DOCSLIB.ORG

Runx1 Expression Defines a Subpopulation of Displaced

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Runx1 Expression Defines a Subpopulation of Displaced Journal of Neurochemistry, 2005, 94, 1739–1745 doi:10.1111/j.1471-4159.2005.03336.x Runx1 expression defines a subpopulation of displaced amacrine cells in the developing mouse retina Lee Stewart,* Mary Anne Potok, Sally A. Camper and Stefano Stifani* *Center for Neuronal Survival, Montreal Neurological Institute, Montreal, Quebec, Canada Department of Human Genetics, University of Michigan Medical School, Ann Arbor, Michigan, USA Abstract primarily in the ganglion cell layer by late embryonic/early AML1/Runx1 (Runx1) is a mammalian transcription factor that post-natal stages and were identified as a subpopulation of plays critical roles in regulating the differentiation of a number displaced amacrine cells by the continued expression of of different cell types. In the present study, we have utilized Islet1, as well as Pax6, and the coexpression of the amacrine mice expressing b-galactosidase (b-gal) under the control of cell subtype-specific markers choline acetyltransferase, cal- the Runx1 promoter to characterize the spatiotemporal retinin and the 65-kDa isoform of glutamic acid decarboxylase. expression pattern of Runx1 during retinogenesis. Expression These findings identify Runx1 as a novel marker for a of b-gal was first detected at embryonic day 13.5 in post- restricted amacrine cell subtype and suggest a role for this mitotic cells located in the inner retina and overlapped with gene in regulating the post-mitotic development of these cells. expression of the early amacrine and ganglion cell marker Keywords: amacrine cells, choline acetyltransferase, gan- protein Islet1. During subsequent developmental stages, the glion cell layer, 65-kDa isoform of glutamic acid decarboxy- number of b-gal-positive cells increased in a central-to-per- lase, retina, Runx1. ipheral gradient until late embryogenesis but then decreased J. Neurochem. (2005) 94, 1739–1745. in the early post-natal retina. b-gal-positive cells were located The differentiation of distinct neuronal subtypes at the Otto et al. 2003). In particular, Runx1 is required for correct time and place is a critical event during nervous definitive hematopoiesis in mice and mutations of its human system development. In that regard, the developing mam- homolog, AML1, are found in a high percentage of acute malian retina provides a relatively simple and well-defined myeloid leukemias and other hematological disorders experimental system to study the events that underlie the (Amman et al. 2001; Roumier et al. 2003). Recent studies generation of different cell types from common progenitors. have also identified a requirement for Runx1 function during Six main classes of neurons and one type of glial cell are the post-mitotic development of selected populations of generated in the retina and the precise spatial and temporal sensory and motor neurons in the murine hindbrain and pattern of retinogenesis is under the influence of both cranial ganglia, implicating Runx1 in the regulation of neuron extrinsic and intrinsic cues (Marquardt and Gruss 2002). subtype differentiation (Theriault et al. 2004). To determine Although a number of transcription factors have been if Runx1 is involved in the development of additional identified as important regulators of mammalian retinal development (Marquardt 2003), the mechanisms that regu- late the acquisition of specific retinal neuron traits still Received April 7, 2005; revision received May 20, 2005; accepted May 20, 2005. remain poorly defined. In particular, little is known about the Address correspondence and reprint requests to Dr Stefano Stifani, molecular characteristics of specific subtypes of each set of Center for Neuronal Survival, #F102, Montreal Neurological Institute, retinal neurons and how the differentiation of those individ- 3801 rue University, Montreal, Quebec, H3A 2B4, Canada. ual subtypes is regulated. E-mail: [email protected] The phylogenetically conserved runt/Runx gene family Abbreviations used: AMCA, Amino Methyl Coumarin Acetate; b-gal, b-galactosidase; ChAT, choline acetyltransferase; E, embryonic encodes a number of DNA-binding transcription factors that day; GAD65, 65-kDa isoform of glutamic acid decarboxylase; GAD67, play important roles during development in both inverte- 67-kDa isoform of glutamic acid decarboxylase; GCL, ganglion cell brates and vertebrates (Wheeler et al. 2000; Coffman 2003; layer; IPL, inner plexiform layer; P, post-natal day. Ó 2005 International Society for Neurochemistry, J. Neurochem. (2005) 94, 1739–1745 1739 1740 L. Stewart et al. neuronal cells, we have characterized its expression during and FITC-conjugated goat anti-mouse/rabbit (1 : 200; Jackson retinal development. Here, we demonstrate for the first time ImmunoResearch, West Grove, PA, USA). Triple-labeling experi- that Runx1 is transiently expressed in a subpopulation ments were performed using the primary antibodies indicated in the of displaced amacrine cells characterized by the expression text and the following secondary antibodies: Cy3-conjugated of choline acetyltransferase (ChAT), the 65-kDa isoform of donkey anti-goat; FITC-conjugated donkey anti-rabbit and AMCA-conjugated donkey anti-mouse (1 : 40; Jackson Immuno- glutamic acid decarboxylase (GAD65) and the calcium- Research). As controls, primary antibodies were omitted from the binding protein calretinin. These findings identify Runx1 as a incubation steps, in which case no staining was observed. new marker of a specific subset of amacrine cells. Moreover, they suggest that Runx1 may contribute during a defined In situ hybridization temporal window to the mechanisms regulating the acquisi- Sense and antisense Runx1 riboprobes were generated by first using tion of a particular terminal phenotype by post-mitotic a mouse Runx1 cDNA (Image Clone ID 4037315) to amplify by amacrine cells. PCR a 0.5-kb product corresponding to the start of the 3¢ untranslated region. The following oligonucleotides were used for PCR: Runx1-3¢-forward, 5¢-TACTGAGCTGAGCGCCATCGC- Experimental procedures CAT-3¢ and Runx1-3¢-reverse, 5¢-GACCCAAAGCTGTAGCTGTC- TCT-3¢ and the PCR product was cloned into pBluescript-SK. Tissue preparation Riboprobes were generated in the presence of digoxigenin 11-UTP lacZ/+ Runx1 mice were generated and maintained as previously by transcription with T7 or T3 RNA polymerases, respectively. lacZ/+ described (North et al. 1999). The recombined locus of Runx1 Wild-type E16.5 mouse embryos on a mixed C57/Bl6 · SJL mice encodes a fusion protein of the N-terminal 242 amino acids background were fixed in 4% paraformaldehyde (2 h), embedded of Runx1 (containing a nuclear localization sequence) and b-galac- in paraffin using a Citadel tissue processor (Thermo Electron, tosidase (b-gal). The expression of this nuclear fusion protein was Pittsburgh, PA, USA) and sectioned at 6 lm on a microtome. Tissue shown to faithfully reproduce the expression pattern of Runx1 sections were then deparaffinized and washed in phosphate-buffered transcripts (North et al. 1999; Theriault et al. 2004). For embryonic saline prior to treatment with 0.3% Triton X-100 followed by staging, the day of the appearance of the vaginal plug was considered incubation in the presence of proteinase K (7.5 lg/mL), 100 mM as embryonic day 0.5 (E0.5). Embryos or pups were collected at glycine and then 0.25% acetic anhydride in 0.1 M triethanolamine. stages E13.5 to post-natal day 5 (P5). Tail clippings were genotyped Sections were pre-hybridized at room temperature (1–2 h) in by both PCR analysis of genomic DNA (North et al. 1999) and hybridization buffer containing 50% formamide, 5· saline sodium incubation with the chromogenic substrate 5-bromo-4-chloro-3- citrate buffer, 2% blocking powder (Roche Molecular Biochemicals, indolyl-b-D-galactosidase (2 lg/mL) in phosphate-buffered saline Indianapolis, IN, USA), 0.1% Triton X-100, 0.5% CHAPS, 5 mM containing 1 M MgCl2,5mM potassium ferrocyanide and 5 mM EDTA, 50 lg/mL heparin and 1 mg/mL yeast tRNA and hybridized potassium ferricyanide. For embryonic stages, eyes were fixed in situ at 50°C overnight in the same buffer with 500 pg/lL riboprobe. in 2% paraformaldehyde containing 10 mM sodium periodate and After hybridization, sections were washed extensively and then 70 mML-lysine (PLP solution) for 2–4 h. Post-natal eyes were incubated in a blocking solution containing 10% heat-inactivated removed and immersion-fixed in 2% PLP solution for 4 h. After tissue sheep serum, 2% bovine serum albumin, 50 mM Tris-HCl (pH 7.5), freezing (Theriault et al. 2004), sections were cut on a cryostat, 100 mM NaCl and 0.1% Triton X-100 for 1 h. Sections were mounted on SuperfrostÔ slides, air-dried and stored at )20°C. All incubated with alkaline phosphatase-conjugated sheep anti-digo- experimental procedures were carried out in accordance with the xigenin Fab fragments (1 : 400) in blocking solution (3 h). guidelines set forth by the Canadian Council for Animal Care. Antibody labeling was visualized with 4.5 lg/mL 4-nitroblue tetrazolium and 3.5 lg/mL 5-bromo-4-chloro-3-indoyl-phosphate. Histochemical detection of b-galactosidase activity Representative sections from each developmental stage examined Image acquisition (E13.5 to P5) were incubated in the presence of 5-bromo-4-chloro- All images were captured with a DVC black and white camera 3-indolyl-b-D-galactosidase overnight at 37°C as described previ- mounted on an Axioskop fluorescence microscope (Zeiss, Toronto, ously (North et al. 1999) followed by counterstaining with Neutral ON, Canada). Grayscale images were digitally assigned to the Red (Sigma, St Louis, MO, USA). appropriate red (Cy3), green (FITC) or blue (AMCA) channels using Northern Eclipse software (Empix, Mississauga, ON, Canada). Immunofluorescence Tissue sections were first incubated in Image-iTÔ FX Signal Enhancer (Molecular Probes, Eugene, OR, USA) for 30 min and Results then for 1 h in a blocking solution manufactured specifically for detecting mouse primary antibodies on mouse tissue (M.O.M. Kit; Spatial and temporal Runx1 expression in the developing Vector Laboratories, Burlingame, CA, USA). The primary antibod- retina ies used to label different retinal cell types are listed in Table 1.
Load more

Recommended publications
  • Implications of Zonal Architecture on Differential Gene Expression
    www.nature.com/scientificreports OPEN Implications of zonal architecture on diferential gene expression profling and altered pathway expressions in mandibular condylar cartilage Aisha M. Basudan1*, Mohammad Azhar Aziz2 & Yanqi Yang3 Mandibular condylar cartilage (MCC) is a multi-zonal heterogeneous fbrocartilage containing diferent types of cells, but the factors/mechanisms governing the phenotypic transition across the zones have not been fully understood. The reliability of molecular studies heavily rely on the procurement of pure cell populations from the heterogeneous tissue. We used a combined laser-capture microdissection and microarray analysis approach which allowed identifcation of diferential zone-specifc gene expression profling and altered pathways in the MCC of 5-week-old rats. The bioinformatics analysis demonstrated that the MCC cells clearly exhibited distinguishable phenotypes from the articular chondrocytes. Additionally, a set of genes has been determined as potential markers to identify each MCC zone individually; Crab1 gene showed the highest enrichment while Clec3a was the most downregulated gene at the superfcial layer, which consists of fbrous (FZ) and proliferative zones (PZ). Ingenuity Pathway Analysis revealed numerous altered signaling pathways; Leukocyte extravasation signaling pathway was predicted to be activated at all MCC zones, in particular mature and hypertrophic chondrocytes zones (MZ&HZ), when compared with femoral condylar cartilage (FCC). Whereas Superpathway of Cholesterol Biosynthesis showed predicted activation in both FZ and PZ as compared with deep MCC zones and FCC. Determining novel zone-specifc diferences of large group of potential genes, upstream regulators and pathways in healthy MCC would improve our understanding of molecular mechanisms on regional (zonal) basis, and provide new insights for future therapeutic strategies.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Expanding the Phenotypic Spectrum of PAX6 Mutations: from Congenital Cataracts to Nystagmus
    G C A T T A C G G C A T genes Article Expanding the Phenotypic Spectrum of PAX6 Mutations: From Congenital Cataracts to Nystagmus Maria Nieves-Moreno 1,* , Susana Noval 1 , Jesus Peralta 1, María Palomares-Bralo 2 , Angela del Pozo 3 , Sixto Garcia-Miñaur 4, Fernando Santos-Simarro 4 and Elena Vallespin 5 1 Department of Ophthalmology, Hospital Universitario La Paz, 28046 Madrid, Spain; [email protected] (S.N.); [email protected] (J.P.) 2 Department of Molecular Developmental Disorders, Medical and Molecular Genetics Institue (INGEMM) IdiPaz, CIBERER, Hospital Universitario La Paz, 28046 Madrid, Spain; [email protected] 3 Department of Bioinformatics, Medical and Molecular Genetics Institue (INGEMM) IdiPaz, CIBERER, Hospital Universitario La Paz, 28046 Madrid, Spain; [email protected] 4 Department of Clinical Genetics, Medical and Molecular Genetics Institue (INGEMM) IdiPaz, CIBERER, Hospital Universitario La Paz, 28046 Madrid, Spain; [email protected] (S.G.-M.); [email protected] (F.S.-S.) 5 Department of Molecular Ophthalmology, Medical and Molecular Genetics Institue (INGEMM) IdiPaz, CIBERER, Hospital Universitario La Paz, 28046 Madrid, Spain; [email protected] * Correspondence: [email protected] Abstract: Background: Congenital aniridia is a complex ocular disorder, usually associated with severe visual impairment, generally caused by mutations on the PAX6 gene. The clinical phenotype of PAX6 mutations is highly variable, making the genotype–phenotype correlations difficult to establish. Methods: we describe the phenotype of eight patients from seven unrelated families Citation: Nieves-Moreno, M.; Noval, with confirmed mutations in PAX6, and very different clinical manifestations.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Transcriptional Regulatory Networks in Neocortical Development
    Review From trans to cis: transcriptional regulatory networks in neocortical development 1 1 1,2 Mikihito Shibata , Forrest O. Gulden , and Nenad Sestan 1 Department of Neurobiology and Kavli Institute for Neuroscience, Yale School of Medicine, New Haven, CT 06510, USA 2 Department of Psychiatry and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale School of Medicine, New Haven, CT 06510, USA Transcriptional mechanisms mediated by the binding of tions among TFs and CREs form the central core of tran- transcription factors (TFs) to cis-acting regulatory ele- scriptional regulatory networks (TRNs) (Box 1) [1]. ments (CREs) in DNA play crucial roles in directing gene Interactions between TFs and CREs are complex, dynam- expression. While TFs have been extensively studied, ic,andmodulatedbyvariousepigeneticprocesses[12].While less effort has gone towards the identification and func- individual CREs may be regulated by the competitive or tional characterization of CREs and associated epigenet- cooperative binding of many TFs, multiple CREs may also ic modulation. However, owing to methodological and confer transcriptional control over the expression of any analytical advances, more comprehensive studies of single gene [12]. Furthermore, TFs and CREs regulate regulatory elements and mechanisms are now possible. transcription together with their cognate transcriptional We summarize recent progress in integrative analyses of cofactors, chromatin regulators, epigenetic modifications, these regulatory components in the development of the RNA-binding proteins, and non-coding RNAs [2,13]. This cerebral neocortex, the part of the brain involved in combinatorial and multi-level transcriptional regulation cognition and complex behavior. These studies are greatly increases the complexity of gene expression regula- uncovering not only the underlying transcriptional reg- tion, facilitating the unique spatio-temporal patterns nec- ulatory networks, but also how these networks are essary for tissue development and function [3].
    [Show full text]
  • Pax6 During Visual System Development
    Hedgehog-dependent E3-ligase Midline1 regulates ubiquitin-mediated proteasomal degradation of Pax6 during visual system development Thorsten Pfirrmanna,1, Enrico Jandta,1, Swantje Ranfta,b, Ashwin Lokapallya, Herbert Neuhausa, Muriel Perronc, and Thomas Hollemanna,2 aInstitute for Physiological Chemistry, University of Halle-Wittenberg, 06114 Halle, Germany; bGynecological Hospital, University Medical Center Mannheim, 68167 Mannheim, Germany; and cParis-Saclay Institute of Neuroscience, CNRS, Univ Paris Sud, Université Paris-Saclay, 91405 Orsay, France Edited by Richard M. Harland, University of California, Berkeley, CA, and approved July 19, 2016 (received for review January 16, 2016) Pax6 is a key transcription factor involved in eye, brain, and pancreas remains unclear how Pax6 protein is removed from the eyestalk development. Although pax6 is expressed in the whole prospective territory on time. Some authors report the regulation of Pax6 retinal field, subsequently its expression becomes restricted to the activity by posttranslational modifications (21–23), and most optic cup by reciprocal transcriptional repression of pax6 and pax2. interestingly, Tuoc et al. showed that in cortical progenitor cells, However, it remains unclear how Pax6 protein is removed from the Pax6 protein is degraded by the proteasome mediated by Trim11 eyestalk territory on time. Here, we report that Mid1, a member of (24). However, the existence of similar mechanisms leading to the RBCC/TRIM E3 ligase family, which was first identified in patients the development of the visual system is not known. with the X-chromosome–linked Opitz BBB/G (OS) syndrome, inter- The data of our present study show that Midline1 (Mid1) acts with Pax6. We found that the forming eyestalk is a major do- serves as one of these links.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials + - NUMB E2F2 PCBP2 CDKN1B MTOR AKT3 HOXA9 HNRNPA1 HNRNPA2B1 HNRNPA2B1 HNRNPK HNRNPA3 PCBP2 AICDA FLT3 SLAMF1 BIC CD34 TAL1 SPI1 GATA1 CD48 PIK3CG RUNX1 PIK3CD SLAMF1 CDKN2B CDKN2A CD34 RUNX1 E2F3 KMT2A RUNX1 T MIXL1 +++ +++ ++++ ++++ +++ 0 0 0 0 hematopoietic potential H1 H1 PB7 PB6 PB6 PB6.1 PB6.1 PB12.1 PB12.1 Figure S1. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of hematopoietic lineage genes (microarray analysis). Hematopoietic-competent cells (H1, PB6.1, PB7) were separated from hematopoietic-deficient ones (PB6, PB12.1). In this experiment, all hPSCs were tested in duplicate, except PB7. Genes under-expressed or over-expressed in blood-deficient hPSCs are indicated in blue and red respectively (related to Table S1). 1 C) Mesoderm B) Endoderm + - KDR HAND1 GATA6 MEF2C DKK1 MSX1 GATA4 WNT3A GATA4 COL2A1 HNF1B ZFPM2 A) Ectoderm GATA4 GATA4 GSC GATA4 T ISL1 NCAM1 FOXH1 NCAM1 MESP1 CER1 WNT3A MIXL1 GATA4 PAX6 CDX2 T PAX6 SOX17 HBB NES GATA6 WT1 SOX1 FN1 ACTC1 ZIC1 FOXA2 MYF5 ZIC1 CXCR4 TBX5 PAX6 NCAM1 TBX20 PAX6 KRT18 DDX4 TUBB3 EPCAM TBX5 SOX2 KRT18 NKX2-5 NES AFP COL1A1 +++ +++ 0 0 0 0 ++++ +++ ++++ +++ +++ ++++ +++ ++++ 0 0 0 0 +++ +++ ++++ +++ ++++ 0 0 0 0 hematopoietic potential H1 H1 H1 H1 H1 H1 PB6 PB6 PB7 PB7 PB6 PB6 PB7 PB6 PB6 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB6.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 PB12.1 Figure S2. Unsupervised hierarchical clustering of hPSC-derived EBs according to the mRNA expression of germ layer differentiation genes (microarray analysis) Selected ectoderm (A), endoderm (B) and mesoderm (C) related genes differentially expressed between hematopoietic-competent (H1, PB6.1, PB7) and -deficient cells (PB6, PB12.1) are shown (related to Table S1).
    [Show full text]
  • Up-Regulation of Homeodomain Genes, DLX1 and DLX2, by FLT3 Signaling
    SUPPLEMENTARY APPENDIX Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling Julia Starkova,1,3 Sharvari Gadgil,2 Yi Hua Qiu,4 Nianxiang Zhang,4 Ivana Hermanova,3 Steven M. Kornblau,4 and Harry A. Drabkin1,3 1Division of Hematology-Oncology, Medical University of South Carolina, Charleston, SC, USA; 2Division of Medical Oncology, University of Colorado Health Sciences Center, Aurora, CO, USA; 3Department of Paediatric Haematology/Oncology, 2nd Faculty of Medicine, Charles University Prague, Czech Republic, and 4Department of Stem Cell Transplantation and Cellular Therapy, Section of Molecular Hematology and Therapy, The University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA Citation: Starkova J, Gadgil S, Hua Qiu Y, Zhang N, Hermanova I, Kornblau SM, and Drabkin HA. Up-regulation of homeodomain genes, DLX1 and DLX2, by FLT3 signaling. Haematologica 2011;96(6):820-828. doi:10.3324/haematol.2010.031179 Online Supplementary Figure S1. Specificity and non-toxicity of PKC412 in MV4;11 cells (A) Results from flow cytometry analysis are shown as a percentage of cells in subG1, G1-G0, S and G2-M phases of the cell cycle after 0, 2, 5 and 24 h treatment of MV4;11 cells with PKC412. (B) Graph shows fold-change of DLX1 gene expression in MV4;11 cells after imatinib treatment. A B Online Supplementary Figure S2. AP1-binding site in the DLX1 promoter. Online Supplementary Figure S3. Diagram of the described interaction between FLT3 and DLX1. Online Supplementary Table S1. Primes sequences. Online Supplementary Table S2. DDCt values of normalized HOX gene expression in MV4; II cells after PKC412 treatment.
    [Show full text]
  • Drosophila Pax6 Promotes Development of the Entire Eye-Antennal Disc, Thereby Ensuring Proper Adult Head Formation
    PAPER Drosophila Pax6 promotes development of the entire COLLOQUIUM eye-antennal disc, thereby ensuring proper adult head formation Jinjin Zhua, Sneha Palliyila, Chen Ranb, and Justin P. Kumara,1 aDepartment of Biology, Indiana University, Bloomington, IN 47405; and bDepartment of Biology, Stanford University, Stanford, CA 94305 Edited by Ellen V. Rothenberg, California Institute of Technology, Pasadena, CA, and accepted by Editorial Board Member Neil H. Shubin February 17, 2017 (received for review July 26, 2016) Paired box 6 (Pax6) is considered to be the master control gene for molecular battle among GRNs allows for the subdivision of the eye development in all seeing animals studied so far. In vertebrates, eye-antennal disc to be maintained within a single continuous it is required not only for lens/retina formation but also for the cellular field (13–16). Of the GRNs that are known to operate development of the CNS, olfactory system, and pancreas. Although within the eye-antennal disc, the retinal determination (RD) Pax6 plays important roles in cell differentiation, proliferation, and network, which controls eye development, is the best studied (17). patterning during the development of these systems, the underlying At the core of the RD network lie the Paired box 6 (Pax6) genes mechanism remains poorly understood. In the fruit fly, Drosophila eyeless (ey)andtwin of eyeless (toy), the SIX family member sine melanogaster, Pax6 also functions in a range of tissues, including oculis (so), the transcriptional coactivator eyes absent (eya), and the the eye and brain. In this report, we describe the function of Pax6 in Ski/Sno family member dachshund (dac)(17).
    [Show full text]
  • Transcriptional and Post-Transcriptional Regulation of ATP-Binding Cassette Transporter Expression
    Transcriptional and Post-transcriptional Regulation of ATP-binding Cassette Transporter Expression by Aparna Chhibber DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Pharmaceutical Sciences and Pbarmacogenomies in the Copyright 2014 by Aparna Chhibber ii Acknowledgements First and foremost, I would like to thank my advisor, Dr. Deanna Kroetz. More than just a research advisor, Deanna has clearly made it a priority to guide her students to become better scientists, and I am grateful for the countless hours she has spent editing papers, developing presentations, discussing research, and so much more. I would not have made it this far without her support and guidance. My thesis committee has provided valuable advice through the years. Dr. Nadav Ahituv in particular has been a source of support from my first year in the graduate program as my academic advisor, qualifying exam committee chair, and finally thesis committee member. Dr. Kathy Giacomini graciously stepped in as a member of my thesis committee in my 3rd year, and Dr. Steven Brenner provided valuable input as thesis committee member in my 2nd year. My labmates over the past five years have been incredible colleagues and friends. Dr. Svetlana Markova first welcomed me into the lab and taught me numerous laboratory techniques, and has always been willing to act as a sounding board. Michael Martin has been my partner-in-crime in the lab from the beginning, and has made my days in lab fly by. Dr. Yingmei Lui has made the lab run smoothly, and has always been willing to jump in to help me at a moment’s notice.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2017/0145518 A1 Hessels Et Al
    US 20170145518A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2017/0145518 A1 Hessels et al. (43) Pub. Date: May 25, 2017 (54) METHOD FOR PREDICTING AND (52) U.S. Cl. TREATING CLINICALLY SIGNIFICANT CPC ..... CI2O 1/6886 (2013.01); C12O 2600/158 PROSTATE CANCER (2013.01) Applicant: MDxHealth Research B.V., Nijmegen (57) ABSTRACT (71) The present invention relates to methods, devices, combi (NL) nations, kits, and systems for predicting and treating clini cally significant prostate cancer in a urine sample of an (72) Inventors: Daphne Hessels, Nijmegen (NL); individual Suspected of Suffering from prostate cancer based Franciscus Petrus Smit, Nijmegen on expression analysis of normalised prostate tumour mark (NL); Jack A. Schalken, Nijmegen ers. The present methods, devices, combinations, kits, and (NL) systems are especially suitable for predicting and treating prostate cancer with a Gleason score of seven or more in (73) Assignee: MDxHealth Research B.V., Nijmegen individuals with a serum prostate-specific antigen (SPSA) (NL) level lower than 15 ng/ml. Specifically, the present invention relates to methods, devices, combinations, kits, and systems for predicting and treating clinically significant prostate (21) Appl. No.: 15/357,342 cancer in a urine sample of an individual Suspected of Suffering from prostate cancer, the method comprises the (22) Filed: Nov. 21, 2016 steps of: a) determining mRNA expression levels of one or more of the genes DLX1, HOXC6, TDRD1 and KLK3 in a Related U.S. Application Data urine sample of said individual; b) normalizing the mRNA expression levels of one ore more of DLX1, HOXC6, and (60) Provisional application No.
    [Show full text]
  • Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia
    Journal of Developmental Biology Article Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia Yuan Wang 1,2,†, Huiqing Zeng 1,† and Aimin Liu 1,* 1 Department of Biology, Eberly College of Sciences, Center for Cellular Dynamics, Huck Institute of Life Science, The Penn State University, University Park, PA 16802, USA; [email protected] (Y.W.); [email protected] (H.Z.) 2 Department of Occupational Health, School of Public Health, China Medical University, No.77 Puhe Road, Shenyang North New Area, Shenyang 110122, China * Correspondence: [email protected]; Tel.: +1-814-865-7043 † These authors contributed equally to this work. Received: 2 November 2018; Accepted: 16 February 2019; Published: 19 February 2019 Abstract: The primary cilia play essential roles in Hh-dependent Gli2 activation and Gli3 proteolytic processing in mammals. However, the roles of the cilia in Gli1 activation remain unresolved due to the loss of Gli1 transcription in cilia mutant embryos, and the inability to address this question by overexpression in cultured cells. Here, we address the roles of the cilia in Gli1 activation by expressing Gli1 from the Gli2 locus in mouse embryos. We find that the maximal activation of Gli1 depends on the cilia, but partial activation of Gli1 by Smo-mediated Hh signaling exists in the absence of the cilia. Combined with reduced Gli3 repressors, this partial activation of Gli1 leads to dorsal expansion of V3 interneuron and motor neuron domains in the absence of the cilia. Moreover, expressing Gli1 from the Gli2 locus in the presence of reduced Sufu has no recognizable impact on neural tube patterning, suggesting an imbalance between the dosages of Gli and Sufu does not explain the extra Gli1 activity.
    [Show full text]