

4T1 cells were grown in DMEM media containing 10% dialyzed FBS and 1% penicillin/streptomycin, at 37 °C and 5% CO2. 4T1 cells were plated at 5000 cell per well in 96 well plates in 100 μL media and incubated for 24 h. Cells were treated with 200 nM of either DCH, Dox, or FA-DCH for 72 h with 4 replicates of each treatment used to determine means and standard deviation. CellTiter-Glo luminescent cell viability assay

(Promega) was implemented according to the manufacturer’s protocol. Significance was determined using a two-tailed Student’s t test.

II.4 Discussion

DNA is central to biology as the predominant carrier of genetic information; however, the physical and chemical properties of DNA make it highly useful as a material for numerous applications including use for drug delivery. These studies have demonstrated that a simple DNA hairpin that includes a “GAA” hairpin-promoting sequence provides a unique site for conjugation with the Top2-poisoning anticancer drug Dox. Conjugation occurs without disrupting stabilizing hydrogen bonding or base stacking interactions in the hairpin loop and allows for facile intercalation of the tetracene ring system of Dox between the first and second base pairs of the hairpin stem. The concurrent covalent linkage and intercalation of Dox in the hairpin results in formation of a complex that is highly stable at physiological pH. As noncovalent Dox–DNA complexes, presumably of

greatly reduced chemical stability relative to the Dox-conjugated DNA hairpin described here have shown decreased toxicity relative to free Dox in human clinical trials,(9) hairpin conjugates may represent an improved approach for limiting Dox toxicity while preserving Dox efficacy.

A number of approaches have been described for improved Dox delivery while limiting systemic toxicities. The liposomal formulation Doxil, for example, has demonstrated clinical utility.(27) A variety of other nanoparticle-mediated drug delivery approaches have also been explored for improved Dox delivery.(28-30) DNA offers many advantages relative to alternative strategies. DNA is readily biodegradable and can be used for in vivo applications without activating an immune response. Further, the use of

DNA for drug delivery allows for natural combination of diverse anticancer drugs of different classes. For example, our laboratory has pioneered the inclusion of cytotoxic nucleotide analogs into ssDNA(4, 5) and more recently into DNA hairpins.(6, 7) We have also shown that duplex or hairpin DNA can be used for delivery of minor groove binding ligands.(6, 7) The present studies have extended this work to include covalent modification of DNA hairpins with simultaneous intercalation by DNA-targeting drugs, such as the Top2 poison Dox. Our studies have also shown that the major groove of DNA can be used for improved drug delivery as our studies have shown that Zn2+ complexation occurs in the major groove of FdU-substituted DNA hairpins.

Drug delivery is a multifaceted process that involves not only improved stability in circulation, but also specific uptake into targeted cells and ultimately release of drug following cell uptake. Our studies show that, as with previous studies with the single- stranded DNA F10, conjugation with folic acid improves uptake into targeted cancer

cells.(25) Many cancer cells overexpress folate receptor as a consequence of increased nutrient requirements to support an elevated growth rate for the malignant phenotype.(31)

These studies show cell uptake of a 25 nucleotide DNA hairpin can be significantly enhanced into 4T1 breast cancer cells through folic acid conjugation. Importantly, while the Dox-conjugated hairpin is highly stable at physiological pH, Dox release is favored at the acidic pH of endosomes following cell uptake. Dox is efficiently released from the hairpin following cell uptake and Dox retains potency as an anticancer drug. The results demonstrate that the DNA-conjugation strategy developed has the requisite components to be useful for Dox delivery in a clinical setting.

To our knowledge, this is the first report of the use of a Dox–DNA covalent conjugate to transfer Dox to DNA for potential therapeutic applications. The approach adopted has potential for greatly expanded drug delivery applications. For example, we have previously shown that FdU nucleotides can be embedded within this hairpin sequence and that the resulting hairpin is cytotoxic to prostate cancer cells.(6, 7) As DNA polymers containing FdU nucleotides are Top1 poisons, the present system allows for creating complexes that deliver both FdU and Dox and that will simultaneously target Top1 and

Top2. Simultaneous targeting of Top1 and Top2 has shown promise for clinical management of cancer, although this combination displays systemic toxicities.(32, 33)

Our studies show that folic acid conjugation can be used to improve uptake for DNA hairpin conjugates into breast cancer cells, and this is expected to concomitantly reduce systemic toxicities. Studies are underway to evaluate these promising concepts in drug delivery. Future studies will focus on demonstrating advantages in cellular and animal models of cancer.

II.5 Conclusions:

The “GAA” sequence motif that promotes intramolecular DNA hairpin formation can be selectively conjugated to the Top2-poisoning anticancer drug Dox. The resulting conjugate is highly stable at physiological pH as a consequence of both covalent modification and intercalation of the tetracene ring system of Dox into the hairpin stem.

Folic acid conjugation of the Dox-conjugated hairpin enhances uptake by 4T1 breast cancer cells. Dox is efficiently released at the acidic pH of endosomes following cell uptake demonstrating that the Dox-conjugated hairpin has both appropriate extracellular stability and intracellular lability well-suited for drug delivery applications. The DNA hairpin structural motif permits further development by inclusion of additional or alternative cytotoxic drugs, such as FdU or other cytotoxic nucleotide analogs demonstrating the multifunctional properties of DNA as a material for drug delivery science.

II.6 Supporting Information:

Supplementary Figure 1: NOESY spectra of DDH showing cross peaks to the G15-NH proton that only appear in spectra where the hairpin has been reacted with Dox. Green lines denote cross peaks between the guanine bases and Dox. The vertical axis has been folded 12 PPM.

Supplementary Figure 3: After breif incubation at low pH approximating late endosomes nearly 20% of Dox can be extracted from the DCh when compared to the physiological pH 7.4

Supplementary Figure 2: Fluorescence microscopy of 4T1 cells after 1 hour treatment with DDH-FA shows endosomal localization of Dox.

II.7 Acknowledgments:

The authors would like to thank Michael Samuel from the Wake Forest University Mass

Spectrometry Core Lab for his help in obtaining all of the mass spectrometry data used in this research. Oligonucleotide syntheses were performed in the DNA Synthesis Core

Laboratory at Wake Forest University School of Medicine. The DNA Synthesis and the

Mass Spectrometry Cores are part of the Bioanalytical Core Laboratory supported in part by the Comprehensive Cancer Center of Wake Forest University. Funding was provided by Department of Defense Prostate Cancer Research Program (093606 to W.H.G.) and the Comprehensive Cancer Center of Wake Forest University Cancer Center Support

Grant P30 CA012197 supporting the Bioanalytical Core Laboratory. The Waters Q-TOF mass spectrometer was purchased with funds from NIH Shared Instrumentation Grant

1S10RR17846. MS analyses were performed in the Mass Spectrometer Facility of the

Comprehensive Cancer Center of Wake Forest University School of Medicine supported in part by NCI center grant 5P30CA12197.

References:

1. Elliott, P. (2006) Pathogenesis of cardiotoxicity induced by anthracyclines. ,

Semin. Oncol. 33, S2–7.

2. Sordet O., Khan Q.A., Kohn K.W., and Pommier Y. (2003) Apoptosis Induced

by Topoisomerase Inhibitors. , Current Medicinal Chemistry - Anti-Cancer

Agents 3, 271–290.

3. Zhang, S., Liu, X., Bawa-Khalfe, T., Lu, L.-S., Lyu, Y. L., Liu, L. F., and Yeh,

E. T. H. (2012) Identification of the molecular basis of doxorubicin-induced

cardiotoxicity. , Nat. Med. 18, 1639–1642.

4. Liao, Z.-Y., Sordet, O., Zhang, H.-L., Kohlhagen, G., Antony, S., Gmeiner, W.

H., and Pommier, Y. (2005) A novel polypyrimidine antitumor agent

FdUMP[10] induces thymineless death with topoisomerase I-DNA complexes. ,

Cancer Res. 65, 4844–4851.

5. Pardee, T. S., Gomes, E., Jennings-Gee, J., Caudell, D., and Gmeiner, W. H.

(2012) Unique dual targeting of thymidylate synthase and topoisomerase1 by

FdUMP[10] results in high efficacy against AML and low toxicity. , Blood 119,

3561–3570.

6. Ghosh, S., Salsbury, F. R., Jr, Horita, D. A., and Gmeiner, W. H. (2011) Zn2+

selectively stabilizes FdU-substituted DNA through a unique major groove

binding motif. , Nucleic Acids Res. 39, 4490–4498.

7. Ghosh, S., Salsbury, F. R., Jr, Horita, D. A., and Gmeiner, W. H. (2013)

Cooperative stabilization of Zn(2+):DNA complexes through netropsin binding

in the minor groove of FdU-substituted DNA. , J. Biomol. Struct. Dyn. 31, 1301–

1310.

8. Wang, A. H., Gao, Y. G., Liaw, Y. C., and Li, Y. K. (1991) Formaldehyde cross-

links daunorubicin and DNA efficiently: HPLC and X-ray diffraction studies. ,

Biochemistry 30, 3812–3815.

9. Trouet, A., and Jolles, G. (1984) Targeting of Daunorubicin by Association With

DNA or Proteins: A Review. , Semin Oncol 11.

10. Zeman, S. M., Phillips, D. R., and Crothers, D. M. (1998) Characterization of

covalent Adriamycin-DNA adducts. , Proc Natl Acad Sci U S A 95, 11561–

11565.

11. Cutts, S. M., Parker, B. S., Swift, L. P., Kimura, K. I., and Phillips, D. R. (2000)

Structural requirements for the formation of anthracycline-DNA adducts. ,

Anticancer Drug Des. 15, 373–386.

12. Swift, L. P., Cutts, S. M., Rephaeli, A., Nudelman, A., and Phillips, D. R. (2003)

Activation of adriamycin by the pH-dependent formaldehyde-releasing prodrug

hexamethylenetetramine. , Mol. Cancer Ther. 2, 189–198.

13. Post, G. C., Barthel, B. L., Burkhart, D. J., Hagadorn, J. R., and Koch, T. H.

(2005) Doxazolidine, a proposed active metabolite of doxorubicin that cross-

links DNA. , J. Med. Chem. 48, 7648–7657.

14. Phillips, D. R., White, R. J., and Cullinane, C. (1989) DNA sequence-specific

adducts of adriamycin and mitomycin C. , FEBS Lett. 246, 233–240.

15. Lee, R. J., and Low, P. S. (1994) Delivery of liposomes into cultured KB cells

via folate receptor-mediated endocytosis. , J. Biol. Chem. 269, 3198–3204.

16. Zhang, H., Cai, Z., Sun, Y., Yu, F., Chen, Y., and Sun, B. (2012) Folate-

conjugated β-cyclodextrin from click chemistry strategy and for tumor-targeted

drug delivery. , J Biomed Mater Res A 100, 2441–2449.

17. Piotto, M., Saudek, V., and Sklenár, V. (1992) Gradient-tailored excitation for

single-quantum NMR spectroscopy of aqueous solutions. , J. Biomol. NMR 2,

661–665.

18. Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A.

(1995) NMRPipe: a multidimensional spectral processing system based on

UNIX pipes. , J. Biomol. NMR 6, 277–293.

19. Ulyanov, N. B., Bauer, W. R., and James, T. L. (2002) High-resolution NMR

structure of an AT-rich DNA sequence. , J. Biomol. NMR 22, 265–280.

20. The PyMOL Molecular Graphics System, Version 1.5.0.4 Schrödinger, LLC.

21. Humphrey, W., Dalke, A., and Schulten, K. (1996) VMD: visual molecular

dynamics. , J Mol Graph 14, 33–38, 27–28.

22. Stewart, J. J. P. (2007) Optimization of parameters for semiempirical methods V:

Modification of NDDO approximations and application to 70 elements. , J Mol

Model 13, 1173–1213.

23. Gaussian 09, Revision A.1, Frisch, M. J., Trucks, G. W., Schlegel, H. B.,

Scuseria, G. E., Robb, M. A., Cheeseman, J. R., Scalmani, G., Barone, V.,

Mennucci, B., Petersson, G. A., Nakatsuji, H., Caricato, M., Li, X., Hratchian, H.

P., Izmaylov, A. F., Bloino, J., Zheng, G., Sonnenberg, J. L., Hada, M., Ehara,

M., Toyota, K., Fukuda, R., Hasegawa, J., Ishida, M., Nakajima, T., Honda, Y.,

Kitao, O., Nakai, H., Vreven, T., Montgomery, Jr., J. A., Peralta, J. E., Ogliaro,

F., Bearpark, M., Heyd, J. J., Brothers, E., Kudin, K. N., Staroverov, V. N.,

Kobayashi, R., Normand, J., Raghavachari, K., Rendell, A., Burant, J. C.,

Iyengar, S. S., Tomasi, J., Cossi, M., Rega, N., Millam, J. M., Klene, M., Knox,

J. E., Cross, J. B., Bakken, V., Adamo, C., Jaramillo, J., Gomperts, R.,

Stratmann, R. E., Yazyev, O., Austin, A. J., Cammi, R., Pomelli, C., Ochterski,

J. W., Martin, R. L., Morokuma, K., Zakrzewski, V. G., Voth, G. A., Salvador,

P., Dannenberg, J. J., Dapprich, S., Daniels, A. D., Farkas, Ö., Foresman, J. B.,

Ortiz, J. V., Cioslowski, J., and Fox, D. J. Gaussian, Inc., Wallingford CT, 2009.

24. Bouaziz, S., Kettani, A., and Patel, D. J. (1998) A K cation-induced

conformational switch within a loop spanning segment of a DNA quadruplex

containing G-G-G-C repeats. , Journal of Molecular Biology 282, 637–652.

25. Liu, J., Kolar, C., Lawson, T. A., and Gmeiner, W. H. (2001) Targeted drug

delivery to chemoresistant cells: folic acid derivatization of FdUMP[10]

enhances cytotoxicity toward 5-FU-resistant human colorectal tumor cells. , J.

Org. Chem. 66, 5655–5663.

26. O’Brien, M. E. R., Wigler, N., Inbar, M., Rosso, R., Grischke, E., Santoro, A.,

Catane, R., Kieback, D. G., Tomczak, P., Ackland, S. P., Orlandi, F., Mellars, L.,

Alland, L., Tendler, C., and CAELYX Breast Cancer Study Group. (2004)

Reduced cardiotoxicity and comparable efficacy in a phase III trial of pegylated

liposomal doxorubicin HCl (CAELYX/Doxil) versus conventional doxorubicin

for first-line treatment of metastatic breast cancer. , Ann. Oncol. 15, 440–449.

27. Boyacioglu, O., Stuart, C. H., Kulik, G., and Gmeiner, W. H. (2013) Dimeric

DNA Aptamer Complexes for High-capacity–targeted Drug Delivery Using pH-

sensitive Covalent Linkages. , Mol Ther Nucleic Acids 2, e107.

28. Janes, K. A., Fresneau, M. P., Marazuela, A., Fabra, A., and Alonso, M. J.

(2001) Chitosan nanoparticles as delivery systems for doxorubicin. , J Control

Release 73, 255–267.

29. Chang, Y., Liu, N., Chen, L., Meng, X., Liu, Y., Li, Y., and Wang, J. (2012)

Synthesis and characterization of DOX-conjugated dendrimer-modified magnetic

iron oxide conjugates for magnetic resonance imaging, targeting, and drug

delivery. , Journal of Materials Chemistry 22, 9594.

30. Russell-Jones, G., McTavish, K., McEwan, J., Rice, J., and Nowotnik, D. (2004)

Vitamin-mediated targeting as a potential mechanism to increase drug uptake by

tumours. , J. Inorg. Biochem. 98, 1625–1633.

31. Eder, J. P., Chan, V., Wong, J., Wong, Y. W., Ara, G., Northey, D., Rizvi, N.,

and Teicher, B. A. (1998) Sequence effect of irinotecan (CPT-11) and

topoisomerase II inhibitors in vivo. , Cancer Chemother Pharmacol 42, 327–

335.

32. Morgensztern, D., Baggstrom, M. Q., Pillot, G., Tan, B., Fracasso, P., Suresh, R.,

Wildi, J., and Govindan, R. (2009) A phase I study of pegylated liposomal

doxorubicin and irinotecan in patients with solid tumors. , Chemotherapy 55,

441–445.

Chapter III

PSMA-Targeted Liposomes Specifically Deliver the Zn2+

Chelator TPEN Inducing Oxidative Stress in Prostate

Cancer Cells

Christopher H. Stuarta,b, Ravi Singha,c, Thomas L. Smithd, Ralph D’Agostino

Jr.c,e, David Caudellf, K.C. Balajic,g,h and William H. Gmeinera,b,c*

Author Affiliations: aDepartment of Cancer Biology, bDepartment of Molecular Medicine and

Translation Science, cComprehensive Cancer Center at Wake Forest University, dDepartment of Orthopedics, eDepartment of Biostatistical Sciences, fDepartment of Pathology and Comparative Medicine, gDepartment of Urology, hWake Forest

Institute of Regenerative Medicine, Wake Forest School of Medicine, Winston-

Salem, NC 27157

Corresponding Author:

William H. Gmeiner, Hanes Building, Room 5044, Medical Center Boulevard,

Winston Salem, NC 27157.

Phone: 336-716-6216; Fax: 336-716-0255; E-mail: [email protected]

This chapter is composed of an accepted manuscript in Nanomedicine: Future

Medicine. The stylistic differences between this chapter and other portions of this

dissertation are due to requirements of the journal.

CS and WG conceived and designed the project. CS preformed the experiments.

RV advised experiments for nanoparticle analysis. TS preformed mouse jugular

vein catheter implants. RD aided in statistical analysis. DC preformed histological

analysis. KB and RS contributed to intellectual discussion during manuscript

preparation. CS wrote the manuscript with editorial input from RS and WG.

Disclosures: WG is an inventor on a patent application related to these studies.

III.1 Abstract:

Aims: To evaluate the potential use of zinc chelation for prostate cancer therapy using a new liposomal formulation of the zinc chelator, N,N,N’,N’-Tetrakis(2-pyridylmethyl)- ethylenediamine (TPEN).

Materials & methods: TPEN was encapsulated in non-targeted liposomes or liposomes displaying an aptamer to target prostate cancer cells overexpression prostate-specific membrane antigen (PSMA). The prostate cancer selectivity and therapeutic efficacy of liposomal (targeted and non-targeted) and free TPEN was evaluated in vitro and in tumor bearing mice.

Results & conclusions: TPEN chelates zinc and results in ROS imbalance leading to cell death. Delivery of TPEN using aptamer-targeted liposomes results in specific delivery to targeted cells. In vivo experiments show that TPEN-loaded, aptamer-targeted liposomes reduce tumor growth in a human prostate cancer xenograph model.

Key Words: Targeted Drug Delivery, Aptamer, Liposome, Prostate Cancer, Zinc

III.2 Background

The most widely used treatment for advanced prostate cancer (PCa) is androgen deprivation therapy, but disease that recurs is often unresponsive to repeated androgen deprivation therapy, resulting in castration-resistant prostate cancer (CRPC). CRPC is much more aggressive and carries a worse prognosis. Treatment of CRPC generally includes docetaxel, a taxane which binds to and stabilizes microtubules. Nonetheless, patients with advanced CRPC have a median survival of 9-30 months [1], in spite of several survival-enhancing novel drugs.

Modulation of Zn2+ is a possible therapeutic strategy for PCa treatment. In the normal prostate, Zn2+ can reduce citrate production and slow oxidative metabolism by inhibiting m-acontinase; this process requires tightly-regulated Zn2+ homeostasis [2].

Zn2+ concentrations are reduced in PCa tissue, and they decrease further as malignancy progresses [3]. However, supplementing PCa cells with Zn2+ induces apoptosis and reduces levels of pro-angiogenic and metastatic cytokines, suggesting that reduced Zn2+ concentrations are vital for PCa survival and may be involved in disease progression

[4,5]. Treatment of PCa with the cell-permeable Zn2+ chelator N,N,N’,N’-Tetrakis(2- pyridylmethyl)-ethylenediamine (TPEN) reduces cell viability through apoptotic pathways, although the initiating factor(s) are unclear [6,7]. Previously, we demonstrated that TPEN can enhance apoptosis induced by other agents [8].

One possible mechanism for TPEN is dysregulation of reactive oxygen species

(ROS) detoxification. TPEN decreases mitochondrial membrane potential and increases superoxide concentrations in breast cancer and leukemia cell lines [9,10]. Both cell types were also rescued from TPEN by the antioxidant N-acetyl cysteine (NAC), indicating that oxidative stress may be involved in TPEN-induced cytotoxicity. However, the effects

of TPEN on oxidative stress in PCa, a malignancy with high oxidative stress and tight regulation of Zn2+ homeostasis, have not been reported previously [2,11].

Although TPEN is cytotoxic to cancer cells in vitro, it also causes neurotoxicity that was sometimes fatal when administered systemically in mice [12]. If Zn2+chelation therapy is to have clinical potential, biodistribution must be restricted to malignant tissue to minimize potential side effects. Nanoparticle-based drug delivery systems, such as liposomes, may reduce side effects associated with parent drugs [13]. For example, liposomes have been used to deliver the iron chelator desferoxamine [14], complexes of radiolabeled metals [15], and for targeted drug delivery[16,17], but liposomal formulations of TPEN have not been previously reported. We recently reported a DNA aptamer (SZTI01) that specifically binds to prostate-specific membrane antigen (PSMA) [18]. Aptamers are

DNA or RNA oligonucleotides that can be used to specifically bind to cellular targets.

Unlike other targeting strategies such as antibodies or small molecules, aptamers have the advantages of non-immunogenicity and scaling [19]. PSMA is a dimeric folate hydrolase expressed in prostate epithelia and proximal kidney tubules and is also upregulated in

PCa [20]. Importantly for treating CRPC, PSMA is highly expressed in over 50% of recurrent cases of PCa, including nearly all metastases to lymph nodes and bone [21].

Our laboratory has demonstrated specific delivery of doxorubicin to PSMA+ C4-2 PCa cells using the SZTI01 aptamer and, in these studies, we investigate the potential of the

SZTI01 aptamer for selective delivery of liposomal TPEN to PCa cells as a potential new approach for targeted therapy of CRPC.

Herein we describe the synthesis and efficacy of a novel targeted liposome which can selectively deliver TPEN to PSMA+ cells using the SZTI01 DNA aptamer. Once internalized by targeted PCa cells, liposomes release TPEN, which chelates Zn2+ and results in increased ROS levels leading to cell death. The targeted, TPEN-loaded liposomes enable killing of targeted PCa cells under treatment conditions where free

TPEN is ineffective. Targeted liposomes are also non-toxic to non-targeted cells under these same conditions. We demonstrate that TPEN induces oxidative stress in PCa cells, which has not been previously reported. Cells can be rescued from TPEN by antioxidants or Zn2+/Cu2+ salts. Additionally, we demonstrate that targeted liposomes loaded with a fluorescent dye preferentially localize to C4-2 tumors, consistent with active targeting. Targeting of TPEN via aptamer-targeted liposomes provides an opportunity to use Zn2+ chelation as a treatment for advanced CRPC, where traditional chemotherapy is ineffective.

III.3 Methods:

Hydrogenated Soy phosphatidylcholine (HSPC), 1,2-distearoyl-sn-Glycero-3-

Phosphoethanolamine-N-[Methoxy(polyethyleneglycol)-2000] (PEG2000 PE), and

Maleimide-terminated PEG2000 PE (M-PEG2000 PE) were obtained from Avanti Lipids as powders and dissolved in 3:1 Chloroform:Methanol and stored at -20°C until used.

Dithiol/Quasar 670 terminated DNA was synthesized by the Wake Forest University

DNA Core Lab. Tris(2-carboxyethyl)phosphine (TCEP) was obtained from Santa Cruz

Biotech. Manganese (III) Tetrakis (4-Benzoic Acid) Porphyrin chloride (MnTBAP) was obtained by Santa Cruz BioTech. All chemicals used in TPEN synthesis were obtained from Sigma Aldrich.

Cell Maintenance:

C4-2 cells were a gift from Dr. Elizabeth M. Wilson (UNC, Chapel Hill, NC).

PC3 cells were purchased from the cell and viral vector core laboratory at Wake Forest

School of Medicine. All cells were maintained with RPMI 1640 (Gibco, Grand Island,

NY) with 10% fetal bovine serum (Gemini Bio-Products, West Sacramento, CA). All cells were kept at 5% CO2 at 37 °C.

Synthesis of Tetrakis-(2-Pyridylmethyl)ethylenediamine (TPEN):

The procedure used for synthesis of TPEN was modified from a previous publication [22]. Deionized water (10mL) was cooled to 4°C and degassed with Argon for 30 min and stirred with a magnetic stir bar. 1 g (.006mol) 2-chloromethyl-pyridine was added, followed by additional argon degassing for 10 min. Ethylene diamine (102

µL, .0015 mol) was mixed with 1 mL water and added over 10 min to the stirring solution. 1.2mL of 10M NaOH was dissolved in 10 mL water and added dropwise over

30 min which produced a brown-red by-product that initially dissipated but that persisted after approximately 50% of the base had been added. After NaOH addition was complete, the reaction was warmed to room temperature while being degassed with Argon. The reaction vessel was sealed and heated to 40 °C overnight. The reaction was extracted 3x with 20 mL chloroform. The organic phase was washed 3x with brine and dried over

MgSO4. The organic phase was filtered and solvent was removed by rotary evaporation.

The resulting brown oil was diluted with minimal chloroform (generally less 0.5 mL), and precipitated with hexane. The solution was then refrigerated at 4 °C for 1 h resulting in a dark precipitate. The target compound was present in the milky organic phase and was dried, dissolved in chloroform, and recrystallized using hexane.

Formation of Liposomes:

Lipid films were formed by mixing HSPC, Cholesterol, PEG2000 PE, and M-

PEG2000 PE in a 2: 1: 0.08: 0.02 molar ratio. Chloroform and methanol were removed by rotary evaporation under reduced pressure. Lipid films were further dried under an

Argon stream for 30 min. Liposomes were formed by reconstituting lipid films with

1.5mL of a 50 mM pH 5.5 citrate buffer that contained 5% dextrose and 1mM TPEN at

55°C. 10 mg/mL 70kDa FITC-Dextran or 100 nM IRDYE 800CW were included in the buffer for select fluorescence microscopy studies. The suspension was pipetted thoroughly until a cloudy solution formed. The liposomes were then sonicated at 37 °C for 5 min, which resulted in a slight clearing of the liposome solution. The liposomes were then extruded through a 0.2 µm syringe filter. Finally, liposomes were purified using 100 kDa Amicon centrifugal filtration devices. Solutions were spun at 2000 xg for

15 m, or until 90% of the solution had passed through the filter. The filtrate was resuspended with 50 mM citrate buffer pH 5.5 with 5% dextrose. This process was repeated twice to ensure no free TPEN or dye remained in solution. This same process was used to purify fluorescent liposomes as well, which results in the removal of all molecules not contained in the liposomes.

Aptamer Targeting of Liposomes:

Aptamers were synthesized by The Wake Forest University DNA Core Lab with

3’ terminal dithiols and 5’ terminal Quasar 670 dye (Biosearch Technologies). Aptamers were folded by heating a 500 µM solution of DNA to 95 °C for 5 min and slow sequential cooling to 80 °C for 5 min, 70 °C for 10 min, 37 °C for 30 min, 23 °C for 1 h,

and 4 °C for at least 1 h. The dithiol was reduced by adding a 10x excess of TCEP in 50 mM TRIS Buffer (pH 7.4) and incubating for 30 min before adding to a solution of liposome (2x excess of activated aptamer versus M-PEG2000 PE used to form liposomes). The reaction proceeded overnight prior to purifying the liposomes as described above.

Characterization of Liposomes:

TPEN loading into liposomes was determined by preparing a standard curve of absorbance at 260 nm. Liposomes were diluted 1:10 in methanol and sonicated 5 min before measuring the absorbance at 260 nm. The concentration of TPEN in liposomes was then determined by comparing the absorbance to the standard curve, which was also obtained in 90% methanol. Aptamer concentration was determined in a similar fashion, except the absorbance at 630 nm, the maximum absorbance of Quasar 670, and the extinction coefficient of the dye were used to determine the concentration of aptamers bound to liposomes. Liposome size was measured with a Malvern Zetasizer ZS90

(Malvern Instruments, Malvern, UK), and data was analysed using Malvern software. A

Nanosight NS500 (Nanosight, Salsbury, UK) and nanotracking analysis software provided by Nanosight was used to determine both liposome size and the number of liposomes produced. Transmission electron microscopy (TEM) images of liposomes were acquired using a FEI Tecnai-Spirit TEM (FEI, Hillsboro OR, USA) using a phosphotungstic acid counterstain. A small drop of liposome containing 2% phosphotungstic acid as counterstain was placed on a formvar plate and allowed to rest for 2 min. The remaining liquid was wicked away, and the plate was allowed to dry completely before imaging.

Fluorescence microscopy:

For all microscopy experiments, cells were seeded at 35,000 cells/well in 8-well

Lab-Tek II chambered #1.5 German Coverglass System (Thermo Fisher Scientific,

Waltham, MA), and incubated at 37 °C under 5% CO2 for 24 h For targeted liposomes, cells were incubated with 5 μM (as measured by aptamer concentration) of aptamer- targeted liposome (Ap-Lip) that contained FITC dye as well as TPEN, in RPMI medium with 10% fetal bovine serum for 2 h at 37 °C. For all microscopy experiments, cells were washed after incubation with dyes using fresh media and Dulbecco’s PBS prior to imaging. Cells were visualized using a Zeiss LSM510 confocal microscope (Carl Zeiss,

Oberkochen, Germany). For studies with dichloro-dihydro-fluorescein diacetate (DCFH), cells were treated with 8 µM TPEN for 6 h prior to addition of 50 nM of the dye. The cells were allowed to incubate for 30 min before imaging. Experiments utilizing Bodipy

C11 (5 µM) (Invitrogen), and Mitotracker green (100 nM) (Invitrogen) were performed in a similar manner to methods used for DCFH, but were treated for 7 h with TPEN prior to imaging.

Liposome cytotoxicity assays:

PC3 and C4-2 cells were seeded at a density of 5,000 cells/well in 96-well plates and incubated at 37 °C under 5% CO2. The following day, cells were treated with aptamer-targeted liposomes, non-targeted liposomes, or TPEN, at equivalent levels of

TPEN. After 4 h, the media was removed, cells were washed with media, and fresh media was added to the cells incubated for 68 h. For co-culture, 2,500 C4-2 luciferase- expressing cells were plated with 2,500 PC3 cells and treated as described above. For aptamer competition experiments, 25 µM aptamer was added to each well before adding

either aptamer-targeted or non-targeted liposomes. In Zn2+ rescue experiments, twice the molar amount of ZnSO4 was added concurrently with the drugs being tested. For PC3 cells, viability was assessed indirectly by measuring the ATP levels using CellTiter-Glo luminescent cell viability assay (Promega). Because the C4-2 cells expressed luciferase, the luciferase-Glo assay (Promega) was used to determine viability, as was done in our previous publication [8]. Statistical significance for in vitro studies was determined by using Student’s t-test, with significance indicated at either p < 0.01 or p < 0.05. All experiments were performed in triplicate.

TPEN cytotoxicity rescue experiments:

For rescue with NAC and MnTBAP, PC3 and C4-2 cells were seeded at a density of 5,000 cells/well in 96-well plates and incubated at 37 °C under 5% CO2. The following day, cells were treated with either NAC or MnTBAP 1 hour prior to TPEN treatment.

Eight h after treatment, the drug was removed and fresh media was added to the cells.

The cells were allowed to grow for 72 h before viability was assayed using a Cell-titer glo assay kit. For metal ion rescue experiments, PC3 and C4-2 cells were cultured in an identical manner and allowed to incubate overnight. The following day, cells were treated with 8 µM TPEN and 16 µM of either ZnSO4 or CuSO4 was added at the indicated time.

At the end of 8 h, media containing drugs and metal ion salts was removed and replaced with fresh media. The cells were incubated for 72 h before viability was measured using a

Cell-titer glo assay kit. Statistical significance for in vitro studies was determined by using Student’s t-test, with significance indicated at either p < 0.01 or p < 0.05. All experiments were performed in triplicate.

In Vivo Experiments:

In vivo studies were approved by the Institutional Animal Care and Use

Committee at WFSM. All animal experiments at our institution are regulated by and conform to requirements of the U.S. Public Health Service Policy on the Humane Care and Use of Laboratory Animals, the National Research Council’s Guide for the Care and

Use of Laboratory Animals, and the U.S. Department of Agriculture’s Animal Welfare

Act & Regulations.

For fluorescent biodistribution studies, liposomes were synthesized as described above, with the inclusion of 25 nmol of IRDYE 800CW per mouse. Eight mice were injected with 2x106 C4-2 cells on the right flank in 200 µL of Matrigel®. Studies were initiated when tumors reached 100 mm3. Four mice were then injected with a single dose of 4 mg/kg TPEN via dye labeled liposomes while four received 25 nmol of free dye and an equivalent dose of TPEN. After 48 h, mice were sacrificed and organs and tumors were imaged using a Li-Cor Perl Trilogy imaging system (Li-Cor).

A second imaging study was performed with 3 mice injected with 2x106 C4-2 cells on the right flank and 2x106 PC3 cells on the left flank, both in 200 µL of Matrigel®.

Studies were initiated when tumors reached 100 mm3. Mice were then injected with a single dose of 4 mg/kg TPEN via labeled liposomes and sacrificed after 48 h for tumor excision and imaging.

For efficacy studies, Male nude mice were implanted with permanent jugular vein catheters for drug delivery. After 2 weeks of recovery from the surgery, mice were injected with 2x106 C4-2 cells on the right flank and 2x106 PC3 cells on the left flank, both in 200 µL of Matrigel®. Studies were initiated when tumors reached 100 mm3. Six

mice per group were injected twice weekly with liposomes that resulted in a dosage of 4 mg/kg of TPEN (general injection volume ≈200-250 µL, depending on batch-to-batch variability) for 30 days. Tumors size and animal weight were measured concurrently with drug treatments. For in vivo studies, statistical significance was determined using a two- way repeated measures analysis of covariance (ANCOVA) model, with significance at p

< 0.05.

III.4 Results:

TPEN induces oxidative stress and mitochondrial damage in PCa cells

We investigated whether TPEN induced oxidative damage in PCa cells using

BODIPY C11, an ROS-sensitive dye that changes emission from ≈590 nm to ≈511 nm upon oxidation (Figure 1a). PCa cells treated with TPEN for 7 h showed a large increase in green fluorescence consistent with ROS-mediated damage, indicating TPEN increases oxidative stress. Cells treated with TPEN also showed an increase in DCHF fluorescence.

DCHF is a sensor for peroxynitrite and other oxidative species, and was used as an additional sensor of oxidative stress [23] (Figure 1b). To evaluate changes in mitochondrial morphology due to TPEN treatment, PCa cells were stained with the mitochondrial-specific dye MitoTracker® Green. In contrast to untreated PC3 cells in which mitochondria are localized near the nucleus, mitochondria in TPEN-treated PC3 cells delocalize and form large, punctate aggregates. C4-2 mitochondria do not demonstrate an altered size, but do display altered distribution in the cell upon treatment with TPEN (Figure 1c, Supplementary Figure 1). Further, PCa cells treated with TPEN

showed altered morphology, including large membrane blebs and increased granularity consistent with apoptosis.

TPEN-mediated damage rapidly becomes irreversible in PCa cells

Because TPEN has a high affinity for both Zn2+ and Cu2+, we investigated at what time PCa cells could no longer be rescued from TPEN with Zn2+ or Cu2+. Inability to rescue TPEN cytotoxicity with exogenous Zn2+/Cu2+ could signify irreversible cellular damage. Both Zn2+ (Figure 2a) and Cu2+ (Figure 2b) could completely rescue both cell lines up to 3 h after treatment with 8µM TPEN, with decreasing ability to rescue at 5 h and with minimal rescue at 7 h. These results demonstrate that TPEN initiates cell death within 3 h and irreversible cellular damage occurs within 7 h.

Mechanistically, cellular damage induced by high levels of ROS may partially explain this short window in which cells can be rescued from Zn2+ chelation via TPEN.

Treating PCa cells with the ROS scavenger NAC 1 hour before, or concurrent with TPEN treatment (8h treatment followed by 64h in drug-free medium), significantly reduced

TPEN cytotoxicity (Figure 2C). TPEN may increase oxidative stress and induce cytotoxicity through inhibiting Cu2+-/Zn2+-dependent proteins such as the ROS- detoxifying enzyme superoxide dismutase 1 (SOD1). Consistent with this, treatment with

MnTBAP, a putative SOD1 mimetic and peroxynitrite scavenger, or NAC, 1 hour before

TPEN treatment rescued cells from TPEN (Figure 2d) [24,25]. However, neither NAC nor MnTBAP completely rescued either cell line, consistent with alternative Zn2+/Cu2+ chelation effects also being exerted by TPEN.

Characterization of SZTI01 Targeted TPEN Liposomes

We hypothesized that encapsulation of TPEN in liposomes that target PSMA could be used to selectively deliver TPEN to PSMA+ PCa cells. We developed a liposomal formulation of TPEN that incorporates the PSMA-specific SZTI01 aptamer.

Liposomes were washed extensively using an Amicon centrifugal filter to remove free

TPEN. Because TPEN absorbs at 260 nm, the A260 of the final wash was measured to demonstrate the liposome solutions did not contain free TPEN (Supplementary Figure

2d). Dialysis of liposomes at 37°C against phosphate buffered saline (PBS) showed that

TPEN was half-life of ≈ 8 h under these conditions (Supplementary Figure 2b). The content of TPEN in purified liposomes was calculated by measuring the A260 of a solution after liposome dissolution relative to a standard curve of TPEN absorbance

(Supplementary Figure 2a). The loading efficiency of TPEN was generally ≥10%; i.e. using 1mL of a 1mM TPEN solution yields 1 mL of 100 µM of liposomal TPEN after purification. However, when TPEN concentration in the buffer was increased beyond

1mM, liposomes failed to form. A general scheme of liposome formation is depicted in

Supplemental Figure 3.

The average diameter of liposomes was 109 + 1.0 nm by DLS (Figure 3a), and

97.2 + 9.3nm by NTA (Figure 3b). Liposomes prepared using 1mM TPEN were spherical (Figure 3c), with a slightly negative zeta potential, -37 mV (Figure 3d). In order to assess the stability of TPEN-loaded liposomes over time, liposomes were dialyzed against PBS at 37 °C between 0-48 h and the liposome size was followed by

DLS. The average diameter of liposomes was relatively unchanged over 48 h of incubation, with an average size of 146.8nm for un-dialyzed liposomes, and 138.7 nm

after 48 h, however the size distribution of the particles does shift to smaller particles at times greater than 4 h (Supplemental figure 4). We estimated the number of liposomes in our preparations using NTA, with approximately 350 billion liposomes in a typical preparation. For liposomes formed with Quasar 670 modified aptamers, dye absorbance was also quantified and was used to determine the number of aptamers attached to each liposome using Beer’s law. This was divided by the number of particles counted with

NTA. The number of aptamers per liposome was typically ≈100.

Specificity of SZTI01-Targeted TPEN Liposomes:

We have previously demonstrated that the SZTI01 aptamer can specifically deliver doxorubicin to PSMA+ PCa cells [18], an approach that resulted in reduced cytotoxicity to non-targeted cells. However the ability of SZTI01 to deliver larger particles, such as liposomes, has not been evaluated. We prepared liposomes conjugated with the SZTI01 aptamer, and followed binding of the aptamer-liposome complex to prostate cancer cells that differed in PSMA expression. The aptamer-targeted liposomes included a Quasar670 dye covalently bound to the aptamer, and liposomes were loaded with FITC-dextran to track delivery of the liposomal cargo to cells. We used PSMA+ C4-

2 as our targeted cells and PSMA- PC3 as non-targeted controls, as in our previous studies [18]. After 1 h treatment, confocal microscopy revealed a marked difference in binding and cargo delivery between C4-2 cells, which displayed strong uptake, and PC3 cells, which displayed minimal binding and cargo delivery (Figure 4). Additionally, non- targeted liposomes demonstrated little to no FITC delivery to either PC3 or C4-2 cells.

These data demonstrate that aptamer-targeted liposomes bind and deliver liposomal cargo selectively to PSMA+ cells.

To demonstrate that selective delivery translated into target-specific cell killing,

C4-2 and PC3 cells were treated with: i) aptamer-targeted liposomes; ii) non-targeted liposomes; or iii) free TPEN. Cells were also treated with liposomes that contained no drug, which resulted in no significant difference from control cells (not shown). Because of this, only treatments that contained TPEN were tested exhaustively. All treatments delivered equal amounts of TPEN (normalized to 5µM free TPEN concentration). Our previous studies showed C4-2 and PC3 cells were equally sensitive to TPEN following

72h treatment while a 3-hour treatment with 5 µM free TPEN was non-toxic to both cell lines [8]. PSMA+ C4-2 cells, but not PC3 cells, displayed significantly reduced viability upon treatment with aptamer-targeted liposomes. Non-targeted liposomes and free TPEN had lesser effects, comparable to untreated controls, in both cell lines (Figure 5a). The specificity of aptamer-targeted liposomes was maintained when C4-2 and PC3 cells were co-cultured, indicating the robustness of our targeting approach (Figure 5b). Further, adding exogenous aptamer to C4-2 cells treated with aptamer-targeted liposomes reduced cytotoxicity by 30% (Figure 5c), consistent with an aptamer-mediated targeting effect.

These results show that our aptamer-targeted liposomes can selectively kill targeted

PSMA+ PCa cells at concentrations that leave non-targeted cells unaffected. Such selective targeting may reduce the risk of neurotoxicity associated with TPEN treatment in vivo.

To confirm that the cytotoxic mechanism for TPEN was not altered by liposomal delivery, C4-2 cells were co-treated for 3 h with exogenous Zn2+ and aptamer-targeted

liposomes at 5 uM TPEN, which was shown to be the point at which cells respond to

TPEN in our previous publication. Addition of TPEN beyond 5 uM does not enhance cytotoxicity, with exposure time playing a larger role. Cytotoxicity of aptamer-targeted liposomes was completely rescued by exogenous Zn2+ (Figure 6a), demonstrating that aptamer-targeted liposomes induce cell death via Zn2+ chelation selectively in PSMA+ cells. Additionally, when C4-2 cells were treated with either aptamer-targeted liposomes, non-targeted liposomes, or free TPEN for 2 h, only cells treated with aptamer-targeted liposomes containing TPEN showed signs of oxidative damage when imaged with

BODIPY (Figure 6b), consistent with aptamer-targeted liposomes causing oxidative damage. C4-2 cells treated with aptamer-targeted liposomes could also be rescued by co- treating the cells with the anti-oxidants MnTBAP or NAC (Figure 6c).

In vivo Targeting and Efficacy of SZTI01-Targeted TPEN Liposomes

We first sought to determine if liposomal delivery had an effect on the accumulation of a near IR dye, IR Dye800CW, in organs and tumors compared to free dye. For all imaging studies liposomes were formed with both the dye as well as TPEN.

Mice that received dye delivered via liposomes displayed higher fluorescence in tumors, kidney, spleen, and liver than mice dosed with free dye (Figure 7a-c), 48 h after injection. Organs and tumors from mice injected with free dye had no fluorescent signal after 48 h, consistent with rapid clearance of the small molecule via the kidneys. We then designed a follow up experiment to examine possible toxicity associated with TPEN and liposomal TPEN. Mice were treated with either TPEN, or liposomal TPEN. After 48 h, mice were sacrificed and the livers were examined for potential toxicity (Figure 7e).

Interestingly, mice treated with TPEN-loaded liposomes showed no visible signs of toxicity, while livers of mice treated with free TPEN show lipid accumulation, consistent with free TPEN causing acute hepatotoxicity. Liposomal delivery may ameliorate this effect.

After establishing that our liposomes altered tissue retention and potential side effects of TPEN, we tested if dye delivered via aptamer-targeted liposomes partitioned preferentially to C4-2 or PC3 tumors in the same animal. Mice were injected with either free dye or dye loaded into targeted liposomes. After 48 h, mice were sacrificed and tumors were excised for imaging. Tumors from mice that received liposomal dye showed fluorescence in both tumors, with greater fluorescence in the targeted C4-2 tumors

(Figure 7d), demonstrating that our aptamer-targeted liposomes deliver their payload to tumors and preferentially to targeted C4-2 tumors.

For in vivo efficacy studies, we utilized a double xenograft model in male nude mice, where each mouse had both a PSMA+ C4-2 tumor and PSMA- PC3 tumor established on opposite flanks. Mice were also implanted with permanent jugular vein catheters, to allow more consistent drug delivery and mimic how patients often receive treatment. We then sought to determine if our targeted liposomes displayed selective efficacy for targeted tumors. Tumors were measured and drugs administered twice per week for 5 weeks. This dosing regimen was chosen to maximize the drug given to mice without requiring high levels of TPEN in a single dose which might be toxic. After 30 days, group-by-time analysis indicated that both treated C4-2 and PC3 tumors were statistically different from untreated tumors (p= 0.0008 and p = 0.009). Treatment with aptamer-targeted liposomes reduced C4-2 tumor growth by 51% compared to untreated

controls (80.3% vs 163% change in tumor volume for aptamer-targeted liposomes vs control after 30 days; Figure 8a). In contrast, treatment of PC3 tumors with aptamer- targeted liposomes reduced tumors by only 33% compared to untreated controls (87% vs

130.2% change in tumor volume for aptamer-targeted liposomes vs control after 30 days;

Figure 8b). These data demonstrate that SZTI01-targeted liposomes increase the specificity and therapeutic efficacy of the Zn2+ chelator TPEN for treatment of PSMA+ tumors versus non-targeted tumors. Targeted delivery resulted in reduced tumor growth compared to controls, with no adverse events or weight loss in treated animals.

III.5 Discussion:

Zn2+ plays a key role in the development and progression of PCa [2,3,26]. Either removal or addition of Zn2+ to PCa cells can result in cell death, with apoptosis being attributed as the mode of cell death induced by Zn2+ chelation. TPEN, a zinc chelator, is cytotoxic to multiple cell types including PCa, and causes caspase activation and XIAP degradation within 3 h of administration [6,27,28]. Recent studies from our lab also showed that TPEN enhanced the cytotoxicity of other drugs [8]. Oxidative damage has been reported to play a role in TPEN-induced cell death, but this has not been previously investigated in PCa [10,11]. Modulation of oxidative stress is emerging as an anticancer strategy, and PCa cells may be sensitive to agents that induce oxidative stress [29,30]. In the present study, we demonstrate that TPEN is highly cytotoxic to PCa cells by causing oxidative stress and have developed a targeted liposomal delivery system to harness the potential of Zn2+-chelation therapy for selective PCa treatment while minimizing systemic toxicities. Our aptamer-targeted liposomes have potential to localize to PSMA+

tumor cells in vivo by both passive targeting, through the enhanced permeability and retention effect, and by active targeting with the SZTI aptamer.

We, and others, have reported TPEN cytotoxicity in PCa and colon cancer cells requires a threshold dose, with virtually no cytotoxicity below 4 µM and essentially complete cytotoxicity with 5 µM treatment, but these effects were highly time-dependent

[8,31]. To develop appropriate dosing regimens, it is important to identify at what point after treatment TPEN-mediated effects become irreversible. Here, we established that exogenous TPEN is cytotoxic within 3 h of treatment and that Cu2+/Zn2+ is ineffective at rescuing from the cytotoxic effects of TPEN after 8 h. This new information suggests that

TPEN rapidly causes cells to commit to apoptosis. The effects of TPEN have largely been attributed to Zn2+ chelation, yet TPEN has higher affinity for Cu2+ than Zn2+ [32].

Our results show that Cu2+ is as effective as Zn2+ for rescue, consistent with enzyme(s) that require both Cu2+ and Zn2+ co-factors being targets for TPEN treatment. One such candidate is SOD1, a ROS-detoxifying enzyme that requires both Cu2+ and Zn2+ co- factors. Chelating Cu2+ and Zn2+ may reduce SOD1 activity, causing oxidative stress, inducing apoptosis, and partially explaining why cells treated with TPEN can be rescued with Cu2+, even h after TPEN treatment (Figure 2a,b). Consistent with this interpretation, TPEN cytotoxicity was rescued by the anti-oxidant NAC (Figure 2c), or by the SOD1 mimetic MnTBAP (Figure 2d). Rescue was only partial, however, consistent with other processes also contributing to TPEN cytotoxicity. This is not surprising, given the ubiquitous use of Cu2+ and Zn2+ as co-factors for transcription factors and other enzymes. Zn2+ may also be directly involved in inhibiting apoptosis, since Zn2+ depletion results in degradation of the anti-apoptotic protein XIAP [6,7].

Our studies with oxidation-sensitive fluorescent dyes BODIPY-C11 (Figure 1a) and DCFH (Figure 1b) established that oxidative stress is induced by TPEN, while studies with Mitotracker Green (Figure 1) demonstrated that TPEN altered mitochondria morphology. When treated with TPEN and BOPIDY, PCa cells displayed much more green fluorescence than controls, indicating high levels of oxidative stress (Figure 1a).

We confirmed these results with an additional ROS-sensitive dye, DCFH (Figure 1b).

Using MitoTracker® Green, we also observed morphological changes in mitochondria and granular bodies in cells undergoing oxidative stress due to TPEN treatment

(especially in PC3 cells; Figure 1c). These morphological changes may reflect mitochondrial damage linked to cytochrome C release and apoptosis[33]. Although the cause of these morphological changes are not clearly understood, these data suggest mitochondria are stressed when cells are treated with TPEN, and this may be important aspect of cytotoxicity due to Zn2+ chelation. These results demonstrate that TPEN induces both oxidative stress and alterations to mitochondrial morphology consistent with apoptosis. Importantly, the IC50 of TPEN is 2-3 fold lower in cancer cells than in non- cancerous cells, indicating that there is a therapeutic window for selective cancer therapy

[31]. These data collectively implicate ROS and oxidative stress as the primary mechanisms of TPEN cytotoxicity.

In order to deliver TPEN to cells in a manner that would reduce the risk of toxicity we encapsulated the chelator in pegylated liposomes targeted with SZTI01 aptamer. In a neutral or basic environment, TPEN is highly hydrophobic and is insoluble in water. We utilized a pH 5.5 citrate buffer which effectively solubilized the drug, up to

100 mM. This allowed for TPEN to be delivered via the interior of the liposome;

however, concentrations much higher than 1 mM prevented liposome formation, indicating that even protonated TPEN may still interact with the lipid membrane at high concentrations. Once liposomes were formed, we assessed them for size distribution

(Figure 3a-c). NTA, DLS, and TEM all confirmed that liposomes were ≈100 nm in diameter with few large or small outliers. The zeta potential of the liposomes was found to be slightly negative, which is to be expected as the particles are coated with DNA aptamers, which have a negative charge from the phosphodiester backbone. After confirming the formation of liposomes, in order to ascertain the leakage rate we dialyzed liposomes containing TPEN and found dialysis against PBS at 37°C showed that approximately 50% of the contents had leaked after 8 h (Supplemental Figure 2B).

These results demonstrate that our liposomes are stable enough to carry their contents, even lipophilic small molecules such as TPEN, for an extended period of time, and deliver them to targeted sites. We also measured the change in diameter of liposomes over time and found that while there was relatively little change to the average diameter, the distribution did change slightly (Supplemental Figure 4b) to favor slightly smaller particles. This likely is a result of larger particles precipitating out of solution. There is no evidence of liposome fusion. These results indicate that the liposomes are stable for up to

48 h at 37 °C, making them a good candidate for in vivo use.

Zn2+ is a vital micronutrient required for many biochemical processes; its depletion can lead to severe side effects. Administration of TPEN via tail vein injection in mice resulted in ataxia, convulsions, and death within 20 min [12]. If Zn2+ chelation were to be used clinically, it must be targeted to PCa cells to limit these side effects. Our aptamer-targeted liposomes seek to address this need. Histological studies of mice treated

with TPEN or TPEN-loaded liposomes revealed possible hepatic toxicity after a single dose of TPEN which was ameliorated when TPEN was delivered via liposomes (Figure

7e). Mice treated with IRDYE 800CW-loaded liposomes showed more dye delivery to the liver, kidneys, spleen and C-42 tumors when compared to mice that received free dye

(Figure 7a-c) after 48 h. These results are unsurprising, as altered accumulation and enhanced delivery is well documented for nano-sized particles, however this can result regardless of targeting. Our imaging study was expanded to examine if aptamer targeted liposomes preferentially bound to PSMA+ cells over PSMA- cells, as we observed in vitro. To test the specificity of our targeted liposomes we used a model in which two tumors were grown on opposite flanks, one with targeted cells and one with untargeted cells. Doing so allowed us to study if targeted liposomes had increased delivery to the targeted tumor over the non-targeted tumor, and removed the variability that can occur between mice. We found that, qualitatively, tumors established from C4-2 cells had higher fluorescence than those established from PC3 cells (Figure 7d). This establishes that SZTI01-targeted liposomes increased delivery of small molecules and preferentially delivered their cargo to tumors established from PSMA+ expressing cells both in vitro and in vivo, as demonstrated by our imaging studies, and reduced liver toxicity.

Additionally, delivery of TPEN via liposomes resulted in a significant reduction in tumor size when compared to non-treated controls in both targeted and non-targeted prostate cancer cell lines (Figure 8). We believe a combination of enhanced permeability and retention and decreased renal clearance results in prolonged circulation time and increased liposomal uptake in both tumors. PSMA+ tumors may attract targeted liposomes that actively bind to the tumor and are internalized. Although in these studies

tumors from C4-2 cells still increased in size despite treatment, our study was limited to a single dose which caused no toxicity as measured by weight loss. A dose-escalation trial may reveal that higher dosages are safe, and more effective at reducing tumor size.

Our study is particularly timely for men with CRPC. While a few treatments improve survival for men with CRPC, none are curative and resistance to novel agents inevitably ensues. There is a persistent need for novel strategies to target CRPC cells. Our study provides opportunity to advance a novel strategy of metal chelation to be delivered safely and effectively in men with CRPC. Among various human organs, the prostate gland has the highest and disproportionately high levels of Zn2+ concentration. This unique Zn2+-rich microenvironment is amenable to metal chelation strategies and our current study is a promising step towards implementing this strategy.

To our knowledge, this is the first report of targeted Zn2+ chelation for treatment of PCa. Our in vitro studies demonstrated that aptamer-targeted liposomes were selectively cytotoxic to PSMA+ C4-2 cells even in the presence of co-culture with PSMA-

PC3 cells. We have also demonstrated that aptamer-targeted liposomal delivery of TPEN is an effective anti-cancer strategy in vivo. Targeted liposomal delivery of TPEN significantly reduced tumor volume for both PC3 and C4-2 tumors, consistent with the enhanced permeability and retention effect contributing to efficacy. Targeted C4-2 tumors were, however, even more sensitive to the targeted therapy indicating that active targeting is an independent factor contributing to therapeutic efficacy. These results are significant given the relatively poor response achieved in clinical trials of metal chelators such as ATN-224[34]. In light of the poor response of CRPC to conventional therapy,

Zn2+ chelation offers promise of a new approach to treatment. Our successful

demonstration of targeted delivery indicates that this approach may overcome potential toxicities associated with systemic administration of Zn2+ chelators and also improve efficacy.

Figure 1: TPEN induces significant oxidative stress in PCa cells. A) Confocal microscopy of C4-2 and PC3 cells treated with or without TPEN for 7 h and imaged with

BODIPY C11. Images denoted by i, ii, iii, or iv are phase, unoxidized BODIPY, oxidized

BODIPY, and merged images, respectively. B) Fluorescent microscopy demonstrating increased DCFH oxidation after 6 h of TPEN treatment. C) Fluorescent microscopy of

C4-2 and PC3 cells using Mito Tracker® Green after 7 h of treatment with 8 µM TPEN.

Large granular bodies can be identified in TPEN-treated cells, which co-localize with

Mito Tracker® Green.

Figure 2: Time-dependence of Cu2+ and Zn2+ rescue. A) Viability of PCa cells after 8 h of 8 µM TPEN treatment followed by 72 h of drug-free incubation with Zn2+ rescue at the indicated times. B) The same as A, but with Cu2+ rescue. C) Viability of cells treated with 8µM of TPEN for 8 h rescued with N-acetyl cysteine 1 hour before and concurrent with TPEN. * indicates p ≤ 0.05 between TPEN-only and TPEN+N-acetyl cysteine. D)

The same as C except cells were rescued with 250µM MnTBAP. * indicates as p ≤ 0.05 between aptamer-targeted liposomes only and + Rescue. Error bars represent standard deviations.

Figure 3: A) Aptamer-targeted liposome sizes as determined by dynamic light scattering.

B) Aptamer-targeted liposome sizes as determined by nanoparticle tracking analysis

(NTA); red bars represent standard deviation. C) Dehydrated aptamer-targeted liposomes imaged with transmission electron microscopy. D) Zeta potential of aptamer-targeted liposomes.

Figure 4: Targeted cell binding and delivery of aptamer-targeted liposomes. A)

Confocal microscopy images of C4-2 and PC3 cells treated with aptamer-targeted liposomes with FITC along with TPEN or non-targeted liposomes (right).

Figure 5: Selective cytotoxicity of aptamer-targeted liposomes to C4-2 cells and rescue by exogenous targeting aptamer or exogenous Zn2+. A) Viability of C4-2 and

PC3 cells when treated with aptamer-targeted liposomes (Ap-Lip), non-targeted liposomes (Lip), or TPEN for 3 h. *, p ≤ 0.01 between Ap-Lip and Lip treatment; #, p ≤

0.01 between C4-2 and PC3 cells treated with Ap-Lip. B) Co-culture of C4-2 and PC3 cells treated with Ap-lip or Lip only for 3 h. C) C4-2 cells treated with Ap-Lip or Ap-Lip plus exogenous aptamer. Error bars represent standard deviation.

Figure 6: TPEN delivered via aptamer-targeted liposomes induces cell death in a similar manner as free TPEN. A) C4-2 cells were treated with aptamer-targeted liposomes (Ap-lip) for 3 h were rescued by addition of zinc salts (ZnSO4). B) C4-2 cells treated with Ap-lips display stress from reactive oxygen species after 2 h, compared to cells treated with untargeted liposomes or free TPEN. C) C4-2 cells treated in a similar manner with either Ap-lip, or Ap-lip + MnTBAP or N-acetyl cysteine show rescue by antioxidants. Error bars represent standard deviation.

Figure 7: Liposomal loading results in increased retention and reduced hepatotoxicity. A) Ex vivo imaging of liver where FD is mice treated with free dye and

Lipo is mice treated with aptamer targeted liposomal dye. B) Spleen and kidneys from mice dosed with either free dye, or targeted dye loaded liposomes. C) C4-2 tumors from the same mice as in A and B. D) Ex vivo fluorescence imaging of tumors derived from

C4-2 (top) and PC3 (bottom) cells. Mice were treated only with aptamer targeted liposomes in this experiment. E) Hemotoxylin and Eosin stain of liver sections from mice treated with 4mg/Kg of either free TPEN or TPEN loaded liposomes.

Figure 8: Aptamer-targeted liposomes specifically deliver contents to and reduce tumor growth of PSMA+ tumors. A) B) Growth of C4-2-derived tumors, normalized to

starting volume. Error bars represent standard error. B) Growth of PC3-derived tumors, normalized to starting volume. Error bars represent standard error.

Supplementary Figure 1: Quantification of mitochondria from 100+ cells for each group using image J.

Supplementary Figure 2: A) Standard curve of TPEN absorbance used to calculate TPEN concentration in liposomes. B) UV absorbance at 260nm of TPEN loaded liposomes after dialysis at 37°C against PBS C) Representative UV-VIS absorbance of Ap-Lip modified with Quazar 670, TPEN loaded liposomes, and buffer after washing liposomes.

Supplemental Figure 3: General Scheme showing formation of aptamer-targeted liposomes.

Supplemental Figure 4: Size as determined by DLS of TPEN loaded liposomes after dialysis against PBS at 37°C.

III.6 Future Directions:

There remains an unmet need for the treatment of advanced prostate cancer. A major complicating factor for the treatment of this disease is that recurrent disease is often hormone independent, leaving the primary treatment for prostate cancer ineffective.

However, some aspects of advanced PCa are possible avenues for future treatments. As

PCa develops, zinc levels in the malignant tissue decrease dramatically compared to the healthy tissue. PCa cells are highly sensitive to changes in zinc concentration, and chelating out the remaining zinc results in PCa cell death. However, this requires a delivery method to ensure that the chelator reaches the site without first chelating other metals from the blood. PCa also expresses high levels of PSMA, and nearly all metastasis to the bone and bladder express this marker as well. The SZTI01 aptamer was designed to recognize this marker and can be used to deliver a variety of molecules to cells expressing this target. Our studies show combining zinc chelation with aptamer mediated delivery may be a promising, and novel, treatment for advanced PCa, and may result in improved prognosis for patients of this disease. We anticipate that further development of zinc chelation therapies for advanced PCa will result in favorable outcomes for these patients, and that aptamer-targeted liposomes provide a good platform for delivery of not only chelating agents, but also traditional chemotherapy for combination treatments as well.

Executive Summary:

Current Status of Prostate Cancer Treatment:

 While primary PCa has a favorable outcome, with 5 year survival ≈90%, recurrent disease has a much worse prognosis even with new treatments.

Development of Novel Treatments for Advanced Prostate Cancer:

 Recent work has shown that PCa has greatly reduced zinc levels when compared to the normal prostates  We investigate the ability of the chelator TPEN to chelate zinc in PCa cells and if this is sufficient to kill PCa cells  We develop a targeted delivery vehicle for TPEN, utilizing liposomes and aptamer targeting, to selectively target PSMA expressing PCa Cells

Key Results of Findings:

 TPEN acts rapidly when administered to PCa cells in vitro, with effects being irreversible within 8 h.  TPEN elicits its effects via zinc chelation and ROS imbalance, and cells can be rescued from TPEN by supplementing with exogenous zinc or antioxidants.  Despite high lipophilicity, TPEN can be incorporated into liposomes and targeted to PSMA expressing cells using the SZTI01 aptamer.  SZTI01 targeted liposomes increase the accumulation of dye in vivo compared to free dye, and delivery of TPEN in this way results in reduced toxicity at short time points.  TPEN delivered via aptamer-targeted liposomes results in a significant reduction in PCa tumors in a xenograph model when administered twice weekly.

Implications:

 These studies demonstrate that zinc chelation can be used to reduce PCa tumors as a single agent treatment, and that aptamer-targeted liposomes can be used to safely deliver drugs that are otherwise toxic in vivo.

References:

Kirby M, Hirst C, Crawford ED. Characterising the castration-resistant prostate

cancer population: a systematic review. Int J Clin Pract. 65(11), 1180–1192

(2011).

1. Costello LC, Franklin RB. Novel role of zinc in the regulation of prostate citrate

metabolism and its implications in prostate cancer. Prostate. 35(4), 285–296

(1998).

2. Costello LC, Franklin RB. The clinical relevance of the metabolism of prostate

cancer; zinc and tumor suppression: connecting the dots. Mol Cancer. 5(17),

(2006).

• Zinc is identified as an important factor for PCa development, and a

possible novel target for future treatments.

3. Golovine K, Uzzo RG, Makhov P, Crispen PL, Kunkle D, Kolenko VM.

Depletion of intracellular zinc increases expression of tumorigenic cytokines

VEGF, IL-6 and IL-8 in prostate cancer cells via NF-kappaB-dependent pathway.

Prostate. 68(13), 1443–1449 (2008).

4. Shah, M.R., Kriedt, C.L., Lents, N.H., Hoyer, M.K., Jamaluddin, N., Klein, C.,

and Baldassare, J. Direct intra-tumoral injection of zinc-acetate halts tumor

growth in a xenograft model of prostate cancer. J Exp Clin Canc Res. 28(84),

(2009).

5. Makhov, P., Golovine, K., Uzzo, R.G., Rothman, J., Crispen, P.L., Shaw, T.,

Scoll, B.J., and Kolenko, V.M. Zinc chelation induces rapid depletion of the X-

linked inhibitor of apoptosis (XIAP) and sensitizes prostate cancer cells to

TRAIL-mediated apoptosis. Cell Death Differ. 15(11), 1745–1751 (2008).

100

6. Carraway, R.E., and Dobner, P.R. Zinc pyrithione induces ERK- and PKC-

dependent necrosis distinct from TPEN-induced apoptosis in prostate cancer cells.

BBA-Mol Cel Res. 1823(2), 544–557 (2012).

7. Gmeiner WH, Boyacioglu O, Stuart CH, Jennings-Gee J, Balaji KC. The

Cytotoxic and Pro-Apoptotic Activities of the Novel Fluoropyrimidine F10

Towards Prostate Cancer Cells are Enhanced by Zn2þ-Chelation and Inhibiting

the Serine Protease Omi/HtrA2. The Prostate. 75(4), 360-9 (2015).

• TPEN is identified to induce apoptosis in a zinc dependent manner, and

can increase apoptotic activity of other drugs in PCa cell lines.

8. Hashemi M, Ghavami S, Eshraghi M, Booy EP, Los M. Cytotoxic effects of

intra and extracellular zinc chelation on human breast cancer cells. Eur. J.

Pharmacol. 557(1), 9–19 (2007).

9. Mendivil-Perez M, Velez-Pardo C, Jimenez-Del-Rio M. TPEN Induces

Apoptosis Independently of Zinc Chelator Activity in a Model of Acute

Lymphoblastic Leukemia and Ex Vivo Acute Leukemia Cells through Oxidative

Stress and Mitochondria Caspase-3- and AIF-Dependent Pathways. Oxid Med

Cell Longev. 2012, e313275 (2012).

10. Khandrika L, Kumar B, Koul S, Maroni P, Koul HK. Oxidative stress in prostate cancer. Cancer Lett. 282(2), 125–136 (2009).

11. Adler M, Dinterman RE, Wannemacher RW. Protection by the heavy metal

chelator N,N,N’,N’-tetrakis (2-pyridylmethyl)ethylenediamine (TPEN) against

the lethal action of botulinum neurotoxin A and B. Toxicon. 35(7), 1089–1100

(1997).

101

12. Safra T, Muggia F, Jeffers S, et al. Pegylated liposomal doxorubicin (doxil):

reduced clinical cardiotoxicity in patients reaching or exceeding cumulative

doses of 500 mg/m2. Ann. Oncol. 11(8), 1029–1033 (2000).

13. Awasthi VD, Goins B, Klipper R, Phillips WT. Dual radiolabeled liposomes:

biodistribution studies and localization of focal sites of infection in rats. Nucl.

Med. Biol. 25(2), 155–160 (1998).

14. Seo JW, Mahakian LM, Kheirolomoom A, et al. Liposomal Cu-64 labeling

method using bifunctional chelators: poly(ethylene glycol) spacer and chelator

effects. Bioconjug. Chem. 21(7), 1206–1215 (2010).

15. Cao Z, Tong R, Mishra A, et al. Reversible Cell-Specific Drug Delivery with

Aptamer-Functionalized Liposomes. Angew Chem Int Ed Engl. 48(35), 6494–

6498 (2009).

16. Kang H, O’Donoghue MB, Liu H, Tan W. A liposome-based nanostructure for

aptamer directed delivery. Chem. Commun. 46(2), 249–251 (2009).

17. Boyacioglu O, Stuart CH, Kulik G, Gmeiner WH. Dimeric DNA Aptamer

Complexes for High-capacity–targeted Drug Delivery Using pH-sensitive

Covalent Linkages. Mol Ther Nucleic Acids. 2(7), e107 (2013).

•• The PSMA specific aptamer SZTI01 is identified and displays differential

binding to cells that express the target versus those that do not.

18. Foy JW, Rittenhouse K., Modi M, Patel, M. Local tolerance and systemic safety

of pegaptanib sodium in the dog and rabbit. J Ocul Pharmacol Ther 23, 452–466

(2003).

102

19. Silver DA, Pellicer I, Fair WR, Heston WD, Cordon-Cardo C. Prostate-specific

membrane antigen expression in normal and malignant human tissues. Clin

Cancer Res. 3(1), 81–85 (1997).

20. Wright Jr. GL, Mayer Grob B, Haley C, et al. Upregulation of prostate-specific

membrane antigen after androgen-deprivation therapy. Urology. 48(2), 326–334

(1996).

21. Tang H, Arulsamy N, Radosz M, et al. Highly Active Copper-Based Catalyst for

Atom Transfer Radical Polymerization. J. Am. Chem. Soc. 128(50), 16277–

16285 (2006).

22. Crow JP. Dichlorodihydrofluorescein and dihydrorhodamine 123 are sensitive

indicators of peroxynitrite in vitro: implications for intracellular measurement of

reactive nitrogen and oxygen species. Nitric Oxide. 1(2), 145–157 (1997).

23. Faulkner KM, Liochev SI, Fridovich I. Stable Mn(III) porphyrins mimic

superoxide dismutase in vitro and substitute for it in vivo. J. Biol. Chem.

269(38), 23471–23476 (1994).

24. Batinić-Haberle I, Cuzzocrea S, Rebouças JS, et al. Pure MnTBAP selectively

scavenges peroxynitrite over superoxide: comparison of pure and commercial

MnTBAP samples to MnTE-2-PyP in two models of oxidative stress injury, an

SOD-specific Escherichia coli model and carrageenan-induced pleurisy. Free

Radic. Biol. Med. 46(2), 192–201 (2009).

25. Costello LC, Feng P, Milon B, Tan M, Franklin RB. Role of zinc in the

pathogenesis and treatment of prostate cancer: critical issues to resolve. Prostate

Cancer Prostatic Dis. 7(2), 111–117 (2004).

103

26. Chai F, Truong‐Tran AQ, Evdokiou A, Young GP, Zalewski PD. Intracellular

Zinc Depletion Induces Caspase Activation and p21 Waf1/Cip1 Cleavage in Human

Epithelial Cell Lines. J Infect Diss. 182(s1), S85–S92 (2000).

27. López JJ, Redondo P c., Salido GM, Pariente JA, Rosado JA. N,N,N′,N′-

tetrakis(2-pyridylmethyl)ethylenediamine induces apoptosis through the

activation of caspases-3 and -8 in human platelets. A role for endoplasmic

reticulum stress. Journal of Thromb Haemost. 7(6), 992–999 (2009).

28. Gorrini C, Harris IS, Mak TW. Modulation of oxidative stress as an anticancer

strategy. Nat Rev Drug Discov. 12(12), 931–947 (2013).

29. Trzeciak AR, Nyaga SG, Jaruga P, Lohani A, Dizdaroglu M, Evans MK.

Cellular repair of oxidatively induced DNA base lesions is defective in prostate

cancer cell lines, PC-3 and DU-145. Carcinogenesis. 25(8), 1359–1370 (2004).

30. Fatfat M, Merhi RA, Rahal O, et al. Copper chelation selectively kills colon

cancer cells through redox cycling and generation of reactive oxygen species.

BMC Cancer. 2014;14(527), (2014).

31. Arslan P, Di Virgilio F, Beltrame M, Tsien RY, Pozzan T. Cytosolic Ca2+

homeostasis in Ehrlich and Yoshida carcinomas. A new, membrane-permeant

chelator of heavy metals reveals that these ascites tumor cell lines have normal

cytosolic free Ca2+. J. Biol. Chem. 260(5), 2719–2727 (1985).

32. Haga N, Fujita N, Tsuruo T. Mitochondrial aggregation precedes cytochrome c

release from mitochondria during apoptosis. Oncogene. 22(36), 5579–5585

(2003).

104

33. Lin J, Zahurak M, Beer TM, Ryan CJ, Wilding G, Matthew P, Morris M,

Callahan JA, Gordon G, Reich SD, Carducci MA, Antonarakis ES. A non-

comparative randomized phase II study of 2 doses of ATN-224, a copper/zinc

superoxide dismutase inhibitor, in patients with biochemically recurrent

hormone-naïve prostate cancer. Urol. Oncol. 31(5), 581-588 (2013).

105

Chapter IV

Selection of a New Aptamer Against Vitronectin Using

Capillary Electrophoresis and Next Generation

Sequencing

Christopher Stuarta,b, Christa Colyerc, Denise Giboa, Lysette Mutkusd, William

Gmeinera,b

Author Affiliations: a Wake Forest University School of Medicine Department of Cancer Biology, bDepartment of Molecular Medicine and Translation Science, cWake Forest

University Department of Chemistry, dWake Forest Institute of Regenerative

Medicine, Wake Forest School of Medicine, Winston-Salem, NC 27157

This chapter is composed of Manuscript in preparation for submission. The stylistic differences between this chapter and other portions of this dissertation are due to requirements of the journal.

WG and CC conceived and designed the project. CS planned and preformed the experiments. DG preformed histological sectioning and imaging. LM preformed

Flow Cytometry. CS wrote the manuscript with editorial input from RS and WG.

106

IV.1 Introduction:

Nearly a quarter of a million women will be diagnosed with breast cancer (BC) every year in the United States, and despite decades of intense research and advances in treatment over 40,000 women will die of the disease each year1. The discovery of amplification of the Her2/Neu gene in a large portion of breast cancer patients and the advent of specific therapy using the antibody Herceptin revolutionized the treatment of breast cancer, extending survival significantly2. However, only about 25% of breast cancers over express this marker limiting the utility of this treatment and underscoring the necessity for further research to improve prognosis for the majority of women3.

One of the most successful ways to improve the prognosis for BC patients is early detection of the disease. Patients that begin treatment at stage I approach 100% 5 year survival while those diagnosed at stage IV have less than a 25% 5 year survival1. The only current method used for breast cancer screening is mammography which can reduce the mortality of breast cancer by 32% in women in their 60’s4. However, mammography is time consuming, intrusive to the patient, result in over diagnosis, and can contribute to increased risk of developing cancer5,6,7. Unlike prostate cancer in men where Prostate

Specific Antigen blood concentration can be monitored and used for screening and diagnostic purposes, there are no equivalent blood monitoring tests for BC. Blood screening tests are favorable over radiographic imaging for multiple reasons including, no radiation exposure to the patient, lack of subjective diagnosis based on image analysis, faster and less intrusive to the patient, as well as the ability to check multiple markers simultaneously. Currently a variety of targets are being investigated as alternatives to mammography. Tumor derived DNA, circulating stem cells, and MUC1, a protein

107

associated with increased BC progression, are all being examined for use in BC screenings, however these markers are generally only useful at later stages of BC development8,9,10. Mammaprint, a screening of 70 genes related to BC, can be used for diagnostic purposes and can be used to help predict if a cancer will progress or become metastatic11. Recently, miRNA’s have been shown to have early diagnostic potential for identifying BC before it is in an advanced stage, but a definitive blood screen is still unavailable, with multiple new candidates being pursued12.

Vitronectin (VN) is being investigated a possible biomarker that can be used for diagnostic purposes in BC. VN is a highly glycosylated protein produced primarily in the liver and secreted into the blood13. VN can exist as a monomer, which predominates in the serum, or as a multimer once it is incorporated into the ECM14,15. One of VN’s major roles is in wound healing and clotting. High levels of VN are stored in platelets and upon activation VN is released and prevents clot degradation via binding of plasminogen

16 activator inhibitor-1 . However, VN also binds to a many other receptors including αV-

β3, an integrin that plays a role in macrophage activation, angiogenesis, and tumor progression17,18. VN is also known to become incorporated into the extra cellular matrix and serves as a support for cell motility and adhesion19. Of particular interest in this regard is the ability of VN to bind to the urokinase receptor (uPAR, CD87), which is also involved in plasminogen activation20. Once uPAR binds to VN it appears to induce cell adhesion and cancer migration through Rac activation21,22. VN binding appears to be key in inducing these effects via uPAR23,24. Because of this, uPAR has been investigated as a potential biomarker for BC. It has been demonstrated that uPAR expression is increased as the disease progresses and may have prognostic value25. VN itself has also been

108

investigated as a possible cancer promoting protein as well. Circulating serum VN has been shown to increase with BC progression26. Additionally, increased VN staining can be observed around the vessels of DCIS containing breast tissue26. Analysis of mRNA from BC carcinoma displaying high VN staining revealed that neither malignant nor normal breast tissue expressed VN, suggesting it was being supplied by the liver and malignant cells were actively binding the protein from serum27. Further, VN was shown to be a driving factor in BC cancer stem cell differentiation, and when VN binding to αV-

β3 was blocked BC cells failed to form tumors in vivo. These results make VN a promising candidate as not only a possible prognostic marker for BC, but also as a therapeutic target used to treat the disease by binding to circulating VN and localizing to areas where malignant tissues are incorporating it into the surrounding ECM.

In order to identify a molecule that could differentiate between VN and

Fibronectin (FN), a structurally similar protein, we developed an aptamer using a novel variation of the Systematic evolution of ligands by exponential enrichment protocol

(SELEX)29. Aptamers are single stranded DNA or RNA molecules that fold into distinct

3D conformations which can recognize proteins, small molecules, and even metal ions30,31. Aptamers have advantages over antibodies in that they are chemically stable, can undergo multiple freeze thaw cycles, be denatured and refolded, are non- immunogenic, and production can be scaled with reasonable cost32. They can also be modified with drugs, dyes, or other molecules to alter their function and stability33,34. We utilized a combination of capillary electrophoresis (CE) and next generation sequencing

(NGS), which has been shown to identify aptamers more efficiently than traditional

SELEX, to identify an aptamer against VN35,36. However, this is the first work to select

109

novel aptamers using a combined CENGS SELEX methodology. Herein we describe the selection, characterization, and drug delivery capability of a novel aptamer against VN,

VBA-01, and its dimer DVBA-01 using CENGS SELEX.

IV.2 Methods:

Vitronectin Specific Aptamer Synthesis:

All DNA aptamer sequences were synthesized at IDT Inc. (Coralville, IA).

Aptamers were reconstituted in sterile 50mM Tris buffer, pH 8.2 at 100 µM. All aptamers were synthesized with either a dA16 or T16 single-stranded tail at the 3’-terminus, in addition to a 3’ phosphorothioate bond to increase nuclease resistance. DVBA-01 and

VBA-dT-01 were formed by prefolding the aptamers and mixing the 2 monomers at 1:1 ratio followed by a 15 minute incubation at 4°C. The DVBA-01 used for these studies

(unless otherwise indicated) included the sequence dCGGCA16GCCG at the 3’ end. The secondary structure for the DVBA-01 calculated using m-fold.

Aptamer selection:

Aptamer selection was achieved by CENGS-SELEX (capillary electrophoresis and next generation sequencing SELEX) to select for and identify aptamer sequences. A

DNA library containing ≈ 2 x 10^19 unique sequences was used for all SELEX studies, with set primer sequences on the 5’ and 3’ ends and 40 random nucleotides in the center of the oligonucleotide

(5’AGCTCAGAATAAACGCTCAA(N)40TTCGACATGAGGCCGGATC). Primers

110

used for PCR were 5’ Phos-GATCCGGCCTCATGTCGAA and 5’

GGGAGCTCAGAATAAACGCTCAA. Fibronectin, Vitonectin, and aptamers were all prepared to 50µM in pH 8.2 Tris buffer. 1.5 x10^13 sequences were used for the initial selection. Aptamers were folded by heating to 95°C for 10 minutes and snap cooled by placing them directly in an ice bath for 15 minutes. Aptamers were mixed 1:1 with protein at a final concentration of 500nM. The mixtures were allowed to incubate at 4°C for 30min prior to CE experiments. Selections were performed using a Beckman Coulter

P/ACE MDQ CE system with laser-induced fluorescence (LIF) with excitation/emission set to 488/520nm. 32 KARAT software was used for for CE control and analysis. An uncoated fused-silica capillary 60.2 cm total length, 75 μm internal diameter was used for

CE studies. The capillary and inlet/outlet vials were filled with separation buffer which contained pH 8.2, 31 mM Tris and 500 mM, as well as 1:100,000 SYBR gold for DNA labeling.

The aptamers were first run with Fibronectin as a negative selection step. The bound fraction of aptamers was discarded, and the remaining aptamers were mixed with

Vitronectin and re-run through CE SELEX. The bound aptamers were then collected, and unbound DNA was discarded. Aptamers were PCR amplified with phosphorylated forward primer using TAQ DNA polymerase, and degraded to single stranded DNA using lambda exonuclease according to manufacturer protocols. Single stranded aptamers were collected using a QIAquick PCR purification kit. Positive SELEX was performed for a 2 additional rounds, with a final negative selection against fibronectin.

111

After the initial selection rounds were complete, the aptamer pool was converted to blunt end dsDNA by amplification with T4 DNA polymerase. The dsDNA was shipped to

Nanomedica for Next Generation Sequencing (NGS).

The top 7 most populous sequences identified by NGS were then synthesized

(Supplemental Figure 1). Aptamer candidates were folded and evaluated for binding under identical conditions that were used for aptamer selection. Sequence 1 (S1), the most populous sequence identified by NGS, had the lowest Kd of these initial aptamers selected and was used for further aptamer refinement. Sequences other than S1 also displayed affinity in the mid-to-high nanomolar range (S5, S6), indicating that there are other aptamers that bind VN despite having significantly different sequences. To identify aptamers that were similar to S1, non-primer bases of S1 were divided into 8 base reading frames which were then compared to the entire library of sequences identified by NGS.

Any sequence that shared an 8 base sequence with S1 was added to a new library of candidate aptamers, for a total of 1582 unique candidate aptamers. The list of candidate aptamers was analyzed with CLUSTAL OMEGA which grouped the candidate aptamers by sequence similarity. The aptamer groups were visualized with a phylogeny tree with average distance using percent identity to construct the tree. This was divided into 8

“families” based on sequence similarity. After clustering we selected 10 aptamers from separate families, with 2 aptamers selected from the largest family and 2 selected from a highly variable family. These aptamers were synthesized and evaluated by CE for binding affinity. We identified 3 aptamers with low nanomolar affinity, S3a, S5a, and

S8a. We then chose to further develop S5a, as it had a similar structure to S1, which was the most populous sequence identified in NGs. S5a was trimmed from the 3’ and 5’ ends

112

until binding affinity began to decrease significantly, resulting in a final length of 63 bases. This trimmed aptamer, VBA-01 was used for binding and toxicity studies.

Synthesis of Doxorubicin Conjugated Aptamers:

The covalent complex of DVBA-01 and VBA-dT-01 was prepared by mixing 250

µL of a 50 µM solution with a Dox-formaldehyde solution prepared upon incubation of a

0.37% formaldehyde solution in Dulbecco’s Phosphate Buffered Saline without Calcium or Magnesium (DPBS) pH 7.4 with Dox. The reaction proceeded in a light-free manner at

4°C for 48 hours. The solution was extracted once with 300 µL of phenol:chloroform followed by two additional extractions with 300 µL chloroform. The aqueous phase was then ethanol precipitated and the pellet rinsed 2x with 70% ethanol and once with absolute ethanol and dried under reduced pressure. The red pellet was re-suspended in

100 µL dH2O. Yields were typically >90% based on DNA recovery.

Determination of Dox:DNA Ratios:

DNA samples were prepared in DPBS and absorbencies were measured from

200-800nm using a Beckman Coulter DU800 spectrophotometer. A standard curve of

Dox was established between 1µM and 10µM by using absorbencies at 494nm at 85°C.

To assess the amount of Dox covalently bound to DNA the samples were heated to 85°C before measuring the absorbance at 494nm and 260nm. The 260nm wavelength was used to determine the DNA content in the sample and to determine the Dox:DNA ratio.

113

Temperature-Dependent UV Studies:

Temperature-dependent UV absorption spectra were obtained using a Beckman

Coulter DU-800 UV-Vis spectrophotometer. Samples of DVBA-01, DVBA-01-Dox,

VBA-01, and VBA-01-Dox were prepared in DPBS. The temperature was increased at a rate of 0.7 °C/min over the range 20 – 85 °C and absorbance at 260 nm was measured for each sample, (400 µL, 1 µM) concentration.

Cell Maintenance:

MDA-MB-231 cells were purchased from cell and viral vector core laboratory at

Wake Forest School of Medicine. All cells were maintained with DMEM (Gibco, Grand

Island, NY) with 10% fetal bovine serum (Gemini Bio-Products, West Sacramento, CA).

All cells were kept at 5% CO2 at 37 °C.

Cell Viability Assays:

Cells were seeded at a density of 5,000 cells/well in 96-well plates and incubated at 37 °C under 5% CO2. For cells plated on protein coated plates, 96 well plates were coated by adding 100µL of 10µ/mL of the appropriate protein in PBS to each well. Plates were sealed with parafilim and placed at 4C° overnight. Plates were warmed to room temperature before removing excess protein solution and plating cells. The following day, cells were washed with FBS free media and treated for 3 hours with drugs. After treatment cells were washed with media congaing 10% FBS and incubated for 72 hours.

Cell viability assessed indirectly by measuring the ATP amounts using CellTiter-Glo

114

luminescent cell viability assay (Promega) according to the manufacturer’s protocol. For experiments where plates were treated before cells were plated, protein coated or uncoated plates were treated with drugs for 1 hour at 4C° before being washed with PBS.

After plates were washed cells were plated as stated above. Cells were incubated 72 hours before being assayed for viability.

Histology:

Frozen tissue sections of patient DCIS tissue were obtained from the Wake Forest

Tissue Bank, sectioned, and fixed using 10% acetone for 10 minutes at -20°C. Sections were then blocked for 15 minutes using 5% Bovine serum albumin. After blocking sections were washed 3x with PBS. Sections were treated with either 1μM of biotin labeled VBA-01, or a 1:750 dilution of the VTN antibody NBP2-20866 from Novus

Biological, both in 1.5% BSA in phosphate buffered saline, overnight at 4°C. Sections were washed in PBS for 1 hour before an anti-biotin HRP conjugated antibody was added to aptamer stained sections, or anti-mouse HRP conjugated antibody was added to antibody stained sections. Sections incubated for 1 hour at room temperature before being washed 3x with PBS and developed. Sections were stained with nova red and counterstained with hematoxylin.

115

IV.3 Results:

Aptamer Selection using CENGS-SELEX:

The use of capillary electrophoresis enabled us to rapidly enrich a pool of 15 trillion unique sequences for only those that bound Vitronectin, with limited binding for

Fibronectin. The use of CE allows for researchers to monitor the Kd of each selection step using electroferograms, with the area under each curve representative of the amount of aptamer that is bound versus unbound. The initial random library had a Kd of ≈16µM for VN before any selection took place (Figure 1a). After a single negative selection against FN and positive selection for VN we increased the affinity for VN by 30 fold, to

≈500nM (Figure 1b). Each successive round of selection increased the affinity of the pool by approximately 2 fold, resulting in a 200nM Kd for the library (Figure 1c). After the selection process was completed the pool was converted to dsDNA and sent to

Nanomedica for Next Generation Sequencing, which identified 143.845 unique sequences. We selected the top 7 unique sequences (S1-S7) to test for VN binding using

CE (Supplementary Figure 1). S1 and a closely related sequence which varied only by the addition of an additional C to a CCC sequence, likely an error in PCR, accounted for

2.7% of the total reads in the data set. S2 accounted for 0.78%, with S3-S7 varying between 0.14% to 0.08% of total reads. After Kd evaluation we identified sequence 1

(S1), the most populous sequence identified in NGS, as the aptamer with the lowest Kd of the selected sequences, with a Kd of ≈400nM. In order to identify similar sequences to

S1 we broke the aptamer into 8 base reading frames and identified all of the aptamers from the NGS that contained any of those reading frames. These sequences were then compiled into CLUSTAL OMEGA and clustered into families according to sequence

116

similarity. Using a phylogenic tree to differentiate the families (Supplementary Figure

2) we then selected 10 sequences from these groups. We avoided multiple selections from the same group in order to avoid overly similar sequences (Supplementary Figure 1), although 2 sequences were selected from the largest family, as well as from a highly variable family. These 10 aptamer candidates were analyzed for Kd using CE. We identified 3 aptamers from the candidates that displayed low nanomolar affinity for VN,

S3a, S5a, and S8a. Kd analysis using CE showed that Sequence 5a (S5a) had the lowest binding affinity of these modified aptamers (Figure 1c). Trimming S5a aptamer sequence in from the 3’ and 5’ sides revealed that 10 bases could be removed from both ends before significant reductions in affinity were lost. The final Kd of this aptamer, VBA-01, was found to be 405nM and its structure was determined by MFOLD (Figure 1d).

Biophysical Characterization of Aptamer Complexes:

We have developed a novel method to covalently link dox with DNA using a pH sensitive bond. However, this chemistry requires dsDNA. Aptamers with double stranded character were formed by appending either CGGC-dA12-GCCG or CGGC-dT12-GCCG to the 3’ terminus of VBA-01. This allows for the formation of the dimeric DVBA-01

(Figure 2) and the monomeric VBA-01-dT, which consists of VBA-01 with a CGGC- dA16-GCCG tail base paired to a complement 20mer oligonucleotide. Both DVBA-01 and VBA-01 displayed a similar Tm of ≈45C°. When DVBA-01 was covalently modified with Dox, the Tm increased to ≈60C°. DVBA-01 bound 7 equivalents of Dox (Figure 3a).

An additional observation was that when DVBA-01 reacted with Dox, all of the drug was bound to the complex, indicating that DVBA-01 may be capable of binding additional

Dox molecules. Dox loaded DVBA-01 and DVBA-01-Dox were assessed for binding

117

affinity against VN using CE as described above. DVBA-01 had an apparent Kd of

485nM, and DVBA-01-Dox had a Kd of 28nM (figure 3b)

VN Specific Cytotoxicity of DVBA-01-Dox Against BCa Cells:

VN, FN, or uncoated 96 well plates were used to assay the ability of DVBA-01-

Dox to specifically kill BCa cells in a VN rich environment. Plates coated with 10µg/mL of VN facilitated increased killing of MDA-MB-231 cells treated with DVBA-01-Dox when compared to FN or untreated plates. The IC50 value was reduced by ≈35% when compared to cells plated on uncoated or FN treated plates (Figure 4b). When the cytotoxicity data over a range of concentrations is evaluated using calcusyn’s dose-effect curves, there is a modest difference between cells cultured on VN and FN/untreated plates (Figure 4a). However, a distinct difference can be seen between the treatments when cells are treated near the IC50 value (Figure 4c). Cells on VN coated plates are much more sensitive to DVBA-01-Dox than cells cultured on plates lacking the appropriate target. In order to confirm that VN is responsible for the increase in activity we pretreated plated coated in VN, FN, Collagen or uncoated plate for 1 hour at 4C° with

4µM of DVBA-01-Dox before washing and plating MDA-MB-231 cells. When the assay is performed in this manner there is much more cytotoxic activity in cells cultured on VN treated plates when compared to controls (Figure 4d), confirming that DVBA-01-Dox is binding to VN and is delivering Dox to the cells.

Flow Cytometry:

We investigated whether VN and DVBA altered the expression of two markers,

CD87 (UPAR), which can bind VN and is associated with malignant progression, and

118

CD44 (HCAM), a stem cell like marker which has been shown to be upregulated on many cancers. MDA-MB-231 BCa cells cultured on plain plates showed high expression of CD44, with nearly all cells expressing the marker (Figure 5). The level of CD87 expressed by these cells was lower, ≈75%, with ≈60% of cells being positive for both markers. When MDA-MB-231 cells were plated on VN coated plates CD44 levels remained above 90%, but CD87 expression was greatly increased, to 90.7% of cells. BCa cells cultured on VN coated plates treated with DVBA-01-Dox displayed decreased expression of both markers compared to cells coated on VN plates. When cells on uncoated plates were treated with DVBA-01-Dox, the relative amount of CD44 + cells remained unchanged; however CD87 expression was reduced by ≈15 percentage points to 57.1%. The amount of double positive cells decreased to 47.1%.

Tissue Binding:

In order to ascertain if VBA-01 could bind to VN in a tumor environment we obtained patient BC tumor samples from the Wake Forest tissue tumor bank. These tumors were sectioned and probed with either ANTI-VN antibody or VBA-01 with a biotinylated 3’ terminus. ANTI-VN was detected by using an anti-mouse secondary linked to HRP, while VBA-01 was detected with an anti-biotin linked HRP antibody.

IHC showed specific binding of both ANTI-VN and VBA-01, however they appear to stain different sections of the tumor (Figure 6). ANTI-VN exclusively binds to extra cellular matrix, where VN can become multimerized and incorporated. ANTI-VN also appears to stain the vessel wall heavily. Additionally, the ANTI-VN antibody failed to bind tumor cells which are directly binding the VN monomer. VBA-01 does not bind the

ECM, but appears to bind directly to the tumor cells, suggesting that VBA-01 may be

119

specific for monomeric VN over the multimeric ECM incorporated isoform of the protein. This binding was confirmed with Fluorescence microscopy where VBA-01 binding was visualized using a streptavidin-Texas Red conjugate. Fluorescence shows that the aptamer binds directly to tumor cells, with much lower binding to ECM. This high specificity for tumor cells bound VN over ECM incorporated VN may play an important role in differentiating between normal VN incorporation, and tumors which bind high levels of the blood protein.

IV.4 Discussion:

Breast Cancer kills over 40,000 women each year necessitating the search for new treatments. VN is a blood protein secreted by the liver and has been shown to have BC promoting activity, as well as having increase expression during BC progression and being present at high levels in BC tissue relative to healthy tissue. These properties make

VN a promising target as a drug development target. VN can be used for two purposes with respect to BC treatment. First, because it is primarily a blood protein with concentration in the low mg/L range, it can be used as both a measure of disease progression as well as a carrier protein for delivery26,37. Albumin, the most abundant blood protein, has been used as a drug carrier molecule to favorably alter pharmacokinetic properties of a variety of dugs38. We hypothesize that VN may also act as a blood carrier protein similar to albumin, however this is not explored in the current work. The second use of VN in BC treatment is as a drug targeting agent. Because VN is upregulated in BC, and appears to accumulate in malignant breast tissue it can be used as

120

a molecular target for the disease26. With this in mind we have developed an aptamer specific to VN, VBA-01, using a novel method of SELEX which utilizes CE and NGS to rapidly select the aptamer in far fewer round than has been possible in the past.

In our aptamer selection protocol we aimed to select an aptamer which had high specificity for VN over FN. In order to accomplish this our first selection was a negative selection against FN. Only aptamers that did not bind to FN were collected for further selection. Although the majority of the aptamer library did not bind, this should remove the aptamers with the highest affinity for FN from future rounds of SELEX. The collected fraction of aptamers was immediately mixed with VN and selected using CE, where only binding aptamers were collected. In order to further expedite the SELEX process a phosphorylated primer was used which could be removed enzymatically after each round of PCR, removing the necessity for column binding and denaturation used to collect ssDNA in other selection protocols. We performed a total of 3 positive selections bookended by negative selections. Another advantage of using CE for selection is that the affinity of the library can be monitored during selection. This method of SELEX resulted in reducing the Kd of the library by 30x after a single round of SELEX (Figure 1a and

1b). Each successive round decreased the affinity 2x, which suggests that the majority of poor binding sequences are removed early in the SELEX process (Figure 1C). However, the DNA:VN ratio remained unchanged throughout the selection, and reducing this ratio may have favored stronger binders, increasing the affinity of future rounds further.

Once we completed our rounds of selection dsDNA was produced from the aptamer library and was sequenced by Nanomedica using NGS. The data obtained by NGS showed that there were only a few sequences that were expressed as a significant

121

percentage of the sequences. We hypothesize that additional rounds of selection may be useful in amplifying some of the less common sequences that are tight binders, but each round of PCR introduces bias. Some sequences may be expressed at high levels despite relatively low affinity to the target. This can occur when many rounds of PCR are preformed, effectively selecting for sequences which are more amenable to PCR than others which may bind more tightly, but PCR at a lower rate35,39,40. Regardless, we selected the 7 most populous sequences for further analysis (Supp S1). CE revealed that sequence 1 (S1, Figure 1d), the most populous sequence, had the highest binding affinity of the select sequences, around 400nM. While this is lower than the final library Kd of about 200nM, it is still appropriate for specific binding. However, this result suggests that many of the less populous sequences had higher affinity than the more populous sequences, indicating that additional rounds of PCR may have resulted in an aptamer with a lower Kd. In order to identify if there were sequences similar to S1 we broke the random region of the aptamer into 8bp reads and identified any aptamer sequence which possessed those reads anywhere in their sequence. This resulted in ≈1500 sequences.

CLUSTAL OMEGA was used to then group the 1500 aptamer candidates into 8 families and chose 1 sequence from each family, and an additional from each of the largest and most variable family (Supp 1). Binding analysis of these sequences revealed that sequence 5a had the highest affinity, ≈200nM, which was similar to the library affinity immediately before NGS sequencing (Figure 1c). This further supports that some of the less populous sequences were strong binders. For future studies we suggest at least 3 rounds of SELEX at the initial selection conditions, with additional rounds of a more stringent selection in order to amplify stronger binders more successfully. To form our

122

final aptamer, VBA-01, we trimmed the aptamer from both termini, removing 20 bases of the aptamer which increased the Kd to 400nM (Figure 1c). This reduction in affinity is not entirely unexpected, and suggests that the ends of the aptamer may have been playing some role in stabilizing the binding conformation.

After finalizing VBA-01 we assembled the dimeric DVBA-01, and doxorubicin modified dimer, DVBA-01-Dox, by synthesizing the aptamers with either poly dT or poly dA tails which when mixed, result in a AT base pair bridge linking each aptamer as we have described previously (Figure 2)34. Dimers were made in part because we hypothesized that a multivalent aptamer would have a higher affinity for VN than a monomer, as it could bind two VN molecules simultaneously, and if one was released the second would remain bound increasing the apparent affinity. However, upon examination of the Kd using CE we found that the affinity was relatively unchanged versus the monomer, and was actually slightly reduced, from ≈400nm for the monomer to ≈500nm for the dimer.

We believe that this demonstrates that our dimer is unable to bind multiple VN molecules simultaneously despite possessing two binding aptamers. One possible reason for this is that once the dimer binds a single VN molecule the second aptamer is obscured from binding. This could occur if our dAdT base pair bridge is not sufficiently long enough to allow for room for multiple VN molecules.

We assessed DVBA-01-Dox for its drug binding capacity and found that DVBA-01-Dox was capable of binding at least 7 equivalents of drug. Because this was the ratio used in our reactions we believe that the aptamer incorporated all of the dox that was available.

The characteristic absorbance of dox apparent in the 500-600nm range, and can be used to quantify the amount of dox loaded into the aptamer as we have previously described34

123

(Figure 3a). While more Dox could theoretically be loaded into the aptamer, the drug can have an effect on the shape of the aptamer and possibly reduce it affinity for VN further.

We found that dox incorporation stabilized DVBA-01 against temperature dependent melting (Figure 3b), indicating that dox was having a structural effect on the aptamer.

When DVBA-01 and DVBA-01-Dox were assessed for binding affinity to VN we discovered that the affinity of DVBA-01-Dox was greatly increased over unmodified

DVBA-01 (Figure 3b). It is possible that dox stabilizes the aptamer in a binding conformation, increasing the affinity of the complex for VN.

After establishing that VBA-01 and its variants could bind to VN in solution via CE we sought to establish that we could use the aptamer complex DVBA-01-Dox to deliver drugs to cancer cells in a VN dependent manner. Because VN is not produced by BC cells but is produced and released by the liver and bound by BC cells, we used protein coated plates to simulate what may happen in vivo where BC cells bind to and accumulate VN26. When plates were coated with 10μg/mL of VN, FN, or uncoated, plated with cells, and then treated for 3 hours with DVBA-01-Dox we observed increased cytotoxicity against MDA-MB-231 cells plated on VN plates when compared to FN or uncoated plates (Figure 4a). This increased cytotoxicity was quantified using calcusyn, and revealed a 35% increase in activity against cells coated on VN (Figure 4b). We hypothesize that BC cells plated with VN receive a higher dose of Dox than other cells because the aptamer binds to the VN on the plate and stays with the cells even after they are washed, increasing the effective dose those cells are exposed to. This effect is especially apparent when cells are treated near the IC50 value of 2μM (Figure 4c).

However, we believed that during the 3 hour incubation cells were taking up the drug

124

complex due to non-specific mechanisms such as endocytosis. In order to test this we coated plates in either VN, FN, collagen, or left them uncoated. These plates were then treated with DVBA-01-Dox, washed, and then plated with cells. When the assay is performed in this manner cells will only be exposed to drug if the complex is binding to the protein. This assay shows that VN coated plates have much more cytotoxic activity than FN, Col, or uncoated plates, consistent with DVBA-01-Dox binding to VN preferentially over the other substrates (Figure 4d). We believe that these data show the feasibility of using the DVBA-01-Dox aptamer to deliver drug to BC cells in a VN rich environment, and lay the foundation for future in vivo experiments, where VN blood binding may also increase the specificity of the complex.

Because VN and its interaction with uPAR is associated with increased metastatic potential in BC we wanted to investigate the effects VN had on UPAR and CD44, a gene which regulates cell-cell interactions, migration, and differeintiation24,28,41. CD44 is also implicated in BC metastasis, and is associated with a stem-like cancer cell phenotype, making it a relevant biomarker to investigate in relation to VN and BC42,43,44. We seeded

MDA-MB-231 cells on either uncoated plates or VN coated plates. Cells were then treated with DVBA-01-Dox and assessed for expression changes in uPAR and CD44.

When BC cells were grown on untreated plates they displayed near uniform (+90%) of

CD44, and high levels of uPAR expression as well (≈75%) (Figure 5a, 5e). When these cells were exposed to DVBA-01-Dox the proportion of cells expressing uPAR decreased compared to controls (Figure 5b, 5e). This likely occurred because cells were cultured in media contain serum, which VN is a component of. We hypothesize that DVBA-01-Dox bound to VN in the sera, which was then taken up by uPAR expressing cells and resulted

125

in their death. Cells that were grown on VN plates had slightly increased expression of

CD44, but UPAR expression increased to 90% of cells (Figure 5c, 5e). It is possible that there is a yet undefined feed forward mechanism that exists between uPAR and VN binding which results in BC cells becoming more metastatic, this is supported by the double positive population increasing from ≈50% to ≈90% of cells. When cells grown on

VN were exposed to DVBA-01-Dox there was a marked decrease in both uPAR and

CD44 expressing cells (Figure 5d, 5e). The decrease in uPAR expressing cells is expected, as higher uPAR expression should correlate with higher VN binding, and therefore drug uptake. Interestingly, CD44 expression is decreased by a similar amount, which was not observed in DVBA-01-Dox treated cells that were not grown on VN. This may indicate that cells which are actively binding VN, and therefore more metastatic, may be more susceptible to DVBA-01-Dox than cells not being stimulated by the protein.

It also demonstrates that there is a likely link between VN, uPAR, and CD44, indicating that VN exposure likely makes BC cells more “stem-like”, in agreement with previous reports of VN levels linked to disease progression. Dox is a topoisomerase II poison which results in DNA machinery failure in replicating cells. Both uPAR and CD44 are known markers of cancer cell migration, replication, and metastasis, and that by targeting cells that are undergoing this process DVBA-01-Dox is killing BC cells that are most likely to become metastatic.

Once we established the effects of VBA-01 and its derivatives in vitro we sought to confirm that VBA-01 could detect VN in BC tissue samples from DCIS patients. Sections of fresh tumor samples were stained with either VBA-01 or a VN specific antibody and assessed for binding. VBA-01 used for these experiments was synthesized with a biotin

126

label, which was detected by an anti-biotin secondary antibody. Comparing the antibody and aptamer stained sections major differences become apparent immediately. Antibody stained sections display heavy staining of the ECM and almost no staining of cellular bodies (Figure 6). It is known that VN can become multimerized and incorporated into the ECM of surrounding BC cells. However, aptamer stained sections show almost exclusive cellular staining (Figure 6). We also synthesized VBA-01 with a fluorescent tag, which does not require a secondary antibody for detection, which confirmed the binding pattern described above. We believe that this results from VBA-01 binding to monomeric VN molecules which are bound to a VN receptor molecule, possibly uPAR or

αV-β3. When VN multimerizes the confirmation of the protein is altered, resulting in altered antibody affinity and cellular function45,46. Because our selection protocol utilized monomeric VN, the form of the protein most prominent in circulation but not in the

ECM, we likely identified an aptamer that recognizes an epitope that becomes obscured once the protein is mulitmerized. We believe that this will be an advantage in an iv vivo scenario, where multimerized VN is present in ECM throughout the body, especially in the vasculature where it plays a role in heparin binding47. An aptamer which recognizes multimeric VN could find itself bound to vasculature well before it can locate to the tumor site, whereas an aptamer against the monomer would be able to use the VN to locate to BC cells which are binding the protein in large quantities.

We have described for the first time the selection of a novel aptamer using a combined

CE and NGS SELEX process. This allowed us to select an aptamer with mid to low nanomolar affinity in only 3 rounds of SELEX, which traditionally has taken a dozen or more rounds. NGS allowed us to refine our aptamer rationally and eliminated the need

127

for tedious cloning and sequencing as well. We believe that CENGS SELEX has the potential to decrease the time required to identify aptamers against protein targets and should become a preferred method with which to identify new aptamers. Once we identified our VN specific aptamer, VBA-01, we formed a dimer and covalently modified it with doxorubicin for drug delivery. This also increased the affinity of the aptamer for its target significantly, and resulted in VN dependent cell killing. VN is a developing molecular target for BC, in the form as both a biomarker which can be used for diagnosis or as a target for therapy, and the VN specific aptamer VBA-01 further advances this field of study.

Figure 1: A) Electropherogram of the starting library against VN. B) Electropherogram of the aptamer library after a single round of positive SELEX. C) Affinity of various aptamer libraries and individual aptamer candidates. D) Structure of VBA-01 as predicted by MFOLD

128

Figure 2: Structure of DVBA-01, with possible dox binding sites highlighted in red

Figure 3: A) Physical characteristics of VBA-01 and its derivatives. B) UV-VIS spectrum of DVBA-01-dox, with the 400-600nm range inset to show dox absorbance.

129

Figure 4: A) Dose effect curve of DVBA-01-Dox effect on MDA-MB-231 cells seeded on coated plates and then treated with drug. B) IC50 values of the drugs based on treatment after seeding determined by Calcusyn. C) Cytotoxicity data of cells treated with

2μM DVBA-01-Dox showing the difference resulting from plate coating. D) Cytotoxicity data from plates that were treated with DVBA-01-Dox, washed, and then seeded with cells.

130

Figure 5: A-D) Flow cytometry results of cells plated on uncoated, untreated MDA-MB-

231 cells. B) Flow cytometry results of cells plated on VN coated, untreated MDA-MB-

231 cells. C) Flow cytometry results of cells plated on uncoated, DVBA-01-Dox treated

MDA-MB-231 cells. D) Flow cytometry results of cells plated on VN coated, DVBA-01-

Dox treated MDA-MB-231 cells. E) Quantification of flow cytometry expression results.

131

Figure 6: Histological examination of patient DCIS tissue stained with either antibody against VN, VBA-01 modified with biotin, or VBA-01 modified with a dye.

Supplementary Figure 1: Sequences of the various aptamers identified via NGS and tested for affinity with CE

132

Supplementary Figure 2: Phylogeny of the ≈1500 sequences related to S1, compiled by

CLUSTAL OMEGA

References:

1. Howlader N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF, Kosary

CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ,

Cronin KA (eds). SEER Cancer Statistics Review, 1975-2012, National Cancer

Institute. Bethesda, MD, http://seer.cancer.gov/csr/1975_2012/, based on

November 2014 SEER data submission, posted to the SEER web site, April 2015.

2. Baselga, J (2001). Clinical trials of Herceptin® (trastuzumab). European Journal

of Cancer 37, Supplement 1: 18–24.

133

3. Emi, Y, Kitamura, K, Shikada, Y, Kakeji, Y, Takahashi, I and Tsutsui, S (2002).

Metastatic breast cancer with HER2/neu-positive cells tends to have a morbid

prognosis. Surgery 131: S217–221.

4. Pace LE and Keating NL (2014). A systematic assessment of benefits and risks

to guide breast cancer screening decisions. JAMA 311: 1327–1335.

5. Tupper, R and Holm, K (2014). Screening Mammography and Breast Cancer

Reduction: Examining the Evidence. The Journal for Nurse Practitioners 10:

721–728.

6. Berrington de González, A and Reeves, G (2005). Mammographic screening

before age 50 years in the UK: comparison of the radiation risks with the

mortality benefits. Br. J. Cancer 93: 590–596.

7. Yaffe, MJ and Mainprize, JG (2011). Risk of radiation-induced breast cancer

from mammographic screening. Radiology 258: 98–105.

8. Cristofanilli, M, Hayes, DF, Budd, GT, Ellis, MJ, Stopeck, A, Reuben, JM, et al.

(2005). Circulating tumor cells: a novel prognostic factor for newly diagnosed

metastatic breast cancer. J. Clin. Oncol. 23: 1420–1430.

9. Dawson, S-J, Tsui, DWY, Murtaza, M, Biggs, H, Rueda, OM, Chin, S-F, et al.

(2013). Analysis of Circulating Tumor DNA to Monitor Metastatic Breast

Cancer. New England Journal of Medicine 368: 1199–1209.

10. Keshaviah, A, Dellapasqua, S, Rotmensz, N, Lindtner, J, Crivellari, D, Collins, J,

et al. (2007). CA15-3 and alkaline phosphatase as predictors for breast cancer

recurrence: a combined analysis of seven International Breast Cancer Study

Group trials. Ann Oncol 18: 701–708.

134

11. Mook, S, Knauer, M, Bueno-de-Mesquita, JM, Retel, VP, Wesseling, J, Linn,

SC, et al. (2010). Metastatic Potential of T1 Breast Cancer can be Predicted by

the 70-gene MammaPrint Signature. Ann Surg Oncol 17: 1406–1413.

12. Cuk, K, Zucknick, M, Heil, J, Madhavan, D, Schott, S, Turchinovich, A, et al.

(2013). Circulating microRNAs in plasma as early detection markers for breast

cancer. Int. J. Cancer 132: 1602–1612.

13. Seiffert, D, Crain, K, Wagner, NV and Loskutoff, DJ (1994). Vitronectin gene

expression in vivo. Evidence for extrahepatic synthesis and acute phase

regulation. J. Biol. Chem. 269: 19836–19842.

14. Zhuang, P, Chen, AI and Peterson, CB (1997). Native and multimeric vitronectin

exhibit similar affinity for heparin. Differences in heparin binding properties

induced upon denaturation are due to self-association into a multivalent form. J.

Biol. Chem. 272: 6858–6867.

15. Wilkins-Port, CE and McKeown-Longo, PJ (1998). Degradation of distinct

forms of multimeric vitronectin by human fibroblasts. Biochimica et Biophysica

Acta (BBA) - Molecular Cell Research 1404: 353–366.

16. Podor, TJ, Campbell, S, Chindemi, P, Foulon, DM, Farrell, DH, Walton, PD, et

al. (2002). Incorporation of vitronectin into fibrin clots. Evidence for a binding

interaction between vitronectin and gamma A/gamma’ fibrinogen. J. Biol. Chem.

277: 7520–7528.

17. Wilder, RL (2002). Integrin alpha V beta 3 as a target for treatment of

rheumatoid arthritis and related rheumatic diseases. Ann. Rheum. Dis. 61 Suppl

2: ii96–99.

135

18. Kumar, CC (2003). Integrin alpha v beta 3 as a therapeutic target for blocking

tumor-induced angiogenesis. Curr Drug Targets 4: 123–131.

19. R P Casaroli Marano, SV (1994). The role of fibronectin, laminin, vitronectin

and their receptors on cellular adhesion in proliferative vitreoretinopathy. Invest.

Investigative ophthalmology & visual science 35: 2791–803.

20. Wei, Y, Waltz, DA, Rao, N, Drummond, RJ, Rosenberg, S and Chapman, HA

(1994). Identification of the urokinase receptor as an adhesion receptor for

vitronectin. J. Biol. Chem. 269: 32380–32388.

21. Noh, H, Hong, S and Huang, S (2013). Role of urokinase receptor in tumor

progression and development. Theranostics 3: 487–495.

22. Jo, M, Takimoto, S, Montel, V and Gonias, SL (2009). The Urokinase Receptor

Promotes Cancer Metastasis Independently of Urokinase-Type Plasminogen

Activator in Mice. Am J Pathol 175: 190–200.

23. Madsen, CD, Ferraris, GMS, Andolfo, A, Cunningham, O and Sidenius, N

(2007). uPAR-induced cell adhesion and migration: vitronectin provides the key.

J Cell Biol 177: 927–939.

24. Pirazzoli, V, Ferraris, GMS and Sidenius, N (2013). Direct evidence of the

importance of vitronectin and its interaction with the urokinase receptor in tumor

growth. Blood 121: 2316–2323.

25. Kotzsch, M, Luther, T, Harbeck, N, Ockert, D, Lutz, V, Noack, F, et al. (2000).

New ELISA for quantitation of human urokinase receptor (CD87) in cancer. Int.

J. Oncol. 17: 827–834.

136

26. Kadowaki, M, Sangai, T, Nagashima, T, Sakakibara, M, Yoshitomi, H, Takano,

S, et al. (2011). Identification of vitronectin as a novel serum marker for early

breast cancer detection using a new proteomic approach. J. Cancer Res. Clin.

Oncol. 137: 1105–1115.

27. Aaboe, M, Offersen, BV, Christensen, A and Andreasen, PA (2003). Vitronectin

in human breast carcinomas. Biochimica et Biophysica Acta (BBA) - Molecular

Basis of Disease 1638: 72–82.

28. Hurt, EM, Chan, K, Serrat, MAD, Thomas, SB, Veenstra, TD and Farrar, WL

(2010). Identification of Vitronectin as an Extrinsic Inducer of Cancer Stem Cell

Differentiation and Tumor Formation. Stem Cells 28: 390–398.

29. Tuerk, C and Gold, L (1990). Systematic evolution of ligands by exponential

enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:

505–510.

30. McKeague, M, DeRosa, MC, McKeague, M and DeRosa, MC (2012).

Challenges and Opportunities for Small Molecule Aptamer Development,

Challenges and Opportunities for Small Molecule Aptamer Development.

Journal of Nucleic Acids, Journal of Nucleic Acids 2012, 2012: e748913.

31. Wrzesinski, J and Ciesiolka, J (2005). Characterization of Structure and Metal

Ions Specificity of Co2+-Binding RNA Aptamers. Biochemistry 44: 6257–6268.

32. Foy, JW-D, Rittenhouse, K, Modi, M and Patel, M (2007). Local tolerance and

systemic safety of pegaptanib sodium in the dog and rabbit. J Ocul Pharmacol

Ther 23: 452–466.

137

33. Ng, EWM, Shima, DT, Calias, P, Cunningham, ET, Guyer, DR and Adamis, AP

(2006). Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease.

Nat Rev Drug Discov 5: 123–132.

34. Boyacioglu, O, Stuart, CH, Kulik, G and Gmeiner, WH (2013). Dimeric DNA

Aptamer Complexes for High-capacity–targeted Drug Delivery Using pH-

sensitive Covalent Linkages. Mol Ther Nucleic Acids 2: e107.

35. Schütze, T, Wilhelm, B, Greiner, N, Braun, H, Peter, F, Mörl, M, et al. (2011).

Probing the SELEX Process with Next-Generation Sequencing. PLOS ONE 6:

e29604.

36. Riley, KR, Gagliano, J, Xiao, J, Libby, K, Saito, S, Yu, G, et al. (2015).

Combining capillary electrophoresis and next-generation sequencing for aptamer

selection. Anal Bioanal Chem 407: 1527–1532.

37. Boyd, NA, Bradwell, AR and Thompson, RA (1993). Quantitation of vitronectin

in serum: evaluation of its usefulness in routine clinical practice. J Clin Pathol

46: 1042–1045.

38. Kratz, F (2008). Albumin as a drug carrier: Design of prodrugs, drug conjugates

and nanoparticles. Journal of Controlled Release 132: 171–183.

39. Tolle, F, Wilke, J, Wengel, J and Mayer, G (2014). By-Product Formation in

Repetitive PCR Amplification of DNA Libraries during SELEX. PLoS One 9.

40. Thiel, WH, Bair, T, Thiel, KW, Dassie, JP, Rockey, WM, Howell, CA, et al.

(2011). Nucleotide Bias Observed with a Short SELEX RNA Aptamer Library.

Nucleic Acid Ther 21: 253–263.

138

41. Ponta, H, Sherman, L and Herrlich, PA (2003). CD44: From adhesion molecules

to signalling regulators. Nat Rev Mol Cell Biol 4: 33–45.

42. Hiraga, T, Ito, S and Nakamura, H (2013). Cancer Stem–like Cell Marker CD44

Promotes Bone Metastases by Enhancing Tumorigenicity, Cell Motility, and

Hyaluronan Production. Cancer Res 73: 4112–4122.

43. Naor, D, Nedvetzki, S, Golan, I, Melnik, L and Faitelson, Y (2002). CD44 in

cancer. Crit Rev Clin Lab Sci 39: 527–579.

44. Sahlberg, SH, Spiegelberg, D, Glimelius, B, Stenerlöw, B and Nestor, M (2014).

Evaluation of cancer stem cell markers CD133, CD44, CD24: association with

AKT isoforms and radiation resistance in colon cancer cells. PLoS ONE 9:

e94621.

45. Wilkins-Port, CE and McKeown-Longo, PJ (1998). Degradation of distinct

forms of multimeric vitronectin by human fibroblasts. Biochimica et Biophysica

Acta (BBA) - Molecular Cell Research 1404: 353–366.

46. Stockmann, A, Hess, S, Declerck, P, Timpl, R and Preissner, KT (1993).

Multimeric vitronectin. Identification and characterization of conformation-

dependent self-association of the adhesive protein. J. Biol. Chem. 268: 22874–

22882.

47. Völker, W, Hess, S, Vischer, P and Preissner, KT (1993). Binding and

processing of multimeric vitronectin by vascular endothelial cells. J. Histochem.

Cytochem. 41: 1823–1832.

139

Chapter V

Discussion and Future Directions

V.1 Aptamers as Therapeutics

Aptamers are a relatively new tool available to researchers, the methods to design them only being described in the mid 1990’s1. Despite the short time these molecules have been researched, the first aptamer therapeutic was approved by the FDA for the treatment of macular degeneration2. There are also a number of aptamers in clinical trials for diseases including diabetes, coronary artery disease, and cancer, exemplifying the utility and diversity of these molecules3,4,5. Aptamers primarily act as antagonistic molecules when used in a therapeutic manner, similar to many therapeutic antibodies including adalimumab and trastuzumab. The aptamer binds to a target protein and blocks the target from eliciting its action in the cell. However, because aptamers are rationally designed and a variety of potential candidates can arise from a single selection, aptamers can be designed with additional functionalities. A few examples which will be discussed include aptamer pairs, aptamers which act as agonists, and also aptamers which can direct their effects by combining two different aptamers into a single compound.

The RB006 aptamer is unique among therapeutic aptamers in that it also has an antidote aptamer, RB007, which can reverse the drug action of RB0065,6. RB006 acts by blocking factor XIa, which results in reduced clotting. However, if a patient were to become injured while on the drug reduced clotting would result in excessive blood loss, a problem inherent to many drugs used to treat heart disease patients. RB007 was

140

developed as an aptamer against RB006 which would bind to RB006 and prevent it from exerting its anti-clotting effects by competing with Factor XIa. Forming an “anti- aptamer” is a unique approach to making the drug effect reversible, and has not yet been demonstrated with antibody therapeutics.

Aptamers can also act as agonists once they bind their target, inducing a response in the cell. Diabetes results when patients either fail to produce their own insulin or become insulin resistant. Once bound to the insulin receptor it results in a phosphorylation of the receptor which signals downstream through multiple pathways, and signals for GLUT-4 to translocate to the plasma membrane for glucose uptake7. Once patients stop producing insulin they are required to monitor their dietary intake and inject insulin before or after every meal. However, like most protein based therapeutics, insulin has a limited shelf- life. The IR-A48 aptamer demonstrates the specificity of aptamers by binding to the insulin receptor and not the related insulin growth factor receptor. Intriguingly, IR-A48 binds to a site that is not bound by insulin but still results in the phosphorylation of a site that results in GLUT-4 translocation and glucose uptake, while not activating the MAPK pathway that can be activated with insulin8.

Recent research has shown that stimulation and repression of the immune system plays a key role in cancer development and also in curing the disease9. Specifically, the 4-1BB aptamer was selected against Cytotoxic T-lymphocyte-Associated Protein 4 (CTLA-4)10, a protein that plays a major role in T-cell activation. CTLA-4 is expressed by T-Helper cells and acts as an inhibitory signal for T-Effector cells11. The goal being that 4-1BB would bind to and prevent T-cell regulation in the tumor environment. This strategy has been explored using antibodies, but the use of aptamers allows for additional targeting to

141

be incorporated into the molecule12. Wide spread deregulation of the immune system can result in a plethora of autoimmune issues, indicating that targeted blockade of CTLA-4 is preferable. This can be achieved with the use of multifunctional apatamers10. In this scheme, two aptamers that target different targets are linked together through a variety of means, although using base pair bridging is common as has been described in this dissertation, there are a variety of ways to link aptamers together including polyethylene glycol13,14. In the case of the 4-1BB aptamer, the CTLA-4 aptamer was bound to a prostate specific membrane antigen (PSMA) specific aptamer, A10. Aptamers were appended to each other using complimentary sequences added to the end of each aptamer.

The resulting hybrid aptamer was shown to localize to PSMA expressing tumors and block CTLA-4 signaling specifically in the tumor region, which had not been accomplished with antibodies previously.

The use of aptamers as therapeutics is a common application for these versatile molecules, and there are a variety of other ways that aptamers can be used to this purpose. While many aptamers have a therapeutic endpoint there are also other uses for aptamers, such as in biosensors. Beyond directly eliciting an effect by binding their target aptamers can also be used as targeting agents, as enzymes, as immune activating agents, and a myriad of other uses.

V.2 Aptamer Complexes and Multifunctional Aptamers

Because aptamers a synthetically produced they can be modified in a variety of ways, which allows for these molecules to be used in a variety of applications that would be

142

difficult for antibody or protein based molecules to accomplish. One of the easiest and most reliable ways to modify an aptamer is to add a short sequence onto the termini of the aptamer which can be used to anneal a complementary strand, resulting in a link between the aptamer and the commentary DNA or RNA. The ability to easily link multiple aptamers together in this way has been explored using different as well as identical aptamers, with each having its benefits. Bi or multifunctional aptamers have the ability to localize to a specific location, where a second aptamer can then bind to a target to elicit its effect, as previously mentioned. Aptamers can also be linked to additional identical aptamers to increase the Kd of the complex to the target, similar to an IgM antibody15. However, using complementary sequences to link multiple aptamers together is not the most prevalent use of base pair binding for aptamers.

Perhaps the most popular use of base pair binding is to use aptamers as a delivery vehicle for siRNA and other gene expression control systems. In these systems the aptamer has a sequence introduced at one of the termini of the aptamer complementary to the siRNA.

The synthetic siRNA is then incubated with the aptamer and base pairs with it. However siRNA does not need to be linked to the aptamer in this way, and other methods have been demonstrated as well16. Delivery in this way results in the siRNA only being delivered to targeted cells, reducing the accidental knockdown of genes in bystander cells. The PSMA specific A9 aptamer was linked to siRNA against lamnin, via a strepavidin/biotin linkage16. Doing so resulted in the knock down of regulation of laminin in as little as 30 minutes and was as effective as using lipofectamine. The aptamer delivered siRNA was also capable of specifically knocking down expression in PSMA expressing cells, and resulted in no knockdown in PSMA negative cells. Aptamer

143

mediated gene expression is being explored in by many researchers as a new therapy for cancer pateints17. One group has shown that by linking an shRNA against SMG1, a nonsense mRNA degradation enzyme, to an aptamer against PSMA resulted in reduced tumor growth in a xenograph mouse model18. Preventing nonsense mRNA degradation leads to the expression of antigen like sequences on targeted cancer cells resulting in immune recognition of the malignancy. This effect was further boosted by the use of the immune activating aptamer 4-1BBB aptamer dimer. Additionally, aptamer-siRNA complexes can increase the sensitivity of cancer cells to ionizing radiation by blocking

DNA repair enzyme synthesis19. An siRNA against DNA-dependent protein kinase,

DNAPK, an enzyme responsible for non-homologous end joining DNA repair, resulted in greatly enhanced sensitivity in vitro and in vivo against PSMA expressing cells. Other

DNA repair enzymes were also targeted in this manner and showed similar results.

Aptamers enable the selective knockdown of gene products that is unparalleled an enables the sensitization of malignant tissue while leaving healthy tissues unaffected. The ability to specifically knockdown the expression of genes only in cells that express a particular biomarker in vivo is has the potential to greatly increase the therapeutic index of current therapies.

Beyond siRNA, aptamers can be used to deliver a variety of molecules ranging from small molecule drugs, such as doxorubicin, all the way to nanoparticles which are orders of magnitude larger than the aptamers they are bound to. Nanoparticles inherently possess altered biodistribution because of their size, which limits the rate of extravasation and renal excretion, but using aptamers has been shown to increase nanoparticle localization to targeted areas in the body20,21,22. Many of the research projects in aptamer-

144

nanoparticle work is primarily focused on cancer treatment and detection, although biosensors are also a popular topic of research as well. A variety of nanoparticles have been linked to aptamers, including carbon nanotubes, gold nanoshells, liposomes, and even other DNA constructs23,24,25. DNA-nanoparticle complexes can have a myriad of activities due to the abundance of nanomaterials that can be delivered via aptamers. Gold nanoparticles and carbon nanotubes are capable of absorbing near infrared irradiation and convert that into thermal energy, resulting in ablation of the tissue. This technique results in specific killing of the tissue where radiation was applied, however these particles can accumulate in other tissues as well and result in nonspecific toxicity. Targeting photothermal particles such as gold and carbon nanotubes results in high accumulation of the therapies in desired tissues, requiring lower doses of the particle, as well as less near

IR irradiation which can cause local site burning. Because aptamers can be denatured by thermal energy, they could be designed to either maintain their shape during the heating process, or to unfold and release additional therapeutic molecules.

In the work presented in this dissertation we have demonstrated that aptamers can be used to specifically deliver nanoparticles as well as doxorubicin, both of which had chemotherapeutic properties. Generally, research in the field has focused on delivering a single type molecule using a single aptamer. However, in clinical practice it is rare for a single drug to be the only therapy administered for chemotherapeutic use. Additionally, when cell types are described multiple cell markers are used to differentiate closely related cells from each other, as a single marker is inadequate to do so. Aptamer complexes have the ability to deliver multiple types of synergistic therapy to a specific cell type using multiple low affinity aptamers. In this system multiple biomarkers would

145

be chosen from those expressed on the cancer of interest. In the example of prostate cancer, PSMA, Prostate Stem Cell Antigen, and the membrane bound fusion product

TMPRSS2-ERG, have been identified as possible therapeutic targets and biomarkers of prostate cancer and could be used for this purpose26,27,28. Aptamers for these targets would be selected using CENGS SELEX with affinity in the mid-to-high nanomolar range. These aptamers would then be used together to target a single nanoparticle. This would result in very high affinity for cells that express all three markers due to the multivalent effect, an intermediate affinity for cells expressing two markers, and relatively low affinity for cells only expressing a single marker. By targeting therapy in this way cells that possess more malignant cells that express multiple biomarkers would be prioritized and receive a heavier dose of drug. The use of multiple aptamers with low affinity (MALA targeting) used in combination for highly specific targeting has not been researched and is a topic which should be investigated in the future.

The MALA targeting system would then be used to deliver a synergistic combination of drugs. The aptamers would be extended to include a complementary sequence for an siRNA against HSP90, which aids cells in responding to thermal stress and has been found to play a role in photothermal therapy resistance29. These aptamer-siRNA hybrids would then be attached to a gold nanoparticle using terminal thiols attached to the aptamer. This aptamer-siRNA-nanoparticle complex would localize to the tumor site, binding particularly tightly to highly malignant cells which express all of the selected biomarkers, and would be activated using near IR irradiation. This would result in thermal dissociation of the siRNA from the complex and would result in the knockdown of HSP90, sensitizing cells to thermal ablation. The thermal energy would also directly

146

damage the cells. Doxorubicin could also be incorporated into the aptamer-siRNA hybrid using chemistry described in this dissertation, and would be released as well, killing any malignant cells that are still capable of replicating after the thermal energy dissipates.

This MALA/siRNA/drug complex could be modified to target many different types of cells by changing the aptamers, sensitizing siRNA, and drug or nanoparticle delivered.

However, the use of MALA requires at least 3 unique aptamers with moderate affinity.

Aptamers can take months to develop and are usually selected for extremely high affinities, which would be inappropriate for MALA, as any cell which expressed any of the markers would bind tightly to the complex. This necessitates a SELEX process which could rapidly identify aptamers against targets, as well as partially control the affinity of the aptamers during the selection process. A new aptamer selection process would also benefit those interested in identifying traditional aptamers as well.

V.3 Improving Aptamer Selection

While antibody production time and costs are difficult to estimate precisely, custom monoclonal antibody development can take upwards of 6+ months to be completed and includes many steps. Antigen selection and production, which must have certain properties to illicit an immune response. Multiple injections of the antigen into an animal to stimulate antibody production. Isolation of monoclonal antibodies for testing. Fusion of antibody producing cells to form hybridomas. Selection of hybridomas that produce specific antibodies, and finally production and purification of the final product from cell culture. However, aptamer selection is not without its own set of limitations and the

147

selection of aptamers can also take months to develop. SELEX is ultimately an iterative process where selection, PCR and single strand DNA generation are repeated about a dozen times before the aptamer library is then transfected into bacteria via plasmids and clones are selected and individually sequenced. This time consuming process has been recognized as a limitation to aptamer adoption over a decade ago, and attempts were made to fully automate the selection steps of SELEX, however this method did not become commonly used, possibly due to the cost or because it failed to optimize the aptamer sequencing phase of SELEX30.

The time spent during the selection steps of SELEX can be reduced by using the RAPID process, which incorporates two selections between each PCR step31. The selection of aptamers can also be improved by removing terminal primer sequences from the random sequence of each aptamer prior to selection steps. This prevents primer sequences from effecting binding, which can be significant as primer sequences can make up as much as

50% of the aptamer length32. The selection of aptamers can even be done on magnetic beads which are then used for emulsion PCR, enabling an easy separation of strands for single strand generation33. Another method used to decrease the selection time of aptamers is the use of capillary electrophoresis, which as demonstrated in this dissertation can reduce the number of selection steps required to generate aptamers to a few as three positive selections, down from 10-20. Besides the time savings afforded by CE SELEX, reduced round of PCR are also beneficial as PCR bias can occur during SELEX, resulting in sequences which PCR at a greater rate becoming a larger portion of the library independent of their binding affinity34,35. Using capillary electrophoresis also allows researchers to monitor changes in the Kd of the aptamer library during each selection,

148

which is not reasonable with other SELEX techniques. Capillary electrophoresis even been used by others to select aptamers that bind to microbes including e. coli, demonstrating the cell SELEX may also be possible using this technique36. The use of CE to enhance SELEX is a new development and will likely continue to grow in popularity due to the benefits it brings over traditional selection methods.

Perhaps the technology that holds the most promise for improving the selection of aptamers is next generation sequencing (NGS). Originally developed for genomic analysis, NGS sequences every sequence in a pool of DNA simultaneously and can quantify how many copies of that sequence were present. This technology is making its way into use for SELEX as well, which allows researchers to sequence entire aptamer libraries without having to sequence individual bacterial clones. NGS has been used to follow the evolution of an aptamer library with each successive selection37. In this dissertation it is described how the data obtained from NGS can also be used to inform modifications to aptamers after they are selected. NGS is vital to developing methods of high throughput SELEX which can be used to identify multiple aptamers simultaneously38,39.

V.4 Conclusions

Aptamers are powerful tools which can be used for a variety of purposes. They serve many of the same functions as antibodies for research purposes, but they can be identified and produced in an entirely synthetic system. The chemistry that is used for synthetic

DNA synthesis is well established and can be manipulated in a variety of ways, enabling researchers to modify aptamers to achieve a myriad of goals. The enzymatic stability of

149

aptamers can be increased, they can be attached to a wide variety of molecules using thiol, amine, alkyne, or even base pair linkages. Unnatural DNA bases or sugars can be incorporated directly into the aptamer during synthesis to create inherently cytotoxic aptamers which can hone to disease sites due to the aptamer’s specificity.

This dissertation has covered in depth many of the ways that aptamers can be used to specifically deliver many types of payloads to their targets. In particular, the development of a novel, pH sensitive linkage between DNA and the chemotherapeutic doxorubicin is described. This novel linkage is used to deliver the drug via folate targeted hairpins and aptamers alike. The PSMA specific aptamer, SZTI01, is shown to deliver a zinc chelator via aptamer targeted liposomes. This results in specific killing of prostate cancer cells in vitro and in vivo via reactive oxygen species. It is likely this mechanisms acts through

Superoxide Dismutase I, although this was not directly proven in this dissertation and remains an avenue of future research. A novel method of SELEX was described which utilizes both capillary electrophoresis to reduce the number of selection steps necessary and next generation sequencing which eliminates the need for individual clonal sequencing of aptamers. This technique can be used to rapidly select aptamers at a pace that opens up new avenues for aptamer research. In the past single aptamers were selected for the highest possible affinity for a single target, in part due to the time investment needed to develop a single aptamer. While this would result in tight binding to malignant cells that over express the target healthy cells commonly express the same marker, resulting in off target delivery of the aptamer’s payload. In the future CENGS

SELEX can be used to quickly select for multiple aptamers which have a relatively low affinity for their respective targets. Combining these aptamers together using either a

150

nanoparticle or DNA base pairing would result in an aptamer complex which would have low affinity for a cell expressing any one of the markers of interest, but high affinity for a cell expressing all three targets due to the multivalent effect. Utilizing multiple aptamers with low affinity (MALA) targeting would allow more specific targeting of cells, as opposed to specific targeting of single markers.

This dissertation work has sought to expand the knowledge base of what is possible with aptamers, in particular with drug delivery and aptamer production. Although not discussed here at length, aptamers can be tailored to suit a variety of specific roles as defined by the researcher beyond delivery systems. They can be utilized as antibody replacements for molecular assays, biosensors, and even as catalytic molecules. The flexibility of aptamers is rare among molecules that are so accessibly produced. While the

SELEX method was first described in the early 1990’s aptamers are only in the past few years beginning to be realized for their potential, and with further developments making their production faster and more reliable the popularity of these versatile molecules should increase exponentially in the years and decades to come.

References:

1. Tuerk, C., and Gold, L. (1990). Systematic evolution of ligands by exponential

enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–

510.

2. Vinores, S.A. (2006). Pegaptanib in the treatment of wet, age-related macular

degeneration. Int J Nanomedicine 1, 263–268.

151

3. Ninichuk, V., Clauss, S., Kulkarni, O., Schmid, H., Segerer, S., Radomska, E.,

Eulberg, D., Buchner, K., Selve, N., Klussmann, S., et al. (2008). Late Onset of Ccl2

Blockade with the Spiegelmer mNOX-E36–3′PEG Prevents Glomerulosclerosis and

Improves Glomerular Filtration Rate in db/db Mice. Am J Pathol 172, 628–637.

4. Becker, R.C., and Chan, M.Y. (2009). REG-1, a regimen comprising RB-006, a

Factor IXa antagonist, and its oligonucleotide active control agent RB-007 for the

potential treatment of arterial thrombosis. Curr. Opin. Mol. Ther. 11, 707–715.

5. Mongelard, F., and Bouvet, P. (2010). AS-1411, a guanosine-rich oligonucleotide

aptamer targeting nucleolin for the potential treatment of cancer, including acute

myeloid leukemia. Curr. Opin. Mol. Ther. 12, 107–114.

6. Tanaka, K.A., Szlam, F., Rusconi, C.P., and Levy, J.H. (2009). In-vitro evaluation of

anti-factor IXa aptamer on thrombin generation, clotting time, and viscoelastometry.

Thromb. Haemost. 101, 827–833.

7. Leney, S.E., and Tavaré, J.M. (2009). The molecular basis of insulin-stimulated

glucose uptake: signalling, trafficking and potential drug targets. J Endocrinol 203, 1–

18.

8. Yunn, N.-O., Koh, A., Han, S., Lim, J.H., Park, S., Lee, J., Kim, E., Jang, S.K.,

Berggren, P.-O., and Ryu, S.H. (2015). Agonistic aptamer to the insulin receptor

leads to biased signaling and functional selectivity through allosteric modulation.

Nucl. Acids Res. gkv767.

9. Waldmann, T.A. (2006). Effective cancer therapy through immunomodulation. Annu.

Rev. Med. 57, 65–81.

152

10. Gilboa, E., McNamara, J., and Pastor, F. (2013). Use of oligonucleotide aptamer

ligands to modulate the function of immune receptors. Clin. Cancer Res. 19, 1054–

1062.

11. Krummel, M.F., and Allison, J.P. (1995). CD28 and CTLA-4 have opposing effects

on the response of T cells to stimulation. J. Exp. Med. 182, 459–465.

12. Weber, J. (2007). Review: Anti–CTLA-4 Antibody Ipilimumab: Case Studies of

Clinical Response and Immune-Related Adverse Events. The Oncologist 12, 864–

872.

13. Boyacioglu, O., Stuart, C.H., Kulik, G., and Gmeiner, W.H. (2013). Dimeric DNA

Aptamer Complexes for High-capacity–targeted Drug Delivery Using pH-sensitive

Covalent Linkages. Mol Ther Nucleic Acids 2, e107.

14. Mallikaratchy, P.R., Ruggiero, A., Gardner, J.R., Kuryavyi, V., Maguire, W.F.,

Heaney, M.L., McDevitt, M.R., Patel, D.J., and Scheinberg, D.A. (2011). A

multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and

leukemia. Nucleic Acids Res 39, 2458–2469.

15. Giusto, D.A.D., and King, G.C. (2004). Construction, Stability, and Activity of

Multivalent Circular Anticoagulant Aptamers. J. Biol. Chem. 279, 46483–46489.

16. Chu, T.C., Twu, K.Y., Ellington, A.D., and Levy, M. (2006). Aptamer mediated

siRNA delivery. Nucl. Acids Res. 34, e73–e73.

17. Vorhies, J.S., and Nemunaitis, J.J. (2007). Nucleic acid aptamers for targeting of

shRNA-based cancer therapeutics. Biologics 1, 367–376.

153

18. Pastor, F., Kolonias, D., Giangrande, P.H., and Gilboa, E. (2010). Induction of

tumour immunity by targeted inhibition of nonsense-mediated mRNA decay. Nature

465, 227–230.

19. Ni, X., Zhang, Y., Ribas, J., Chowdhury, W.H., Castanares, M., Zhang, Z., Laiho, M.,

DeWeese, T.L., and Lupold, S.E. (2011). Prostate-targeted radiosensitization via

aptamer-shRNA chimeras in human tumor xenografts. Journal of Clinical

Investigation 121, 2383–2390.

20. Yu, C., Hu, Y., Duan, J., Yuan, W., Wang, C., Xu, H., and Yang, X.-D. (2011). Novel

Aptamer-Nanoparticle Bioconjugates Enhances Delivery of Anticancer Drug to

MUC1-Positive Cancer Cells In Vitro. PLOS ONE 6, e24077.

21. Farokhzad, O.C., Cheng, J., Teply, B.A., Sherifi, I., Jon, S., Kantoff, P.W., Richie,

J.P., and Langer, R. (2006). Targeted nanoparticle-aptamer bioconjugates for cancer

chemotherapy in vivo. PNAS 103, 6315–6320.

22. Liang, C., Guo, B., Wu, H., Shao, N., Li, D., Liu, J., Dang, L., Wang, C., Li, H., Li,

S., et al. (2015). Aptamer-functionalized lipid nanoparticles targeting osteoblasts as a

novel RNA interference-based bone anabolic strategy. Nat Med 21, 288–294.

23. Yang, Y., Liu, J., Sun, X., Feng, L., Zhu, W., Liu, Z., and Chen, M. (2015). Near-

infrared light-activated cancer cell targeting and drug delivery with aptamer-modified

nanostructures. Nano Res. 9, 139–148.

24. Yang, L., Tseng, Y.-T., Suo, G., Chen, L., Yu, J., Chiu, W.-J., Huang, C.-C., and Lin,

C.-H. (2015). Photothermal therapeutic response of cancer cells to aptamer-gold

nanoparticle-hybridized graphene oxide under NIR illumination. ACS Appl Mater

Interfaces 7, 5097–5106.

154

25. Zhu, G., Zheng, J., Song, E., Donovan, M., Zhang, K., Liu, C., and Tan, W. (2013).

Self-assembled, aptamer-tethered DNA nanotrains for targeted transport of molecular

drugs in cancer theranostics. Proc Natl Acad Sci U S A 110, 7998–8003.

26. Madu, C.O., and Lu, Y. (2010). Novel diagnostic biomarkers for prostate cancer. J

Cancer 1, 150–177.

27. Sun, C., Dobi, A., Mohamed, A., Li, H., Thangapazham, R.L., Furusato, B.,

Shaheduzzaman, S., Tan, S.-H., Vaidyanathan, G., Whitman, E., et al. (2008).

TMPRSS2-ERG fusion, a common genomic alteration in prostate cancer activates C-

MYC and abrogates prostate epithelial differentiation. Oncogene 27, 5348–5353.

28. Ross, S., Spencer, S.D., Holcomb, I., Tan, C., Hongo, J., Devaux, B., Rangell, L.,

Keller, G.A., Schow, P., Steeves, R.M., et al. (2002). Prostate Stem Cell Antigen as

Therapy Target Tissue Expression and in Vivo Efficacy of an Immunoconjugate.

Cancer Res 62, 2546–2553.

29. Huang, H.-C., Yang, Y., Nanda, A., Koria, P., and Rege, K. (2011). Synergistic

administration of photothermal therapy and chemotherapy to cancer cells using

polypeptide-based degradable plasmonic matrices. Nanomedicine (Lond) 6, 459–473.

30. Eulberg, D., Buchner, K., Maasch, C., and Klussmann, S. (2005). Development of an

automated in vitro selection protocol to obtain RNA-based aptamers: identification of

a biostable substance P antagonist. Nucl. Acids Res. 33, e45–e45.

31. Szeto, K., Latulippe, D.R., Ozer, A., Pagano, J.M., White, B.S., Shalloway, D., Lis,

J.T., and Craighead, H.G. (2013). RAPID-SELEX for RNA Aptamers. PLOS ONE 8,

e82667.

155

32. Pan, W., Xin, P., Patrick, S., Dean, S., Keating, C., and Clawson, G. (2010). Primer-

free aptamer selection using a random DNA library. J Vis Exp.

33. Hünniger, T., Wessels, H., Fischer, C., Paschke-Kratzin, A., and Fischer, M. (2014).

Just in Time-Selection: A Rapid Semiautomated SELEX of DNA Aptamers Using

Magnetic Separation and BEAMing. Anal. Chem. 86, 10940–10947.

34. Tolle, F., Wilke, J., Wengel, J., and Mayer, G. (2014). By-Product Formation in

Repetitive PCR Amplification of DNA Libraries during SELEX. PLOS ONE 9,

e114693.

35. Meyers, L.A., Lee, J.F., Cowperthwaite, M., and Ellington, A.D. (2004). The

robustness of naturally and artificially selected nucleic acid secondary structures. J.

Mol. Evol. 58, 681–691.

36. Saito, S., Hirose, K., Tsuchida, M., Wakui, K., Yoshimoto, K., Nishiyama, Y., and

Shibukawa, M. (2016). Rapid acquisition of high-affinity DNA aptamer motifs

recognizing microbial cell surfaces using polymer-enhanced capillary transient

isotachophoresis. Chem. Commun. 52, 461–464.

37. Schütze, T., Wilhelm, B., Greiner, N., Braun, H., Peter, F., Mörl, M., Erdmann, V.A.,

Lehrach, H., Konthur, Z., Menger, M., et al. (2011). Probing the SELEX Process with

Next-Generation Sequencing. PLOS ONE 6, e29604.

38. Cho, M., Soo Oh, S., Nie, J., Stewart, R., Eisenstein, M., Chambers, J., Marth, J.D.,

Walker, F., Thomson, J.A., and Soh, H.T. (2013). Quantitative selection and parallel

characterization of aptamers. Proc Natl Acad Sci U S A 110, 18460–18465.

39. Levay, A., Brenneman, R., Hoinka, J., Sant, D., Cardone, M., Trinchieri, G.,

Przytycka, T.M., and Berezhnoy, A. (2015). Identifying high-affinity aptamer ligands

156

with defined cross-reactivity using high-throughput guided systematic evolution of ligands by exponential enrichment. Nucl. Acids Res. gkv534.

157

Appendix

Appendix Chapter 1

Dimeric DNA Aptamer Complexes for High-capacity–targeted

Drug Delivery Using pH-sensitive Covalent Linkages

Olcay Boyacioglu,1 Christopher H Stuart,1,2 George Kulik,1 and William H Gmeiner1,2,*

Author Affiliations:

1Department of Cancer Biology and Program in Molecular Medicine, Wake Forest

School of Medicine, Winston-Salem, North Carolina, USA

2Program in Molecular Medicine and Translational Science, Wake Forest School of

Medicine, Winston-Salem, North Carolina, USA

Corresponding Author:

William H. Gmeiner, Hanes Building, Room 5044, Medical Center Boulevard, Winston

Salem, NC 27157.

Phone: 336-716-6216; Fax: 336-716-0255; E-mail: [email protected]

This chapter is composed of a published manuscript. The stylistic differences between this chapter and other portions of this dissertation are due to requirements of the journal.

WG conceived and designed the project. OB and CS planned and preformed the experiments. GK contributed to intellectual discussion during manuscript preparation. CS aided in manuscript production. WG wrote the manuscript.

Mol Ther Nucleic Acids. 2013 Jul; 2(7): e107 doi: 10.1038/mtna.2013.37

158

A1.1 Abstract:

Treatment with doxorubicin (Dox) results in serious systemic toxicities that limit effectiveness for cancer treatment and cause long-term health issues for cancer patients.

We identified a new DNA aptamer to prostate-specific membrane antigen (PSMA) using fixed sequences to promote Dox binding and developed dimeric aptamer complexes

(DACs) for specific delivery of Dox to PSMA+ cancer cells. DACs are stable under physiological conditions and are internalized specifically into PSMA+ C4-2 cells with minimal uptake into PSMA-null PC3 cells. Cellular internalization of DAC was demonstrated by confocal microscopy and flow cytometry. Covalent modification of

DAC with Dox (DAC-D) resulted in a complex with stoichiometry ~4:1. Dox was covalently bound in DAC-D using a reversible linker that promotes covalent attachment of Dox to genomic DNA following cell internalization. Dox was released from the DAC-

D under physiological conditions with a half-life of 8 hours, sufficient for in vivo targeting. DAC-D was used to selectively deliver Dox to C4-2 cells with endosomal release and nuclear localization of Dox. DAC-D was selectively cytotoxic to C4-2 cells with similar cytotoxicity as the molar equivalent of free-Dox. In contrast, DAC-D displayed minimal cytotoxicity to PC3 cells, demonstrating the complex displays a high degree of selectivity for PSMA+ cells. DAC-D displays specificity and stability features that may be useful for improved delivery of Dox selectively to malignant tissue in vivo.

Keywords: aptamer, chemotherapy, prostate cancer, prostate-specific membrane antigen

159

A1.2 Introduction:

Cell-specific delivery of cytotoxic drugs via passive1 and active targeting2 is an important objective in order to improve cancer chemotherapy.3 Successful targeting requires the targeting vehicle to have appropriate dimensions for tumor localization via the enhanced permeability and retention effect4 and to bind with high affinity to an antigen that is specifically expressed by targeted cells. Successful drug delivery via a targeted approach must meet additional requirements regarding the stability of the drug complex–drug must be retained in the complex during targeting which may take several hours, but released from the complex after binding to the targeted cell. Drug delivery should also be efficient, releasing multiple drugs for each successfully targeted complex. There is a strong need for new targeted drug delivery approaches that display stability with high payload delivery.

Prostate-specific membrane antigen (PSMA) is of interest for selective delivery of therapeutics for cancer treatment as a consequence of its elevated expression on the apical plasma membrane5 of prostate cancer (PCa) cells and in endothelial cells of vasculature from diverse malignancies. PSMA is an exopeptidase6 with folate hydrolase and NAALADase (N-acetylated α-linked acidic dipeptidase) activities. PSMA also associates with the anaphase-promoting complex and its expression may promote aneuploidy.7 PSMA is expressed by prostate epithelial cells,8 however, elevated PSMA expression occurs in advanced PCa, including bone metastases9 and PSMA expression levels are an independent predictor of PCa recurrence.10PSMA is also expressed in vasculature11 from many different cancers including a high percentage of bladder,12 gastric, and colorectal,13 as well as hepatocellular, renal, breast, and ovarian

160

cancer.6 PSMA is expressed as a dimer,14 and dimerized ligands targeting the PSMA dimer display improved activity relative to monovalent ligands.15

The restricted expression of PSMA has resulted in numerous attempts to both image and treat cancer with PSMA-targeted diagnostic and therapeutic modalities. Three classes of molecules have been most frequently employed in these targeted applications: monoclonal antibodies such as J591, RNA aptamers such as A10-3, and small molecule inhibitors of PSMA enzymatic activity. Radiolabeled conjugates of J591 are being investigated for treatment of advanced PCa16 and have been utilized for cancer imaging.

PSMA inhibitors have been used to deliver theranostic nanoparticles to cancer cells.17 The A10-3 RNA aptamer to PSMA has been used to deliver diverse therapeutic modalities selectively to cancer cells including cisplatin,18,19functionalized nanoparticles,20 a micelle-encapsulated PI3K inhibitor,21 as well as toxins22, and small interfering RNA.23,24 Aptamer targeting of PSMA may be particularly beneficial for delivery of anticancer drugs that have serious systemic toxicities, such as doxorubicin

(Dox). Dox is among the most widely used chemotherapy drugs, however, treatment results in a serious, occasionally lethal cardiotoxicity that may manifest years after treatment, necessitating the development of selective delivery approaches.

The current approaches to Dox delivery using RNA aptamers have several limitations that may be overcome to improve treatment outcomes. Current RNA aptamers are costly to produce, require modified nucleotides for nuclease stability and Dox is generally noncovalently associated with the aptamer. Noncovalent complexes of Dox with duplex

DNA have limited stability with half-lives of only a few minutes (or less) and it is unlikely that noncovalent complexes of Dox with aptamers would be sufficiently stable

161

for optimal in vivo activity. Here, we report a new strategy for improved targeted delivery of Dox to PSMA+ cancer cells using a novel dimeric DNA aptamer complex bound to

Dox through a pH-sensitive linker. PSMA is expressed on the plasma membrane as a dimer, and dimerized ligands targeting PSMA display improved activity relative to monovalent ligands.15 We formed a dimeric aptamer complex (DAC) to take advantage of the dimeric nature of PSMA. As our goal was to efficiently deliver multiple Dox per

DAC, we included 5′-dCpG, the preferred binding site for Dox, interspersed in the primers used for PCR amplification during SELEX to permit Dox-binding motifs to be retained in the final DNA aptamer sequence (Figure 1). We employed a novel strategy in which the priming sequences were imperfectly matched to fixed sequences within the template, permitting aptamer length to vary during the selection process. We identified a

48 nucleotide DNA aptamer (SZTI01, Supplementary Figure S1) using an affinity matrix consisting of the extracellular domain of human PSMA.

A1.3 Results:

Thermal stability of DACs

A key design feature for our strategy to deliver Dox to PCa cells was the formation of a duplex DNA “bridge” linking the two DNA aptamers in the DAC (Figure 1). The bridging DNA duplex is designed to be sufficiently thermally stable such that the DAC remains intact under physiological conditions for times sufficient for aptamers to localize specifically to targets in vivo, and includes a preferred site for Dox binding (CpG). The fixed sequences used during the aptamer selection process also included preferred sites for Dox binding that are included in the final DAC structure. Thermal melting profiles

162

were obtained for DACs with and without Dox modification to evaluate stability of these complexes and any effects Dox may have on thermal stability (Figure 2). The temperature-dependent ultraviolet (UV) melting profile for the dA16:T16 DAC indicated some reduction in secondary structure at temperatures less than 30°C with initial dissociation of the dimeric complex at ~41 °C with a dissociation temperature of ~47 °C.

While dissociation for this dimeric complex occurred above physiological temperature, increased stability would be preferred to promote long-term stability under physiological conditions. Further, the A-T duplex used to form this dimeric complex did not include a preferred Dox-binding sequence motif. We prepared an alternative DAC by appending

GCCG and CGGC sequences to the 5′- and 3′-ends of the A16:T16 DNA duplex-forming sequences (Figure 1). The resulting DAC displayed a dissociation temperature of ~58 °C, thus displaying stability suitable for further development. Covalent modification of DAC with Dox (DAC-D) further enhanced complex stability, and the DAC-D complex displayed minimal change in absorbance for temperatures lower than the melting temperature consistent with Dox stabilizing DAC structure (Figure 2a). The secondary structure and thermal stability of DAC were further investigated using circular dichroism spectroscopy (Supplementary Figure S2). The DAC complexes displayed circular dichroism spectra typical of B-form DNA with a maximum at 283 nm and a minimum at

248 nm consistent with the tail-forming sequences forming the target structures. Covalent modification with Dox in the DAC-D complex has no discernible effect on overall secondary structure for the complex although a slight sharpening in the peaks was noted.

The DAC-D complex displayed less sensitivity to increased temperature relative to DAC

163

and DAC + Dox indicating covalent modification with Dox stabilizes the overall complex.

Formation and dissociation of covalent Dox conjugates

The duplex DNA-binding motif stabilizing the DAC has the potential for binding two equivalents of Dox per complex. In addition, the DNA aptamers comprising the complex contained other CpG sites for potential Dox binding (Figure 1). We formed a covalent complex between the DAC and Dox (DAC-D) by mixing the dimeric complex with a fourfold excess of Dox in the presence of formaldehyde. We formed covalent linkages at

4:1 stoichiometry (Supplementary Figure S3; Supplementary Table S1) and evaluated

Dox transfer from the resulting covalent complex (DAC-D) in which Dox fluorescence is effectively quenched to an excess of a 25mer DNA hairpin in which Dox fluorescence is less effectively quenched. These studies revealed the half-life for Dox covalently bound in DAC-D via formaldehyde was >8 hours (Figure 2b), while the dissociation of the noncovalent complex was too rapid to measure using this assay, but is fully dissociated in

≤5 minutes. These studies indicated that covalent attachment of Dox results in formation of a complex with increased retention of Dox that is well suited for drug delivery applications in vivo.

PSMA-specific uptake of dimeric complexes

The selective delivery of Dox to PSMA+ cells requires binding and ideally internalization of the complex. To evaluate to what extent the DAC was specific for binding and internalization into PSMA+ cells, we compared internalization of the complex in

164

PSMA+ C4-2 cells and PSMA-null PC3 cells using confocal microscopy and flow cytometry. The component of the dimeric complex containing dA16 single-stranded

(ssDNA) was labeled with Quasar 570, while the component with T16 ssDNA was labeled with Quasar 670 permitting simultaneous detection and visualization of each aptamer component. Confocal microscopy revealed minimal uptake of either fluorescently labeled aptamer into PC3 cells, however, strong signal was observed for each fluorescent aptamer signal in PSMA+ C4-2 cells (Figure 3). Further, fluorescence emitted from each of the two aptamers was completely colocalized consistent with uptake and retention of the

DAC in dimeric form. Fluorescence emitted from the aptamer complexes appeared punctate, with nuclear exclusion, consistent with endosomal localization of the DAC which was confirmed by colocalization with the endosomal marker fluorescein isothiocyanate–dextran (Figure 4). Flow cytometry also confirmed specificity of DAC for

PSMA+ C4-2 cells (Supplementary Figure S4). Preincubation of C4-2 cells with J591

PSMA-specific monoclonal antibody attenuated DAC uptake consistent with PSMA- specific internalization (Figure 5a).

PSMA-specific delivery of Dox

The serious toxicities associated with Dox treatment indicate that premature release of

Dox from targeting vehicles is likely to be therapeutically detrimental. In this regard, noncovalent complexes of Dox with DNA have demonstrated improved toxicity profiles relative to free-Dox,25 however covalent linkage of Dox with a targeted DNA vehicle should markedly enhance efficacy and reduce systemic toxicities by limiting Dox dissociation while in circulation. We devised a strategy to covalently attach Dox to the

165

DAC using formaldehyde, a strategy previously shown to promote covalent complex formation of Dox with genomic DNA.26 The specific delivery of Dox to PSMA+ cells using DAC-D was evaluated using confocal microscopy (Figure 5b). While noncomplexed Dox readily accumulated in the nuclei of both PC3 and C4-2 cells, Dox delivered using DAC-D internalized nearly exclusively into C4-2 cells with minimal accumulation in PC3 cells. Dox fluorescence was exclusively nuclear, while the aptamer fluorescent signal from DAC-D displayed nuclear exclusion consistent with Dox becoming dissociated from the DAC-D following cellular internalization. These results are consistent with Dox becoming dissociated in the acidic environment of the endosome following cell uptake of DAC-D followed by nuclear localization of Dox. The results demonstrate PSMA-specific uptake of the DAC-D complex with nuclear delivery of Dox.

PSMA-dependent selective cytotoxicity

Paramount to targeted drug delivery is selective cytotoxicity towards targeted cells with minimal damage to nontargeted cells. The specificity of DAC-D for PSMA+ cells was evaluated using cell viability assays in PC3 and C4-2 cells. The results are shown in Figure 6. Free-Dox was highly cytotoxic to both PC3 and C4-2 cells consistent with the wide-spectrum activity previously reported (Supplementary Figure S5). In contrast,

Dox delivery via DAC-D was highly cytotoxic towards C4-2 cells, but displayed greatly reduced cytotoxicity to PC3 cells. For example, at Dox concentrations that resulted in

~90% reduction in viability for free-Dox (2 μmol/l), the same amount of Dox delivered via DAC-D displayed greater than 80% potency towards targeted C4-2 cells and less than 50% of cytotoxic activity towards PC3 cells. An especially challenging

166

situation for targeted drug delivery occurs when targeted cells are in close proximity to nonmalignant cells as arises in metastases to vital organs. In this case, highly localized cytotoxicity is desirable. To simulate this challenging environment, we performed coculture of luciferase-transfected C4-2 cells (C4-2-luc) with PC3 cells and assessed the viability of each cell line in coculture independently (Figure 6). Preliminary studies demonstrated that C4-2-luc and C4-2 cells displayed no significant difference in viability in response to Dox or the DAC-D complex (Supplementary Figure S5). The response of

C4-2-luc cells in coculture with PC3 cells was similar to C4-2 cells in monoculture with

DAC-D retaining greater than 80% cytotoxicity in the mixed environment. In contrast,

PC3 cells in coculture with C4-2-luc cells showed markedly decreased response to DAC-

D relative to studies in monoculture (P < 0.05). The results are consistent with the DAC-

D undergoing selective internalization into targeted PSMA+C4-2 cells, reducing the

DAC-D available for nonspecific uptake into nontargeted PC3 cells.

A1.4 Discussion:

Aptamer-mediated delivery is a promising technology for improving the therapeutic index of cytotoxic drugs that cause serious systemic toxicities, such as Dox. We identified a new DNA aptamer to PSMA and developed a DAC to take advantage of

PSMA being expressed as a dimer. Our objective was to use the DAC as a scaffold for high-capacity drug delivery. The process used for aptamer identification was designed to identify DNA sequences that included preferred Dox-binding sites (e.g., 5′-CpG). We also developed a process for covalent modification at the preferred binding sites with

Dox resulting in a high-capacity (4:1) payload. The covalent linkage utilized is pH-

167

sensitive releasing free-Dox in the acidic environment of endosomes following internalization into targeted cells. Released Dox migrates to the nucleus and binds genomic DNA interfering in replication and mitosis, while the DAC is retained in the cytosol. The resultant DAC-D complex is internalized selectively into PSMA+ cells and is highly cytotoxic to these cells while displaying minimal effects to PSMA-null cells.

Importantly, this high degree of selectivity is retained in the context of coculture experiments in which PSMA+ cells retain full sensitivity to the targeted complex even while cocultured adjacent PSMA-null cells are not affected. It is anticipated that DAC-D complexes will be highly effective antitumor agents in vivo with minimal systemic toxicity.

DACs have potential advantages relative to monomeric aptamers for drug delivery applications in terms of target selection, target avidity, physical and chemical stability, higher payload capacity, improved pharmacokinetics, and utility if partly damaged– among other properties. The present studies utilized a DAC with both components targeting PSMA which is expressed as a dimer. The length of the 24 base pair DNA duplex connecting the component aptamers is approximately 70 Å which is similar to the dimensions of the PSMA dimer making it possible for the component aptamers to bind simultaneously, although optimization of DAC dimensions would be required to fully optimize simultaneous binding. The structure of the DAC utilized in the present studies was stable under physiologically relevant conditions and useful for high-capacity drug delivery with a 4:1 stoichiometry payload. In principle, additional Dox-binding sites can be included into the structure to further enhance drug delivery potential.

168

The chemical linkage used for covalent Dox attachment enables convenient synthesis with high yields and straightforward purification. While this approach is readily scaled for in vivo studies and eventual clinical applications, perhaps the most important advantage of using this chemistry for Dox delivery is that Dox is readily released from the DAC-D under moderately acidic conditions (pH <6) that occur in endosomes following cellular internalization, or possibly in the tumor microenvironment. Dox released from endocytic DACs readily translocates to the nucleus and is capable of exerting cytotoxicity to a similar extent as free-Dox which acts via topoisomerase 2 poisoning. Formaldehyde released from the DAC-D upon acid-mediated dissociation has the potential to promote Dox binding to genomic DNA,27,28 thus formaldehyde is not merely a passive chemical linkage, but may also potentiate genomic DNA binding of Dox released from the DAC-D delivery vehicle. This approach has advantages relative to strategies that use covalent linkers that lack this potential for enhancing genomic DNA binding by released Dox.

Aptamers may be prepared more cost effectively relative to monoclonal antibodies and are more amenable to chemical derivation for drug delivery applications. PSMA has emerged as a favored target for aptamer-mediated delivery of cytotoxic drugs and nanoparticles because of its elevated expression in advanced PCa and in the vasculature of diverse malignancies. The majority of studies described for PSMA targeting with aptamers have used variants of the A10 RNA aptamer.22 While these studies have demonstrated target selectivity, there is a need for new aptamers that display improved targeting distinction and that retain the cytotoxic payload to a greater extent during delivery. We have identified a new DNA aptamer to PSMA, and developed a dimeric

169

complex that displays a high degree of selectivity for PSMA+ cells similar to the A10

RNA aptamer (Supplementary Figure S6).

Improved pharmacokinetic properties and reduced cardiotoxicity are important characteristics for Dox delivery that improves treatment outcomes for cancer patients. In this regard, the liposomal formulation, Doxil, has demonstrated decreased blood clearance and reduced cardiotoxicity relative to free drug. Doxil is not specifically targeted to malignant cells, and delivery that includes active targeting is expected to further increase treatment efficacy. The DAC-D described here has molecular weight

(~45 kDa) suitable for prolonged retention in plasma as well as tumor localization via the enhanced permeability and retention and with specificity for malignant cells via PSMA targeting. Future studies will investigate the pharmacokinetic properties of DAC-D as well as systemic toxicities and efficacy towards in vivo models of cancer. Based on previous studies showing DNA delivery of Dox-reduced cardiotoxicity,25 we expect

DAC-D to have minimal cardiotoxicity. Ultimately, we expect DAC-D to prove useful for clinical management of cancer.

170

Figure 1: Secondary structure of the dimeric aptamer complex containing CpG sequences appended to the ends of the dA16 (red bases) or T16 (green bases). Red boxes indicate potential doxorubicin-binding sites.

171

Figure 2: Physical characterization of DAC and DAC-D. (a) The Tm of DAC and

DAC-D was determined by measuring the ultraviolet absorbance at 260 nm and by heating the samples at 0.7 °C/minute. (b) Dox fluorescence was measured by exciting the sample with a 532 nm laser and reading the emission at 580 nm. The calculated half-life of transfer from DAC-D was found to be 8.27 hours. Error bars represent mean ± SD.

DAC, dimeric aptamer complex; DAC-D, dimeric aptamer complex with doxorubicin.

172

Figure 3: Cells were incubated with 1 μm of dimeric aptamer complex (DAC) for 2 hours before being fixed and imaged. Confocal microscopy shows DAC binds to and is internalized by (a) the prostate-specific membrane antigen (PSMA)+ cell line C4-2, but not by (b) the PSMA-null cell line PC3. Colocalization studies (dT16 Quasar 570/green, dA16 Quasar 670/red) confirm DAC internalization as a dimer in C4-2 cells.

173

Figure 4: Cells were incubated with 1 mg/ml FITC–dextran (70 kDa) and 1 μmol/l

DAC for 2 hours before fixation and imaging. Colocalization of FITC–dextran

(70 kDa; green) with DAC (red) in C4-2 cells confirms the DAC enters the cell through endosomes. DAC, dimeric aptamer complex; FITC, fluorescein isothiocyanate.

174

Figure 5: Specificity of DAC complexes for PSMA+ cells. (a) C4-2 cells were incubated with the prostate-specific membrane antigen–specific antibody J591 for 30 minutes before washing and fixation using formaldehyde. Cells were then treated with DAC for

20 minutes and imaged using confocal microscopy. (b) Cells were incubated with either 1

μmol/l Dox, 1 μmol/l Dox premixed with 250 nmol/l DAC, or 250 nmol/l DAC-D (1

μmol/l Dox equivalent) for 2 hours before fixation and imaging. Dox shows nuclear localization in all cells. The use of DAC to deliver Dox results in reduced Dox delivery to

PC3 cells. DAC, dimeric aptamer complex; DAC-D, dimeric aptamer complex with doxorubicin; Dox, doxorubicin; FITC, fluorescein isothiocyanate.\

175

Figure 6: PC3 and C4-2 cells were incubated alone or in coculture and were treated with DAC-D, DAC + Dox, or free-Dox for 24 hours. Media was replaced and cells were allowed to grow for 48 hours before determining viability. Percentage of Dox retained was found by comparing the viability of DAC-D (or DAC + Dox) with Dox.

There is no statistical difference between C4-2 cells alone versus C4-2 cells in coculture, however there is a significant reduction in cytotoxicity for PC3 cells in coculture versus

PC3 cells alone (P < 0.05). Error bars represent mean ± SEM. DAC, dimeric aptamer complex; DAC-D, dimeric aptamer complex with doxorubicin; Dox, doxorubicin.

A1.5 Materials and Methods:

DNA SELEX. Recombinant human PSMA extracellular domain (720 amino acids) was expressed from baculovirus (Kinakeet Biotechnology, Richmond, VA). The recombinant

176

protein included a His-tag sequence that was used to form an affinity matrix using Talon beads which was then used in a DNA SELEX procedure to identify DNA aptamers to

PSMA. DNA aptamers were selected from a library including a 47 nucleotide random sequence flanked by fixed sequences of 21 nucleotides each. The fixed sequences selected permit formation of short hairpins in the final aptamer that include stem regions with sequence elements favorable for Dox binding (underlined). The sequence for the random library was: dGCGAAAACGCAAAAGCGAAAA(N47)ACAGCAATCGTATGCTTAGCA

Initially, 8-μg ssDNA from the random library (307 pmol of DNA; 186 trillion sequences) was converted to double-stranded DNA (dsDNA) using a T7 fill-in reaction and amplified by PCR using primers that were imperfectly matched to the template.

5′ dGCGTTTTCGCTTTTGCGTTTT (forward)

5′ dAGCATTGCTATCGTAAGCAGA (reverse)

The 5′-primer was synthesized with a 5′-phosphate and the resulting dsDNA was converted to ssDNA using λ-exonuclease to selectively cleave the strand amplified with the phosphorylated primer. SELEX forward rounds were performed by adding 1 mg of

PSMA bound to Dynabeads Talon (Invitrogen, Oslo, Norway) to 700 μl of binding buffer

(100 mmol/l NaCl, 20 mmol/l Tris, 2 mmol/l MgCl2, 5 mmol/l KCl, 1 mmol/l CaCl2,

0.2% Tween-20, pH 8). The beads were removed using a Dynal magnet (Invitrogen) and were washed four times with binding buffer. At least 10 μg of ssDNA was annealed by heating to 95 °C followed by gentle cooling and was added to the PSMA matrix followed by vortexing and incubation for 1 hour at 37 °C with mild agitation. The supernatant was removed and 20 μl of 5 μmol/l 5′-phosphorylated primer was added to the beads and the

177

mixture was heated to 95 °C for 5 minutes following which the beads were sequestered and the supernatant transferred to a clean microfuge tube and DNA converted to dsDNA using a primer extension reaction using T7 polymerase. DNA was collected by ethanol precipitation and then amplified by 10 cycles of PCR using a phosphorylated 3′-primer.

The dsDNA was purified by gel electrophoresis followed by ethanol precipitation and then converted to ssDNA by treating 32–40 μg of dsDNA with λ-exonuclease for 30 minutes at 37 °C followed by ethanol precipitation. The resulting ssDNA was analyzed by gel electrophoresis and quantified by UV absorbance and used in a subsequent

SELEX forward or counter round. Counter rounds differed from forward rounds by incubation with a magnetic bead matrix that did not contain PSMA and using the DNA that did not bind to the matrix for subsequent PCR amplification. A total of 10 forward and two counter rounds were performed. After the final SELEX round, ssDNA was converted to dsDNA using a T7 fill-in procedure and was cloned into a pGEM vector

(Promega, Madison, WI) for sequencing. A single, 48 nucleotide sequence (SZTI01) was identified and used in subsequent studies.

SZTI01: dGCGTTTTCGCTTTTGCGTTTTGGGTCATCTGCTTACGATAGCAATGCT

PSMA-specific aptamer synthesis. The DNA aptamer sequences were synthesized at either the University of Calgary (Calgary, Alberta, Canada) or IDT (Coralville, IA).

Aptamers were reconstituted in sterile, nuclease-free H2O at 100 μmol/l. DACs were prepared from aptamers that included either a dA16 or T16 single-stranded tail at the 3′- terminus (dA16:T16 DAC) by mixing the two monomers at 1:1 ratio followed by heating to 95 °C and gentle cooling. The DAC used for these studies (unless otherwise indicated)

178

included the sequences dCGGCA16GCCG or dCGGCT16GCCG. The secondary structure for the DAC calculated using m-fold is shown in Figure 1.

Synthesis of DAC-D complexes. The covalent complex of DAC-D was prepared by mixing 250 μl of a 50 μmol/l solution of the DAC with a Dox–formaldehyde solution prepared upon incubation of a 0.37% formaldehyde solution in Dulbecco's phosphate- buffered saline (PBS) without calcium or magnesium pH 7.4 with Dox. The reaction proceeded in a light-free manner at 4 °C for 48 hours. The solution was extracted once with 300 μl of phenol:chloroform followed by two additional extractions with 300 μl chloroform. The aqueous phase was then ethanol precipitated and the pellet rinsed 2× with 70% ethanol and once with absolute ethanol and dried under reduced pressure. The red pellet was resuspended in 100 μl dH2O. Yields were typically >90% based on DNA recovery.

Determination of Dox:DNA ratios. DNA samples were prepared in dH2O and absorbencies were measured from 200–800 nm using a Beckman Coulter DU-800 spectrophotometer (Beckman Coulter, Brea, CA). A standard curve of Dox was established between 1 and 10 μmol/l by using absorbencies at 494 nm at 85 °C. To assess the amount of Dox covalently bound to DNA, the samples were heated to 85 °C before measuring the absorbance at 494 and 260 nm. The 260 nm wavelength was used to determine the DNA content in the sample and to determine the Dox:DNA ratio.

Dox transfer from DAC-D. Samples of DAC-D or the noncovalent complex (DAC + D), or free-Dox 625 nmol/l were prepared in Dulbecco's PBS with or without a 100-fold (by weight) excess of a 25mer DNA and were incubated at 37 °C. Changes in fluorescence

179

intensity were determined using a Typhoon-9210 variable mode imager with excitation set to 532 nm and the emission filter at 580 nm.

Temperature-dependent UV studies. Temperature-dependent UV absorption spectra were obtained using a Beckman Coulter DU-800 UV-Vis spectrophotometer. Samples of

DAC, DAC-D, and DAC + D were prepared. The temperature was increased at a rate of

0.7 °C/minute over the range 20–85 °C and absorbance at 260 nm was measured for each sample (400 μl and 1 μmol/l) concentration.

Cell lines. The C4-2 cell line was a gift from Dr Elizabeth M Wilson (University of North

Carolina, Chapel Hill, NC). C4-2-Luc cell line was generated by transfecting C4-2 cells with pTRE2hygro and firefly luciferase (PGL3). PC3 cells were purchased from cell and viral vector core laboratory at Wake Forest School of Medicine. All cells were maintained with RPMI 1640 (Gibco, Grand Island, NY) with 10% fetal bovine serum

(Gemini Bio-Products, West Sacramento, CA). All cells were kept at 5% CO2 at 37 °C.

Confocal microscopy. Cells were seeded at 20,000 cells/well in 8-well Lab-Tek II chambered #1.5 German Coverglass System (Thermo Fisher Scientific, Waltham, MA), and incubated at 37 °C under 5% CO2 for 2 days. Cells were incubated with 1 μmol/l of

DAC in which the dA16 aptamer was labeled with Quasar 570 at the 5′-terminus and the

T16 aptamer was labeled with Quasar 670 dyes in RPMI medium with 10% fetal bovine serum for 2 hours at 37 °C. Cells were washed with fresh media and Dulbecco's PBS, followed by a 5 minutes fixation with 3.7% formaldehyde in Dulbecco's PBS. Cells were visualized using a Zeiss LSM510 confocal microscope (Carl Zeiss, Oberkochen,

Germany). Cells were also incubated with 1 μmol/l of DAC-D (or the noncovalent DAC

+ D) for 2 hours. DACs were only labeled with Quasar 670 for these studies as the

180

Quasar 570 emission would interfere with the Dox emission. Cells were washed, fixed, and imaged using identical procedures.

Flow cytometry. PC3 and C4-2 cells were incubated with 1 µmol/l of DAC for 2 hours at

37 °C. Dimers were fluorescently labeled with either Quasar 570 or 670 alone, or both.

Cells were trypsinized and washed with PBS twice. Cells resuspended in PBS were analyzed to measure their intracellular fluorescence using the Accuri C6 flow cytometer

(BD Biosciences, San Jose, CA).

Cytotoxicity measurements. PC3, C4-2, and C4-2-Luc cells were seeded at a density of

3,000 cells/well in 96-well plates and incubated at 37 °C under 5% CO2. Next day, the cells were treated with Dox, DAC + Dox, or DAC-D for 24 hours. Next day the treatment was removed, cells were washed once with warm fresh media and incubated for another

48 hours in fresh media. Cell counts were measured indirectly by measuring the ATP amounts using CellTiter-Glo luminescent cell viability assay (Promega) according to the manufacturer's protocol. In coculture experiments, PC3 and C4-2-Luc cells were each seeded at a density of 1,500 cells/well in 96-well plates. Cocultured cells were treated with Dox, DAC + Dox, or DAC-D and cell viability was also measured using the

CellTiter-Glo assay. Luciferase levels were measured for cocultures of PC3 and C4-2-

Luc cells using a luciferase reporter assay system (Promega). PC3 and C4-2-Luc cells were seeded and treated as described above and the cells were lysed and luciferase activity was measured according to the manufacturer's protocol.

181

A1.6 Supplementary Material

Figure S1. The sequence of the SZTI01 aptamer.

Figure S2. Circular dichroism spectra were acquired at three temperatures (as indicated) at wavelengths 200–350 nm and a graph of the temperature-dependent reduction in

182

ellipticity, which is less for DAC-D than DAC, is displayed.

Figure S3. A standard curve for Dox was established by measuring the absorbance of

Dox at 494 nm at 85 °C.

183

Figure S4. Flow cytometry was performed by incubating cells with DAC for 2 hours before measuring the amount of fluorescence emitted by either Quasar 670 or Quasar 570 as a read-out for aptamer internalization.

Figure S5. Cells were treated with drugs for 24 hours.

184

Figure S6. Relative binding of the A10 RNA aptamer and SZTI01 to C4-2 cells is similar.

Abs at Abs at Dox Conc DNA Conc

498nm 260nm (µM) (µM) Dox:DNA

DAC-D 1 0.0358 1.0223 3.48 0.793 4.388398

DAC-D 2 0.0272 1.0084 2.85 0.768 3.710938

DAC-D 3 0.0376 1.61 4.02 1.19 3.378151 avg 3.825829 std dev 0.51483

Table S1. Absorbance values for DAC-D complexes of different aptamer:Dox ratio.

185

A1.7 Acknowledgments

Elizabeth M Wilson (University of North Carolina, Chapel Hill, NC) provided C4-2 cells.

Stacy Trozzo and Patrick Guthrie helped with SELEX. Funding: DOD PCRP 093606

(W.H.G.) and National Institutes of Health-National Cancer Institute P30CA012197

(W.H.G.). The authors declared no conflict of interest.

References:

1. Maeda H. Macromolecular therapeutics in cancer treatment: The EPR effect and beyond. J Control Release 2012.

2. Byrne JD, Betancourt T, Brannon-Peppas L. Active targeting schemes for nanoparticle systems in cancer therapeutics. Adv Drug Deliv Rev 2008;60:1615-1626.

3. Kaminskyy VO, Piskunova T, Zborovskaya IB, Tchevkina EM, Zhivotovsky B.

Suppression of basal autophagy reduces lung cancer cell proliferation and enhances caspase-dependent and -independent apoptosis by stimulating ROS formation.

Autophagy 2012;8.

4. Erickson HP. Size and shape of protein molecules at the nanometer level determined by sedimentation, gel filtration, and electron microscopy. Biol Proced Online

2009;11:32-51.

5. Christiansen JJ, Rajasekaran SA, Inge L, et al. N-glycosylation and microtubule integrity are involved in apical targeting of prostate-specific membrane antigen: implications for immunotherapy. Mol Cancer Ther 2005;4:704-714.

186

6. Denmeade SR, Mhaka AM, Rosen DM, et al. Engineering a prostate-specific membrane antigen-activated tumor endothelial cell prodrug for cancer therapy. Sci Transl

Med 2012;4:140ra186.

7. Rajasekaran SA, Christiansen JJ, Schmid I, et al. Prostate-specific membrane antigen associates with anaphase-promoting complex and induces chromosomal instability. Mol

Cancer Ther 2008;7:2142-2151.

8. Gong MC, Chang SS, Sadelain M, Bander NH, Heston WD. Prostate-specific membrane antigen (PSMA)-specific monoclonal antibodies in the treatment of prostate and other cancers. Cancer Metastasis Rev 1999;18:483-490.

9. Mannweiler S, Amersdorfer P, Trajanoski S, Terrett JA, King D, Mehes G.

Heterogeneity of prostate-specific membrane antigen (PSMA) expression in prostate carcinoma with distant metastasis. Pathol Oncol Res 2009;15:167-172.

10. Perner S, Hofer MD, Kim R, et al. Prostate-specific membrane antigen expression as a predictor of prostate cancer progression. Hum Pathol 2007;38:696-701.

11. Liu H, Moy P, Kim S, et al. Monoclonal antibodies to the extracellular domain of prostate-specific membrane antigen also react with tumor vascular endothelium. Cancer

Res 1997;57:3629-3634.

12. Samplaski MK, Heston W, Elson P, Magi-Galluzzi C, Hansel DE. Folate hydrolase

(prostate-specific membrane [corrected] antigen) 1 expression in bladder cancer subtypes and associated tumor neovasculature. Mod Pathol 2011;24:1521-1529.

13. Haffner MC, Kronberger IE, Ross JS, et al. Prostate-specific membrane antigen expression in the neovasculature of gastric and colorectal cancers. Hum Pathol

2009;40:1754-1761.

187

14. Schulke N, Varlamova OA, Donovan GP, et al. The homodimer of prostate- specific membrane antigen is a functional target for cancer therapy. Proc Natl Acad Sci U

S A 2003;100:12590-12595.

15. Aggarwal S, Singh P, Topaloglu O, Isaacs JT, Denmeade SR. A dimeric peptide that binds selectively to prostate-specific membrane antigen and inhibits its enzymatic activity. Cancer Res 2006;66:9171-9177.

16. Tagawa ST, Beltran H, Vallabhajosula S, et al. Anti-prostate-specific membrane antigen-based radioimmunotherapy for prostate cancer. Cancer 2010;116:1075-1083.

17. Chen Z, Penet MF, Nimmagadda S, et al. PSMA-targeted theranostic nanoplex for prostate cancer therapy. ACS Nano 2012;6:7752-7762.

18. Dhar S, Gu FX, Langer R, Farokhzad OC, Lippard SJ. Targeted delivery of cisplatin to prostate cancer cells by aptamer functionalized Pt(IV) prodrug-PLGA-PEG nanoparticles. Proc Natl Acad Sci U S A 2008;105:17356-17361.

19. Dhar S, Kolishetti N, Lippard SJ, Farokhzad OC. Targeted delivery of a cisplatin prodrug for safer and more effective prostate cancer therapy in vivo. Proc Natl Acad Sci

U S A 2011;108:1850-1855.

20. Gu F, Langer R, Farokhzad OC. Formulation/preparation of functionalized nanoparticles for in vivo targeted drug delivery. Methods Mol Biol 2009;544:589-598.

21. Zhao Y, Duan S, Zeng X, et al. Prodrug strategy for PSMA-targeted delivery of

TGX-221 to prostate cancer cells. Mol Pharm 2012;9:1705-1716.

22. Chu TC, Marks JW, 3rd, Lavery LA, et al. Aptamer:toxin conjugates that specifically target prostate tumor cells. Cancer Res 2006;66:5989-5992.

188

23. Ni X, Zhang Y, Ribas J, et al. Prostate-targeted radiosensitization via aptamer- shRNA chimeras in human tumor xenografts. J Clin Invest 2011;121:2383-2390.

24. Dassie JP, Liu XY, Thomas GS, et al. Systemic administration of optimized aptamer-siRNA chimeras promotes regression of PSMA-expressing tumors. Nat

Biotechnol 2009;27:839-849.

189

Christopher H Stuart 2020 Morgan Circle #305 · Winston Salem NC, 27104 · 706-936-9019 · [email protected]

Education PhD, Wake Forest University July 2011 - April 2016 Molecular Medicine and Translational Science

BS, Berry College ACS Certified Biochemistry, Biology double August 2007 – May major 2011

Research Experience February 2011 - April 2016 The Use of DNA as a Specific Delivery Vehicle for Winston-Salem, NC Chemotherapeutics Wake Forest University Supervisor: William Gmeiner  Conjugation of Doxorubicin to small hairpin and aptamer DNA via a novel pH sensitive linkage  Cell culture and sterile techniques  Biophysical characterizations of DNA by UV absorption, circular dichroism, NMR, gel electrophoresis and mass spectrometry  Synthesis of propargylated folate derivatives for attachment to small hairpin DNA  Synthesis of aptamer targeted liposomes for drug delivery  Confocal microscopy  Design experiments to evaluate increased specificity of targeted drug-DNA and aptamer conjugates in vitro  Design experiments to evaluate synergy of multiple drugs on malignant cells  Design in vivo experiments to evaluate the toxicity and localization to tumors of Aptamer targeted nanoparticles.  Evaluate aptamers for cell binding and internalization  Design and identify aptamers using capillary electrophoresis based SELEX techniques and NGS sequencing

190

Immobilization of Jacobsen-Like Catalyst on Gold May 2009-May 2011 Electrodes Mount Berry, GA Supervisor: Kevin Hoke Berry College Department of Chemistry, Berry College  Prepare and evaluate the efficiency of organic reactions of catalysts  Optimize reaction conditions to overcome low yields and separation issues  Synthesized asymmetric variations of Jacobsen's catalyst and test for catalytic activity, Functionalized acetylacetone with an alkyne, synthesized azide terminated thiol for click chemistry.  Utilize functionalized catalysts for surface modification of gold electrodes for testing oxidation-reduction potentials involved in catalyzed olephin epoxidation

Gene Expression in Corals affected by Caribbean Yellow Band Disease August 2010-May 2011 Supervisor: Michael Morgan Mount Berry, GA Department of Biology, Berry College Berry College  Optimize PCR conditions and identify ideal control genes For RT-PCR  Design custom primers from sequences extracted from wild corals

 Develop RT-PCR methods used to identify altered gene expression in diseased versus healthy coral

Isolation of BLV-GAG August 2010-May 2011 Supervisor: Dominic Qualley Mount Berry, GA Berry College  Design and create plasmids for cloning of

the GAG region of the Bovine Leukemia Virus  Transfect bacteria with plasmids and isolate genetic material from colonies for sequencing

191

Selected Work and Leadership

Experience  Gmeiner Lab Student Training th th 2014-2016 o Over the course of my 4 and 5 years in the lab I trained and helped manage 4 undergraduate and 4 master level students. o This involved lab safety, experiment planning, discussing results, data analysis, trouble shooting, and communicating goals from the PI. o Projects ranged from organic chemistry, hydrogel formation, cell culture and cellular biology experiments. o I also was responsible for material ordering and basic lab management during this period  Molecular Medicine and Translation Science 2012-2014 Executive Committee Student Representative o Serve on the MMTSEC as a student representative for 2 years providing student input for policy changes  Hoke Lab Supervisor 2011 o As the senior student in the lab, I trained students and ensured the safety of the lab was maintained. I also aided in trouble shooting and planning organic reactions for the younger students.  Biochemistry Lab Preparer 2011 o I worked as part of a team to make sure that all biochemistry labs were setup before labs began. We also performed all experiments beforehand to identify areas that could be improved and where students may have difficulty. o I created a manual for future lab preparers which contained protocols, tips and tricks for preparing for each lab.  Organic Lab TA 2010 o Ensure that student labs are ready for lab, answer student questions, prepare lab for next section, responsible for safety in lab, grade prelab and procedure write ups.

192

Publications  Boyacioglu, O., Stuart, C.H., Kulik, G., and Gmeiner, W.H. (2013). Dimeric DNA Aptamer Complexes for High-capacity–targeted Drug Delivery Using pH-sensitive Covalent Linkages. Mol Ther Nucleic Acids 2, e107.  Stuart, C.H., Horita, D.A., Thomas, M.J., Salsbury, F.R., Lively, M.O., and Gmeiner, W.H. (2014). Site-Specific DNA–Doxorubicin Conjugates Display Enhanced Cytotoxicity to Breast Cancer Cells. Bioconjugate Chem. 25, 406–413. ◦ Listed as co-inventor on provisional patent applied for by WFUSM on work related to this publication  Gmeiner, W.H., Jennings-Gee, J., Stuart, C.H., and Pardee, T.S. (2015). Thymineless death in F10-treated AML cells occurs via lipid raft depletion and Fas/FasL co-localization in the plasma membrane with activation of the extrinsic apoptotic pathway. Leuk. Res. 39, 229–235.  Gmeiner, W.H., Boyacioglu, O., Stuart, C.H., Jennings-Gee, J., and Balaji, K. c. (2015). The cytotoxic and pro-apoptotic activities of the novel fluoropyrimidine F10 towards prostate cancer cells are enhanced by Zn2+- chelation and inhibiting the serine protease Omi/HtrA2. Prostate 75, 360– 369.  Morgan, M., Goodner, K., Ross, J., Poole, A.Z., Stepp, E., Stuart, C.H., Wilbanks, C., and Weil, E. (2015). Development and application of molecular biomarkers for characterizing Caribbean Yellow Band Disease in Orbicella faveolata. PeerJ 3, e1371.  Hoke, K.R., Stuart, C.H., Kase, A.M., and Summerlin, M.B. (2011). Stepwise assembly of coordination complexes on electrode surfaces. In ABSTRACTS OF PAPERS OF THE AMERICAN CHEMICAL SOCIETY

Awards and Presentations  Genetic and Environmental Mutagens Society Symposium Poster and Abstract (2013) ▪ “DNA Hairpins for Targeted Drug Delivery” with Bill Gmeiner ▪ Detailed the synthesis, cytotoxicity, and enhanced delivery of Doxorubicin to a model of breast cancer in vitro by conjugating the drug to a small DNA hairpin with a pH sensitive linker.  Triangle Consortium for Reproductive Biology Symposium Poster (2012) ▪ “Constructing a Gene Expression Profile of Post-Menopausal Breast Tissue in Cynomolgus Macaques” with Mark Cline ▪ Detailed the use of gene expression data from a non-human primate model to develop a gene expression profile for post- menopausal breast tissue. Identified common patterns in genes that displayed altered gene regulation when compared to other age

193

groups.  Student Worker of the Year Award 2010 ◦ Employers select students for outstanding work and are then selected by a committee.  2nd Place Poster, Berry College Research Symposium 2010 ◦ Selected by judges from all students who had performed research the past year.  Berry College Research Symposium Poster (2011) ◦ “Synthesis of 3-propargyl 2,4 pentadione” ▪ Detailed the methods of optimization, synthesis, purification, and future uses of the molecule in the larger project.  Tri-Beta Biological Honors Society member  Graduated with an American Chemical Society Certified Biochemistry BS

Instrumentation and Technical Skills  Nuclear Magnetic Resonance  Infrared Surface Spectroscopy  UV and Visible Spectroscopy  RT-PCR and PCR  Mass Atomic Absorption Spectroscopy  Gas Chromatography  Capillary Electrophoresis facilitated SELEX  MALDI-TOF MS  Confocal Microscopy  Multiple SELEX methodologies  Cell culture  In vivo tumor establishment

Relevant Classwork  Medicinal Chemistry  Organic Chemistry  Biochemistry  Physical Chemistry  Cellular Biology  Developmental Biology  Genetics  Molecular And Cellular Biosciences  Carcinogenesis and DNA Damage  Foundations of Translation Science  Introduction to Regenerative Medicine

194

 Cancer Cell Biology  Drug Discovery, Design, and Development  Scientific Development and the Business of Science

195