Hantavirus Glycoprotein Gn in Virion Assembly and Regulation of Interferon Response

HANTAVIRUS GLYCOPROTEIN GN IN VIRION ASSEMBLY AND REGULATION OF INTERFERON RESPONSE

HAO WANG

Department of Virology, Haartman Institute,

University of Helsinki

Finland

Helsinki Graduate School in Biotechnology and Molecular Biology

Academic Dissertation To be presented for public examination, with the permission of the Faculty of Medicine of the University of Helsinki, in Lecture Hall 2, Haartman Institute, on 17th June 2011 at 12 noon

Helsinki 2011

Supervised by: Professor Antti Vaheri Department of Virology Haartman Institute University of Helsinki

Reviewed by: Docent Tero Ahola Institute of Biotechnology University of Helsinki

and

Docent Sampsa Matikainen Finnish Institute of Occupational Health Helsinki

Opponent: Professor Michèle Bouloy Institute Pasteur Paris

ISBN 978-952-92-9095-6 (nid.)

ISBN 978-952-10-7004-4 (PDF)

Unigrafia Oy, Helsinki University Print

TABLE OF CONTENTS

1 LIST OF ORIGINAL PUBLICATIONS 5

2 ABBREVIATIONS 6

3 SUMMARY 8

4 REVIEW OF THE LITERATURE 10

4.1 Overview of hantaviruses 10

4.2 History 11

4.3 Virus structure and genome 12

4.4 Virus life cycle 13 4.4.1 Entry 13 4.4.2 Transcription 14 4.4.3 Translation 15 4.4.4 Replication 15 4.4.5 Virus maturation 16 4.4.5.1 Encapsidation 16 4.4.5.2 Assembly 17 4.4.5.3 Budding 18

4.5 Viral proteins 18 4.5.1 L protein 18 4.5.2 N protein 19 4.5.3 Gn and Gc proteins 21

4.6 Hantaviruses and immunity 22 4.6.1 Innate immunity 22 4.6.1.1 Hantaviruses and innate immunity 25 4.6.1.2 Induction of innate immunity by hantaviruses 25 4.6.1.3 Inhibition 27 4.6.2 Adaptive immunity 27 4.6.2.1 Humoral immune response and diagnostics 28 4.6.2.2 Cellular immune response 29

5 AIMS OF THE STUDY 31

6 MATERIALS AND METHODS 32 3

7 RESULTS 37

7.1 Fate of Gn-CT of the apathogenic Tula hantavirus and its role in virus assembly 37 7.1.1 Degradation and aggresome formation of Gn-CT (I) 37 7.1.2 Interaction between Gn tail and N protein (II) 39

7.2 Regulation of interferon response by Old World hantaviruses 41 7.2.1 Viral dsRNA production and genomic RNA of hantavirus (III) 41 7.2.2 Hantavirus Gn-CT inhibits the activation of IFN- immune response (IV) 42

8 DISCUSSION 44

8.1 Analysis of the Gn protein sequence alignment and the selection of Gn-CT region 44

8.2 Degradation and aggresome formation of Gn-CT may be a general property of most hantaviruses 44

8.3 The role of ITAM and zinc finger motifs in the interaction of N and Gn-CT 45

8.4 The role of hantavirus RNA in the induction of innate immunity 45

8.5 The role of Gn-CT of TULV in inhibition of innate immunity 46

9 CONCLUDING REMARKS 48

10 FUTURE PROSPECTS 49

11 ACKNOWLEDGEMENTS 50

12 REFERENCES 51

1 List of original publications

This thesis is based on the following original publications which are referred to by Roman mumerals in the text

I Wang H, Strandin T, Hepojoki J, Lankinen H, Vaheri A. Degradation and aggresome formation of the Gn tail of the apathogenic Tula hantavirus. J Gen Virol. 2009 Dec;90(Pt 12):2995-3001

II Wang H*, Alminaite A*, Vaheri A, Plyusnin A. Interaction between hantaviral nucleocapsid protein and the cytoplasmic tail of surface glycoprotein Gn. Virus Res. 2010 Aug;151(2):205-12.

III Wang H, Vaheri A, Weber F, Plyusnin A. Hantaviruses do not produce detectable amounts of dsRNA in infected cells and their genome 5´-termini bear monophosphate. J Gen Virol. 2011 May;92(Pt 5):1199-204.

IV Wang H, Sillanpää M, Strandin T, Hepojoki J, Lankinen H, Julkunen I, Vaheri A. Tula hantavirus Gn tail inhibits the activation of IFN beta innate immunity response. In manuscript

*equal contribution

2 Abbreviations

ANDV Andes hantavirus CARDs caspase-recruitment domains CHX cycloheximide cRNA antigenomic RNA DOBV Dobrava hantavirus dsRNA double-stranded RNA ECM extracellular matrix eIF4F eukaryotic translation initiation factor 4F FACS flow cytometry

GFP green fluorescent protein Gn-CT Gn glycoprotein cytoplasmic tail GPC glycoprotein precursor GST glutathione-S-transferase HCPS hantavirus cardiopulmonary syndrome HFRS hemorrhagic fever with renal syndrome HLA human leukocyte antigen HTNV Hantaan hantavirus IFN interferon IKK      IB kinase- IPS-I IFN- promoter stimulator

IPTG isopropyl--D-1-thiogalactopyranoside IRESs cis-acting internal ribosomal entry site IRF interferon regulatory factor ITAM immunoreceptor tyrosine based activation motif MDA5 melanoma differentiation-associated gene 5 MHC major histocompatibility complex

MTOC microtubule organizing center MyD88 myeloid differentiation primary response gene (88) NCR non-coding region NE nephropahia epidemica NF-B nuclear factor -light-chain-enhancer of activated B cells NOC nocodazole NY-1 New York-1 hantavirus ORF open reading frame PAMPs pathogen-associated molecular patterns PHV Prospect Hill hantavirus PRRs pattern recognition receptors PUUV Puumala virus RdRp RNA-dependent RNA polymerase RIG-I retinoic acid inducible gene I

RLH retinoic acid-inducible gene I-like RNA helicases SAAV Saaremaa hantavirus SEOV Seoul hantavirus SFV Semliki Forest virus SNV Sin Nombre hantavirus TBK-1 TANK-binding kinase 1 TLR Toll-like receptor TNF- tumor necrosis factor alpha

TRAF3 TNF receptor-associated factor 3 TULV Tula hantavirus vRNA viral RNA vRNP viral ribonucleoprotein

3 Summary

Hantaviruses have a tri-segmented negative-stranded RNA genome. The S segment encodes the nucleocapsid protein (N), M segment two glycoproteins, Gn and Gc, and the L segment the RNA polymerase. Gn and Gc are co-translationally cleaved from a precursor and targeted to the cis-Golgi compartment. The Gn glycoprotein consists of an external domain, a transmembrane domain and a C-terminal cytoplasmic domain. In addition, the S segment of some hantaviruses, including Tula and Puumala virus, have an open reading frame (ORF) encoding a nonstructural potein NSs that can function as a weak interferon antagonist. The mechanisms of hantavirus-induced pathogenesis are not fully understood but it is known that both hemorrhagic fever with renal syndrome (HFRS) and hantavirus (cardio) pulmonary syndrome (HCPS) share various features such as increased capillary permeability, thrombocytopenia and upregulation of TNF-. Several hantaviruses have been reported to induce programmed cell death (apoptosis), such as TULV-infected Vero E6 cells which is known to be defective in interferon signaling. Recently reports describing properties of the hantavirus Gn cytoplasmic tail (Gn-CT) have appeared. The Gn-CT of hantaviruses contains animmunoreceptor tyrosine-based activation motif (ITAM) which directs receptor signaling in immune and endothelial cells; and contain highly conserved classical zinc finger domains which may have a role in the interaction with N protein. More functions of Gn protein have been discovered, but much still remains unknown. Our aim was to study the functions of Gn protein from several aspects: synthesis, degradation and interaction with N protein. Gn protein was reported to inhibit interferon induction and amplication. For this reason, we also carried out projects studying the mechanisms of IFN induction and evasion by hantavirus. We first showed degradation and aggresome formation of the Gn-CT of the apathogenic TULV. It was reported earlier that the degradation of Gn-CT is related to the pathogenicity of hantavirus. We found that the Gn-CT of the apathogenic hantaviruses (TULV, Prospect Hill virus) was degraded through the ubiquitin-proteasome pathway, and TULV Gn-CT formed

8 aggresomes upon treatment with proteasomal inhibitor. Thus the results suggest that degradation and aggregation of the Gn-CT may be a general property of most hantaviruses, unrelated to pathogenicity. Second, we investigated the interaction of TULV N protein and the TULV Gn-CT. The Gn protein is located on the Golgi membrane and its interaction with N protein has been thought to determine the cargo of the hantaviral ribonucleoprotein which is an important step in virus assembly, but direct evidence has not been reported. We found that TULV Gn-CT fused with GST tag expressed in bacteria can pull-down the N protein expressed in mammalian cells; a mutagenesis assay was carried out, in which we found that the zinc finger motif in Gn-CT and RNA-binding motif in N protein are indispensable for the interaction. For the study of mechanisms of IFN induction and evasion by Old World hantavirus, we found that Old World hantaviruses do not produce detectable amounts of dsRNA in infected cells and the 5’-termini of their genomic RNAs are monophosphorylated. DsRNA and tri-phosphorylated RNA are considered to be critical activators of innate immnity response by interacting with PRRs (pattern recognition receptors). We examined systematically the 5´-termini of hantavirus genomic RNAs and the dsRNA production by different species of hantaviruses. We found that no detectable dsRNA was produced in cells infected by the two groups of the old world hantaviruses: Seoul, Dobrava, Saaremaa, Puumala and Tula. We also found that the genomic RNAs of these Old World hantaviruses carry

5´-monophosphate and are unable to trigger interferon induction. The antiviral response is mainly mediated by alpha/beta interferon. Recently the glycoproteins of the pathogenic hantaviruses Sin Nombre and New York-1 viruses were reported to regulate cellular interferon. We found that Gn-CT can inhibit the induction of IFN activation through Toll-like receptor (TLR) and retinoic acid-inducible gene I-like RNA helicases (RLH) pathway and that the inhibition target lies at the level of TANK-binding kinase 1 (TBK-1)/ IB kinase-IKK complex and myeloid differentiation primary response gene (88) (MyD88) / interferon regulatory factor 7 (IRF-7) complex.

4 Review of the literature

4.1 Overview of hantaviruses

Hantaviruses are RNA viruses within the family Bunyaviridae (Nichol, 2005). They are found worldwide and are associated with two severe disease syndromes: hemorrhagic fever with renal syndrome (HFRS) and hantavirus (cardio) pulmonary syndrome (HCPS) (Heyman et al., 2009; Vapalahti et al., 2003). Unlike the rest of the family Bunyaviridae, which are arthropod-borne, the carriers of hantaviruses are rodents and insectivores (Heyman et al., 2009; Vaheri et al., 2011). These viruses are transmitted directly or indirectly between hosts through aggressive interactions or the inhalation of infectious aerosols released in saliva, urine and feces (Plyusnin and Morzunov, 2001). In insectivores, recently, new hantaviruses have been detected in shrews (Klempa et al., 2007; Song et al., 2007). In rodents, hantaviruses are found in the Cricetidae family (subfamilies Arvicolinae, Neotominae and Sigmodontinae) and in the Muridae family (subfamily Murinae). Each hantavirus type is carried primarily by a specific rodent host species and they are co-evolving with their hosts (Khaiboullina et al., 2005; Plyusnin et al., 1996). In Europe, HFRS is caused by three hantaviruses: Puumala virus (PUUV) (Brummer-Korvenkontio et al., 1982), Dobrava virus (DOBV) (Avsic-Zupanc et al., 1992) and Saaremaa virus (SAAV) (Plyusnin et al., 1997). In Finland, a total of 22, 681 cases of PUUV-caused mild HFRS were reported from 1995 to 2008 (average annual incidence 31/100 000 population). There has been an increasing trend in incidence, and the rates have varied widely by season and region (Makary et al., 2010; Vaheri et al., 2008).

4.2 History

Before the identification of the causative agent of HFRS in 1976 by Dr. Ho Wang Lee (Lee et al., 1978), the human diseases of HFRS type had already been described long time ago. In A.D. 960, a Chinese medical account described a similar disease (Lee et al., 1982). In 1934, Japanese physicians first encountered HFRS in Manchuria during troop field maneuvers, and in the same year the milder form of hantavirus disease, nephropathia epidemica (NE), was first described in Sweden (Myhrman, 1951). During World War II, 10,000 German and Finnish soldiers were infected in Finnish Lapland. In the 1950s, HFRS was recognized in countries of Eastern Europe including former Yugoslavia, Bulgaria, former Czechoslovakia, and Hungary (Gajdusek, 1962). Also during the 1950s, American soldiers met HFRS during the Korean War: over 3,000 American and Korean soldiers fell severely ill with a lethality of more than 10% (Earle, 1954). In the attempt to identify the causative agent in the Korean War, Ho Wang Lee developed a sensitive diagnostic test for clinical HFRS by using lung sections from infected wild mice (Lee and Lee, 1976). In the meantime, several groups failed to find a susceptible laboratory host or cell system. After Lee adapted the infectious agent to mice belonging to the subspecies jejudoica, he successfully isolated the first hantavirus, Hantaan virus (HTNV) (Lee et al., 1978). Since then more and more HFRS-causing viruses have been identified. Soon in 1980, the first hantavirus found in Europe PUUV was identified by Finnish scientists in the lungs of infected bank voles (Brummer-Korvenkontio et al., 1980). A number of hantaviruses were identified soon after, including Seoul (SEOV) and Prospect Hill virus (PHV) in the early 1980s (Lee et al., 1982), Thailand virus in 1985, Dobrava (DOBV) in 1992 and Tula (TULV) in 1994 (Avsic-Zupanc et al., 1992; Elwell et al., 1985; Plyusnin et al., 1994). Another important event in hantavirus history was the outbreak in southwestern USA in 1993 which initially killed up to 50% of the infected patients. The causative agent was soon identified and later named Sin Nombre virus (SNV). Since then, more New World hantaviruses have been discovered in North and South America. At

11 present, nearly 50 hantaviruses have been identified including over 20 hantaviruses causing human disease (Heyman et al., 2009; Vaheri et al., 2011).

4.3 Virus structure and genome

Hantaviruses are negative-stranded RNA viruses with a tripartite genome. The large (L) segment ( 6.5 kb) encodes the viral RNA-dependent RNA polymerase (L protein), the medium (M) segment (3.6-3.7 kb) two surface glycoproteins, Gn and Gc, and the small (S) segment (1.7-2.0 kb) the nucleocapsid (N) protein (Plyusnin et al., 1996). A nonstructural protein (NSs) was found recently in some (e.g. TULV and PUUV) but not all hantaviruses, and it is encoded by an overlapping (+1) ORF of the S segment (Jääskelainen et al., 2007; Virtanen et al., 2010). Both the 5' and 3' ends of each genomic segment contain non-coding sequences (NCR) (Plyusnin, 2002). Due to the conserved, complementary terminal nucleotides on the L, M, and S segments, hantavirus RNA segments can form closed circular structures called panhandles (Plyusnin et al., 1996). The hantavirus virion has a varying morphology (Martin et al., 1985). Taking TULV as an example, the structure has been recently revealed by electron cryotomography: generally they are large spherical particles with a diameter of 120-160 nm, occasionally smaller particles with a diameter of 60 nm, but there are also tubular particles 350 nm long and 80 nm in diameter (Huiskonen et al., 2010). The virion surface is covered by Gn and Gc proteins. Only small areas of membrane are exposed. The Gn and Gc were recently reported to favor homo-oligomers over hetero-oligomers, and Gn and Gc proteins are presented in heterocomplexes that include tetramers of Gn protein interconnected by Gc protein dimers forming a unique, four-fold grid-like structure on the surface of viral particles (Hepojoki et al., 2010a). The virions contain viral ribonucleoprotein complexes (vRNP), which consist of the genomic S, M, L vRNA encapsidated by N protein. It has been suggested that the bunyavirus vRNPs can interact directly with the viral glycoprotein thus facilitating

12 virus assembly (Hepojoki et al., 2010b; von Bonsdorff and Pettersson, 1975; Wang et al., 2010).

4.4 Virus life cycle

4.4.1 Entry

Both pathogenic and non-pathogenic hantaviruses can replicate in endothelial cells but there is little if any damage to the infected endothelium (Yanagihara and Silverman, 1990; Zaki et al., 1995). HTNV and PUUV enter cells from the apical surface of polarized endothelial cells (Krautkramer and Zeier, 2008), while the entry of Andes hantavirus (ANDV) occurs via both apical and basolateral membranes of epithelium cells (Rowe and Pekosz, 2006). Virus entry is initiated by attachment to cells. The hantavirus first has to interact directly with host cell receptors. Integrins act as host cell receptors mediating the hantavirus entry. Integrins are heterodimeric transmembrane receptors composed of a combination of α and β subunits, and they can mediate cell-cell adhesion, cell migration and extracellular matrix protein (ECM) recognition (Sugimori et al., 1997). Pathogenic hantaviruses like SNV, NY-1, PUUV, HTNV and SEOV use β3 integrin whereas non-pathogenic hantaviruses such as PHV use β1 integrin (Gavrilovskaya et al., 2002; Gavrilovskaya et al., 1998). After cell attachment, receptor-mediated endocytosis occurs. During this step, the hantavirus enters the cell through the dynamin-regulated clathrin-mediated endocytosis pathway (Jin et al., 2002). Hantaviruses are transported to early endosomes, and subsequently to late endosomes or lysosomes. Within endosomes, the low pH induces the fusion activity of Gc protein, the viral and endosomal membranes fuse with each other, and then the ribonucleocapsids are released into the cytoplasm (Cifuentes-Munoz et al., 2010; Ogino et al., 2004; Tischler et al., 2005). Now, the hantavirus starts to reproduce itself. This process is exclusively cytoplasmic and includes several steps: transcription (mRNA synthesis), translation

(virus protein synthesis) and replication (vRNA synthesis).

4.4.2 Transcription

During this step, the positive-strand mRNA is synthesized. For the initiation of transcription, two mechanisms are involved: cap-snatching and primer-realign. The 5'termini of synthesized mRNAs contain a 5'm7G cap structure. This 5'm7G cap has important biological functions as it is required by the RdRp to initiate the transcription (Braam et al., 1983; Dhar et al., 1980; Plotch et al., 1981) and is recognized by the cap-binding complex, eIF4F, for the initiation of translation (Richter and Sonenberg, 2005; von der Haar et al., 2004). The capped RNA primer is generated from the 5'terminus of host cell mRNA by the “cap-snatching” process. This process has been well characterized for influenza virus. Based on this knowledge, the PB2 subunit of heterotrimeric RdRp binds to the 5' caps of host mRNA, then the 5'm7G cap is cut from the host mRNA by the PB1 subunit of influenza virus RdRp (Guilligay et al., 2008; Sugiyama et al., 2009). In contrast to the RdRp of influenza virus which has three subunits, the hantavirus RdRp is a large single protein. The La Crosse orthobunyavirus (Bunyaviridae) polymerase protein contains endonuclease domain (Reguera et al., 2010), whether the hantavirus RdRp also has endonuclease activity is unknown. In hantavirus, the 5' and 3' end of vRNA has a triplet of repeats (3'-AUCAUCAUC) which is indispensable for the 5'cap to bind and initiate transcription (Garcin et al., 1995; Mir and Panganiban, 2010). The 3'terminus of 5'caps from the host cell mRNA is a “G”residue which is supposed to basepair with one of the C residues at the 3'termini of vRNA template during transcription initiation (Garcin et al., 1995). The 5'cap is elongated by RdRp using a “primer-realign”mechanism (Garcin et al., 1995). In this model 5' caps aligns 3'terminus of the viral template through G-C basepairing. Following elongation of a few nucleotides, the extended primer realigns with viral RNA so that the G residue of

3'termini of 5' caps would be at position -1 (Garcin et al., 1995). The binding of N protein to 5' caps may facilitate the G-C basepairing (Mir et al., 2008; Mir and Panganiban, 2010).

4.4.3 Translation

In cells, during the initiation of translation, the mRNA 5' cap interacts with the cap-binding complex (eIF4F) and then recruits the 43S pre-initiation cmplex which contains the small ribosomal subunit, eIF3 cluster of peptides and initiator methionine transfer RNA, eIF2 and GTP (Richter and Sonenberg, 2005; von der Haar et al., 2004). The cap-binding complex eIF4F comprises eIF4E, which directly binds to the mRNA cap (Richter and Sonenberg, 2005; von der Haar et al., 2004), and eIF4A, which contains a DEAD box RNA helicase (Rogers et al., 2002), and eIF4G, which acts like a bridge between eIF4E and eIF4A (Mader et al., 1995). The mRNA 5'cap together with eIF4F and 43S pre-initiation complex proceed to scan for the start codon AUG. When the start codon is recognized, 60S large ribosomal subunit and additional factors are recruited and translation begins (Kozak, 1991; Kozak, 1992). Viruses use cellular machinery for the translation of viral mRNA. However, there are still some differences between the mechanisms adopted by different viruses. Take picornaviruses as an example, which contain a cis-acting internal ribosomal entry site (IRESs) to enable translation initiation without a cap (Hellen and Sarnow, 2001; Jang, 2006). In the case of hantavirus genome translation, it was recently reported that the N protein may replace the cap-binding complex (eIF4F) during the initiation of translation (Mir and Panganiban, 2008).

4.4.4 Replication

The complementary copy of vRNA, antigenomic RNA (cRNA) is synthesized

15 from the vRNA. Then the new vRNA is synthesized from the cRNA. The initiation mechanisms of cRNA/vRNA and viral mRNA are similar, both utilize a primer- realign mechanism (Garcin et al., 1995). But there are some differences between viral mRNA and cRNA/vRNA. The 5'termini of cRNA and vRNA are not capped because they are initiated by GTP, while the termini of viral mRNA contain a 5'capped structure. The HTNV genome RNA contains a 5'monophosphate (Garcin et al., 1995; Habjan et al., 2008). According to the finding made by Garcin 1995, the genome chain is initiated with GTP and a cleavage step occurs after realignment to remove the initiating GTP, leaving a monophosphate uridine (Garcin et al., 1995). The enzyme which has the ability to remove GTP may be the RdRp of hantavirus.

4.4.5 Virus maturation

4.4.5.1 Encapsidation

After the viral genome transcription and replication, the viral mRNA and the vRNAs of S, L, M exist in the cytoplasm. The newly synthesized N protein starts to encapsidate the cRNA and vRNA, but not the viral mRNA (Hacker et al., 1989; Jin and Elliott, 1993). The mechanism for selective encapsidation of vRNA and some cRNA by the N protein remains unknown. The viral mRNA is quite different from the vRNA in structure and sequence, as vRNAs have panhandle structures, but mRNA not. Additionally, vRNA has 5'monophosphate, but mRNA has a 5'm7G cap (Raju and Kolakofsky, 1989). These specific sequences or structures have been suggested to provide the signal for the N protein to encapsidate the cRNA or vRNA but not the mRNA (Severson et al., 1999; Severson et al., 2001; Severson et al., 2005). It has been reported that HTNV N protein has a binding preference for its S segment vRNA as compared to its binding with the S segment open-reading frame (ORF) or nonspecific RNA, thus suggesting that the N protein recognition site resides in the non-coding region of HTNV vRNA (Severson et al., 1999). Later, it was reported that 16 the 5' end of the S segment vRNA is necessary and sufficient for the binding reaction to occur (Severson et al., 2001).

4.4.5.2 Assembly

The virion should be assembled after the N protein encapsidates the vRNA. Bunyaviruses lack a matrix protein, which in other negative-stranded RNA viruses, such as ortho-, paramyxo- and rhabdoviruses, plays a key role in virus assembly (Harrison et al., 2010; Schmitt and Lamb, 2004; Ye et al., 1999). Therefore it was suggested that bunyavirus vRNPs can interact directly with the membrane-associated viral glycoprotein(s) thus helping the virus assembly (von Bonsdorff and Pettersson, 1975). For Uukuniemi virus (genus Phlebovirus), the interaction between vRNPs and Gn/Gc proteins was first demonstrated by immunoprecipitation (Kuismanen, 1984). Later, it was shown that it is the glycoprotein cytoplasmic tail (Gn-CT) of Uukuniemi virus that interacts with the vRNP (Overby et al., 2007). For Bunyamwera virus (genus Orthobunyavirus) the interaction between RNP and Gn glycoprotein has been shown in infectious virus-like particles (Shi et al., 2006). Similarly, in tomato spotted wilt virus (genus Tospovirus) direct interaction of the N protein, a key component of the vRNPs, and Gn glycoprotein was demonstrated by co-localization assay (Ribeiro et al., 2009; Snippe et al., 2007). Recently it has been reported that the Tula hantavirus Gn glycoprotein interacts with N protein which might facilitate the virus assembly (Hepojoki et al., 2010b; Wang et al., 2010). Also in Tula virion tomogram slices, connections from the RNP to the membrane, where the cytoplamic tail of Gn protein is located, were occasionally observed (Huiskonen et al., 2010). Most recently, the Gn glycoprotein of Crimean Congo Hemorrhagic Fever (CCHF) virus, Nairovirus genus Bunyaviridae, was found to interact with RNA, which may facilitate the assembly of virus RNP (Estrada and De Guzman, 2011).

4.4.5.3 Budding

The hantavirus M segment encodes two viral glycoproteins Gn and Gc. Gn and Gc glycoproteins are co-translationally cleaved from a single precursor at the conserved WAASA motif and targeted to Golgi compartment where they are processed and transported to the virus assembly site (Lober et al., 2001; Shi and Elliott, 2002; Spiropoulou et al., 2003). The maturation of bunyaviruses is thought to occur intracellularly in the Golgi complex (Matsuoka et al., 1991; Pettersson, 1991), as the glycoproteins of bunyavirus are retained in the Golgi complex, which may determine the site of virus assembly. In the case of hantaviruses, there exists a discrepancy. It has been reported that the glycoproteins of HTNV (representing Old World hantaviruses), SNV and ANDV (New World hantaviruses) accumulate in the Golgi complex (Shi and Elliott, 2002; Spiropoulou et al., 2003). For Old World hantaviruses, intracellular maturation was observed and the viral envelope was derived from budding into the Golgi (Schmaljohn and Nichol, 2007), but according to electron microscopy studies the maturation site of SNV and Black Creek Canal hantavirus is the plasma membrane (Goldsmith et al., 1995; Ravkov et al., 1997).

4.5 Viral proteins

4.5.1 L protein

The L protein is the RNA polymerase, which transcribes and replicates the genomic RNA. The L segments are of similar size among hantaviruses, varying from 6530 to 6562 nucleotides (Kukkonen et al., 2005). The transcript of hantavirus L segment has a single large open reading frame (ORF) to encode L protein with a predicted molecular mass of approximately 250 kDa. The size of L protein of HTNV and SEOV has been measured by radiolabeling infected cells and running on 12% SDS-PAGE gels to be approximately 200 kDa (Elliott et al., 1984). Later on, by using

18 specific antibody against L protein of TULV and PUUV, the size of L protein was measured to be 250 kDa (Kukkonen et al., 2004). In hantavirus, the L and N proteins are the only viral proteins required for RNA synthesis (Flick et al., 2003). The site of RNA synthesis is localized in the cytoplasm (Rossier et al., 1986), but whether this site is associated with membrane is unknown. It is well known that the RNA synthesis of all plus-strand RNA viruses is associated with membranes (Salonen et al., 2005). Since the N protein is localized in the perinuclear region (Kariwa et al., 2003; Kaukinen et al., 2003; Ravkov and Compans, 2001) and associated with membrane (Ravkov and Compans, 2001), and similarly to the L protein (Kukkonen et al., 2004), hantavirus RNA synthesis may also be membrane associated.

4.5.2 N protein

N protein which is encoded by the S segment contains 429-433 aa residues. It contains of an N terminal coiled-coil region, central conserved region and C-terminal helix-loop-helix region (Alfadhli et al., 2002; Kaukinen et al., 2005) (Fig 1). The N terminal and C-terminal region are involved in the N protein oligomerization (Alminaite et al., 2006; Kaukinen et al., 2005). The central region contains an RNA-binding domain and interacts with cellular proteins such as SUMO and Ubc9 (Kaukinen et al., 2003; Maeda et al., 2003; Xu et al., 2002). The central domain of N protein also binds to the 5'caps of mRNAs (Mir et al., 2008). Furthermore, PUUV N protein was shown to interact with Daxx protein, a Fas-mediated apoptosis enhancer, and the interaction domain has been mapped to the C-terminus (Li et al., 2002). Yeast and mammalian two-hybrid assays revealed that the N-terminal amino acids 100–125 of SEOV N protein, which represents a critical region for N-N oligomerization, was responsible for the interaction with SUMO-1-related molecules such as PIAS1, PIASxβ, HIPK2, CHD3, and TTRAP (Lee et al., 2003).

N protein N-termanal domain C-terminal domain (coiled-coil domain) central domain (helix-loop-helix region)

amino acid (1-80) amino acid (81-248) amino acid (249-429)

Fig 1 Hantavirus N protein. The N-terminal domain, central domain and C-terminal domain are shown.

N is involved in many aspects of the virus life cycle, including encapsidation and packaging of viral RNA (Jonsson et al., 2001; Mir et al., 2006; Mir and Panganiban, 2005; Severson et al., 1999), N protein trafficking (Ramanathan et al., 2007; Ramanathan and Jonsson, 2008), viral genome translation (Mir and Panganiban, 2008), viral genome replication (Flick et al., 2003; Kohl et al., 2004; Osborne and Elliott, 2000), modulation of apoptosis (Ontiveros et al., 2010) and modulation of immune signaling (Taylor et al., 2009a; Taylor et al., 2009b). Some of the functions of N protein have been discussed in the above sections. To conclude, the N protein encapsidates both cRNA and vRNA after viral genome replication (Hacker et al., 1989; Jin and Elliott, 1993). In the transcription and translation process, N protein binds to the 5'caps of cellular mRNAs and protects them from degradation in cellular P bodies, replaces the cellular cap-binding complex, eIF4F, and augments translational expression (Mir et al., 2008; Mir and Panganiban, 2008); in the viral maturation step, the N protein binds to the glycoprotein Gn to facilitate the budding (Hepojoki et al., 2010b; Huiskonen et al., 2010). Recently it was reported that N protein is involved in the tumor necrosis factor alpha (TNF-activated host immune response and apoptosis. TNF- is a multifunctional cytokine with functions including activation of NF-B and induction of apoptosis (Wajant et al., 2003). The plasma levels of TNF- are elevated in HFRS patients (Krakauer et al., 1995; Linderholm et al., 1996; Temonen et al., 1996) and TNF-producing cells are found in the kidneys and lungs of HFRS and HCPS patients (Mori et al., 1999). The N protein interacts with importin-which will

20 transport NF-B to the nucleus to activate downstream immune reponse, thus N protein can inhibit the TNF- induced NF-B pathway (Taylor et al., 2009a; Taylor et al., 2009b). Also, the N protein interacts with NF-B, sequesters it in the cytoplasm, and promotes the inhibitor of NF-B (Idegradation, thus N protein can facilitate the reduction of TNF-induced caspase activity and apoptosis (Ontiveros et al., 2010).

4.5.3 Gn and Gc proteins

The M segment of hantaviruses encodes two glycoprotein, Gn and Gc. The Gn and Gc are co-translationally cleaved from a precursor (GPC) at the conserved sequence WAASA (Shi and Elliott, 2002). The Gn protein consists of an external domain, a transmembrane domain and a C-terminal cytoplasmic domain (Fig 2). Gc consists of an external domain and a quite short C-terminal cytoplasmic domain. The hantavirus Gn is a multifunctional protein: it is involved in many aspects such as virus recognition by celluar receptors, virus assembly and fusion with cells. In addition, Gn is also involved in the inhibition of both IFN-induction and signaling. Gn-CT of NY-1V was found to coprecipitate the N-terminal domain of TRAF3 and disrupt the formation of TRAF3-TBK1 complex, thus regulating the RIG-I and TBK-1 directed immune response (Alff et al., 2006; Alff et al., 2008). The Gn of both ANDV and PHV were shown to inhibit nuclear translocation of STAT-1 (Spiropoulou et al., 2007). Most recently, it was reported that IFN-β induction is inhibited of coexpression of ANDV N protein and GPC and is robustly inhibited by SNV GPC alone. Downstream amplification by Jak/STAT signaling is also inhibited by SNV GPC and by either NP or GPC of ANDV (Levine et al., 2010).

Fig 2. Cytoplasmic tail of hantaviral Gn protein. The upper part shows the glycoproteins (Gn and Gc). The transmembrane domains and signal domains are marked in grey. The lower part is the alignment of Gn-CT sequences. Zinc finger motifs and immunoreceptor tyrosine-based activation motif (ITAM) are marked.

In most RNA viruses, the non-structural proteins are involved in the inhibition of innate immunity (Haller et al., 2006). But in the case of hantaviruses, the glycoproteins are more likely to be involved in the inhibition of innate immunity considering that NSs of TULV and PUUV are weak inhibitors. This unusual feature of hantavirus glycoproteins may be related to the conserved cytoplasmic tail of Gn. The C-terminal part of Gn-CT of hantavirues contains immunoreceptor tyrosine-based activation motif (ITAM) which direct receptor signaling within immune and endothelial cells (Geimonen et al., 2003). In addition, the Gn-CT tail contains highly conserved zinc finger motifs (Estrada et al., 2009) (Fig 2).

4.6 Hantaviruses and immunity

4.6.1 Innate immunity

Immediately after virus infection, the host cell innate immunity is induced to limit the virus replication. The host cell recognizes the virus infection through the

22 interaction between pathogen recognition receptor (PRR) proteins and pathogen-associated molecular patterns (PAMPs). The PRRs are comprised of several groups: Toll-like receptors (TLRs), retinoic acid-inducible gene I-like RNA helicases (RLHs), NOD-like receptors (NLRs), C-type lectin receptors (CLRs) and AIM2-like receptors (ALRs). TLRs are expressed by various tissues and cell types, including macrophages, dentritic cells, lymphocytes and tissue parenchymal cells (Kumar et al., 2011). Of the 13 mammalian TLRs discovered so far, TLR2 and TLR4 are expressed on the cell surface while TLR3, TLR7, TLR8 and TLR9 are intracellular and endosomal (Kumar et al., 2011). TLR2 and TLR4 recognize viral envelope components, TLR3 recognizes dsRNA, TLR7 and TLR8 recognize ssRNA rich in G and U residues, and TLR9 recognizes dsDNA (Kopp and Medzhitov, 2003; Kumar et al., 2011). TLRs recruit TIR domain containing adaptor molecules, like MyD88 and TRIF, and thus activate the IRF-3, IRF-7 and NF- B, leading to expression of type I IFNs and cytokines (Kumar et al., 2011; Yamamoto et al., 2003). RLHs include RIG-I, MDA5 and LGP2 and function independently of TLRs (Andrejeva et al., 2004; Yoneyama et al., 2004). RIG-I and MDA5 contain two caspase-recruitment domains (CARDs) and a DExD/H-box helicase domain. The helicase domains recognize viral RNAs, and CARDs then interact with IPS-I (also called MAVS, VISA, and Cardif) which are located in the outer mitochondrial membrane (Kawai et al., 2005; Meylan et al., 2005; Seth et al., 2005; Xu et al., 2005). This interaction then activates IRF-3, IRF-7 and NF-B for the induction of type I IFNs and cytokines (Kumar et al., 2011; Sato et al., 2000). LGP2, which lacks the CARDs, functions as a positive regulator of virus recognition and subsequent antiviral responses as recently been identified (Satoh et al., 2010) .(Fig. 3)

Fig 3. Endosomal and cytoplasmic pathways for virus recognition and IFN production. TLR7 and TLR8 recognize viral ssRNA and signals through MyD88 thus activating IFN response. TLR3 recognize dsRNA and through TRIF activates IFN response. RIG-I and MDA-5 recognize ssRNA, dsRNA and via TBK-1 thereby also activating IFN response. Modified from Baum and Garcia-Sastre et al., 2010.

The PAMPs include various viral inducers. Nucleic acids derived from virus, including dsRNA, ssRNA and DNA, serve as the major PAMPs. From the study of chemically synthesized nucleotides, long dsRNA activates MDA5 (Gitlin et al., 2006; Kato et al., 2006), and short poly I:C (200-1000 nt) has been reported to trigger RIG-I (Kato et al., 2008), and 25 nt to 70 nt long synthetic double-strand RNA lacking 5'ppp can activate RIG-I (Kato et al., 2008; Takahasi et al., 2008). Another effector is 5'ppp RNA. The genomic RNA of influenza or rabies viruses bearing 5'ppp, but not genome of viruses that have a 5'monophospate, can activate the RIG -I dependent IFN induction (Habjan et al., 2008; Hornung et al., 2006; Pichlmair et al., 2006). Also it has been reported that the recognition of 5'ppp by RIG-I requires short blunt double-stranded RNA which is inconsistent with other reports (Schlee et al., 2009; Takahasi et al., 2008). Although the activity of natural RNAs after infection is largely unknown, there is evidence that the antigenomic RNA of negative-stranded viruses, which bears 5'ppp, contributes only minimally to RIG-I activation compared to the genomic RNA also bearing 5'ppp (Rehwinkel et al., 2010). The mRNA transcripts of measles and Epstein-Barr viruses bearing 5'ppp termini are reported to activate RIG-I (Plumet et

24 al., 2007; Samanta et al., 2006). A viral mRNA, with 5'-cap and 3'-poly (A) was found to activate IFN expression through the RNase L-MDA5 pathway (Luthra et al., 2011). The panhandle structure of negative-stranded RNA virus genome is also thought to be a RIG-I inducer (Schlee et al., 2009). Except the viral RNA, the PAMPs include viral proteins and ribonucleoprotein (RNP) complex. The RNPs of the negative-stranded vesicular stomatitis and measles viruses were found capable of triggering IFN induction (tenOever et al., 2002; tenOever et al., 2004). Hepatitis C virus (HCV) NS5A protein has been shown to activate NF-B when expressed in cells (Waris et al., 2002).

4.6.1.1 Hantaviruses and innate immunity

4.6.1.2 Induction of innate immunity by hantaviruses

In the 1990s, it was reported that PUUV-infected monocyte/macrophages produce significantly increased amount of MxA, suggesting IFN- production (Temonen et al., 1995). In microarray assay, upregulated interferon regulatory factor (IRFs) gene expression level was observed in both SNV-infected cells and PHV-infected cells, no changes of IFN- gene expression were observed (Khaiboullina et al., 2004). In another mircroarray screening, it was found that PHV induced much higher expression of MxA and 24 IFN-specific genes 24 h post infection than NY-1V and HTNV, but at late times MxA was induced about 200 fold by all three hantaviruses (Geimonen et al., 2002). A study comparing innate immunity induction of HTNV and TULV-infected HUVEC cells showed that HTNV induced a higher interferon response than the non-pathogenic TULV hantavirus, while TULV showed an early onset of MxA expression compared to HTNV (Kraus et al., 2004). A comparison between PHV and ANDV disclosed that PHV, but not ANDV, induced a robust interferon (IFN- response early after infection, and IRF-3 dimerization and nuclear translocation was detected in PHV but not ANDV infection (Spiropoulou et al., 2007). ANDV and SNV infection elicited minimal or delayed expression of 25

ISG56 and MxA in A549 and Huh-TLR3 cells (Levine et al., 2010). Recently, it has been reported that the activation of complementary system is in correlation with the disease severity in PUUV infection patients (Sane et al., 2011). Although there are inconsistences in the above reports, we can conclude that most hantaviruses can activate the innate immunity, however, pathogenic HTNV, NY-1 and ANDV may lead to a lower induction probably due to the fact that the pathogenic hantaviruses can evade the innate immunity. Several groups have studied the mechanism of the induction of IFN innate immune response to hantaviruses. It has been reported that the IFN innate immune responses to SNV are independent of virus entry, IRF-3, TLRs, and other known PRRs in infected Huh7 cells (Prescott et al., 2007). In contrast to the results, recently the same group reported that the intial activation of innate immunity in SNV infected Huh7 cells was due to the IFN- contained in the SNV virus stock, and Huh7 cells lack the innate immune responsiveness to SNV (Prescott et al., 2010). Also, UV-inactivated PHV, ANDV and HTNV were unable to induce innate immunity, and TLR3 was needed for HTNV to trigger innate immunity induction (Handke et al., 2009; Spiropoulou et al., 2007). But interestingly, UV-inactivated SNV can still activate the innate immunity response at early time points post infection in HUVEC cells and the initial immnunity response in SNV-infected HUVEC was not due to IFN- contained in the SNV stock (Prescott et al., 2010; Prescott et al., 2005). It has been reported that dsRNA is not detectable in negative-stranded RNA viruses, and RIG-I is unable to detect genomic RNA derived from HTNV (Habjan et al., 2008; Weber et al., 2006). In conclusion, what PAMPs and PRRs are involved still remains unknown; different hantaviruses may use different PAMPs to activate the innate immunity.

4.6.1.3 Inhibition

While host cells utilize the innate immune response to limit virus replication, viruses have evolved numerous ways to escape the interferon response. The Gn-CT of NY-1, but not PHV, blocks RIG-I and TBK-1 directed IFN- responses by interacting with TRAF3 and thus disrupting TBK-1-TRAF3 complex formation (Alff et al., 2006; Alff et al., 2008). In contrast to this result, the full-length glycoprotein of ANDV and PHV was found unable to inhibit IRF-3 activation by Sendai virus, but instead inhibited the Jak/Stat interferon signaling pathway (Spiropoulou et al., 2007). In line with this, another group reported that the N protein and GPC of ANDV did not result in inhibition of IFN induction seperately, but when N and GPC of ANDV were expressed together there was an inhibitory effect on IFN induction (Levine et al., 2010). IFN induction was inhibited robustly by GPC of SNV alone, and the IFN amplication by Jak/Stat signaling was inhibited by SNV GPC and by either N or GPC of ANDV (Levine et al., 2010). Moreover, the NSs of TULV and PUUV was found to act as a weak inhibitor of IFN response (Jääskelainen et al., 2007; Jääskelainen et al., 2008). In conclusion, different hantaviruses may use different mechanisms to inhibit the innate immunity response, and this mechanism appears to be independent of virus pathogenicity in humans.

4.6.2 Adaptive immunity

While the innate immunity serves as a first line defense system in nearly all multicellular organisms, the adaptive immunity functions as a more sophisticated, specific and longer-lasting immune system. The adaptive immunity consists of humoral immune response which involves antibody secretion by B cells and the cellular immune response including the T lymphocyte recognition system.

4.6.2.1 Humoral immune response and diagnostics

Antibodies produced by B lymphocytes include IgA, IgG, IgE, IgM and IgD. These antibodies circulate around the body in the blood and are present in other body fluids, where they can recognize and eliminate antigens or pathogens. After hantavirus infection, the virus elicits a stable and long-lasting humoral immune response involving all Ig classes. IgA is an antibody produced in the mucosa. In ANDV- and PUUV- infected patients the level of total and specific IgA has been reported to be elevated (de Carvalho Nicacio et al., 2001; Padula et al., 2000). IgE triggers the immediate allergic reations. The total IgE level was increased in patients with HFRS (Alexeyev et al., 1994). The virus-specific IgM directed against all three structure proteins (N, Gn, Gc) are present during the early phase of the disease and at decreasing levels during convalescence (Lundkvist et al., 1993). ELISA test based on recombinant N protein to detect hantavirus specific IgM is the most commonly used technique in diagnostics (Kallio-Kokko et al., 1998; Sjolander et al., 1997; Vapalahti et al., 1996). For PUUV diagnosis, besides the traditional immunofluorescence assay, a -capture enzyme immunoassay for IgM has been used routinely, and a point-of-care test for acute PUUV has been developed based on IgM detection (Hujakka et al., 2001; Vapalahti et al., 1996). IgG is the major class of circulating antibodies, and N proteins are the major target antigens followed by Gn and Gc (Kallio-Kokko et al., 2001; Vapalahti et al., 1995). Different hantaviruses have different epitope patterns, the cross-reactive epitope of HFRS virus N proteins was located within the first 118 amino acid N-terminal residues and the serotype-specific epitopes were located in the middle of the protein (Gott et al., 1997; Yoshimatsu et al., 1996). The Gn and Gc proteins also contain epitope regions, e.g. in SNV there is a serotype-specific epitope located at 59-89 aa from N termninus (Jenison et al., 1994). Both PUUV Gn and Gc contain at least one neutralizing epitope unique for PUUV (Lundkvist and Niklasson, 1992).

4.6.2.2 Cellular immune response

T lymphocytes together with natural killer cells, dendritic cells and macrophages can produce various cytokines or directly act on the pathogens. T lymphocytes play an important role in the pathogeneses of HFRS and HCPS. Upon hantavirus infection, the levels of IFN-, TNF-, IL-2 and IL-6 are increased, the amount of CD8+ cells is also increased, and a reversed CD4+/CD8+ ratio was detected (Linderholm et al., 1996). Also higher frequencies of SNV-specific T cells were found in patients with severe HCPS (Maes et al., 2004) which indicates that a higher amount of CD8+ correlated with more severe symptoms of the disease. Interestingly, human CD8+ T cells are generated during the acute phase of PUUV-HFRS, and these memory C8+ cells persist for 15 years after the acute phase without virus persistence (Tuuminen et al., 2007; Van Epps et al., 2002). These reports suggest that immunopathogenesis may have a role in the clinical syndrome caused by hantavirus infection. The natural killer (NK) cells also take part in the innate and adaptive immunity. After hantavirus infection changes in NK cells population were observed according to several reports, but the results are controversial. Significantly higher numbers of NK cells were observed in NE and HCPS patients (Linderholm et al., 1993; Nolte et al., 1995), whereas another group found no changes or decreased numbers (Lewis et al., 1991). Most recently it was reported that the NK cells expanded rapidly and remained at significantly elevated numbers for over two months (Bjorkstrom et al., 2011). Dendritic cells are the most important antigen-presenting cells. These cells can be infected by hantaviruses and the infection can upregulate the MHC (HLA), costimulatory and adhesion molecules (Raftery et al., 2002). HLA is expressed as a cell-surface antigen presenting protein, and is composed of two classes. HLA I is expressed in most cells and presents peptides from inside cells, thus directing CD8 cells to destroy the presenting cell. HLA II is expressed only by antigen-presenting cells and can attract CD4 cells. Several groups reported the association of HLA with susceptibility to hantavirus infection. HLA-B*3501 and B8-DRB1*03 were associated with severe symptoms of HCPS and NE while HLA-B27 was linked to

29 mild course of PUUV infection (Kilpatrick et al., 2004; Makela et al., 2002; Mustonen et al., 1996; Mustonen et al., 1998). Like the B cell epitopes, the N protein is the major viral target antigen for T cells, but Gn and Gc also have epitope regions recognized by T- cells.

5 Aims of the study

Hantaviruses have four structural proteins Gn, Gc, L and N. Each protein has its unique functions during virus replication. Our aim was to study the functions of Gn protein from different aspects, synthesis and degradation (I), interaction with N protein (II), and role in innate immunity (IV). In addition, we were interested in how the hantavirus activate IFN innate immunity.(III). The specific aims of each study were: I To study the degradation and aggresome formation of Gn protein. II To study the interaction between hantavirus Gn protein and N protein. III and IV To study the mechanisms of IFN immune response induction and evasion by Old World hantaviruses

6 Materials and Methods

Cell cultures and reagents (I - IV) Human embryonic kidney cells (HEK-293), African green monkey kidney epithelial cells (Vero E6) and human lung adenocarcinoma epithelial cells (A549) were maintained in modified Eagle's medium (MEM). 10% fetal bovine serum, 2 mM glutamine, 100 IU penicillin/ml and 100 µg streptomycin/ml were added into the medium. All cultures were grown at 37℃ in a humidified atmosphere containing 5%

CO2.

Virus infection and purification (III) Different viruses have been used including PUUV, TULV, DOBV, SEOV, SAAV and Semliki forest virus (SFV). All handling of live virus was performed in a laboratory of biosafety level 3 or 2. For infection, desired amounts of viruses were added to cell monolayers for absorption for 1 hour at 37℃, virus inocula were then removed and replaced with complete medium. For virus purification, growth medium collected 7-14 days after infection was cleared through a 0.22-m pore-size filter (Millipore), and virus particles were concentrated by pelleting through a 3-ml 30% (wt/vol) sucrose cushion (Beckman SW28 rotor; 27,000 rpm for 2 h at 4°C) in 10 mM HEPES, 100 mM NaCl, pH 7.4 buffer.

Plasmid constructions and transfections (I, II, IV) By using different programs (HMMTOP, TMHMM, SOSUI AND TMPRED) (Hirokawa et al., 1998; Hofmann and Stoffel, 1993; Krogh et al., 2001; Tusnady and Simon, 2001), the region of Gn-CT was chosen (aa residues 521 to 653). TULV, PUUV and PHV Gn-CT were fused in-frame with enhanced GFP (eGFP) in the peGFP-C1 (Clontech) vector. The TULV Gn-CT was also fused with pCMV-HA

(Clontech). The TULV Gn-CT proteins, lacking 21 or 34 residues from the C terminus, were fused to eGFP in the peGFP-C1 vector. The expression plasmids for GST-tagged TULV Gn-CT and truncated TULV Gn-CT were constructed by inserting PCR fragments into the pGEX-4T-3 vector (GE Healthcare). The N protein of TULV was cloned into pcDNA3 (Invitrogen) plasmid and pCMV-HA plasmid. Point mutations were introduced into pGEX-4T-3-CT and pcDNA3-TULV-N plasmids using a site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. Lipofectamine 2000 (Invitrogen) and TranIT (Mirus) transfection reagent were used to transfect vectors into cells according to the manufacturer's instructions.

Immunoblotting (I, II,IV) Cells were collected and lysed in radioimmunoprecipitation buffer (150 mM sodium chloride, 50 µM Tris/HCl pH 7.5, 0.2% SDS, 0.5% deoxycholate, 1% NP-40). Ten micrograms of total protein from each sample were run on 12% SDS-PAGE and electroblotted on to a nitrocellulose membrane. Proteins were probed with a primary antibody followed by three washes with TENT buffer (0.05% Tween 20; 20 mM Tris-HCl; pH 8, 1 mM EDTA; 50 mM NaCl). Then the secondary antibody was used to blot the proteins. After three washes with TENT buffer the proteins were detected by enhanced chemiluminescence.

Immunofluorescence and confocal microscopy analysis (I, III) Cells were grown on coverslips in 24-well plates and transfected with different constructs. Later, the cells were washed and fixed with 3.5% paraformaldehyde in PBS for 20 min at room temperature, permeabilized and blocked with 3% BSA and 0.1% Triton X-100 in PBS. The cells were stained with primary antibody for one hour, then washed three times with PBS, stained with fluorescein-conjugated secondary antibodies, and observed under a fluorescence or confocal microscope (Leica SP2).

Antibodies and reagents (I, II, III) 33

Primary antibodies: Anti-green fluorescent protein (GFP) (Sigma); anti-β-actin primary antibody (Sigma); anti-hemagglutinin (HA) (Abcam); mouse anti-vimentin; mouse anti--tubulin (from Erkki Hölttä, University of Helsinki); TULV N specific monoclonal antibodies (MAb) 1C12 (from Ake Lundkvist, Stockholm); anti-FLAG antibodies (Sigma); mouse monoclonal antibody J2 (Scicons); patient serum against PUUV (local); antibody against SFV (anti-SFV) (from Ari Hinkkanen, University of Kuopio). Secondary antibodies: anti-mouse IgG red-fluorescent Alexa Fluor 555 (Invitrogen); anti-mouse HRP (DAKO); anti-mouse Dylight680 conjugate (Pierce Biotechnology); FITC-labeled anti-human IgG (DAKO); FITC-labeled anti-rabbit IgG (DAKO). Reagents: proteasomal inhibitors MG-132, ALLN, lactacystin and protein synthesis inhibitor cycloheximide (CHX) (Sigma); Sepharose 4B glutathione beads (GE Healthcare); calf intestinal alkaline phosphatase (CIP) (Finzyme); 5'-phosphate-dependent exonuclease (Epicentre Biotechnologies).

Flow cytometry protocol (I). Cells were transfected with eGFP-TULV-Gn-CT and treated overnight with 25 µM ALLN. Cells were collected, fixed with 3% paraformaldehyde (PFA) and washed with PBS. The percentage of GFP-positive cells after various treatments was calculated using flow cytometry (The Flow Cytometry Facility, Haartman Institute, University of Helsinki).

GST pull-down assay (II) E. coli (BL21) transformed with GST-tagged Gn-CT constructs were grown in

300 ml of LB medium containing 0.1 mg/ml ampicillin. When the value of A600 reached 0.6, the bacteria were induced with 1 mM isopropyl--D-1-thiogalactopyranoside (IPTG) for 5 h and then harvested by centrifugation at 7000 × g for 10 min and resuspended in lysis buffer (10 mM Tris pH

8.0, 150 mM NaCl, 50 mg/ml lysozyme, with or without 1 mM EDTA). After addition of 5 mM dithiothreitol and 1.5% N-lauroylsarcosine, cells were sonicated briefly and lysates were cleared by centrifugation at 10,000 × g for 5 min at 4°C. Supernatant was adjusted to 2% Triton X-100, incubated at 4°C for 1 h and bound to Sepharose 4B glutathione beads (GE Healthcare). Beads were washed three times for 10 min with cold STE buffer (10 mM Tris pH 8.0, 150 mM NaCl with or without 1 mM EDTA). Precleaned HEK 293-cell lysates which express the N protein were incubated with slurry of GST-bound Sepharose 4B glutathione beads overnight at 4°C with end-over-end mixing and the beads were washed five times with 1 ml of ice-cold ST buffer (10 mM Tris pH 8.0, 150 mM NaCl). Supernatants and beads were then mixed with SDS-PAGE gel-loading buffer, boiled and analyzed by SDS-PAGE followed by immunoblotting.

RT-PCR (III)

Primer Nucleotide sequence Target gene, and expected size (bp) SEOMF1936 GTGGACTCTTCTTCTCATTATTG SEOV, M gene, 417

SEOMR2353 TGGGCAATCTGGGGGGTTGCA

DOBV/SAAVMM1674F TGTGAI(A/G)TITGIAAITAIGAGTGTGA DOBV, SAAV, M gene, 316 DOBV/SAAVMM1990R TCIG(A/C)TGCI(G/C)TIGCIGCCCA

PUUVSF532 TCATTTGA(A/G)GA(G/T)ATCAATGGCAT PUUV, S gene, 665

PUUVSR1197 CCCATTCCAACATAAACAGTAGG

TULVSF894 GATTGATGACTTGATTGATCTTGC TULV, S gene, 473

TULVSR1367 ATGTGTRTGTGTGTATGCAGGAAC

FLUMF25 AGATGAGTCTTCTAACCGAGGTCG Influenza A, M gene, 349 FLUMR324 TGCAAAAACATCTTCAAGTCTCTG

Table 1. Primers used RT-PCR.

Reverse transcription was performed with 1 l RevertAid M-MuLV Reverse Transcriptase (Fermentas) and 0.5 g random hexanucleotides in 20 l reaction mixture include 0.5 l RNase inhibitor and 1mM dNTP. The resulting cDNA was amplified by 30 cycles of PCR, with each cycle consisting of 1 min at 95℃, 1 min at 50℃, and 1 min at 72℃, followed by a final step for 10 min at 72℃.

Reporter gene assay (III, IV) Subconfluent HEK-293 cell monolayers grown in 24-well dishes were transfected with 0.15 g of IFN-promoter luciferase reporter construct (p125-Luc) and 0.5 ng of constitutively active Renilla luciferase expression vector (pRL-SV40) in 50 l OptiMEM (Gibco-BRL) using 3 l Lipofectamine 2000 (Invitrogen) per g DNA. After 6 h at 37°C, cells were transfected either with 0.5 g of viral RNA or with 0.5 of g poly I:C using 3 l Lipofectamine 2000 (Invitrogen) per g RNA prepared in 50 l OptiMEM. At 18 h post transfection, the luciferase activities were determined using the Dual-Luciferase Reporter Assay System (Promega) and multilabel reader (Wallac). (III) HEK-293 cells (20,000 cells/well) were seeded in 96-well plate and were cotransfected on the following day with p125-Luc60 ng), pRL-SV40 (60 ng), indicated amount of viral protein expression vectors and also 60 ng of expression construct which can activate innate immune pathway including TBK-1 construct, RIG-I construct, MyD88 and IRF-7 constructs, TRIF construct, IKK and IRF-3 constructs (from Illka Julkunen, KTL). The transfection was done following the manufacturer's instructions of TransIT tranfection reagent (Mirus). The total amount of plasmid transfected was kept constant by using empty vector (peGFP-C1 or pCMV-HA). At 24 hours posttransfection luciferase activities were determined using the Dual-Luciferase Reporter Assay System (Promega) and multilabel reader (Wallac). (IV)

7 Results

7.1 Fate of Gn-CT of the apathogenic Tula hantavirus and its role in virus assembly

7.1.1 Degradation and aggresome formation of Gn-CT (I)

The Gn-CT of TULV is proteasomally degraded To determine whether the Gn-CT of TULV is proteasomally degraded, TULV Gn-CT (residues 521 to 653) was fused to the C-terminus of enhanced green fluorescent protein (eGFP). HEK-293 cells, transfected with this construct, were treated with proteasome inhibitors (ALLN, lactacystin, MG-132) separately. Proteasome inhibition is known to stabilize proteins that are destined for degradation by the proteasome (Coux et al., 1996). The expression level of eGFP-TULV-Gn-CT was nearly undetectable when the cells were treated with DMSO, but increased after treatment with proteasomal inhibitors (I, Fig. 2A). To define whether the TULV Gn-CT colocalizes with ubiquitin which is known to be associated with degrading proteins, eGFP-TULV-Gn-CT and hemagglutinin (HA)-tagged ubiquitin were cotranfected into HEK-293 cells. Twenty-four hours later the cells were treated with DMSO or proteasome inhibitor ALLN overnight. Ubiquitin was detected by staining with anti-HA antibody. Confocal microscopy was used to study the colocalizaton of the these two proteins. Colocalizaton was observed when the cells were treated with the proteasomal inhibitor, while partial colocalization was seen when they were DMSO treated (I, Fig. 2B). To check whether the degradation signal resides within the C-terminus of TULV Gn-CT, TULV Gn-CT protein lacking 21 or 34 residues from the C-terminus were fused to eGFP. HEK-293 cells were transfected with these constructs or the full-length eGFP-Gn-CT. 24 hours after transfection, the cells were treated either with 25M ALLN or DMSO overnight. The deletion of 21 or 34 residues from the C-terminus

37 completely stabilized the protein expression (I, Fig. 2C). These results suggest that the Gn-CT of TULV is directed to degradation through the ubiquitin-proteasome pathway and that the C-terminal 21 residues of TULV Gn-CT are required for the proteasomal degradation.

The Gn-CT of other apathogenic and pathogenic hantaviruses is degraded by proteasomes HEK-293 cells were transfected with eGFP-PHV Gn-CT and eGFP-PUUV Gn-CT, and treated with MG132 or ALLN separately as described above. Unexpectedly, the PHV hantavirus Gn-CT was also degraded (I, Fig. 3), which contradicts a previous reports (Sen et al., 2007) while the PUUV Gn-CT was degraded, as expected (I, Fig. 3). Furthermore, another cell line was used to test the degradation property of TULV, PHV and PUUV Gn-CT. Vero E6 cells were transfected with eGFP-TULV-Gn-CT, eGFP-PHV-Gn-CT and eGFP-PUUV Gn-CT, and the cells treated with DMSO, CHX, MG132, or MG132+CHX. Similarly, the Gn-CT of PHV, TULV and PUUV were degraded in VeroE6 cells and the tail protein level was maintained by continuous synthesis and rapid degradation (I, Fig. 4). In addition, we compared the results from the two different cells described above by performing FACS assay. Vero E6 and HEK-293 cells transfected with eGFP-TULV Gn-CT and were treated overnight with 25 M ALLN. The percentage of GFP-positive cells calculated using flow cytometry further confirmed our previous result that the Gn-CT of TULV was not degraded when treated with proteasome inhibitors (I, Fig. 5).

TULV Gn-CT forms aggresomes upon treatment with proteasomal inhibitor fter treatment with proteasomal inhibitor, we found that TULV Gn-CT formed aggresome-like structure. Further, we found that the TULV Gn-CT protein colocalized with -tubulin, an microtubule-organising centre (MTOC) marker, after treatment with ALLN (I, Fig. 6A). Since aggresome formation is dependent on transport along 38 microtubules, nocodazole can inhibit the formation of aggresomes leading to the dispersion of aggregates throughout the cytoplasm. HEK-293 cells transfected with eGFP-Gn-CT were treated overnight with DMSO, 25 M MG-132 and/or 1g/ml nocodazole (NOC). Cells were observed under a fluorescence microscope. The treatment of transfected HEK-293 cells with nocodazole together with MG-132 prevented the formation of MG-132-induced accumulation of TULV Gn-CT protein into aggresomes and instead induced the dispersion of these structures diffusely to the cytoplasm (I, Fig. 6B). The percentage of large aggresome-containing cells in nocodazole and MG-132 treated samples was lower than in cells treated only with MG-132 (I, Fig. 6C). These results showed that, when overexpressed, TULV Gn-CT translocated to the aggresomes formed.

7.1.2 Interaction between Gn tail and N protein (II)

First, the interaction between Gn-CT and N protein was studied. The Gn-CT was expressed as a GST-fusion protein in E. coli and bound to glutathione beads (II, Fig. 2 A). The N protein was expressed in HEK-293 cells (II, Fig. 2 B). To establish the GST pull-down assay, we observed the pull-down of N protein with the Gn-CT in different dilutions of the initial N protein-fractioning lysate (II, Fig.3). Notably, the treatment of the N protein-containing lysates with RNase (that left no cellular RNA of any substantial length intact) did not influence the efficiency of pull-down assay (II, Fig. 4 A, 4 B). This suggested that, to interact with the Gn-CT in these experimental settings, the N protein does not need to be a part of long RNP structures formed via nonspecific encapsidation of cellular RNA.

Analysis of the Gn-CT/N interaction: cytoplasmic tail of the Gn protein We analyzed the two structure-functional elements within the Gn-CT: zinc finger motifs and ITAM motifs. As known, EDTA can chelate Zn2+ cations thus disrupting the structure of zinc fingers. The standard buffer used in experiments described in II, Fig. 3

39 contained 1 mM EDTA. Therefore, in subsequent experiments EDTA was omitted from all buffers and the beads with attached Gn-CT were treated with 100 M ZnSO4. We found that the amount of pulled-down N protein in ZnSO4-treated samples was substantially higher than in EDTA-treated samples thus suggesting that the concentration of Zn2+ cations is important for the Gn-CT/N interaction (II, Fig. 5 A). Next, zing finger motifs were destroyed by point mutations, and the resulting constructs were analyzed in the modified pull-down assay (EDTA omitted and the

Gn-CT-beads treated with ZnSO4). The results showed that both zinc fingers should stay intact for successful pull-down (II, Fig. 5 B). Introduction of H->Q and C->S mutations in two HxxxC motifs (H566Q,C570S); (H592Q,C596S) totally abolished the Gn-CT/N interaction, and the double hit (C575S,C578S,H592Q,C596S) abolished the interaction as well. Two deletion mutants were made to partially/totally destroy the conserved ITAM motifs in the Gn-CT. In one of the mutants 21 C-terminal aa residues, which included the second YxxL-sequence, were deleted. In another mutant, GST-CTΔ34, both ITAMs were deleted. Both mutants with deletions retained the capability to pull-down the N protein (Fig. 5 C). Taken together, these results indicated that zinc finger motfs but not ITAM motifs are crucial for its interaction with the N protein.

Analysis of the Gn-CT/N interaction: the N protein The N-terminal domain (aa 1-79) and C-terminal domain (aa 370- 429) of hantaviral N protein are involved in oligomerization. The central part of the N protein is thought to carry the RNA-binding domain (Fig 1). To find out which domain in the N protein is involved in the interactions with the Gn-CT, several N protein mutants were tested in the pull-down assay (II, Fig. 1 B). First, several mutations and deletions were made to evaluate the role of the C-terminus of N protein in the Gn interaction (NΔC25 (N1-404), NΔC31 (N1-398), NΔC100 (N1-329), and two point mutants, I380A,I381A and W388A). None of the deletions and mutations affected the ability of the N protein to be pulled-down (II, Fig. 6 A; only some of the results are shown). Another three deletions were made to evaluate the possible contribution of the 40

N-terminal and central N protein domains; three more constructs were created (N(D1), N(D2), N(D1D2)) (II, Fig. 2 B). Of these three proteins, only D1 (aa 1-79) could not be pulled-down (II, Fig. 6 B). These results showed that the D2 (aa 80-248) domain which is the central domain of N protein is both critical and sufficient for the interaction with Gn-CT.

7.2 Regulation of interferon response by Old World hantaviruses

7.2.1 Viral dsRNA production and genomic RNA of hantavirus (III)

There are no detectable amounts of dsRNA in cells infected with hantaviruses The presence of dsRNA in hantavirus-infected Vero E6 cells was detected by dsRNA-specific mouse monoclocal antibody J2. Cells infected with different hantaviruses (SEOV, DOBV, SAAV, PUUV, TULV) or Semliki forest virus (SFV) were stained with J2 antibody and virus specific antibody. Strong dsRNA signals were observed in the cells transfected with poly I:C and also in the cells infected with SFV. In contrast no dsRNA was detected after SEOV, DOBV, SAAV, PUUV or TULV infection (III, Fig. 1). Meanwhile, all these viruses replicated efficiently as shown by the expression of viral protein. Thus, hantavirus-infected cells did not produce any detectable amounts of dsRNA.

Hantavirus genomic RNAs contain 5'monophosphate and can not activate RIG-I-dependent IFN- induction SEOV, DOBV, SAAV, PUUV and TULV viruses were purified and their viral genomic RNAs were isolated. The viral RNAs were incubated with exonuclease for four hours or were mock treated. This 5'-3'-exonuclease specifically digests ssRNA bearing 5'-monophosphate. RT-PCR was performed to detect viral RNAs with and without exonuclease treatment. We found that the genomic RNA of influenza A virus could still be detected after digestion while the genomic RNAs of SEOV, DOBV, SAAV, PUUV and TULV were degraded which suggested that the 5’-termini of all 41 hantaviruses tested are 5’-monophosphorylated (III, Fig. 2). The IFN-promoter reporter gene assay was also used in the experiments. The transfection of genomic RNAs of SEOV, DOBV, SAAV, PUUV and TULV did not cause any IFN-induction (III, Fig. 3).

7.2.2 Hantavirus Gn-CT inhibits the activation of IFN- immune response (IV)

TULV Gn-CT but not N protein inhibits TBK-1-directed IFN activation. HEK-293 cells grown in 96-well plates were cotransfected with constitutively active TBK-1 construct and IFN- promoter reporter construct. Cotransfection with pCMV-N expressing HA-tagged N protein had no effect on TBK-1 directed IFN-transcriptional activation, while the expression of GFP tagged Gn-CT inhibited IFN-transcription and increasing amounts of Gn-CT protein resulted in decrease in IFN-transcription (IV, Fig. 1). These results indicate that the TULV Gn-CT but not the N protein can inhibit the TBK-1 directed IFN-activation. In addition, the Gn-CT fused with different tags was tested. Cotransfecting cells with constitutively active TBK-1, RIG-I construct and pCMV-CT resulted in a decrease in TBK-1 and RIG-I directed IFN-activation (IV, Fig. 2 A and 2 B)

TULV Gn-CT can inhibit TRIF-, MyD88/IRF-7- and IKK-directed IFN activation but not IRF-3-directed IFN activation The PRRs are comprised of two main groups: the Toll-like receptors (TLRs) and retinoic acid-inducible gene I-like RNA helicases (RLHs). The above results showed that the RLH pathway was inhibited by Gn-CT. Most TLRs recruit MyD88 to transmit the immunity response while TLR3 signaling is through the recruitment of TRIF. To investigate whether Gn-CT is involved in the inhibition of the TLR pathways, MyD88/IRF-7 expression construct or TRIF construct were cotransfected with pCMV-CT. As shown (IV, Fig. 3a and 3b), the expression of pCMV-CT inhibited IFN activation in a dose dependent way. These results suggest that Gn-CT is not only

42 involved in the inhibition of RLH pathway but also TLR pathway. To further identify the downstream target of Gn-CT, we used constitutively active IKKand IRF-3 constructs. IKKtogether with TBK-1 are two kinases that have been demonstrated to directly phosphorylate and activate IRF-3 and IRF-7. As shown (IV, Fig. 3c and 3d), Gn-CT inhibited the IKKdirected but not IRF-3 directed IFN activation. Taken together, these results suggest that TULV Gn-CT inhibit IFN transcriptional activation upstream of IRF-3 phosphorylation and at the level of TBK-1/IKK and MyD88/IRF-7 complex.

8 Discussion

8.1 Analysis of the Gn protein sequence alignment and the selection of Gn-CT

region

Based on the sequence analysis of hantavirus Gn protein (Fig 2), the region 521-653 aa was selected as the Gn-CT and used in projects I, II, IV. As shown in Fig 2, the pairs TULV/ PUUV, SNV/ANDV, and HTNV/SEOV represented three major groups of hantaviruses associated, respectively, with Cricetid/Arvicoline, Cricetid/Neotomine-Sigmodontine, and Murid/Murine rodents. Gn-CT protein is highly conserved among different hantaviruses with >40% sequence conservation, and most of the aa residues important for maintaining the 3D structure such as cysteines, bulk aromatic, hydrophobic and charged residues, as well as glycines and prolines are identical in all hantavirus sequences. The two zinc finger motifs are conserved in all hantaviruses while the ITAM is conserved in Tula and Sin Nombre- and Andes-like viruses. Such a conservation suggests a similar mode of folding, and hence similar or even identical function, of the Gn-CT in different hantavirus species.

8.2 Degradation and aggresome formation of Gn-CT may be a general property

of most hantaviruses

As described in the results section, we observed degradation of TULV and PHV Gn-CT both in human HEK-293 and simian Vero E6 cells and the hantavirus Gn-CT had a tendency to self-associate into large protein aggregates. It was reported that when SNV Gn full-length protein expressed in the absence of Gc it has the tendency to form SDS-stable oligomers (Spiropoulou et al., 2003). Such multimers could also be seen in immunoprecipitation experiments of the HTNV Gn (Antic et al., 1992;

Hooper et al., 2001; Pensiero and Hay, 1992), and the SNV Gn protein was found in aggresomes when overexpressed (Spiropoulou et al., 2003). Taken together the results and other reports, however, suggest that the degradation and aggregation of the envelope protein Gn may be a general property of most hantaviruses and is unrelated to pathogenicity.

8.3 The role of ITAM and zinc finger motifs in the interaction of N and Gn-CT

We found that the ITAM motifs carried by Gn-CT can be removed without affecting the capability of the tail to interact with N (II). In contrast, zinc fingers appeared to be crucial for the interaction. The mutations of either of the two zinc fingers totally abolished the Gn-CT/N interaction. These results supported the idea that, unlike other type zinc fingers forming a "beads-on-a-string" configuration, the hantavirus Gn-CT zinc fingers fold into unique, compact stucture (Estrada et al., 2009). The data on the modeling of Gn-CT (II, Fig. 6) also supported this notion: two quartets of Zn-coordinating aa residues are located in close proximity. The tight fold of the whole zinc finger domain could explain the results of experiments with EDTA treatment (II, Fig. 4) in which the interacting capability of the Gn-CT was not totally abolished; it seemed that a portion of Zn2+ cations remained in contact with cysteine and histidine residues thus helping to maintain correct folding of at least some Gn-CT molecules.

8.4 The role of hantavirus RNA in the induction of innate immunity

As shown in results section, we found that Old World hantaviruses do not produce detectable amounts of dsRNA in infected cells and the 5’-termini of their genomic RNAs are monophosphorylated. These results suggest that the hantavirus RNA may be only minimally involved in the induction of innate immunity. In accordance with this presumption, UV-inactivated Sin Nombre virus can activate the

45 innate immunity response at early time points post infection in HUVEC cells considering that the UV irradiation could dramatically destroy the integrity of RNA (Prescott et al., 2010; Prescott et al., 2005). However, there are also several contradictory reports: UV-inactivated PHV, ANDV and HTNV viruses were reported to be unable to induce the innate immunity; and the TLR3 was needed for HTNV to trigger IFN innate immunity induction (Handke et al., 2009; Spiropoulou et al., 2007). In addition, we can not exclude the possibility that the amounts of dsRNA produced by hantaviruses are below our detection limit since one molecule of dsRNA per cell can activate IFN production (Marcus and Sekellick, 1977). Therefore, whether hantavirus RNAs are actually involved in the innate immunity induction needs further characterization.

8.5 The role of Gn-CT of TULV in inhibition of innate immunity

Hantavirus Gn are reported to be involved in the inhibition of both IFN-induction and signaling. Gn-CT of NY-1V was found to coprecipitate the N-terminal domain of TRAF3 and disrupt the formation of TRAF3-TBK1 complex, thus regulating the RIG-I and TBK-1 directed immune response (Alff et al., 2006; Alff et al., 2008). The Gn of both ANDV and PHV were shown to inhibit nuclear translocation of STAT-1 (Spiropoulou et al., 2007). Most recently, it was reported that IFN-β induction is inhibited of coexpression of ANDV N protein and GPC and is robustly inhibited by SNV GPC alone. Downstream amplification by Jak/STAT signaling is also inhibited by SNV GPC and by either NP or GPC of ANDV (Levine et al., 2010). In addition, it has been reported that the TLR3 and TLR4 are involved in the HTNV-induced innate immunity, but the mechanism remains unknown (Handke et al., 2009; Jiang et al., 2008). TLRs mediate the signal transduction through two possible ways, Myd88 and TRIF. TLR4 operates both through the MyD88 and TRIF pathways, TLR3 signals through TRIF and all the other TLRs mediate through the MyD88 pathway (Amati et al., 2006; Foster et al., 2007; O'Neill, 2006; Pandey and

Agrawal, 2006) (Fig. 3). TRIF and RLH pathways converge on the formation of TBK1/IKKϵ complex thus catalyzing the phosphorylation of IRF-3 and IRF-7. MyD88 activates IFN through another pathway: it interacts directly with IRF-7 to activate the signaling pathway (Fig 3). Cotransfection of expression plasmids for MyD88 and IRF-7 together with the IFN- promoter-driven reporter gene would strongly induced the reporter gene. In our study these two major pathways, TBK1/IKK and MyD88/IRF-7, were assessed. We found that TULV Gn-CT can inhibit the signaling transduction through these two major pathways.

9 Concluding remarks

Recently the hantavirus Gn protein has been studied extansively by several groups, but still many questions remain unknown. Our study on Gn protein included different aspects, synthesis and degradation (I), interaction with N protein (II), and role in innate immunity (IV). Also we carried out a project to study how the hantavirus induces innate immunity (III). In this thesis, we first found the Gn-CT of the apathogenic hantaviruses (TULV, PHV) are degraded through the ubiquitin-proteasome pathway both in human HEK-293 and simian Vero E6 cells and TULV Gn-CT formed aggresome upon treatment of proteasomal inhibitors. Second, we found that the TULV Gn-CT fused with GST tag expressed in bacteria could pull-down the N protein expressed in mammalian cells and that the zinc finger motifs in Gn-CT and RNA binding motif in N protein are indispensable for the interaction. Third, we found that Old World hantaviruses do not produce detectable amounts of dsRNA in infected cells and the 5’-termini of their genomic RNAs are monophosphorylated. The hantavirus RNA may be only minimally involved in the induction of innate immunity. Finally, we found that the Gn-CT of TULV inhibits the IFN transcriptional activation through TLR and RLH pathway and that the inhibition target lies at the level of TBK-1/IKK complex and MyD88/IRF-7 complex.

10 Future prospects

As the mechanism hantaviruses use to activate innate immunity remains unknown, in the future studies, this should be investigated in more detail. It has been reported recently that short double-stranded RNA/DNA without tri-ppp can activate the RIG-I response, thus whether the panhandle structure of hantavirus genomic RNA may activate the innate immunity is an open question and needs to be studied later. In addition, the viral transcript (mRNA) has been reported to be able to activate innate immunity after RNase L digestion (Luthra et al., 2011). Does the hantavirus mRNA also have a similar effect? This also should be investigated in more detail. Furthermore, currently there are no unified conclusions on the inhibitory effect of different hantavirus glycoproteins. Is the inhibitory effect related to the pathogenesis? How is the difference generated? Studies comparing all the known hantavirus glycoproteins should be carried out to create a comprehensive picture.

11 Acknowledgements

The work was carried out in the Department of Virology, Haartman Institute, University of Helsinki. I would like to thank the head of Haartman Institute, Professor Seppo Meri for your most kind support and the head of Department of Virology Professor Kalle Saksela for providing an excellent environment for research. I thank Docent Tero Ahola and Docent Sampsa Matikainen for reviewing the manuscript of this thesis and providing valuable comments to improve it. I thank my supervisor Professor Antti Vaheri for his great support. You recruited me to your research team five years ago, and during these five years, your wealth of knowledge, your constant support, your sense of humor, your generosity, your immense patience guide me through. I really appreciated that. I thank docent Alexander Plyusnin, you helped me when the most difficult time. There is a Chinese proverb: “Send coal in snowy weather”, thanks for your generous support. I thank docent Hilkka Lankinen for your constant support, critical comments and valuable suggestions. I thank for the collaborators: Maarit Sillanpää and Professor Ilkka Julkunen for your valuable contributions. I thank Professor Olli Vapalathi for the discussion and suggestions. I thank Tomas and Jussi H. We shared so much time together, did experiments, discussed and had fun. Really appreciate your company through all these years. With that wish both of you have a wonderful career and a sweet family. I thank all my colleagues: Agne, Angelina, Anna, Anu, Jussi S, Pertteli, Lev, Kirsi, Maria, Erika, Suvi, Satu, Tarja….. I thank all my Chinese friends, especially Miao Yin. You are the first Chinese I met in Helsinki, and I have to say that you are just like my brother although actually I don’t have one. Wish you good luck for everything. And all my Chinese friends. Sorry I can not list you all. Thank you all, my friends. I would like to thank my parents, I finally realize your love after all these years living in another country.

12 References

Alexeyev, O.A., Ahlm, C., Billheden, J., Settergren, B., Wadell, G. and Juto, P. (1994) Elevated levels of total and Puumala virus-specific immunoglobulin E in the Scandinavian type of hemorrhagic fever with renal syndrome. Clin Diagn Lab Immunol 1(3), 269-72. Alfadhli, A., Steel, E., Finlay, L., Bachinger, H.P. and Barklis, E. (2002) Hantavirus nucleocapsid protein coiled-coil domains. J Biol Chem 277(30), 27103-8. Alff, P.J., Gavrilovskaya, I.N., Gorbunova, E., Endriss, K., Chong, Y., Geimonen, E., Sen, N., Reich, N.C. and Mackow, E.R. (2006) The pathogenic NY-1 hantavirus G1 cytoplasmic tail inhibits RIG-I- and TBK-1-directed interferon responses. J Virol 80(19), 9676-86. Alff, P.J., Sen, N., Gorbunova, E., Gavrilovskaya, I.N. and Mackow, E.R. (2008) The NY-1 hantavirus Gn cytoplasmic tail coprecipitates TRAF3 and inhibits cellular interferon responses by disrupting TBK1-TRAF3 complex formation. J Virol 82(18), 9115-22. Alminaite, A., Halttunen, V., Kumar, V., Vaheri, A., Holm, L. and Plyusnin, A. (2006) Oligomerization of hantavirus nucleocapsid protein: analysis of the N-terminal coiled-coil domain. J Virol 80(18), 9073-81. Amati, L., Pepe, M., Passeri, M.E., Mastronardi, M.L., Jirillo, E. and Covelli, V. (2006) Toll-like receptor signaling mechanisms involved in dendritic cell activation: potential therapeutic control of T cell polarization. Curr Pharm Des 12(32), 4247-54. Andrejeva, J., Childs, K.S., Young, D.F., Carlos, T.S., Stock, N., Goodbourn, S. and Randall, R.E. (2004) The V proteins of paramyxoviruses bind the IFN-inducible RNA helicase, mda-5, and inhibit its activation of the IFN-beta promoter. Proc Natl Acad Sci U S A 101(49), 17264-9. Antic, D., Wright, K.E. and Kang, C.Y. (1992) Maturation of Hantaan virus glycoproteins G1 and G2. Virology 189(1), 324-8. Avsic-Zupanc, T., Xiao, S.Y., Stojanovic, R., Gligic, A., van der Groen, G. and LeDuc, J.W. (1992) Characterization of Dobrava virus: a Hantavirus from Slovenia, Yugoslavia. J Med Virol 38(2), 132-7. Bjorkstrom, N.K., Lindgren, T., Stoltz, M., Fauriat, C., Braun, M., Evander, M., Michaelsson, J., Malmberg, K.J., Klingstrom, J., Ahlm, C. and Ljunggren, H.G. (2011) Rapid expansion and long-term persistence of elevated NK cell numbers in humans infected with hantavirus. J Exp Med 208(1), 13-21. Braam, J., Ulmanen, I. and Krug, R.M. (1983) Molecular model of a eucaryotic transcription complex: functions and movements of influenza P proteins during capped RNA-primed transcription. Cell 34(2), 609-18. Brummer-Korvenkontio, M., Henttonen, H. and Vaheri, A. (1982) Hemorrhagic fever with renal syndrome in Finland: ecology and virology of nephropathia epidemica. Scand J Infect Dis Suppl 36, 88-91. Brummer-Korvenkontio, M., Vaheri, A., Hovi, T., von Bonsdorff, C.H., Vuorimies, J., Manni, T., Penttinen, K., Oker-Blom, N. and Lahdevirta, J. (1980) Nephropathia epidemica: detection of antigen in bank voles and serologic diagnosis of human infection. J Infect Dis 141(2), 131-4. Cifuentes-Munoz, N., Barriga, G.P., Valenzuela, P.D. and Tischler, N.D. (2010) Aromatic and polar

residues spanning the candidate fusion peptide of the andes virus Gc protein are essential for membrane fusion and infection. J Gen Virol. Coux, O., Tanaka, K. and Goldberg, A.L. (1996) Structure and functions of the 20S and 26S proteasomes. Annu Rev Biochem 65, 801-47. de Carvalho Nicacio, C., Sallberg, M., Hultgren, C. and Lundkvist, A. (2001) T-helper and humoral responses to Puumala hantavirus nucleocapsid protein: identification of T-helper epitopes in a mouse model. J Gen Virol 82(Pt 1), 129-38. Dhar, R., Chanock, R.M. and Lai, C.J. (1980) Nonviral oligonucleotides at the 5' terminus of cytoplasmic influenza viral mRNA deduced from cloned complete genomic sequences. Cell 21(2), 495-500. Earle, D.P. (1954) Symposium on epidemic hemorrhagic fever. Am J Med 16, 617-709. Elliott, L.H., Kiley, M.P. and McCormick, J.B. (1984) Hantaan virus: identification of virion proteins. J Gen Virol 65 ( Pt 8), 1285-93. Elwell, M.R., Ward, G.S., Tingpalapong, M. and LeDuc, J.W. (1985) Serologic evidence of Hantaan-like virus in rodents and man in Thailand. Southeast Asian J Trop Med Public Health 16(3), 349-54. Estrada, D.F., Boudreaux, D.M., Zhong, D., St Jeor, S.C. and De Guzman, R.N. (2009) The Hantavirus Glycoprotein G1 Tail Contains Dual CCHC-type Classical Zinc Fingers. J Biol Chem 284(13), 8654-60. Estrada, D.F. and De Guzman, R.N. (2011) Structural characterization of the Crimean-Congo hemorrhagic fever virus Gn tail provides insight into virus assembly. J Biol Chem. Flick, K., Hooper, J.W., Schmaljohn, C.S., Pettersson, R.F., Feldmann, H. and Flick, R. (2003) Rescue of Hantaan virus minigenomes. Virology 306(2), 219-24. Foster, S.L., Hargreaves, D.C. and Medzhitov, R. (2007) Gene-specific control of inflammation by TLR-induced chromatin modifications. Nature 447(7147), 972-8. Gajdusek, D.C. (1962) Virus hemorrhagic fevers. Special reference to hemorrhagic fever with renal syndrome (epidemic hemorrhagic fever). J Pediatr 60, 841-57. Garcin, D., Lezzi, M., Dobbs, M., Elliott, R.M., Schmaljohn, C., Kang, C.Y. and Kolakofsky, D. (1995) The 5' ends of Hantaan virus (Bunyaviridae) RNAs suggest a prime-and-realign mechanism for the initiation of RNA synthesis. J Virol 69(9), 5754-62. Gavrilovskaya, I.N., Peresleni, T., Geimonen, E. and Mackow, E.R. (2002) Pathogenic hantaviruses selectively inhibit beta3 integrin directed endothelial cell migration. Arch Virol 147(10), 1913-31. Gavrilovskaya, I.N., Shepley, M., Shaw, R., Ginsberg, M.H. and Mackow, E.R. (1998) beta3 Integrins mediate the cellular entry of hantaviruses that cause respiratory failure. Proc Natl Acad Sci U S A 95(12), 7074-9. Geimonen, E., LaMonica, R., Springer, K., Farooqui, Y., Gavrilovskaya, I.N. and Mackow, E.R. (2003) Hantavirus pulmonary syndrome-associated hantaviruses contain conserved and functional ITAM signaling elements. J Virol 77(2), 1638-43. Geimonen, E., Neff, S., Raymond, T., Kocer, S.S., Gavrilovskaya, I.N. and Mackow, E.R. (2002) Pathogenic and nonpathogenic hantaviruses differentially regulate endothelial cell responses. Proc Natl Acad Sci U S A 99(21), 13837-42. Gitlin, L., Barchet, W., Gilfillan, S., Cella, M., Beutler, B., Flavell, R.A., Diamond, M.S. and Colonna, M. (2006) Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavirus. Proc Natl Acad Sci U S A 103(22), 8459-64. Goldsmith, C.S., Elliott, L.H., Peters, C.J. and Zaki, S.R. (1995) Ultrastructural characteristics of Sin

Nombre virus, causative agent of hantavirus pulmonary syndrome. Arch Virol 140(12), 2107-22. Gott, P., Zoller, L., Darai, G. and Bautz, E.K. (1997) A major antigenic domain of hantaviruses is located on the aminoproximal site of the viral nucleocapsid protein. Virus Genes 14(1), 31-40. Guilligay, D., Tarendeau, F., Resa-Infante, P., Coloma, R., Crepin, T., Sehr, P., Lewis, J., Ruigrok, R.W., Ortin, J., Hart, D.J. and Cusack, S. (2008) The structural basis for cap binding by influenza virus polymerase subunit PB2. Nat Struct Mol Biol 15(5), 500-6. Habjan, M., Andersson, I., Klingstrom, J., Schumann, M., Martin, A., Zimmermann, P., Wagner, V., Pichlmair, A., Schneider, U., Muhlberger, E., Mirazimi, A. and Weber, F. (2008) Processing of genome 5' termini as a strategy of negative-strand RNA viruses to avoid RIG-I-dependent interferon induction. PLoS One 3(4), e2032. Hacker, D., Raju, R. and Kolakofsky, D. (1989) La Crosse virus nucleocapsid protein controls its own synthesis in mosquito cells by encapsidating its mRNA. J Virol 63(12), 5166-74. Haller, O., Kochs, G. and Weber, F. (2006) The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344(1), 119-30. Handke, W., Oelschlegel, R., Franke, R., Kruger, D.H. and Rang, A. (2009) Hantaan virus triggers TLR3-dependent innate immune responses. J Immunol 182(5), 2849-58. Harrison, M.S., Sakaguchi, T. and Schmitt, A.P. (2010) Paramyxovirus assembly and budding: building particles that transmit infections. Int J Biochem Cell Biol 42(9), 1416-29. Hellen, C.U. and Sarnow, P. (2001) Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev 15(13), 1593-612. Hepojoki, J., Strandin, T., Vaheri, A. and Lankinen, H. (2010a) Interactions and oligomerization of hantavirus glycoproteins. J Virol 84(1), 227-42. Hepojoki, J., Strandin, T., Wang, H., Vapalahti, O., Vaheri, A. and Lankinen, H. (2010b) Cytoplasmic tails of hantavirus glycoproteins interact with the nucleocapsid protein. J Gen Virol 91(Pt 9), 2341-50. Heyman, P., Vaheri, A., Lundkvist, A. and Avsic-Zupanc, T. (2009) Hantavirus infections in Europe: from virus carriers to a major public-health problem. Expert Rev Anti Infect Ther 7(2), 205-17. Hirokawa, T., Boon-Chieng, S. and Mitaku, S. (1998) SOSUI: classification and secondary structure prediction system for membrane proteins. Bioinformatics 14(4), 378-9. Hofmann, K. and Stoffel, W. (1993) TMBASE-a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler 374(166). Hooper, J.W., Custer, D.M., Thompson, E. and Schmaljohn, C.S. (2001) DNA vaccination with the Hantaan virus M gene protects Hamsters against three of four HFRS hantaviruses and elicits a high-titer neutralizing antibody response in Rhesus monkeys. J Virol 75(18), 8469-77. Hornung, V., Ellegast, J., Kim, S., Brzozka, K., Jung, A., Kato, H., Poeck, H., Akira, S., Conzelmann, K.K., Schlee, M., Endres, S. and Hartmann, G. (2006) 5'-Triphosphate RNA is the ligand for RIG-I. Science 314(5801), 994-7. Huiskonen, J.T., Hepojoki, J., Laurinmaki, P., Vaheri, A., Lankinen, H., Butcher, S.J. and Grunewald, K. (2010) Electron cryotomography of Tula hantavirus suggests a unique assembly paradigm for enveloped viruses. J Virol 84(10), 4889-97. Hujakka, H., Koistinen, V., Eerikainen, P., Kuronen, I., Mononen, I., Parviainen, M., Lundkvist, A., Vaheri, A., Narvanen, A. and Vapalahti, O. (2001) New immunochromatographic rapid test for diagnosis of acute Puumala virus infection. J Clin Microbiol 39(6), 2146-50.

Jääskelainen, K.M., Kaukinen, P., Minskaya, E.S., Plyusnina, A., Vapalahti, O., Elliott, R.M., Weber, F., Vaheri, A. and Plyusnin, A. (2007) Tula and Puumala hantavirus NSs ORFs are functional and the products inhibit activation of the interferon-beta promoter. J Med Virol 79(10), 1527-36. Jääskelainen, K.M., Plyusnina, A., Lundkvist, A., Vaheri, A. and Plyusnin, A. (2008) Tula hantavirus isolate with the full-length ORF for nonstructural protein NSs survives for more consequent passages in interferon-competent cells than the isolate having truncated NSs ORF. Virol J 5, 3. Jang, S.K. (2006) Internal initiation: IRES elements of picornaviruses and hepatitis c virus. Virus Res 119(1), 2-15. Jenison, S., Yamada, T., Morris, C., Anderson, B., Torrez-Martinez, N., Keller, N. and Hjelle, B. (1994) Characterization of human antibody responses to four corners hantavirus infections among patients with hantavirus pulmonary syndrome. J Virol 68(5), 3000-6. Jiang, H., Wang, P.Z., Zhang, Y., Xu, Z., Sun, L., Wang, L.M., Huang, C.X., Lian, J.Q., Jia, Z.S., Li, Z.D. and Bai, X.F. (2008) Hantaan virus induces toll-like receptor 4 expression, leading to enhanced production of beta interferon, interleukin-6 and tumor necrosis factor-alpha. Virology 380(1), 52-9. Jin, H. and Elliott, R.M. (1993) Characterization of Bunyamwera virus S RNA that is transcribed and replicated by the L protein expressed from recombinant vaccinia virus. J Virol 67(3), 1396-404. Jin, M., Park, J., Lee, S., Park, B., Shin, J., Song, K.J., Ahn, T.I., Hwang, S.Y., Ahn, B.Y. and Ahn, K. (2002) Hantaan virus enters cells by clathrin-dependent receptor-mediated endocytosis. Virology 294(1), 60-9. Jonsson, C.B., Gallegos, J., Ferro, P., Severson, W., Xu, X. and Schmaljohn, C.S. (2001) Purification and characterization of the Sin Nombre virus nucleocapsid protein expressed in Escherichia coli. Protein Expr Purif 23(1), 134-41. Kallio-Kokko, H., Leveelahti, R., Brummer-Korvenkontio, M., Lundkvist, A., Vaheri, A. and Vapalahti, O. (2001) Human immune response to Puumala virus glycoproteins and nucleocapsid protein expressed in mammalian cells. J Med Virol 65(3), 605-13. Kallio-Kokko, H., Vapalahti, O., Lundkvist, A. and Vaheri, A. (1998) Evaluation of Puumala virus IgG and IgM enzyme immunoassays based on recombinant baculovirus-expressed nucleocapsid protein for early nephropathia epidemica diagnosis. Clin Diagn Virol 10(1), 83-90. Kariwa, H., Tanabe, H., Mizutani, T., Kon, Y., Lokugamage, K., Lokugamage, N., Iwasa, M.A., Hagiya, T., Araki, K., Yoshimatsu, K., Arikawa, J. and Takashima, I. (2003) Synthesis of Seoul virus RNA and structural proteins in cultured cells. Arch Virol 148(9), 1671-85. Kato, H., Takeuchi, O., Mikamo-Satoh, E., Hirai, R., Kawai, T., Matsushita, K., Hiiragi, A., Dermody, T.S., Fujita, T. and Akira, S. (2008) Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5. J Exp Med 205(7), 1601-10. Kato, H., Takeuchi, O., Sato, S., Yoneyama, M., Yamamoto, M., Matsui, K., Uematsu, S., Jung, A., Kawai, T., Ishii, K.J., Yamaguchi, O., Otsu, K., Tsujimura, T., Koh, C.S., Reis e Sousa, C., Matsuura, Y., Fujita, T. and Akira, S. (2006) Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 441(7089), 101-5. Kaukinen, P., Vaheri, A. and Plyusnin, A. (2003) Non-covalent interaction between nucleocapsid protein of Tula hantavirus and small ubiquitin-related modifier-1, SUMO-1. Virus Res 92(1), 37-45.

Kaukinen, P., Vaheri, A. and Plyusnin, A. (2005) Hantavirus nucleocapsid protein: a multifunctional molecule with both housekeeping and ambassadorial duties. Arch Virol 150(9), 1693-713. Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K.J., Takeuchi, O. and Akira, S. (2005) IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat Immunol 6(10), 981-8. Khaiboullina, S.F., Morzunov, S.P. and St Jeor, S.C. (2005) Hantaviruses: molecular biology, evolution and pathogenesis. Curr Mol Med 5(8), 773-90. Khaiboullina, S.F., Rizvanov, A.A., Otteson, E., Miyazato, A., Maciejewski, J. and St Jeor, S. (2004) Regulation of cellular gene expression in endothelial cells by sin nombre and prospect hill viruses. Viral Immunol 17(2), 234-51. Kilpatrick, E.D., Terajima, M., Koster, F.T., Catalina, M.D., Cruz, J. and Ennis, F.A. (2004) Role of specific CD8+ T cells in the severity of a fulminant zoonotic viral hemorrhagic fever, hantavirus pulmonary syndrome. J Immunol 172(5), 3297-304. Klempa, B., Fichet-Calvet, E., Lecompte, E., Auste, B., Aniskin, V., Meisel, H., Barriere, P., Koivogui, L., ter Meulen, J. and Kruger, D.H. (2007) Novel hantavirus sequences in Shrew, Guinea. Emerg Infect Dis 13(3), 520-2. Kohl, A., Hart, T.J., Noonan, C., Royall, E., Roberts, L.O. and Elliott, R.M. (2004) A bunyamwera virus minireplicon system in mosquito cells. J Virol 78(11), 5679-85. Kopp, E. and Medzhitov, R. (2003) Recognition of microbial infection by Toll-like receptors. Curr Opin Immunol 15(4), 396-401. Kozak, M. (1991) Structural features in eukaryotic mRNAs that modulate the initiation of translation. J Biol Chem 266(30), 19867-70. Kozak, M. (1992) Regulation of translation in eukaryotic systems. Annu Rev Cell Biol 8, 197-225. Krakauer, T., Leduc, J.W. and Krakauer, H. (1995) Serum levels of tumor necrosis factor-alpha, interleukin-1, and interleukin-6 in hemorrhagic fever with renal syndrome. Viral Immunol 8(2), 75-9. Kraus, A.A., Raftery, M.J., Giese, T., Ulrich, R., Zawatzky, R., Hippenstiel, S., Suttorp, N., Kruger, D.H. and Schonrich, G. (2004) Differential antiviral response of endothelial cells after infection with pathogenic and nonpathogenic hantaviruses. J Virol 78(12), 6143-50. Krautkramer, E. and Zeier, M. (2008) Hantavirus causing hemorrhagic fever with renal syndrome enters from the apical surface and requires decay-accelerating factor (DAF/CD55). J Virol 82(9), 4257-64. Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E.L. (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305(3), 567-80. Kuismanen, E. (1984) Posttranslational processing of Uukuniemi virus glycoproteins G1 and G2. J Virol 51(3), 806-12. Kukkonen, S.K., Vaheri, A. and Plyusnin, A. (2004) Tula hantavirus L protein is a 250 kDa perinuclear membrane-associated protein. J Gen Virol 85(Pt 5), 1181-9. Kukkonen, S.K., Vaheri, A. and Plyusnin, A. (2005) L protein, the RNA-dependent RNA polymerase of hantaviruses. Arch Virol 150(3), 533-56. Kumar, H., Kawai, T. and Akira, S. (2011) Pathogen recognition by the innate immune system. Int Rev Immunol 30(1), 16-34. Lee, B.H., Yoshimatsu, K., Maeda, A., Ochiai, K., Morimatsu, M., Araki, K., Ogino, M., Morikawa, S. and

Arikawa, J. (2003) Association of the nucleocapsid protein of the Seoul and Hantaan hantaviruses with small ubiquitin-like modifier-1-related molecules. Virus Res 98(1), 83-91. Lee, H.W., Baek, L.J. and Johnson, K.M. (1982) Isolation of Hantaan virus, the etiologic agent of Korean hemorrhagic fever, from wild urban rats. J Infect Dis 146(5), 638-44. Lee, H.W. and Lee, P.W. (1976) Korean hemorrhagic fever. I. Demonstration of causative agent and antibodies. Korean J Intern Med 19, 371-384. Lee, H.W., Lee, P.W. and Johnson, K.M. (1978) Isolation of the etiologic agent of Korean Hemorrhagic fever. J Infect Dis 137(3), 298-308. Levine, J.R., Prescott, J., Brown, K.S., Best, S.M., Ebihara, H. and Feldmann, H. (2010) Antagonism of type I interferon responses by new world hantaviruses. J Virol 84(22), 11790-801. Lewis, R.M., Lee, H.W., See, A.F., Parrish, D.B., Moon, J.S., Kim, D.J. and Cosgriff, T.M. (1991) Changes in populations of immune effector cells during the course of haemorrhagic fever with renal syndrome. Trans R Soc Trop Med Hyg 85(2), 282-6. Li, X.D., Makela, T.P., Guo, D., Soliymani, R., Koistinen, V., Vapalahti, O., Vaheri, A. and Lankinen, H. (2002) Hantavirus nucleocapsid protein interacts with the Fas-mediated apoptosis enhancer Daxx. J Gen Virol 83(Pt 4), 759-66. Linderholm, M., Ahlm, C., Settergren, B., Waage, A. and Tarnvik, A. (1996) Elevated plasma levels of tumor necrosis factor (TNF)-alpha, soluble TNF receptors, interleukin (IL)-6, and IL-10 in patients with hemorrhagic fever with renal syndrome. J Infect Dis 173(1), 38-43. Linderholm, M., Bjermer, L., Juto, P., Roos, G., Sandstrom, T., Settergren, B. and Tarnvik, A. (1993) Local host response in the lower respiratory tract in nephropathia epidemica. Scand J Infect Dis 25(5), 639-46. Lober, C., Anheier, B., Lindow, S., Klenk, H.D. and Feldmann, H. (2001) The Hantaan virus glycoprotein precursor is cleaved at the conserved pentapeptide WAASA. Virology 289(2), 224-9. Lundkvist, A., Horling, J. and Niklasson, B. (1993) The humoral response to Puumala virus infection (nephropathia epidemica) investigated by viral protein specific immunoassays. Arch Virol 130(1-2), 121-30. Lundkvist, A. and Niklasson, B. (1992) Bank vole monoclonal antibodies against Puumala virus envelope glycoproteins: identification of epitopes involved in neutralization. Arch Virol 126(1-4), 93-105. Luthra, P., Sun, D., Silverman, R.H. and He, B. (2011) Activation of IFN-{beta} expression by a viral mRNA through RNase L and MDA5. Proc Natl Acad Sci U S A. Mader, S., Lee, H., Pause, A. and Sonenberg, N. (1995) The translation initiation factor eIF-4E binds to a common motif shared by the translation factor eIF-4 gamma and the translational repressors 4E-binding proteins. Mol Cell Biol 15(9), 4990-7. Maeda, A., Lee, B.H., Yoshimatsu, K., Saijo, M., Kurane, I., Arikawa, J. and Morikawa, S. (2003) The intracellular association of the nucleocapsid protein (NP) of hantaan virus (HTNV) with small ubiquitin-like modifier-1 (SUMO-1) conjugating enzyme 9 (Ubc9). Virology 305(2), 288-97. Maes, P., Clement, J., Gavrilovskaya, I. and Van Ranst, M. (2004) Hantaviruses: immunology, treatment, and prevention. Viral Immunol 17(4), 481-97. Makary, P., Kanerva, M., Ollgren, J., Virtanen, M.J., Vapalahti, O. and Lyytikainen, O. (2010) Disease burden of Puumala virus infections, 1995-2008. Epidemiol Infect 138(10), 1484-92. Makela, S., Mustonen, J., Ala-Houhala, I., Hurme, M., Partanen, J., Vapalahti, O., Vaheri, A. and Pasternack, A. (2002) Human leukocyte antigen-B8-DR3 is a more important risk factor for

severe Puumala hantavirus infection than the tumor necrosis factor-alpha(-308) G/A polymorphism. J Infect Dis 186(6), 843-6. Marcus, P.I. and Sekellick, M.J. (1977) Defective interfering particles with covalently linked [+/-]RNA induce interferon. Nature 266(5605), 815-9. Martin, M.L., Lindsey-Regnery, H., Sasso, D.R., McCormick, J.B. and Palmer, E. (1985) Distinction between Bunyaviridae genera by surface structure and comparison with Hantaan virus using negative stain electron microscopy. Arch Virol 86(1-2), 17-28. Matsuoka, Y., Chen, S.Y. and Compans, R.W. (1991) Bunyavirus protein transport and assembly. Curr Top Microbiol Immunol 169, 161-79. Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R. and Tschopp, J. (2005) Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 437(7062), 1167-72. Mir, M.A., Brown, B., Hjelle, B., Duran, W.A. and Panganiban, A.T. (2006) Hantavirus N protein exhibits genus-specific recognition of the viral RNA panhandle. J Virol 80(22), 11283-92. Mir, M.A., Duran, W.A., Hjelle, B.L., Ye, C. and Panganiban, A.T. (2008) Storage of cellular 5' mRNA caps in P bodies for viral cap-snatching. Proc Natl Acad Sci U S A 105(49), 19294-9. Mir, M.A. and Panganiban, A.T. (2005) The hantavirus nucleocapsid protein recognizes specific features of the viral RNA panhandle and is altered in conformation upon RNA binding. J Virol 79(3), 1824-35. Mir, M.A. and Panganiban, A.T. (2008) A protein that replaces the entire cellular eIF4F complex. EMBO J 27(23), 3129-39. Mir, M.A. and Panganiban, A.T. (2010) The triplet repeats of the Sin Nombre hantavirus 5' untranslated region are sufficient in cis for nucleocapsid-mediated translation initiation. J Virol 84(17), 8937-44. Mori, M., Rothman, A.L., Kurane, I., Montoya, J.M., Nolte, K.B., Norman, J.E., Waite, D.C., Koster, F.T. and Ennis, F.A. (1999) High levels of cytokine-producing cells in the lung tissues of patients with fatal hantavirus pulmonary syndrome. J Infect Dis 179(2), 295-302. Mustonen, J., Partanen, J., Kanerva, M., Pietila, K., Vapalahti, O., Pasternack, A. and Vaheri, A. (1996) Genetic susceptibility to severe course of nephropathia epidemica caused by Puumala hantavirus. Kidney Int 49(1), 217-21. Mustonen, J., Partanen, J., Kanerva, M., Pietila, K., Vapalahti, O., Pasternack, A. and Vaheri, A. (1998) Association of HLA B27 with benign clinical course of nephropathia epidemica caused by Puumala hantavirus. Scand J Immunol 47(3), 277-9. Myhrman, G. (1951) Nephropathia epidemica a new infectious disease in northern Scandinavia. Acta Med Scand 140(1), 52-6. Nichol, S.T., Beaty, B. J., Elliott, R. M., Goldbach, R., Plyusnin, A, Schmaljohn, C. S. & Tesh, R. B. (2005) Bunyaviridae. In Virus Taxonomy VIIIth report of the International Committee on Taxonomy of Viruses(Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball. Amsterdam, Elsevier Academic Press). Nolte, K.B., Feddersen, R.M., Foucar, K., Zaki, S.R., Koster, F.T., Madar, D., Merlin, T.L., McFeeley, P.J., Umland, E.T. and Zumwalt, R.E. (1995) Hantavirus pulmonary syndrome in the United States: a pathological description of a disease caused by a new agent. Hum Pathol 26(1), 110-20. O'Neill, L.A. (2006) Targeting signal transduction as a strategy to treat inflammatory diseases. Nat Rev Drug Discov 5(7), 549-63.

Ogino, M., Yoshimatsu, K., Ebihara, H., Araki, K., Lee, B.H., Okumura, M. and Arikawa, J. (2004) Cell fusion activities of Hantaan virus envelope glycoproteins. J Virol 78(19), 10776-82. Ontiveros, S.J., Li, Q. and Jonsson, C.B. (2010) Modulation of apoptosis and immune signaling pathways by the Hantaan virus nucleocapsid protein. Virology 401(2), 165-78. Osborne, J.C. and Elliott, R.M. (2000) RNA binding properties of bunyamwera virus nucleocapsid protein and selective binding to an element in the 5' terminus of the negative-sense S segment. J Virol 74(21), 9946-52. Overby, A.K., Popov, V.L., Pettersson, R.F. and Neve, E.P. (2007) The cytoplasmic tails of Uukuniemi Virus (Bunyaviridae) G(N) and G(C) glycoproteins are important for intracellular targeting and the budding of virus-like particles. J Virol 81(20), 11381-91. Padula, P.J., Rossi, C.M., Della Valle, M.O., Martinez, P.V., Colavecchia, S.B., Edelstein, A., Miguel, S.D., Rabinovich, R.D. and Segura, E.L. (2000) Development and evaluation of a solid-phase enzyme immunoassay based on Andes hantavirus recombinant nucleoprotein. J Med Microbiol 49(2), 149-55. Pandey, S. and Agrawal, D.K. (2006) Immunobiology of Toll-like receptors: emerging trends. Immunol Cell Biol 84(4), 333-41. Pensiero, M.N. and Hay, J. (1992) The Hantaan virus M-segment glycoproteins G1 and G2 can be expressed independently. J Virol 66(4), 1907-14. Pettersson, R.F. (1991) Protein localization and virus assembly at intracellular membranes. Curr Top Microbiol Immunol 170, 67-106. Pichlmair, A., Schulz, O., Tan, C.P., Naslund, T.I., Liljestrom, P., Weber, F. and Reis e Sousa, C. (2006) RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 314(5801), 997-1001. Plotch, S.J., Bouloy, M., Ulmanen, I. and Krug, R.M. (1981) A unique cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23(3), 847-58. Plumet, S., Herschke, F., Bourhis, J.M., Valentin, H., Longhi, S. and Gerlier, D. (2007) Cytosolic 5'-triphosphate ended viral leader transcript of measles virus as activator of the RIG I-mediated interferon response. PLoS One 2(3), e279. Plyusnin, A. (2002) Genetics of hantaviruses: implications to taxonomy. Arch Virol 147(4), 665-82. Plyusnin, A. and Morzunov, S.P. (2001) Virus evolution and genetic diversity of hantaviruses and their rodent hosts. Curr Top Microbiol Immunol 256, 47-75. Plyusnin, A., Vapalahti, O., Lankinen, H., Lehvaslaiho, H., Apekina, N., Myasnikov, Y., Kallio-Kokko, H., Henttonen, H., Lundkvist, A., Brummer-Korvenkontio, M. and et al. (1994) Tula virus: a newly detected hantavirus carried by European common voles. J Virol 68(12), 7833-9. Plyusnin, A., Vapalahti, O. and Vaheri, A. (1996) Hantaviruses: genome structure, expression and evolution. J Gen Virol 77 ( Pt 11), 2677-87. Plyusnin, A., Vapalahti, O., Vasilenko, V., Henttonen, H. and Vaheri, A. (1997) Dobrava hantavirus in Estonia: does the virus exist throughout Europe? Lancet 349(9062), 1369-70. Prescott, J., Hall, P., Acuna-Retamar, M., Ye, C., Wathelet, M.G., Ebihara, H., Feldmann, H. and Hjelle, B. (2010) New World hantaviruses activate IFNlambda production in type I IFN-deficient vero E6 cells. PLoS One 5(6), e11159. Prescott, J., Ye, C., Sen, G. and Hjelle, B. (2005) Induction of innate immune response genes by Sin Nombre hantavirus does not require viral replication. J Virol 79(24), 15007-15.

Prescott, J.B., Hall, P.R., Bondu-Hawkins, V.S., Ye, C. and Hjelle, B. (2007) Early innate immune responses to Sin Nombre hantavirus occur independently of IFN regulatory factor 3, characterized pattern recognition receptors, and viral entry. J Immunol 179(3), 1796-802. Raftery, M.J., Kraus, A.A., Ulrich, R., Kruger, D.H. and Schonrich, G. (2002) Hantavirus infection of dendritic cells. J Virol 76(21), 10724-33. Raju, R. and Kolakofsky, D. (1989) The ends of La Crosse virus genome and antigenome RNAs within nucleocapsids are base paired. J Virol 63(1), 122-8. Ramanathan, H.N., Chung, D.H., Plane, S.J., Sztul, E., Chu, Y.K., Guttieri, M.C., McDowell, M., Ali, G. and Jonsson, C.B. (2007) Dynein-dependent transport of the hantaan virus nucleocapsid protein to the endoplasmic reticulum-Golgi intermediate compartment. J Virol 81(16), 8634-47. Ramanathan, H.N. and Jonsson, C.B. (2008) New and Old World hantaviruses differentially utilize host cytoskeletal components during their life cycles. Virology 374(1), 138-50. Ravkov, E.V. and Compans, R.W. (2001) Hantavirus nucleocapsid protein is expressed as a membrane-associated protein in the perinuclear region. J Virol 75(4), 1808-15. Ravkov, E.V., Nichol, S.T. and Compans, R.W. (1997) Polarized entry and release in epithelial cells of Black Creek Canal virus, a New World hantavirus. J Virol 71(2), 1147-54. Reguera, J., Weber, F. and Cusack, S. (2010) Bunyaviridae RNA polymerases (L-protein) have an N-terminal, influenza-like endonuclease domain, essential for viral cap-dependent transcription. PLoS Pathog 6(9). Rehwinkel, J., Tan, C.P., Goubau, D., Schulz, O., Pichlmair, A., Bier, K., Robb, N., Vreede, F., Barclay, W., Fodor, E. and Reis e Sousa, C. (2010) RIG-I detects viral genomic RNA during negative-strand RNA virus infection. Cell 140(3), 397-408. Ribeiro, D., Borst, J.W., Goldbach, R. and Kormelink, R. (2009) Tomato spotted wilt virus nucleocapsid protein interacts with both viral glycoproteins Gn and Gc in planta. Virology 383(1), 121-30. Richter, J.D. and Sonenberg, N. (2005) Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433(7025), 477-80. Rogers, G.W., Jr., Komar, A.A. and Merrick, W.C. (2002) eIF4A: the godfather of the DEAD box helicases. Prog Nucleic Acid Res Mol Biol 72, 307-31. Rossier, C., Patterson, J. and Kolakofsky, D. (1986) La Crosse virus small genome mRNA is made in the cytoplasm. J Virol 58(2), 647-50. Rowe, R.K. and Pekosz, A. (2006) Bidirectional virus secretion and nonciliated cell tropism following Andes virus infection of primary airway epithelial cell cultures. J Virol 80(3), 1087-97. Salonen, A., Ahola, T. and Kaariainen, L. (2005) Viral RNA replication in association with cellular membranes. Curr Top Microbiol Immunol 285, 139-73. Samanta, M., Iwakiri, D., Kanda, T., Imaizumi, T. and Takada, K. (2006) EB virus-encoded RNAs are recognized by RIG-I and activate signaling to induce type I IFN. EMBO J 25(18), 4207-14. Sane, J., Laine, O., Makela, S., Paakkala, A., Jarva, H., Mustonen, J., Vapalahti, O., Meri, S. and Vaheri, A. (2011) Complement activation in Puumala hantavirus infection correlates with disease severity. Ann Med. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N. and Taniguchi, T. (2000) Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction. Immunity 13(4), 539-48. Satoh, T., Kato, H., Kumagai, Y., Yoneyama, M., Sato, S., Matsushita, K., Tsujimura, T., Fujita, T., Akira, S. and Takeuchi, O. (2010) LGP2 is a positive regulator of RIG-I- and MDA5-mediated antiviral

responses. Proc Natl Acad Sci U S A 107(4), 1512-7. Schlee, M., Roth, A., Hornung, V., Hagmann, C.A., Wimmenauer, V., Barchet, W., Coch, C., Janke, M., Mihailovic, A., Wardle, G., Juranek, S., Kato, H., Kawai, T., Poeck, H., Fitzgerald, K.A., Takeuchi, O., Akira, S., Tuschl, T., Latz, E., Ludwig, J. and Hartmann, G. (2009) Recognition of 5' triphosphate by RIG-I helicase requires short blunt double-stranded RNA as contained in panhandle of negative-strand virus. Immunity 31(1), 25-34. Schmaljohn, C. and Nichol, S.T. (2007) Bunyaviridae, In "Fields virology" (D.M. Knipe, P.M. Howley, D.E. Griffin, R.A. Lamb, M.A. Martin, R.B., and S.S.E., Eds.) pp. 1741–1789. Vol. 2. Lippincott Williams & Wilkins, Philadelphia. Schmitt, A.P. and Lamb, R.A. (2004) Escaping from the cell: assembly and budding of negative-strand RNA viruses. Curr Top Microbiol Immunol 283, 145-96. Sen, N., Sen, A. and Mackow, E.R. (2007) Degrons at the C terminus of the pathogenic but not the nonpathogenic hantavirus G1 tail direct proteasomal degradation. J Virol 81(8), 4323-30. Seth, R.B., Sun, L., Ea, C.K. and Chen, Z.J. (2005) Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122(5), 669-82. Severson, W., Partin, L., Schmaljohn, C.S. and Jonsson, C.B. (1999) Characterization of the Hantaan nucleocapsid protein-ribonucleic acid interaction. J Biol Chem 274(47), 33732-9. Severson, W., Xu, X. and Jonsson, C.B. (2001) cis-Acting signals in encapsidation of Hantaan virus S-segment viral genomic RNA by its N protein. J Virol 75(6), 2646-52. Severson, W., Xu, X., Kuhn, M., Senutovitch, N., Thokala, M., Ferron, F., Longhi, S., Canard, B. and Jonsson, C.B. (2005) Essential amino acids of the hantaan virus N protein in its interaction with RNA. J Virol 79(15), 10032-9. Shi, X. and Elliott, R.M. (2002) Golgi localization of Hantaan virus glycoproteins requires coexpression of G1 and G2. Virology 300(1), 31-8. Shi, X., Kohl, A., Leonard, V.H., Li, P., McLees, A. and Elliott, R.M. (2006) Requirement of the N-terminal region of orthobunyavirus nonstructural protein NSm for virus assembly and morphogenesis. J Virol 80(16), 8089-99. Sjolander, K.B., Elgh, F., Kallio-Kokko, H., Vapalahti, O., Hagglund, M., Palmcrantz, V., Juto, P., Vaheri, A., Niklasson, B. and Lundkvist, A. (1997) Evaluation of serological methods for diagnosis of Puumala hantavirus infection (nephropathia epidemica). J Clin Microbiol 35(12), 3264-8. Snippe, M., Willem Borst, J., Goldbach, R. and Kormelink, R. (2007) Tomato spotted wilt virus Gc and N proteins interact in vivo. Virology 357(2), 115-23. Song, J.W., Gu, S.H., Bennett, S.N., Arai, S., Puorger, M., Hilbe, M. and Yanagihara, R. (2007) Seewis virus, a genetically distinct hantavirus in the Eurasian common shrew (Sorex araneus). Virol J 4, 114. Spiropoulou, C.F., Albarino, C.G., Ksiazek, T.G. and Rollin, P.E. (2007) Andes and Prospect Hill hantaviruses differ in early induction of interferon although both can downregulate interferon signaling. J Virol 81(6), 2769-76. Spiropoulou, C.F., Goldsmith, C.S., Shoemaker, T.R., Peters, C.J. and Compans, R.W. (2003) Sin Nombre virus glycoprotein trafficking. Virology 308(1), 48-63. Sugimori, T., Griffith, D.L. and Arnaout, M.A. (1997) Emerging paradigms of integrin ligand binding and activation. Kidney Int 51(5), 1454-62. Sugiyama, K., Obayashi, E., Kawaguchi, A., Suzuki, Y., Tame, J.R., Nagata, K. and Park, S.Y. (2009)

Structural insight into the essential PB1-PB2 subunit contact of the influenza virus RNA polymerase. EMBO J 28(12), 1803-11. Takahasi, K., Yoneyama, M., Nishihori, T., Hirai, R., Kumeta, H., Narita, R., Gale, M., Jr., Inagaki, F. and Fujita, T. (2008) Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses. Mol Cell 29(4), 428-40. Taylor, S.L., Frias-Staheli, N., Garcia-Sastre, A. and Schmaljohn, C.S. (2009a) Hantaan virus nucleocapsid protein binds to importin alpha proteins and inhibits tumor necrosis factor alpha-induced activation of nuclear factor kappa B. J Virol 83(3), 1271-9. Taylor, S.L., Krempel, R.L. and Schmaljohn, C.S. (2009b) Inhibition of TNF-alpha-induced activation of NF-kappaB by hantavirus nucleocapsid proteins. Ann N Y Acad Sci 1171 Suppl 1, E86-93. Temonen, M., Lankinen, H., Vapalahti, O., Ronni, T., Julkunen, I. and Vaheri, A. (1995) Effect of interferon-alpha and cell differentiation on Puumala virus infection in human monocyte/macrophages. Virology 206(1), 8-15. Temonen, M., Mustonen, J., Helin, H., Pasternack, A., Vaheri, A. and Holthofer, H. (1996) Cytokines, adhesion molecules, and cellular infiltration in nephropathia epidemica kidneys: an immunohistochemical study. Clin Immunol Immunopathol 78(1), 47-55. tenOever, B.R., Servant, M.J., Grandvaux, N., Lin, R. and Hiscott, J. (2002) Recognition of the measles virus nucleocapsid as a mechanism of IRF-3 activation. J Virol 76(8), 3659-69. tenOever, B.R., Sharma, S., Zou, W., Sun, Q., Grandvaux, N., Julkunen, I., Hemmi, H., Yamamoto, M., Akira, S., Yeh, W.C., Lin, R. and Hiscott, J. (2004) Activation of TBK1 and IKKvarepsilon kinases by vesicular stomatitis virus infection and the role of viral ribonucleoprotein in the development of interferon antiviral immunity. J Virol 78(19), 10636-49. Tischler, N.D., Gonzalez, A., Perez-Acle, T., Rosemblatt, M. and Valenzuela, P.D. (2005) Hantavirus Gc glycoprotein: evidence for a class II fusion protein. J Gen Virol 86(Pt 11), 2937-47. Tusnady, G.E. and Simon, I. (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics 17(9), 849-50. Tuuminen, T., Kekalainen, E., Makela, S., Ala-Houhala, I., Ennis, F.A., Hedman, K., Mustonen, J., Vaheri, A. and Arstila, T.P. (2007) Human CD8+ T cell memory generation in Puumala hantavirus infection occurs after the acute phase and is associated with boosting of EBV-specific CD8+ memory T cells. J Immunol 179(3), 1988-95. Vaheri, A., Mills, J.N., Spiropoulou, C. and Hjelle, B. (2011) Hantaviruses. Zoonoses - biology, clinical practice and public health, 2ed Edition(Oxford University Press. Oxford. U.K.), pp. 307-22. Vaheri, A., Vapalahti, O. and Plyusnin, A. (2008) How to diagnose hantavirus infections and detect them in rodents and insectivores. Rev Med Virol 18(4), 277-88. Van Epps, H.L., Terajima, M., Mustonen, J., Arstila, T.P., Corey, E.A., Vaheri, A. and Ennis, F.A. (2002) Long-lived memory T lymphocyte responses after hantavirus infection. J Exp Med 196(5), 579-88. Vapalahti, O., Kallio-Kokko, H., Narvanen, A., Julkunen, I., Lundkvist, A., Plyusnin, A., Lehvaslaiho, H., Brummer-Korvenkontio, M., Vaheri, A. and Lankinen, H. (1995) Human B-cell epitopes of Puumala virus nucleocapsid protein, the major antigen in early serological response. J Med Virol 46(4), 293-303. Vapalahti, O., Lundkvist, A., Kallio-Kokko, H., Paukku, K., Julkunen, I., Lankinen, H. and Vaheri, A. (1996) Antigenic properties and diagnostic potential of puumala virus nucleocapsid protein expressed in insect cells. J Clin Microbiol 34(1), 119-25.

Vapalahti, O., Mustonen, J., Lundkvist, A., Henttonen, H., Plyusnin, A. and Vaheri, A. (2003) Hantavirus infections in Europe. Lancet Infect Dis 3(10), 653-61. Virtanen, J.O., Jaaskelainen, K.M., Djupsjobacka, J., Vaheri, A. and Plyusnin, A. (2010) Tula hantavirus NSs protein accumulates in the perinuclear area in infected and transfected cells. Arch Virol 155(1), 117-21. von Bonsdorff, C.H. and Pettersson, R. (1975) Surface structure of Uukuniemi virus. J Virol 16(5), 1296-307. von der Haar, T., Gross, J.D., Wagner, G. and McCarthy, J.E. (2004) The mRNA cap-binding protein eIF4E in post-transcriptional gene expression. Nat Struct Mol Biol 11(6), 503-11. Wajant, H., Pfizenmaier, K. and Scheurich, P. (2003) Tumor necrosis factor signaling. Cell Death Differ 10(1), 45-65. Wang, H., Alminaite, A., Vaheri, A. and Plyusnin, A. (2010) Interaction between hantaviral nucleocapsid protein and the cytoplasmic tail of surface glycoprotein Gn. Virus Res 151(2), 205-12. Waris, G., Tardif, K.D. and Siddiqui, A. (2002) Endoplasmic reticulum (ER) stress: hepatitis C virus induces an ER-nucleus signal transduction pathway and activates NF-kappaB and STAT-3. Biochem Pharmacol 64(10), 1425-30. Weber, F., Wagner, V., Rasmussen, S.B., Hartmann, R. and Paludan, S.R. (2006) Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J Virol 80(10), 5059-64. Xu, L.G., Wang, Y.Y., Han, K.J., Li, L.Y., Zhai, Z. and Shu, H.B. (2005) VISA is an adapter protein required for virus-triggered IFN-beta signaling. Mol Cell 19(6), 727-40. Xu, X., Severson, W., Villegas, N., Schmaljohn, C.S. and Jonsson, C.B. (2002) The RNA binding domain of the hantaan virus N protein maps to a central, conserved region. J Virol 76(7), 3301-8. Yamamoto, M., Sato, S., Hemmi, H., Hoshino, K., Kaisho, T., Sanjo, H., Takeuchi, O., Sugiyama, M., Okabe, M., Takeda, K. and Akira, S. (2003) Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science 301(5633), 640-3. Yanagihara, R. and Silverman, D.J. (1990) Experimental infection of human vascular endothelial cells by pathogenic and nonpathogenic hantaviruses. Arch Virol 111(3-4), 281-6. Ye, Z., Liu, T., Offringa, D.P., McInnis, J. and Levandowski, R.A. (1999) Association of influenza virus matrix protein with ribonucleoproteins. J Virol 73(9), 7467-73. Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira, K., Akira, S. and Fujita, T. (2004) The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nat Immunol 5(7), 730-7. Yoshimatsu, K., Arikawa, J., Tamura, M., Yoshida, R., Lundkvist, A., Niklasson, B., Kariwa, H. and Azuma, I. (1996) Characterization of the nucleocapsid protein of Hantaan virus strain 76-118 using monoclonal antibodies. J Gen Virol 77 ( Pt 4), 695-704. Zaki, S.R., Greer, P.W., Coffield, L.M., Goldsmith, C.S., Nolte, K.B., Foucar, K., Feddersen, R.M., Zumwalt, R.E., Miller, G.L., Khan, A.S. and et al. (1995) Hantavirus pulmonary syndrome. Pathogenesis of an emerging infectious disease. Am J Pathol 146(3), 552-79.