INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did not serxt UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to Ise removed, a note vrill indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overlaps.

Photographs included in the original manuscript have been reproduced xerographically in this copy. Higher quality 6" x 9" black and white photographic prints are availat>le for any photographs or illustrations appearing in this copy for an additional charge. Contact UMI directly to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA 800-521-0600 UMI

BIOCHEMICAL ANALYSIS OF GLVCOSYLTRANSFERASES INVOLVED IN BY Streptomyces sp. strain C5

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

By

Anton James Woo, B. S.

The Ohio State University 2000

Dissertation Committee: Approved by Dr. William Strohl

Dr. Tina Henkin, Adviser

Dr. Charles Daniels Adviser Department of Microbiology Dr. John Reeve UMI Number 9983010

UMI

UMI Microform9983010 Copyright 2000 by Bell & Howell Information and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.

Bell & Howell Information and Learning Company 300 North Zeeb Road P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT

Daunorubicin (daunomycin) and doxorubicin (Adriamycin) are clinically

important antitumor agents produced by Streptomyces sp. strain C5 and

Streptomyces peucetius ATCC 29050. Most anthracyclinones, or lacking a

sugar moiety, are biologically inactive, which underlies the critical nature for

in the biosynthesis of these compounds (Arcamone, 1981 b). Unfortunately, extensive characterizations of glycosyltransferases (GTs) involved in antibiotic

biosynthesis have not been prevalent, primarily due to the limited availability of the often complex required. Recent findings on structure and mechanistic

implications have arisen strictly from sequence analysis and hydrophobic cluster analysis

(HCA) (Saxena et ai, 1995; Fish and Cundliffe, 1997; Kapitonov and Yu, 1999).

Within the Streptomyces sp. stain C5 and Streptomyces peucetius /doxorubicin biosynthetic gene clusters are two putative glycosyltransferase- encoding genes: dnmS and dauH. Biosynthesis of daunorubicin requires one glycosyltransferase-mediated step, believed to be the addition of TDP-daunosmine to e- rhodomycinone forming rhodomycin D. Additionally, higher glycosides of daunorubicin are produced by both Streptomyces species, implicating the need for a second glycosyltransferase activity. I describe here the cloning, overexpression, purification, and analysis of both glycosyltransferases from Streptomyces sp. stain C5. Only DnmS demonstrated the ability to glycosylate e-rhodomycinone to rhodomycin D. The sugar source used in these assays was a strain C5 mutant with only a functional TDP-daunosamine biosynthetic pathway. Kinetic binding data also supported DnmS as the GT responsible for the formation of rhodomycin D. Moreover, analysis of DnmS binding to the different substrates and products allowed for a reaction mechanism to be proposed. Finally, the generation of site-directed mutants of DnmS addressed structure-function relationships, particularly of conserved amino acids involved in binding.

Ill DEDICATION

To my wife Angie, who represents ail that is wonderful and loving in this life, and to our son, Nathan.

IV ACKNOWLEDGMENTS

I wish to thank my adviser. Dr. William Strohl, for his supportive and rational guidance throughout my graduate school career and for his contagious enthusiasm toward scientific discovery and education. I am also deeply indebted to Dr. Nigel Priestley, who supported and enhanced my research greatly and helped me with many technical aspects of my experiments. Additionally, many thanks are in order for Dr. Tyrrell Conway and Dr.

Tina Henkin for serving as “surrogate” advisors near the end of my dissertation work. I would also like to thank Dr. Brian Ahmer for temporary housing and the Department of

Microbiology for financial support during my last year.

I wish to thank former members of the Strohl laboratory. Dr. Michael Dickens, Dr.

Yun Li, Dr. Vineet Rajgarhia, Chuck DeSanti, and Rob Walczak. Their instruction and input were essential to my professional development and their fnendships are invaluable.

Moreover, I would like to thank Dr. Trevor Darcy for years of stimulating discussion, scientific and non-scientific, and Don Ordaz and Jon-David Sears for particularly helping with all of the “little things” . I also wish to thank Dr. Merv Bibb for graciously providing the streptomyces expression vectors and Dr. Ben Liu for help with chemical synthesis concerns.

My family, Angie’s family, and all of our friends receive my full appreciation for love, encouragement, and support throughout my graduate studies. In particular, I wish to thank my father. Dr James Woo, who planted the seed so many years ago. Thus begins the harvest...

Finally, “to Him who sits on the throne, and to the Lamb, be praise, honor, glory, and power, forever and ever. Amen.”

VI VITA

July 9, 1971...... Bom - Mayfield Heights, Ohio

1993...... B S. , Bowling Green State University, Bowling Green, Ohio

1993-present ...... Graduate Teaching and Research Associate, The Ohio State University, Columbus, Ohio

PUBLICATIONS

Research Publications

1. Walczak, R.J., A J. Woo, W.R. Strohl, and N. D. Priestley. 2000. Nonactin biosynthesis; The potential nonactin biosynthesis gene cluster contains type II polyketide-synthetase-like genes. FEMS Microbiology Letters 183:171 -175.

2. Woo, A. J., W. R. Strohl, and N. D. Priestley. 1999. Nonactin biosynthesis: The product of nonS catalyzes the formation of the furan ring of nonactic acid. Antimicrobial Agents and 43:1662-1668.

3. Strohl, W. R , Dickens, M. L , Rajgarhia, V., Woo, A., and N. Priestley. Anthracyclines. In. Strohl WR, ed. Biotechnology of Industrial Antibiotics, 2nd ed. New York: Marcel Dekker, Inc, 1997:577-657.

4. Strohl, W. R., Dickens, M. L , Rajgarhia, V., Walczak, R., Woo, A., and N. D. Priestley. 1997. , molecular biology and - protein interactions in daunorubicin/doxorubicin biosynthesis: Proceedings of the Biotechnology of Microbial Products (BMP 1997). C. R. Hutchinson and J. McAlpine, eds. Developments in Industrial Microbiology. 35: 15-22.

FIELDS OF STUDY

Major Field: Microbiology

VII TABLE OF CONTENTS

Page

Abstract ...... ii

Dedication ...... iv

Acknowledgements ...... v

V ita...... vii

Table of Contents ...... viii

List of Tables ...... xiii

List of Figures ...... xiv

Chapters;

1. Introduction ...... I

Historical significance ...... 1

Daunorubicin and doxorubicin producing Streptomyces spp ...... 5

Daunorubicin and doxorubicin mechanism of action ...... 6

Toxicity associated with doxorubicin therapy ...... 7

Biosynthetic pathway for daunorubicin/doxorubicin production ...... 8

Polyketide synthase-catalyzed aklanonic acid biosynthesis ...... 8

Formation of e-rhodomycinone from aklanonic acid ...... 13

Evidence that e-rhodomycinone is the last aglycone intermediate ...... 17

TDP-daunosamine biosynthesis ...... 18

v iii Page

Conversion of rhodomycin D to doxorubicin ...... 22

Higher glycosides of daunorubicin ...... 23

Quantitative structure-activity relationship - sugar modifications ...... 26

Glycosyltransferases from antibiotic-producing ...... 27

Production of novel antibiotics by recombinant glycosyltransferases 30

Glycosyltransferase reactions in daunorubicin biosynthesis ...... 31

Goals of this study ...... 34

2. Materials and M ethods ...... 36

Bacterial strains, media, and plasmids ...... 36

General genetic manipulations ...... 37

Substrates and authentic standards ...... 39

Analytical m ethods ...... 39

Thin-layer chromatography (TLC) ...... 39

High-performance liquid chromatography (HPLC) ...... 39

Molecular cloning and Southern blotting ...... 40

DNA sequencing and analysis ...... 41

Construction of vectors for disruption of glycosyltransferase genes 42

Polymerase chain reaction-based cloning o f dauH...... 44

Construction of expression plasmids ...... 47

D auH ...... 47

D nm S ...... 48

IX Page

Expression of glycosyltransferases ...... 48

E. coli pTrcHis-based expression ...... 48

Streptomyces expression ...... 49

Purification of glycosyltransferases ...... 50

Purification from recombinant E. c o li ...... 50

Purification fi'om recombinant Streptomyces ...... 50

Removal of polyhistidine tag s ...... 52

Determination of relative molecular masses (Mr) of glycosyltransferases ... 52

Fermentation conditions ...... 53

Western blot analysis of DnmS expression in Streptomyces sp. strain C5 ... 53

Time course of anthracycline production ...... 55

Radiolabeling of E-rhodomycinone ...... 55

Generation of Streptomyces sp. strain mutant C5AW1 and recombinant strains ...... 56

In vivo e-rhodomycinone feeding of recombinant Streptomyces sp. strain C5AW1 ...... 62

TDP-daunosamine; e-rhodomycinone glycosyltransferase assay ...... 63

Glycosyltransfer involving daunorubicin ...... 64

Fluorescence binding assays ...... 64

Further fluorescence studies ...... 65

Construction and analysis of site-directed mutants of DnmS ...... 65 P«£C

3. Results

Molecular cloning of d n m S ...... 67

DNA and deduced sequence analysis and database searches 70

Attempted disruption of glycosyltransferase genes ...... 78

Construction of expression vectors ...... 83

Heterologous expression of DnmS and DauH in S. lividans ...... 88

Protein purification and analysis ...... 91

Determination of molecular weight ...... 94

Time course for anthracycline production and DnmS expression in wild- type strain C5 ...... 94

Generation of mutant strain C5AW1 and recombinant strains ...... 99

In vivo glycosylation...... 104

TDP-daunosamine: e-rhodomycinone glycosyltransferase assay ...... 107

Glycosyltransfer involving daunorubicin ...... 112

Binding assays using fluorescence spectroscopy ...... 112

Site-directed mutagenesis of DnmS ...... 123

4. Discussion

Isolation and characterization of a Streptomyces sp strain CS genomic DNA locus ...... 134

Attempted disruption of glycosyltransferase genes ...... 136

Cloning, expression, and purification of glycosyltransferases ...... 138

Determination of molecular weight ...... 139

x i Pass

Time course for anthracycline production and DnmS expression ...... 140

In vivo glycosylation...... 140

TDP-daunosamine; e-rhodomycinone glycosyltransferase assay ...... 143

Daunorubicin biosynthesis pathway implications ...... 146

Glycosyltransfer involving daunorubicin ...... 147

Binding kinetics ...... 147

Mechanism ...... 150

Site-directed mutagenesis of DnmS ...... 154

5. Summary and Conclusions ...... 161

List of References ...... 165

Appendices ...... 183

Appendix A Table of bacterial strains used ...... 183

Appendix B. Maps of plasmids used ...... 185

Appendix C Table of plasmids generated in this study ...... 196

Appendix D Table of primers used ...... 199

Appendix E Examples o f plots used for -ligand binding analysis ... 202

Appendix F. Circular dichroism spectra of DnmS and mutants ...... 206

Appendix G. Nonactin biosynthesis in Streptomyces griseus A7796 ...... 210

Xll LIST OF TABLES

Table Page

3.1 Calculated binding constants (K d ) and Hill coefficients (N) of DnmS and DauH with various anthracyclinones and anthracyclines ...... 116

3.2 Comparison of e-rhodomycinone binding data for wild-type DnmS with site-directed mutant forms ...... 129

A. 1 Table of bacterial strains used ...... 183

C 1 Table of plasmids generated in this study ...... 196

D .l Table of primers u se d ...... 199

XIII LIST OF FIGURES

Figure Page

1.1 Structures of daunorubicin, doxorubicin, and related anthracyclines 3

1.2 Predicted genes required for doxorubicin biosynthesis and their location within the Streptomyces peucetius ATCC 29050 and Streptomyces sp. strain C5 daunorubicin/doxorubicin biosynthetic gene clusters ...... 9

1.3 Hypothetical steps involved in aklanonic acid biosynthesis in Streptomyces peucetius ATCC 29050 and Streptomyces sp. strain C 5 ...... 11

1.4 Biosynthetic pathway for the conversion of aklanonic acid to e-rhodomycinone ...... 14

1.5 Hypothetical pathway for the biosynthesis of TDP-daunosamine ...... 19

1.6 Proposed conversion of rhodomycin D to doxorubicin by Streptomyces sp. strain C5 DauP, DauK, and D oxA ...... 24

1.7 Proposed reactions catalyzed by glycosyltransferases encoded from genes in the daunorubicin/doxorubicin biosynthetic cluster of Streptomyces peucetius ATCC 29050 and Streptomyces sp. strain C5 ...... 32

2.1 Strategy for the construction of a plasmid, pANTlOOl, containing the complete dauH gene with an artificial £coRI site upstream of the gene’s start codon ...... 45

2.2 Schematic representation of the strategy to generate a Streptomyces sp. strain C5 mutant with only a functional TDP-daunosamine biosynthetic pathway ...... 57

2.3 Strategy for the construction of pANTlO 13 ...... 60

3.1 Southern hybridization of Streptomyces sp. strain C5 genomic DNA using a DNA fragment containing the amino-terminal encoding portion of dnmS as a probe ...... 68

XIV Figure P«ge

3 .2 Slreplomyces sp. strain C5 locus containing d n m S ...... 71

3.3 Hydropathy plot of the 431 amino acids of Dnm S ...... 74

3.4 Hydropathy plot o f the 442 amino acids of D auH ...... 76

3 .5 LINE-UP representation of a PILE-UP comparison (GCG package) of the primary amino acid sequences of glycosyltransferases ...... 79

3.6 Attempted disruption of d au H...... 81

3.7 Southern blot of iEcoRI-digested genomic DNA from Streptomyces sp. strain C5 mutants and putative mutants ...... 84

3 .8 Attempted disruption of ...... 86

3.9 Purification o f denatured DauH and DnmS expressed from the E. coli- based pTrcHis system ...... 89

3.10 Purification o f Hise-tagged DnmS and DauH expressed from pIJ4123- based constructs in Streptomyces lividans T K 24...... 92

3.11 Determination o f the relative molecular mass (Mr) of recombinant glycosyltransferases by gel filtration...... 95

3.12 Time course analysis of Streptomyces sp. strain C5 growth (as measured by dry cell weights), e-rhodomycinone production, and daunorubicin production ...... 97

3.13 Comparison of e-rhodomycinone production and relative DnmS expression in Streptomyces sp. strain C 5 ...... 100

3.14 Construction of mutant strain C5AW1 ...... 102

3.15 Western analysis o f from Streptomyces sp. strains C5 and C5AW1 using anti-DnmS antisera ...... 105

3.16 TDP-daunosamine; e-rhodomycinone glycosyltransferase assay ...... 108

3.17 TDP-daunosamine: e-rhodomycinone glycosyltransferase assay ...... 110

3.18 Daunorubicin glycosyltransferase assay ...... 113

XV Figure Paec

3 .19 Comparison of the effect of TDP on strain C5 glycosyltransferase binding to e-rhodomycinone ...... 119

3 .20 Comparison of the effect of ADP on strain C5 glycosyltransferase binding to e-rhodomycinone ...... 121

3 .21 Comparison of the effect of TDP on DnmS binding to rhodomycin D 124

3 .22 Purification o f DnmS site-directed m utants...... 127

3 .23 Comparison of the effect of TDP on DnmS site-directed mutant binding to e-rhodomycinone ...... 131

4.1 Proposed reaction mechanism for DnmS based upon binding assay results...... 152

4.2 Glycosyltransferase consensus motif ...... 156

B. 1 Map of the E. coli cloning vector pUC 1 9 ...... 186

B .2 Map o f the E. coli protein expression vector pTrcHisA ...... 187

B 3 Map of the 5’/rep/o/n>'ce5 protein expression vector pIJ4123 ...... 188

B .4 Map o f the E. coli cloning vector pKK840 containing the aphi gene .... 189

B .5 Map o f the Streptomyces vector pANT152 containing a portion of the daunorubicin biosynthetic gene cluster ...... 190

B.6 Map o f the E. coli cloning vector pANT841 ...... 191

B .7 Map of the protein expression vector pANT849 ...... 192

B 8 Map of the E. coli-Streptomyces shuttle vector pANT855 ...... 193

B .9 Map o f the E. coli-Streptomyces shuttle vector pANT857 ...... 194

BIG Map of the E. coli-Streptomyces shuttle vector pANT799C ...... 195

E.l Double-reciprocal plot of DauH binding to E-rhodomycinone ...... 203

E.2 Scatchard plot of DauH binding to E-rhodomycinone ...... 204

■ w i Figure Page

E.2 Hill piot of DauH binding to e-rhodomycinone ...... 204

F. 1 Circular dichroism spectrum of DnmS ...... 207

F 2 Circular dichroism spectrum of DnmS ProSOOAla mutant ...... 208

F.3 Circular dichroism spectrum of DnmS Gln340Glu mutant ...... 209

• W l l Chapter 1

Introduction

Historical significance

Anthracyclines are glycosidic derivatives of 7, 8, 9, 10-tetrahydronaphthacene quinones originating biogenetically from polyketide precursors (Brockmann and

Brockmann Jr., 1963). This family o f antibiotics has the widest spectrum of activity in human cancers, with only a few cancers unresponsive to treatment (Weiss, 1992). The first members of the family, {3-rhodomycin I, isorhodomycin, and derivatives, were isolated from Streptomyces purpurascens (ATCC 25489). Rhodomycin, the first anthracycline to be structurally characterized, displayed bactericidal activity against Staphyiococcus aureus but was not pursued further clinically due to its high cytoxicity (Brockman and Bauer,

1950).

In the late I950’s and early 1960’s, independent researchers at Farmitalia Research

Laboratories (now Pharmacia Upjohn) and laboratories at Rhône-Poulenc (now Aventis) isolated a red pigment from Streptomyces peucetius (ATCC 29050) and Streptomyces coert4leorubidus, respectively, that displayed antifungal, antibacterial, and antitumor activities (Arcamone et al., 1961; Cassinelli and Orezzi, 1963; DiMarco et a i, 1963; and

DiMarco et al., 1964). This compound, called daunorubicin in recognition of the efforts

1 of both research groups, showed high activity against acute leukemia in clinical trials in the early I960’s (Weiss, 1992; DiMarcoet ai, 1963; DiMarco et al., 1964 a and b).

Farmitalia in 1969 generated a N-nitroso-N-methyl-urethane-induced mutant o f S. peucetius that produced a 14-hydroxyl analog of daunorubicin, called doxorubicin, or

Adriamycin. This new antibiotic displayed significantly greater antitumor activity and a better therapeutic index over its predecessor, daunorubicin (Arcamone, 1969 a and b;

Bonadonna, 1969; Blum and Carter, 1974). Today, doxorubicin is still one of the most active drugs available for treatment of solid tumors such as those arising in breast, bile ducts, esophagus, and endometrial tissue, as well as osteosarcomas, soft-tissue sarcomas and non-Hodgkin’s lymphoma (Murphy et al., 1995). Daunorubicin, on the other hand, is utilized primarily in acute myeloid leukemia (Weimik and Dutcher, 1992).

Since the discovery of daunorubicin and doxorubicin over thirty years ago, more than 2000 analogs have been isolated from natural sources or by chemical synthesis

(Weiss, 1992; Strohl et al., 1997). Five new anthracyclines have been developed for clinical use worldwide since the FDA approval of doxorubicin in 1973. These include (4-demethoxydaunorubicin), epirubicin (4 ’ -epidoxorubicin), pirarubicin

(tetrahydropyranyldoxorubicin), aclarubicin (aclacinomycin A), and zorubicin (rubidazone)

(Fig. 1.1) (Weiss et al., 1986; Suarato, 1990; Weiss, 1992). Interestingly enougft, a few third generation anthracyclines are currently undergoing clinical trials and include fluoro- substituted derivatives and dissacharide derivatives of doxorubicin (Arcamone et al., 1998;

Arcamone, 1998). Fig. 1.1. Structures of daunorubicin, doxorubicin, and related anthracyclines (Strohl ef oA, 1997). CHîRî

R i R% R3 R4 R s -OH Doxonibicio = o -OH -O C H 3 H Dannornbicta = o -H —OCU3 H -OH CanniBomycin = o -H -OH H -OH -OH Idanibicin = o -H -H H - t f Epirubicin =o -OH -O CH 3 -OH

Pirambicin = o -OH -O C H 3 H i . Baumycin Ai = o -H -O C H 3 H

Zonibicin —WHCO— —H -O C H 3 H -OH

?ig. 1 '1 Daunorubicin and doxorubicin producing Streptomyces spp.

Streptomyces is a genus of Gram-positive, aerobic, mycelia-forming bacteria the

members of which undergo a complex morphological differentiation that includes the

sequential production of substrate mycelium, aerial mycelium, and spores. Concomitant

with morphological differentiation, these organisms undergo biochemical differentiation

during wtiich they produce secondary metabolites, including approximately 55% of the

almost 12,000 antibiotics discovered since 1944 and rouglily 60% of antineoplastic agents, proteases, enzyme inhibitors, restriction endonucleases, and glycohydrolases (Berdy,

1995).

Daunorubicin, doxorubicin and related anthracyclines are produced by a wide variety of Streptomyces spp. Among the known strains are S. peucetius (Arcamone et al.,

1961; Cassinelli and Orezzi 1963; DiMarco et ai, 1963; Grein et a i, 1963; DiMarco et a i, 1964), Streptomyces sp. strain C5 (ATCC 49111) (McGuire et a i, 1980),

Streptomyces sp. strain D788 (Fujii et a i 1986), S. viridochromogenes (Liu and Rao,

1974), S. bifurcus strain 23219 (Mancy and Florent, 1975), S. coeruieontbidus strain

ME 130-A4 (Komiyama et a i, 1977, Takahashi et a i, 1977), Streptomyces strain 8899

(Dubost et a i, 1963; Despois et a i, 1967; Pinnert and Ninet, 1976), Streptomyces strain

JA10092 (Blumauerova et a i, 1977), S. griseoruber (Higashide et a i, 1972), S. griseus

IMET JA5142 (Strauss and Fleck, 1975), and Streptomyces insignis ATCC 31913 (Kem et a i, 1977; Tunac et a i, 1985). Daunorubicin and doxorubicin mechanism of action

As antitumor drugs, anthracyclines display a wide spectrum of activity, primarily due to their ability to affect a number of cellular Amctions, including intercalation of DNA noncovalently, inhibition o f preribosomal DNA and RNA synthesis, and alteration of cell membranes (Graham et al., 1993; Doroshow, 1995; Cutts and Phillips, 1995).

Generation of free radicals by anthracyclines can also be deleterious to certain cellular functions, however, this is not believed to be related to the antitumor activity of these drugs (Weiss, 1992; Doroshow, 1995, Graham er a/., 1993).

The primary activity of anthracyclines on DNA is believed to be through topoisomerase Il-induced DNA strand breakage (Drlica and Franco, 1988; Cullinane et al., 1994; Chen and Liu, 1994; Pommier, 1995). Topoisomerase II catalyzes double strand breakage and religation of DNA and is involved in chromosomal condensation and structure, segregation o f mitotic and meiotic spindles, chromatid separation, and possibly in eukaryotic cells (Liu, 1989). According to a topoisomerase II model proposed by Roca and Wang (1994), doxorubicin and daunorubicin trap topoisomerase II in a drug-enzyme-DNA complex known as the “cleavable complex”.

Inhibition of DNA and RNA synthesis result from formation of this complex, which lead to cessation of cell division, chromosomal abnormalities, and ultimately cell death via apoptosis (Hickman, 1992; Osheroff t?/a/., 1994).

Other findings suggest that anthracyclines are also capable of inhibiting DNA helicases, which can lead to effects such as increased helix rigidity, helix unwinding, and deformation and lengthening of DNA (Bachur et al., 1995). Toxicity associated with doxorubicin and daunorubicin therapy

The quinone nature of anthracyclines allows the transfer of one and two electron

reductions by these compounds, resulting in the formation of highly reactive products.

These toxic products, which include superoxide, peroxide, and hydroxyl radical,

can cause damage at cellular, nuclear and mitochondrial membranes, sarcoplasmic

reticulum, and macromolecules, such as DNA (Myers et a i, 1977; Doroshow, 1988). The reduction of doxorubicin to doxorubicinol and a free radical semiquinone intermediate is believed to be the specific cause of myocardial cell death (Shan et a/., 1996; Speyer and

Wasserheit, 1998). However, the actual cytotoxic activity of anthracyclines probably involves a very complex set of interactions between the drug and cellular components

(Cutts and Phillips, 1995).

Damage to heart tissue is a toxicity unique to doxorubicin and other anthracyclines, limiting lifetime dosages from 500 to 600 mg/m^ (Fischer et al., 1993;

Shan et a i, 1996). Heart muscle cells contain a large number of mitochondria in which qui none-derived free radicals are generated, yet lack the appropriate defense mechanisms, such as antioxidant enzymes, for adequate protection (Hale and Lewis, 1994). The acute cardiac toxicities that result include EGG changes, arrhythmias, including atrial premature contractions, premature ventricular contractions, and atrial flutter or fibrillation (Speyer and Wasserheit, 1998). Additional side effects due to daunorubicin and doxorubicin therapy include nausea, gastrointestinal disturbances, myelosuppression, and hepatotoxicity (Arcamone, 1981 a and b; Strohl era/., 1997). Biosynthetic pathway for daunorubicin/doxonibicin production

Almost the entire daunorubicin/doxombicin biosynthetic gene cluster from

Streptomyces peucetius and Streptomyces sp. strain C5 has been sequenced (Strohl et a i,

1997). A 20 kbp continuous region of the two clusters shows 93% DNA similarity and greater than 95% identity at the amino acid level. Figure 1.2 outlines all of the genes identified fi'om the S. peucetius and Streptomyces. sp. strain C5 daunorubicin biosynthetic gene clusters, as well as their involvement in the pathway. Most of the information discussed here concerning anthracycline biosynthesis is taken from research conducted on both organisms.

Daunorubicin biosynthesis is achieved by four primary processes; 1) polyketide synthase-catalyzed formation of aklanonic acid; 2) conversion of aklanonic acid to e- rhodomycinone; 3) dideoxy-aminosugar formation and transfer to e-rhodomycinone; and

4) conversions of glycosidic intermediates to daunorubicin and doxorubicin. Most of the enzymatically catalyzed steps have been identified by a variety of methods including: characterization of blocked mutants, analysis of individual enzymatic steps, sequence homologies, and precursor feeding experiments (Strohl et a i, 1997).

Polyketide synthase-catalyzed aklanonic acid biosynthesis.

The first recognized chromophore in the daunorubicin/doxorubicin biosynthetic pathway is aklanonic acid. Biosynthesis of this early intermediate is accomplished by the condensation of nine Cz units derived from malonyl coenzyme A (CoA) onto a propionyl starter moiety (Fig. 1.3). The resulting Czi polyketide structure is then reduced at C-9,

8 Fig. 1.2. Predicted genes required for doxorubicin biosynthesis (Strohl et oL, 1997) and their location within the Streptomyces peucetius ATCC 29050 and Streptomyces sp. strain CS daunorubicin/doxorubicin biosynthetic gene clusters. Dps denotes genes encoding proteins involved in polyketide synthase reactions; dnm denotes genes encoding proteins involved in duanosamine biosynthesis and attachment; drr denotes genes encoding proteins conferring resistance. H* ro C=i I. M N 0 (IrrA drrB drrD Y dnniZ |diiniV diimll

— I f dnmj I doiA V II | Z dnniT H E dpsFdpsEG dpsA dpsG

dpsB dpsC dpsl) C D K P dnraQ dnraS drrC

2.0 kbp Fig. 1.3. Hypothetical steps involved in aklanonic acid biosynthesis in Streptomyces peucetius ATCC 29050 and Streptomyces sp. strain C5. Enzymes predicted or proven to be involved in catalysis include: DpsA, the ketoacyl synthase a homolog

(KASa); DpsB, the ketoacyl synthase P homolog (KASp); DpsC, a putative E. coll

KASriI homolog without the active site ; DpsD, a putative acyltransferase; DpsE, the polyketide reductase; DpsF, the polyketide cyclase;

DpsG, the acyl carrier protein; and DauG, a 12-deoxyaklanonic acid oxygenase

(Grimm etoL, 1994; Ye era/., 1994; Strohl era/., 1995; Rajgarhia and Strohl, 1997).

II Propioayt*SCoA

9 X mmWmyl-SCeA

D##A. OpsB. OpiG

9 C O i

SE o

o o oo

OpsC. DpsF. Da«G

4 H iO

F'lg. 1.3 12 cyclized, aromatized, and oxidized at C-I2 to form aklanonic acid (Strohl et al., 1989;

Strohl and Conners, 1992; Hutchinson, 1995; Strohl et a i, 1997). The entire set of reactions is catalyzed by a complex of enzymes analogous to E. coli fatty acid biosynthesis enzymes, called polyketide synthase (PKS) enzymes (Grimm et al., 1994; Ye et al., 1994).

Specifically, the complex involved in daunorubicin biosynthesis is a type II PKS, characterized by multiple mono- or bifunctional gene products that synthesize polyketides via an iterative mechanism.

The Streptomyces sp. strain C5 and Streptomyces peucetius ATCC 29050 PKS complex includes the following gene products and functions. DpsA, the ketoacyl synthase a homolog (KASa); DpsB, the ketoacyl synthase (3 homolog (KASp); DpsC, a putative E. coli KASm homolog without the active site cysteine residue; DpsD, a putative acyltransferase; DpsE, the polyketide reductase; DpsF, the polyketide cyclase; DpsG, the acyl carrier protein; and DauG, a 12-deoxyaklanonic acid oxygenase (Grimm et al., 1994;

Y q et a i, 1994; Strohl et a i, 1995; Rajgarhia and Strohl, 1997). Minimally, DpsA,

DpsB, DpsE, DpsF, DpsG, DauG, and Daul, a transcriptional activator, are required for the production of aklanonic acid in a non-anthracyciine-producing Streptomyces host

(Rajgarhia and Strohl, 1997). The remaining functions provided by DpsC and DpsD, unique to the daunorubicin PKS system, are involved in starter unit selectivity.

Formation of E-rhodomycinone from aklanonic acid.

Conversion of aklanonic acid to e-rhodomycinone is accomplished by four enzymatic steps (Fig. 1.4). The reactions were confirmed by the isolation of single and

13 Fig. 1.4. Biosynthetic pathway for the conversion of aUanonic acid to e- rhodomycinone. Enzymes involved in catalysis are: OauC, aklanonic acid ; DauD, aklanonic acid methylester cyclase; DauE, akiaviketone reductase: and DauF, aklavinone 11-hydroaylase (Dickens etoL^ 1995; Madduri and

Hutchinson, 1995).

14 ?rooionvi-CûA - x Mïlonvi-CoA

ZOOM

OH 0 OH OH

A Uuonic Acid

O m C

OH O OH OH

AkluoDic Acid M ethvl

OmmO

OH ZOOCH.

DaaF

OH OH OH 0 OH 0

\Uavikeione Mafgiemvcin

0 « h E OaaE

OH ZOOCH.

OaaF

Akmvmone c-Rhoaomvcmone

1.4 double mutants of Streptomyces sp. strain C5 blocked in daunorubicin biosynthesis and in

vitro analysis (Bartel et a i, 1990; Conners et a i, 1990; Dickens et ai, 1995; Dickens et a i, 1996).

The homodimeric product of the danC gene, aklanonic acid methyltransferase, catalyzes the S-adenosylmethionine dependent conversion of aklanonic acid to its methyl ester (Dickens et al., 1995; Madduri and Hutchinson, 1995b). Subsequent cyclization of the methyl ester to akiaviketone via an aidol condensation is catalyzed by DauD (Dickens etal., 1995; Madduri and Hutchinson, 1995b; Kendrew er a/., 1999). Reduction of the 7-

0 X0 moiety of akiaviketone to a hydroxyl group is accomplished by akiaviketone reductase, encoded by the dauE gene. DauE is also capable of reducing maggiemycin, a shunt product that accumulates in dauE mutants, to e-rhodomycinone, although at reduced eflBciency (Conners et a i, 1990).

The product of the DauE reaction, aklavinone, is the major intermediate common to all of the anthracyclines o f the daunorubicin-aclacinomycin-rhodomycin families (Strohl et a i, 1989). Conversion of aklavinone to the final aglycone precursor, e-rhodomycinone, is catalyzed by DnrF, an apparent fiavoprotein that hydroxylates at C-11 (Hong et ai.,

1994; Filippini et a i, 1995; Hwang et a i, 1995; Kim et a i, 1996). The presence o f the

11-hydroxyl group on intermediates confers an orange/red color to the compound, whereas absence of this moiety results in a yellow color Interestingly, aclacinomycin antibiotics, derived from aklavinone and structurally similar to daunorubicin, do not have hydroxyl groups at C-11 (Oki et a i, 1975; Oki et a i, 1979 a and b).

16 Evidence that E-rhodomycinone is the last aglycone intermediate.

Yoshimoto et al. initially proposed that e-rhodomycinone was glycosylated to rhodomycin D (lO-carbomethcxy-13-deoxycarminomycin) based on products observed from blocked mutants of Streptomyces sp. strain D788 (Yoshimoto et a i, 1986). Other product formation and bioconversion studies have also supported this hypothesis, including studies on Streptomyces sp. strain C5 (Yoshimoto et aL, 1980 a and b; Reddy et al., 1985; Bartel et al., 1990). Chemical mutagenesis of strain C5 resulted in a high frequency of mutants that accumulated e-rhodomycinone, suggesting multiple mutation targets (e.g., sugar biosynthetic genes) (Bartel et al., 1990). Additionally, e- rhodomycinone is the major anthracycline product in many daunorubicin fermentations and can be converted to daunorubicin and related glycosides by Streptomyces species

(McGuire et al., 1980; Yoshimoto et al., 1980 a and b). The accumulation of this intermediate suggests a “bottleneck” in daunorubicin biosynthesis, perhaps due to the convergence of the aglycone biosynthetic pathway and the TDP-daunosamine biosynthetic pathway. Finally, the absolute specificity of carminomycin 4-O-methyltransferase (now called anthracycline 4-O-methyltransferase) for 4-hydroxyanthracycline glycosides indicates that glycosylation must precede méthylation (Conners et al., 1990; Conners and

Strohl, 1993; Strohl et a i, 1997). Thus, based on the above observations it is hypothesized that E-rhodomycinone is the primary aglycone substrate for the TDP- daunosamineianthracyclinone giycosyltransferase in Streptomyces sp. strain CS and

Streptomyces peucetius.

17 TDP-daunosamine biosynthesis

The precise pathway for the biosynthesis of TDP-daunosamine has not been elucidated. However, a hypothetical pathway can be constructed based on sequence homologies to known sugar biosynthesis enzymes and mutagenesis of putative daunosamine biosynthesis open reading frames (Fig 1.5). The first proposed reaction, trans-thymidyiylation of glucose-1-phosphate, is believed to be catalyzed by the product of the cinmL gene based on sequence similarities to known thymidylyltransferases (Gallo et aL, 1996). Subsequent conversion of TDP-glucose-1-phosphate to the 4-keto-6-deoxy derivative involves TDP-glucose 4,6, dehydratase, which has been purified from

Streptomyces sp. strain C5 and S. peucetius (Thompson et aL, 1992; Gallo et aL, 1996)

Both enzymes show similar kinetic and inhibition patterns, as well as pH optima, however, they possess very different amino-terminal amino acid sequences.

The product of dnmM, a gene within the daunorubicin biosynthetic cluster that encodes a 4,6-dehydratase homolog, is enzymatically inactive in S. peucetius due to a natural frameshift mutation in the open reading frame (Gallo et aL, 1996) As a result, a gene outside of the daunorubicin cluster must be responsible for catalysis at this step, thereby contributing to the accumulation of e-rhodomycinone seen in S. peucetius fermentations (Strohl et aL, 1997). An S. peucetius dnmMr.aphll mutant produced less daunorubicin and doxorubicin when compared to the wild-type strain, confirming the involvement of another locus (Olano, et aL, 1999). The authors could not provide a reason for the decrease in anthracycline products seen with this mutant. However, complementation of this mutant with a repaired dumM slightly increased the amount of

1 8 Fig. 1.5. Hypothetical pathway for the biosynthesis of TDP-daunosamine. Gene products putatively involved in the conversion of glucose-1-phosphate to TDP- daunosamine are indicated for each step. DnmS is the postulated giycosyltransferase that catalyzes the addition of TDP-daunosamine to e- rhodomycinone (adapted from Strohl e t al.., 1997).

19 : h .o h CH.OH

O m m L ► O

HO HO OTOf OfCK OTDP 1 OH OH OH TDP-^-keto-6-deoxy. Glucose* i-phosphate TDP-O-fiucosc 0-fiucose i DmmU o CH. CH. ]TDP OTOP ^ error OH OH OH TDP-2.6-4>kcia>L-rliamnose ketohexuiose

NH, donor D#mj c H,0 O OH cooat. o O aaV CH. CH OH or DP XH. OH o OH ÛH c-Rhodomvcinone TDP-2.6-deoxv-•-amino- rO P-daunosam me •-ketonexuiose

Rhodomvcm D

Fig. 1.5 20 daunorubicin produced and almost doubled the amount of doxorubicin, when compared to the wild-type strain.

DnmU shares sequence similarity with known NDP-4-keto-deoxyhexulose-3, 5- epimerases, such as orf4 from S. griseus, and may be involved in the conversion o f the D- sugar TDP-4-keto-6-deoxy-D-glucose to the L-sugar, TDP-4-keto-L-rhamnose (Kriigel et al., 1993). Disruption of S. peucetius dnmU resulted in a strain that accumulated e- rhodomycinone, linking the activity to TDP-daunosamine biosynthesis; however, the sugar substrate and product have not been fully confirmed (Otten et aL, 1997).

Formation of TDP-daunosamine from TDP-4-keto-L-rhamnose theoretically requires three to four enzymatic steps. Dehydration of the latter sugar to TDP-2,6-deoxy-

3,4-keto-L-hexulose can be catalyzed by two possible candidates located within the daunorubicin gene cluster. DnmT, which was shown to be required for daunosamine biosynthesis, may catalyze 2-dehydration of TDP-4-keto-L-rhamnose to form the diketo intermediate (Scotti and Hutchinson, 1996). Homologs of dnmT in Streptomyces antibioticus and Streptomyces vioiaceoruber are involved in C2-deoxygenation (Olano et ai, 1999). Conversely, DnmQ, a P-450-like protein without the characteristic heme- binding cysteine required for oxygen transfer, could catalyze successive oxidations analogous to the reactions catalyzed by DoxA (see later) (Otten et a i, 1995; Strohl et a i,

1997). Disruption of both genes by insertional mutagenesis demonstrated their requirement for TDP-daunosamine biosynthesis but did not ultimately prove functionality

(Otten et a i, 1995; Scotti and Hutchinson, 1996). Additional work demonstrated that

2 1 dnmO is not essential for glycoside biosynthesis; however, the absence of the gene product

results in reduced glycoside levels (Olano et al., 1999).

TDP-2,6-deoxy-3,4-ketohexulose serves as the substrate for DnmJ, an enzyme

with sequence similarity to known transaminases (Madduri and Hutchinson, 1995a). The

product of the transamination reaction, TDP-2,6-deoxy-3-amino-4-ketohexulose, is

reduced to the final product, TDP-daunosamine, by DnmV. Disruption of the gene, the presence of an NADH-binding site, and similarity to putative NDP-4-ketodeoxyhexulose ketoreductases all suggest DnmV is the proper candidate to catalyze this final step (Otten et a l, 1997). Two other genes, dnm W (formerly dpsH in S. peucetius-, dauZ in strain C5) and dnmZ, were implicated to be involved in TDP-sugar biosynthesis by gene disruptions, but, were found to be non-essential (Olano et al, 1999).

Conversion of rhodomycin D to doxorubicin

Conversion of rhodomycin D ( 10-carboxy-13 -deoxycarminomycin) to doxorubicin requires the following events; (a) déméthylation of the Cl 6 methoxy residue; (b) removal of the resultant free CIO carboxyl moiety; (c) at C13 with subsequent oxidation to a keto-group; (d) O- of the C4 hydroxyl group; and (e) hydroxylation at C14. Three enzymes, DauK, DauP, and DoxA, are capable of carrying out these functions in Streptomyces sp. strain CS and were identified using in vitro assays with cell free extracts or purified enzymes (Conners et a l, 1990b; Conners et a l, 1993;

Madduri et al, 1993; Scotti and Hutchinson, 1995, Dickens et a l, 1995; Dickens and

2 2 Strohl, 1996; Walczak et a i, 1999). Figure 1.6 shows the proposed pathway for conversion of rhodomycin D to daunorubicin, doxorubicin, and baumycin A 1/A 2 .

The product of the dauK gene was purified from both Streptomyces sp. strain C5 and S. peucetius, and the strain CS methyltransferase was shown to convert 13- dihydrocarminomycin to 13-dihydrodaunorubicin and carminomycin to daunorubicin

(Conners et aL, 1990b; Conners et a i, 1993; Madduri et a i, 1993; Scotti and

Hutchinson, 1995). Recently, the product o f the doxA gene from Streptomyces sp. strain

C5 was purified to homogeneity and biochemically characterized (Walczak et aL, 1999).

This particular cytochrome P-450 monooxygenase demonstrated broad substrate specificity for anthracycline glycosides, yet conversion of daunorubicin to doxorubicin was not a favored reaction. As a result, the primary anthracycline flux through the late steps of the daunorubicin biosynthetic pathway catalyzed by DoxA may be directed through the 4-

O- methyl series of anthracyclines. The product of the dauP gene has not been thoroughly examined; yet, preliminary data suggest that it works in concert with DauK in decarboxylating the 10-position of 10-carboxy-glycone substrates (Strohl et al., 1997).

Higher glycosides of daunorubicin

Analysis of the natural products produced by Streptomyces coeruieorubidus in the late 1970’s resulted in the discovery of a new group of antitumor anthracyclines related to daunorubicin, called baumycins (Komiyama et aL, 1977; Takahashi et aL, 1977). Since then, baumycins have been identified as significant products from cultures o f Streptomyces peucetius ATCC 29050 (Oki et a!., 1981), Streptomyces sp. strain D-788, Streptomyces

23 Fig. 1.6. Proposed conversion of rhodomycin D to doxorubicin by Streptomyces sp. strain C5 enzymes DauP, DauK, and DoxA (Dickens et a t, 1997). Enzymes catalyzing each step are labeled at each reaction and include: DoxA, K (DauK), F

(DauP), and KR, an uncbaracterized C 13 ketoreductase. Bullets represent chemical conversion processes. Abbreviations: AKRB, akrobomycin; BADC, bis~ anhydro-13-deoxycarminomycinone; BADD, Aw-anbydro-13-deoxydaunomycinone;

BAU, baumycin A1/A2; CAR, carminomycin; CDOC, lO-carboxy-13- deoxycarminomycin; CDOD, 10-carboxy-13-d eoxydaunorubicin; DAU, daunorubicin; DHC, 13-dibydrocarminomycin; DHD, 13-dibydrodaunorubicin;

DOC, 13-deoxy carminomycin ; DOD, 13-deoxydaunorubicin; DOX, doxorubicin;

MAKR, 4-O-metbyl-akrobomycin; MRHO, 4-O-metbyl-rbodomycin D; RHOD, rhodomycin D.

24 AKM

BAOC

2 ^

KRIlOoxA

Fig. 1.6

25 insigtiis ATCC 31913 (Fujii et al., 1986), and several Actinomadura strains (Matsuzawa et a i, 1981; Ogawa et aL, 1981; Uchida et a i, 1988). Additionally, McGuire et ai.

(1980) demonstrated that baumycins A 1/A2, epimers at Cl” or C3”, were some of the major anthracyclines produced in Streptomyces sp strain C5 fermentations. Additional natural baumycin analogs, such as barminomycins, rubeomycins, and others have been described (Matsuzawa e/a/., 1981; Ogawa era/., 1981; Uchida e/a/., 1988).

Baumycins are structurally identical to daunorubicin, except for a seven carbon acetai moiety on the C-4’ hydroxyl of daunosamine (Fig. 1.1) (Takahashi et aL, 1977).

The origin of the acetai substituent is believed to be in nature, which suggests addition to daunosamine via a glycosyitransferase-mediated reaction (Umezawa et aL, 1981). Moreover, disruption of the Streptomyces peucetius dnrH, a gene with sequence similarity to known glycosyltransferases, resulted in the disappearance of products believed to be baumycins A 1/A2 (Scotti and Hutchinson, 1996). Definitive structural proof however, is still unavailable. Disruption of another S. peucetius gene, durX, also resulted in the lack of metabolites presumed to be higher glycosides of doxorubicin, due to their acid-sensitive nature (Lomovskaya et aL, 1998).

Quantitative structure-activity relationships (QSAR) - sugar modifications

As stated previously, most anthracyclines lacking a sugar moiety are biologically inactive and modifications of the sugar residues can immensely affect the efficacy and cardiotoxicity of the drug. For instance, N, N-dimethyl sugar derivatives of daunorubicin and doxorubicin are approximately 10-fold more active against L1210 leukemia cells than

26 are the parental compounds (Arcamone, 1981). Similarly, N-demethyl derivatives of

aclarubicin are apparently less cardiotoxic than their parent compound (Arcamone, 1981;

Johdo, 1992).

The structure and stereochemistry of the carbohydrate side chains greatly influence

tissue distribution, cellular uptake, and intracellular distribution o f the anthracyclines

(Weiss et aL, 1986). As a result, analogs with isomeric configuration changes as well as

structural changes have been synthesized Modifications at the 4’- position of daunosamine have resulted in a number of novel anthracyclines with improved pharmacological properties. Epirubicin (4' -epidoxorubicin), a doxorubicin derivative that contains the L-arabino form of the sugar, is currently on the market worldwide as an alternative treatment for a variety of cancers (Fischer et al., 1993). Another doxorubicin derivative, esorubicin (4 ' -deoxydoxorubicin), contains the L-threo configuration of the sugar and displays lower cardiotoxicity, but reduced antitumor activity as well (Weiss et a i, 1986). Yet another analogue that possesses potential for widespread clinical use is pirarubicin, a 4 ' -tetrahydropyrany 1 derivative of doxorubicin. This drug displays similar activity to doxorubicin with significantly less cardiotoxicity (Hirano et aL, 1994).

Glycosyltransferases from antibiotic-producing organisms

Glycosyltransferases are enzymes that catalyze the addition of carbohydrate moieties to acceptor molecules, thereby forming a diverse array of compounds, such as polysaccharides, , glycolipids, and antibiotic glycones. Quantitatively, glycosyl-transfer reactions are amongst the most important biotransformations on Earth,

27 since they account for the biosynthesis and degradation of the majority of biomass (Kleene and Berger, 1993). These reactions are also biologically important as exhibited by their presence in a variety of systems including cellular structure, storage, and signaling pathways. However, despite the ubiquity of glycosyltransferases, little is known about their structure or mechanism. In particular, structures and biochemical functions of glycosyltransferases involved in antibiotic biosynthesis have not been examined or characterized until recently.

A number of glycosyltransferases from antibiotic-producing organisms have now been identified including oleD, olel, oleGl, and oleG2 involved in oleandomycin biosynthesis and resistance (Vilches et a i, 1992; Hernandez et aL, 1993; Quiros and

Salas, 1995; Olano et aL, 1998; Quiros et aL, 1998), mtmGl, and mtmGII involved in mithramycin bioysynthesis (Fernandez et aL, 1998), gimA involved in spiramycin resistance (Gourmelen et aL, 1998), tylN and tylM2 involved in tylosin biosynthesis (Fish and Cundlifie, 1997; Wilson and Cundliffe, 1998), mgt involved in macrolide resistance

(Jenkins and Cundliffe, 1991; Cundliffe, 1992), and dnrS and dauH involved in doxorubicin biosynthesis (Otten et aL, 1995; Dickens et aL, 1996; Scotti and Hutchinson,

1996).

Most of the glycosyltransferases were identified by insertional inactivation of the putative genes or by in vitro assays with cell-free extracts and nucleotide-glucose as the sugar donor. However, extensive biochemical characterization of glycosyltransferases associated with antibiotic production or resistance has been limited, primarily due to the lack of commercially available sugar substrates. In addition, difficulty in the chemical

2 8 synthesis of the modified deoxysugars has prevented in-depth experimentation on these

enzymes.

Consequently, only three glycosyltransferases, Olel and OleD from Streptomyces

antibioticus and Mgt from Streptomyces lividans TK21, have been well characterized.

Olel, a 56 IcDa monomer, intracellularly glucosylates oleandomycin, providing resistance

to S. antibioticus (Quiros and Salas, 1995; Quiros et aL, 1998; Quiros et aL, 2000).

Upon export to the environment, oleandomycin is reactivated by an extracellular

glycosidase, encoded by the oleR gene The reaction catalyzed by Olel proceeds by a

compulsory-order mechanism in which the aglycone (oleandomycin) binds first to the

enzyme, followed by UDP-glucose. A ternary complex is formed prior to glucose transfer

and subsequent release of UDP and glycosylated oleandomycin. Specificity of Olel is

limited to oleandomycin, as demonstrated by negligible glucosyltransferase activity on

other macrolides. Conversely, OleD is a 51 kDa giycosyltransferase that is capable of

transferring the glucose moiety of UDP-glucose to a number of different macrolides

(Quiros et aL, 2000). The reaction also proceeds by a compulsory ordered mechanism,

similar to that of Olel.

Mgt of S. lividans is active against a wide range of cyclic polyketide lactones but is

specific for the 2 -OH group on the sugar moieties attached to either C-5 or C-3 of the lactone ring (Cundliffe, 1992). Like Olel, Mgt also provides resistance to antibiotics, specifically macrolides, by the addition o f glucose (from UDP-glucose) to the drug.

However, the host strain S. lividans TK21 does not produce macrolides, bringing into question the physiological role for this enzyme. Sasaki et aL (1996) discovered that

29 macrolide giycosyltransferase activity is present in fifteen other Streptomyces strains,

primarily poiyketide-producing strains. The widespread presence of this activity among

antibiotic-producing Streptomyces suggests that macrolide resistance may have spread via

successive gene transfer events and provides an ecological advantage for the hosts

Production of novel antibiotics by recombinant glycosyltransferases.

A primary goal for elucidating biochemical parameters of glycosyltransferases associated with antibiotic biosynthesis is to provide an alternative method for the production of novel antibiotics. Other enzymes have been used in the production of new drugs on the basis of relaxed substrate specificity, such as the UrdE oxygenase fi-om S. fradiae and the alkavinone-II-hydroxylase (DnrF) fi'om S. peucetius expressed in heterologous Streptomyces hosts (Decker and Haag, 1995; Hwang et aL, 1995).

Theoretically, the generation of novel drugs using glycosyltransferases can be accomplished by altering either the site of sugar attachment or the attachment of a modified sugar into a position where the natural sugar is normally present.

Enzymatic glycosylation may allow for the production of stereo-specific giyco- products, perhaps with enhanced biological activity. Solenberg et al. (1997) demonstrated the production of hybrid monoglycosylated glycopeptides by the in vitro glucosyltransferase activity of gene products from Amycolatopsis orientaiis on vancomycin derivatives. The gene products, GtfB and GtfE’ expressed in E. coli, transferred glucose to aglycosyl vancomycin (AGV) in the presence of TDP-glucose or

UDP-glucose to produce desvancosaminyl vancomycin (DW ) Moreover, GtfE’

30 incubated with biosynthetic cores of the teicoplanin heptapeptide class resulted in glucosylated products bioactive against Micrococcus luteus. Integration of gtfE ' under the control of the strong emtEp* into the chromosome of Streptomyces toyocaemis, a producer of two “giycopeptide” aglycones without their corresponding sugar residues, also resulted in the production of a novel product with antibacterial activity.

More recently, a novel erythromycin B derivative was generated by interspecies complementation o f Saccharopolyspora erythraea mutants with the oleGl/G2 genes, which encode glycosyltransferases from Streptomyces antibioticus (Doumith et al.,

1999). This was the first example of an unrelated sugar (L-rhamnose, which is not involved in macrolide biosynthesis) being transferred to an aglycone antibiotic precursor to generate a novel compound.

Glycosyltransfcrase reactions in daunorubicin biosynthesis

Within the Streptomyces sp. strain CS daunomycin biosynthetic pathway there are two proposed glycosyltransferase-mediated steps; 1) condensation of e-rhodomycinone and TDP-daunosamine to form rhodomycin D; and 2) addition of a seven carbon carbohydrate to daunorubicin to form baumycin A1/A2 (Fig. 1.7). Both of the proposed steps play important roles in the biological activity o f these antibiotics, as well as in the quantity produced. Most anthracyclinones, or anthracyclines lacking a sugar moiety, are biologically inactive, and as a result, the glycoside intermediates of the daunorubicin

31 Fig. 1.7. Proposed reactions catalyzed by glycosyltransferases encoded from genes in the daunorubicin/dozorubicin biosynthetic cluster of Streptomyces peucetitts ATCC

29050 and Streptomyces sp. strain C5. A) Glycosylation of daunorubicin by DauH with a carbohydrate of unknown origin. B) DnmS-catalyzed addition of daunosamine to e-rhodomycinone forming rhodomycin D.

32 on B) C 'O O C ii, H- A) Oq on

on 0 on On OCII, Ô DAUNORDHICIN

c RIIODOMYCINONI': o nr OnmS

Nil o on C( XK’II, on

Daull ... on 0 Ul u* () Oil ()

Aon

Nil, ()(’

RHODOMYCIN I) UAIIMYCIN AI/A2

II,( Nil

I HOC IK II, (*’ll2 (*'IM)II (*11011

(*• 11, pathway are more bioactive than the aglycones (Arcamone, 1981b). Additionally, 8-

rhodomycinone and baumycin A1/A2 are the anthracyclines produced in the greatest

quantities by Streptomyces sp. strain C5 (McGuire et a i, 1980; Strohl et a i, 1997).

Whether production o f the intermediates is due to catalytic inefficiency or regulation of

the associated enzymes remains to be solved.

The Streptomyces sp. C5 gene cluster contains two open reading frames with

sequence similarity to known glycosyltransferases involved in antibiotic biosynthetic

pathways. These genes, dmnS and dauH, encode enzymes which contain the conserved

“glycosyltransferase motif’, LPxxAAxxHHGGAGTxxxAxxAGxPQxxxP, recently

proposed by Fish and Cundliffe (1997). Otten and co-workers complemented a S. pence tins mutant that accumulated only E-rhodomycinone with dnmS on a high copy

number plasmid, restoring daunorubicin production (Otten et al., 1995). As mentioned

previously, disruption of the chromosomal S. peucetius dnrH gene resulted in the loss of

an anthracycline believed to be baumycin or perhaps 4 ’-daunosaminyIdaunomycin (Scotti

and Hutchinson, 1996). However, unequivocal proof of function for both enzymes is

lacking.

Goals of this study

This dissertation describes the results of my studies on the biochemistry and mutagenesis of glycosyltransferases involved in the Streptomyces sp. strain C5 daunorubicin/doxorubicin biosynthetic pathway. The primary goals o f this research were to determine the function for each of the glycosyltransferases, as well as to biochemically

34 characterize the enzymes via kinetic analysis, and identify structure/function relationships using site-directed mutagenesis.

Realization of these goals would introduce future researchers to the specifics of the reaction mechanism of glycosyltransferases involved in antibiotic biosynthesis and the role of conserved amino acids in glycosyltransferase activity Further biochemical analysis of these enzymes could lead to a better understanding of factors that influence substrate specificity, catalytic efficiency, or other components that influence binding or catalysis.

Understanding these factors can thereby enhance the synthesis of existing drugs or hirther the synthesis of analogues with better pharmacological properties.

This work begins with a description of experiments performed to isolate, express, and purify glycosyltransferases from the Streptomyces sp. strain C5 daunorubicin/doxorubicin gene cluster. Both recombinant enzymes were successfully purified and analyzed for glycosyltransfer activity Determination of function by in vitro and in vivo conversion assays was aided by the generation of a strain CS mutant containing only the daunosamine biosynthetic pathway, as well as other mutants in genes involved in aglycone biosynthesis. Anthracycline binding by both glycosyltransferases was also examined using fluorescence spectrometry. Dissociation constants were determined for a number of anthracyclines and insights into the reaction mechanism of DnmS were gleaned from these experiments.

Additionally, several site-directed mutants in conserved residues of DnmS were generated and examined for alterations in catalysis and substrate binding relative to the wild-type enzyme. Disruption of Pro^^^ negatively impacted nucleotide sugar binding; however, the precise role o f this residue remains unclear

35 Chapter 2

Materiab and Methods

Bacterial strains, media, and plasmids

Streptomyces sp. strain CS ATCC 49111, originally obtained from the Frederick

Cancer Research Center, has been previously characterized (Bartel, 1990) and

Streptomyces lividans TK24 was obtained from D. A. Hopwood. Cultures of strain CS

were grown in nitrate-dehned medium plus yeast extract (NDYE) (Dekleva and Strohl,

1987) or R2YE solid medium (Hopwood et al., 198S). Recombinant S. lividans TK24

cultures were grown in YEME medium supplemented with 20% sucrose with kanamycin

at a concentration of 10 pg/ml (Hopwood et al., 198S). Escherichia coli DHSa

(Hanahan, 1983) or Top 10 (Invitrogen, San Diego, California) were used to propagate

plasmids and maintain the partial genomic library of Streptomyces sp. strain CS

chromosomal DNA. E. coli was grown in Luria-Bertani (LB) or SOB medium and

introduction of plasmids into cells was achieved by standard procedures (Sambrook et al.,

1989). Ampicillin was added at a concentration of SO-100 pg/ml to cultures of E. coli

harboring plasmids. Plasmids constructed and used in this work are described in

Appendices B and C.

36 General genetic manipulations

Procedures for protoplast formation, transformation, and regeneration for

Streptomyces lividans TK24 are outlined in Hopwood et al. (1985). Similar procedures for Streptomyces sp. strain C5 are described in detail by Lampel and Strohl (1986).

Restriction mapping and other routine molecular methods used in this work are described by Sambrook et al. (1989).

Plasmids from E. coli and Streptomyces were routinely prepared by the methods described by Carter and Milton (1993). Recombinant E. coli DH5a cultures were grown overnight at 37" C in 3 ml LB broth containing 100 ng/ml ampicillin. Recombinant

Streptomyces cultures were grown in the same volume of YEME or 2X Bacto Tryptic Soy

Broth (TSB, Difco Laboratories, Detroit, MI), with the appropriate antibiotic for 48-72 h at 30° C (Hopwood et al., 1985). Cells were pelleted by centrifugation and resuspended in buffer A for E. coli (25 mM Tris-HCl, 10 mM EDTA, pH 7.4) or buffer B for

Streptomyces (25 mM Tris-HCl, 10 mM EDTA, pH 8.0). Lysozyme treatment (2.0 mg/ml for 1-2 h) was required for Streptomyces cultures before treatment with 200 pi lysis solution (0.2 M NaOH, 1% SDS). Cleared mixtures were combined with 200 pi neutralization solution (3 M potassium acetate, pH 4.8) and mixed by inversion until a white precipitate formed. Suspensions were spun in a microfuge for 5 min at 14,000 x g and the supernatant was removed to a clean tube containing 1 ml of resin solution (10%

[w/v] diatomaceous earth in 4 M guanidine thiocyanate, 20 mM Tris-HCl, 5 mM EDTA, pH 7.5. After inversion for 1-2 min, the resin/supematant mixture was passed through a

“Wizard” minicolumn (Promega, Madison, Wisconsin) and the filtrate discarded. The

37 column, which contained the plasmid DNA bound to the resin, was washed with 2.0 ml of

buffer C (200 mM NaCl, 20 mM Tris-HCl, 5 mM EDTA, pH 7.5, and 50% ethanol (v/v).

The washed column was spun in a microfuge to remove any residual buffer C and

transferred to a new 1.5 ml tube. Fifty to 100 |il of water was added to the column and

the DNA was eluted from the resin by centrifugation.

Chromosomal DNA from Streptomyces sp. strain C5 was isolated by a procedure

described by Pospiech and Neumann (1995). Strain C5 was grown in 50 ml of 2X TSB

for 2-3 days at 30° C. Cells were pelleted by centrifugation and resuspended in 5 ml of

SET buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris-HCl, pH 7.5). Lysozyme was added to a final concentration of 1 mg/ml and the mixture was incubated at 37° C for 45 min. Half a ml of 20% sodium dodecyl sulfate (SDS) was then added to the lysozyme- treated cells along with proteinase K (final concentration of 0.5 mg/ml) and the mixture incubated at 55° C with occasional inversion for 2 h. Two ml of 5 M NaCl and 6 ml of chloroform were added with frequent and gentle inversion of the mixture at room temperature for 0.5 h. After centrifugation at 4500 xgfbr 15 min, the aqueous phase was transferred to a clean tube using a blunt-ended pipette tip. RNase A was added to a final concentration of 0.04 mg/ml and the suspension was incubated for 45-60 min at 37° C.

After RNase treatment, an equal volume of isopropanol was added and genomic DNA was isolated by spooling the precipitate at the aqueous solution/isopropanol interface with a glass Pasteur pipette. The spooled DNA was transferred to a new microfuge tube, washed with 70% ethanol, and resuspended in 0.5-1.0 ml TE buffer, depending on the yield.

38 Substrates and authentic standards

Rhodomycin D was obtained from the Chemical Synthesis Branch, National

Cancer Institute (NCI), Beltsville, M d , as NSC 263854-H and the structure confirmed previously (Dickens et al., 1997). Daunorubicin and doxorubicin were purchased from

Calbiochem (La Jolla, CA). Authentic e-rhodomycinone and 13-dihydrodaunorubicin were also obtained from NCI

Analytical methods

i). Thin-layer chromatography (TLC). Dried organic extracts containing

anthracyclines were resuspended in 10 pi of methanol and spotted onto 20 cm x 20 cm x

0.25 mm aluminum-backed silica gel TLC plates (Whatman, Clifton, New Jersey) with authentic standards run in parallel and co-chromatographed. TLC plates were developed using a mobile phase of chloroform; methanol: acetic acid: water (80:20:16:6) (glycone solvent system) or heptane: chloroform: methanol (10:10:3) (aglycone solvent system) and anthracyclines were detected using UV irradiation at 365 nm. Rf values for each o f the substrates and products used are described elsewhere (Dickens, 1997) ii). High-performance liquid chromatography (HPLC). Dried organic extracts containing anthracyclines were resuspended in 50-100 pi methanol, separated, and quantified by HPLC using a Bio-Rad Hi-Pore® RP-318 (250 x 10 mm) reversed-phase column (Richmond, California) with a mobile phase of methanol water (65:35) brought to a pH of 2.0 with 85% phosphoric acid. A Waters model 600E multi-solvent delivery pump and controller and a model U6K 0-2 ml manual injector were used. Anthracyclines

39 were detected at 470 nm with a Waters model 486 tunable absorbance detector and with a

Waters 470 scanning fluorescence detector The wavelength used for excitation of

anthracyclines was 479 nm and the emission wavelength was 550 nm Data were analyzed

using “Baseline 815” software and a 386 SX IBM-compatible computer When necessary,

peak integration was performed by the software to determine quantitative values. The

elution times of enzyme assay products were compared to times of authentic standards run

in parallel. Retention times for the anthracycline standards were, in minutes: e-

rhodomycinone, 42.6; rhodomycin D, 22.7; daunorubicin, 21.5; carminomycin, 31.3; and

dihydrodaunorubicin, 15.8.

Molecular cloning and Southern blotting

To isolate the entire dnm S gene ftom the Streptomyces sp strain C5 chromosome,

a partial genomic library was constructed and probed with the 5’ portion of the dnmS gene

identified previously (Dickens, 1997). Chromosomal DNA from Streptomyces sp. strain

C5 was digested with 5pHI, Kpnl, £coRI, SphVKpnl, and EcoRUSphl and fractionated by

gel electrophoresis. DNA was transferred to BA-85 nitrocellulose filters

(Schleicher and Schuell, Inc., Keene, New Hampshire) and blots were hybridized to a ^^P-

labeled 1.4 kb BamHi fragment from pANT140 containing the amino-terminal encoding

region of the dnmS gene. DNA probes were labeled with the Prime-it® U Random Primer

Labeling Kit (Stratagene, La Jolla, California) in the presence of a-^^P dCTP (3000

Ci/mmole). Probes were hybridized to filters in a solution of 5X SSPE, 3X Denhardt’s solution, 5% SDS, and ISO pg/ml fragmented salmon sperm DNA at 68° C for 12-20 h

40 (Sambrook et a i, 1989). Filters were washed twice in IX SSPE/0.1% SDS for 5 min at room temperature and twice in 0 IX SSPE/0.1% SDS for 15 minutes at 42° C. Blots were exposed to film for 3-24 h depending on the strength of the hybridization signal.

SphVKpnl digested chromosomal DNA fragments from 2-4 kb were isolated from agarose gel pieces and were used to construct a partial, pUC19-based genomic library in

E. coli. The library was screened using the same labeled fragment as previously described under identical hybridization and wash conditions. DNA from colonies that hybridized to the probe was isolated and Southern analysis performed again to confirm the positive clones.

DNA sequencing and analysis

A 2.5 kb SphVKpnl fragment containing the dnm S gene and downstream regions was cloned and sequenced on both strands by the dideoxynucleoside chain termination method using Sequenase Version 2.0 (United States Biochemical Corp., Cleveland, Ohio), universal and sequence-specific primers, and a-thio-^^S-dCTP (1000 Ci/mmol; Dupont-

New England Nuclear, Boston, Massachusetts) (Sanger et o/., 1977). Conditions for sequence analysis are described in the literature accompanying the Sequenase enzyme

(United States Biochemical Corp., Cleveland, Ohio). 7-Deaza-dGTP nucleotide mixes were substituted for dGTP to reduce compressions.

DNA was also sequenced using the ABI PRISM Dye Terminator Cycle

Sequencing Ready Reaction Kit (Perkin-Elmer, Fostor City, California). One microgram of DNA to be sequenced was added to 3.2 pi of 1 pM primer (0.16 pM final

41 concentration), 8 |il Ready Reaction mix, 1 |xl dimethyisulfoxide (DMSO), and water up

to 20 pi. Mixtures were subjected to the polymerase chain reaction (PCR) (Saiki et a i.

1985; Muilis et al. 1986) for 25 cycles of the following: 95° C for 30 sec; 50° C for 15

sec; 60° C for 4 min . PCR products were precipitated with ethanol, resuspended in 25 pi

suppression reagent, and analyzed on an ABI model 310 automated sequencer (Perkin-

Elmer, Fostor City, California).

Open reading frames (ORFs) were assigned based on third position G+C bias and

codon usage distinct to Streptomyces genes using FRAME (Bibb et a i, 1984) and

CODON PREFERENCE (Wright and Bibb, 1992) algorithms with IBM-PC programs

(Kleman and Strohl, 1993). Sequences were compared with those in the databases using

BLAST and PSI-BLAST (Altschul et a/., 1997). Amino acid alignments were obtained

using programs in the Wisconsin Genetics Computer Group Package (Devereux et a/.,

1984). Hydropathy plots were constructed using the scale generated by Kyte and

Doolittle (1982).

Construction of vectors for disruption of glycosyltransferase genes

Attempts were made to individually replace chromosomal copies of dnm S and daiiH with aphi, encoding neomycin phosphotransferase (Thompson et a/., 1982). The dauH disruption constructs were generated by subcloning a 2.4 kb Nrul-Eco91 fragment

from pANT152, containing dnmT, dauH, and dattE, into pANT841 (see Appendix B and

C). Then, a 1.4 kb B g lll fragment from pKK840, containing the ap h i gene, was inserted into the BamlU. site within dattH, in both orientations, resulting in pANT 1009a and b.

42 Constructs for disruption of dnmS were generated by digestion of pANTlOOT with 55/EII,

followed by filling in the digested ends by Klenow (Gibco BRL, Gaithersburg, Maryland).

A blunt-ended £coRI-///>k/III fragment from pKK840 containing aphI was inserted into

the modified pANTI007 in both orientations. The resulting plasmids were called

pANT1003a and b (Appendix C). All four disruption constructs were first introduced into

E. coli ET 12567 by standard techniques and then into wild-type Streptomyces sp. strain

C5 by PEG-mediated transformation (Lampel and Strohl, 1986; Sambrook e t al„ 1989).

After 18-22 h at 30° C, regenerated protoplasts were challenged with 10 pg/ml neomycin

sulfate (Sigma, St. Louis, Missouri) and plates were further incubated at 30° C. After 5-7

days, neomycin resistant transformants were transferred to new R2YE plates with the

same concentration o f neomycin and grown at 30° C.

Genomic DNA from several transformants was isolated and fractionated on 0.8%

agarose gels. DNA was transferred to nitrocellulose filters and Southern hybridizations

performed as described previously. For examination of dauH disruption, either a 1.7 kb

Hindlll-Sstl fragment or a 0.7 kb iÏjÆII fragment from pANT1009 (depending on the predicted orientation of the disruption construct) was used as a probe. Examination of dnmS disruption employed the use of a 0.6 kb N col or 1.3 kb Apal fragments from pANT1003 as probes (depending on the orientation o f the mutant). Blots were exposed to film for 3-24 h, depending on the strength of the hybridization signal.

43 Polymerase chain reaction-based cloning ofdauH

A fragment containing the entire dauH gene was previously isolated from

Streptomyces sp. strain C5 and cloned into a pUC19-based vector resulting in pANTI52

(Dickens, 1997). Subcloning of the individual dauH gene was accomplished with the aid of the polymerase chain reaction (PCR) (Saiki et a i, 1985; Muilis et a i, 1986). A standard reaction was carried out for 25 cycles using Pftt polymerase (0.5 |il) (Stratagene,

La Jolla, California) and the following components: 2 td dimethyisulfoxide; 16 o f 2 mM dATP, dCTP, dGTP, and dTTP, 5 nl of I OX Pfit polymerase buffer (Stratagene, La

Jolla, California), 5 jal (50 pmol) each of designed primers (described below), 17.5 nl water, and 2 |j.l (10 ng) DNA template. Primers were designed for cloning the amino- terminal encoding region of dauH while introducing an £coRl restriction enzyme site directly upstream of the gene’s start codon to facilitate expression from the m pA promoter of pANT849 (Fig. 2.1) (Appendix D). The polymerase chain reaction was carried out by incubating the reaction mixture at 95° C for 5 minutes without Pfu polymerase, followed by 25 cycles of 95° C for 30 sec (dénaturation), 55° C for 30 sec

(annealing), and 72° C for 2 min (extension). After the cycles were completed, the mixture was incubated at 72° C for 5 min and held at 4° C until further use.

PCR products were separated by agarose gel electrophoresis (0.8%) and the DNA band corresponding to the correct size was excised and eluted from the gel using previously described methods (Carter and Milton, 1993). The modified dauH gene was reconstructed by cloning the upstream PCR amplified region and the downstream region

44 Fig. 2.1. Strategy for the construction of a plasmid, pANTIOOl, containing the complete dauH gene with an artificial £coRI site upstream of the gene’s start codon.

Plasmid pANTlSZ is described in Dickens, 1997.

45 PC»

pANTIOOO an»#

‘ig. 2.1

46 excised from pANTI52 into pUC19 (Fig. 2.1). The construct (pANTlOOl) was

confirmed by sequencing using the dideoxynucleoside chain termination method.

Construction of expression plasmids

Both dnmS and dauH genes were cloned into E. coli pTrcHis vectors (Invitrogen,

San Diego, California) and the streptomycete expression vectors, pANT849, pANT857

(DeSanti et a i, 2000) and pU4123 (Takano et a i, 1995) (Appendix B).

DauH. An £'coRI-^/>u^ fragment containing the modified dauH gene from pANTIOOl,

was excised and ligated into pANT849 by standard cloning techniques (pANT1002)

(Sambrook et a i, 1989). Conversely, cloning into pTrcHis and pLJ4123 involved

introduction of novel restriction enzyme sites and amplification of the modified genes by

PCR (as described above) to ensure proper expression. For generation of a pTrcHis-based

construct, an X hol site was introduced directly upstream of the DauH start codon.

However, an Ndel site that contained the DauH start codon was constructed for cloning the gene into pH4123 Both cloning strategies utilized primers identical to wild-type sequences downstream of dattH in addition to the primers containing the modified upstream sequences (Appendix D). PCR products were ligated directly into pTrcHisA as

X hol-H indm fragments (pANTlOM) or into pUC19 as Ndel-EcoBI fragments.

Transformation of Æ. coli Top 10 with these constructs followed established procedures described previously. Inserts from constructs confirmed by restriction digests were sequenced on both strands by dideoxynucleoside sequencing. The N del-E coR l insert

47 containing the modified dauH gene was subsequently ligated into pU4l23 (pANT1037).

Introduction of streptomyces vectors into S. lividatis TK24 was accomplished by

transformation as described by Hopwood et al. (1985).

DnmS. Strategies to clone cbtmS into each of the three expression vectors were similar to

those employed for dauH. Cloning into pANT849 required introduction of a novel Sph\

site upstream of the gene’s start codon and amplification by PCR. This product was

directly cloned into pANT849 as an Sphl-EcoBl fi-agment (pANT1008). Generation o f

pTrcHis constructs also incorporated a unique X hol site directly upstream of the DnmS

start codon and amplification by PCR (Appendix D). The product with the modified dnm S gene was ligated into pTrcHisA as an X hol-E coK l fragment followed by

introduction into E. coli Top 10 (pANT1015). The strategy for cloning dnm S into

pIJ4123 was identical to that used for cloning dauH, with construction of a novel N del site within the start codon, PCR amplification, ligation into pUC19, and transformation into E. coli. After sequencing, the insert was ligated into pU4123 and cloned into S. lividans TK24 (pANT1028).

Expression of glycosyltransferases

£1 coli pTrcHis-based expression. For overexpression of glycosyltransferases by the pTrcHis system, single transformants of E. coli Top 10 with pANT10l4 or pANTlOlS were grown overnight at 37° C in 3 ml SOB supplemented with ampicillin (50 pg/ml).

Overnight cultures of 0.2 ml were used to inoculate 50 ml of SOB plus ampicillin and cultures were incubated at 37° C until an ODeoo o f approximately 0.6 was reached.

48 Isopropylthio-|3-D-galactoside (IPTG) was added to cultures at a final concentration of 1

mM and incubation continued for another 4 h. Cells were harvested by centrifugation

(10,000 for 10 min) and cell lysates were prepared as described in the XPRESS system manual (Invitrogen, San Diego, California). Soluble and insoluble fractions were generated and analyzed by SDS-PAGE. Initial expression conditions for both His-tagged glycosyltransferases resulted in insoluble proteins. Thus, growth and induction conditions were altered in an attempt to produce soluble enzymes. Among the conditions altered include variation of media (LB, YT) and media composition (e.g., addition of sucrose), incubation temperature (30° C, 25° C, 20° C), IPTG concentration (0 1 mM, O.OI mM), and induction times (1-4 h).

Streptomyces expression. S. lividans TK24 (pANT1028) or (pANT1037) spore preparations were used to inoculate 50 ml of YEME with kanamycin at a final concentration of 10 pg/ml. Cultures were grown for 60 h at 30° C and the entire volume was used to inoculate 500 ml YEME with 10 pg/ml kanamycin. Incubation at 30° C continued for another 15 h before thiostrepton was added at a concentration of 10 pg/ml to induce expression from the lipA promoter. Induction proceeded for an additional 15 hours at 30° C and cells were harvested and stored at -70° C until further use.

Expression of DnmS and DauH in S. lividans TK24 containing pANT849-based constructs was achieved following conditions utilized by Dickens et al. (1996).

Recombinant YEME cultures with 10 pg thiostrepton per ml were grown for 48-72 h, pelleted, and stored at -70° C for future use.

49 Purification of glycosyltransferases

Expression/production in Escherichia coiL Purification of polyhistidine-tagged glycosyltransferases from recombinant E. coli Top 10 cultures was carried out using Ni^*- nitrilotriacetic acid (NTA) spin columns (Qiagen, Santa Clara, California) under denaturing conditions. Induced cultures containing pANT10l4 or pANTlOlS were resuspended in Buffer B (8 M urea, 0.1 M NaHzP 04, 0.01 M Tris-HCl, pH 8.0) and cells were lysed by incubation and agitation for 1 h at room temperature. After centrifugation

(10,000 X g, 20 min), supernatants were collected and loaded onto Ni^-NTA columns.

The columns were washed with 3-5 column volumes o f Buffer C (8 M urea, O.l M

NaH^PO^, 0.01 M Tris-HCl, pH 6.3) and enzymes were eluted with Buffer E (8 M urea,

0.1 M NaH2? 04, 0.01 M Tris-HCl, pH 4.5). Fractions containing purified proteins were examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli (1970). Gels were run at 15 mA per gel using a Mini-Protean gel apparatus (Bio-Rad, Hercules, California) and proteins visualized by silver staining

(Oakley era/.. 1980).

Expression/production in Streptomyces. Enzyme purification steps under native conditions were carried out at 4° C and solutions were maintained on ice when applicable.

Frozen mycelia of Streptomyces lividans TK24 (pANT1028) or Streptomyces lividans

(pANT1037) from 500 ml cultures were thawed and resuspended in 15 ml buffer containing 50 mM potassium phosphate, pH 7.4, 400 mM NaCl, 20 mM imidazole, 10% glycerol (v/v), 2 mM MgSÛ4, 5 mM P-mercaptoethanol, 0.5% Tween 20, and 1 mM

50 phenylmethylsuifonyi fluoride (PMSF) (Buflfer A). Cells were disrupted by several

passages through a French pressure cell (American Instrument Co., Urbana, IL) at 16,000

psi. The crude mycelial extracts were clarifled of unbroken mycelia and insoluble material

by centrifugation at 16,000 x g for 45 min The supernatants were Altered through glass

wool to remove any remaining particulate matter and then the protein solutions were

loaded onto columns containing 10 ml o f Ni^^'-NTA resin (Qiagen, Santa Clara,

California). The columns were washed with Buffer B (identical to Buffer A except with

40 mM imidazole) at a flow rate of 0.5 ml/min for 3-5 column volumes. Proteins were eluted by addition of Buffer C (identical to Buffer A except with 400 mM imidazole) at a

flow rate of 0.6 ml/min; 1 ml fractions were collected. Protein quantity and purity were examined by SDS-PAGE (Laemmli, 1970) and visualized by silver staining (Oakley et a i,

1980).

If glycosyltransferases were not puriAed to homogeneity by the initial affinity chromatography step, fractions containing the glycosyltransferases were pooled and concentrated to less than 1 ml Anal volume using Centricon-30 concentrators (Amicon,

Beverly, MA). Approximately 400 pi of the concentrated protein solution was added to a

Superose 6 HR 10/30 fast protein liquid chromatography (FPLC) column (Pharmacia

LKB Biotechnology, Uppsala, Sweden) at a flow rate of 0.25 ml/min. Proteins were detected at 280 nm using a Waters model 486 tunable absorbance detector and 200-300 pi fractions were collected. Fractions were again analyzed for protein purity and quantity by

SDS-PAGE analysis followed by silver staining as described previously.

51 Removal of polyhistidine tags

Removal of the N-terminal His6 from purified glycosyltransferases was accomplished by thrombin cleavage as described by Parry and Li (1997). Cleavage buffer

(200 mM Tris-HCl, pH 8.4, 1.5 M NaCl, 25 mM CaCh) and human plasma thrombin

(31.7 units) (Sigma Chemical Co., St. Louis, Missouri) were added to purified glycosyltransferases and the solutions incubated for 3 h at 25° C. Samples were analyzed by SDS-PAGE to ensure efficient cleavage and the thrombin was removed by gel filtration chromatography.

Determination of relative molecular masses (Mr) of glycosyltransferases

The approximate molecular weights of DauH and DnmS were determined by comparison to protein standards of known molecular weight (Gibco BRL, Gaithersburg,

MD) when separated on SDS-polyacrylamide gels (10-12%) visualized by silver (Oakley etal.^ 1980) or Coomassie staining (Blakesley and Boezi, 1977).

The apparent molecular weights of recombinant DauH and DnmS were determined by gel filtration chromatography. Purified glycosyltransferases and protein molecular weight standards (Boehringer Mannheim, Indianapolis, IN) were run on a Superose 6 HR

10/30 column. A standard curve was derived from the molecular weights and elution times of the following protein standards, cytochrome c (12.5 kDa); chymotrypsinogen A

(25 kDa); albumin (hen egg) (45 kDa); bovine serum albumin (68 kDa); aldolase (rabbit muscle) (158 kDa); catalase (beef liver) (240 kDa); and ferritin (450 kDa). The void volume was determined by running 10-20 pg blue dextran (2 MDa) through the column.

52 The ratio of the elution volume to void volume of recombinant DnmS and DauH was used to interpolate the Mr from the linear plot o f the logarithm of the native Mr of the standards as a function o f elution volume to void volume. Additionally, the presence of proteins in elution peaks was confirmed by analysis o f fractions by SDS-PAGE.

Fermentation conditions

Cultures of wild-type Streptomyces sp. strain C5 were grown in 50 ml of NDYE media supplemented with 2.25% glucose for 48 h at 30° C (Dekleva and Strohl, 1987).

At the end of the incubation period, the total volumes of the seed cultures were used to inoculate 500 ml of the same media and incubation proceeded for another 24 h at the same temperature. Entire overnight cultures were then used to inoculate 10-L of NDYE.

Fermentative cultures were incubated at 30° C with agitation (250 rpm) and aeration (10

L/min) for 7 d. Twenty ml samples were taken over the course of the fermentations and were stored at -70° C until further use.

Western blot analysis of DnmS expression in Streptomyces sp. strain C5

Samples from 7 d Streptomyces sp. strain C5 lO-L NDYE cultures were thawed and three milliliters from each time point were pelleted in a microfuge. Pellets were washed and resuspended in 0.5 ml buffer containing 25 mM Tris-HCl, 10 mM EDTA, pH

8.0, and 1 mM PMSF. Cells were lysed by sonication (three cycles at 15-sec intervals each for 1 min total) (Virtis, Gardiner, New York). After centrifugation for 20 min at

12,000 X g, the supernatants were removed to new tubes and the protein concentrations

53 were determined by the method of Bradford (1976). Equivalent amounts of total protein

(1-5 (xg) were loaded onto 10% SDS-polyacrylamide gels and electrophoresis run as

described previously.

Proteins from the gels were transferred to nitrocellulose membranes using a Mini

Trans-Blot electrophoretic transfer cell (Bio-Rad, Hercules, California) and 1 L of

Transfer Buffer (20 mM Tris, 66 mM ). Transfer at 4° C was complete after 10-12

h at 30 V. Blots were blocked with TBS/TW buffer (25 mM Tris-HCl pH 8.0, 125 mM

NaCl, 0.1% Tween 20) with 4% BSA for 1-2 h and then incubated with anti-DnmS

antibody diluted 1 ; 1000 to 1 ;5000 in TBS/TW buffer for 2 h.

Antisera to DnmS were raised in rabbits by injection of purified, denatured DnmS

from E. coli (pANT1015) by ICN Pharmaceuticals, Inc. Antisera from the eighth and

ninth week bleeds were used as sources of anti-DnmS polyclonal antibodies. Blots were

washed six times at ten minutes each with the same buffer and then incubated with a

1:1000 dilution of anti-rabbit Protein G-horseradish peroxidase conjugate (Bio-Rad,

Hercules, California) for 1 h. After three additional ten minute washes with TBS/TW

buffer, blots were developed and visualized using the SuperSignal™ CL Substrate System

(Pierce, Rockford, Illinois) followed by exposure to film. Additionally, relative intensity

values for each cross-reactive band were obtained with the aid of a STORM™ fiuohmager

(Molecular Dynamics, Sunnyvale, California).

54 Time course of anthracycline production

One milliliter samples of Streptomyces sp. strain C5 whole broth from 10-L fermentations were brought to pH 8.5 and extracted three times with equal volumes of chloroform methanol (9.1). Dried anthracycline extracts were resuspended in 250 pi of methanol and filtered using Nylon Acrodisc' 13, 0.2 pm filters (Pall Gelman, Ann Arbor,

Michigan). Twenty pi samples were injected onto a Hi-Pore® reversed phase column

(Bio-Rad, Richmond, California) with detection by UV 470 nm and fluorescence

(excitation; 470 nm, emission: 570 nm). Integration of the area o f relevant peaks was accomplished using “Baseline 815” software.

Radiolabeling of e-rhodomycinone. Fifty-milliliter cultures of Streptomyces sp. strain

C5 danH #54 mutants (Bartel, 1990) that accumulate e-rhodomycinone were grown for

48 h at 30° C in NDYE media. Fifty pCi of [I-'^C] acetate (sodium salt) (58 mCi/mmol) and 50 pCi o f [l-'^C] propionate-sodium salt (51 mCi/mmol) were added and the cultures further incubated for an additional 72 h at 30° C. Anthracyclinones were extracted from the cultures at the completion of the incubation periods and the labeled e-rhodomycinone was separated from other aglycones by TLC using the previously described aglycone solvent system. The purity of e-rhodomycinone was analyzed by TLC and autoradiography, e-rhodomycinone was quantified at 409 nm by interpolating a small amount of the purified compound to a linear plot of known amounts of e-rhodomycinone plotted against their respective absorbance values at 409 nm (e^oe = 1850 for 1 cm path

55 length). The specific radioacti ity ranged from 0.5-1.0 mCi/mmol, as determined by

scintillation counting.

Generation of Streptom yces sp. strain mutant CSAWl and recombinant strains

Giycosyltransferase assays require a sugar acceptor and a sugar donor. The

proposed acceptor for the DnmS-catalyzed reaction, e-rhodomycinone, was available in

large quantities; however, attempts to obtain the sugar donor, TDP-daunosamine, were

not successful. As a result, biological sources of TDP-daunosamine were investigated

Theoretically, a Streptomyces sp. strain C5 mutant could be generated that only contained

a functional TDP-daunosamine biosynthetic pathway In other words, aglycone biosynthesis (PKS and other early reactions), as well as reactions subsequent to glycosylation would be disrupted (Fig. 2.2). Following restoration of glycosyltransferases on expression vectors, various substrates would be fed to the recombinant mutants to look at substrate specificity o f the glycosyltransferases. In addition, extracts from this mutant would be used with e-rhodomycinone to examine giycosyltransferase activity by purified

DnmS or DauH. This aglycone-minus mutant offers the advantage over wild-type strain

C5 of having a background absent of anthracyclines as well as the absence of functionalities that could interfere with assays.

To generate a Streptomyces sp. strain C5 mutant with only a functional TDP- daunosamine biosynthetic pathway, a three-part cloning strategy was employed to disrupt most of the genes involved in aglycone formation and post-glycosylation reactions (Fig.

2.2). Unfortunately, to generate this mutant one proposed sugar biosynthetic gene, dnmQ,

56 Fig. 2.2. Schematic representation of the strategy to generate aStreptomyces sp. strain C5 mutant with only a functional TDP-daunosamine biosynthetic pathway.

Genes involved in aglycone biosynthesis as well as post-glycosylation reactions were disrupted.

57 |X Propioiily.SCoA 9X MaloayLSCoA

dpsA, dpsBt dpsG, (dpsC, dpsD) COOH o_ 0 0 0

0000

iQjsE, dpsF, dauG X' COOH ccccr Akianonic Add OH O OH OH

dauD, dauE CHtOH

O OH OCOCHj dnmQTJVU ^H^ e.Rhodomydnone ZMWL u OH OH O OH ÔH Ghicose-l-phosphatc Æ > O H ] OTDP NHi TOP daunmamiae O OH OCOCHi

ccccrOH O OH O Rhodomydn D

OH

dauKf d m P 1 >O V^ OH

OH R = H Daunorubidn H /1 O 0 » o R = OH Doxonibidn

7 5 ^

F ig . 2 .2

58 was disrupted (Fig. 2.3). Thus, recombinant strains of the mutant would have to be generated containing cbmQ on an expression vector to ensure that all of the TDP- daunosamine genes were present.

A 5.2 kb Sstl fragment from pANT152 containing the complete dauZ, dnmT, dauH, dauE genes and a partial dpsF gene was subcloned into pANT841 (Fig. 2.3;

Appendix C). The aphi gene, which encodes neomycin phosphotransferase (Thompson et a i, 1982), was introduced into the first construct as a 1.2 kb BglH -Kpnl fi'agment fi-om pKK840. Finally, a 2.5 kb ClaV-Hindlll fragment from pANT1008 containing a partial cbvnQ, a complete dnmS, and a partial drrC was introduced into the second construct, resulting in the disruption construct, pANT1013. This plasmid was used to transform

Streptomyces sp. strain C5 protoplasts as previously described (Lampel and Strohl, 1986).

After 18-22 h at 30° C, regenerated protoplasts were challenged with 10 pg/ml neomycin sulfate (Sigma Chemical Co., St. Louis, Missouri) and further incubated at 30° C. After

5-7 days, resistant transformants were transferred to liquid TSB media with neomycin at a final concentration of 1 pg/ml.

Genomic DNA from several neomycin-resistant transformants was isolated and fractionated on 0.8% agarose gels Southern hybridizations were performed as described previously using a 0.8 kb P stl fi'agment containing portions of the dpsF and aphI genes as a probe. Blots were exposed to film for 3-24 h depending on the strength of the hybridization signal.

59 Fig. 2.3. Strategy Tor the construction of pANT1013. Approximately 9 kb of the daunorubicin biosynthetic cluster of Streptomyces sp. strain C5, containing genes encoding enzymes involved in aglycone biosynthesis and post-glycosylation reactions, were replaced hy the a p h gene. i

60 ■Ajrrxi

Fig. 2.3 61 Since generation of the Streptomyces sp. strain CS AWl mutant deleted dnmQ, a putative

daunosamine biosynthetic gene, and probably dnmS by polar efiects, both functionalities were restored to the mutant (Madduri and Hutchinson, 1995b). The dnmS gene was

restored to the mutant to analyze glycosylation by in vivo feeding of potential substrates

(see next section). DNA fragments containing both genes individually and together were

ligated into pANT857, a streptomyccte-E. coli shuttle vector o f pANT849 (Appendix B).

The following constructs were cloned into mutant strain C5AW1; pANT1021 (dnmQ),

pANT1025 (dttmQ, dnmS), and pANT1027 (dnmS) by PEG-mediated transformation

(Lampel and Strohl, 1986).

In vivo e-rhodomycinone feeding of recombinant Streptomyces sp. strain C5AW1

Recombinant Streptomyces sp. strain C5AW1 with pANT1021, pANT1025, or pANT1027 cultures were grown for 48 h in 50 mi ofNDYE with thiostrepton (10 pg/ml) at 30° C. Forty pg C'^-labelled e-rhodomycinone (0.2-0.5 mCi/mmol) were added to each culture and incubation continued for another 12 h. Anthracyclines were extracted as described previously.

Initial difficulties in detecting conversion of e-rhodomycinone to rhodomycin D in the recombinant C5AW1 mutants led to speculation that rhodomycin D was unstable under the ascribed conditions. As a result, the genes encoding the enzymes responsible for conversion of rhodomycin D to more stable products, dauK and dauP, were also returned to the mutant (Dickens et al., 1997). The resulting construct, pANT1034, contained

62 dauK, dauP, dnmQ, and dnmS. The new recombinant strains were grown as 50 ml NDYE cultures, fed E-rhodomycinone, and anthracyclines extracted as described previously.

TDP-daunosamine: E-rhodomycinone giycosyltransferase assay

Streptomyces sp. strain C5AW1 (pANT1021) cultures were grown in 50 mi

NDYE and were harvested after 4-5 d. Cells were resuspended in 3 ml of buffer containing 50 mM potassium phosphate buffer pH 7.0, 100 mM NaCL 20 % glycerol and were lysed by several passages through a French pressure cell (1,000 PSIGXAmerican

Instrument Co., Urbana, Illinois). After centrifugation for 45 min at 4500 % g, the amount of protein in the supernatants was quantified by the method of Bradford (1976).

Supernatant at 0.5-1.0 ml was added to 200 pg purified, soluble DnmS or DauH along with 0.1 mM ’^C- e-rhodomycinone (0.5 mCi/mmol) or unlabelled e-rhodomycinone.

Assays were incubated at 30° C for 5 h and anthracyclines were extracted and analyzed by

TLC and HPLC, as described elsewhere. Additionally, extracts of Streptomyces sp. strain

C5 dauE mutant (A21) (Bartel, 1990), without proteins, were also used as sugar sources in the giycosyltransferase assays to see if more efficient conversion could be obtained.

Removal of proteins from mutant extracts was accomplished through trichloroacetic acid precipitation, followed by centrifugation and neutralization of the supernatant (Lovrien and Matulis, 1995).

63 Glycosyltransfer involving daunorubicin

The presence of higher glycosides of daunorubicin led to speculation that a giycosyltransferase exists in Streptomyces sp. strain C5 capable of using daunorubicin as a substrate. DnmS and DauH were tested for giycosyltransferase activity on daunorubicin usirig extracts of Streptomyces sp. strain C5AW1 (pANT1021) or S. lividans as sugar sources. Assays were performed as described previously for e-rhodomycinone and examined by TLC and autoradiography.

Fluorescence binding assays

Dissociation constants (Ko) of DnmS and DauH for various anthracyclines were determined fluorometrically with the use of a LS50B Luminescence spectrometer (Perkin

Elmer, Foster City, California) with 5.0 nm excitation and emission slits. The wavelengths used for excitation of anthracyclines were: 479 nm for e-rhodomycinone and rhodomycin

D, 470 nm for daunorubicin, 459 nm for doxorubicin, 400 nm for aklavinone.

Anthracyclines were resuspended in 3.0 ml buffer (0.025 M potassium phosphate, pH 7.2,

0.250 M NaCI, 0.05% Tween 20, 10% glycerol) at final concentrations of 0.5 or 1.0 tiM.

Purified protein was added in small aliquots until saturation was observed to obtain an initial estimate of the Ko Subsequent binding assays used substrate concentrations of 0.2

K d , 0.5 K d , K d , 2 K d , and 5 K d , as recommended by Cleland (1963). Fluorescence spectra of proteins and buffer alone were also determined and the results subtracted from the experimental spectra. Fluorescence values corresponding to the wavelength that showed the maximal difference between substrate alone and substrate saturated with

64 enzyme were plotted as double-reciprocal, Scatchard, and Hill plots. Subsequent fluorescence maxima (Fm»), Kd, and Hill coefficient values (N) were determined by nonlinear least-squares regression. All fluorescence determinations were performed minimally in duplicate at ambient (room) temperature.

Further fluorescence studies

The effects of nucleotides and nucleotide-sugars on giycosyltransferase binding to anthracyclines were examined using the same fluorescence-based approach as described in the previous section. For further examination of DnmS and DauH binding to e- rhodomycinone and rhodomycin D, TDP, ADP, TDP-glucose, and ADP-glucose were added to the antfiracycline and protein solutions at various concentrations and emission spectra observed. Data were plotted as double-reciprocal, Scatchard, and Hill plots. F,*,,

Kd, and N values were determined by least-squares regression.

Construction and analysis of site-directed mutants of DnmS

Specific, conserved amino acids in DnmS were mutated in an attempt to identify those essential for catalytic activity or substrate binding. Initially, conserved residues, believed to be the catalytic residues, and residues of the “giycosyltransferase motif’ were targeted (Zvelebil and Sternberg, 1988; Fish and Cundliffe, 1997). Residues successfully altered include; Asp"** to Ala"*', Pro^” to Ala^^^, Glu‘” ->Ala‘^,

Pro^™—>Ala^°®, and Gln^"*®—>Glu^^“ (see Chapter 3, Fig 3.5 for sequence and location of mutants). Site-directed mutants of DnmS were generated with the aid of the

65 QuikChange™ Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California).

Complementary primers containing single point mutations with 10-15 nucleotides flanking the mutation were generated for each proposed mutant (Appendix D). PCR reactions were run using pANTI023 (Appendix C) as the template DNA and the constructed oligonucleotide primers as described previously. PCR conditions were optimized on an individual mutation basis. Following thermal cycling, the reactions were treated with 10 U of Dpnl and were incubated for 1 h at 37° C. Epicurian Coli XL 1-Blue supercompetant cells were transformed with the reaction mixes according to the manufacturer’s directions.

DNA from transformants was sequenced by dye-tenminator sequencing to confirm the presence of the point mutations and ensure the absence of other errors from the PCR reactions.

Inserts from positive clones were introduced into pU4123 as Mdel-ElcoKi fragments and transformed into Streptomyces lividans TK24. Mutant proteins were purified by nickel column chromatography and, if necessary, gel filtration chromatography.

Purified proteins were analyzed for giycosyltransferase activity using the previously described assay and ligand binding using fluorescence spectrometry. Additionally, spectra of DnmS and the purified mutants were obtained using a circular dichroism (CD) spectrometer. Model 62A DS (Aviv, Lakewood, New Jersey). CD spectra between 200-

300 nm for 100 ^1 purified protein samples were obtained.

66 Chapter 3

Results

Molecular cloning of dnmS

The entire dnm S gene was isolated from the Streptomyces sp. strain C5 chromosome by Southern blotting and colony hybridizations using a DNA fragment

identical to a portion of the gene encoding the N terminal region of the protein. The fragment used as a probe was excised from pANTI40, a construct containing a partial dauK. a complete dauP. a complete dnmQ, and a partial dnmS gene (Dickens. 1996).

Two genomic fragments hybridized strongly to the probe under high stringency conditions: an approximately 2.5 kb Sphl-Kpnl fragment and an approximately 7 kb Kpnl fragment (Fig. 3.1). Consequently, partial genomic libraries of SpAI-A^wI-digested and

ATpnl-digested DNA surrounding the hybridizing fragments were constructed in pUC19 and screened by colony hybridizations of E. coli transformants with the same probe. A plasmid (pANT1007) containing the desired fragment in pUC19 was isolated from the library containing the region around the 2.5 kb Sph\-Kpn\ fragment (Appendix C). The presence of the entire dnmS gene was confirmed by Southern analysis and double­ stranded sequencing using universal forward and reverse primers in addition to internal, sequence-specific primers (see Appendix D).

67 Fig. 3.1. Southern hybridization of Streptomyces sp. strain C5 genomic DNA using a

DNA fragment containing the amino-terminal encoding portion ofdnmS as a probe.

The DNA samples were digested with the following restriction endonucleases: lane 1

= Kpnl; lane 2 = Eco¥H; lane 3 = SphUKpnl; lane 4 = SphUKpnl. Numerical values on the side of the blot are in kilobases.

68 23.1-

9 . 4 " -

6 .6 - 4 .4 »-

2.2 • -

? i i 5 - 3-1

69 DNA and deduced amino acid sequence analysis and database searches

Two open reading frames (ORFs) were identified within the 2528 nucleotide insert

of pANTI007 using FRAME analysis and CODON PREFERENCE (Bibb e t al., 1984;

Wright and Bibb, 1992). The entire dnm S gene is comprised of 1296 nucleotides and has

a G+C content of 72 %, consistent with other Streptomyces ORFs (Wright and Bibb,

1992) (Fig. 3.2). The probable ATG start codon is 8 nucleotides downstream of a

possible ribosome binding sequence (GGAGG) (Strohl, 1992). The proposed ORF

encodes a polypeptide of 431 amino acids ending with a TGA stop codon. The predicted

Mr of DnmS is 46,672. The second ORF identified by CODON PREFERENCE analysis

was only a partial one and had high sequence homology to the drrC daunorubicin

resistance gene, previously identified by Otten et al. (1995). The dauH gene of

Streptomyces sp. strain C5 was isolated, sequenced, and analyzed previously by Dickens,

et al. (1996). The proposed ORF encodes a polypeptide of 442 amino acids with a

predicted Mr of 48,011.

Further analysis of DnmS and DauH sequences revealed hydrophobic amino acid

contents of over 40% based on the hydropathy scale of Kyte and Doolittle (1982).

However, no membrane-spanning regions were apparent in either enzyme upon

examination of hydropathy plots (Fig 3 .3 and Fig 3 .4).

Analysis of the deduced dnmS protein product with BLAST revealed high

sequence identity with a number of putative glycosyltransferases involved in antibiotic

biosynthesis. DnmS from Streptomyces sp. strain C5 shows 98% identity with the S. peucetins homolog, yet only 41% identity with DauH from both daunorubicin producers,

70 Fig. 3.2. Streptomyces sp. strain C5 locus containing dnmS A). Restriction map and open reading frame designations of the 2.528 kb insert of pANTlOOT. B).

Nucleotide sequence of the same insert and corresponding amino acid sequence of

DnmS. Abbreviations: RBS = ribosome binding site.

71 A. unmO .unmS urrL

SpM Bca BamHl Ssil 5amHI Kpnl

B.

CAGTGCACCGCCGTCCTOCGGOCGGTGGCCGAACOCiCTrCCCGGGCTGCGGOCCGAGGGCGAGCCCiCTGGG

RBS gcgcgggcgctcacctgtggtccgcgcccccctctcgctgccoctggcccagaagtgacccggggaggatg

jnmS acacatgaagctgctcgtgacggcgttcgccatggacgcgcacttcaatggtgtggtgccccttgcctggg MK.VLVT a F\MD a HF \i G V V P LAW

CGCTGCGGGCGOCCGGACACGACGTCCGGGTGGCGAGCCAGCCCGCTCTCACCGACAGCATCACCCGTGCG ALR AAGH DVRV a SOP ALTDSI t r a

ggactcacgcctgtaccggtgogtacagaccaccaggtgcaggcggcgatgggggccatggcgcccggcgt GLTaVP \ G r 0 H () V O A A MG AMaPG

gttcgcgctgcaccggaactccgactacctggagaaccogccgcagctgctcgacctggagttcctcgaag vfalhrns dylenrp elldlefle

CGTCCACGTCGATGCTGACGGCCGCGTTCTACGCCCAGATC.AACAATGACTCCATGATCGACGAGTTGGTG ASTSML'AAFVAOi N SDSMiDELV

gacttcgccgattgctggcggcccgacctggtcgtctgggagcccttcaccttcgccggcgcggtggccgc DFa DA WR ? □ LV\’ WE ?F T F A G A A

ccaggtgaccggcgcggcgcaggcccgcctgctgtgogocccggacctcttcctacgggtgcacgaccggt aOV TG A A oar L LWG PDLF •_ RA H DR

tccagcaggcgctgcacgaggtgccggccgagcacccggacgacgccctggaggagtggctgacgtggacg FQQA L H E A P a ERRD O LE EA LTAVT

ctggagcggcacggcgcggccttcggacccgaggtgatcagcggtcactggacgatcgaccagatgccgcc LERHG a a FGPEV ISGHWTt DQVIP

GAGCGTGCGGTTCCCCACOGACCGCCCGACGGTGCCCATGCGGTTCGTCCCGTACAACGGCCCGGTCCCGG PSVRF a TARPTA'PMRFA P'i \GPA P

cagtggtgccgccgtggctccgggagoacccgggacgcccgagggtcctgctcaccc .aagocatcacggaa a A A PPWLR ADPGRPRA LLTOGITE

CGCTCGACGGGCTTCACCGCGCTGCCCCGGGTCGGTGAACTGCTGGCCTCGATCCCGGAACTGGACCCC.AA R'iTGFTGLPRAGELLA' : A E L 0 A

'JGTGGTCCCAACGOTC.AAOGCCGAGGAGCGCGAGTGCCTGCCGCCCCTGCCCGGGAACGTGCGGGTGGTGGA 5 A A A T A k A E E R E A L P P _ P ,, ^ A R

Fig. 3.2 (continued) 72 Fig. 3.2 (continued).

.AGTCTGTCCCTGCACGTCG7CCTGCCGAGCTGTGAGCTCGTCGTGCACCACGGCGGCGCCGGA.ACCTGGOC \ LPSC HHGG\G TA

GACGGCGGCCCTGCACGGGGTGCCTCAGCTCGCCCTCGCCTGGCAGTGGGACGACGTCTTCCGGGCCGGGC A-\:kLHGV?nL \ L D D V F R à G

\GCTGGAAAAGCTGGGCGCGGOGATCTTCCTCCCGCCGCACGCrrGAGGGCGCCTCGGCCGACCGGGTCAGG OLE n.LG\G :FL?PHGEGJ i 5 \ GR'. r

GACAGGCTGGCTCAGATACTGGCCGAGCCGTCCTTCCGOCAOGGCGCCGCGCGGATCCGCGCGGAGATGCT d r g aqvlaepsfrogaa R: R j. em

GCGGACCCCOGCACCCOGTGCGGTGGTGCCGACGCTGGAACACXn’GACGGCCCGGCACCCiTGTGTCGGCCG LRTPA P G a V V P T L E Q L T a R H R V S a STOP gocagcgtgtccgocgctgagccctgtccggtgacctctogtcccggggccgcggcgttcccggcgacgog GO R V R R

CACGTACGGGAACGCCOGTCGGCCCTCGGGGCGAGGATCAGCOCCTGOCGCGATGACCGGTCGTCTCGGAA

CCGGCGTCGGCCAGGGACGCCGCGAGGAACCGACCCGTGACCCACTGCCTCGGCCTTCGCCAGGTCGGCGG

gggtgccctcgaagatcacccggccgccctcgctgccgcccccggggaccgaggtcgacgacccgagtccg

CGTGCTTGACGACGTCGAGATTGTGCTCGATGACGATGACCGAGTTGCCCrTCTCGACCAGGTCGTCGACC

aggtgcacgaggctgtcgacgtcggacatgtggagcccggtggtggoctcgtccatgacgtagacgctgcc

CTTCTTCCCGAGCTCCGTGGCGAGCTTGATGCGCTGGCACTCGCCGCCGGAGAGCGTGTTCAGCGGCTGGC

CGAGCTGGAGATAGCCGAGGCCGACCCGGTTGATGGAACGGAGGOTCGTGGCAACCCTGGGTTCGGTGAAG

AACTCGGCCGCCTCGGCGGCGCTCATCGACAGTACGTCGTGGATGTTCTGCCCGCGCAGGGTCAGACGCAG

gacgacttcggtgaaacgcatccccgcgcacacctcgcacggtcgtgatcatcggatccatgaaggcgagg

tcggtgtagatgatgccgtgtcctggcaggtggggcaggcgccctcggagttgaagctgaacagtgagggg

ctgacctggttctcgcgggcgaacagcctgcgcatctcgtccatgatgccgctgtaggtcgccgggttcga

a CGCCGGTTGTGGTGACCGCGGACTGGTCGATGACGACCGCCGAGGGGTGTTGCCGCAACAGCACGTCGTG

aatgagcgtgctcttgccggagccggccggcccggtgacggcggtcagtacgccgagcgoaatccgtacgc

TGATGTCCTTGAGGTTGTGGGCCCGGGCTCCCGTCACCTCCAGGTGCCCCCTGGCCTCGCGGAACCGGTTC

TTGATCGG

73 Fig. 3.3. Hydropathy plot of the 431 amino acids of DnmS. Values are based upon the hydropathy scale of Kyte and Doolittle (1982).

74 mH' Mean Hydropathy ^ 0.0334 C) Scale: Kyte and Doolittle (1982) W - 1 1 Hydropathy threshold for helices 1.6 3.

0

Ln 0 0

0

0

0 31 62 93 124 1 55 186 217 248 279 310 341 372 403 Residue Number Fig. 3.4. Hydropathy plot of the 442 amino acids of DauH. Values are based upon the hydropathy scale of Kyte and Doolittle (1982).

76 H*

Mean HydropaLhy = 0.0952 Pr Scale: Kyle and Doolillie (1982) W - I 1 Hydropathy threshold for helices = 1.6 3.0

2.0

-vlI 0.0

. 0

2.0

3 . 0 32 64 96 128 1 60 1 92 224 256 288 320 352 384 416 Residue Number Streptomyces sp. strain CS and S. peucetius. Other glycosyltransferases found in actinomycete antibiotic biosynthesis gene clusters with high amino acid sequence identity to DnmS include; DesVn from Streptomyces venezuelae (Xue et al., 1998) (49%);

OleGl and GleG2 from Streptomyces antihioticus (Olano et a i, 1998) (49% and 48%, respectively); EryCIII and EryBV from Saccharopolyspora erythraea (Summers et a i,

1997) (both 46%); TylM2 from Streptomyces fradiae (Gandecha et al., 1997) (45%);

LanGTl, GT2, GT3, and GT4 from Streptomyces cyanogenus (Westrich et al., 1999)

(32%, 30%, 30%, and 38%, respectively); and MtmGI, GII, GHI, and GIV from

Streptomyces argillaceus (Blanco et al., 2000) (31%, 29%, 33%, and 34%, respectively).

Olel (Quiros et al., 1995) and OleD (Quirôs et al., 2000) from Streptomyces antihioticus were less than 25% identical in overall sequence to DnmS.

Sequence alignments of DnmS and DauH with other empirically proven and putative glycosyltransferases displayed a number o f conserved amino acids (Fig. 3.5).

Both strain C5 enzymes appear to contain the proposed giycosyltransferase motif (Fish and Cundliffe, 1997), as well as conserved carboxylic acids, which may serve as catalytic residues (these will be discussed in the section on site-directed mutagenesis (pg. 123).

Attempted disruption of giycosyltransferase genes

Multiple attempts to generate dauH and dnm S chromosomal disruptions in

Streptomyces sp. strain C5 were unsuccessful. Isolation o f genomic DNA from neomycin resistant colonies transformed with pANT1009 (dauff), followed by Southern analysis resulted in the identification of two fragmentation patterns in the same mutant DNA: those

78 Fig. 3.5. LINE-UP representation of a PILE-UP comparison (GCG package) of the primary amino acid sequences of glycosyltransferases. The underlined sequence is the proposed ‘^giycosyltransferase motif* (Fish and Cundliffe, 1997) and the dashed lines represent an extension of the motif (Olano et al^ 1998). Numbers represent completed or proposed site-directed mutations in conserved amino acids of DnmS.

Completed mutations: #1 - Asp41Ala; #3 - Pro339Ala; #5 - Glul99Ala; #7 —

Gln340Glu; and #9 Pro200Ala. Proposed/attempted mutations: #2 - His324Asn; #4

Glu387Aia; #6 — Gly328Glu; #8 — Trp241Tyr. Sources of sequences: strain C5 = dauh and dnms; S. nodosus = nodos; S. vioiaceoruber strain TÜ22 - tu22; S. antihioticus = antibt; S. lividans = slivdn; and P. aeruginosa psrham.—

79 h" <|l t Sd.llltl MNV I.FAIMAAMSH VÏAUVriASA I N I AOHKVI.V ASQPUVUIDI VRAQI.1HVHI ULIII.NIKEKT RCANASPBDU NN1X3GIJVMSN IHIIlJI'I.IHUII % gtdnra MKU LVTAPMOMI PNOWPIJkNA LRAAOHOVRV AR0PAL1DRI TRAOLTAVPV OTDMOV-QAA NOANAPOVPA I.HLNPDyi.RN RPBU.nt.RP gtnodoa MAAO#PAT VPAUkPIATA ARNAOHOWM AAMDONVPVI TAMLPaiAT T ...... 0 LPIRHPITTD NAONPEEIPS VjO gltu22 MRP LPVSOMIWM VPPITPLALA ARNAOHRVIV OATINVNPLV AATOLPOAPi T ...... S RTMPOmORD RHONPLBIPR gl antIbt MTTQTTPAHI «NPflMNOH VNPII.IVIRB LVAROHRVn AltPVPROKV RRTOPRPVLI HRTL...... POPDAOPBAN vn gtalIvdn MTTRPAMI AMP»IAUMM VMPBLBVIM LVAROHRVn RIPRLLRDRV RIROABPRLN NRTL...... POPDADPBAN gtparham NHA ILIAIOUOO VPPPIOLMT LRUHMRViL CriPVPRORV IQNOIRPVPL RDRL...... TVRR1M0DPR gtnogal HRV MPTVSSNriM IMLVPUILA LOAJUMiVRV LCAPRomev RNAOLTPVPV LOOl,...... 0 VPONLRI^YV EEAROQIMPV 1 onaenaiia a. gh V p pla.a IraaM. v.v a 4. V a.afll..vp...... • . > . J) . I glcbdauh A1>GNFTANTA MVFQNVCPIP NVDDLVOLAR DNR- POLV VMDPLTUUIP VRARLSOAAH ARU POPOON ORWRTAPRAL IDRORPS gtdnra LBABTBMLTA A P f M I N M M HIDBIVDPM NNR -POLV VNIPPTniOR VRRQVTORRQ ARLLNQPOLP LRVNORPQQV LMBVPAB gtnodoa DPVBOALPTO mPMMMM L-PRNLIPCII AWR POLI VaOTNSfVRP LLRLHLOVPN WR...... QT NDAIBAO gttu22 DPHBRNLPNO RONMILAUM N BOLVPLVB RNQ---PDVL VROAUVRRP LVRNRPOLPW WR...... HA LMNOBPS gl ant ibt - • 0STI4JNI m NTPUm RIOALPOMO RTADOIPOLV LNOITSrPRR VURRMOVPR VB I.SPNLV ANBOVBR..... BVABPHMR EPHQTEN glalIvdn OSTLLON V- - IPPLW AIQBLPQWO APRQORPOLV LHDIAflTRR VLORRWBVPV IB I4PCMV AMOIRQ..... BVOBPNNB EPRBTBR gtparham LHOPRTBPOV L -NOTIM NIIPVYirVfl AQRHOO- IW vaSLMALORR IRNBBTaiPV I.SAOVSPBTL LBAHLPPVHP RFNVP80MPI. AMRKI.I.NHCI gtnogal PMI.PPHPVTO BDNMIAIP-» rniiHcnaiia t t .. .a...... ml I a aw[ . p d lv ay a v.a. g p

glc&iiaiih CVTTRCA BNLIWTLBRM RRQRLO MSBBLV LOQIfriOPTP P8NRIPL0LP CVPVRyVPVN 0 PBLLPOW UIBPPRIIPRR I.CI.TIXIVSLO gtilnra RROOALR RML1ML# -RHOAA FOFRV: BONimOONP MVRFATARP TVFNRFVPIfl OPVPAWRIN LRAOPORPRV I. LTQOITBR •jtiiodoa OIHPOAO A8LRPBUIBP OtORLP...... LPOVPV..... DICP PBLRPAOAAP AQFMRTVPAN AORR--LRFN NTRROBRRRV I.VTBOBRVAB gltu22 IIDLBAA ABLAPBLRRN OLBAIP...... BPONW ..... RICP POARRFOAOP AQFMRFVPFM TQRA--LRPN NIAROORPRV I.VSAOBRVTA o gl antibt ORAVI ARFRAMLRBM OITBHPOTFA B- NPPRBL.V ....LI PR AtQPNAORVD BOVPTPWAC QOPRABRBBM OR PAOABBV VI.VSI23SAFT glallvdn OQATF ARPMAWLRRM OlimPDPPI 0 RPORBL.V....LI PR ALQPNAORVD RTTrTPVOAC dOORTAMON AR PROABBV VI.VSLQSAFT gipaiham ERFRIARTCA PDINAVRRBV OLRTPVRRIP TOHMHRPQOV VCLPPANPAP PQQOHPOPLN WTOFPLFDOB IPOTPLOORL ORFIAQGSRP I.VFTOaSTEH conaanaiia ...... a.i. . , I, a. g p...v I.p p..t.a.,.p . ... t . vp .n ...... w . r..... r v I . g. 5 0

iji cbtlaiih KATOAOTVAA SOVIAAVDOL DVmWATL B RNCORLOTLP ANVRAVDPVR UIALLPBCBO IIWIOOBOTP NTALAHATPQ I.IVPDMMIlA HEKAHGIARU gtdnra STOPTOLPRA ORLLABIAiL DAiWATVBA BBRBOLPPLP UIWLPBCAA WMRMAani ATAAUMVPQ ULA-MOMDO VFRAOOLBRI. ■Itnodoa BSVORNPRPL ROUIROVAAN DViLIVAAPB AVAOALHORL POIRA-ONAP lOWAPTCDV LVNHOOOVBT LTaUMOVPO 1.1.1 PROA VI, EBPALRVAOH gltu22 DFBADAL BALVRBVAOL DVRLLIAAPO RIAOAUWLP OMVRA-OCVP l A W U T C O L LVNRA«M1N LNAIVOOVPO LVIPAMP BO VGMSARIABV giantibt RQPAFfRBCV RAP-ONLPON NL-VLOIORR VTPARLORLP OMVRVNOWVP OLAILRQAOL PVTHAOAOHR O n U T A ÎP N lAVPQ AVOO FONAmiWI gtalIvdn ROPAPïRBCV RAP OBLPQW HT-VLQVORH VDPARLOOVP ONVRVRTNVP OLAILQOADL PVTHAOAOOS OROUITATFH lAVPO AAOO PGNAONIOOI. gipaiham IWOPIAMAL RAL-BRLOAR OI-FLTOA-- -aOBPLMLP NNVLQRATAP LOALLPBCAO LVHPOaiOAN BLALAAOVPO VI.I.PC AIIDO IDMABRIVRI. CDiiaenaiia ral g. d V ...... Lg IP nvr p I.a.Ip.c.. vhhgO.g.. . .ala.g< I.p. dg a I I 9 2 6

Streptomyces sp. strain CS ((+)-type) and strain C5 transformed with pANT1009

(mutant) digested with Sstl and M lul. Numerical values next to the images are in kilobases. B). Restriction maps of the parental chromosome and the expected mutant chromosome that would result from a double-crossover evenL

Abbreviations: Sstl (S); M lul (M).

81 A. Ssfl Mlu\ Mutant (♦Hype Mutant (♦)-type

9.4 ► 4.4

6.6 ►

B.

pANT1009a

Probe

C5 Chromosome

JmL' dptC damZ dmmT imH iamE dfaF

M S M 5.0 kb S.2 kb

CS-dauH Chromosome

dûML' dpsG dmmZ dmmT dm H apàl daitH dmm£ dpsF dpsE

M S 3.0 kb

Fig. 3.6

82 predicted for the mutant and wild-type genotypes (Fig. 3 .6). The possibility that a single- crossover event occurred was eliminated by Southern analysis using pUCl9 as a probe.

No genomic DNA from the alleged dauff transformants hybridized to the pUC19 probe.

Moreover, probing with the aphi gene, which was used as the selection marker in the disruption construct, resulted in only one (3 .2 kb) band that hybridized to the probe (Fig.

3.7). Analysis of the anthracyclines produced by the neomycin-resistant mutants did not provide conclusive results in deciphering the function of DauH.

Attempts to disrupt cbm S by cassette mutagenesis with pANTI006 resulted in neomycin resistant transformants, however, they possessed genotypes identical to wild- type Streptomyces sp. strain C5 (Fig. 3.8). It should be noted that a copy of the aphI gene is present in these transformants’ genomes; but, the location is uncertain (Fig 3.7).

Construction of expression vectors

Both Streptomyces sp. strain C5 glycosyltransferase genes were cloned as translational fusion constructs into the pTrcHis vectors for recombinant expression in E. coli. Expression of both proteins by this system resulted in the formation of insoluble inclusion bodies. As a consequence, culture growth and expression conditions were altered in an attempt to solubilize the enzymes. Cultures were grown in different media

(YT, LB, SOB) and at lower incubation temperatures (30, 25, 20° C) to slow the growth rate of the recombinant E. coli, and consequently, lower protein expression. In addition, sucrose was added to the media to reduce the growth rate, since E. coli is incapable of metabolizing this carbohydrate (Zhang et a i, 1994). Induction conditions also were

83 Fig. 3.7. Southern blot of £coRI-digested genomic DNA from Streptomyces sp. strain CS mutants and putative mutants. The blot was probed with a DNA fragment containing a portion of the aphi gene. Lane I: strain C5 transformed with pANT1003 (dnmS^i lane 2: strain CS transformed with pANT1009 idaufT); lane 3: strain C5AW1; lane 4: pKK840.

84 2 3

9.4 6.6

4.4 ►

2.3

Fig. 3-7

85 Fig. 3.8. Attempted disruption of dnmS. Southern blot of genomic DNA of

Streptomyces sp. strain C5 (lanes 1-3) and strain C5 transformed with pANTlOOé

(lanes 4 and 5) digested with PvuH. (lanes 1 and 4), Sstl (lanes 2 and 4), and Pstl

(lane 3). A DNA fragment from pANTI006, which contained portions of the aphi and dnmS genes was used as a probe. Numerical values next to the blot are in kilobases.

86 1 2 3 4 5

6.6 ►

4.4 ► m

2.2 ► 2.0 ►

Fig. 3.8

87 altered, again to limit the amount of enzyme expressed by the host. The concentration of the inducer, IPTG, was reduced 10 to 100-fold from the recommended amount

(Invitrogen instruction manual) and the length of induction was shortened. Unfortunately, none of the changes in growth expression conditions resulted in a noticeable increase in solubility of either glycosyltransferase based on results from SDS-PAGE analysis and various purification attempts.

The insoluble glycosyltransferases were successfully purified under denaturing conditions (8 M urea) and antibodies were raised against denatured DnmS (Fig. 3.9).

Urea was removed from pooled fi'actions by dialysis with the hope of re-folding the pure enzymes. However, the lack of an efficient catalytic activity assay made it difficult to assess the activity of the refolded glycosyltransferases. Consequently, dnmS and dauH were cloned into a streptomycete expression vector, pIJ4123, which also imparts upon the protein product an amino-terminal Hise tag for expression in Streptomyces lividans

(Takano et al., 1995). The purpose for this approach was to provide the recombinant, tagged enzymes a streptomycete or wild-type-like background for expression, thereby increasing the likelihood of obtaining soluble products for purification and analysis.

Heterologous expression of DnmS and DauH in S. lividans

Five hundred ml cultures of Streptomyces lividans TK24 containing the glycosyltransferase genes in vector pU4l23 (pANT1028 and pANT1037, for the his- tagged versions of dnmS and dauH, respectively) were grown to obtain sufficient amounts of enzyme. After an initial 15 h growth period, thiostrepton was added to induce

88 Fig. 3.9. Purification of denatured DauH and DnmS expressed from the K coli'- based pTrcHls system (Invitrogen, San Diego, California). Both proteins were purified by Ni^^>NTA spin columns (Qiagen, Santa Clara, California) in 8 M urea.

A) Silver-stained SDS-polyacrylamide gel of molecular weight markers (lane 1) and purified DauH (lane 2). B) SDS-polyacrylamide gel of molecular weight markers

(lane 1) and purified DnmS (lane 2).

89

m

4 A AA N 0 0 CO o> o> (OCM

Fig. 3 . 9

90 expression from the Pup promoter (Takano et aL, 1995). Growth proceeded for a

minimum of 15 h and additional samples were taken up to 26 h SDS-PAGE analysis of

the post-induction time points showed significant amounts of soluble DnmS and DauH

were produced under the ascribed conditions Only minimal increases in the amount of

Hise-tagged DnmS and DauH were noted in the time points after 15 h o f induction

Therefore, all subsequent induction periods for expression of both glycosyltransferases by

Pup were performed for 15 h.

Protein purification and analysis

DnmS and DauH were purified to homogeneity or to near homogeneity in one

purification step, Ni^"^ aflfinity chromatography, as shown by silver stained SDS-

polyacrylamide gels (Fig. 3.10). Both enzymes eluted from the Ni^* column over a large

volume (30-50 ml). Thus, concentration of proteins was necessary. Unfortunately, both

proteins became insoluble at concentrations greater than roughly 0.1-0.2 mg/ml in buffers

containing 50 mM potassium phosphate (pH 7.4), 200 mM NaCl, 400 mM imidazole, and

5 % glycerol. As a result, alterations were made in the buffers used for purification. The

components that appeared to aid in maintaining the solubility of the proteins at the higher

concentrations were high salt concentration (400 mM), presence of detergent (0.1%-0.5%

Tween (v/v) 20), and the presence of a reducing agent (0.5 mM P-mercaptoethanol). The buffers described earlier in Chapter 2 are the optimized buffers. Proteins were concentrated in the new buffers up to approximately 1-1.5 mg/ml; however, precipitation still occurred at higher concentrations.

91 Fig. 3.10. Purification of Hisa-tagged DnmS and DauH expressed from pIJ4123- based constructs in Streptomyces lividans TK24 (Takano et aL, 1995). A). SDS- polyacrylamide gel of molecular weight markers (lane 1), S. lividans (pANT1028) extract (lane 2), and DnmS purified by Mi -NTA chromatography (lane 3). B).

SDS-polyacrylamide gel of molecular weight markers (lane 1), & lividans

(pANT1037) extract run on Ni^^-NTA column (lane 2), and DauH purified by gel filtration chromatography (lane 3).

92 00 CO o> i O CM

03

3 CO O t

CO

CM

CO CO o> CD CM CM

F ig . 3.10 93 Enzymes not purified to homogeneity after the Ni^-chromotography step, further

purification was achieved by gel filtration chromatography Removal of the N-terminal

His-tags from purified glycosyltransferases was accomplished by thrombin cleavage and

subsequent gel filtration to remove the protease.

Determination of molecular weight of enzymes

Initial gel filtration (GF) runs to determine the apparent Mr of the

glycosyltransferases utilized a running buffer similar to the buffer used to purify the

enzymes. DnmS eluted from multiple GF column runs on average at 15.35 ml, which

corresponds to a V(/Ve ratio of 2.06. Use of this ratio and the standard curve depicted in

Fig. 3 .11A allowed for calculation of the M, of DnmS, which was approximately 90,500.

The predicted molecular weight of DnmS was ca. 46,600, substantiated by mobility of the

enzyme on SDS-polyacrylamide gels. Thus, it appears that DnmS in its native state is a

dimer. DauH also appears to be a dimer, based on the calculated Mr of 92,800 and

predicted molecular weight o f48,000 (average elution volume of 15.31 ml and VyVe ratio

of 2.06) (Fig. 3.1 IB).

Time course for anthracycllne production and DnmS expression in wild-type C5

Fig. 3 .12 depicts the results of the study of daunorubicin and e-rhodomycinone production in comparison to growth of Streptomyces sp. strain C5 over the course of seven days. Streptomyces sp. strain C5 displayed standard bacterial growth in NDYE media as evident by the plot of dry cell weights. Daunorubicin production remained fairly

94 Fig. 3.11. Determination of the relative molecular mass (Mr) of recombinant A)

DnmS (A) and B) DauH (n) by Superose-6 fractionation. Molecular weight standards used include: cytochrome c (12.5 kDa), chymotrypsinogen A (25 kDa), albumin (hen egg) (45 kDa), bovine serum albumin (68 kDa), aldolase (rabbit muscle) (158 kDa), catalase (beef liver) (240 kDa), ferritin (450 kDa), and blue dextran (2 MDa).

9 5 A.

CI

1.1 1 #2 2.1 22 29 2.4 29 Elution volume/Vold volume (ml)

B. 6 * '

18 2 21 22 23 24 25 Bution volunwA/bid volume (ml)

Fig. 3.11

96 Fig. 3.12. Time course analysis of Streptomyces sp. strain C5 growth (as measured by dry cell weights) (▲), e-rhodomycinone production (♦), and daunoruhicin production (■).

97 8 6 ZJ'C 'SJA

Dry Call Weight (g/L 8 * È S S

» ■

- I g 3

a t

a i o a i o a t Anthracycllne (mlcromolar low throughout the experiment, staying around 0.1 micromoles/L. Conversely, e-

rhodomycinone production steadily increased after 34 h of culture growth and reached

69.4 |xM (24.6 g/L) after seven days. A comparison of e-rhodomycinone production to

relative DnmS expression, based on Western analysis. Is displayed in Fig. 3.13. A small

amount of DnmS was evident after 12 h. After 34 h the relative enzyme amount remained

fairly constant for the remainder of the experiment. Interestingly, this pattern is in contrast

to the production of the proposed substrate, e-rhodomycinone, which increased

throughout the examined time period

Generation of mutant strain C5AW1 and recombinant strains

A Streptomyces sp. strain C5 mutant was generated in which most of the genes that function early in the biosynthesis of daunorubicin (polyketide synthase genes and genes encoding aklanonic acid methyltransferase and aklanonic acid methyl ester cyclase), as well two late genes (encoding anthracycllne 4-O-methyltransferase and rhodomycin D

16-methylesterase) were deleted. Additionally, one gene that encodes a product involved in TDP-daunosamine biosynthesis was deleted (dnmQ, a putative oxidase (Otten et aL,

1995)). The mutant was constructed by transforming protoplasts of Streptomyces sp. strain C5 with pANT1013, a suicide vector with approximately 9 kb of the above genes replaced with aphi. Southern hybridizations of several neomycin-resistant transformants, using a portion of the integrated DNA as a probe, revealed the presence of recombinants in which a double crossover event had occurred (Fig. 3.14). This mutant strain, called

99 Fig. 3.13. A). Comparison of e-rhodomycinone production (♦) and relative DnmS expression (■) in Streptomyces sp. strain CS. Relative DnmS expression values were obtained by STORM"* fluorimager analysis on the Western blot depicted in (B).

Each time point examined by Western analysis contained equal amounts of cellular protein.

100 lOl

CT-C

Anthracyclin* (mlcromolar) O—a cn O ^ cr o

s

8

O I 8

ê

w I 8 8 O O I OD GD R##mUv# D nm S E xprM slon Fig. 3.14. Construction of mutant strain CSAWI. (A). Southern blot of genomic

DNA of Streptomyces sp. strains C5 (lanes: I, 3, and 5) and CSAWI (lanes: 2, 4, and

6) digested with BamiBl (B), £c0 RI (E), and Pstl (P), showing replacement of approximately 9 kb of genes encoding polyketide synthase, early, and late daunorubicin biosynthetic functions with aphi. Blots were probed with a DNA fragment from pANTIOI3 which contained portions of the aphi and the dpsF genes.

(B). Restriction maps of the parental and mutant chromosome, displaying the expected results obtained by double crossover.

102 A. 1 2 3 4 5 6

2.3 2.6

B.

pANTlOlS

Prabc

UmHéÊmE apk! itmmQ

CS Chromosome

dtmH émuE 4f i F df%E étm C d f i t dptC dfiD damC damO d d a t dmmF dmmQ dmtmS drrC

B EPS B E P B B I^A L II hbp t . M k b p ------10.42 kbfi damH damE dftF tpai éaaiQ daatS C5AW1 Chromosome

B E PB PBE B

2 4# kkp * 0.S4 hbp ! J S k b « Fig. 3.14 O .M k b p 103 Streptomyces sp. strain C5AW1, did not produce any anthracyclines as determined by

TLC and HPLC analysis. Although a complete dnm S gene was still present in strain

CSAWI, the product was not expressed at 48 h, as demonstrated by Western blot analysis

(Fig. 3 .15). Restoration of a functional TDP-daunosamine pathway in Streptomyces sp.

strain CSAWI was accomplished by introducing dnmQ in the streptomyces expression

vector pANT8S7 (pANT1021) into the mutant. Additionally, pANT857-based constructs

containing dnmQ and dnmS (pANT102S), and cbm S alone (pANTI027) were also

introduced into the mutant.

In vivo giycosylation

Incubation of '"‘C-labeled e-rhodomycinone with recombinant Streptomyces sp.

strain CSAWI (pANT1021), (pANT1025), or (pANT1027) cultures did not result in the

production of rhodomycin D in any of the cultures. It was expected that the mutant

transformed with pANT1025 {dnmQ, dnmS) would glycosylate e-rhodomycinone, since it

theoretically contained all of the necessary genes to accomplish this. Incubation times were shortened to less than 24 h to minimize the time the typically unstable rhodomycin D

remained in solution. This too did not result in giycosylation of e-rhodomycinone. Other media were tested for growth of the recombinant strains, including R2YE and TSB, supplemented with the appropriate antibiotic. These cultures also did not demonstrate conversion of e-rhodomycinone to rhodomycin D.

Consequently, in an effort to generate a more stable, identifiable product by the mutant cultures, the da u Kand dauP genes were reintroduced into strain CSAWI.

104 Fig. 3.15. Western analysis of proteins from Streptomyces sp. strains CS and

CSAWI using anti DnmS antisera. Lane 1: purified DnmS (2 pg); lane 2: cell-free extract of strain CSAWI (20 pg); lane 3: cell-free extract of strain CS (20 pg).

105 DnmS ^ J&Lf j ^. A#

Fig. 3 . 1 5

106 However, this new recombinant mutant containing pANTI034 {dnmKPQS), when grown on NDYE and fed labeled e-rhodomycinone, also did not produce any anthracycline glycosides. With the failure of the in vivo feeding experiments to show glycosylation o f G- rhodomycinone by DnmS or DauH, ftirther emphasis was placed on the in vitro assays

TDP-daunosamine: G-rhodomycinone giycosyitransferase assay

In vitro glycosyltransferases assays were performed using purified glycosyltransferases, '^C-labeled or unlabeled G-rhodomycinone, and strain C5AW1

(pANTI021) extracts as the source of TDP-daunosamine. Using labeled g- rhodomycinone, assays containing purified, soluble DnmS displayed a radioactive spot on

TLC plates that co-migrated with rhodomycin D and had an average signal to noise ratio over 10:1, as determined by p-scanning (Fig 3.16). A product that eluted at the same retention time as rhodomycin D on HPLC also was identified fi-om assays containing unlabeled G-rhodomycinone (Fig 3.17). Acid hydrolysis o f the product resulted in the restoration of G-rhodomycinone, confirming that the product was derived from this aglycone. When C5AW1 extracts were used as sugar sources instead of C5AW1

(pANT1021), no rhodomycin D was detected (Fig 3.16). Additionally, purified, soluble

DauH incubated with C5AW1 (pANT1021) did not produce any products detectable by

TLC or P-scanning.

The best DnmS activity was observed in phosphate buffer at pH 7.5.

Unfortunately, conversion efficiency was poor, ranging from 2-3%. Modification of

107 Fig. 3.16. TDP-daunosamine: e-rhodomycinone giycosyitransferase assay.

TLC data results of in vitro giycosyitransferase assays using recombinant strain

C5AW1 (pANTlOZi) as a sugar source, C-labelled e-rhodomycinone, and purified

DnmS or DauH. A). Autoradiograph of extracted assay products resolved on a thin-layer chromatogram. Lane I: C5AWI (pANTI021) alone; Lane 2: C5AW1 +

DnmS; Lane 3: C5AW1 (pANT1021) + DauH; Lane 4: CSAWl (pANT1021) +

DnmS; Lane 5: acid-hydrolyzed CSAWl (pANT1021) + DnmS. B). Table displaying total counts of radioactive substrates and products and percent conversion.

108 A.

8-RHO

RHOD

B.

e-RHO counts RHOD counts % conversion’ Signal; Noise^ N C5AW1 (1021) 53400 +/- 6340 177 +/-230 < 1 1.5:01 2

DnmS + C5AW1 (1021) 58100 +/- 5990 1390 +/-212 2.5 11:01 2

DauH + C5AW1 (1021) 68200 +/- 8810 369 +/- 163 < 1 3:01 2

' = average of individual conversions “ = average of individual ratios; based on average background of 125 cpm

Fig. 3.16

109 Fig. 3.17. TDP-daunosamine: e-rhodomycinone glycosyhransferase assay. HPLC data results of in vitro giycosyitransferase assays using recombinant strain CSAWl

(pANTlOZl) as a sugar source, uniabeiied e-rbodomycinone, and purified DnmS or

DauH. A). High performance liquid cbromatograpby profiles of extracted assay products. 1 = CSAWl (pANT1021); 2 = CSAWl (pANT1021) + DauH; CSAWl

(pANT1021) + DnmS. B). Table displaying peak areas of substrates and products and percent conversion.

110 -MHO

/W.I I.

c-RHO -MHO

RHOD _A__ «»«,

B. c-RHO peak RHOD peak % area area conversion* N C5AW1 (1021) 7.83 • 10^ 3.7S-10* < 0.1% 2

DauH * CSAWl (1021) 6.04 • 10^ S.98-10* < 0.1%

DnmS ♦ CSAWl (1021) S.56'10^ 1.67 "10* 3% • « ivcrafe of indm deal ceavcrsioa* N • number of trials ’ig. 3.17

111 buflfer components or pH did not improve the efficiency nor did the use of a de-

proteinated strain C5 dauE mutant as a sugar source. For the dauE mutant studies, the

proteins (including DnmS) were removed by a number of precipitation methods, including

trichloroacetic acid, ammonium sulfate, or acetone precipitation, as well as by a number of

different filtration devices

Glycosyltransfer involving daunorubicin

The inability of DauH to use G-rhodomycinone as substrate led to experimentation to analyze daunorubicin as a potential substrate The same in vitro assays described above were run using daunorubicin instead of G-rhodomycinone Additionally, ^H-daunorubicin was fed in vivo to cultures of S. lividans TK24 with pANT1002 (dauH in pANT849) or pANT849 alone. With CSAWl (pANT1021) as the source of sugar, no new products were noted when compared to controls without enzyme (Fig 3.18A). DnmS did not glycosylate daunorubicin under these conditions either. However, a product was apparent on thin-layer chromatograms of extracted S. lividans TK24 + pANTI002 cultures that was absent in cultures with vector alone (Fig. 3.18B). The identity of this new compound was unable to be determined due to difficulties in extraction.

Binding assays using fluorescence spectroscopy

The binding of glycosyltransferases to anthracyclines was examined by plotting the fluorescence values at a wavelength corresponding to the maximal change between substrate alone and substrate saturated with enzyme. Subtraction of the fluorescence of

112 Fig. 3.18. Daunorubicin giycosyitransferase assay. Results ofin vitro and in vivo giycosyitransferase assays using H-daunorubicin as a potential substrate for strain

C5 glycosyltransferases. A). Autoradiograph of extracted products from in vitro assays using strain CSAWl (1021) as a sugar source. Lane 1: CSAWl (1021) alone;

Lane 2: CSAWl (1021) + DauH; Lane 3: CSAWl (1021) + DnmS. B).

Autoradiograph of extracted products of recombinant Streptomyces lividans TK24 cultures fed H-daunorubicin in vivo. Lane 4: S. lividans (pANT849); Lane S: S. lividans (pANT1002).

113 A. B.

H- 7 1

00 DOD DAU

DAU

DHD DHD buffer alone resulted in the actual fluorescence values used for further analysis. To assess the reliability of this approach, a few control experiments were performed. First o f all, an enzyme with no documented ability to bind anthracyclines, chymotrypsinogen A, was tested for binding to G-rhodomycinone using fluorescence spectroscopy. The spectra over a number of wavelengths obtained upon addition of increasing amounts of the enzyme to a solution of G-rhodomycinone did not display the typical saturation curves seen with authentic enzyme-ligand binding. This indicated that binding specificity was required to observe saturation. Additionally, when DnmS that was boiled for 10 minutes was added to a solution of G-rhodomycinone, the spectra obtained were also inconsistent and non­ saturating and a binding constant could not be calculated (Kd > 1000). This indicated that enzyme activity, or minimally, undenatured status o f an enzyme of required specificity, was needed to observe saturation. Each of these controls provided further evidence for the validity of this approach to examine binding of glycosyltransferases to anthracyclines.

The emission wavelengths that exhibited the greatest difiference between substrate saturated with DnmS or DauH and substrate alone were: G-rhodomycinone, 539 nm; rhodomycin D, 557 nm; daunorubicin, 527 nm; and doxorubicin, 543 nm. Additionally, the effects of nucleotides and nucleotide-sugars on anthracycline binding were examined.

Dissociation constants (Ko) and Hill coefficients (N) were determined from least-squares regression analysis of straight binding curves, Scatchard plots, and Hill plots (Table 3.1).

Representative examples of each of these plots are given in Appendix E.

Almost all of the Hill coefficients calculated for DnmS and DauH binding to anthracyclines were very close to one. However, a few plots of G-rhodomycinone

115 Table 3.1. Calculated binding constants (Kd) and Hill cocflicients (N) of DnmS and

DauH with various anthracyclinones and anthracyclines.

116 Kp(uM) Substrate DnmS N* DauH N e-RHO' 1.16 ±0.28 1.13± 0.18 1.09 ± 0.20 0.93 ± 0.33 +0.1 mM TOP 0.54 ± 0.07 1.01 ±0.21 1.04 ±0.56 1.37 ±0.19 +0.1 mM ADR 1.30 ±0.04 0.95 ± 0.07 0.99 ± 0.27 0.86 ± 0.42 +0.1 mM TDPgIc 0.73 ± 0.31 1.08 ±0.23 - - +0.1 mM ADPgIc 1.39 ±0.09 1.27 ±0.44 --

+0.5 mM TDP° 0.87 0.94 .. +1mM TOP" >1000 - - -

RHOD° 2.46 1.22 . +0.1 mM TOP 2.27 1.12 - -

DAU° 2.66 1.10 0.4 1.28

DOX° 13.3 0.80 3.46 1.45

AKL° >1000 -- -

t = assays performed in triplicate o = assays performed in duplicate; standard deviations were not calculated in these instances * = tlie assumption of N=1 was not factored into calculation Value of > 1000 = no binding Abbreviations: e-RHO = e-rhodomycinone; RHOD = rhodomycin D; DAU = daimorubicin; DOX = doxorubicin; AKL = aklavinone.

Table 3.1. Binding constants (K d ) and Hill coefficients (N) of DnmS and DauH with various anthracyclinones and anthracyclines.

117 fluorescence versus DnmS concentration displayed sigmoidal curves, indicative of Hill coefficient (N) values of two or greater. In these instances, DnmS appeared to precipitate during the assays, which would effectively alter the actual enzyme concentration and lead to a distortion in the binding curve (Dahlquist, 1978). In these instances, only Kd values were calculated assuming N = 1, which resulted in consistent and reproducible data.

The calculated Ko’s for DnmS and DauH binding to e-rhodomycinone were 1.16 ±

0.28 nM and 1.09 ± 0.20 pM, respectively (Table 3.1). Addition of 0.1 mM TDP, one of the predicted products of the e-rhodomycinone;TDP-daunosamine giycosyitransferase reaction, to these assays resulted in a lower calculated Kd for DnmS (0.54 ± 0.07) and roughly the same value as the assay without TDP for DauH (1.04 ± 0.56). Double- reciprocal plots of fluorescence versus protein concentration also confirmed this promotion of e-rhodomycinone binding effect by TDP on DnmS, but not DauH (Fig.

3 .19). By comparison, ADP at 0.1 mM concentrations had no apparent effect on binding to e-rhodomycinone for DnmS and may actually have an inhibitory effect on DauH binding

(Fig. 3.20) (Table 3.1). Increasing the concentration of TDP to 0.5 mM may have slightly enhanced the binding of DnmS to e-rhodomycinone, as indicated by a K d of 0.87.

However TDP at 1.0 mM inhibited binding because non-saturating curves resulted. TDP- glucose at 0.1 mM appeared to enhance DnmS binding to e-rhodomycinone (K d = 0.73 ±

0.19), yet 0.1 mM ADP-giucose did not exhibit the same effect (K d = 1.39 ± 0.09).

DnmS also was capable of binding the other proposed product of the e- rhodomycinone TDP-daunosamine giycosyitransferase reaction, rhodomycin D, as

118 Fig. 3.19. Comparison of the effect of TDP on strain CS giycosyitransferase binding to G-rhodomycinone. A). Double reciprocal plot of DnmS binding to e- rhodomycinone in the absence (■) and presence (•) of 0.1 mM TDP versus fluorescence at 539 nm. B). Double reciprocal plot of DauH binding to e- rhodomycinone in the absence (♦) and presence (■) of 0.1 mM TDP versus fluorescence at 539 nm.

119 A.

■ e-RHO • 0.1 mMTDP

1 2 3 4 5 6 1/DnmS (1/nricromolar)

Z 5 B.

u_ ♦ e-RHO a s ■ 0.1 mMTDP

0 1 3 3 4 S a 1/DauH (1/micromolar)

F ig. 3-19

1 2 0 Fig. 3.20. Comparison of the effect of ADP on strain CS giycosyitransferase binding to e-rhodomycinone. A). Double reciprocal plot of DnmS binding to e- rhodomycinone in the absence (▲) and presence (■) of 0.1 mM ADP versus fluorescence at 539 nm. B). Double reciprocal plot of DauH binding to e- rhodomycinone in the absence (^) and presence (■) of 0.1 mM TDP versus fluorescence at 539 nm.

121 A.

i

A e-RHO ■ e-RHO+ADP

i 2 2i r s * *3 1/DnmS (microM)

B.

a

2

o 13 u .

I ♦ e-RHO os ■ e-RHO+ADP

0 I 20 a s t 1/DauH (micromolar)

Fig. 3.20

1 2 2 evidenced by the calculated Kd of 2.46 ± 0.35 nM (Table 3.1). In contrast to the e- rhodomycinone binding results, the presence of 0.1 mM TDP did not display any significant effect on DnmS binding to rhodomycin D (Fig. 3.21).

Among the other anthracyclines tested for binding to glycosyltransferases, only aklavinone did not bind to DnmS (Table 3.1). DauH exhibited tighter binding to daunorubicin (K d = 0.40 pM) than DnmS (K d = 2.66 pM). Doxorubicin also bound better to DauH, as evidenced by a Kd of 3.46 pM, compared to that for DnmS of 13.3 pM.

Site-directed mutagenesis of DnmS

Alignment of the DnmS amino acid sequence with other glycosyltransferases whose genes are found in antibiotic biosynthetic clusters revealed a number of conserved residues (Fig. 3 .5). Aspartic acid or residues are believed to be the catalytic residues in glycosyl transfer reactions. However, only a few other residues have been implicated in catalysis or binding (Saxena et al.. 1995; Campbell, et ai.. 1997; Kapitonov and Yu, 1999). Five site-directed mutants of DnmS were generated with the intent to examine the effect of the mutations on catalysis and substrate binding. The following

DnmS mutants were successfully generated in an E. co//-based disruption system:

Asp41Ala; Glu 199Ala; Pro300Ala; Pro330Ala; and Gln340Asp. The first two mutations listed were in highly conserved carboxylic acid residues and the latter three were found in the “giycosyitransferase motif’ (Fish and Cundlifife, 1997).

123 Fig. 3.21. Comparison of the effect of TDP on DnmS binding to rhodomycin D.

Double reciprocal plot of DnmS binding to rhodomycin D in the absence ( # ) and presence (■ ) of 0.1 mM TDP versus fluorescence at 557 nm.

124 P' on

ro

N»LA

• RHOD

m RHOD + TDP

I

DnmS (microM) Mutant genes were cloned into the heterologous Streptomyces host S. lividans

TK24 under the control of the Pup promoter (pIJ4123) (Takano et al., 1995). Induction of mutant protein expression initially mirrored the procedure for wild-type DnmS, unless differences in amount of protein were noted Appropriate methods to increase expression were taken as needed, such as increasing the inducer concentration or lengthening the time of induction. DnmS mutants Asp41Ala and Fro300Ala had noticeable decreases in target protein produced when compared to wild-type protein, as analyzed by SDS-PAGE. As a result, purification of these mutant enzymes was not accomplished. Conversely, DnmS mutant enzymes Glu 199Ala, Pro330Ala, and Gln340Asp were produced in reasonable amounts in S. lividans TK24 and purification was achieved (Fig. 3.22). Attempts to obtain accurate circular dichroism spectra of wild-type DnmS and the three site-directed mutants were unsuccessful. CD spectra between 200 and 300 nm were marred by interference and therefore, did not provide conclusive results with regards to the structural integrity of the enzymes (Appendix F).

Binding of e-rhodomycinone to the three pure mutant DnmS enzymes was examined by fluorescence spectroscopy. Mutant protein Glu 199Ala showed little difference in binding to e-rhodomycinone when compared to wild-type DnmS, as indicated by a calculated Kd of 1.08 ± 0.34 (Table 3.2). The presence of 0.1 mM TDP also enhanced the binding of this mutant to e-rhodomycinone (K d = 0.50 ± 0.02) (Fig. 3 .23 A); thus G 199A was virtually indistinguishable from the wild-type enzyme. The Kd determined for binding of mutant Pro339Ala to e-rhodomycinone was 1.27 ± 0.11, also similar to the value calculated for wild-type DnmS. However, 0.1 mM TDP did not

126 Fig. 3.22. Purification of DnmS site-directed mutants. Silver-stained polyacrylamide gels of DnmS mutants expressed in Streptomyces lividans TK24 and purified by Ni^^ chromatography. Numerical values next to gels are in kilodaltons.

127 '■•‘J H- Oq

P339A E199A Q340A

68

68 68 43

43 43 ►

K) 00 29

29 29 Table 3.2. Table of dissociation constants (K d ) and Hill coefficients (N) of DnmS and site-directed mutants for e-rhodomycinone in the absence and presence of 0.1 mM TDP. The units for dissociation constants are pM.

129 Kp Cu IVD Substrate DnmS E199A P339A Q340D e-rho 1.16 ±0.28 1.08 ±0.34 1.27±0.1l > 1000

e-rhod + TDP 0.54 ±0.07 0.50 ± 0.02 1.31 ±0.40 > 1000

- e-rho = E-rhodomycinone - TDP concentration was 0.1 mM - assays were performed in duplicate; thus, results shown indicate averages (except assays with DnmS which were performed in triplicate)

Table 3.2 Comparison of e-rhodomycinone binding data for wild-type DnmS site-directed mutant forms.

130 Fig. 3.23. Comparison of the efTect of TDP on DnmS site-directed mutant binding to e-rhodomycinone. A). Double reciprocal plot of DnmS G199A binding to e- rhodomycinone in the absence (♦ ) and presence (■) of 0.1 mM TDP versus fluorescence at 539 nm. B). Double reciprocal plot o f DnmS P339A binding to e- rhodomycinone in the absence (♦) and presence (■) of 0.1 mM TDP versus fluorescence at 539 nm.

131 H- 04 bd

fo U) 1/Fluorescence 539 nm l/Fluoraeoence 530 nm s kl G E g 2 . kl k &

w w r o

■

H enhance E-rhodomycinone binding by this mutant because the Kd was 1.31 ± 0.40. The third site-directed mutant examined, Gln340Asp, did not appear to bind E-rhodomycinone because the fluorescence at 539 nm upon addition of protein was non-saturating in the presence and absence o f 0.1 mM TDP. All Hill coefficients calculated for DnmS G 199A and P339A mutants, in the presence and absence of TDP, were very close to 1 (Table

3.2).

133 Chapter 4

Discussion

Isolation and characterization of aStreptomyces sp. strain C5 genomic DNA locus

A region of the Streptomyces sp. strain C5 genome containing the entire dnmS

gene, which encodes a putative glycosyltransferase (GT), and a portion of the drrC gene,

involved in daunorubicin resistance, was isolated, cloned, and sequenced. Not

surprisingly, both genes are almost identical in sequence to their Streptomyces peucetius

counterparts, which is consistent with most of the genes involved in antibiotic biosynthesis

in these two organisms (Strohl et al., 1997). One difference in the region cloned from

strain CS and the S. peucetius locus is the presence in the latter strain of an approximately

900-nt insertion sequence (IS)-like element between dnmS and drrC. This IS element is

similar to IS-/27 and an element from Mycobacterium tuberculosis, but without the

characteristic inverted repeats (De Meirsman et al., 1990; Mariani et al., 1993).

Conversely, the intragenic region between dnm S and drrC of Streptomyces sp. strain C5 is

only 44-nt and devoid of insertion elements. This is not unexpected, since the two

Streptomyces strains were discovered and cultured from completely different parts of the

world, and overall, are considered very different organisms (Gibb et al., 1987).

134 The amino acid sequences of DnmS and DauH have significant identity to a

number of glycosyltransferases found in antibiotic biosynthesis gene clusters. A majority

of these sequences are putative glycosyltransferases, on the basis of sequence similarity

with other, proven GTs (particularly those not involved with antibiotic synthesis or

resistance). Interestingly, identities between GTs involved in antibiotic biosynthesis are

not extremely high with regards to the overall amino acid sequence (Campbell et al.,

1997). This is most likely due to the wide range of carbohydrate and aglycone substrates utilized by these enzymes. Nonetheless, a number o f putative domains and motifs have been identified within these enzymes, in particular the “glycosyltransferase motif’

suggested by Fish and Cundliffe (1997). Other domains have been proposed to be involved in nucleotide sugar binding, as well as catalysis (Saxena et al., 1995; Campbell, et al-, 1997; Kapitonov and Yu, 1999). However, the requirement of these sequences in their ascribed function has not yet been empirically proven (see section on DnmS site- directed mutagenesis for further discussion).

Further analysis of the amino acid sequences of DnmS and DauH revealed a high percentage of hydrophobic amino acids, based on Kyte and Doolittle’s hydropathy scale

(1982). For a particular region to be considered a membrane spanning domain it must contain at least 19 consecutive amino acids with average hydropathy values o f +1.6 or greater, a profile absent in both strain C5 enzymes. Despite the lack of definitive membrane spanning regions, the likelihood of both GTs being associated with the cell membrane is apparent, since the final product, daunombicin, is exported out of the cell. In

135 addition, the high hydrophobicity of DnmS and DauH correlates with low protein solubility seen in the water-based buffers used for purification.

Attempted disruption of glycosyltransferase genes

Strain CS mutants containing individual disruptions of chromosomal d tm S or dauH genes were unable to be generated in this study by cassette mutagenesis using the ap h i gene. All attempts to disrupt dauH resulted in neomycin-resistant transformants with hybridization patterns consistent with the expected mutant genotype, in addition to that expected for the wild-type strain. The possibility of the “mutants” arising as the result of single-crossover events was eliminated by Southern analysis using a portion of pUC19, the vector in which the disruption construct was cloned into, as a probe. DNA from the mutants examined did not hybridize to this probe. Additionally, chromosomal DNA of putative dauH mutants was probed with the aphI gene, resulting in single bands hybridizing to the probe. This indicates either the presence of a single copy of aphi in the putative mutants’ genomes, or the presence of two, identical loci within Streptomyces sp. strain CS. The latter explanation is not feasible since disruptions o f other Streptomyces sp. strain CS daunorubicin biosynthetic genes have been successfully generated (Rajgarhia and

Strohl, 1997). Additionally, successive rounds of protoplasting and restreaking of the putative mutants to ensure single cell chromosomes resulted in the same wild-type/mutant combination of hybridization patterns. Consequently, no further reasons can be offered as to the nature of the exact genotypes of these “mutants”.

136 Lomovskaya et al. (1998) were able to generate a dauH disruptant strain in

Streptomyces peucetius. However, the phenotype of the mutant was not completely

characterized. The researchers speculated that the disruptants did not produce baumycins,

yet this was not definitive because baumycin standards were not utilized in the

identification of anthracyclines produced. However, the S. peucetius dauH strain did

overproduce daunorubicin and saw a significant decrease in the production of e-

rhodomycinone. Thus, it is probable that DauH is involved in further bioconversion of

daunorubicin, perhaps to higher glycosides.

Disruption of the Streptomyces sp. strain C5 dtunS gene also was not

accomplished. Neomycin-resistant transformants were generated, however, with identical

Southern hybridization patterns as wild-type strain CS. Fig. 3.7 demonstrated that the

neomycin gene also was present in these putative mutants as a single copy, yet perhaps

inserted at another, unidentified locus. Streptomyces sp. strain CS may contain other

genes which encode glycosyltransferases involved in primary metabolism or cell

biosynthesis that may be potential targets for homologous recombination of a disrupted

glycosyltransferase gene. However, given the overall low sequence identity amongst these

enzymes, the possibility seems unlikely. Nevertheless, homologous recombination of the dnmS disruptant vector at a locus outside of the daunorubicin biosynthetic cluster is still

the most probable explanation for the observed results. Other chromosomal genes

involved in daunorubicin biosynthesis (dnrD, dnrP) in S. peucetius were also unable to be disrupted by similar techniques (Madduri and Hutchinson, 1995b) The reasons for the failures in either case are unknown.

137 The putative dnm S disruption generated in S. peucetius was accomplished by chemical mutagenesis and not generated by targeted, genetic mutagenesis (Ho and Chye,

1985). Although this strain had daunorubicin production restored by addition of dnm S in an expression construct (Otten et a i, 1995), the exact nature of the mutant, whether it exhibited pleiotropy or not, remains in doubt

Cloning, expression, and purification of glycosyltransferases

Recombinant DnmS and DauH were expressed and purified under denaturing conditions using the pTrcHis system in Escherichia coli. Attempts to express soluble proteins in E. coli by altering growth and induction conditions were unsuccessful.

Expression of recombinant Streptomyces sp. strain C5 daunorubicin biosynthetic enzymes in E. coli has presented solubility problems in the past. Attempts at expressing DoxA and

DauK with the pTrcHis system also resulted in the formation of insoluble inclusion bodies

(Dickens, 1997). A number of issues could contribute to the difficulties in maintaining solubility in a heterologous host including; increased hydrophobicity of enzymes due to hydrophobic substrates and possible interaction with membranes; slow streptomycete growth which correlates with slow protein expression normally; or the absence of streptomyces-specific folding factors (i.e., chaparonins). However, a few daunorubicin biosynthetic gene products fi'om S. peucetius have been expressed in E. coli and purified in their native state, indicating this problem is not generally inherent in the approach (Tang etai, 1996; Kendrewera/., 1999).

138 The solubilities of both enzymes were enhanced dramatically when their genes

were expressed from the streptomycete-based pU4123 (Takano et al., 1995). Purification

of glycosyltransferases also was eased by the addition of the Hise-tag on the pU4123-

based constructs. Solubility o f the purified proteins required the presence of high salt

concentrations (300 mM NaCl) and detergent (0.05% Tween 20). Under these conditions

glycosyltransferases could be purified and concentrated up to 1.5 mg/ml. Attempts to

concentrate above this mark almost exclusively resulted in protein precipitation. The

requirement of high salt for protein solubility was curious and was perhaps the result of a

“salting in” effect.

Determination of molecular weight

DnmS and DauH in their native purified state form dimers, as determined by size-

exclusion chromatography. Initial column runs on both enzymes gave two UV 280 nm

absorbance peaks, one corresponding to the size of a dimer, the other to the size of a

monomer. However, collection and analysis of both peaks by SDS-PAGE indicated that

the monomeric peak was an artifact and the dimer was the valid form for DnmS and

DauH. O f the other glycosyltransferases involved in antibiotic biosynthesis or resistance

examined, all are monomers in their native states (Quirôs and Salas, 1995; Quirôs et a i,

2000). However, glycosyltransferases not involved in antibiotic biosynthesis, such as a

mammalian UDP-glucuronosyltransferase and a fiructosyltransferase from Aspergillus fo etid u s exist as dimers in their native states (Meech and Mackenzie, 1997; Rehm et a i,

1998).

139 Time course for anthnicycline production and DnmS expression

Biosynthesis of antibiotics and other secondary metabolites generally occurs once the producing nears the completion of log phase and continues through stationary phase. Thus, it was expected that the enzymes responsible for biosynthesis of these compounds would be expressed in a similar time frame. Small quantities of e- rhodomycinone were initially detected once Streptomyces sp. strain CS fermentative cultures were well into log phase and production was still increasing at the completion of the growth period (Fig.3.12). DnmS expression followed a similar pattern to e- rhodomycinone production, implying that both events are coordinately regulated

However, expression of DnmS appeared to level off once the organism entered stationary phase, in contrast to the enzyme’s putative substrate, e-rhodomycinone, which continued to increase. By comparison, the downstream glycoside product, daunorubicin, maintained a low but steady concentration for most of the growth period. The large accumulation of e-rhodomycinone normally seen in strain C5 fermentations might be due to the simple fact that there is apparently less DnmS around to bind and convert the substrate to product.

Realistically though, DnmS activity and the concentration or availability of the other substrate, TDP-daunosamine, probably plays a more significant role in the accumulation of e-rhodomycinone.

In vivo giycosylation

Extensive efforts by a colleague. Dr. Nigel Priestley, to obtain TDP-daunosamine via chemical synthesis were not successful; thus, biological sources were examined Wild-

140 type strain C5 could have been used as a direct source o f nucleoside sugar, however, the

presence of DnmS would have complicated interpretation of any conversion results,

particularly when feeding substrates to cultures. Mutants in other daunorubicin biosynthetic genes could also have been utilized yet downstream glycosides would have been the products, not rhodomycin D (Bartel, 1990). In addition, experimentation with these may have shown glycosylation had occurred, but would not have deciphered the specific components of the glycosyltransferase-catalyzed reaction. Consequently, mutant strain CSAWl, containing a functional TDP-daunosamine biosynthetic pathway and lacking early and late biosynthetic functions, was generated.

Construction of the subsequent disruption vector involved deletion of the amino- terminal encoding portion of dnmQ, a putative sugar biosynthetic gene. DnmQ function was restored by introducing an expression vector containing the complete gene into strain

CSAWl. Moreover, the entire dnmS gene was still present in strain CSAWl, but low- resolution SI protection experiments by Madduri and Hutchinson (1995b) suggested that dnmQ and dnmS are transcribed as part o f a polycistronic transcript that also includes dauDKP. Thus, DnmS should not be expressed in strain CSAWl because its promoter is not present. This was confirmed by Western analysis of strain CSAWl extracts using anti-DnmS antisera.

In vivo feeding o f ‘^C-labeled e-rhodomycinone to recombinant strain CSAWl cultures (containing dnmQ, dnmS, or both genes in expression vectors) did not result in the production of rhodomycin D or other glycosides by any of the strains. Feeding the same compound to wild-type stain CS did result in labeled glycosides, so exogenous e-

141 rhodomycinone was capable of being taken up and acted upon by this particular strain.

Interestingly enough, strain CSAWl should still have a functional DauH Thus, DauH is

not the glycosyltransferase responsible for this particular reaction

Some possible reasons that conversion was not seen in the recombinant mutants include the instability of the product and problems with expression o f dnm S or dtrniQ from the expression vectors Rhodomycin D spontaneously deglycosylates over a period of several hours, even when stored in water or methanol at 4° C Corrective action for this observation was attempted by the restoration of dauK and dauP, along with dnmQ and dnm S to strain C5AW1. Since the downstream glycosides are usually seen at higher concentrations than rhodomycin D in strain C5 fermentations, it was assumed that the downstream glycosides were more stable than rhodomycin D (White and Stroshane,

1984). Nevertheless, no glycosides were detected in this new mutant strain (CSAWl

(pANT1034)) aAer feeding e-rhodomycinone to cultures. Product instability probably contributed to the poor efficiency of the glycosyltransfer reaction, but does not appear to be the primary factor in the failure to see conversion in the mutant strains.

Another problem that might exist with the in vivo assays is that DnmS and DnmQ activity may not have been restored to strain CSAWl by cloning the genes in pANT8S7 into the mutant. However, the presence of DnmS was noted in strain CSAWl

(pANT102S) cultures by Western analysis. Whether or not DnmS in strain CSAWl

(pANT102S) was properly folded and active remains a point of question. Furthermore, the in vitro glycosyltransferase assay data suggested that a functional, but highly limited.

142 TDP-daunosamine biosynthetic pathway was present in strain CSAWl (pANT1021), implicating the presence of functional DnmQ activity.

A highly speculative explanation for the lack of glycosylation in these recombinant mutant strains stems from observations from feeding studies using other strain CS daunorubicin biosynthetic mutants Glycosides were not detected when mutants in dpsA

{dauA74), dpsABCD, or dauC were fed ‘^C-labeled e-rhodomycinone (Bartel, 1990;

Rajgarhia and Strohl, 1997). The only mutant in which labeled glycosides were observed when E-rhodomycinone was fed was a dauE mutant (Bartel, 1990). Apparently, mutations in the polyketide synthase genes or other early acting biosynthetic genes negatively affect glycosylation. The reason for this is unknown; however, it is tempting to speculate that

DnmS interacts with the PKS components and early gene products as part of a large complex. Further experimentation is needed to sufficiently substantiate or refute this hypothesis.

TDP-daunosamine: e-rhodomycinone glycosyltransferase assay

The results of the in vitro glycosyltransferase assays using strain CSAWl

(pANT1021) extracts as sugar sources provided further evidence that DnmS is the glycosyltransferase capable of converting e-rhodomycinone to rhodomycin D (10- carbomethoxy-13 -deoxycarminomycin) rather than DauH. DnmS only glycosylated e- rhodomycinone using strain CSAWl (pANT1021) and not CSAWl alone or CSAWl

(pANT1027). Thus, extracts derived from strain CSAWl (pANT1021) must contain a functional TDP-daunosamine biosynthetic pathway. Despite the absence of a chemical

143 structure elucidation, the product co-migrated with authentic rhodomycin D using two different TLC solvent systems and eluted at the same retention time as authentic rhodomycin D on a reversed-phase HPLC column Moreover, the product identified by

TLC was radioactively labeled with a signal to noise ratio of over 10:1, indicating that it was a derivative of the '^C-labeled e-rhodomycinone. Acid hydrolysis of the product restored radiolabelled e-rhodomycinone, again confirming the authenticity of the product.

There remains a minute possibility tfiat the product was a glycoside of e- rhodomycinone with a different carbohydrate moiety. However, no such product has been identified in Streptomyces sp. strain C5 or Streptomyces peucetius. Furthermore, previous work has shown rhodomycin D to be the substrate for DauK and DauP, which indicates it is a daunorubicin biosynthetic pathway intermediate and the product of a reaction in the pathway (Dickens et al., 1997). On the basis of the above evidence, DnmS is the glycosyltransferase that catalyzes the addition of TDP-daunosamine to e-rhodomycinone, thus forming rhodomycin D.

Unfortunately, under the conditions used the maximum conversion of e- rhodomycinone to rhodomycin D by DnmS observed was 3%. A number of steps were taken to try and increase the conversion efficiency. First of all, the divalent cation, Mg^^, was added to the assays at various concentrations. Determination o f the three dimensional crystal structure of the SpsA glycosyltransferase from Bacillus subtilus revealed a hexacoordinate magnesium ion within the enzyme’s active site (Chamock and Davies,

1999). This finding implied that Mg^"^ may have a role in catalysis. However, addition of

Mg^^ to the glycosyltransferase assays did not increase the amount of rhodomycin D

144 produced. Increasing the amount of DnmS in the assays also had no effect on conversion efficiency, which suggested that some component in the assay was limiting The most likely candidate was TDP-daunosamine, since its concentration in the strain CSAWl extract was unknown.

Other attempts at improving product yield included altering the nucleoside sugar source. Of the other strain CS mutants (dauE, dauC) examined as potential sources, only the dauE mutant showed conversion. To ensure that no other enzymes in the dauE mutant were responsible for glycosylation, de-proteinated extracts were used as sources of the nucleotide sugar. A number of different techniques were used to remove proteins from the recombinant mutant strains including acetone precipitation, ammonium sulfate precipitation, and ultrafiltration. However, TCA precipitation was the only one that worked in the assays. This was a little unexpected since the nucleotide-sugar bond is usually labile in acid (Liu and Thorson, 1994). Nevertheless, rhodomycin D production was not improved with different biological sugar sources.

Some of the reasons that plagued the in vivo assays are applicable to the poor efficiency of the in vitro assays. For instance, instability of rhodomycin D probably plays a significant role. Additionally, inactivity of the recombinant DnmS is also a potential problem; however, this is unlikely because of the results observed in the binding assays.

Again, the most plausible explanation for the poor efficiency of these assays is the limited availability of TDP-daunosamine. Further discussion of this topic is covered in the next section.

145 Daunorubicin biosynthesis pathway implications

In wild-type Streptomyces sp. strain C5 and Streptomyces peucetius, e- rhodomycinone is the anthracycline intermediate present at the greatest concentration

(McGuire et a i , 1980). This implies stringent regulation at the glycosyltransfer step or poor glycosyltransferase activity, either due to inefficient catalysis by the enzyme or lack of available substrate, specifically TDP-daunosamine In vitro glycosyltransferase reactions using purified DnmS and Streptomyces sp. strain C5 mutant extracts as the source of sugar demonstrated poor conversion of e-rhodomycinone to rhodomycin D (2-

3%). These assays did not clarify if this was the result o f enzyme inefficiency or unavailability of TDP-daunosamine, however, they did suggest the latter explanation.

Work by Hutchinson and co-workers suggested that DnmS from S. peucetius was capable of efficient glycosyl transfer. Overexpression of DnmT, an enzyme involved in

TDP-daunosamine biosynthesis, in wild-type S. peucetius resulted in a 6-fold decrease in the amount of e-rhodomycinone and 8.5-fold increase in daunorubicin production, relative to the wild-type strain (Scotti and Hutchinson, 1996). The authors concluded that DnmT was limiting in the ATCC 25050 strain and overexpression allowed for sufficient amounts of TDP-daunosamine to be produced to increase daunorubicin production. Thus, DnmS was capable of efficient conversion in that recombinant strain.

Moreover, disruption of the S. peucetius c//;r-ORF6 (dauH in Streptomyces sp. strain C5) resulted in 2.5-fold decrease in e-rhodomycinone produced compared to wild- type and an increase in daunorubicin produced (Scotti and Hutchinson, 1996). As mentioned previously, d>ir-ORF6 encodes an enzyme believed to be involved in the

146 formation of higher glycosides of daunorubicin. It is unknown how this disruption positively affects glycosylation. However, it does show that native DnmS is capable of efficiently converting e-rhodomycinone to rhodomycin D and that accumulation of e- rhodomycinone is due to limited TDP-daunosamine.

Glycosyltransfer involving daunorubicin

The chemical structure of the product of the in vivo assay which used daunorubicin as a substrate for DauH expressed in Streptomyces lividans TK24 was not determined.

Despite this setback, a few conclusions can still be drawn about the product and DauH.

First of all, S. livickuts does not produce dideoxy sugars (Liu and Thorson, 1994). Thus, if the product is a glycoside, it does not contain a dideoxy sugar. This result still is consistent with the hypothesis that DauH is responsible for baumycin formation in strain

C5. More common sugars, TDP-glucose and TDP-galactose, were also tested as possible substrates in in vitro assays without any success. The possibility still remains that DauH is not a glycosyltransferase, yet no definitive evidence exists to support this notion. In fact,

Johnson and Liu (1998) believe that DauH is a glycosyltransferase that acts on NDP- deoxysugars, based on their sequence analysis.

Binding kinetics

The determination of binding parameters of glycosyltransferases to anthracyclines was significantly aided by the inherent fluorescence o f the ligands. Other methods are available for determining binding parameters such as equilibrium dialysis or filter binding

147 assays. However, fluorescence generally provides the advantage of increased sensitivity and the rapid assessment of the interactions (Lee, 1997). The preferred method for performing ligand fluorescence assays is to add enzyme to saturating concentrations to a solution of ligand, essentially performing the titration in reverse (Clarke, 1996). The fluorescence of the ligand may change upon binding to an enzyme, either due to the change in the microenvironment of the ligand or as the result of energy transfer (Lee,

1997). The direction and magnitude of this change is strictly dependent on the nature of the interaction.

The Ko’s determined for most of the anthracyclines were in the low micromolar range, which is still considered a fairly strong interaction (Suelter, 1985). By comparison,

K d ’ s reported from the apo egg white riboflavin binding protein, an enzyme with natural substrates structurally similar to anthracyclines, for doxorubicin, daunorubicin, and aclacinomycin A were 0.5 |iM, 0.4 ^iM, and 1 (iM, respectively (Fischer et a i, 1982).

These values are definitely within the range of the K d ’s of DnmS and DauH determined for a number of anthracyclines (Table 3.1).

Interestingly, both DnmS and DauH exhibited similar Kd values for e- rhodomycinone (Table 3.1). This is a reasonable finding because both enzymes should contain a domain capable of binding anthracyclines Additionally, all of the above assays were done in the absence of the second proposed substrate, TDP-daunosamine. The binding constants for each glycosyltransferase to ligand may not reflect the actual Kd ’s because the presence of the second substrate may alter binding affinities. In fact, the results from the “inhibition” studies suggest that this may be true for DnmS binding to e-

148 rhodomycinone. Both TDP and TDP-glucose at 0.1 mM concentrations increased the

binding of DnmS for e-rhodomycinone (Table 3 .1). TDP-glucose is apparently structurally

similar enough to TDP-daunosamine as to serve as an analog However, once bound, the

glucose moiety probably does not get transferred to e-rhodomycinone because all attempts to show transglycosylation to e-rhodomycinone with DnmS (purified protein, extracts

containing recombinant, and wild-type Streptomyces sp. strain C5) and TDP-glucose were

unsuccessful.

The enhanced binding of DnmS to e-rhodomycinone in the presence of 0.1 mM

TDP was unexpected, primarily because TDP is one of the predicted products of the

reaction. The most probable explanation is that TDP at lower concentrations binds to the

nucleotide-sugar binding domain in the same manner as TDP-daunosamine would, except

catalysis can not occur in the former case. In other words, TDP probably mimics TDP-

daunosamine to give an abortive complex that pulls the equilibrium in favor of bound e-

rhodomycinone.

This nucleotide binding enhancement was not observed with ADP or ADP-glucose at identical concentrations or TDP at 1 mM concentration. Kapitonov and Yu (1999) reported that DnmS belongs to a group of glycosyltransferases that possess a carboxy- terminal nucleotide recognition domain, termed NDRip. This domain was predicted to bind only -sugars (UDP, TDP) and not purine-sugars (ADP, GDP). The inability of ADP or ADP-glucose to affect DnmS binding to e-rhodomycinone supports the strict specificity o f the nucleotide-binding site for . By comparison, DauH binding to e-rhodomycinone in the presence of 0.1 mM TDP was largely unafifected,

149 implying that TDP at this concentration is incapable of mimicking the natural DauH sugar substrate (Table 3.1). Whether this indicates that DauH does not utilize a TDP-sugar as a natural substrate remains to be proven. Moreover, since the promotion effect of TDP on e-rhodomycinone binding was limited to DnmS, this supports the specificity of DnmS for

E-rhodomycinone and a TDP-sugar These results, as a whole, again point to DnmS as the

E-rhodomycinone daunosamine glycosyltransferase in daunorubicin biosynthesis.

Mechanism

Analysis of the binding data provided insights into the catalytic mechanism of

DnmS. The ability of DnmS to bind e-rhodomycinone without TDP-daunosamine eliminates the possibility that the reaction proceeds by a ping-pong mechanism. A ping- pong mechanism would require TDP-daunosamine to bind first with subsequent release of the TDP moiety prior to e-rhodomycinone binding. Additionally, the reaction is not random because with four parameters involved (two substrates with two possible paths), quadratic functions from the binding data would have been the expected outcome, which was not the case (Fromm, 1979). Furthermore, DnmS binding to e-rhodomycinone was enhanced in the presence of TDP, suggesting TDP is the first product off of the enzyme.

If TDP were the last product to come off the enzyme, competition with 8-rhodomycinone for DnmS binding would have been expected, resulting in inhibition. As explained earlier,

TDP at specific concentrations actually promoted E-rhodomycinone binding, perhaps by mimicking TDP-daunosamine.

150 Since rhodomycin D is the predicted product of the e-rhodomycinone daunosamine glycosyltransfer reaction, it should also bind to the glycosyltransferase. The Kd of DnmS for rhodomycin D was calculated to be 2.45 ± 0.35 |iM. However, in the presence of 0.1 mM 1T)P, the other proposed product, DnmS exhibited a similar binding constant to that determined for rhodomycin D alone (2.27 pM) (Table 3.1). The non-effect of TDP on rhodomycin D binding implicates rhodomycin D as the last product off o f DnmS, while

TDP comes off first. This is in agreement with the data for DnmS binding to e- rhodomycinone in the presence of TDP If TDP were the last product off, it should compete with e-rhodomycinone, the first substrate to bind, for DnmS binding.

Consequently, all of the presented binding data indicate a sequential ordered mechanism with e-rhodomycinone binding first, followed by TDP-daunosamine (Fig. 4.1).

TDP is the first product to come off of DnmS and rhodomycin D the last. TDP may mimic

TDP-daunosamine in terms of binding to the enzyme; however, this would result in a dead-end pathway.

Campbell et al. (1997) aligned 555 glycosyltransferase sequences from the various databases by sequence similarities and came up with 26 different families. Each family was defined by a minimum of two sequences of significant amino acid or hydrophobic cluster analysis (HC A) similarity over a length of at least 100 amino acids. DnmS and most o f the known GTs from antibiotic-producing organisms fell into Family #1, characterized by enzymes whose catalysis resulted in inversion of the anomeric configuration of the substrates to products. Olel, the glycosyltransferase involved in oleandomycin resistance in Streptomyces antibioticus, is also a member of Family #1. As mentioned previously,

151 Fig. 4.1. Proposed reaction mechanism for DnmS based upon binding assay results.

152 H- DnmS Proposed Reaction Mechanism

EZeRHO + TDP *• E2-e-RH0-TDP

LA w E+E-»- ►EZ + e-RHO-«-»EZ-e-rho + TDP-DAUNOt—•EZ-e-RHO-TDP-DAUNG

EZTDPRHOG»— »EZ-RHOD + TDP*— *-EZ + RHOD*— ►EZ*«— ► E+E Olel catalyzes glycosyl transfer by a compulsory-order mechanism in which oleandomycin

(the aglycone) binds first, followed by UDP-glucose (Olano et a i, 1995). A ternary complex is formed, followed by glucose transfer, UDP release, and glycoside release

OleD, from the same bacterium, also has a very similar mechanism to Olel (Quirôs et al.,

2000). The proposed mechanism for DnmS follows the same sequence; aglycone binding, nucleotide-sugar binding, nucleotide release, and lastly glycoside release The similar mechanism exhibited by these enzymes lends credence to their grouping into the same family by sequence similarity.

Site-directed mutagenesis of DnmS

Proper folding o f enzymes is a critical issue in assays involving mutagenized proteins. Generally, circular dichroism (CD) spectra of mutants are compared to the wild- type protein to ensure the integrity of the various secondary and tertiary structures. CD spectra of the site-directed DnmS mutants and wild-type protein were not obtained due to a number of reasons, all stemming from the buffer used to keep the proteins in solution.

First of all, accurate protein concentrations could not be determined by amino acid analysis because of the strict requirement of high salt and detergent in the buffers, which were incompatible with AA analysis.

Nevertheless, protein concentrations were determined by absorbance measurements at 280 nm and Bradford assays and samples were run on the CD spectrometer. Spectra of each enzyme examined had a great deal of interference at 220 nm and below, which is the region critical for detecting secondary structures. Discussions

154 with the spectrometer manufacturer’s technical support group again led to the conclusion

that the detergent and high salt most likely are the cause of this interference.

Unfortunately, as stated previously, these components are required for solubility of the

recombinant enzymes. However, an approach using the fluorescence binding assays

addressed some of the activity issues associated with the DnmS mutants and circumvented

the need for CD spectra.

Along with the DnmS mutant containing an altered potential catalytic residue,

G 199 A, two other mutants were successfully expressed and purified. The latter mutations

were made in two residues located at the ends of the glycosyltransferase motif

(Fig. 4.2). The upstream proline residue at the beginning of the glycosyltransferase motif

does not have a proposed functional role Alteration of the residue to alanine affected

protein expression or protein stability to the degree that pure protein could not be

obtained. On the other hand, the conserved Pro/GIn at the end of the “glycosyltransferase

motif’ (Pro^^’ and Gln^^ in DnmS) have been implicated in recognition of the pyrimidine

portion of the nucleotide sugar (Kapitonov and Yu, 1999). As stated previously, DnmS

belongs to a group of glycosyltransferases that possess a carboxy-terminal nucleotide

recognition domain, termed NDRip, which encompasses the GT motif. Involvement of

these residues in nucleotide-sugar binding was tested using the fluorescence binding assays

developed for DnmS using the following premises. First of all, if mutants bound e- rhodomycinone with the same strength as wild-type DnmS, then they could be considered properly folded and active. Secondly, the enhancement of e-rhodomycinone binding by

155 Fig. 4.2. Glycosyltransferase consensus sequence motif. (**) above DnmS PQ indicates mutated residues. Origins of sequences: TylM2 and TyIN from

Streptomyces fradiae; RhlB from Pseudomonas aeruginosa; DnmS and DauH from

Streptomyces sp. strain CS; GtfB from Amylocopsis orientaiis. Figure was adapted from Wilson and CundiifTe (1998).

156 ■73 H" Oq TylN LM PRTAAWHHGGFGTTADAVRAGVPQV L.VP f TylM2 L( .PTCSAWHHOGAGTCFTATLNGLPQIVVA

RhlB LI, PSCAG r .VHPGGIGAMSLALAAGVPQV f, I ,P

DiiiiiS VI, PSCAAVVHHGQAGTWATAALHGVPQI ,A l.,A

BryCIII/OrfS L L PTCAATVHHGG PGSWHTAAIHGVPQVILP

-J DauH LL PSCSGIIHHQGSOTFMTALAHATPQF., 1VP

G tfB LFGRVAAVIHHGGAGTTHVAARAGAPQI [ ,LP

CONSENSUS LhP* *AAhhHHGGAGT* * *A* *AGhPQlilihP TDP could be examined in those DnmS mutants that were deemed properly folded. If the enhancement phenomenon was absent, then disruption of the residue negatively impacted nucleotide-sugar binding.

For instance, DnmS mutant G199A is likely to be properly folded because the mutant was capable o f binding e-rhodomycinone and TDP with the same strength as wild- type DnmS. Glu‘^ is one of three conserved carboxylic acid-containing residues in DnmS and its likely role would be in catalysis and not nucleotide-sugar substrate binding.

Nevertheless, this mutant served as a good “negative” control for the binding assays.

Mutagenesis of DnmS Pro^^^ to Ala^^’ and analysis of binding to e-rhodomycinone alone also resulted in little difference between the mutant and wild-type Kd values (Table

3 .22). However, in the presence of 0.1 mM TDP, binding to e-rhodomycinone by DnmS

P339A was not enhanced, in contrast to what was observed for wild-type DnmS. As stated previously, TDP at lower concentrations probably mimics TDP-daunosamine, and consequently binds DnmS, resulting in enhanced aglycone binding. The DnmS P339A mutant did not exhibit this same capability, which suggests that TDP did not bind.

Additionally, the structural integrity of the mutant appears to be maintained since e- rhodomycinone binding is similar to wild-type DnmS binding.

These results suggest that Pro^^^ may be involved in nucleotide-sugar binding by

DnmS. Whether the involvement is in actual binding or structure remains undetermined.

The latter case is the more likely scenario based on the absence of chemical reactivity of the proline side chain and the structural involvement of these residues in bends between secondary structure elements (Brandon and Tooze, 1991). The alteration of proline to

158 alanine introduced a much smaller hydrophobic residue into the enzyme, which may have

negatively impacted the positioning of Gln^^ Gln'^'*" is the more likely candidate to bind

nucleotides because of its positively charged side chain.

Unfortunately, the results of the binding assays by the DnmS Q340D were

inconclusive. Changing the residue to an aspartic acid should have completely abolished

electrostatic interactions because of the introduction of the negative charge Binding

constants for e-rhodomycinone in the presence and absence of TDP could not be

determined because the spectra at 539 nm were inconsistent. Without CD spectra for this

mutant, it is difficult to conclusively attribute the inability to bind e-rhodomycinone to the

mutation.

Only a few glycosyltransferases have been crystalized to date, making prediction of

functional roles for amino acids difficult. However, a few other conserved amino acids in

glycosyltransferases have been recently hypothesized to be involved in substrate binding

and catalysis, on the basis of the proposed reaction mechanism and GT sequence

alignments (Saxena et al., 1995; Campbell et a i, 1997; Kapitonov and Yu, 1999). As

implied earlier, amino acids containing carboxylic acids are believed to be involved in

catalysis (i.e., glycosyl transfer). Glycosyltransferases that invert stereochemistry at the

anomeric center catalyze the transfer of glycosylated moieties via an Sn2 nucleophilic

substitution. Consequently, aspartic acids or glutamic acids are the most probable

candidates for the nucleophile because they have the appropriate side chains that can act as the general base for acceptor activation or as the nucleophile for the formation of the glycosyl-enzyme intermediate (Campbell et al., 1997).

159 Asp^' and Glu'” were identified as two conserved carboxylic acid residues in

DnmS. Alteration of Asp^' to alanine apparently affected protein expression, protein stability, or turnover of improperly folded protein in Streptomyces lividans TK24 by the

Ptip promoter because the recombinant protein was unable to be purified On the other hand, mutagenesis of Glu'” to alanine resulted in reasonable recombinant protein expression and subsequent purification The effect of this mutation on catalysis was unable to be determined.

Kapitonov and Yu also implicated a residue found at the beginning of the glycosyltransferase motif (His^^^ in DnmS) to act as a proton donor in the reaction mechanism for NDRlp containing glycosyltransferases. Unfortunately, attempts to generate a His^^"* to Asn^^^ mutation in DnmS were unsuccessful.

160 CHAPTER 5

SUMMARY AND CONCLUSIONS

This dissertation describes the isolation and characterization of glycosyltransferases functional in the daunorubicin/doxorubicin biosynthetic pathway of

Streptomyces sp. strain CS. Ironically, this research addresses one of the last major uncharacterized steps in daunorubicin/doxorubicin biosynthesis, while at the same time introduces new findings to the adolescent study of glycosyltransferases involved in antibiotic biosynthesis pathways.

With the completion of this work, a majority of the daunorubicin biosynthetic reactions in Streptomyces sp. strain C5 and Streptomyces peucetius have now been identified and experimentally proven. Some of the unique features uncovered from this biosynthetic pathway include: the unusual location o f certain polyketide genes in the gene cluster (Madduri et a/., 1993; Grimm eta l., 1994; Ye et al., 1994), the role of DpsC in starter selection and the identity of starter unit itself (Rajgarhia and Strohl, 1997; Bao e t a i, 1999). downstream enzymes that utilize a number of glycoside substrates (Conners e t al., 1990b; Conners et al., 1993; Dickens and Strohl, 1996), and the discovery of the unique DoxA oxidase (Dickens, 1997; Dickens e/a/., 1997; Walczak e/a/., 1999). Each of these features plays an important role in the generation of the final, biologically active products. Likewise, the role of DnmS in the daunorubicin/doxorubicin biosynthetic pathway is believed to be equally important due to two primary reasons. First of all the 161 proposed substrate for DnmS, e-rhodomycinone, is the major anthracycline intermediate that accumulates in Streptomyces sp. strain C5 fermentions (McGuire et al.. 1980). Thus, daunorubicin production seems to be limited at this step. Secondly, the addition of the sugar residue, TDP-daunosamine, is absolutely required for daunorubicin/doxorubicin activity. These reasons warranted further investigation of the two glycosyltransferases found in the daunorubicin/doxorubicin biosynthetic gene cluster.

The complete dnmS gene was isolated from the Streptomyces sp. strain C5 genome, cloned, sequenced, and expressed in a heterologous Streptomyces host. The previously identified dauH was also expressed recombinantly. Both glycosyltransferases were purified to homogeneity and were found to form dimers under non-denaturing conditions. Only three other daunorubicin biosynthetic enzymes have been purified to homogeneity and biochemically characterized to date (Bao et a i, 1999;

Kendrewe/ al., 1999; Walczak et al.. 1999). Consequently, this work further increases the basic understanding of the structural and functional makeup of enzymes in antibiotic biosynthetic pathways.

Another finding of this research was that the expression of DnmS in wild-type strain C5 was coordinated with anthracycline production, supporting its role as a daunorubicin biosynthetic enzyme. Consequently, DnmS was determined to be the e- rhodomycinonerTDP-daunosamine glycosyltransferase by in vitro conversion assays and ligand binding assays. This is the first characterization of an enzyme involved in antibiotic biosynthesis to examine binding parameters, by taking advantage of the inherent fluorescent properties of the anthracycline ligands. In addition, a reaction mechanism for DnmS was proposed based on the results of the binding assays. DnmS

162 follows a sequential ordered mechanism in which e-rhodomycinone binds first, followed by TDP-daunosamine; TDP departs first, followed by rhodomycin D.

Finally, analysis of site-directed mutants of DnmS established that disruption of

Pro^^^ negatively effected nucleotide-sugar binding, however, the exact role of this residue remains unclear. This work was also the first attempt to evaluate the structure- activity relationships of an enzyme involved in anthracycline biosynthesis by site- directed mutagenesis.

Investigation of the daunorubicin/doxorubicin biosynthesis reactions has given rise to a number of practical strategies for the improvement antibiotic biosyntheses and for the generation of novel products. Direct industrial applications resulting from research conducted over the last decade primarily deal with doxorubicin production and combinatorial biosynthesis. For instance, genetic engineering of Streptomyces peucetius by mutagenesis or enhanced expression of gene products involved in regulation or biosynthesis resulted in increased doxorubicin production (Stutzmen-Engwall et a i.

1992; Scotti and Hutchinson, 1996, Lomovskaya e/a/., 1999; Lomovskaya e/a/., 1999).

Consequently, a large-scale industrial process for the conversion of daunorubicin to doxorubicin was developed (Inventi-Scolari et a/., 1997). In addition, combinatorial biosynthesis studies in S. peucetius resulted in the production of the daunorubicin analog, epirubicin (Madduri et al., 1998). Each industrial application example could not have been achieved without the initial identification and characterization of enzymes and their corresponding reactions required to synthesize these anthracyclines.

As a result, further work on DnmS and DauH could also lead to enhanced doxorubicin production or more likely, the production of novel compounds. Specifically

163 identifying the function of DauH could open avenues for the production of higher

glycosides of daunorubicin or doxorubicin. As mentioned previously, some of the third generation anthracyclines currently being examined for increased efficacy are dissacharide derivatives of doxorubicin (Arcamone et a i, 1998; Arcamone, 1998).

Moreover, a comprehensive analysis of the roles of DnmS amino acids could lead to a better understanding of the factors that effect catalytic efficiency and substrate specificity. As a result, daunorubicin production could theoretically be increased and novel antibiotics generated by alteration of specific amino acids. Additionally, the structure-function relationships established in DnmS could also apply to other glycosyltransferases involved in antibiotic biosynthesis. Thus, the capability to biologically generate new structures would increase dramatically. This work has established the groundwork for the pursuit of these beneficial goals.

164 List of References

Aitschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.

Arcamone F. 1981a. Doxorxibicin: Anticancer antibiotics. New York: Academic Press, 1981.

Arcamone, F. 1981b. Structure-activity relationships, pp. 79-84. In G. Mathe, M. Maral, and R. De Jager (ed.), Anthracyclines: current status and future developments. Masson Publishing USA, Inc., New York.

Arcamone, F. 1998. From the pigments of the actinomycetes to third generation antitumor anthracyclines. Biochimie 80:201-206.

Arcamone, F., F. Animati, G. Capranico, P. Lombardi, G. Pratesi, S. Manzini, R. Supino, and F. Zunino. 1998. New developments in antitumor anthracyclines. Pharmacol. Ther. 76:117-124.

Arcamone, F., G. Cassinelli, G. Fantini, A. Grein, P. Orezzi, C. Pol, and C Spalla. 1969a. Adriamycin, 14-hydroxydaunomycin, a new antitumor antibiotic from S. peucetius var. caesius. Biotechnol. Bioeng. 11:1101-1110.

Arcamone, F., DiMarco A., Gaetani M., and T. Scotti. 1961. Isolamento ed attivita antitumorale di un antibiotico do Streptomyces sp. Giom Microbiol. 9:83-90.

Arcamone F., G Franceschi, and S. Penco. 1969b. Adriamycin (14- hydroxydaunomycin), a novel antitumor antibiotic. Tetrahedron Lett. 13:1007-1010.

Bachur, N. R., R. Johnson, F. Yu, R. Hickey, and L. Malkas. 1995. Anthracycline antihelicase action. New mechanism with implications for guanosine-cytidine intercalation specificity, p. 204-221. In W. Priebe (ed.), Anthracycline antibiotics. New analogues, methods of delivery, and mechanisms of action. American Chemical Society Press, Washington, D. C.

Bao, W, P. J. Sheldon, andC. R. Hutchinson. 1999. Purification and properties o f the Streptomyces peucetius DpsC beta-ketoacy 1 : acyl carrier protein synthase in that specifies the propionate-starter unit for type II polyketide biosynthesis. Biochemistry 38:9752-9757.

165 Bartel, P. L. 1989. Analysis of natural and hybrid antibiotic formation in anthracycline- producing streptomyces, Ph.D. Dissertation, p. 242. The Ohio State University, Columbus, Ohio.

Bartel, P. L., N. C Connors, W R. Strohl. 1990a. Biosynthesis of anthracyclines; Analysis o f mutants of Streptomyces sp. strain C5 blocked in daunomycin biosynthesis. J. Gen. Microbiol. 136:1877-1886.

Bartel, P. L., C. B. Zhu, J. S. Lampel, D C. Dosch, N. C. Connors, W. R. Strohl, J. M. Beale, Jr., and H.G. Floss. 1990b. Biosynthesis of anthraquinones by interspecies cloning of actinorhodin biosynthesis genes in streptomycetes: Clarification of actinorhodin gene functions. J. Bacteriol. 172:4816-4826.

Berdy, J. 1995 Are actinomycetes exhausted as a source of secondary metabolites? pp. 13-34. In V.G. Debabov, Y. V. Dudnik, and V. N. Danilenko (eds ), Proceedings of the Ninth International Symposium on the Biology of Actinomycetes. All-Russia Scientific Research Institute for Genetics and Selection of Industrial Microorganisms, Moscow.

Bibb, M. J., P. R. Findlay, and M. W. Johnson. 1984.The relationship between base composition and codon usage in bacterial genes and its use for the simple and reliable identification of protein-coding sequences. Gene 30:157-166.

Blakesley, R. W. and J. A. Boezi. 1977. A new staining technique for protein in polyacrylamide gels using Coomassie Brilliant Blue G-250. Anal. Biochem. 82:580-582.

Blanco, G., E. Fernandez, M. J. Fernandez, A. F Brana, U. Weissbach, E. Kunzel, J. Rohr, C. Mendez, and J. A. Salas. 2000. Characterization of two glycosyltransferases involved in early glycosylation steps during biosynthesis of the antitumor polyketide mithramycin by Streptomyces argiUaceus. Mol. Gen. Genet. 262:991-1000.

Blum, R., and S. Carter. 1974. Adriamycin, a new anticancer drug with significant clinical activity. Ann. Intern Med. 80:249-259.

Blumauerova, M., J. Mateju, K. Strajner, and Z. Vanek. 1977. Studies on the production of daunomycinone-derived glycosides and related metabolites in Streptomyces coeruleortibidus and Streptomyces peucetius. Folia Microbiol. 22:275-285.

Bonadonna, G., S. Monfardini, M. de Lena, F. Fossati-Bellani. 1969. Clinical evaluation of adriamycin, a new antitumor antibiotic. Brit. Med. J. 3:503-506.

166 Bonfante, V. 1981. Toxic and therapeutic activity of 4 -epidoxorubicin pp. 149-152. In G. Mathe, M. Maral, R. De Jager (eds.) Anthracyclines: Current Status and Future Developments. New York: Masson Publishing USA.

Bradford, M. M. 1976. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle o f protein-dye binding. Anal Biochem. 72:248-254.

Brandon, C., and J. Tooze. 1991. Motifs of protein structure, pp. 13-14. In Introduction to protein structure. Garland Publishing, Inc. New York.

Brockmann, H. and K. Bauer. 1950. Rhodomycin, ein rotes Antibioticum aus Actincmyceten. NaturwissenschaAen 37:492-493.

Brockmann, H., and H. Brockmann Jr. 1963. Rhodomycine, VIII; Antibiotica aus Actinomyceten. L. Chem. Ber. 96:1171-1178

Campbell, J. A., G. J. Davies, V. Buione, and B. Henrissat. 1997 A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid similarities. Biochem. J. 326:929-942.

Carter, M. J., and L. D. Milton. 1993 An inexpensive and simple method for DNA purification on silica particles. Nucleic Acids Res. 21:1044.

Casey, M. L., R. C. Paulick, and H. W. Whitlock. 1978. Carbon-13 nuclear magnetic resonance study o f the biosynthesis of daunomycin and islandicin. J. Org. Chem 43:1627-1634.

Cassinelli, G. and P. Orezzi. 1963. La daunomicina: Un nuovo antibiotico ad citostatica isolamento e proprieta. Giom Microbiol. II: 167-174.

Charnock, S. J., and G J. Davies. 1999. Structure of the nucleotide-diphospho-sugar transferase, SpsA from Bacillus subtilus, in native and nucleotide-complexed forms. Biochem. 38:6380-6385.

Chen, A. V., and L. F. Liu. 1994. DNA topoisomerases - essential enzymes and lethal targets. Annu. Rev. Pharmacol. Toxicol. 34:191-218.

Cleland, W. W 1963 The kinetics of enzyme-catalyzed reactions with two or more substrates or products. I. Nomenclature and rate equations. Biochem. Biophys. Acta. 67:104-137.

167 Connors, N. C., P. L. Bartd, and W. R Strohl. 1990a. Biosynthesis of anthracyclines; Enzymic conversion of aklanonic acid to aklavinone and e-rhodomycinone by anthracycline-producing streptomycetes. J. Gen. Microbiol. 136:1887-1894.

Connors, N. C., P. L. Bartel, and W. R Strohl. 1990b. Biosynthesis of anthracyclines: carminomycin 4-0-methyltransferase, the terminal enzymic step in the formation of daunomycin. J. Gen. Microbiol. 136:1895-1898.

Connors, N. C., and W. R Strohl. 1993. Partial purification and properties of carminomycin 4-0-methyltransferase fi’om Streptomyces sp. strain C5. J. Gen. Microbiol. 139:1353-1362.

Cullinane, C., A. van Rosmalen, and D. R Phillips. 1994. Does adriamycin induce interstrand cross-links in DNA? Biochem. 33:4632-4638.

CundiifTe, E. 1992. Glycosylation of macrolide antibiotics in extracts o f Streptomyces lividans. Antimicrob. Agents Chemother. 36:348-352.

Cutts S. M. and D. R Phillips. 1995. Use of oligonucleotides to define the site of interstrand cross-links induced by adriamycin. Nucl. Acids Res. 23:2450-2456.

Dahlquist, F. W. 1978. The meaning of Scatchard and Hill Plots. Methods Enzymol. 48:270-299.

Decker, H. and S. Haag. 1995. Cloning and characterization of a polyketide synthase gene fi'om Streptomyces fradiae TÜ2717, which carries the genes for biosynthesis of the angucycline antibiotic urdamycin A and a gene probably involved in its oxygenation. J. Bacteriol. 177:6126-6136.

Dekleva, M. and W. R Strohl. 1987. Glucose-stimulated acidogenesis by Streptomyces peucetius. Can. J. Microbiol. 33:1129-11132.

De Meirsman, C., C. Van Soom, S. Verreth, A. Van gool, and J. Vanderleyden. 1990. Nucleotide sequence analysis of IS427 and its target sites in Agrobacterium tumefaciensT'Sl. Plasmid 24:227-234.

DeSanti, C., J. S. Lampel, K. A. Lampel, and W. R Strohl. Unpublished data.

Despois, R , M. Dubost, D. Mancy, R Maral, L. Ninct, S. Pinnert, J. Prud'homme, Y. Charpentic, A. Belloc, N. de Chezelles, J. Lunel, and J. Renaut. 1967. Un novel antibiotique doue d’activité antitumorale: la rubidomycine( 13 057 R. P.). I. Preparation et propriétés. Arzneim Forsch. 17:934-939.

168 Devereux, J., P. Hacberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.

Dickens, M. L. 1997. The molecular biology and biochemistry of doxorubicin biosynthesis in Streptomyces sp strain C5. Ph.D. Dissertation, p. 185-214. The Ohio State University, Columbus, Ohio.

Dickens, M. L., N. D Priestley, and W. R. Strohl. 1997. In vivo and in vitro bioconversion of e-rhodomycinone glycoside to doxorubicin; functions of DauP, DauK, and DoxA. J. Bacteriol. 179:2641-2650.

Dickens, M. L., and W. R. Strohl. 1996. Isolation and characterization of a gene from Streptomcyes sp. strain C5 that confers the ability to convert daunomycin to doxorubicin on Streptomyces lividans TK2A. J. Bacteriol. 178:3389-3395.

Dickens, M. L., J. Ye, and W. R. Strohl. 1995. Analysis of clustered genes encoding both early and late steps in daunomycin biosynthesis by Streptomyces sp. strain C5. J. Bacteriol. 177:536-543.

Dickens, M. L., J. Ye, and W. R. Strohl. 1996. Cloning, sequencing and analysis of aklaviketone reductase from Streptomyces sp. strain C5. J. Bacteriol. 178:3384-3388.

DiMarco, A., M. Gaetani, L. Dorigotti, M. Soldati, and O. Bellini. 1963. Studi sperimentali sull "attivita" antineoplastica del nuovo antibiotico daunomicina Tumori 49:203-217.

DiMarco, A., M. Gaetani, L. Dorigotti, M. Soldati, and O. Belini. 1964. “Daunomycin”, a new antibiotic with antitumor activity. Cancer Chemother. Rep. 38:31- 38.

DiMarco, A., M. Gaetani, P. Orezzi, BM Scrapinato, R. Slivestrini, M. Soldati, T. Dasdia, and L. Valentin:. 1964. “Daunomycin”, a new antibiotic of the rhodomycin group. Nature (London) 201:706-707.

Doroshow, J. H. 1988. Organ directed toxicities of anticancer drugs, pp. 31-40. In Hacker, M., Lazo, J , and T. Tritton (eds ). Role of reactive oxygen production in doxorubicin cardiac toxicity. Martinus Nijhoff, Boston, MA.

Doroshow, J. H. 1995. Role of reactive-oxygen metabolism in cardiac toxicity of anthracycline antibiotics, pp. 259-267. In W. Priebe (ed.), Anthracycline antibiotics: new analogues, methods of delivery, and mechanisms of action. American Chemical Society Press. Washington, D. C.

169 Doumith, M., R. Lcgnind, C. Lang, J. A. Salas, and M. C Raynai. 1999. Interspecies complementation in Saccharopoyspora erythraea: elucidation of the function of olePl, oleGl. and oleG 2 from the oleandomycin biosynthetic gene cluster of Streptomyces antibioticus and generation of new erythromycin derivatives. Mol. Microbiology. 34:1039-1048.

Driica, K., and R. J. Franco. 1998. Inhibitors of DNA topoisomerases. Biochem. 27:2253-2259.

Dubost, M., P. Ganter, R. Maral, L. Ninet, S. Pinnert, J. Prud'homme, and G H Werner. 1963. Un novel antibiotique a properties cytostatique: la nibidomycine. CR Acad. Sci. 257:1813-1815.

Eckardt, K. and C. Wagner. 1988. Biosynthesis o f anthracycUnones. J. Basic Microbiol. 28:137-144.

Fernandez, E., U. Weifibach, C. S. Reillo, A. F. Brada, C. Méndez, J. Rohr, and J. A. Salas. 1998. Identification of two genes from Streptomyces argiUaceus encoding glycosyltransferases involved in transfer of a disaccharide during biosynthesis of the antitumor drug mithramycin. J. Bacteriol. 180:4929-4937.

Filippini, S., M M. Selinas, U. Breme, M. B. Schluter, D. Gabellini, G. Biamonti, and A. L. Garofano. 1995. Streptomyces peucetius daunorubicin biosynthesis gene, dnr^: sequence and heterologous expression. Microbiology 141:1007-1016.

Fischer, D. S., M. T. Knobf, and H. J. Durivage. 1993. The cancer chemotherapy handbook, 4“* ed. Mosby, St. Louis, Missouri.

Fisher, J., K. Ramakrisbnan, and K. E. McLane. 1982. Complexation of anthracycline antibiotics by the apo egg white riboflavin binding protein. Biochem. 21:6172-6180.

Fish, S. A., and E. CundiifTe. 1997. Stimulation o f polyketide metabolism in Streptomyces fradiae by tylosin and its glycosylated precursors. Microbiology 143:3871- 3876.

Fromm, H. J. 1979. Summary of kinetic reaction mechanisms. Meth. Enzymol. 63:42- 53.

Fujii, S., K. Kubo, O. Jobdo, A. Yosbimoto, T. Isbikura, H. Naganawa, T. Sawa, T. Takeuchi, and H. Umezawa. 1986. A new anthracycline metabolite D788-I (10- carboxy-13-deoxocarminomycin) in daunorubicin beer. J. Antibiot. 39:1240-1242.

170 Gallo, M. A., J. Ward, and C R. Hutchinson. 1996. The dttrM gene in Streptomyces peucetius contains a naturally occurring frameshiA mutation that is suppressed by another locus outside o f the daunorubicin-production gene cluster. Microbiology (Reading) 142:269-275.

Gandecha, A. R., S. L. Large, and E. CundiifTe. 1997. Analysis of four tylosin biosynthetic genes from the tylLM region of the Streptomyces fradiae genome. Gene 184:197-203.

Gewirtz, D. A. 1999. A critical evaluation o f the mechanisms of action proposed for the antitumor effects o f the anthracycline antibiotics adriamycin and daunorubicin. Biochem. Pharm. 57:727-741.

Gibb, G. D., Dekleva, M. L., Lampel, J. S., and W. R. Strohl. 1987. Isolation and characterization of a Streptomyces C5 mutant strain hyperproductive of extracellular protease. Biotechnol. Lett. 9:605-610.

Gourmelen, A., M. H. B. Rouault, and J. L. Pemodet. 1998. Characterization of a glycosyl transferase inactivating macroiides, encoded by gimA from Streptomyces ambofaciens. Antimicrob. Agents Chemother. 42:2612-2619.

Graham, M. A., D. J. Kerr, P. Workman. 1993. Absorption and distribution of anticancer drugs, p. 1-26 In A. T. Florence, E. G. Salole (eds ). Pharmaceutical Aspects of Cancer Chemotherapy. Oxford. Butterworth-Heinemann.

Grein, A., C. Spalla, A. DiMarco, and G. Canevazzi. 1963. Descrizione e classiAcazione di un attinomicette {Strptomyces peucetius sp. nova) produttore di Una Sostanza ad attivita antitumorale: la daunocinina. Giom. Microbiol. 11:109-118.

Grimm, A., K. Madduri, A. Ali, and C. R. Hutchinson. 1994. Characterization of the Streptomyces peucetius ATCC 29050 genes encoding doxorubicin polyketide synthase. Gene 151:1-10.

Hale, J. P. and I. J. Lewis. 1994. Anthracyclines: cardiotoxicity and its prevention. Arch. Dis. Childhood 71:457-462.

Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids J. Mol. Biol. 166:557.

Hernandez, C , C. Olano, C. Méndez, and J. A. Salas. 1993. Characterization of a Streptomyces antibioticus gene cluster encoding a glycosyltransferase involved in oleandomycin inactivation. Gene 134:139-140.

171 Hickman, J. A. 1992. Apoptosis induced by anticancer drugs. Cancer Metastasis Rev. 11:121-139.

Higashlde, E., T. Hasegawa, M. Shibata, and K. Mizumo. 1972. U.S. Patent 3655878.

Hirano, S., K. Wakazono, N. Agata, H. IguchI, and H. Tone. 1994. Comparison of cardiotoxicity of pirarubicin, epirubicin, and doxorubicin in the rate. Drugs Exp. Clin. Res. 20:153-160.

Ho, C. C., and M. L. Chye. 1985. Construction of a genetic map of chromosomal auxotrophic markers in Streptomyces peucetius var. caesius. J. Gen. AppI Microbiol. 31:231-241.

Hong, Y. S., C. K. Hwang, S. K. Hong, Y. H. Kim, and J. J. Lee. 1994. Molecular cloning and characterization of the aklavinone 11-hydroxylase gene of Streptomyces peucetius subsp. caesius ^ C C 27952. J. Bacteriol. 176:7096-7101.

Hopwood, D. A., M. J. Bibb, K F. Chater, T. Kieser, C. J. Bruton, H M. Kieser, D. J. Lydiate, C. . Smith, J. M. Ward, and H Schrempf. 1985. Genetic manipulation of Streptomyces. a laboratory manual. The John Innes Foundation, Norwich, England.

Hutchinson, C. R. 1995. Anthracyclines. p. 331-357. In L. C. Vining and C. Stuttard (eds.). Genetics and biochemistry of antibiotic production. Boston. Butterworth- Heinemann.

Hwang, C. K., H. S. Kim, Y. S. Hong, Y H. Kim, S. K. Hong, S. J. Kim, and J. J. Lee. 1995. Expression of Streptomyces peucetius genes for doxorubicin resistance and aklavinone 11-hydroxylase in Streptomyces galilaeus ATCC 31133 and production of a hybrid aclacinomycin. Antimicrob. Agents Chemother. 39:1616-1620.

Inventi-Scolari, A., F. Torti, S. L. Ottcn, A L. Colombo, and C. R. Hutchinson. Process for preparing doxorubicin. U.S. patent application.

Jenkins, G., and E. CundiifTe. 1991. Cloning and characterization o f two genes from Streptomyces lividans that confer inducible resistance to lincomycin and macrolide antibiotics. Gene 108:55-62.

Johdo, O. H. Tone, R. Okamoto, and A. Yosbimoto. 1992. Photochemically obtained N-demethyl derivatives of anthracyclines. J. Antibiot. 45:1653-1661.

Johnson, D. A., and H. W. Liu. 1998. Mechanisms and pathways from recent deoxysugar biosynthesis research. Curr. Opin. Chem. Biol 2:642-649.

172 Kapitonov, D., and R. K. Yu. 1999. Conserved domains in glycosyltransferases. Glycobiol. 9:961-978.

Kendrew, S. G., E. Deutsch, K. Madduri, and C R. Hutchinson. 1996. Aklanonic acid methyl ester cyclase: An intramolecular aldol condesation in the biosynthesis of daunorubicin. Bloomington: Abstr Sixth Conf Gen Mol Biol Industr Microorg, P4.

Kendrew, S. G , K. Katayama, E. Deutsch, K. Madduri, and C. R. Hutchinson. 1999. DnrD cyclase involved in the biosynthesis of doxorubicin: purification and characterization o f the recombinant enzyme. Biochem. 38:4794-4799.

Kem, D. L., R. H. Bunge, J. C. French, and H. W. Dixon. 1977. The identification of G-rhodomycine and 7-deoxy-daunorubicinol aglycone in daunorubin beers. J. Antibiot 30:432-434.

Kim, H. S., Y. S. Hong, Y. H. Kim, O. J. Yoo, and J. J. Lee. 1996. New anthracycline metabolites produced by the aklavinone 11-hydroxylase gene in Streptomyces galilaeus J. Antibiot. 49:355-360.

Kitamura, I., H. Tobe, A. Yoshimoto, T. Oki, H. Nagahawa, T. Takeuchi, and H. Umezawa. Biosynthesis of aklavinone and aclacinomycins. J. Antibiot. 34:1498-1500.

Kleene, R., and E. G. Berger. 1993. The molecular and cellular biology of glycosyltransferases. Biochim. Biophys. Acta. 1154:283-325.

Kleman, G. L., and W. R. Strohl. 1993. PC program for FRAME and CODON PREFERENCE analysis. ptp.bio.Indiana.edu (129.79.224.25)/mol-bio/iomps/frame.zip.

Komiyama, T., Y. Matsuzaqa, T. Oki, T. Inui, Y. Takahashi, H. Naganawa, T. Takeuchi, and H. Umezawa. 1977. Baumycins, new antitumor antibiotics related to daunomycin. J. Antibiot 30:619-621.

Kriigel, H., G. Schumann, F. Hanei, and G. Fielder. 1993. Nucleotide sequence analysis of five putative Streptomyces griseus genes, one of which complements an early function in daunorubicin biosynthesis that is linked to a putative gene cluster involved in TDP-daunosamine formation. Mol. Gen. Genet. 241:193-202.

Kyte, J. and R. F. Doolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly o f the head of bacteriophage T4. Nature (London) 227:680-685.

173 Lampel, J. S., and W. R. Strohl. 1986. Transformation and transfection of anthracycline-producing streptomycetes. AppI. Environ. Microbiol. 51:126-131.

Lee, Y. C. 1997. Fluorescence spectrometry in studies of carbohydrate-protein interactions. J. Biochem. 121:818-825.

Liu, L. F. 1989. DNA topoisomerase poisons as antitumor drugs. Annu. Rev. Biochem 58:351-375.

Liu, H. W., and J. S. Thorson. 1994. Pathways and mechanisms in the biogenesis of novel deoxysugars by bacteria. Annu. Rev. Microbiol. 48:223-256.

Liu, W. C , and K. U. Rao. 1974. U.S. Patent 3852425.

Lomovskaya, N., S. L. Otten, V. Doi-Katayama, L. Fonstein, X. C. Liu, T. Takatsu, A. Inventi-Solari, S. Filippini, F. Torti, a. L. Colombo, and C. R. Hutchinson. 1999. Doxorubicin overproduction in Streptomyces peucetius: cloning and characterization of the dnrU ketoreductase and dnrV genes and the doxA cytochrome P-450 hydroxylase gene. J. Bacteriol. 181:305-318.

Lomovskaya, N., D. K. Yukiko, S. Filippini, C. Nastro, L. Fonstein, M. Gallo, A. L. Columbo, and C. R. Hutchinson. 1998. The Streptomyces peucetius dpsY and dnrX genes govern early and late steps of daunorubicin and doxorubicin biosynthesis. J. Bacteriol. 180:2379-2386.

Lovrien, R., and D. Matulis. 1995. Assays for total protein, p. 3.4.13. In: J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield (eds). Current Protocols in Protein Science. John Wiley and Sons, Inc.

MacNeil, D. J. 1988. Characterization of a unique methyl-specific restriction system in Streptomyces avermitilis. J. Bacteriol. 170:5607-5612.

Madduri, K., and C. R. Hutchinson. 1995a. Functional characterization and transcriptional analysis of the dnrRt locus, which controls daunorubicin biosynthesis in Streptomyces peucetius. J. Bacteriol. 177:1208-1215.

Madduri, K., and C. R. Hutchinson. 1995b. Functional characterization and transcriptional analysis of a gene cluster governing early and later steps in daunorubicin hiosynxhesxs \n Streptomyces peucetius. J. Bacteriol. 177:3879-3884.

Madduri, K., J. Kennedy, G. Rivola, A. Inventi-Solari, S. Filippini, G. Zanuso, A. L. Colombo, K. M. Gcwain, J. L. Occi, D. J. MacNeil, and C. R. Hutchinson. 1998. Production of the antitumor drug epirubicin (4’-epidoxorubicin) and its precursor by a genetically engineered strain o f Streptomyces peucetius. Nat. Biotechnol 16:69-74. 174 Madduri, K., F. Torti, A. L. Columbo, and C. R. Hutchinson. 1993. Cloning and sequencing of a gene encoding carminomycin 4-O-methyltransferase from Streptomyces peucetius and its expression in Escherichia coli. J. Bacteriol. 175:3900-3904.

Mancy, D., J. Florent, and J. Freud*homme. 1975. U.S. Patent 3855010.

Mariani, F., E. Ficcoiella, V. Colizzi, R. Rappuoli, and R. Gross. 1993. Characterization o f an IS-like element from Mycobacterium tuberculosis. J. Gen. Microbiol. 139:1767-1772.

Matsuzawa, Y., A. Yoshimoto, K. Kuono, and T. Oki. 1977. Baumycin analogs from Actinomadura sp. J. Antibiot. 34:774-776.

McGuire, J. C., M. C. Thomas, R. M. Stroshane, B. K. Hamilton, and R. J. White. 1980. Biosynthesis of daunomycin glycosides; role of e-rhodomycinone. Antimicrob. Agents Chemother. 18:454-464.

Meech, R., and F. L Mackenzie. 1997. UDP-giucuronosyltransferase, the role of the amino terminus in dimerization. J Biol. Chem. 272:26913-26917.

Mullis, K., F. Faloona, S. Scharf, R Saiki, G. Horn, and H. Erlich. 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 51:263-273.

Murphy, G. F., W. Lawrence Jr., and R. E. Lenhard. 1995. American Society Textbook of Clinical Oncology, 2"^ Edn. American Cancer Society, Atlanta, Georgia.

Myers, C. E., W. F. McGuire, and R H. Liss. 1977. Adriamycin: the role of peroxidation in cardic toxicity and tumor response. Science 197:165-169.

Niemi, J. and F. Mantsala. 1995. Nucleotide sequences and expression of genes from Streptomyces purpurascens that cause the production of new anthracyclines in Streptomyces galilaeus. J. Bacteriol. 177:2942-2945.

Oakley, B. R , D. R Kirsch, and N. R Morris. 1980. A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 105:361-363.

Ogawa, Y., H. Sugi, N. Fujikawa, and H. Mori. 1981. Rubeomycin, a new anthracycline antibiotic complex. I. Taxonomy of producing organism, isolation, characterization, and biological activities o f rubeomycin A, A,, B and Bj. J. Antibiot. 34:938-950.

175 Oki, T., I. KlUmura, Y. Matsuzawa, N. Shibamoto, T. Ogasawara, A. Yoshimoto, and T. Inui. 1979. Antitumor anthracycline antibiotics, aclacinomycin A and analogues. II. Structural determination. J. Antibiot. 32:801-819.

Oki, T., I. Kitamura, A. Yoshimoto, A. Matsuzawa, N. Shibamoto, T. Ogasawara, T. Inui, A. Takamatsu, T. Takeuchi, T. Masuda, M. Hamada, H. Suda, M. Ishuzuka, T. Sawa, and H. Umezawa. 1979. Antitumor anthracycline antibiotics, aclacinomycin A and analogues. I. Taxonomy, production, isolation, and physicochemical properties. J. Antibiot. 32:791-800.

Oki, T., Y. Matsuzawa, K. Kiyoshima, and A. Yoshimoto. 1981. New anthracyclines, feudomycins, produced by the mutant from Streptomyces coenileorubidus ME 130-A4. J. Antibiot. 34:783-790.

Oki, T., Y. Matsuzawa, A. Yoshimoto, K. Numata, L Kitamura, S. Hori, A. Takamatsu, H. Umezawa, M. Ishuzuka, H. Naganawa, H. Suda, M. Hamada, and T. Takeuchi. 1975. New antitumor antibiotics, aclacinomycins A and B. J. Antibiot. 28:830-834.

Olano, C., N. Lomovskaya, L. Fonstein, J. T. Roil, and C. R. Hutchinson. 1999. A two-plasmid system for the glycosylation of polyketide antibiotics; bioconversion of e- rhodomycinone to rhodomycin D. Chem. Biol. 6:845-855.

Olano, C., A. M. Rodriguez, J. M. Michel, C. Méndez, M. C. Raynai, and J. A. Salas. 1998. Analysis o f a Streptomyces antibioticus chromosomal region involved in oleandomycin biosynthesis, which encodes two glycosyltransferases responsible for glycosyltation of the macrolactone ring. Mol. Gen. Genet. 259:299-308.

OsherofT, N., A. H. Corbett, S. H. Elsea, and M. Westergaard. 1994. Defining functional drug-interaction domains on topoisomerase II by exploiting mechanistic differences between drug classes. Cancer Chemother Pharmacol. 34(Suppl):S 19-525.

Otten, S. L., M. A. Gallo, K. Madduri, X. Liu, and C. R. Hutchinson. 1997. Cloning and characterization of the Streptomyces peucetius dnmZUV genes encoding three enzymes required for biosynthesis of the daunorubicin precursor, thymidine diphospho-L- daunosamine. J. Bacteriol. 179:4446-4450.

Otten, S. L., X. Liu, J. Ferguson, and C. R. Hutchinson. 1995. Cloning and characterization of the Streptomyces peucetius dnrQS gene encoding a daunosamine biosynthesis enzyme and a glyosyl transferase involved in daunorubicin biosynthesis. J. Bacteriol. 177:6688-6692.

176 Parry, R. J., and W. Li. 1997. An NADPH FAD oxidoreductase from the valanimycin producer Streptomyces viridifaciens. Cloning, analysis, and overexpression. J. Biol. Chem. 272:23303-23311.

Paulick, R. C., M. L. Casey, and H. W. Whitlock. 1976. A ' C nuclear magnetic resonance study of the biosynthesis of daunomycin from ‘^Cj'^COiNa. J. Am. Chem. Soc. 98:3370-3371.

Pinnert, S. and L. Ninet. 1979. U.S. Patent 3989598.

Pommier, Y. 1995. DNA topoisomerases and their inhibition by anthracyclines, pp. 183-203. In W. Priebe (ed.), Anthracycline antibiotics. New analogues, methods of delivery, and mechanisms of action. American Chemical Society Press, Washington D C

Quiros, L. M., I. Aguirrezabalaga, C. Olano, C. Méndez, and J. A. Salas. 1998. Two glycosyltransferases and a glycosidase are involved in oleandomycin modification during its biosynthesis by Streptomyces antibioticus. Mol. Microbiol. 28: 1177-1185.

Quiros, L. M., R. J. Carbajo, A. F. Brana, and J. A. Salas. 2000. Glycosylation of macrolide antibiotics. Purification and kinetic studies of a macrolide glycosyltransferase from Streptomyces antibioticus.J. Biol. Chem. 275:11713-11720.

Quiros, L. M., and J. A. Salas. 1995. Biosynthesis of the macrolide oleandomycin by Streptomyces antibioticus. Purification and kinetic characterization o f an oleandomycin glucosyltransferase. J. Biol. Chem. 270:18234-18239.

Rajgarhia, V. B. and W. R. Strohl. 1997 Minimal Streptomyces sp. strain C5 Daunorubicin polyketide biosynthesis genes required for aklanonic acid biosynthesis. J. Bacteriol. 179:2690-2696.

Reddy, G. C. S., R. Saha:, H. W. Fchlhabcr, and B. N. Ganguli. 1985. Isolation and structure of a new e-rhodomycin compound produced by a Streptomyces species HPL Y- 11472. J. Antibiot. 38:1423-1425.

Rehm, J., L. Wiilmitzer, and A. G. Heyer. 1998. Production of 1-kestose in transgenic yeast expressing a fiuctosyltransferase from Aspergillus foetidus. J. Bacteriol. 180: 1305- 1310.

Roca, J. and J. C. Wang. 1994. DNA transport by a type II DNA topoisomerase: Evidence in favor of a two-gate mechanism. Cell 77:609-616.

Saiki, R. K., S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Amheim. 1985. Enzymatic amplification of globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354. 177 Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning; A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York

Sanger, F., S. NicMcn, and A. R. Coulson. 1977. DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74:5463-5467.

Sasaki, J., K. Mizoue, S. Morimoto, and S. Omura. 1996. Microbial glycosylation of macrolide antibiotics by Streptomyces hygroscopicus ATCC 31080 and distribution of a macrolide glycosyl transferase in several Streptomyces strains. J. Antibiot. 49:1110-1118.

Saxena, I. M., R. M. Brown, Jr., M. Fevre, R. A. Geremia, and B. Henrissat. 1995. Multidomain architecture of 3-glycosyl transferases: implications for mechanism of action. J. Bacteriol. 177:1419-1424.

Scotti, C. and C. R. Hutchinson. 1995. Immobilization and properties of carminomycin 4-O-methyltransferase, the enzyme which catalyzes the final step in the biosynthesis of da.unoTub\c\n 'm Streptomyces peucetius. Biotechnol. Bioeng. 48:133-140.

Scotti, C. and C. R. Hutchinson. 1996. Enhanced antibiotic production by manipulation of the Streptomyces peucetius dnrH and dnm T genes involved in doxorubicin (adriamycin) biosynthesis. J. Bacteriol. 178:7316-7321.

Shan, K., A. M. Lincott, and J. B. Young. 1996. Anthracycline-induced cardiotoxicity. Arm. Intern. Med. 125:47-58.

Shen, B., R. G. Summers, E. Wendt-Pienkoski, and C. R. Hutchinson. 1995. The Streptomyces glaucesetts tcmKL polyketide synthase and tcm N polyketide cyclase genes govern the size and shape of aromatic polyketides. J. Am. Chem. Soc. 117:6811-6821

Soienberg, P. J., P. Matsushima, D. R. Stack, S. C. Wilkie, R. C. Thompson, and R. H. Baltz. 1997. Production of hybrid glycopeptide antibiotics iti vitro and in Streptomyces toyocaensis. Chem. Biol. 4:195-202.

Speyer, J. and C. Wasserheit. 1998. Strategies for reduction of anthracycline cardiac toxicity. Semin. Oncol. 25:525-537.

Strauss, D. and W. F. Fleck. 1975. Luekaemomycin, and antibiotic with antitumor activity. II. Isolation and identification. Zeitschr. Allg. Mikrobiol. 15:615-623.

Strohl, W. R. 1992. Compilation and analysis o f DNA sequences associated with apparent streptomyces promoters. Nucleic Acids Res. 20:961-974.

178 Strohl, W. R., P. L. Bartel, N. C. Connors, C. B. Zhu, D. C. Dosch, J. M. Beale Jr., H. G. Floss, K. Stutzmann-Engwall, S. L. Otten, and C. R. Hutchinson. 1989. Biosynthesis of natural and hybrid polyketides by anthracycline-producing streptomycetes. pp. 68-84. In C. L. Hershberger, S. W. Queener, G. Hegeman (eds). Genetics and molecular biology of industrial microorganisms Washington, D. C American Society for Microbiology.

Strohl, W. R., and N. C. Conners. 1992. Significance of anthraquinone formation resulting fi'om the cloning of actinorhodin genes in heterologous streptomycetes. Mol. Microbiol. 6:147-152.

Strohl, W. R., M. L. Dickens, V. B. Rajgarhia, A. Woo, and N. D. Priestley. 1997. Anthracyclines, p.577-658. In W. R. Strohl (ed.). Biotechnology o f antibiotics, 2“* ed Marcel-Dekker, Inc., New York.

Strohl, W. R., J. Ye, and M. L. Dickens. 1995. Daunomycin biosynthesis genes of Streptomyces sp. strain C5. Proceedings o f the Ninth International Symposium on the Biology of the Actinomycetes. pp. 45-54. In V. G. Debabov, Y. V. Dudnik, V. N. Danileko (eds ), All-Russia Scientific Research Institute for Genetics and Selection o f Industrial Microorganisms, Moscow.

Stutzman-Engwall, K. J., S. L. Otten, and C. R. Hutchinson. 1992. Regulation of secondary metabolism in Streptomyces spp and the overproduction of daunorubicin in Streptomyces peucetius. J. Bacteriol. 174:144-154.

Suarato A. 1990. Antitumor anthracyclines. In D. E. V. Wilman (ed ). The of antitumor agents. Glasgow; Blackie and Son, Ltd. 30-62.

Sueiter, C. 1985. Protein-ligand complexes and enzyme kinetics, p. 203-265. In Practical guide to enzymology. John Wiley & Sons. New York.

Summers, R. G., S. Donadio, M. J. Staver, E. Wendt-Pienkowski, C. R. Hutchinson, and L. Katz. 1997. Sequencing and mutagenesis of genes from the erythromycin biosynthetic gene cluster of Saccharopolyspora erythraea that are involved in L-mycarose and D-desosamine production. Microbiology 143:3251-62.

Tang, L., A. Grimm, Y. X. Zhang, and C. R. Hutchinson. 1996. Purification and characterization of the DNA-binding protein DnrI, a transcriptional factor of daunorubicin biosynthesis in Streptomyces peucetius. Mol. Microbiol. 22:801-813.

Takahashi, Y., H. Naganawa, T. Takeuchi, H. Umezawa, T. Komiyama, T. Oki, and T. Inui. 1977. The structure of baumycins Al, A2, B l, B2, C l, and C2. J. Antibiot. 30:622-624.

179 Takano E., J. White, C J Thompson, and M. J. Bibb. 1995. Construction of thiostrepton-inducible, high-copy-number expression vectors for use in Streptomyces spp Gene 166:133-137.

Thompson, C. J., T. Kieser, J. M. Ward, and D. A. Hopwood. 1982. Physical analysis of antibiotic-resistance genes from Streptomyces and their use in vector construction. Gene. 20:51-62.

Thompson, M. W , W. R. Strohl, and H. G. Floss. 1992. Purification and characterization of TDP-D-glucose 4,6-dehydratase from anthracycline-producing streptomycetes. J. Gen. Microbiol. 138:779-786.

Tunac, J. B„ B. D. Graham, W. E. Dobson, and M. D. Lenzini. 1985. Fermentation by a new daunomycin-producing organism, Streptomyces insignis ATCC 31913. Appl. Environ. Microbiol. 49:265-268.

Uchida, T., M. Imoto, Y. Takahashi, A. Odagawa, T. Sawa, K. Tatsuta, H. Naganawa, M. Hamada, T. Takeuchi, and H. Umezawa. 1988. New potent anthracyclines, barminomycins I and II. J. Antibiot. 41:404-408.

Umezawa, H., V. Takahashi, M. Kinoshita, H. Naganawa, T. Masuda, M. Ishizuka, K. Tatsuta, and T. Takeuchi. 1979. Tetrahydropyrany 1 derivatives of daunomycin and adriamycin. J. Antibiot. 32:1082-1084.

Umezawa, H., K. Yamada, T. and T. Oki. 1981. Comparative experimental studies on 4 '-O-tetrahydropyranyl-adriamycin and adriamycin. pp. 183-188. In G Mathé, M. Maral, R. De Jager (eds.), Anthracyclines; current status and future developments. Masson Publishing, New York.

Viiches, C , C. Hemândez, C. Méndez, and J. A. Salas. 1992. Role of glycosylation and deglycosylation in biosynthesis of and resistance to oleandomycin in the producer organism, Streptomyces antibioticus. J. Bacteriol. 174: 161-165.

Wagner, C., C. Stengel, I. Eritt, G. Schumann, W. F. Fleck. 1985. Leukaemomycin- geblockte Mutanten des Streptomyces griseus und ihre Pigmente. UI. 11- Desoxydaunycinon-derivate aus der Mutante ZIMET 43 699/G44. J. Basic Microbiol. 25:687-693.

Walczak, R. J., M. L. Dickens, N. D. Priestley, and W. R. Strohl. 1999. Purification, properties, and characterization of recombinant Streptomyces sp. strain C5 DoxA, a cytochrome P-450 catalyzing mutiple steps in doxorubicin biosynthesis. J. Bacteriol. 181:298-304.

180 Weirnik, P. H. and J. P. Butcher. 1992. Clinical importance of anthracyclines in the treatment of acute myeloid leukemia Leukemia 6:67-69.

Weiss, R. B. 1992. The anthracyclines. Will we ever find a better doxorubicin? Semin. Oncol. 19:670-686.

Weiss, R. B., G. Sarosy, K. Clagctt-Carr, M. Rosso, and B. Lcyland-Jones. 1986. Anthracycline analogs; The past, present, and future. Cancer Chemother. Pharmacol. 18:185-197.

Westrich, L., S. Domann, B. Faust, D. Bedford, D. A. Hopwood, and A. Bechthold. 1999. Cloning and characterization of a gene cluster fi'om Streptomyces cyattogenus SI 36 probably involved in landomycin biosynthesis. FEMS Microbiol. Lett 170:381-387.

White, R. J., and R. M. Stroshane. 1984. Daunorubicin and adriamycin: properties, biosynthesis, and fermentation, p. 569-594. In E. J. Vandamme (ed.). Biotechnology of Industrial Antibiotics, Marcel-Dekker. New York.

Wilson, V. T. W., and E. CundiifTe. 1998. Characterization and targeted disruption of a glycosyltransferase gene in the tylosin producer, Streptomyces fradiae. Gene 214:95- 100.

Wright, F„ and M. J. Bibb. 1992. Codon usage in the G+C rich Streptomyces genome. Gene 113:55-65.

Xue, V., L. Zhao, H. W. Liu, and D. H. Sherman. 1998. A gene cluster for macrolide antibiotic biosynthesis in Streptomyces venezuelae: architecture of metabolic diversity. Proc. Natl. Acad. Sci. 95; 12111-12116.

Yanisch-Perron, C , J. Vieira, and J. Messing. 1985. Improving M13 phage cloning vectors and host strains: nucleotide sequences of the M l3 pUC18 and pUC19 vectors. Gene 33:103-119.

Ye, J., M. L. Dickens, R. Plater, Y. Li, J. Lawrence, and W. R. Strohl. 1994. Isolation and sequence analysis of polyketide synthase genes from the duanomycin- producing5/re/7/om^cejsp. strain C5. J. Bacteriol. 176:6270-6280.

Yoshimoto, A., S. Fujii, O. Johdo, K. Kubo, T. Ishikura, H. Naganawa, T. Sawa, T. and Takeuchi, H. Umezawa. 1986. Intensely potent anthracycline antibiotic oxaunomycin produced by blocked mutant of daunorubicin-producing organism. J. Antibiot. 39:902-909.

181 YoshimotOy A., T. Old, T. Takeuchi, and H. Umezawa. 1980a. Microbial conversions of anthracyciinones to daunomycin by blocked mutants of Streptomyces coeruleortibidiis. J. Antibiot. 33:1158-1166.

Yoshimoto, A., T. Old, and H. Umezawa. 1980b. Biosynthesis o f daunomycinone from akiavinone and E-rhodomycinone. J. Antibiot. 33:1199-1201.

Zhang, H., V. Obias, K. Gonyer, and D. Dennis. 1994. Production of polyhydroxyalkanoates in sucrose-utilizing recombinant Escherichia caii and Klebsiella strains. Appl. Environ. Microbiol. 60:1198-1205

Zvelebil, M. J., and M. J. E. Sternberg. 1988. Analysis and prediction o f the location of catalytic residues in enzymes. Protein Eng. 2:127-138.

182 Appendix A

Table of Bacterial Strains Used

183 Strain Description Reference/Source Escherichia coli . DH5a Hanahan, 1983

ET12567 dam', dcm', hsd MacNeil, 1988

Top 10 Invitrogen

Streptomyces lividatts. TK24 act*, dau Hopwood e/a/., 1985

Streptomyces sp. strain C5 ATCC 49111 wild type, McGuire er a/., 1980a dan*, ban*

SC5-110 danE' mutants Bartel, 1989; Bartel et al., 1990a

SC5-74 dan A' (dpsA) Bartel, 1989; mutant Bartel et al., 1990a

SC5-69 danO Bartel, 1989; Bartel et al., 1990a

C5AW-1 dpsFEABCD'. This work danGCDKF, dnmOS

Table A l. Bacterial Strains Used In This Work.

184 Appendix B

Maps of Plasmids Used

185 Ndel,183 EcoRI,396 Sacl Kpnl 2 6 1 7 ,A a tII Xm al BamHI ,X b aI [ISail PstI .SphI 2294,X m nI, ^HindIII,447

2177,Seal

Sapl,683

\flIII,806

L784,Gsu I . 1766,B sal

AI wNI,1217

Fig. B.l. Map of the £1 coli cloning vector pUC19 (Yanisch-Perron et al., 1985).

186 BamHLSlS Sacl PChoI 4282,fibel B rill s t i 4091,EcoRV Kpnl EcoRI 3850,ApaI p -trc HindIII,559 3657,Bell 3643,Mlul

pTrcHis-(A,B,C) 4414 bps 3202,NsiI \ ApaLI,1199 3200,SphI

Scal,1388 2988,AccI 2943.ApaLI

Brll,1747 2445,ApaLI 2345,AlwNI

Fig. B.2. Map of the E. coli protein expression vector pTrcHisA (Invitrogen).

187 Xhol

Pnl

SphI... Bgin EcoRI SstI Kpnl Xmal Ttd BamHI Ndel PtipA

To Clal TSR

SstI KAN

SphI

Fig. B.3. Map of the Streptomyces protein expression vector pIJ4123 (Takano e t oA, 1995).

188 Kpnl

pK K 840 aphi 4119 bps

ampR

Bglll

Fig. B.4. Map of the £. coli cloning vector pKK840 containing the a p h gene l (Rajgarhia and Strohl, 1997).

189 Hindin BamHI

ampR danZ BamHI

EcoRI ^ 8 tl pANT152 dnmT dpsA 10360 bps , dauG

dpaE dauH BamHI

dpsF dauE S s tI SstI BamHI EcoRI

Fig. B.S. Map of the Streptomyces vector pANTlS2 containing a portion of the daunorubicin biosynthetic gene cluster (Dickens, 1997).

190 Hindm Clal /.BamHI //Kpnl ///.Satl 7// EcoRI o n

lacZ-alpha

pANT841 2746 bps

ampR

Fig. B.6. Map of the E, coli cloning vector pANT84i (DeSanti et oL, unpublished).

191 BamHI Xhol

Stul. rep

snpR ... N otl

pANT849

Saul 1 5343 bps

P-snpA

Xhol orfS 6 SphI,: EcoRI .1 Bginl Xbal] S a d i H indllli tsrR D ralf Spel I Ndel Hpall Mlul

Fig. B.7. Map of the Streptomyces protein expression vector pANT849 (Dickens and Strohl, 1996).

192 BamHI Xhol

Bbnl. Sphli EcoRI I Bgin Xbal Sacl Hindm Oral Spel? Notl Hpal pA N T855 Mlul 4799 bps

PvuII

EcoRV Clal

Fig. B.8. Map of the E. coli-Streptomyces shuttle vector pANT8S5.

193 BamHI Xhol AauII PvuII PmaCI rep

o n Notl

pANT857 orfS6 ampR 7970 bps Seal"* XmnI ■■ Ndel

SspI Clal tsrR EcoRV

snpR P-snpA PvuII S tul -V BaaHH BatXI PvuII

Saul

Fig. B.9. Map of the E. coHStreptomyces shuttle vector pANTSS? (Rajgarhia and Strohl, 1997).

194 Kpnl. Xhol Asp718\ AsuII

pANT799C orfSb 8093 bps

XmnI

EcoRV

P-snpA

Stul BssHII M lul Hpal Spel H indlll S a d Xbal iB g ill EcoRI SphI Xhol Saul

Fig.B.lO. Map of the £. coli-Streptomyces shuttle vector pANT799C (Rajgarhia and Strohl. 1997).

195 Appendix C

Table of Plasmids Generated in This Study

196 Plasmid Size Description Name (kb) p ANTI 000 2.88 0.21 kb £coRI-AmaI PCR product containing the 5’ region o f dauH cloned into pUC19 pANTlOOl 4.11 1.25 kb X m al fragment from pANT152 containing the rest o f the dauH gene cloned into pANTlOOO pANT1002 6.80 1.47 kb EcoU-HhuKm insert from pANTlOOl containing the entire dauH gene cloned into pANT849 pANT1004 5.04 2.56 kb Nrul-Eco91 fragment of pANT152 containing the dauH gene into pANT841 p ANTI 005 6.60 2.56 kb /fr/K/m-£coRI insert o f pANT1004 into the suicide vector pDH5 p ANT1006 8.10 1.50 kb BgtO. fragment from pKK840 containing the aphl gene cloned into pANTl005 pANTlOO? 5.17 2.52 kb Sphl-Kpril fragment from the Streptomyces sp. strain C5 genome containing the entire dtunS and partial drrC cloned into pANT841 pANTlOOS 10.62 2.53 kb SphlUEcoU insert from pANT1007 into pANT799C pANT1009 6.54 1.50 kb BgFCL fragment from pKK840 containing the aphl gene cloned into pANT1004 pANTlOlO 7.32 2.52 kb Sphl-Eco91 fragment from pANT1007 containing the complete dnmS gene cloned into pANT855 pANTlOll 6.25 1.48 kb EcoBl-HituBU fragment from pANTlOOl containing the entire dauH gene cloned into pANT855 pANTlOlS 11.85 9.21 kb insert with the aph l gene replacing 9 kb of DNA between dpsF and dnmS, 2.54 kb Clal-HindHL fragment from pANT1008, 5.24 kb SstI fragment from pANT152, 1.32 kb Kpnl-BglU. fragment from pKK840; all cloned into pA>rr841 (see Fig. 2.3) pANTlOM 5.84 1.46 kb Xhol-HittcUIL PCR product containing the dauH gene cloned into pTrcHisA pANT1015 6.88 2.5 kb Xhol-HincKQ. PCR product containing the dnmS gene cloned into pTrcHisA pANT1016 4.4 1.7 kb £coRI-M:oI fragment from pant 140 (Dickens, 1997) containing the complete dnmQ gene cloned into pANT841. pANTlOn 4.51 1.87 kb Sstl-Hiitdlll fragment from pANT1007 containing the dnm S gene in pANT841. pANT1018 5.04 2.36 kb MfeI-£coRI PCR product containing dnmS cloned into pA>4T841. pANT1019 5.04 2.36 kb Sphl-Eco91 PCR product containing cbtmS cloned into pANT841. ______(continued)

Table C .l. Table of plasmids generated in this study.

197 Table C.l (continued).

pANT1021 9.77 1.8 kb £coRI-///>ii/III fragment of pANTlOlô containing the complete cùm Q gene cloned into pANT857. p ANTI 022 8.17 3 .0 kb SphI fragment of pANT140 (Dickens, 1997) containing dauK, dauF, and diimQ cloned upstream of dumS in pANT1007. pANT1023 4.45 1.72 kb N del-E coR l PCR product containing dnm S cloned into pANT84I. pANT1024 6.9 4.2 kb E cdB l-K pnl fragment of pANTI022 containing cùmQ and dnntS cloned into pANT841 pANT1025 12.0 4.2 kb £coRI-i^/iI fragment of pANT1024 containing dnmQ and dnm S cloned into pANT8S7. pANT1026 4.45 1.72 kb Sphl-E coR l PCR product containing dnm S cloned into pANT841. pANT1027 9.69 1.72 kb Sphl-EcoKL fragment of pANT1026 containing d/tmS cloned into pANT857. pANTI028 10.9 1.72 kb N del-E coB l fragment from pANT1023 containing dnmS cloned into pU4123. pANTI029 10.9 1.72 kb Ndel‘E co R l fragment from pANT1023 containing dnmS Asp41 Ala mutant gene cloned into pU4123. pANT1030 10.9 1.72 kb N del-E coB I fragment from pANT1023 containing dnmS Pro339Ala mutant gene cloned into pU4123. pANT1031 10.9 1.72 kb N del-E coR l fragment from pANT1023 containing dnmS Glul99Ala mutant gene cloned into pU4123. pANT1032 4.34 1.91 kb N del-E coR l PCR product containing the complete dauH gene cloned into pUC19. pANT1033 8.47 4.07 kb EcoRI fragment of pANTI022 containing dnmS, dnmQ, and dauP cloned into pANT1016 (dauK). pANT1034 13.5 3 .8 kb SphI fragment of pANT1033 containing complete diuK, dauP, dnmQ, and dnm S cloned into pANT1027. pANT1037 11.1 1.9 kb N del-E coR l fragment from pANT1032 containing cloned into pU4123. pANT1038 10.9 1.72 kb N del-E coR l fragment from pANT1023 containing dnmS Pro300Ala mutant gene cloned into pIJ4123. pANT1039 10.9 1.72 kb N del-E coR l fragment from pANT1023 containing dnmS Gln340Glu mutant gene cloned into pIJ4123. ______

198 Appendix D

Table of Primers Used

199 Name Sequence Purpose dnmSl CTG GCA GTG GAC GAC GTC TT pANTlOO? sequencing dnmS2 CTG CAC CGG AAC TCC GAC TA p ANT1007 sequencing dnmS3 ATC GAG GCC AAG GAG TTC AC p ANT1007 sequencing dnmS4 CGT CAT TCA GCA CAA TCT CG p ANT1007 sequencing dnmS5 GTC TCG GAA CCG GCG TCG GC pANT1007 sequencing dnmS6 GCC GAC GCC GGT TCC GAG AC p ANT1007 sequencing diunS? AAT CGG CGA AGT CCA CCA AC pANTlOO? sequencing dnmS8 ATC AGC GGT CAC TGG ACG AT pANT1007 sequencing dnmS9 AGC TGT GAG GTC GTC GTG CA p ANT1007 sequencing drrCl CAG GCT GGC TCA GAT ACT GG pANT1007 sequencing drrC2 TGG TGT TGG CCG CAA GCT TG pANT1007 sequencing

ExpS I CTA CAG GCA TGC AGG AGG Cloning d n m S into pTrcHisA ATC CTC GAG ATG AAG GTG CTC GTG ACG GCG TTC GCC ATG

ExpS2 GTT GTA AAA CGA CGG CCA GT Cloning d n m S into pTrcHisA

StrcpSl CTA CAG GCA TGC AGG AGG Cloning d n m S into pIJ4123 ATC CTC GAG ATG AAG GTG CTC GTG ACG GCG TTC GCC ATG dauHl TCA TTG AAT TCG GAG GTG Cloning d a u H into pANT849 AGT TCC CGT GCG dauH2 GGC CTC CCG GGT CTC CTC Cloning d a u H into pANT849 CTC GAT G

HTrcl CTA CTC GAG GTG CGC GTC Cloning d a u H into pTrcHisA CTG TTC G HTrc2 AAC AGC TAT GAC CAT GAT TA Cloning d a u H into pTrcHisA (continued)

Table D.l. Sequence and purpose of primers used in this work.

2 0 0 Table D.l (continued).

SlrepH2 TAG AGT TCC ATA TGC GCG Cloning d a u H into pU4123 TCC TGT TCG CCA CCA TGG CCG StrepH3 CGA Cloning d a u H into pLI4123 SDM3A TGC Generation of DnmS site-directed mutant P339A SDM3B ACG Generation of DnmS site-directed mutant P339A SDM5A CGG Generation of DnmS site-directed mutant E199A SDM5B GCC Generation of DiunS site-directed mutant E199A SDM7A GTG Generation of DnmS site-directed mutant Q340P SDM7B CAC Generation of DnmS site-directed mutant CG Q340P______

201 Appendix E

Examples of plots used for enzyme-ligand binding analysis

202 07

06

0.5 •

t 04

03

02 -

0.5 1 5 2 25 3 3 5 VIDiuH]

Fig. E.l. Double-reciprocal plot of DauH binding to G-rbodomycinone.

203 15

13

07

^ OS

0.3

01

045 055 Q75 065 105

•03 ftM

Fig. E.2. Scatchard plot of DauH binding to e-rhodomycinone.

204 O.i

i = 0 9769 % • 0.0281 R^ = 0 985

0.2

-0.5-0 4 -03 -0.2 ■0.1 0 1 02 0 3 0.4

■0.2

-0.3

■05

-06

l4 9 (P tiiH ]

Fig. E.2. Hill plot of DauH binding to E-rhodomycinone.

205 Appendix F

Circular dichroism spectra of DnmS and mutants

206 miliidegree

ro ro o Ü1 o cn o CJl

ro ro

ro O i Z ra< m s c/>

ro 05

ro œ

CO o

Fig. F.l. Circular dichroism spectrum of DnmS.

207 miliidegree

ro ro no o OI cn o o

ro ro o

ro o I (/) 2. O 3o s ta CO 3- 3- 3 ro 05 o

ro 00 o

CO o o

Fig. F.2. Circular dichroism spectrum of DnmS Pro300AIa mutant.

208 miliidegree

03 O ro O C71 o oi o o

ro ro o

ro ■u o Oi : a i (S z

ro 00 o

oCO

Fig. F.3. Circular dichroism spectrum of DnmS Gln340Glu mutant.

209 Appendix G

Nonactin biosynthesis in Streptomyces griseus A7796

210 Nonactin is the parent compound of a group of ionophore antibiotics, known as

macrotetralides, produced by Streptomyces griseus ETH A7796 (Bennett et al., 1962;

Dutcher. 1962; Gerlach et al., 1967). This antibiotic was shown to possess antitumor

activity against mammalian cell lines in vitro and against Crocker sarcoma 180 in

studies with mice (Bennett et al., 1962). In addition, nonactin was shown to be a novel

inhibitor of the 170-kDa P--mediated efflux of 4 -0-

tetrahydropyranyldoxorubicin in multidrug-resistant erythroleukemia K562 cells at

subtoxic concentrations (Borrel et a i, 1994).

Robinson et a i initially proposed a hypothetical nonactin biosynthetic pathway

based on stable isotope and radioisotope precursor and intermediate feeding studies

(Stahl and Pape, 1972; Ashworth et a i, 1982; Clark, 1982; Ashworth and Robinson.

1983; Clark and Robinson. 1985; Spavold. 1987; Spavold and Robinson, 1988;

Ashworth et a i. 1989). Plater and Robinson (1992) cloned and sequenced a portion of

the S. griseus ETH A7796 chromosome that conferred tetranactin resistance (nonR) on

Streptomyces lividans TK24. Three other open reading frames (ORFs) were identified;

two complete ORFs with no known homologies to other genes and one partial ORF that

shared similarity to the enoyl coenzyme A (enoyl-CoA) hydratase from rat

mitochondria (initially called orfX, but changed to nonS) (Minami-lshii et ai, 1989).

The latter ORF was of particular interest because the chemical reactions of the enoyl-

CoA hydratase family of enzymes and the hypothesized nonactate synthase are very

similar. As a result, it was initially proposed that nonS encodes the nonactate synthase, the enzyme which forms the backbone units o f the nonactin structure, nonactic acid

211 (Plater and Robinson, 1992). This work set out to prove this hypothesis by isolating the full nonS gene and assaying the gene product with chemically synthesized substrate analogs.

A fragment from the S. griseus ETH A7796 chromosome that contained the entire nonS gene was isolated by Southern and colony hybridizations, cloned and sequenced. Three additional ORFs were identified in this DNA fragment: a complete

ORF with high sequence homology to X-prolyl dipeptidase enzymes (Vesanto et al..

1995), a complete ORF with high sequence homology to ATP-dependent CoASH ligases, and a partial ORF with high sequence homology to p-ketoacyl reductase enzymes of type 11 polyketide synthase clusters.

The nonS gene was subcloned into Streptomyces expression vectors and transformed into Streptomyces lividans. Recombinant S. lividans extracts were assayed spectrophotometrically using a thioester substrate analog that was previously shown to be incorporated into nonactin by S. griseus. The nonactate synthase activity demonstrated by NonS expressed in S. lividans was very similar to that seen in the wild- type organism. As a result, NonS is the nonactate synthase involved in nonactin biosynthesis. Moreover, this was the first biochemical connection made between a gene product and a reaction in nonactic acid biosynthesis.

212 List of references

Ashworth, D. M., and J. A. Robinson. 1983. Biosynthesis of the macrotetralide antibiotics: an investigation using carbon-13 and oxygen-18 labelled acetate and propionate. Chem. Commun. (J. Chem. Soc. Sect. D) 1983:1327-1329.

Ashworth, D. M., C. A. Clark, and J. A. Robinson. 1989. On the biosynthetic origins of the hydrogen atoms in the macrotetralide antibiotics and their mode of assembly catalyzed by a nonactin polyketide synthase. J. Chem Soc. Perkin Trans. 1989:1461-1467.

Ashworth, D. M., J. A. Robinson, and D. L. Turner. 1982. Biosynthesis of nonactin from acetate, propionate, and succinate: the assignment of its carbon-13 N.M.R. spectrum by two-dimensional correlation spectroscopy. Chem. Commun. (J. Chem. Soc. Sect. D) 1982:491-493.

Bennet, R. E., S. A. Brindie, N. A. Giuffre, P. W. Jackson, J. Kowaid, F. E. Pansy, D. Perlman, and W. H. Trejo. 1962. Production of a novel cytotoxic agent, SQ 15,859. by Streptomyces chrysomalliis. Antimicrob. Agents Chemother. 1961:169- 172.

Borrel, M. N., E. Pereira, M. Fiallo, and A. Garnier-Suillerot. 1994. Mobile ionophores are a novel class of P-glycoprotein inhibitors. The effects of ionophores on 4 '-O-tetrahydropyrany 1-adriamycin incorporation in K562 drug-resistant cells. Eur. J. Biochem. 223:125-133.

Clark, C. A. 1982. The biosynthesis of nonactin. Ph.D. thesis. University of Southampton. Southampton, United Kingdom.

Clark, C. A., and J. A. Robinson. 1985. Biosynthesis of nonactin. The role of acetoacetyl-CoA in the formation of nonactic acid. Chem. Commun. (J. Chem. soc. Sect. D) 1985:1568-1569.

Dutcher, J. D. 1962. Isolation and characterization of a cytotoxic agent, SQ 15.859. from Streptomyces chrysomallus. Antimicrob. Agents. Chemother. 1961:173-177.

Gerlach, H , R. Hutter, W. Keller-Schlierlein, J. Seihl, and EL Zahner. 1967. Metabolic products of microorganisms. LVIII. New macrotetralides from actinomycetes. Helv. Chim. 50:1782-1793.

213 Minami-lshii, N., S. taketani, T. Osumi, and T. Hashimoto. 1989. Molecular cloning and sequence analysis of the cDNA for rat mitochondrial enoyl-CoA hydratase. Eur. J. Biochem. 185:73-78.

Plater, R., and J. A. Robinson. 1992. Cloning and sequence of a gene encoding macrotetralide antibiotic resistance from Streptomyces griseus. Gene 112:117-122.

Spavold, Z. M. 1987. Studies in antibiotic production. Ph.D. thesis. University of Southampton, Southampton, United Kingdom.

Spavold, Z. M., and J. A. Robinson. 1988. Nonactin biosynthesis: On the role of (6R, 8R)- and (6S, 8S)-2-methyl-6,8-dihydroxynon-2E-enoic acids in the formation of nonactic acid. Chem. Commun. (J. Chem. Soc. Sect. D) 1988:4-6.

Stahl, P., and H. Pape. 1972. Metabolic products of microorganisms. 110. Biosynthesis of macrotetralides. III. Isolation of free nonactinic acids and their function as precursors of macrotetralides. Arch. Mikrobiol. 85:239-248.

Vesanto, E., K. Savijold, T. Rantanen, J. L. Steele, and A Palva. 1995. An X-prolyl dipeptidyl aminopeptidase (pepX) from Lactobacillus helveticus. Microbiology. 141:3067-3075.

214