G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

Molecular Immunology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Molecular Immunology

j ournal homepage: www.elsevier.com/locate/molimm

CD100 and plexins B2 and B1 mediate monocyte-endothelial cell

adhesion and might take part in atherogenesis

a,b a a a,b,c

Maria Carolina A. Luque , Paulo S. Gutierrez , Victor Debbas , Jorge Kalil ,

d,∗

Beatriz S. Stolf

a

Heart Institute of São Paulo (InCor), HC-FMUSP, São Paulo, SP, Brazil

b

Clinical Immunology and Allergy, Department of Clinical Medicine, University of São Paulo Medical School—HC-FMUSP, São Paulo, SP, Brazil

c

Institute for Investigation in Immunology – INCT – National Institute of Science and Technology, São Paulo, SP, Brazil

d

Department of Parasitology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, SP, Brazil

a r t i c l e i n f o a b s t r a c t

Article history: Leukocyte migration is essential for the function of the . Their recruitment from the

Received 28 April 2015

vessels to the tissues involves sequential molecular interactions between leukocytes and endothelial

Received in revised form 23 June 2015

cells (ECs). Many adhesion molecules involved in this process have already been described. However,

Accepted 22 July 2015

additional molecules may be important in this interaction, and here we explore the potential role for

Available online xxx

CD100 and plexins in monocyte-EC binding.

CD100 was shown to be involved in platelet-endothelial cell interaction, an important step in athero-

Keywords:

genesis and thrombus formation. In a recent work we have described CD100 expression in monocytes

Monocyte adhesion

SEMA4D and in and foam cells of human atherosclerotic plaques. In the present work, we have iden-

Plexins tified plexin B2 as a putative CD100 in these cells. We have detected CD100 expression in the

Atherosclerosis endothelium as well as in in vitro cultured endothelial cells. Blocking of CD100, plexin B1 and/or B2 in

adhesion experiments have shown that both CD100 and plexins act as adhesion molecules involved in

monocyte-endothelial cell binding. This effect may be mediated by CD100 expressed in both cell types,

probably coupled to the receptors endothelial plexin B1 and monocytic plexin B2. These results can bring

new insights about a possible biological activity of CD100 in monocyte adhesion and atherosclerosis, as

well as a future candidate for targeting therapeutics.

© 2015 Published by Elsevier Ltd.

1. Introduction inflammatory diseases such as atherosclerosis. In fact, atheroscle-

rosis is characterized by monocyte and accumulation

Immune system functions depend largely on leukocyte in the vascular intima of the vessels (van Gils et al., 2009).

migration from the vessels to the tissues, which involves sequen- Endothelial cell (EC) activation occurs in the presence of proathero-

tial molecular interactions between leukocytes and endothelial genic insults such as oxLDL, proinflammatory , oxidative

cells (ECs) (Imhof and Aurrand-Lions, 2004). While transient stress, hypertension, hyperglycemia, aging, and shear stress (Sun

leukocyte–endothelial cell interactions are mediated by the et al., 2013) and result in the increase of the mentioned adhesion

endothelial E- and P-selectins and leukocyte L-selectin and PSGL- molecules on the surface of the arteries (Hansson and Hermansson,

1, firm adhesion relies on the binding of activated to 2011). Concurrently, activated monocytes and T lymphocytes

endothelial Intercellular Adhesion Molecule 1 (ICAM-1) and Vas- express cell surface molecules that interact with the endothelia and

cular Cell Adhesion Molecule (VCAM-1) (Heemskerk et al., 2014). mediate their transmigration into the arterial wall (Mehta et al.,

Because of their ability to differentiate into phagocytes and 1998).

antigen-presenting cells, monocytes have important roles in CD100/SEMA4D belongs to the class 4 of the pro-

tein family, and has important roles in the nervous and immune

systems. It is expressed by the majority of hematopoietic cells (B,

T, NK and myeloid cells), and its levels generally increase after cell

Abbreviations: CD100, cluster of differentiation 100; CD72, cluster of differenti-

activation (Delaire et al., 1998). In T lymphocytes it is expressed

ation 72; SEMA4D, semaphorin-4D.

∗ as membrane and soluble forms with distinct functional properties

Corresponding author. Tel.: +55 1130917271; fax: +55 1130917417.

E-mail address: [email protected] (B.S. Stolf). (Delaire et al., 1998). T cells exhibit the highest levels of CD100 (Hu

http://dx.doi.org/10.1016/j.molimm.2015.07.028

0161-5890/© 2015 Published by Elsevier Ltd.

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

2 M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx

et al., 2008; Ji et al., 2009), followed by platelets (Zhu et al., 2007, School of Medicine (controls with no vascular disease). Researchers

2009) and monocytes (Bougeret et al., 1992; Luque et al., 2013). involved in the project were present during heart removal from

Human CD100 was shown to influence migration and the donor and received a fresh fragment of approximately 5 cm

production in monocytes (Chabbert-de Ponnat et al., 2005), and is of the carotid that would not be used for transplantation. The

involved in activation and survival. It has also been artery fragments were fixed for 24 or 48 h in buffered solution

shown to participate in cell-to-cell communication and adhesion with 10% formalin for posterior inclusion in paraffin and prepa-

in different contexts (Mizrahi et al., 2007; Witherden et al., 2012; ration of tissue sections (∼7 ␮m). Donor’s family had previously

Zhu et al., 2007). Distinct receptors have been identified for CD100, signed an authorization form specific for this project donating the

depending on the cell type and organism. In humans, plexin B1 is artery fragment to the “Laboratory of Immunology, Heart Institute”.

the CD100 high affinity receptor in a broad range of non-immune Collection of all human samples was approved by the Heart Insti-

cells (Tamagnone et al., 1999). In the immune system plexin B1 is tute Scientific Committee and CAPPesq (Hospital das Clinicas Ethics

expressed only in follicular dendritic cells, bone marrow stromal Committee).

cells and (at lower levels) in activated T cells, but not in mono-

cytes, macrophages, other dendritic cells and quiescent T and B

2.3. Cell culture

lymphocytes (Ishida et al., 2003; Granziero et al., 2003). In fact,

no high affinity receptor for CD100 was precisely identified in

PBMCs were obtained from healthy subjects by density gradient

human monocytes. Plexin B2 has been described in mouse ger-

centrifugation with Ficoll (Invitrogen, Carlsbad, CA) and mono-

minal center B cells (Yu et al., 2008) and in mouse macrophages,

cytes were purified by positive selection using anti-CD14 magnetic

conventional and plasmacytoid dendritic cells, and its cDNA was

beads, as recommended by the manufacturer (Miltenyi Biotec,

present in human myeloid cells (Roney et al., 2011).

Germany). Purity of monocytes was above 98% as verified by FACS

In atherosclerosis, CD100 was shown to be involved in platelet-

analysis. Human T lymphocytes were purified by negative selection,

endothelial cell interaction, an important step in atherogenesis and

using Pan T Isolation kit (Miltenyi Biotec, Germany). THP-1 mono-

thrombus formation (Zhu et al., 2007). In the mice model the lack of

cytes (ATCC, Manassas, VA) and PBMC monocytes, macrophages

CD100 reduces platelet hyperactivity, therefore conferring protec-

and foam cells were cultured in RPMI-1640 (Gibco, NY) containing

tion against atherosclerosis (Zhu et al., 2007). Sema4D−/−ApoE−/−

10% calf serum (Hy Clone, Utah), 10 mM HEPES, 1 mM glutamine,

mice present decreased lipid staining, macrophage infiltration and

200 U/ml penicillin, 2 mg/ml streptomycin, 1 mM sodium pyru-

intimal neovascularization in the aortic plaques (Yukawa et al.,

vate. T lymphocytes were cultured in DMEM (Gibco, NY) with

2010). A recent work from our group has shown CD100 expres-

10% calf serum (Hy Clone, Utah), 10 mM HEPES, 1 mM glutamine,

sion in human atheromas, more specifically in plaque macrophages

200 U/ml penicillin, 2 mg/ml streptomycin, 1 mM sodium pyru-

and foam cells (Luque et al., 2013). In vitro cultured monocytes (Hu

vate and IL-2, IL-7 e IL-15 (R&D, Minneapolis, MN) 40 U/ml each.

et al., 2008) and differentiated macrophages and foam cells were

HUVECs (human umbilical vein endothelial cells) (ATCC, Manas-

shown to express CD100, mainly under pro-inflammatory stimuli

sas, VA) were cultured in 199 medium (Earle’s) supplemented with

(Luque et al., 2013). In addition, we have shown that CD100 reduces

0.6 mg/ml penicillin, 60 mg/ml streptomycin, 2 mM glutamine,

oxLDL incorporation by macrophages by decreasing CD36 expres-

4

20 mM HEPES and 10% FCS on coverslips in 24-well plates (5 × 10

sion, pointing to a specific antiatherogenic effect of the molecule

cells/well in 500 ␮l) for immunocytochemistry experiments or in 6

(Luque et al., 2013).

5

well plates (4 × 10 cells/well in 2 ml of medium) for qRT-PCR and

Since adherence of monocytes to endothelium is among the ear-

Western blot experiments. For activation, HUVECs were cultivated

liest events in atherogenesis (Ross, 1993) and since CD100 acts

in 6-well plates until confluence and then incubated with 1 ng/ml

as an adhesion molecule in platelet-EC interaction (Zhu et al., ◦

LPS (Sigma) and 10 ng/ml TNF-␣ (Peprotech) for 6 h at 37 C and 5%

2007), we analyzed whether CD100 could also participate in

CO2.

monocyte-endothelial cell adhesion. We show here for the first

time that CD100 is expressed in endothelial cells, and demon-

strate the expression of its receptor plexin B2 in human monocytes,

2.4. Macrophage differentiation and foam cell formation

macrophages and foam cells. We also show that both CD100 and

plexins B1 and B2 are important for adhesion between monocytes

All procedures were done as previously mentioned (Luque et al.,

and endothelial cells.. CD100 could be part of the wide range of

2013). Briefly, macrophages were differentiated from PBMC mono-

adhesion molecules that promote cell-to-cell contact in monocyte-

cytes with 20 ng/ml M-CSF (Peprotech, Rocky Hill, NJ) for 72 h,

EC interaction, and its coupling to plexins could mediate the arrest

and were further differentiated into foam cells by incubation with

and migration of blood monocytes into the subendothelial space,

oxLDL (50 ␮g/ml) for 72 h.

outlining another important role for CD100 in atherogenesis.

2.5. Immunohistochemistry

2. Material and methods

Tissue sections were submitted to antigen recovery with Tris-

2.1. Ethics statement

EDTA buffer in Pascal pan. The sections were blocked with Protein

Block (DAKO, Glostrup, Denmark) and incubated with the primary

Informed written consent was obtained from each ◦

in PBS 1% BSA for 18 h at 4 C. Anti-CD100 was purchased

patient/family before collection of samples and the study protocol

from BD Transduction (San Jose, CA). The samples were then incu-

conforms to the ethical guidelines of the Hospital das Clínicas

bated with reagent A (LSAB-DAKO, Glostrup, Denmark) for 1 h and

(HC—University of São Paulo School of Medicine) Human Research ◦

with reagent B (LSAB) for 30 min, both at 37 C. The glass slides were

Committee.

next incubated with DAB (DAKO, Glostrup, Denmark) for 1 min 30 s

and in Scott water for 30 s. The tissue sections were then dehy-

2.2. Human specimen collection drated through passages in alcohol and xylol and mounted with

Entellan (Merck, Darmstadt, Germany). The digitalization of the

Normal carotid samples were obtained from donors of the images was made with the program AxioVision (Carl Zeiss Inc., Jena,

Organ Transplantation of the Hospital das Clínicas of the São Paulo Germany).

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx 3

2.6. Immunofluorescence CD100; anti-CD100 + anti-plexin B1 + anti-plexin B2 + recombinant

CD100). Three different control conditions were assayed in the four

Cells were cultured in coverslips inside 24 well plates for adhe- experiments. In experiment 1, the control used was an unrelated

sion. Medium was then aspirated, and coverslips were washed purified murine IgG; in experiments 2 and 3 an anti-Fc was used

three times with PBS. Cells were fixed with 2% paraformaldehyde in conditions 3–6 and total murine sera in control; and in exper-

◦

for 30 min at RT or for 15 min at 37 C. After additional washing iment 4 we used as control goat total IgG. The control conditions

steps with PBS the cells were permeabilized in PBS 0.1% Nonidet of the four experiments had similar results and thus are plotted

◦

P40 for 30 min at RT or 15 min at 37 C. Cells were blocked for 1 h at together in the graph. After this period, THP-1 cells were seeded

room temperature with Protein Block (DAKO, Glostrup, Denmark) on stimulated HUVECs (24-well plates, described above) and kept

◦

and incubated with anti-CD100 (BD Transduction San Jose, CA), in an incubator with 5% CO2 at 37 C for 45 min, after which each

◦

anti-plexin B1 (REF) or anti-plexin B2 (REF) in PBS 1% BSA at 4 C well was washed with PBS for 7 times. The analysis was performed

for 18 h. The secondary (Alexa 660 and Alexa 488 Invi- with a Zeiss fluorescence microscope and images acquired with

◦

trogen, Carlsbad, CA) were added for 90 min at 4 C. The glass slides AxioVision (Carl Zeiss Microscopy, Germany). Each blocking condi-

were mounted with DAPI (Sigma, St. Louis, MO) (10 ␮g/ml in glyc- tion and control treatment was performed in triplicate (three wells)

erol: PBS 1:1) and analyzed in the confocal microscope Zeiss laser and the number of THP-1 cells that firmly bound to HUVECs was

scanning. counted in six fields using fluorescent microscopy. Results were

expressed as ratios of adhesion (numbers of adhered monocytes in

2.7. Real time RT-PCR treated/untreated condition) for the seven blocking conditions and

control treatment relative to no treatment.

RNA extraction, cDNA preparation and amplification were per-

formed as described in Luque et al. (2013). The primers employed 2.10. Statistical analysis

are listed below.

Primers: Data from different conditions/treatments were compared

either using t test (when two sample types were compared) or

•  

CD100(F):5 CGAGAAGCAGCATGAGGTGTATTG3 . ANOVA followed by Bonferroni post test. Differences were consid-

•  

≤ CD100(R): 5 CGGATGTAGTTGAGGCACTCTGTC3 . ered significant when p 0.05. •   GAPDH(F): 5 TGGTCTCCTCTGACTTCAACA3 .

•  

GAPDH(R): 5 AGCCAAATTCGTTGTCATACC3 . 3. Results

2.8. Western blot 3.1. CD100 is expressed in normal human endothelial cells

␮

Cultured cells were washed with PBS and lysed with 120 l Monocyte adhesion to endothelial cells is a crucial step in several

of lysis buffer (1% Nonidet P-40 (v/v) detergent buffer contain- inflammatory dysfunctions such as atherogenesis. The identifica-

ing 50 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, tion of molecules that participate in the adhesion process may help

◦

50 U/ml aprotinin and 1 mM leupeptin) for 30 min at 4 C. Cell in the control of exacerbated cell recruitment and the consequent

scrapers were used to help remove adherent cells and to facil- accumulation of macrophages and lipids that characterize human

itate lysis. Lysates were collected and centrifuged at 12,000 × g atheromas.

to remove cellular debris. Protein concentration was determined In order to evaluate a possible role for CD100 in monocyte-EC

␮

using BCA (Pierce, IL). 30 g of protein were separated by SDS-PAGE adhesion, we first confirmed the expression of CD100 and plexin

and electro transferred to nitrocellulose membranes (Amersham, B1 in EC of normal carotid tissue sections. CD100-positive label-

France). The membranes were blocked and incubated with the pri- ing was observed in endothelial cells from normal carotids tissue

mary antibody anti-CD100 (BD Transduction, CA), or anti-plexin B1 (Fig. 1B), confirming previous findings from our group. We observed

◦

or anti-plexin B2 (Santa Cruz, CA) overnight at 4 C. After washing, positive plexin B1 staining in the endothelium of normal arter-

the membranes were incubated with anti-mouse HRP-conjugated ies (Fig. 1C) and of vessels of the vasa vasorum (in the adventitial

secondary antibody for 1 h at room temperature. Blots were devel- layer, data not shown), as expected. Negative control for immuno-

oped using chemiluminescence detection system ECL (Amersham, histochemistry was prepared with the same normal carotid artery

Paris, France) followed by autoradiography on x-ray film (Kodak, using only secondary antibody (peroxidase conjugated) (Fig. 1A).

Cedex, France) and scanning densitometry. The same blots were HUVECs also presented strong labeling for CD100 by immunofluo-

␤

incubated with anti- - mouse anti-human antibody (Sigma, resce (Fig. 1E), and the lack of labeling by the secondary fluorescent

St. Louis, MO) and developed as described. antibody (Fig. 1H) validated the specificity of CD100 expression.

2.9. Adhesion 3.2. CD100 mRNA and protein in HUVECs

Adhesion protocol was adapted from Hwang et al. (2003). We then evaluated whether CD100 mRNA would increase after

4

Briefly, HUVECs were cultured in 24-well plates (5 × 10 cells/well) endothelial cell activation, as seen in monocytes. We compared

in 199 medium (Earle’s) supplemented with 10% FCS until mCD100 expression in endothelial cells (HUVECs) activated with

70–80% confluence and stimulated as described in the Cell Cul- LPS and TNF-␣ to non-stimulated cells and observed that CD100

◦ 5

ture section for 6 h at 37 C. THP-1 cells (5 × 10 /ml RPMI) expression decreased upon HUVEC activation (Fig. 2A).

 

were labeled with 1 ␮g/␮l BCECF-AM (2 ,7 -bis-(2-carboxyethyl)- CD100 protein was also evaluated in non-stimulated and in LPS

◦

5-(and-6)-carboxyfluorescein, Invitrogen, Carlsbad, CA) at 4 C for and TNF-␣ activated HUVECs and in T lymphocytes (used as positive

1 h. After labeling, cells were centrifuged (500 × g for 10 min) and controls). We detected two bands of approximately 150 kDa and

ressuspended in RPMI 10% FCS with each of the following treat- 120 kDa, both in activated and in non-activated cells (Fig. 2B). These

◦

ments for 10 min at 4 C (all in a final concentration of 10 ␮g/ml, in band sizes are similar to those already described in Jukart cells

triplicate): anti-CD100 (Abnova); anti-plexin B1 (Santa Cruz), anti- (Elhabazi et al., 2001) and monocytes, macrophages and foam cells

plexin B2 (Santa Cruz), recombinant CD100 (Abnova), anti-plexin (Luque et al., 2013), and confirmed CD100 expression in endothe-

B1 + anti-plexin B2; anti-plexin B1 + anti-plexin B2 + recombinant lial cells. Non activated HUVECs express significantly higher levels

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

4 M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx

Fig. 1. CD100 and plexin B1 are expressed in carotid arteries and in in vitro cultured HUVECs. Immunohistochemistry of normal carotid artery tissue sections. Negative

control-normal carotid incubated with secondary peroxidase labeled antibody (A), CD100 (B) and plexin B1 (C) labeling in normal carotid. Immunofluorescence of cultured

HUVECs showing blue nuclei in DAPI (D), CD100 staining in Alexa660 (red, E) co-localization of markers (F); negative control employing only Alexa 660 secondary antibody

showing blue nuclei (G), no labeling with secondary antibody (H) and merge+ interface contrast image (I). Scale bars: 20 ␮m. (For interpretation of the references to color in

this figure legend, the reader is referred to the web version of this article.)

of CD100 than their activated counterpart, consistent with Plexin B1 was detected as a single band of 240 kDa only in HUVECs,

expression results (Fig. 2C). In contrast, T lymphocytes activated but was absent in all other samples (Fig. 5A), consistent with the

with CD3/CD28 showed increase in CD100 protein, as expected. immunofluorescence data (Fig. 4). Plexin B2 was detected as two

bands of approximately 300 kDa and 200 kDa, representing the pre-

cursor and active forms of protein, respectively (Fig. 5B). For PBMC

3.3. Plexin B2 is expressed in PBMC monocytes, macrophages and

monocytes (activated or not), the band of 200 kDa was present,

foam cells

while for THP-1 monocytes, only the 300 kDa band was observed.

No significant difference is observed in plexin B2 expression in

Although previous works have shown that human monocytes

PBMC monocytes upon IFN-␥ activation (Fig. 5C), and THP-1 mono-

and macrophages respond to CD100, no CD100 receptor was

cytes express the highest levels of plexin B2. The lack of modulation

undoubtedly described in these cells. The expression of two puta-

of plexin B2 by a proinflammatory stimulus agrees with previ-

tive CD100 receptors, plexins B1 and B2, was evaluated in PBMC

ous observations that plexin B2 RNA was not modulated by LPS

monocytes, macrophages and foam cells. Isolated monocytes were

in murine macrophages (Roney et al., 2011).

differentiated in macrophages and foam cells and incubated with

anti-plexin B1 or anti-plexin B2 and anti-CD68 in double staining

experiments. We observed the same labeling pattern for the three 3.4. CD100 and plexins participate in monocyte-endothelial cell

cell types: strong co-localized plexin B2 and CD68 labeling (Fig. 3), adhesion

while labeling for plexin B1 was lacking (Fig. 4). These experiments

suggest that plexin B2 may be the CD100 receptor in these cells. Considering that CD100 and plexins B1 and B2 are known to

We also assessed plexin B1 and B2 protein expression in THP- act as adhesion molecules in several systems, our hypothesis was

1 and PBMC monocytes stimulated or not with IFN-␥. HUVECs that they could also act as adhesion molecules between monocytes

were used as positive controls to plexin B1 (Basile et al., 2004). and activated endothelial cells. To address this issue we analyzed

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx 5

Fig. 2. Stimulated HUVECs express less CD100 than control (unstimulated) cells. HUVECS were stimulated with LPS and TNF-␣ for 6 h. CD100 expression was analyzed in

terms of RNA and protein. CD100 transcripts were quantified by Real Time RT-PCR and expressed as fold relative to unstimulated cells, using housekeeping GAPDH gene as

normalizer (A). Mean and SD of 3 distinct experiments. ** p < 0.0001, t-test. CD100 protein was analyzed by Western blot in HUVECs and T cells CD100 and ␤-actin (normalizer)

expression in HUVECs unstimulated or stimulated (stim) with TNF-␣ and LPS for 6 h; and in total T cells (purified by MACS Pan T kit) unstimulated or stimulated (stim) with

CD3/CD28 beads (B). Representative of 3 experiments. Densitometry of CD100 and ␤-actin protein bands, showing the 150 kDa and 120 kDa band ratio as well as the sum of

the two CD100/␤-actin bands for each cell type (C). Mean and standard deviation of 3 experiments (*** p < 0.001, two-way ANOVA).

the binding of labeled THP-1 monocytes to HUVECs pre-activated involved in the interaction of these two cell types. Since one of the

with LPS and TNF-␣ blocking CD100 and/or plexins. THP1 are usu- triggering events of atherosclerosis is the recruitment of monocytes

ally employed in this kind of experiment (Hwang et al., 2003; to the artery wall and their cross through the luminal endothelium,

Arita-Okubo et al., 2015) for their similarities with PB monocytes we suggest that CD100 may act in this earliest phase of atherogen-

(Auwers, 1991). Since both THP1 and PB monocytes express CD100 esis as an adhesion molecule involved in monocyte-endothelial cell

and plexin B2 but not plexin B1, we employed this lineage in adhe- binding.

sion experiments. We observed CD100 expression in vascular endothelium as well

In Fig. 6, we show the ratios of adhesion (numbers of adhered as in in vitro cultured endothelial cells. Interestingly, both gene and

monocytes in treated/untreated condition) observed for the seven protein expression experiments showed that endothelial cell stim-

blocking conditions and control treatment relative to no treat- ulation with activating cytokines (LPS and TNF-␣) did not result

ment. We see that conditions employing anti-plexin and/or CD100 in CD100 augmentation, contrarily to the observed for monocytes

are the ones that blocked the interaction THP-1/HUVEC more (Hu et al., 2008; Luque et al., 2013) and T cells (Bougeret et al., 1992

efficiently, especially condition with anti-plexins + CD100 recom- and this work). It is possible that LPS and/or TNF-␣ concentrations

binant human protein. The blocking effect was very similar to used were high when compared to the concentrations normally

the obtained with the use of anti-plexin B2 alone. Anti-CD100 present in the context of atherosclerosis, and that in vivo effects

presented a blocking effect of lower magnitude. In fact, the best may differ from those observed in these experiments. It is also pos-

blocking conditions were mediated by anti-plexin antibodies. sible that synergistic effects with other immune or non-immune

stimuli in vivo might increase CD100 expression in endothelial cells.

4. Discussion Indeed, CD100 expression was described in HUVECs under hypoxic

conditions (Sun et al., 2009), showing its important influence on

In a previous work we had shown that CD100 was expressed tumor growth and vascularization.

in ECs, and we now show that it acts as an adhesion molecule in and plexins are expressed in a variety of tis-

monocyte-endothelial cell binding. CD100 receptor plexin B2 was sues outside the , where their expression was first

found to be expressed in monocytes, macrophages and foam cells. described (Raper, 2000). Most of semaphorins biological effects are

These results suggest that CD100 coupling to either plexin B1 (on achieved through activation of plexins (Tamagnone et al., 1999)

endothelial cells) or plexin B2 (on monocytes) could be an impor- or through interaction with CD72. CD72 is a low affinity receptor

tant surface molecule “duo” along with selectins and integrins, also widely expressed in lymphoid tissues, while plexin B1 expression

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

6 M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx

Fig. 3. Monocytes and in vitro differentiated macrophages and foam cells express plexin B2. Double staining immunofluorescence of PBMC monocytes (A–D), macrophages

(E–H) and foam cells (I–L). (B), (F) and (J) Plexin B2 (red, Alexa 660); (C), (G) and (K) CD68 (green, Alexa 488). (A), (E) and (I) Blue nuclear staining with DAPI; (D), (H) and (L)

co-localization. Scale bars: 5 ␮m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 4. Monocytes and in vitro differentiated macrophages and foam cells do not express plexin B1. Double staining immunofluorescence of PBMC monocytes (A–D),

macrophages (E–H) and foam cells (I–L). (B), (F) and (J) plexin B1 (red, Alexa 660); (C), (G) and (K) CD68 (green, Alexa 488). (A), (E) and (I) Blue nuclear staining with DAPI;

(D), (H) and (L) co-localization. Scale bars: 5 ␮m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx 7

Fig. 5. PBMC monocytes express plexin B2. Plexin B1 and ␤-actin expression in HUVECs, PBMC monocytes (mono), IFN-␥ activated (for 24 h) PBMC monocytes (mono IFN-␥)

and THP-1 monocytes (THP-1) (A). Plexin B2 and ␤-actin expression in PBMC monocytes (mono), IFN-␥ activated (24 h) PBMC monocytes (mono IFN-␥) and THP-1 monocytes

(THP-1) (B). Densitometry of plexin B2 and ␤-actin bands, showing plexin B2/␤-actin ratio for each cell type (C). Mean and standard deviation of 3 independent experiments.

is restricted to non-lymphoid tissues (Kumanogoh et al., 2000; adhesion molecule in these cells, possibly binding to endothelial

Tamagnone et al., 1999). Plexin B2 was first described in the ner- CD100. The lack of plexin B1 in these myeloid cells was consis-

vous system (Hirschberg et al., 2009), but was later described to tent with previous data on monocytes (Chabbert-de Ponnat et al.,

participate in the interaction between ␥␦ T cells (CD100) and kera- 2005). Interactions between plexins (especially B1) and CD100 have

tinocyte (plexin B2) (Witherden et al., 2012) and to be expressed in been described to mediate adhesion and cell recruitment in dif-

endocrine organs and lungs in mice (Zielonka et al., 2010). Plexin B2 ferent settings (Basile et al., 2004; Kruger et al., 2005; Li et al.,

is abundant in mouse B cells from T cell dependent germinal centers 2009; Zhu et al., 2007). CD100 from lymphocytes and cells

(Yu et al., 2008) and is expressed in mouse macrophages, conven- guide endothelial cells to the tumor and induce by

tional and plasmacytoid dendritic cells (Roney et al., 2011). Plexin binding to EC plexin B1 (Basile et al., 2004). Additionally, activa-

B2 cDNA is present in human myeloid cells (Roney et al., 2011), but tion of CD45 (which also interacts with CD100) in T lymphocytes

its protein and the identity of its ligand were not analyzed. induces the production of adhesion molecules (Bernard et al., 1994)

The present work is the first to describe plexin B2 protein in and the release of soluble CD100, creating a permissive environ-

human monocytes, macrophages and foam cells, and its role as an ment for cell interaction and aggregation (Elhabazi et al., 2003). In

Fig. 6. Blocking of plexins B1 and B2 reduces adhesion between monocytes and endothelial cells. Ratio between the numbers of adhered monocytes after different blocking

conditions and control treatment relative to no treatment. Means and standard deviations of 4 independent experiments. Blocking conditions are shown below the histogram:

anti-CD100; anti-plexin B1; anti-plexin B2; recombinant human CD100; anti-plexin B1 + anti-plexin B2; anti-plexin B1 + anti-plexin B2 + recombinant human CD100; anti-

CD100 + anti-plexin B1 + anti-plexin B2 + recombinant human CD100. Control condition: see text for details * p < 0.05 relative to condition 8, ANOVA.

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

8 M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx

murine models of experimental glomerulonephritis CD100 induces interaction that accelerates atherosclerosis. Cardiovasc. Res. 105 (3),

361–371.

macrophage recruitment through the coupling of glomerular plexin

Auwers, J., 1991. The human leukemia cell line THP-1: a multifaceted model for the

B1 and CD100 positive leukocytes (Li et al., 2009). Moreover, CD100

study of monocyte-macrophage differentiation. Experientia 47, 22–31.

participates in the interaction between platelets and between NK Basile, J.R., Barac, A., Zhu, T., Guan, K.L., Gutkind, J.S., 2004. Class IV semaphorins

promote angiogenesis by stimulating Rho-initiated pathways through

and target cells. Platelets express CD100 receptors CD72 and plexin

plexin-B. Cancer Res. 64, 5212–5224.

B1, and the initial coupling of the semaphorin with these receptors

Bernard, G., Zoccola, D., Ticchioni, M., Breittmayer, J.P., Aussel, C., Bernard, A., 1994.

promotes aggregation of platelets and thrombus formation (Zhu Engagement of the CD45 molecule induces homotypic adhesion of human

thymocytes through a LFA-1/ICAM-3-dependent pathway. J. Immunol. 152,

et al., 2007). A similar phenomenon was demonstrated in NK cells,

5161–5170.

in which membrane CD100 mediates cytotoxicity through binding

Bougeret, C., Mansur, I.G., Dastot, H., Schmid, M., Mahouy, G., Bensussan, A.,

to the CD72 receptor present in target cells, resulting in increased Boumsell, L., 1992. Increased surface expression of a newly identified 150-kDa

toxicity and IFN-␥ production (Mizrahi et al., 2007). The diversity dimer early after human T lymphocyte activation. J. Immunol. 148,

318–323.

of systems in which CD100 participates in cell adhesion, coupled

Chabbert-de Ponnat, I., Marie-Cardine, A., Pasterkamp, R.J., Schiavon, V.,

to different receptors, reinforces the importance of this molecule

Tamagnone, L., Thomasset, N., Bensussan, A., Boumsell, L., 2005. Soluble CD100

in cell–cell contact and the complexity of these interactions. functions on human monocytes and immature dendritic cells require plexin C1

and plexin B1, respectively. Int. Immunol. 17, 439–447.

Our adhesion inhibition experiments have shown that CD100

Delaire, S., Elhabazi, A., Bensussan, A., Boumsell, L., 1998. CD100 is a leukocyte

may act as an adhesion molecule involved in monocyte-endothelial

semaphorin. Cell. Mol. Life Sci. 54, 1265–1276.

cell binding, possibly coupled to endothelial plexin B1 and mono- Elhabazi, A., Delaire, S., Bensussan, A., Boumsell, L., Bismuth, G., 2001. Biological

activity of soluble CD100. I. The extracellular region of CD100 is released from

cytic plexin B2. We found that activated THP-1 cells adhered less to

the surface of T lymphocytes by regulated proteolysis. J. Immunol. 166,

HUVECs in the conditions in which anti-plexins were used together 4341–4347.

with recombinant CD100 protein. The inhibition observed was Elhabazi, A., Marie-Cardine, A., Chabbert-de Ponnat, I., Bensussan, A., Boumsell, L.,

2003. Structure and function of the immune semaphorin CD100/SEMA4D. Crit.

almost the same in magnitude as in the condition where only plexin

Rev. Immunol. 23, 65–81.

B2 was blocked. Recombinant CD100 protein, which may bind to

Granziero, L., Circosta, P., Scielzo, C., Frisaldi, E., Stella, S., Geuna, M., Giordano, S.,

plexins in both HUVECs and THP-1 cells, exacerbates this inhibi- Ghia, P., Caligaris-Cappio, F., 2003. CD100/Plexin-B1 interactions sustain

+

proliferation and survival of normal and leukemic CD5 B lymphocytes. Blood

tion. These results indicate that plexin B2 and its binding probably

101 (5), 1962–1969.

to CD100 may have an important role in the interaction between

Hansson, G.K., Hermansson, A., 2011. The immune system in atherosclerosis. Nat.

monocytes and endothelial cells, the main cell types involved in the Immunol. 12, 204–212.

initiation of atherosclerosis. Heemskerk, N., van Rijssel, J., van Buul, J.D., 2014. Rho-GTPase signaling in

leukocyte extravasation: an endothelial point of view. Cell Adhes. Migr. 8,

A relatively recent study showed that CD100 is involved in

67–75.

the progression phase of atherosclerosis by accelerating intimal

Hirschberg, A., Deng, S., Korostylev, A., Paldy, E., Costa, M.R., Worzfeld, T.,

neovascularization, resulting in enhanced macrophage infiltration Vodrazka, P., Wizenmann, A., Gotz, M., Offermanns, S., et al., 2009. Gene

deletion mutants reveal a role for semaphorin receptors of the plexin-B

in the murine model (Yukawa et al., 2010). Considering this and

family in mechanisms underlying corticogenesis. Mol. Cell. Biol. 30,

the findings presented here, we suggest that CD100 might play 764–780.

important roles both in the establishment and maintenance of Hu, Y., Hu, X., Boumsell, L., Ivashkiv, L.B., 2008. IFN-gamma and STAT1 arrest

monocyte migration and modulate RAC/CDC42 pathways. J. Immunol. 180,

atherosclerotic plaques. Further studies should be performed to

8057–8065.

determine whether blocking of adhesion molecules such as CD100

Hwang, J., Saha, A., Boo, Y.C., Sorescu, G.P., McNally, J.S., Holland, S.M., Dikalov, S.,

and plexin B2 can be used as potential targets for therapies, reduc- Giddens, D.P., Griendling, K.K., Harrison, D.G., Jo, H., 2003. Oscillatory shear

stress stimulates endothelial production of O2—from p47phox-dependent

ing atheroma formation and growth. Despite a growing list of

NAD(P)H oxidases, leading to monocyte adhesion. J. Biol. Chem. 278 (47),

molecules involved in monocyte traffic, there is still much to be 47291–47298.

determined about the coordination of their functions and, in par- Imhof, B.A., Aurrand-Lions, M., 2004. Adhesion mechanisms regulating the

migration of monocytes. Nat. Rev. Immunol. 4, 432–444.

ticular, how they become dysregulated during the development of

Ishida, I., Kumanogoh, A., Suzuki, K., Akahani, S., Noda, K., Kikutani, H., 2003.

inflammatory diseases such as atherosclerosis.

Involvement of CD100, a lymphocyte semaphorin, in the activation of the

In conclusion, we have shown that CD100 and plexins, especially human immune system via CD72: implications for the regulation of immune

plexin B2, contribute to the binding of monocytes to endothelial and inflammatory responses. Int. Immunol. 15, 1027–1034.

Ji, J.D., Park-Min, K.H., Ivashkiv, L.B., 2009. Expression and function of semaphorin

cells in vitro. We showed that CD100 is expressed in monocytes and

3A and its receptors in human monocyte-derived macrophages. Hum.

endothelial cells, and that plexin B2 is probably the CD100 recep-

Immunol. 70, 211–217.

tor in monocytes. CD100 and plexin blocking may thus attenuate Kruger, R.P., Aurandt, J., Guan, K.L., 2005. Semaphorins command cells to move.

Nat. Rev. Mol. Cell Biol. 6, 789–800.

the recruitment of monocytes and accumulation of macrophages

Kumanogoh, A., Watanabe, C., Lee, I., Wang, X., Shi, W., Araki, H., Hirata, H.,

in diseases such as atherosclerosis.

Iwahori, K., Uchida, J., Yasui, T., et al., 2000. Identification of CD72 as a

lymphocyte receptor for the class IV semaphorin CD100: a novel mechanism

for regulating B cell signaling. Immunity 13, 621–631.

Conflict of interest statement

Li, M., O’Sullivan, K.M., Jones, L.K., Lo, C., Semple, T., Kumanogoh, A., Kikutani, H.,

Holdsworth, S.R., Kitching, R., 2009. Endogenous CD100 promotes glomerular

injury and macrophage recruitment in experimental crescentic

The authors declare no conflict of interest.

glomerulonephritis. Immunology 128, 114–122.

Luque, M.C., Gutierrez, P.S., Debbas, V., Martins, W.K., Puech-Leao, P., Porto, G.,

Acknowledgements Coelho, V., Boumsell, L., Kalil, J., Stolf, B., 2013. Phage display identification of

CD100 in human atherosclerotic plaque macrophages and foam cells. PLoS

ONE 8, e75772.

Financial support was obtained mainly from FAPESP (Fundac¸ ão Mehta, J.L., Saldeen, T.G., Rand, K., 1998. Interactive role of infection, inflammation

de Amparo à Pesquisa do Estado de São Paulo). We would like to and traditional risk factors in atherosclerosis and coronary artery disease. J.

Am. Coll. Cardiol. 31, 1217–1225.

thank Dr. Verônica Coelho and Prof. Francisco Laurindo for dis-

Mizrahi, S., Markel, G., Porgador, A., Bushkin, Y., Mandelboim, O., 2007. CD100 on

cussing the data and Dr. Edilberto Postol for the help with adhesion

NK cells enhance IFNgamma secretion and killing of target cells expressing

experiment control conditions. CD72. PLoS ONE 2, e818.

Raper, J.A., 2000. Semaphorins and their receptors in vertebrates and

invertebrates. Curr. Opin. Neurobiol. 10, 88–94.

References Roney, K.E., O’Connor, B.P., Wen, H., Holl, E.K., Guthrie, E.H., Davis, B.K., Jones, S.W.,

Jha, S., Sharek, L., Garcia-Mata, R., et al., 2011. Plexin-B2 negatively regulates

macrophage motility, Rac, and Cdc42 activation. PLoS ONE 6, e24795.

Arita-Okubo, S., Kim-Kaneyama, J.R., Lei, X.F., Fu, W.G., Ohnishi, K., Takeya, M.,

Ross, R., 1993. The pathogenesis of atherosclerosis: a perspective for the 1990s.

Miyauchi, A., Honda, H., Itabe, H., Miyazaki, T., Miyazaki, A., 2015. Role of Hic-5

Nature 362, 801–809.

in the formation of microvilli-like structures and the monocyte-endothelial

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028

G Model

MIMM-4749; No. of Pages 9 ARTICLE IN PRESS

M.C.A. Luque et al. / Molecular Immunology xxx (2015) xxx–xxx 9

Sun, Q., Zhou, H., Binmadi, N.O., Basile, J.R., 2009. Hypoxia-inducible platelet hypersensitivity in dyslipidemia and confers protection against the

factor-1-mediated regulation of semaphorin 4D affects tumor growth and development of atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 29,

vascularity. J. Biol. Chem. 284, 32066–32074. 1039–1045.

Sun, X., Belkin, N., Feinberg, M.W., 2013. Endothelial microRNAs and Zielonka, M., Xia, J., Friedel, R.H., Offermanns, S., Worzfeld, T., 2010. A systematic

atherosclerosis. Curr. Atheroscler. Rep. 15, 372. expression analysis implicates Plexin-B2 and its ligand Sema4C in the

Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G.I., Song, H., Chedotal, A., regulation of the vascular and endocrine system. Exp. Cell Res. 316, 2477–2486.

Winberg, M.L., Goodman, C.S., Poo, M., et al., 1999. Plexins are a large family of

receptors for transmembrane, secreted, and GPI-anchored semaphorins in

Glossary

vertebrates. Cell 99, 71–80.

van Gils, J.M., Zwaginga, J.J., Hordijk, P.L., 2009. Molecular and functional

interactions among monocytes, platelets, and endothelial cells and their ApoE: apolipoprotein E

relevance for cardiovascular diseases. J. Leukocyte Biol. 85, 195–204. BSA: bovine serum albumin

Witherden, D.A., Watanabe, M., Garijo, O., Rieder, S.E., Sarkisyan, G., Cronin, S.J., DC:

Verdino, P., Wilson, I.A., Kumanogoh, A., Kikutani, H., et al., 2012. The CD100

EDTA: ethylenediaminetetraacetic acid

receptor interacts with its plexin B2 ligand to regulate epidermal gammadelta

GAPDH: glyceraldehyde 3-phosphate dehydrogenase

T cell function. Immunity 37, 314–325.

HUVEC: human umbilical vein endothelial cells

Yu, D., Cook, M.C., Shin, D.M., Silva, D.G., Marshall, J., Toellner, K.M., Havran, W.L.,

IgG: immunoglobulin G

Caroni, P., Cooke, M.P., Morse, H.C., et al., 2008. growth and guidance

IFN␥: interferon gamma

identify T-dependent germinal centre B cells. Immunol. Cell Biol. 86,

LPS: lipopolysaccharide

3–14.

NK cell: natural killer cell

Yukawa, K., Tanaka, T., Kishino, M., Yoshida, K., Takeuchi, N., Ito, T., Takamatsu, H.,

oxLDL: oxidized low-density lipoprotein

Kikutani, H., Kumanogoh, A., 2010. Deletion of Sema4D gene reduces intimal

PBMC: peripheral blood mononuclear cell

neovascularization and plaque growth in apolipoprotein E-deficient mice. Int.

J. Mol. Med. 26, 39–44. PBS: phosphate buffered saline

Zhu, L., Bergmeier, W., Wu, J., Jiang, H., Stalker, T.J., Cieslak, M., Fan, R., Boumsell, L., RT-PCR: reverse transcriptase-polymerase chain reaction

Kumanogoh, A., Kikutani, H., et al., 2007. Regulated surface expression and TNF: tumor necrosis factor

shedding support a dual role for semaphorin 4D in platelet responses to VCAM-1: vascular cell adhesion molecule 1

vascular injury. Proc. Natl. Acad. Sci. U.S.A. 104, 1621–1626.

−/− mice: knockout mice

Zhu, L., Stalker, T.J., Fong, K.P., Jiang, H., Tran, A., Crichton, I., Lee, E.K., Neeves, K.B.,

Maloney, S.F., Kikutani, H., et al., 2009. Disruption of SEMA4D ameliorates

Please cite this article in press as: Luque, M.C.A., et al., CD100 and plexins B2 and B1 mediate monocyte-endothelial cell adhesion and

might take part in atherogenesis. Mol. Immunol. (2015), http://dx.doi.org/10.1016/j.molimm.2015.07.028