DOCSLIB.ORG

فیلوژنی مولکولی Vetigastropoda براساس ژنهای میتوکندریایی COI و 16S Rrna

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
فیلوژنی مولکولی Vetigastropoda براساس ژنهای میتوکندریایی COI و 16S Rrna Archive of SID فصلنامه علمی پژوهشی محیط زیست جانوری سال دهم، شماره 2، تابستان 1397 فیلوژنی مولکولی Vetigastropoda براساس ژنهای میتوکندریایی COI و 16S rRNA منا ایزدیان*: گروه تنوع زیستی و ایمنی زیستی، پژوهشکده محیطزیست و توسعه پایدار، سازمان حفاظت محیطزیست حسین ذوالقرنین: گروه بیولوژی دریا، دانشکده علوم دریایی و اقیانوسی، دانشگاه علوم و فنون دریایی خرمشهر سیدمحمدباقر نبوی: گروه بیولوژی دریا، دانشکده علوم دریایی و اقیانوسی، دانشگاه علوم و فنون دریایی خرمشهر آریا اشجعاردﻻن: گروه زیستشناسی دریا، دانشکده علوم و فنون دریایی، دانشگاه دانشگاه آزاد اسﻻمی واحد تهران شمال، صندوق پستی: -181 19735 سیامک یوسفیسیاهکلرودی: گروه زیستشناسی، دانشکده علوم زیستی، واحد ورامین- پیشوا، دانشگاه آزاد اسﻻمی ورامین، ایران تاریخ دریافت: خرداد 1396 تاریخ پذیرش: شهریور 1396 چکیده در این پژوهش روابط فیلوژنی بین گونههای کﻻد Vetigastropoda در آبهای ساحلی خلیج فارس مورد بررسی قرار گرفت. بدین منظور از ژنهای میتوکندریایی COI و 16S rRNA استفاده شد. نمونهبرداری در سالهای 1392 و 1393 در سواحل صخرهای شمال خلیج فارس انجام گرفت و نمونهها مورد شناسایی مورفولوژیک قرار گرفتند. سپس مراحل استخراج DNA، تکثیر قطعه ژنی زیر واحد I سیتوکروم اکسیداز )COI( و 16S rRNA و توالییابی انجام شد. در مجموع تعداد 9 توالی COI و 5 توالی 16S rRNA متعلق به 5 گونه از این کﻻد بهدست آمد که این توالیها برای اولین بار از منطقه شمالی خلیجفارس گزارش شده است. آنالیزهای فیلوژنی با استفاده از نرمافزارهای PAUP ،MEGA6 و BEAST و با رسم درختهای فیلوژنی Maximum Parsimony ،Maximum Likelihood و Bayesian صورت گرفت. نتایج نشان داد کﻻد Vetigastropoda که از نظر ردهبندی سنتی خانوادههای Turbinidae ،Chilodontidae ،Trochidae و Fissurellidae از این مطالعه را، شامل میشود، مونوفیلتیک نمیباشد. به این ترتیب که گونههای متعلق به خانوادههای Trochidae و Chilodontidae در یک کﻻد مجزا از گونههای متعلق به دو خانواده Turbinidae و Fissurellidae قرار گرفتند. این مطلب نشان دهنده رابطه غیرخواهری میان این دو گروه بوده که بیانگر تفاوت بین دیدگاه ردهبندی سنتی و ردهبندی مولکولی است. S rRNA COI Vetigastropoda کلمات کلیدی: ، ، 16، فیلوژنی، سواحل صخرهای، خلیجفارس 251 * پست الکترونیکی نویسنده مسئول: [email protected] www.SID.ir Archive of SID ایزدیان و همکاران فیلوژنی مولکولی Vetigastropoda براساس ژنهای میتوکندریایی COI و 16S rRNA استفاده نمود. بیش از 70 گونه Vetigastropod متعلق به 13 خانواده و 25 مقدمه زیرخانواده، یک کﻻد عظیم تشکیل دادند که در مقابل آنها دو کﻻد تعیین روابط بین گونهای از زمان لینه با مقایسه ویژگیهای برون گونه Neomphalina و Cocculinoidea قرار داشتند. خانواده مورفولوژیک صورت میگرفته است. اگرچه تاکسونومی همچنان بر پایه Seguenziidae - که از نظر فیلوژنتیکی بسیار بحث برانگیز است، به ویژگیهایمورفولوژیکبناشدهاست،امااطﻻعاتروبهگسترشمولکولی عنوان یک کﻻد مشتق شده از Vetigastropoda ظاهر شد و بههمراه مانند توالییابی نوکلئوتیدی به آشکار کردن روابط فیلوژنی میپردازد. Ventsia ،Adeuomphalus و Xyloskenea از Trochidها، یک کﻻد در بین زیستشناسان استفاده از دادههای مولکولی جهت ترسیم حمایت شده را تشکیل دادند. Layton و همکاران )2014( با جمع- درختهای فیلوژنی اهمیت قابل توجهی پیدا کرده است و مقایسه آوری 2471 نرمتن دریایی کانادا و با استفاده از DNA بارکدینگ، نشانگرهای مولکولی در بین جانداران گوناگون میتواند رابطه فیلوژنی مطالعاتی بر روی الگویهای مختلف ژنتیکی 227 گونه انجام دادند. Lemey )اجدادی( آنها را آشکار کند ) و همکاران، 2009(. از آنجایی آنها نشان دادند که استفاده از توالی COI ابزاری مفید، برای شناسایی که چنین دادههایی )در مقایسه با دادههایی مانند دادههای ریختشناسی( نرمتنان کانادا و نیز برای آشکارکردن چشماندازی بر موقعیتهای کمتر تحت تأثیر نتایج انتخاب قرار میگیرند، بهتر میتوانند روابط احتمالی گونههای مختلف است. واگرایی عمیق درونگونهای در برخی Maddison فیلوژنتیکی واقعی را بازتاب دهند ) ، 1997(. در بین 13 گونهها، جدایی جغرافیایی را بین اجداد آنها در سواحل اقیانوسهای ژنکدکنندهپروتئین در ژنوممیتوکندریایی،زیرواحدیکژن سیتوکروم اطلس، منجمد شمالی و آرام نشان داد که میتواند بهعلت عصر یخبندان اکسیداز محبوبیت ویژهای برای برآورد روابط میان تاکسونهای نزدیک در پلیستوسن در بخشی از جمعیت آنها رخ داده باشد. در این مطالعه COI بههمیافته است. با وجود کاربرد وسیع در تعیین قرابت در سطوح سعی شد تا حد امکان از توالییابی ژن 16S rRNA جهت حصول پایین تاکسونومیک، تا حدی برای تعیین روابط عمیقتر فیلوژنتیک اطمینان بیشتر بهره برده شود. این مطالعه همچنین رابطه بین نیز از آن بهره برده شده است. عﻻوه بر اثبات مفید بودن استفاده از محتوی GC و واگرایی توالی را بین گونههای متجانس مشخص کرد. این ژن در مطالعه نرمتنان گوناگون، دﻻیلی بر قابلیت توالی COI در دریافت واگراییهای عمیقتر نیز مشاهده شده است )Elpidio و Hebert، 2003(. با وجود این تقریباً در تمامی مطالعات فیلوژنی همواره از مواد و روشها توالییابی و بررسی ژن دیگری در کنار COI استفاده میشود تا نتایج نمونهبرداری: طی سالهای 92 و 93 نمونهبرداری از بسترهای حاصل محکمتر و قابل استناد باشد. در بسیاری از این مطالعات این صخرهای سواحل شمالی خلیجفارس در زمان حداکثر جزر انجام گرفت. ژن جانبی Mitochondrial 16S ribosomal RNA( mt16S rRNA( مشخصات ایستگاههای نمونهبرداری در جدول 1 آورده شده است. میباشد )Quintero-Galvis و Castro، 2013؛ Strong و Bouchet، نمونهها در اتانول 98 درصد فیکس شد و به آزمایشگاه انتقال یافتند. 2013؛ Frey و Vermeij، 2008؛ Donald و همکاران، 2005؛ Collin، موقعیت ایستگاههای نمونهبرداری در شکل 1 نشان داده شده است. 2003؛ Medina و همکاران، Donald .)1999 و همکاران )2005( بر شناسایی مورفولوژیک: جهت شناسایی مورفولوژیک نمونهها از روی کﻻدوژنز برخی از گونههای خانواده Trochidae در نتیجه حوادث کلیدهای شناسایی شامل: Bosch( Sea Shells of Eastern Arabia و جغرافیایی در جنوب اقیانوس آرام مطالعاتی انجام دادند. آنها در این همکاران، Jones( Sea Shore of Kuwait Persian Gulf ،)1995، 1986(، مطالعه از دو قطعه ژنی میتوکندریایی COI و 16S و یک ژن هستهای Robin( Encyclopedia of Marine Gastropods، 2008( و اطلس actin برای تخمین فیلوژنی برخی از اعضای جنسهای Diloma، نرمتنان خلیج فارس )حسینزادهصحافی و همکاران، 1379( استفاده شد. Melagraphia و Austrocochlea استفاده کردند. مطالعات فیلوژنی مطالعات مولکولی: پس از شناسایی مورفولوژیک نمونهها، آنها نشان دادکه با وجود حوادث جغرافیایی غیرمحتمل در این استخراج DNA از دو نمونه از هر گونه شناسایی شده، انجام شد. منطقه، در طول تاریخ تکامل این گروه در چندین موقعیت انتشار بالغین استخراج DNA با استفاده از پودر Chelex و پروتئیناز K صورت توسط جریانات اقیانوسی رخ داده که منتج به پراکنش وسیع امروزی گرفت. تکثیر قطعه ژنی COI و 16S rRNA پس از ارزیابی کمی و کیفی آنها گشته است. Kano )2008( فیلوژنی Vetigastropod را با استفاده DNA استخراج شده بهوسیله الکتروفورز و اسپکتروفوتومتر، انجام از روش BI وML بررسی نمود. او در این مطالعه با تکیه بر نمونه- گرفت. پرایمر مورد استفاده در تکثیر قطعه ژنی COI، پرایمر جهانی برداری وسیع تاکسونومیک، از آنالیزهای مجزا و ترکیبی یک ژن Folmer )1994( و پرایمر مورد استفاده جهت تکثیر ژن 16S rRNA میتوکندریایی COI و دو ژن هستهای هیستون H3 و 18S rRNA پرایمر Palumbi )1991( بود که مشخصات آنها در جدول 2 آمده است. 252 www.SID.ir Archive of SID فصلنامه علمی پژوهشی محیط زیست جانوری سال دهم، شماره 2، تابستان 1397 جدول 1: نام و مشخصات ایستگاههای نمونهبرداری جهت تهیه محلول PCR، از یک میکرولیتر )10 نانوگرم( DNA نام طول عرض استخراجی، یک میکرولیتر از هر یک از پرایمرها )10 پیکومول(، 0/5 ردیف شهر استان ایستگاه جغرافیایی جغرافیایی میکرولیتر dNTP )10 میلیموﻻر(، 3/0 میکرولیتر آنزیم Taq پلیمراز ° ʹ ʺ ° ʹ ʺ 1 نیروهوایی بوشهر بوشهر 5u/μ( 93 28 55 80 50 66(، 5/2 میکرولیتر بافر )PCR )10X و یک میکرولیتر MgCl2 2 اسکلهجفره بوشهر بوشهر ʺ44ʹ82°50 ʺ37ʹ97°28 3 تیو بوشهر بوشهر ʺ58ʹ50°82 ʺ13ʹ28°98 )50 میلیموﻻر( استفاده شد که در نهایت حجم آن با آب مقطر به Møller McPherson 4 بندررستمی تنگستان بوشهر ʺ81ʹ00°51 ʺ66ʹ28°56 25میکرولیتررساندهشد) و ، 2006(.برنامه تکثیر 5 اولیجنوبی دیر بوشهر ʺ14ʹ51°90 ʺ33ʹ27°83 قطعات ژنی در جدول 3 آمده است. در مواردی که نمونهها از کیفیت ° ʹ ʺ ° ʹ ʺ 6 نایبند عسلویه بوشهر 41 52 67 02 27 42 مناسبی برخوردار نبودند، از روش و مواد دیگری در واکنش زنجیرهای 7 بستانه بندر لنگه هرمزگان ʺ38ʹ99°52 ʺ41ʹ12°27 BSA ساحل پلیمراز استفادهشد. بهطور مثال از ، که در تکثیر ژنهای نرمتنان 8 قشم هرمزگان ʺ37ʹ16°56 ʺ12ʹ54°26 سیمرغ کاربرد دارد، برای رفع عمل محدودکنندهها استفاده شد. محصول PCR 9 قشم قشم هرمزگان ʺ98ʹ56°26 ʺ46ʹ26°93 مورد خالصسازی قرار گرفت و جهت توالی یابی ارسال شد. ثبت توالیها در پایگاه دادهها: به این منظور ابتدا توالیها در سایت Basic Local Alignment Search Tool( BLAST ،NCBI( شد و با توجه بهمیزان فاصله ژنتیکی از توالیهای نزدیک به آنها و همچنین رسم درخت در این سایت، اقدام به ثبت نمونهها گردید. در ابتدا قالب خواندن )Fram( توالیهای بهدست آمده، توسط نرمافزار CLC Sequence )www.clcbio.com Knudsen Viewer v6.5.4 ) و همکاران، 2012( ) تعیین شد. سپس از طریق سایت DDBJ توالیها در پایگاه داده NCBI ثبت گردید. در مجموع 9 توالی COI و 5 توالی 16S خوانا و قابل تحلیل بهدست آمد که این توالیها برای نخستین بار از منطقه خلیج فارس گزارش شده است. مراحل ثبت توالیهای COI در بانک ژن جهانی به پایان رسیده که شماره دسترسی )Accession number( آنها در سایت www.ncbi.nih.gov در جدول 4 قابل مشاهده است. شکل 1: موقعیت ایستگاههای نمونهبرداری جدول 2: نام و توالی پرایمرهای مورد استفاده (Nucleotide Sequence (5’ to 3’) Primer Name (F/R منابع TGTAAAACGACGGCCAGTGGTCAACAAATCATAAAGATATTGG LCO1490_t1 Folmer CAGGAAACAGCTATGACTAAACTTCAGGGTGACCAAAAAATCA HCO2198_t1 ) ، 1994( CGCCTGTTTAACAAAAACAT 16Sar )1991 Palumbi CCGGTCTGAACTCAGATCACGT 16Sbr ) ، جدول 3: برنامه دمایی زنجیرهای واکنشهای پلیمراز بهکار رفته در تکثیر قطعات ژنی مراحل درجه حرارت C° زمان تعداد چرخه )سیکل( واسرشتهسازی اولیه 94 2 دقیقه 1 واسرشتهسازی )Denaturation( 94 30 ثانیه اتصال )Annealing( 45 30 ثانیه 40 بسط )Extention( 72 1 دقیقه بسط نهایی 72 4 دقیقه 1 253 www.SID.ir Archive of SID ایزدیان و همکاران فیلوژنی مولکولی Vetigastropoda براساس ژنهای میتوکندریایی COI و 16S rRNA جدول 4: شماره دسترسی توالیهای ثبت شده در NCBI بوت استرپ بررسی شدند. آنالیز ML برای توالیهای بهدست آمده با ردیف ژن اسم ثبت شده Accession Number استفاده از نرمافزار Tamura( MEGA6 و همکاران، 2011( و تکرار AB976640.1 Diodora sp.
Load more

Recommended publications
  • Evaluation of Immunomodulatory Activity of Extracts from Marine Animals
    Indian Journal of Marine Sciences Vol. 38(1), March 2009, pp. 22-27 Evaluation of immunomodulatory activity of extracts from marine animals Aditya S Akerkar 1, Chetan A Ponkshe 2 & Madhavi M Indap 1* 1Department of Zoology, D G Ruparel College, Senapati Bapat Marg, Mahim, Mumbai 400 016, India. 2Department of Zoology, Sathaye College, Dixit Road, Vile-Parle (E), Mumbai 400 057, India. [Email: [email protected]] Received 16 August 2007; revised 21 November 2007 The whole body ether extracts of a marine prawn Nematopaleamon tenuipes (PEP), two gastropods viz . Euchelus asper (EAE) and Hemifusus pugilinus (HPE), and acetone extract of a fish Rastrelliger kanagurta (MA), were tested for their effects on Delayed type Hypersensitivity (DTH) reaction and Plaque Forming Cell (PFC) assay. The Delayed type Hypersensitive reaction assay for HPE and PEP as well as MA showed stimulation but EAE was found to be less effective . In the PFC assay HPE and MA showed immunostimulation whereas PEP and EAE showed immunosuppression. PEP was further resolved into two fractions, which were tested for in vitro lymphocyte proliferation assay as well as antiproliferative assay. It is concluded that the test extracts possess immunomodulatory property. [Keywords : Animal extracts, Delayed Type Hypersensitivity, Plaque Forming Cells ] Introduction N. tenuipes, E. asper and H. pugilinus have already Majority of the species diversity is found in the been tested for their in-vitro and in-vivo phagocytic ocean fringe. This slender land sea interface with its activity 6. Rastrelliger kanagurta , locally known as high concentration of species is amongst the most Bangada, or Indian mackerel, found throughout biodiverse and productive environments on planet 1.
    [Show full text]
  • Turbo Sarmaticus Linnaeus 1758 CONTENTS
    GROWTH, REPRODUCTION AND FEEDING BIOLOGY OF TURBO SARMA TICUS (MOLLUSCA: VETIGASTROPODA) ALONG THE COAST OF THE EASTERN CAPE PROVINCE OF SOUTH AFRICA THESIS Submitted in Fulfilment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY of RHODES UNIVERSITY by GREGORY GEORGE FOSTER November 1997 Turbo sarmaticus Linnaeus 1758 CONTENTS Acknowledgements Abstract ii CHAPTER 1 : General introduction 1 CHAPTER 2 : Population structure and standing stock of Turbo sarmaticus at four sites along the coast of the Eastern Cape Province Introduction 12 Materials and Methods 14 Results 20 Discussion 36 References 42 CHAPTER 3 : Growth rate of Turbo sarmaticus from a wave-cut platform Introduction 52 Materials and Methods 53 Results 59 Discussion 62 References 69 CHAPTER 4 : The annual reproductive cycle of Turbo sarmaticus Introduction 80 Materials and Methods 81 Results 84 Discussion 100 References 107 CHAPTER 5 : Consumption rates and digestibility of six intertidal macroalgae by Turbo sarmaticus Introduction 118 Materials and Methods 121 Results 126 Discussion 140 References 149 CHAPTER 6 : The influence of diet on the growth rate, reproductive fitness and other aspects of the biology of Turbo sarmaticus Introduction 163 Materials and Methods 165 Results 174 Discussion 189 References 195 CHAPTER 7 : Polysaccharolytic activity of the digestive enzymes of Turbo sarmaticus Introduction 207 Materials and Methods 210 Results 215 Discussion 219 References 227 CHAPTER 8 : General discussion 236 ACKNOWLEDGEMENTS I am extremely indebted to my supervisor and mentor, Prof. Alan Hodgson, with whom I am honoured to have had such a successful association. His continued confidence, guidance, integrity and friendship throughout this study were a source of reassurance and inspiration.
    [Show full text]
  • Arakawa, Kohman Y. Citation PUBLICATIONS of the SETO
    Title STUDIES ON THE MOLLUSCAN FAECES (II) Author(s) Arakawa, Kohman Y. PUBLICATIONS OF THE SETO MARINE BIOLOGICAL Citation LABORATORY (1965), 13(1): 1-21 Issue Date 1965-06-30 URL http://hdl.handle.net/2433/175396 Right Type Departmental Bulletin Paper Textversion publisher Kyoto University STUDIES ON THE MOLLUSCAN FAECES (II) KORMAN Y. ARAKAwA Hiroshima Fisheries Experimental Station, Kusatsu-minami-cho, Hiroshima, Japan With Plates I-VI and 5 Text-figures The work recorded in this paper is a continuation of the study on the molluscan faecal pellets, which has already been presented partly in a preliminary communication (ARAKAWA, 1962) and an initial paper of this series (ARAKAWA, '63). In this paper are included the descriptions of the pellets of fourty-four more molluscan species which were collected at several locations in the Seto Inland Sea and the vicinities in these four years. Before passing to the descriptions, I wish to express my cordial thanks to the following gentlemen who offered me facilities or help in earring out the present work: Dr. Toshijiro KAWAMURA (Hiroshima University), Dr. Ryozo YAGIU (Hiroshima Univ.) Dr. Takasi ToKIOKA (Seto Marine Biological Labora­ tory), Dr. Yoshimitsu 0GASAWARA (Naikai Regional Fisheries Research Lab.), Dr. Huzio UTINOMI (Seto Mar. Bioi. Lab.), Mr. Nobuo MATSUNAGA (Isumi Senior High School), Dr. Katura OYAMA (Geological Survey), Dr. Iwao T AKI (Hiroshima Univ.), Dr. Kikutaro BABA (Osaka Gakugei Univ.), Dr. Shigeru 0TA (National Pearl Research Lab.), Prof. Jiro SE:No (Tokyo Univ. of Fisheries) and Mr. Masa-aki HAMAr (Hiroshima Fish. Exp. Sta:). MATERIAL The scientific names, localities and types of faeces of respective species treated in this work are listed below.
    [Show full text]
  • IMPACTS of SELECTIVE and NON-SELECTIVE FISHING GEARS
    Comparative study of significant molluscans dwelling at two sites of Jiwani coast, Pakistan Item Type article Authors Ghani, Abdul; Nuzhat, Afsar; Riaz, Ahmed; Shees, Qadir; Saifullah, Saleh; Samroz, Majeed; Najeeb, Imam Download date 03/10/2021 01:08:27 Link to Item http://hdl.handle.net/1834/41191 Pakistan Journal of Marine Sciences, Vol. 28(1), 19-33, 2019. COMPARATIVE STUDY OF SIGNIFICANT MOLLUSCANS DWELLING AT TWO SITES OF JIWANI COAST, PAKISTAN Abdul Ghani, Nuzhat Afsar, Riaz Ahmed, Shees Qadir, Saifullah Saleh, Samroz Majeed and Najeeb Imam Institute of Marine Science, University of Karachi, Karachi 75270, Pakistan. email: [email protected] ABSTRACT: During the present study collectively eighty two (82) molluscan species have been explored from Bandri (25 04. 788 N; 61 45. 059 E) and Shapk beach (25 01. 885 N; 61 43. 682 E) of Jiwani coast. This study presents the first ever record of molluscan fauna from shapk beach of Jiwani. Amongst these fifty eight (58) species were found belonging to class gastropoda, twenty two (22) bivalves, one (1) scaphopod and one (1) polyplachopora comprised of thirty nine (39) families. Each collected samples was identified on species level as well as biometric data of certain species was calculated for both sites. Molluscan species similarity was also calculated between two sites. For gastropods it was remain 74 %, for bivalves 76 %, for Polyplacophora 100 % and for Scapophoda 0 %. Meanwhile total similarity of molluscan species between two sites was calculated 75 %. Notable identified species from Bandri and Shapak includes Oysters, Muricids, Babylonia shells, Trochids, Turbinids and shells belonging to Pinnidae, Arcidae, Veneridae families are of commercial significance which can be exploited for a variety of purposes like edible, ornamental, therapeutic, dye extraction, and in cement industry etc.
    [Show full text]
  • Invertebrate Fauna of Korea
    Invertebrate Fauna of Korea Volume 19, Number 4 Mollusca: Gastropoda: Vetigastropoda, Sorbeoconcha Gastropods III 2017 National Institute of Biological Resources Ministry of Environment, Korea Invertebrate Fauna of Korea Volume 19, Number 4 Mollusca: Gastropoda: Vetigastropoda, Sorbeoconcha Gastropods III Jun-Sang Lee Kangwon National University Invertebrate Fauna of Korea Volume 19, Number 4 Mollusca: Gastropoda: Vetigastropoda, Sorbeoconcha Gastropods III Copyright ⓒ 2017 by the National Institute of Biological Resources Published by the National Institute of Biological Resources Environmental Research Complex, Hwangyeong-ro 42, Seo-gu Incheon 22689, Republic of Korea www.nibr.go.kr All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of the National Institute of Biological Resources. ISBN : 978-89-6811-266-9 (96470) ISBN : 978-89-94555-00-3 (세트) Government Publications Registration Number : 11-1480592-001226-01 Printed by Junghaengsa, Inc. in Korea on acid-free paper Publisher : Woonsuk Baek Author : Jun-Sang Lee Project Staff : Jin-Han Kim, Hyun Jong Kil, Eunjung Nam and Kwang-Soo Kim Published on February 7, 2017 The Flora and Fauna of Korea logo was designed to represent six major target groups of the project including vertebrates, invertebrates, insects, algae, fungi, and bacteria. The book cover and the logo were designed by Jee-Yeon Koo. Chlorococcales: 1 Preface The biological resources include all the composition of organisms and genetic resources which possess the practical and potential values essential to human live. Biological resources will be firmed competition of the nation because they will be used as fundamental sources to make highly valued products such as new lines or varieties of biological organisms, new material, and drugs.
    [Show full text]
  • Elixir Journal
    46093 Nilesh S. Chavan and Rahul N. Jadhav / Elixir Appl. Zoology 105C (2017) 46093-46099 Available online at www.elixirpublishers.com (Elixir International Journal) Applied Zoology Elixir Appl. Zoology 105C (2017) 46093-46099 Survey of Marine Molluscan diversity along the coasts of Shreewardhan (M.S.) Nilesh S. Chavan1 and Rahul N. Jadhav2 Department of Zoology, G.E.Society’s Arts, Commerce & Science College, Shreewardhan-402110,Dist.- Raigad. Department of Zoology, Vidyavardhini’s College of Arts, Commerce and Science, Vasai (W), Maharashtra 401202,India. ARTICLE INFO ABSTRACT Article history: The preliminary survey of marine molluscs at 5 coasts of Shreewardhan namely Received: 23 February 2017; Shreewardhan coast, Shekhadi coast, Dive Agar coast, Sarva coast and Harihareshwar Received in revised form: coast were carried out. The occurrence of 65 species belonging to 52 genera, 35 families, 29 March 2017; 8 orders and 3 classes was noted. The Class- Gastropoda was diverse and represented by Accepted: 4 April 2017; 3 orders, 24 families, 32 genera and 42 species. Class- Scaphopoda was represented by single order, family, genus and species whereas Class- Bivalvia was represented by Keywords 4orders, 10 families, 19 genera and 22 species of molluscs. Among these 65% of the Marine, species are gastropods, 34% are bivalvia and only 1% is Scaphopoda were noted. The Molluscs, present survey indicates that Sarva coast and Shekhadi coast are diversity rich followed Diversity, by Shreewardhan coast, Harihareshwar coast and Dive Agar coast as far as molluscan Shreewardhan coasts. diversity is concerned. © 2017 Elixir All rights reserved. Introduction Sea shells play an important role in geological as well as Area of Research biological processes (Soni and Thakur,2015).
    [Show full text]
  • Karachi, Pakistan
    INT. J. BIOL. BIOTECH., 10 (2): 289-298, 2013. INTERTIDAL FAUNAL ASSEMBLAGES AT LIGHT HOUSE–KEAMARI SEAWALL: MANORA CHANNEL LAGOON (KARACHI, PAKISTAN) Syed Aijazuddin and Sohail Barkati Deparment of Zoology, University of Karachi, Karachi-75270, Pakistan ABSTRACT The intertidal faunal assemblages of the Light house -Keamari Sea wall of Manora channel was studied during the period May 2006 to August 2008. Animal species belonging to following phyla were found: Porifera (1 species), Cnidaria (1 species), Annelida (3 species), Arthopoda (16 species), Mollusca (41 species), Echinodermata (2 species) and Chordata (1 species). Molluscs were the main components of the lagoon studied. Ten most abundant species were Euchelus asper, Nerita dombyi, Thais rudolphi, Thais tissoti, Morula tuberculata, Chiton oceanica, Onchidium daemelli, Megabalanus tintinabulum, Canthrus spirilis and Cellana radiata respectively. More animals were collected in summer months compared to other seasons. Key words: Intertidal, artificial habitats, abundance, Seawalls, Manora channel, Karachi, Pakistan. INTRODUCTION Coastal Urbanization has modified and continues to modify marine shorelines around the world to meet the commercial and residential demands (Bulleri and Chapman, 2010).The hard coastal structures of Pakistan’s coastline (Seawalls, jetties and breakwaters) have turned natural habitat into hard intertidal habitat. The loss of intertidal habitats have implications for a variety of species that utilize them for shelter, spawning, nesting, breeding and food (Lee
    [Show full text]
  • Atoll Research Bulletin No. 383 Ogasawara (Bonin
    ATOLL RESEARCH BULLETIN NO. 383 DIES ON THE BIO OGASAWARA (BONIN) ISLANDS I. LIST OF COLLECTED SPECIES WITH COMMENTS ON SOME SPECIES Y IJRA, SNIIR00 A, AND VASUO KONDO ISSUED BY NATIONAL MUSEUM OF NATURAL HISTORY SMITHSONIAN INSTITUTION WASHINGTON, D.C., U.S.A. JANUARY 1993 STUDIES ON THE BIOLOGY AND ECOLOGY OF THE INTERTIDAL ANlMALS OF CHICHlJlMA ISLAND IN THE OGASAWARA (BONIN) lSLANDS I. LIST OF COLLECTED SPECIES WITH COMMENTS ON SOME SPECIES AKIRA ASAKURA*, SHIROU NISHIHAMA**, AND YASUO KONDO*"" The Ogasawara (Bonin) Islands are subtropical, oceanic islands, located in the north west Pacific (Lat. 27" N, Long. 142" E). The nearest landmass is the Japan Islands situated ca. 1000 km to the north (Fig. 1). Many endemic species have been found in its terrestrial (Ono & Masuda, 1981; Ono & Sugawara, 1981; Kobayashi, 1978; Habe, 1969; Habe et al., 1978) and marine environments (Okutani, 1986; Shigei, 1970; Hirohito, 1974; Habe et al., 1978; Imajima 1970; Sugano, 1973; Ooishi, 1970; Kurata et al., 1975). The authors visited Chichijima Island of the Ogasawara Islands three times, in April 1986, May 1989, and June 1990. The purpose of the visits was to study the biological and ecological aspects of the intertidal animals there, which have received little attention to date. In this paper, a list of species collected through those trips is presented, which includes one new species of a hermit crab, Pagurus insulae in Asakura (1991a), two new subspecies of gastropods, Notoacmea schrenckii boninensis in Asakura & Nishihama (1987a) and Monodonta perplexa boninensis in Asakura & Nishihama (1987b), and one new record of a hermit crab, Calcinus guarnensis Wooster, from Japan (Asakura, 1991b).
    [Show full text]
  • DNA Barcoding Reveal Patterns of Species Diversity Among
    www.nature.com/scientificreports OPEN DNA barcoding reveal patterns of species diversity among northwestern Pacific molluscs Received: 04 April 2016 Shao’e Sun, Qi Li, Lingfeng Kong, Hong Yu, Xiaodong Zheng, Ruihai Yu, Lina Dai, Yan Sun, Accepted: 25 August 2016 Jun Chen, Jun Liu, Lehai Ni, Yanwei Feng, Zhenzhen Yu, Shanmei Zou & Jiping Lin Published: 19 September 2016 This study represents the first comprehensive molecular assessment of northwestern Pacific molluscs. In total, 2801 DNA barcodes belonging to 569 species from China, Japan and Korea were analyzed. An overlap between intra- and interspecific genetic distances was present in 71 species. We tested the efficacy of this library by simulating a sequence-based specimen identification scenario using Best Match (BM), Best Close Match (BCM) and All Species Barcode (ASB) criteria with three threshold values. BM approach returned 89.15% true identifications (95.27% when excluding singletons). The highest success rate of congruent identifications was obtained with BCM at 0.053 threshold. The analysis of our barcode library together with public data resulted in 582 Barcode Index Numbers (BINs), 72.2% of which was found to be concordantly with morphology-based identifications. The discrepancies were divided in two groups: sequences from different species clustered in a single BIN and conspecific sequences divided in one more BINs. In Neighbour-Joining phenogram, 2,320 (83.0%) queries fromed 355 (62.4%) species-specific barcode clusters allowing their successful identification. 33 species showed paraphyletic and haplotype sharing. 62 cases are represented by deeply diverged lineages. This study suggest an increased species diversity in this region, highlighting taxonomic revision and conservation strategy for the cryptic complexes.
    [Show full text]
  • Studies on the Biology and Ecology of the Intertidal Animals of Chichijima
    The malacologicalsocietymalacological society ofJapanof Japan Hes VENUS (Jap. Jour. Malac) VoL 46, No. 4 (1987):lg2-193 4xSMXk 5e R o ma ma ur ut tbu ssA- ll . paimEpt 1- )lf v v 7 7t if I o:Ex . a> pt . v i X reEk J6ft as *H *t pteft bl A \･th az ± fis (YL{･1･1]k\X"taiftEXwtnt) Studies on the Biology and Eeology of the Intertidal Animals of Chiehijima Island in the Ogasawara (Bonin) Islands-II. Description,Distribution,SizeStrueturein the Population, of and Allometric Growth the Limpet, Notoacmea schrenckii boninensisn. subsp." Akira AsAKuRA and Shiro NIsHIHAMA (Amakusa Marine Biologieal Laboratory, Kyushu University, Tomioka, Reihoku, Amakusa-gun, Kumamoto-ken, Japan, 863-25) Abstract: A new subspecies of Acmaeidae, Notoacmea sehrenekii boninensis, is des¢ ribed, and general biology of this limpet is observed. At Chiehijima Island of the Ogasawara Islands, this limpet was colleeted from underside ef boulders in the intertidal zone of the wave-exposed beaches. The shell size is smaller than that of N. schrenckii sehrenckii (Lischke) from Japanese temperate region, The shell is green color with radially seattered lines and V-shape patteTn, and is wider and the apex situated more anteriorly than that of IV. sehrenehii schrenckii. They mainly inhabit the rniddle intertidal zone and were also distri- buted in lower number in the lower intertidal zone, No individual was found in a sheltered boulder beach, rock platforms, or tide pools. Introduction Noteacmea schrenckii (Lischke) is a small limpet common to the intertidal zones of roeky shores in Japan, Formosa, and China (Habe and Okutani, 1975; Habe and Kosuge, 1967; Nakamura, 1986).
    [Show full text]
  • Shell's Field Guide C.20.1 150 FB.Pdf
    1 C.20.1 Human beings have an innate connection and fascination with the ocean & wildlife, but still we know more about the moon than our Oceans. so it’s a our effort to introduce a small part of second largest phylum “Mollusca”, with illustration of about 600 species / verities Which will quit useful for those, who are passionate and involved with exploring shells. This database made from our personal collection made by us in last 15 years. Also we have introduce website “www.conchology.co.in” where one can find more introduction related to our col- lection, general knowledge of sea life & phylum “Mollusca”. Mehul D. Patel & Hiral M. Patel At.Talodh, Near Water Tank Po.Bilimora - 396321 Dist - Navsari, Gujarat, India [email protected] www.conchology.co.in 2 Table of Contents Hints to Understand illustration 4 Reference Books 5 Mollusca Classification Details 6 Hypothetical view of Gastropoda & Bivalvia 7 Habitat 8 Shell collecting tips 9 Shell Identification Plates 12 Habitat : Sea Class : Bivalvia 12 Class : Cephalopoda 30 Class : Gastropoda 31 Class : Polyplacophora 147 Class : Scaphopoda 147 Habitat : Land Class : Gastropoda 148 Habitat :Freshwater Class : Bivalvia 157 Class : Gastropoda 158 3 Hints to Understand illustration Scientific Name Author Common Name Reference Book Page Serial No. No. 5 as Details shown Average Size Species No. For Internal Ref. Habitat : Sea Image of species From personal Land collection (Not in Scale) Freshwater Page No.8 4 Reference Books Book Name Short Format Used Example Book Front Look p-Plate No.-Species Indian Seashells, by Dr.Apte p-29-16 No.
    [Show full text]
  • CJ Greyling Orcid.Org/0000-0001-8505-8583
    Trophic transfer of metals and OCP’s in organisms from a warm temperate and a subtropical intertidal rocky shore CJ Greyling orcid.org/0000-0001-8505-8583 Dissertation submitted in fulfilment of the requirements for the degree Master of Science in Environmental Sciences at the North-West University Supervisor: Prof V Wepener Co-supervisor: Prof Y Ikenaka Graduation May 2018 23599235 Acknowledgements Writing a dissertation takes determination and patience and most of all support. This research would not have been completed without the contributions and assistance of many. I want to extend my greatest appreciation to the following people and institutions: To my supervisor, thank you for providing me with the opportunity to do research in a field that I love. Thank you for your support during fieldtrips and in the laboratory, for all the knowledge and encouragement to finish this project and all the long hours of reviewing. The NWU Water Research Group for funding of the project and every opportunity to further my knowledge and passion in this field. Prof. Mayumi Ishizuka, Prof. Yoshinori Ikenaka, Dr. Shouta Nakayama, Dr. Yared Beyene, Ichise-san, Ishii-san, Aksorn-san, Mizukawa-san, Lesa and everyone from the Toxicology Laboratory at the Graduate School of Veterinary Medicine Hokkaido University, for their hospitality, assistance, the opportunities and organization to analyse samples for stable isotope analysis. Prof. van Vuren for advice and the organization of my travels to Japan. Claire Volschenk (neé Edwards) for her assistance, advice and early mornings in Japan. Prof. Rialet Pieters, Tash Vogt, Suranie Horn and Nico Wolmarans for their assistance during the organic extractions.
    [Show full text]