A Member of a New Family of Telomeric Repeated Genesin Yeast

RTMl: A Member of a New Family of Telomeric Repeated Genesin Yeast

Frederique Ness' and Michel Aigle Laboratoire de Ge'nitique, UPR CNRS 9026, Avenue des Facultis, F-33405 Talence Cedex, France Manuscript received November 7, 1994 Accepted for publication April 12, 1995

ABSTRACT Wehave isolateda newyeast gene called RTMl whoseoverexpression confers resistance to the toxicity of molasses. TheRTMl gene encodes a hydrophobic 34kD protein that contains seven potential transmembranespanning segments.Analysis of a series of industrial strains shows that the sequence is present in multiple copies and in variable locations inthe genome. RTM loci arealways physically associated with SUC telomeric loci. The SUGRTM sequences are located between X and Y' subtelomeric sequences at chromosome ends. Surprisingly RTM sequences are not detected in the laboratory strain X2180. The lack of this sequence is associated with the absence of any SUC telomeric gene previously described. This observation raises the question of the origin of this nonessential gene. The particular subtelomeric position might explain the SUC-RTM sequence amplification observed in the genome of yeasts used in industrial biomass or ethanol production with molasses as substrate. This SUGRTM sequence dispersion seems to be a good example of genomic rearrangement playing a role in evolution and environmental adaptation in these industrial yeasts.

ENE overexpression or increase in the copy num- in Saccharomyces cermisim. Three families of duplicated G ber of a gene is a common adaptative mechanism genes illustrate the genetic polymorphism of the yeast exploited by different organisms to increase their resis- Saccharomyces and underline another gene amplifica- tance to various toxicagents. A particularly well-studied tion process. They comprise the SUC, MAL and MEL example of the gene amplification processes involves gene families, which encode enzymes necessav for the the increased specific resistance to copper. Copper re- utilization of sucrose, maltose and melibiose, respec- sistance in yeast is controlled by the CWl locus. The tively. The MEL gene family of S. cermisiae consists of level of resistance is proportional to the copy number 210 structural genes MELl-MELIO (NAUMOVet al. of this gene, which can be found in up to 15 tandemly 1990, 1991; TURAKAINENet al. 1993); the MAL gene repeated copies (WELCHet al. 1983; KARIN et al. 1984). family comprises the five highly homologous MALI, 2, Resistance to multiple cytotoxic compounds is an- 3, 4 and 6 (CHARRONet al. 1989), and the SUC gene other acquired property in many species from bacteria family includes the six loci SUCI, 2, 3, 4, 5 and 7 (CARL to man. The major molecular determinants mediating SON and BOTSTEIN1983; CARLSON et al. 1985). All of multidrug resistance are transport proteins driving the these genes (except SUCZ) are located near chromo- traffic of drugs and physiological substrates across the some ends; they are dispersed on different chromo- cell membrane, including themajor facilitors superfam- somes but generally not all of them are presentsimulta- ily (MARGER and SAIER1993) and the ATP-binding cas- neously. The particularity of the SUC telomeric genes sette superfamily (ABC) (reviewed by HIGGINS1992). is their specific location between the Y' and X telomere- The former family comprises the yeast aminotriazole- associated sequences. As has been suggested for the genes and the and subtelomeric sequences, resistance determinant ATRl (KANAZAWA et al. 1988; SUC Y' X the other gene families may have resulted from GOMPEL-KLEIN and BRENDEL1990); the latter includes two the yeast STE6pump forsecretion of the mating phero- translocation events involvingthe telomeres of different chromosomes (CARLSON et al. 1985; CHARRONet al. mone a (KUCHLERet al. 1989; MCGRATHand VARSHAV- 1989; LOUIS and WER1990b; MICHELS et al. 1992; SKY 1989). A common mechanism underlying multi- TURAKAINENet al. 1993). drug resistance is overexpression of transport proteins, Studying some distiller's yeasts, we observed that for example, MDRl in tumor cell lines (GOTTESMAN some of the molasses used as substrate in industrial and PASTAN1993) and PDR5 in yeast (LEPPERTet al. ethanol production confer growth inhibition. Previous 1990). studies (VON TRESSLet al. 1976; FIEDLER1981; BRONN Other geneamplification events have been described and FATTOHI 1988) tried to identify the toxic elements but have failed due to the complex composition of such Curresponding author: Michel Aigle, Laboratoire de Qnitique, UPR CNRS 9026, Avenue des Facultis, F-33405 Talence Cedex, France. media. As we have observed that strains exhibit various Present address: Transgene S.A., 11 rue de Molsheim, F-67082 Stras- levels of resistance to toxic molasses, we attempted to bourg Cedex, France. isolate a gene conferring resistance to toxic molasses

Genetics 140 945-956 (July, 1995) 946 F. Ness and M. Aigle

TABLE 1 Genotypes of the laboratory strains used in this study

Strain Genotype Sources M AT a wild type ATCC 28383 ATCC EL1 00type wild MATa FLlOOm MATa trpl ura3 F. LACROUTE

FL100m-2n ”-MATa tql ura3 F. LACROUTE MATa trpl ura3 FL100-Al“ MATa t7pl ura3 rtml-Al::URA3 This study X2180-1BMATa SUC2 mal me1 GAL2 CUP1 Yeast Genetic Stock Center LG16lA MATa uru3 Our laboratory/CROUZET et d. (1991) LC1 65A MATa ura3 Our laboratory/CROUZET et ul. (1991) MATa ura3 Our laboratory/CROUZET et ul. (1991) LG162nb ” MATa ura3 Deletion of RTMl gene in the strain FL100-A1 was obtained by one-step gene replacement as described in MATERIALS AND METHODS. LG162n strain was sporulated to obtain LG16lA and LG165A. LG16 strains are isogenic to X2180.

(RTM).By analogy with several other resistance genes, the ura3 haploid and homozygote diploid strains ofFLlOO we looked for such a gene using a multicopy (overex- background and LC16 (X2180 background). The strain ob tained was designed FL100-Al. pressing) genomic library. By this experimental proce- Growth: The ability of strains to grow on molasses medium dure we isolated the RTMl gene that, overexpressed, was determined on solid medium at 30” during 2-4 days by confers a resistance phenotype against toxic molasses. drop test (3 p1of cell suspension to an booof 0.2). The We explored the genome of different strains and ob minimal concentration of molasses that completely inhibited served the genetic diversity ofRTMl in distiller’syeasts. yeast growth is named MIC (minimal inhibitory concentration). We describe that RTMl is a member of a new telomeric The growth inhibition by different drugs was performed in family of genes dispersed thoughout the yeast genome the same manner on solid or liquid YNB, YPD or YPGE media. and physically associated with the SUC telomeric loci. Cloning of RTMl gene: RTMl was cloned from a library of 5- to 8-kb Sau3Afragments of FLlOOgenomic DNA inserted MATERIALSAND METHODS into the BamHI site of the pFL44L (BONNEAUDet al. 1991), a multicopy based 2pm/URA3 shuttle vector. The library was Strains and media: The growth media used were YPD (10 kindly provided by F. LACROUTE and F. KARST (unpublished g/1 yeast extract, 20 g/l peptone, 20 g/1 glucose),YNB (6.7 g/ data). FLlOO (ura-, trf) strain has a MIC of 10% molasses. 1 Yeast Nitrogen Base (Difco), 20 g/1 glucose) and YPGE (10 Putative RTMI-containing clones were identified by screening g/1yeast extract, 20g/1 peptone, 20g/1 glycerol, 20 ml/l URA transformants ( lo8) of FLlOO (uru-, trp-) on 40% molas- ethanol) (SHERMANet al. 1986). The molasses media are based ses. This occurred at a frequency of 1 per 100,000 cells. Proof on 6.7 g/l Yeast Nitrogen Base without amino acids (Difco) that the cloned DNA carries a molasses resistance function supplemented with pure molasses (20-400 gA). Molassesis was obtained by the loss of the phenotype when the strain was composed of -50% sucrose. Two different batches of molasses were used. One was 2 years old (batch 1); the other was 5 mo TABLE 2 old (batch 2) and was obtained from another sugar refinery. The concentration of molasses (%) is given in g of molasses List of distiller’s yeast strains used in French industrial plan per 100 ml of final medium. The molasses media weresupple- for ethanol production mented with 20 mg/l of tryptophan for the selection of molasses resistant transformants from FLlOO (t@, uru-). Strain Origin Industrial plan Escherichia coli strain DH5a was used for routine cloning. The genotypes of the laboratory yeast strains employed are 1 UNGDA (Paris) Distillery no. 1 listed in Table 1. The strains numbered from 1 to 21 are used 5 UNGDA (Paris) Distillery no. 2 in industrial ethanol production onmolasses or produced on 6 UNGDA (Paris) Distillery no. 3 molasses. Their characteristics are listed in Table 2. They all 7 UNGDA (Paris) Distillery no. 4 belong to the species S. cerevirisae. 8 2345 ATCC The rtml-A1 :: URA3 mutation constructed in vitrowas used 10 4126 ATCC to replace the wild-type locus by a one step gene replacement 11 ATCC 9763 technique (ROTHSTEIN1983). The 2.8-kb Sphl-KpnI fragment 13 Distillery no. 5 derived from a genomic clone (plasmid pl, Figure 1) carrying 17 INSA (Toulouse) the entiresequence of RTMl was cloned after blunting inthe 18 Yeast producer pBluescript SK+ plasmid digested by EcoRV. The 0.1-kb SalI 19 Yeast producer fragment located within the coding region of RTMl was cut 20 Yeast producer out, and a 1.2-kb SaZI fragment containing the URA3 gene 21 Yeast producer was inserted, yielding the plasmid plD. ClaI and Bad1diges- tion of this plasmid gives a 2-kb fragment containing the rtml- UNGDA, Union Nationale des Groupement de Distillateurs A 1:: UBA3 allele (see Figure 1). This fragment was used to d’Alcool (National Union ofAlcohol Distillators);INSA, Insti- replace the wild-type allele of RTMl by transformation of tut National des Sciences Appliquees. New Telomeric947 Yeast Gene cured from the plasmid pl. To subclone the genecontaining mid DNA from seven independent transformants was fragment, the original genomic clone obtained (pl) was di- recovered in E. coli. Restriction fragment analysis indi- gested with several enzymes (SphI, KpnI, BumHI) and the different generated fragments were cloned individually into ade- cated that these seven plasmids contained identical in- quate sites in the pFL44L. Subclones containingRTMl were serts. All of them contained a genomic insert of -4.5 identified by their ability to confer resistance to 40% molasses kb. One of the plasmids (pl) was used for subsequent medium to the FLlOO (uru-, tq-) strain (Figure1). The acqui- analysis. sition of the resistantphenotype of the molassessensitive Location of RTMl was further defined by different strains LG16-1A, LG16-5A and a new clone of FLlOO (uru-, tq-) transformed by plK was also obtained. The industrial deletions of the plasmid pl. We have subcloned several wild-type strain 10 (ATCC 4126) was also transformed by the fragments from the 4.5-kb insert back to pFL44L by plasmid plK-14DM. This plasmid corresponds to plK where using standard techniques to determine the minimal a dominant marker [a mutant allele of the C14 a lanosterol DNA fragmentconferring the resistantphenotype. demethylase: P45014DMFLZ" marker (DOIGNONet al. 1993)] Thus, the plasmids obtained were checked for their is inserted. The transformed strain also shows the resistance phenotype. ability to confer resistance to 40% molasses medium. Sequencing: DNA sequencing was performed by the chain- The plKplasmid contained the smallest insert confer- termination method (SANGER1977). For sequencing of the ring resistance, localizing the RTMl gene within a 2.8- RTMl gene, the 2.8-kb SphI-KpnIfragment of the plKplasmid kb SphI-KpnI fragment (Figure 1). (see Figure 1) was subcloned into the vector pBluescriptSK+ Sequence of the RTMl gene: The 2.8-kb fragment yielding the plasmid pslK, and several deletions were generated usingexonuclease I11 strategy (ExoIII/Mung Bean conferring resistanceto molasses was subclonedin nuclease, Stratagene). The whole fragment was sequenced in pBluescript SK'. ExonucleaseIII-deleted fragments the two orientations using the Sequenase kit (PharmaciaLKB were sequenced using theSanger dideoxy method Biotechnology) under conditions recommendedby the man- (SANGERet al. 1977).Computer analysis of that se- ufacturer. quence revealed an open reading frame(ORF) of 927 CHEF gel electrophoresis: Growth and preparation of cells for chromosomal DNA analysis are adapted to the protocol bp. Figure 2 represents the nucleotide sequence of the described by CARLE and OLSON1985. A CHEF-2015 PULSA- RTMl gene. ThisORF encodes a predicted proteincon- TOR TM system-apparatus (LKB) was used to separate the taining 309 amino acid residues with a calculated mo- yeast chromosomes. Electrophoresiswas carried out at 200 V lecular mass of 34 kD. The primary sequence predicted and 10" for 15 hr with a switching time of 70 sec and then for the RTMl gene product was compared with both for 12 hr with a switching time of 120 sec.S. cerevisiueX2180- 1B was used as reference. GenBank and EMBL data bases using the FASTA and Southern blot analysis: After soaking the agarose gels con- BLASTP algorithms. The search of protein data base taining the separated chromosomal DNAs or digested frag- failed to detect any significant homologies. Neverthe- ments of genomic DNA in 0.25 M HCl for 5 min, the DNA less, the Rtml protein sharesa low degree of similarity was neutralized and transferred to nitrocellulose filters ac- with putative transmembrane regions of other proteins cording to the procedure recommended by the manufacturer (Amersham). Hybridization was performed in 5X SSC con- (30% identical, 50-60% similar over short regions of taining 50% formamide, 5X Dehnhard, 0.5% SDS and 0.2 20-30 residues). Following analyses of the sequenceof mg/ml salmon sperm DNA at 45" overnight. The filters were Rtmlp (algorithm of K~Eand DOOLITLE 1982; EISEN- then washed twice with 2X SCC containing 0.1% SDS and BERG et al. 1984), we have found seven predicted high with 0.2X SCC containing 0.1% SDS at 65" for 15 min. The hydrophobic domains that should be potential trans- probes were labeled with a 32P-dCTP usingthe random prim- ing kit (Boeringer Mannheim), and detection of hybridiza- membrane-spanning segments (see Figure 2). tion was done by autoradiography. The RTMl gene probe Deletion of the RTMl is not lethal: To establish the was the 1-kb HindIII-BumHIfragment isolated from thepslK, role of the RTMl gene, we have constructed a deletion the RTMI 3' end region probe was the l-kb BumHI-SstI frag- rtmld 1 :: URA3 in vitro, eliminating a short sequence ment isolated from the same plasmid. The SUC2 gene probe in the ORF of RTMl. This deletion was marked by the was a 0.8-kb HindIII-BumHI fragment of the coding region, isolated from the plasmidpRl358 (CARLSON and BOTSTEIN URA3 gene. Constructionof the mutantallele of RTMl 1982). The URA3 gene probe was the 1.1-kb BgnI fragment is described in detail in MATERIALSAND METHODS. We isolated from the plasmid pFL44L. tried to introduce the rtml-A1 ::UBI3 construct by a one-step genereplacement technique (ROTHSTEIN RESULTS 1983) into two geneticbackgrounds. One is derived from FLlOO [diploid strainFLlOO (ura3/ura3, trpl/trpl) Cloning of the RTMl gene: Plasmids containing the and haploidstrain FLlOO (ura3, trpl)];the other is RTMl gene have been identifiedby screening onmolas- derivedfrom X2180 background [the diploidstrain ses medium. The strainFLlOO (UT&, trp-) transformed LG16-2n (ura3/ura3) andthe haploid strain LG16- with a yeast (FLlOO) genomic library of 5- to 8-kb frag- 5A (ura3)1. It was possible to directly produce haploid ments into an2 pm/ URA3multicopy based vector was FLlOO URA strains but not haploid or diploid LG16 plated on molasses 40% medium. This concentration URA strains. Colonies containing rtml-A1 :: URA3 dis- of molasses inhibits the growth of FLlOO (ura-, trp-) ruption had normal growth rates. Southern hybridiza- completely. After 4 days, some transformants were re- tion analysis of genomic DNA from the parents and the covered that were resistant to this toxic medium. Plas- transformed strains confirmed the disruptionof RTMl 948 Ness F. and M. Aigle

A. B/A P GH C SS B TSK SR T,B/A growth FIGURE1.-Functional analysis I II I I1 I II I 11 of the subclones from the 4.5-kb Pl I I + genomic fragment of the pl plasmid containing the RTMl gene. I 1 + (A) Restriction map of the original pl plasmid. Barsbelow the map indicate different fragments subcloned in the pFL44L and tested for their ability toconfer resistance to40% molasses medium indicated as growth. The hatched 2.8- kb insert in plK was the smallest clone defined. (B) Structure of the 2-kb fragment containing the rtml- A 1:: URA3 disruption allele. The arrow indicates direction and length of the OW. A, Sa&A, B, B. C SS B BumHI; P, SphI; G, BglII; H, Hin- dIII; C, ChI; S, Sua; T, SstI; K, KpnI; R, EcoRl.

at the chromosomal locus of FLlOO (data not shown), and as distiller’s yeast used on molasses media show but noRTMl hybridized sequences were found in LG16 different levels of molasses resistance, we decided to or X2180, doubtless explaining the failure to produce analyze the RTMl gene in the genome of those strains. URA strains by genereplacement procedure. The The strains tested are the laboratory strains X2180-1B RTMl gene product is therefore not required for cell and FLlOO and 13 different yeasts used in industrial viability under standard growth conditions. ethanolproduction or produced on molasses (like The rtml-A1::UR43disruption strain (FL100-Al) was baker’s and distiller’s yeasts) (listed in Table 2). Chro- examined for molasses growth phenotype. The deletion mosomal DNA from those strains was separated by of RTMl gene in FLlOOm increased slightly the sensitiv- pulsed field gel electrophoresis, and the chromosomes ity to molasses (shifting the MIC from 10% to 6%). carrying RTM sequence were identified by Southern RTMl gene does nothave a general drug resistance analysis. Figure 3 shows the hybridization pattern when function: We examined four strains for resistance phe- probed with the sequence derived from the coding re- notypes that could provide information toward under- gion of the RTMl gene. Analysis of the karyotype (data standing the RTMl gene product function. Thestrains not shown) of the 13 industrial yeasts and FLlOO shows examined were LG16-5A (no RTMl gene) and LG16- that their profile is close to the standard strain X2180- 5A transformed by plK (Figure 1) (overexpressing lB, but all those industrial strains tested nevertheless RTMl gene). We also examined the strains rtml- show polymorphisms in genomic structure. More strik- Al::URA3 disrupted FLlOO and FL100. Different ing, all the strains show a different hybridization profile. drugs were tested: substances that could be concen- RTM genes aremapped on different chromosomes trated in molasses during the sugar extraction process (chromosomes W, WI/(XV),XIIZ/(XVZ), II, VU/(V) (organic acids, heavy metals), substances that could be and two unidentified chromosomes). Particular chro- added in that process (fungicides, antifoam) and sev- mosomes were identified based on their size by compar- eral other toxic substances (Table 3). The RTMl gene ison to strain X2180 (II, N). Unfortunately, chromo- or the RTMl gene on multicopy plasmid does not con- somes VIand XV, XII and x1/7, WIZ and V usually fer specific resistance to any of the different drugfami- run as doublets. Therefore we were unable to identify lies tested. Thus, its function is not analogous to a gen- precisely which chromosome hybridizes in those dou- eral detoxification system. Moreover, we haveshown blets. Nevertheless, different numbers of chromosomes that the aging of molasses leads to an increase in the carrying RTMl homologous sequences are shown in toxic element concentration (Table 4). The toxicity of each strain, except for X2180 where the absence of molasses is then probably due to one specific inhibiting RTMl gene is also confirmed. The different hybridiza- compound foundin several batches of old molasses that tion intensities suggest that a different number of ho- is absent or present only at low levels in new molasses. mologous chromosomes carry RTM gene. Thus RTMl Genetic diversity of RTM genes in yeast strains: As is a member of a new family of genes repeated in the overexpression of RTMl allows the growth on molasses genome as are the SUC, MAL or MEL families. New Telomeric Yeast Gene 949

1 T~~~~~TATT~~T~~ 101 A~CAAATAA~;ACAGGCTT~TT~~~~~~~~AT~~ 201 ~~Cn~TC~~A~~CTA~T~~A~~~~~ 301 ATA~~~~~C~~C~T~C~T~~~A~T 401 G~c~~TTA~CCACG~;CCGGACCATPATCAG TAA~~ATA~~ATATATAACCAAAAAAATA 501 ***** ***** 601 TGGCGGATGATGTAACACC'~T~~TC~TATA~CA A% TCA AAT GAC 'KT Ac;T GGC TCT GAA MSNDSSGSE

691 n;GGAGCTTTATCGATh~ACACCTAGTAAGGGAcerGCAATAGCAtTAACTG'ITC?T~ATAGTTACAACA~A WELYRYTPSKGAAIALTVLFIVTTTt

766 ATA TAC TCT TTA CAG GTA GTA TGG GAT GCA AGA AAG GCT TCT AAG CCA GAA GTCGAC AAT CCC TIT GAT ACT CCT IYSLQVVWDARKASKPEVDNPFDTP

841 GlT GATAAG TfX GAA TCT ATCACA GCC ATT ACX "E GGG GAG AhT TAT AAG AAA ClG ACAGTA AGG TCG ACA TlT' VDKCESITAISLGENYKKLTVRSU

916 TCTGCCTTCATCC~TTA~mGGT~ATAATGGAAATPGTGGGCTACATTGCAAGA~GTATCATCGTCT SAFIPLFFGCXMEIVGYIARAVSSS

991 AACACA AAG GAGATA GCG CCGTAC GTC ATA CAA GCA GTG Cry: CTG 'ITA ATT GCG CCT GCC TIG TAT GCA GCGACT NTKEIAPYVIOAVLLLIAPALYAAT

1066 A'IT TAT ATG CTG 'FIT GGT AGG CTA CTGCAT GTT ATGAGG 'KT GAA TCC Cl" A% ATC G'IT TCC TCT COT "T GGG IYMLFGRLLHVMRCESLMIVSSRFG

1141 ACTAGT TN' T" GTG !r" GGA GAT GTG GTl' AGT TIT TGT CIT CAG GCTGCT GQT GGG GGC TTA A% GCA ACA GW TSFFVFGDVVSFCLOAAGGGLMATV

1216 AACGGT AGA ACGACC GGT TCG AAT CY'" ATT ACT GCG GGC Cry: GTT ATT CAA ATT GIY: TTT TIC GGG (JIT TTC AX NGRTTGSNkITAGLVI0IVFFGVF-L

1291 ATC AAT GAG TTC AGA TTC TCA TAC AGT Gl" GCG AGG GTP n;C CCC TTC TACCGT CAT ATA TCG AAA AAA TOG TWZ UEFRFSYSVARVCPFYRHISE-

1366 l" "G AAT CTT ACA CTA ATG CTT TCG AGTATA "G ATC A% GTA CGT TCG ATT AGA CTA GTC GAG "T GTA FLNLTLMLSSILIMVRSIYRLVEFV

1441 GAA GGG TAT GAT GGA ?Tc ATAATA TCG CAC GAA TAT 'ITC ATCTAC GTC "T GAC GCT GTG CCT A% Cl" TTA Gcp EGYDGFIISHEYFIYVFDAVPMLLA

1516 GCCATTGTATTTATTGTTGGATCC~TIYTGGAAACATTmACCACAATTACCGAGTdCAGTCCTn;AAACCA AIVFIVGSPFGNIFTTZTECQSLKF'

1591 TAA CGAACACAT~CAGCACT'~C~~TACTITITGG GGCTCCGA~TAACTA~TA~~T~T~T~~TAA~TAT~TA~~~TAA~~AC~~G 1690 *** ***** 1790 CAGT~~~TCACTAGCGCATGAAAACGCATTAAAA ********* (a) 1890 ~'ITAC'M-TPGGTACAAAACCAAAATATGTTACT~~~TA~~TCCC~TATA~~TA~~~ 1990 CA~GT~G~~A~~~~A~~~~A~~~ 2090 GCTGCTAA~TOTCGT~~~TA~GTGTACATAAATA ***e*** (b) 2190 GTCGTAGCOG?TAAGTTGAGATGGTATGTGCGTATGGCAn 2290 mY;GAGTTCGAAATGCAATTAT~~ATTA~~~~~~~~TA~~~~ 2390 AGACGAACCAGATTPCCAGGGCGGACCGATGCCrPCAAAC 2490 TT~TAcTATAATGGGTTG~~'ACGAAATGCGAGGGGC 2590 ATAAGG?AATATGGTTACTACACGTAGATGAGCTATCCAAGCAAGMTAC~GAAGGTtXACACACA@&GGACJXGC?i~ 2690 A~TAhG~GCAGTACTAAGACTCCACGATGTCGT 2790 AACGGATCGCGCGGACTCTTATAGAATAAGTITG FIGURE2.-Nucleotide sequence of the RTMl gene. The deduced amino acid sequence is indicated. The putative TATA elements and transcription termination signals of (a) ZARET and SHERMAN(1982) and (b) BENNETZENand HALL (1982) are marked by *. In the aminoacid sequence, the seven predicted hydrophobic domains that would be potential membrane spanning segments are underlined. The GenBank accession number is U02618.

Moreover, the minimal copy number of RTM genes (overexpression) of RTMl gene. Moreover, testing the (estimated from the different location) inyeast is expression of RTMl gene by Northern blot, we observed roughly correlated to the molasses resistance (Table 5). that strains exhibiting the molasses resistancephenotype Strains carryingat least two copies of RTM gene present associated with high copy number of RTM sequence the higher molasses resistance except strain 5. This ob- show high steady-state levelsof the RTM transcript when servation is in agreement with the isolation procedure compared to the molasses-sensitive FLlOO strain. 950 F. Ness and M. Aigle

TABLE 3 TABLE 4 List of the inhibitory compounds tested Measure of the toxicity of different batches of molasses

Organic acids: acetic, malic, lactic, propionic, benzoic acids Growth of the strains Antifoam: tryptol, Erol XDMl Heavy metal salts: Cu, Zn, Mn, Mo, Co, Ba, Li Batch of Molasses LG165A Fungicides: benomyl, nystatin, fenpropimorph, ketokonazol molasses (%) (MICbatch1: 16%) LG165A/plK Others: sinefungin, cycloheximid, tetracyclin, neomycin, 1 16 - +++ actinomycin D 30 - ++ 2 30 + ++ 50 +/- + RTM genes are located in subtelomeric regions: In 2 (after 2 mo.) 16 - +++ an attempt to analyze the location of the different cop 30 - ++ ies of RTM gene and to be able to understand this gene amplification, we first analyzed the RTM loci by Yeast growth was performed on solid media as described in MATERIALS AND METHODS. - and + represent in increasing hybridization experiments. The genomic DNA from order the growth ability of yeast on molasses media. LG165A five strains containing differentestimated copies (mini- is used as reference sensitive strain. LG165A transformed with mal) of RTM gene, based on their chromosomal analy- the multicopy yeast vector containing RTMl gene (plK) is sis, was digested with different restriction enzymes: used as specific resistant yeast to the molasses toxicity. strain FLlOO (one minimal copy), strain 1 (two minimal copies), strain 5 (five minimal copies), strain 7 (four the different loci exist in different number. A common minimal copies) and strain 13 (seven minimal copies). chromosome carrying RTM shared by the different Using the RTMl probe (HindIII-BamHI fragment), the strains is the chromosome W1,W. It could possibly genomic BamHI-BglII digest always generated a single carry the common locus no. 2. Nevertheless, the num- high homology hybridizing fragment of the 1.3-kb ex- ber of different loci defined by restriction mapping is pected size (data not shown). Thus, the coding and not correlated with the number of different chromo- immediate 5’ region of the different copies is conserved somes carrying the RTM gene. Then, identical copies for all the five strains. The hybridization of the BamHI of RTM could be located on different chromosomes. genomic DNA digest by the same RTMl probe shows a That homologous chromosomes could share different single fragment of 5.8 kb (Figure 4). The BamHI site copies of RTM is not excluded by our results. in the 5’ side of the different copies of the RTMgene To determine the identity of the 3’ and 5’ flanking is thus conserved in all the strains. The same genomic regions, the nucleotide sequence of the 2.8-kb fragment DNA digestion hybridized with the 3’ side probe of the was compared with the GenBank data bases. Surpris- RTMl gene (the BamHI-SstI fragment) gives for FL100, ingly, we found high homology (80-95% identity) on an 8-kb fragment. This result confirms that only one the 3’ side of the RTMI gene (locus isolated from the RTM locus is present in the strain FL100. For all the FLlOO genome) withy’subtelomeric sequence (see Fig- other strains a 6.2-kb fragment is observed, and de- ure 5). Thehomology is found with centromere proxi- pending on thestrains, one, two or perhaps three addi- mal portions of the Y’subtelomeric sequence described tional fragments are shown per strain that have respec- by LOUISand HABER (1992). The RTMl gene is there- tively 2.5, 1.9 and 2.1 kb. We could therefore define fore probably located close to the telomere in the fol- four or perhaps five restriction maps (loci) with these lowing order: centromere . . . -RTMI-Y’sequence-te- different strains. As the 5’ side and the coding region lomere. However, several differences are observed in comprised between the BglII and BamHI sites are con- comparison with the general chromosome end struc- served, the variations observed reflect a polymorphism ture. No homology occurred between the nucleotides within the 3’ side of the RTM gene. To construct more 1 to 652 and 703 to 1440 of the Y‘ sequence. Only a detailed maps, Hind111 and, independently, BglrI geno- short X subtelomeric sequence portion(of -50 nucleo- mic DNA digestions were hybridized with the two tides) is found between RTMI and the Y’ sequence, the probes. The results confirm the polymorphism of the remainder of the X sequence is missing. 3’ side (see Figure 4). Four distinct loci are described. As RTMl is probably located near a telomere and is The fifth hypothetical locus is not presented because it a memberof a new familyof repeated gene,we decided was not possible to locate in this locus the doublet Hzn- to compare this family with the SUC gene family that dIII BglII in comparison with the BamHI site in the 3’ shares the same characteristics. All the SUC genes have side of RTM. highly homologous sequences, are dispersed on differ- In the strain FL100, there is only one locus (locus ent chromosomes (SUCI, 2, 3, 4, 5 and 7 have been no. 1). In the other strains tested, a common locus is identified respectively on chromosomes WI, ZX, IZ, XZI, present (locus no. 2), which is associated with one to Nand 7.711) and are located between the X and the Y’ three different additional other loci. Moreover, the dif- subtelomeric sequences except sUc2 (CARLSON et al. ferent intensities of the hydridized bands suggest that 1985).The filter used for chromosomal location of New Telomeric Yeast Gene

1 2 3 4 5 6 7 8 910 14131211 15

FK;I’KI.J.-Divcrsity in copy mm- her antl location of R7X1 gene on chromosomal DNAs from different S. wrmrixinC strains. Thc figure show the results oL‘Sorlthcrn hyl,ritlization analysis of the chromosomal DNAs probed with thc R7MI cocling region gene probe. Strains: clistillcr’syeast strains 1, 5,7, 13,6,8, 10, 11, 17, 18, 19, 20 and 21 (lanes 2-14, rcspcc- tivcly), X‘LIXO-IB (lanc 1) antl FI.100 (lanc 15). Chromosomes csti- mated to be hvbritlizccl arc notecl.

RTM gene was hybridized with a SUC2 coding region used on molasses. All the previously identified SUC probe. As the differentSUCgenes share high homology, genes were found in our strains. All of the strains con- this probe will hybridize to all of the SUC genes. The tain a SUC sequence on the chromosome IX that has results (Figure 6) show a high diversity of SUC genes been shown to carry the SUC2 gene. These results are (number and location) in the genome of the yeasts accordingtothe observations of C;ARI.SON antl BOTSTEIN(1983). The laboratory strain X2 180- 1B car- TABLE 5 ries only the SUC2 gene, and, in addition, the strain Relation between natural RTM copy number FLlOO shows the SUC7 gene on chromosome KVI, con- and molasses-resistant phenotype sistent with the analyses of CARISON and BOTSTHN (1983) and CARLSON et (11. (1981). The different indus- Minimal copy (:M~I,,,,,I, I trial yeasts share the commonSUC2 gene andfrom one Strain number (% molasses) to five different telomeric SUC genes (SUCI, 3, 4, 5 or X 0 16 7). Moreover, two unidentified locations are found. 17 0 17 20 The comparison between RTM and SUC hybridiza- FL 1 20 tion chromosome profiles show a remarkable result. All 10 1 10 8 the chromosomes hybridized with the RTMl probe are 8 1 30 11 3 20 also hybridized with the SUC2 probe. These chromo- 1 2 > 40 somes aretherefore the chromosomes carrying SUC 6 2 >40 telomeric gene (WI, 11, Nil, VI1 and W)and the two 18 3 2 40 unidentifiedchromosomes. The chromosome IX 20 4 2 40 known to carry the nontelomeric SUC2 gene is the only 21 4 2 40 chromosome not hybridized with the RTMl probe in 7 4 7 >40 all the strainstested. Therefore the presence of the 13 7 40 19 5 >40 RTM gene isalways associated with SUC telomeric 5 5 20 genes. Moreover, the hybridization intensities are the same with RTMI and SUC2 probes. This ohsenration Estimation of minimal RTMcopies is based on the number suggests that thecopy number of RTMl antl SUCgenes of chromosomal bands (see Figure 3) hybridizing to RTMI probe. Molasses-resistant phenotype is expressed in MIC (%). are the same on each group of homologous chrome Strains: X, (X2180-1R); FL, FLl00; numbered strains, indus- somes concerned. trial distiller’s strains. As RI” repeated sequences andSUC telomeric genes 952 F. Ness and M. Xiglc

FL100 1 5 7 13

B GHBGHBGHBGHBGH A.

8,O kb (B) B. 6,2 kb (6) 5,O kb (G)

38kb G 3:6 kb \HI 2.7 kb (H) 2,5 kb (B) 21 kb B 1:9 kb [B{

0IA C. 01 A V TSK SR T FL100 genomic P G HVCSS B I I II II I I II I I I fragment in pl I I

loci

FL100: I-

Distillery strains: 1, 5, 7, 13 - -

1,513 "

7, 13: "

FIGURE4."Southern analysis of the different RTM copies in different yeast strains. The genomic DNA from the FI.100 strain and the distiller's strains 1, 5, 7 and 13 were digested with RnmHl (lane R), RgnI (lane G) or Hind111 (lane H) and hybridized with the HindIII-RnmHI fragment (RTMI gene) (A) and the finmHI-Ss~Ifragment (3' side of RII"1 gene) (R). (C) Schematic representation of the different loci present in FLl00 and distiller's strains deduced from the Southern analvsis. Restriction sites: A, SudA; R, RnmHI; P, SphI; G, BgflI; H, HindIII; C, Ckd; V, LcoRV; S, .MI;T, .%/I: K, Kpnl; R, KmRI. seem to be carried by the same chromosomes and as SUC telomeric genes (and in particular the SUC7) and these genes are located near the Y' subtelomeric se- the Y' sequence. The RnmHI site located on the 5' side quences, we decided to compare the RI"1 restriction of the RTMI gene and conserved in the different loci map and those of theSUCgenes establishedby CARLSON we have defined (Figure 4) corresponds to the BamHI et al. (1985).The results (Figure 7) show that therestric- site in the coding region of the SUCsequence. The SalI tionsites defined on RTMI gene correspond to the and EcoRI sites identified in the 3' side of RTMI in the conserved restriction sites located betweenthe different Y' homologue sequence are conserved sites present in Ncw Telomcric Yeast Gene 953

X sequence Y' sequence

telomere 6." 6."

6. I (664) (1591) Sph I / Kpn I (2235) (2850)

FIGI'RE 5."Comp;lrisonof the nucleotide sequence of the3' side of the R7iZ11 gene and subtelomeric sequences. Schematic representation of RTMl 3' side homology (80-957r) with subtelomeric portions ofY' (LOUISand HARER1992) and X (BUTTON and ASTEl.1. 1986) sequences. (A) Ch-omosome end in S. wrmisinr. Oval symbols represent functional telomere composed of (Gl-3T)n repeat$. Acljacent to this seqtlence are up to four tandem copies of the Y' element. This element can be missing. These are then preceded by the X element. The telomere sequences are sometimes found betweenX and Y'. The sequence is numbered like this in I.or~and HNWR (1992). (R)The 2.8-kb SphI-KpnI fragment (sequence see Figure 2). the different proximal Y' sequence analyzed near the relatedto SUC genes. The 3' side RTM polymorphism SUCtelomeric genes. Therefore the RTMl gene is phys- probably corresponds to the Y' sequence variation. ically associated with SUC telomeric genes (SUC7 in the strain FL100) between the X and the Y' suhtelomeric DISCUSSION sequences. As the RTM gene and the 5' side of RTM are completely conserved in the different loci defined We have identified a new gene called RTMl dispersed in thedifferent strains tested (FL100, 1, 5, 7 and 13), throughout the yeast genome. The different RTMse- all the dispersed RTMsequences have the same location quences are highly homologous and are always physi-

1 2 3 4 5 6 7 8 910 11 12 151413

FIGURE6."Southern hybridization analysis ofchromosomal IV suc5- DNA5 fromdifferent S. cmmisinr strains. The figure shows the results of Southernhybridization analysis of the chromosomalDNAs probed with a SUC2-coding re- vi1 SUCl gion gene probe. The membrane - used was the sameas the one used for RTM Southern analysis (Fig- Xlll sua ure 3) after total dehybridization. Strains: distiller's yeast strains 1, I1 suc3- 5,7, 13,6,8, 10, 11, 17, 18, 19,20 SUC? _.) and 21 (lanes 2-14, respectively), X2180-1B (lane1) and FLlOO (lane 15). Vlll suc7- IX suc2 SUC? - 954 F. Ness and M. Aigle

FI(;CRF. 7.-(;omparison of the stnlc- ture of the SUC telomeric and RTMI ICENTROMERE TELOMERE C loci. (A) Conserved structure of the different SUC telomericloci (SUCI, 3, 4, x SUC V0 5, 7'). The restriction sitesrepresented PS G XR 8 XG GHS B SSR G X are the conserved or majority sites be- A. += I+-& . ,. tween the different SUC loci (CARISON I I1 I \ \\ I \ I II I I I\ \ \ ~t a/. 1985). (R) Restriction mapof I II I \ l\l I RTM1 loci in FL100 strain. The SCK, I I1 I I \\\ \ I ."Ill I. l\l I RTMI, Y' and X sequences are repre- B GH S B SSR GH sented as boxes. Arrows indicate SUC B. -1 kh and RTMI structure genesand are RTMl pointed in the direction of transcrip v' tion. The 2.8-kb sequenced fragment is shown. Restriction sites: P, Sj~lrl;S, Snn; G, &ill: X, XhI; R, I.:coRI; R, RnmHI; H, HintllIl. cally associated with SUC telomeric genes; each associ- kb SUC-RTM sequences are present only at subtelom- ated SUC-RTM sequence is inserted behveen X and Y' eric loci in all the strains tested. This sequence is not subtelomericsequences, i.~., centromere. . .-X se- found in the strain X2180 nor its progenitor S288C quence-SUGRTM-Y' sequence-telomere. Transcription (CARLSONPI 01. 1985) where the only SUC locus, SUC2, of the two genes is in the same centromere-to-telomere is not telomeric. direction. The lack of the RTM sequence in some strains raises The fact that RTM sequences are adjacent to Y' se- the question of the RTMorigin. The same remark could quences could explain the 3' side of RTM loci's poly- be asked for Y' subtelomeric sequences. Y' element5 morphism. One hypothesis is that the Y' variation in- are not distributed widely among yeasts (JAGER and cludes many insertion/deletions as described bv I,OCVS PI-1Il.IPPSEN 1989; NAUMOVet nl. 1992). In S. camisine and HAIWX(199011, 1992) and NAC~MO\~e/ nl. (1992). these elements are highly conserved, are adjacent to Another hypothesis could be thevariation of SUC RTM the telomere, and presentin one to four tandemcopies, sequence's insertion position at the 5' side of the Y' but are not found at all chromosome ends (SZOSTAK sequence. and RIACKDURN 1982; CI-IANand Tk 1983; WAI.MSLEY The high number andlocation diversity and the par- PI nl. 1984; LOUIS and HARER 1990a).Several structural ticular common insertion of these associated SUCR7'M features are consistent with a mobile element origin sequences seem to indicate that the dispersal of SUC- for Y's (LOUISand HARER 1992). Thesecharacteristics RTM sequences to different chromosomcs occurred by support perhapsa link between SUC-RTMand Y's evolu- rearrangements of chromosometermini. Cj2RI.SON P/ tion or dispersion. But even if their dispersion among 01. (1985) suggested a model for the evolution of the the genomecould have occurred with the same mecha- telomeric members of the SUC gene family in regard nism (by recombination or conversion), they have to the comparaison of the SUC loci and the suc" loci evolved independently.Indeed, SUC-RTMisalways (loci lacking the SUC gene). This model could then be found adjacent to theY' sequence (thisstudy and CARL- adapted not only to the SUC gene but to the whole SON e/ nl. 1985) but the Y' sequence could be present SUC-RTM sequence. The model proposed that the first without the SUGRTMsequence, e.g., in the strain S288C telomeric SUC locus evolved by the insertion of an -7- (see LOUISPI 01. 1994). kb element containinga SUCand a RTM gene behveen In S. camisiclp other repeated genefamilies have been X and Y' subtelomeric sequences. The resulting SUC- described [MAL (CHARRONet 01. 1989), MEl, (NAUMOV RTM locus could then move to different chromosomes etnl. 1990, 1991)]. Acommoncharacteristic can be high- by recombination or could be transferredby conversion lighted between the two telomeric RTM and MIX fami- mediated by the homology of thesubtelomeric se- lies compared to the othergene's family. This is the lack quences. The evolutionaryrelationship behveen the in some strains of any RTM or MEL sequence, when in nontelomeric SUC2 and the otherSUCgenes, suggested all strains tested there is at least a SUC2 gene (CARLSON by CARISON~t nl. (1985), is a gene duplication where and BOTSTEIN1983) and atleat an allele of MALI (NAU- SUC2is speculated to be the ancestral gene, but the MOL' el al. 1994). This observation may suggest a similar lack of RTM gene near the SUC2 gene adds another evolution mechanism. Their amplification is therefore variable to the model. It could be proposed that the independent because all the MIX genes seem to be Io- first duplication eventof SUC2corresponds tothe inser- cated on left ends of chromosomes (TURAKAINENet 01. tion of SUC2 in an RTM original telomeric locus. The 1993), when SUC telomeric genes mapped are located two genes were then dispersed together through other on right ends of chromosomes (MORTIMERPI nb 1992). telomeres. Nevertheless such an isolated RTM locus is Ends of chromosomes seem then to be a good way for never seen in our study. It is noteworthy that these 7- spontaneous gene amplification. New Telomeric Yeast Gene 955

A recent publication concerning the MEL gene fam- strains and for their interest taken in this work and P. WILSONfor ily describes a new unidentified OW that like the RTM language correction. We are grateful to F. DOIGNONfor providing the P45014DMFLZR marker and to him andN. BITEAUfor the sequence genes is absent or present in different copy number in analysis. This work was supported by PIRSEM/ECOTECH. F.N. was yeast (TURAKAINEN et al. 1994). supported by a grant from the Centre National de la Recherche The RTM gene amplification may have a real func- Scientifique. tional role. RTMl overexpression provides a higher level of resistance on molasses media. It is noteworthy LITERATURE CITED that compared tolaboratory strains (0 or 1 RTM copy), ADAMS, J., S. PUSKASROZSA,J. SIMLARand C. M. WILKE,1992 Adapta- the industrial strains grown on molasses (biomass pro- tion and major chromosomal changesin populations of Sacchare duction or industrial ethanol production)show the am- myces cerevisiae. Curr. Genetics 22: 13-19. BENNETZEN,J. L., and B.D. HALL,1982 The primaIy structure of plification of RTM sequences throughout the genome. the Saccharomyces cerevisiae gene for alcohol dehydrogenase I. J. The high copy numbers of this sequence in distiller’s Biol. Chem. 257: 3018-3025. yeasts iscorrelated with the hightranscription rate com- BIDENNE,C., B. BLONDIN,S. DEQUINand F. VEZINHET,1992 Analysis of the chromosomal DNA polymorphism of wine strains of Suc- pared to the FLlOO strain (one RTM copy), even if charomyces cerevisiae. Curr. Genet. 22 1-7. RTM sequences are located near telomeres described BONNEAUD,N., 0. OZIER-KALOGEROPOULOS,G. LI, M. LABOUESSE,L. to repress the transcription (GOTTSCHLING et al. 1990). MINVIELLE-SEBASTIAet al., 1991 A family of low and high copy replicative, integrative andsinglestranded S. cereuisiae/E. coli Indeed, this amplification can explain the adaptation shuttle vectors. Yeast 7: 609-615. of the growth of these yeasts on molasses. The RTM BRONN,W. &, and N.FATTOHI, 1988 ProbEmes de residus dans genes show genetic diversity in this population of yeasts la mklasse de sucre de betteraves. Die Branntweinwirtschaft 2: 238-241. and seem to be a good example of genomic rearrange- BURKHOLDER,A. C., and L. H. HARTWELL,1985 The yeast a-factor ment playing a role in evolution and environmental receptor: Structural properties deduced from the sequence of adaptation in yeast population used on molasses. This the STE2 gene. Nucleic Acids Res. 13: 8463-8475. BUTTON,L. L., and C. R. ASTELL, 1986 The Saccharomycescerevisiae remark includes the physically associatedtelomeric SUC chromosome 111 left telomere has a type X, but not a type Y’, genes encoding the invertase enzyme by the fact that ARS region. Mol. Cell. Biol. 6: 1352-1356. the major carbon source in beet molasses is sucrose. CARLE,G. F., and V.M. OLSON,1985 An electrophoretic karyotype for yeast. Proc. Natl. Acad. Sci. USA 82 3756-3760. Indeed, changes in yeast genomic structure in relation CARLSON,M., and D.BOTSTEIN, 1982 Two differentially regulated to the culture conditionswere observed by ADAMS et al. mRNAs with different 5’ ends encode secreted and intracellular (1992). forms of yeast invertase. Cell 28: 145-154. CARLSON, M., and D. BOTSTEIN,1983 Organization of the SUCgene In contrast to distiller’s strains, yeasts originally not family in Saccharomyces. Mol. Cell. Biol. 3: 351-359. growing on molasses like the majority of wine strains, CARLSON, M.B., C. OSMONDand D. BOTSTEIN,1981 Genetic evi- show only the SUC2 gene and no SUC telomeric gene dence for a silent SUC gene in yeast. Genetics 98: 41 -54. CARLSON, M., J. L. CELENZAand F. J. ENG, 1985 Evolution of the (BIDENNEet al. 1992). It can be noted that those yeasts dispersed SUC gene family of Saccharomyces by rearrangements ferment grape juice thatcontains glucose and fructose of chromosome telomeres. Mol. Cell. Biol. 5: 2894-2902. instead of sucrose for molasses. We did not test the CHAN, C. S. M., and B. TYE, 1983 Organization of DNA sequences and replication origins at yeast telomeres. Cell 33: 563-573. presence of RTMin these strains but suspect its absence CHARRON,M. J., E. READ,S. R. HAUTand C. A. MICHELS,1989 Molecu- as SUC telomeric genes are absent too. lar evolution of the telomere-associated MAL loci of Saccharo- The Rtml protein does not belong to the family of myces. Genetics 122 307-316. CROUZET,M., M. URDACI,L. DULAUand M. AIGLE,1991 Yeast mu- multidrug resistant proteins that arein most cases large tant affected for viability upon nutrient starvation: characteriza- proteins with 12 transmembrane domains. It seems that tion and cloning of the RVS161 gene. Yeast 7: 727-743. Rtmlp does not provide a general detoxification func- DOHLMAN,H. G.,J. THORNER,M. G. CARON and R. J. LEFKOWITZ,1991 Model systems for the study of seven-transmembrane-segment tion but confers a resistance to a particular toxic ele- receptors. Annu. Rev. Biochem. 60: 653-688. ment present in some molasses. This toxic element ap- DOIGNON,F., M. AIGLE and P.RIBEREAU-GAYON, 1993 Resistance pears with time in beet molasses. The Rtml protein to imidazoles and triazoles in Saccharomycescerevisiae as a new dominant marker. Plasmid 30: 224-233. looks like a member of the seven transmembrane seg- EISENBERG,D., E. SCHWARZ,M. Komomand R. WALL,1984 Analy- ment protein family (for review see DOHLMANet al. sis of membrane and surface protein sequences with the hy- 1991). It could be, for example, a signal-transducing drophobic moment plot. J. Mol. Biol. 179: 125-142. FIEDLER,A,, 1981 Recherchede composesinhibiteurs contenus protein like STEZ or STE3 (BURKHOLDERand HART- dansla mClasse. These (Berlin) (rCsumC en franqais).Tech- WELL 1985; HACEN et al. 1986) or a specific extrusion nischen UniversiCit Berlin. pump. Codon usage of the RTMl gene is surprisingly COMPEL-KLEIN,P., and M. BRENDEL,1990 Allelism of SNQl and ATRl, genes of the yeast Saccharomyces cerevisiae required forcon- low (CAI = 0.093) (SHARP and COW 1991). This value trolling sensitivity to 4nitroquinoline-N-oxide and aminotri- is closer to those of genes encodingregulation or signal azole. Curr. Genetics 18: 93-96. transduction proteins than forgenes encoding enzymes GOTTESMAN, M. M., and I. PASTAN,1993 Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu. Rev. or transporters. The identification of the toxic element Biochem. 62: 385-427. would give us a tool to study the function of this mem- GO~SCHLING,D. E., 0. M.APARICIO, B. L. BILLINGTONand V. A. brane protein encoded by this new gene family. Z-, 1990 Position effect at S. cereuisiae telomeres: reversible repression of Pol I1 transcription. Cell 63: 751-762. We thank M. DE MINIAC(Union Nationale des Groupement de HAGEN, D. C., G. MCCAFFREYand G. F. SPRAGUE,1986 Evidence the Distillateurs d’Alcool), G. Gom and P. CLEMENTfor providing yeast yeast STE3 gene encodes a receptor for the peptide pheromone 956 F. Ness and M. Aigle

a factor: gene sequence andimplications for the structureof the NAUMOV,G. I., H. TURAKAINEN,E. S. NAUMOVA,S. AHO and M. KOR- presumed receptor. Proc. Natl. Acad. Sci. USA 83: 1418-1422. HOLA, 1990 A new family of polymeric genes in Saccharomyces HIGGINS,C. F., 1992 ABC transporters: from microorganismsto cereuisiae: a-galactosidase genes MELl"EL7. Mol. Gen. Genet. man. Annu. Rev. Cell. Biol. 8: 67-113. 224: 119-128. JAGER,D., and P. PHILIPPSEN,1989 Manyyeast chromosomes lack NAUMOV,G. I., E. S. NAUMOVA,H. TURAKAINEN, P.K. SUOMINENand the telomere-specific Y' sequence. Mol. Cell. Biol. 9: 5754-5757. M. KORHOLA,1991 Polymeric genes MEL8, MEL9 and MELlO KANAZAWA, S., M. DRISCOLLand K. STRUHL,1988 ATRI, a Saccharo- new members of a-galactosidase gene family in Saccharomyces cere- myces cereuisiaegene encoding a transmembrane protein required vzsiae. Curr. Genetics 20: 269-276. for aminotriazole resistance. Mol. Cell. Biol. 8: 664-673. NAUMOV,G. I., E. S. NAUMOVA,R.A. LANTTO, E. J. LOUISand M. KARIN, M., R. NAJARIAN,A. HASLINGER,P. VALENZUELA,J. WEI.CH et KORHOIA,1992 Genetics homology between Saccharomyces cereuis- aZ., 1984 Primary structure and transcription of an amplified iaewith its sibling species S. paradoxus and S. bayanus: electropho- genetic locus: the CUP1 locus of yeast. Proc. Natl. Acad. Sci. USA retic karyotypes. Yeast 8: 599-612. 81: 337-341. NAUMOV,G. I., E. S. NAUMOVAand C. A. MICHELS,1994 Genetic KUCHLER,R, R. E. STERNEand J. THORNER,1989 Saccharomyces cere- variation of the repeated MAL loci in natural populations of uisiae STE6 gene product: a novel pathway for protein export in Saccharomyces cerevisiaeand Saccharomyces paradoxus. Genetics 136: eukaryotic cell. EMBO J. 8: 3973-3984. 803-812. m,J., and R F. DOOLITLE,1982. A simple method for displaying the ROTHSTEIN,R. J., 1983 One-step gene disruption in yeast. Methods hydropathic character of a protein. J. Mol. Biol. 157: 105-132. Enzymol. 101: 202-211. LEPPERT,G., R. MCDEVITT, S. C. FAICO,T. K. VAN DYK, M. B. FICKE SANGER,F., S. NICKLENand A. R. COULSON,1977 DNA sequencing et aZ., 1990 Cloning by gene amplification of two loci conferring with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: multiple drug resistance in Saccharomyces. Genetics 125 13-20. 5463-5467. LOUIS,E. J., and J. E. HABER, 1990a Mitotic recombinaison among SHARP, P. L., and E. COW, 1991 Synonymous codon usage in Sac- subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 124: charomyces cereuisiae. Yeast 7: 657-678. 547-559. SHERMAN,F., G. R. RNKand J. B. HICKS, 1986 Methods in Yeast Genet- LOUIS,E. J., and J. E. HABER,1990b The subtelomeric Y' repeat ics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. family in Saccharomyces cereuisiae: an experimental system for re- SZOSTAK,J. W., and E. H. BLACKBURN,1982 Cloning yeast telomeres peated sequence evolution. Genetics 124: 533-545. on linear plasmid vectors. Cell 29: 245-255. LOUIS,E. J., and J. E. HABER,1992 The structure of subtelomeric TURAKAINEN,H., G. I. NAUMOV,E. S. NAUMOVAand M. KORHOLA, Y' repeats in Saccharomyces cerevisiae. Genetics 131: 559-574. 1993 Physical mapping of the MEL gene family in Saccharomyces LOUIS,E. J., E. S. NAUMOVA,A. LEE, G. NAUMOVand J. E. HABER, cerevisiae. Curr. Genetics 24: 461-464. 1994 The chromosome end in yeast: its mosaic nature and in- TURAKAINEN,H., P. KRISTO and M.KORHOLA, 1994 Consideration fluence on recombinational dynamics. Genetics 136: 789-802. of the evolution of the Saccharomyces cerevisiae MEL gene family on the basis of the nucleotide sequences of the genes and their MARGER, M. D., and M. H. SAIER,1993 A major superfamily of transmembrane facilitors that catalyse uniport, symport and antiport. flanking regions. Yeast 10: 1559-1568. VON TRESSL,R., R. JACOB, T. KOSSAand W. K. BRONN,1976 Re- Trends Biochem. Sci. 18: 13-20. cherches par chromatographie enphase gazeuse (CPG) et spec- MCGRATH,J. P., and A. VARSHAVSKY,1989 The yeat STE6 gene tromttrie (SM) des substances volatiles contenues dans la mkl- encodes a homologue of the mammalian multidrug resistance asse. Die Branntweinwirtschaft 116: 117- 119. P-glycoprotein. Nature 340: 400-404. WALMSLEY,R. W., C. S. M. CHAN,B. TYEand T. D. PETES,1984 MICHELS,C. A,, E. READ, K. NAT and M. J. CHARRON,1992 The Unusual DNA sequences associated with the ends of yeast chrc- telomere-associated MAW locus of Saccharomyces is a tandem mosomes. Nature 310: 157-160. 8: array of repeated genes. Yeast 655-665. WELCH,J. W., S. FOGEI.,G. CATHAIA and M. KARIN,1983 Industrial MORTIMER,R. IC, C. R. CONTOPOULOUand J. S. KING,1992 Genetic yeasts display tandem gene iteration at the CUP1 region. Mol. and physical maps of Saccharomyces cerevisiae, pp. 737-812 in The Cell. Biol. 3: 1353-1361. Molecular and Cellular Biology of the YeastSaccharomyces, Genome ZARET,K. S., and F. SHERMAN,1982 DNA sequencerequired for Dynamics, Protein Synthesis and Energetics, edited by J. R. BROACH, efficient transcription termination in yeast. Cell 28: 563-573. J. R. PRINGL.Eand E. W. JONES. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Communicating editor: M. CARLSON