DOCSLIB.ORG

Tibet Orbivirus, a Novel Orbivirus Species Isolated from Anopheles

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tibet Orbivirus, a Novel Orbivirus Species Isolated from Anopheles Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 Tibet Orbivirus, a novel Orbivirus species isolated from Anopheles maculatus mosquitoes in Tibet, China Minghua Li Chinese Center for Disease Control and Prevention, Beijing Yayun Zheng Chinese Center for Disease Control and Prevention, Beijing Guoyan Zhao Washington University School of Medicine in St. Louis Shihong Fu Chinese Center for Disease Control and Prevention, Beijing David Wang Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Li, Minghua; Zheng, Yayun; Zhao, Guoyan; Fu, Shihong; Wang, David; Wang, Zhiyu; and Liang, Guodong, ,"Tibet Orbivirus, a novel Orbivirus species isolated from Anopheles maculatus mosquitoes in Tibet, China." PLoS One.9,2. e88738. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3048 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Minghua Li, Yayun Zheng, Guoyan Zhao, Shihong Fu, David Wang, Zhiyu Wang, and Guodong Liang This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3048 Tibet Orbivirus, a Novel Orbivirus Species Isolated from Anopheles maculatus Mosquitoes in Tibet, China Minghua Li1., Yayun Zheng1,2., Guoyan Zhao3, Shihong Fu1, David Wang3, Zhiyu Wang2, Guodong Liang1,2* 1 State Key Laboratory for Infectious Disease Prevention and Control, Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing, China, 2 School of Public Health, Shandong University, Jinan, Shandong Province, China, 3 Washington University, St. Louis, Missouri, United States of America Abstract Background: The genus Orbivirus includes a number of important pathogenic viruses, including Bluetongue virus (BTV), African horse sickness virus (AHSV), and Epizootic hemorrhagic disease virus (EHDV). In this study we describe the isolation and characterization of an Orbivirus strain isolated from Anopheles maculatus mosquitoes collected in Tibet, China. Methods and Results: Initial viral screening identified a viral strain (XZ0906) that caused significant cytopathic effect (CPE) in BHK-21 cells, including rounding, cell rupture, and floating. Although CPE was not observed in insect cells (C6/36), these cells supported viral replication. Polyacrylamide gel analysis revealed a genome consisting of 10 segments of double- stranded RNA (dsRNA), with a distribution pattern of 3-3-3-1. 454 high throughput sequencing of culture supernatant was used for viral identification. Complete genome sequencing was performed by Sanger sequencing in combination with 59- RACE and 39-RACE. Sequence analysis demonstrated that all 59- and 39- untranslated regions (UTRs) for each of the 10 genome segments contained a series of six highly conserved nucleotides. In addition, homology analysis and phylogenetic analysis based on amino acid sequence was completed, and all results show that virus XZ0906 was not a member of any known species or serotype of Orbivirus, indicating it to be a new species within the genus Orbivirus. Conclusions: The isolated Orbivirus strain was designated Tibet Orbivirus, TIBOV to denote the location from which it was isolated. TIBOV is a novel orbivirus species which is isolated from Anopheles maculatus mosquitoes collected in Tibet, China. Citation: Li M, Zheng Y, Zhao G, Fu S, Wang D, et al. (2014) Tibet Orbivirus, a Novel Orbivirus Species Isolated from Anopheles maculatus Mosquitoes in Tibet, China. PLoS ONE 9(2): e88738. doi:10.1371/journal.pone.0088738 Editor: Jianming Qiu, University of Kansas Medical Center, United States of America Received November 2, 2013; Accepted January 9, 2014; Published February 12, 2014 Copyright: ß 2014 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work is supported by grants from National Natural Science Foundation of China (81290342), The Ministry of Science and Technology, China (2011CB504702) and Development Grant of State Key Laboratory for Infectious Disease Prevention and Control (2008SKLID105). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] . These authors contributed equally to this work. Introduction XZ0906 and Yunnan Orbivirus (YUOV), an orbivirus also isolated from China. After whole genome sequencing, amino acid There are currently 22 confirmed species of the genus Orbivirus homology and molecular phylogenetic analysis, XZ0906, which is in the family Reoviridae [1]. This genus includes a number of designated as Tibet Orbivirus (TIBOV), is identified as a novel important pathogenic viruses, including Bluetongue virus (BTV), species of the genus Orbivirus. African horse sickness virus (AHSV), and Epizootic hemorrhagic disease virus (EHDV) [1,2], which are spread primarily through Materials and Methods insect vectors, such as Culicoides midges, ticks, mosquitoes, and phlebotomine flies [1,3–6]. 1. Cell culture Orbiviruses contain a multi-segmented, double-stranded RNA Aedes albopictus C6/36 cells and BHK-21 (Baby hamster kidney) genome, consisting of 10 segments (Seg1–Seg10) of various length, cells (ATCC) were used in this study [11], and both cell lines were which are identified according to their molecular weight [7]. kept in our laboratory. C6/36 cells were maintained in medium Partial nucleotide sequences for each of the gene segments for with 45% RMPI 1640 and 45% DMEM (Invitrogen) supplement- many of the Orbiviruses have been published, along with complete ed with 10% inactive fetal bovine serum (FBS, Invitrogen) and genome sequences of some species [3,5,8–10], allowing for 100 U/mL penicillin and streptomycin. Cells were propagated detailed classification and phylogenetic analysis of Orbiviruses. and maintained at 28uC [11–13]. BHK-21 cells were grown in This study describes a viral strain (XZ0906) isolated from minimal essential medium with Eagle’s balanced salt solution Anopheles maculatus specimens collected in Tibet, China. All the supplemented with 10% FBS (Invitrogen), 2 mM glutamine, results of initial viral screening showed a difference between 0.12% NaHCO3, and 100 U/mL penicillin and streptomycin. PLOS ONE | www.plosone.org 1 February 2014 | Volume 9 | Issue 2 | e88738 A Novel Orbivirus Isolated from Tibet, China Table 1. Primers used in this study. Table 1. Cont. Primer Sequence (59-39) Position Primer Sequence (59-39) Position Orientation 6-8-2F GGTAACCGAGATTCGCTCAA 524–543 Sense 6-1-1F GTAAAATCACAATGGTCG 1–18 Sense 6-8-2R GTAAGTTTAAATTCCCTCCCCTATA 1118–1142 Antisense 6-1-1R TAGCAGCAACTCCCCAAG 826–843 Antisense 6-9-1F GTAAAAAATTGCTTATGTCAGCTGC 1–25 Sense 6-1-2F TGGAGGAAGAGGGCGTGAG 679–697 Sense 6-9-1R TGAGCACTACCCACCCTC 565–582 Antisense 6-1-2R TAGAACCCTTTGTTTGGT 1531–1548 Antisense 6-9-2F AAGAAGATTCGGTGGTGG 286–303 Sense 6-1-3F AGTCAAGAAAAGGTTTGG 1385–1402 Sense 6-9-2R GTAAGTTTTAAATTGCTACGGTCAG 1076–1100 Antisense 6-1-3R CTGAGCGTAAAATAGCGT 2310–2327 Antisense 6-10-1F GTAAAAAAGAATGTGGTTGTCATGC 1–25 Sense 6-1-4F ATTTAGCCATGATAGACACG 2152–2171 Sense 6-10-1R CGATTTGGCCCGTTAGCA 587–604 Antisense 6-1-4R GAGACAATCGCCCTGGTG 3064–3081 Antisense 6-10-2F GATGACGGATGGAATGGC 159–176 Sense 6-1-5F ATGCGACCCATACATAAA 2874–2891 Sense 6-10-2R GTAAGTTGGGTGAATGCGGTGAACT 808–832 Antisense 6-1-5R CTCGTCCTCCGTCACAAC 3786–3803 Antisense doi:10.1371/journal.pone.0088738.t001 6-1-6F CTGAAATAATGGATGCGGTTGA 3019–3040 Sense 6-1-6R GTAAGTGTATCACGGGCGCGCTAAT 3926–3950 Antisense BHK-21 cells were propagated and maintained at 37uC under a 6-2-1F GTAAAAACTGACGATGGACGAATTC 1–25 Sense 5% CO2 atmosphere [11–13]. 6-2-1R CGCATCCGCTCTTGAAAT 940–957 Antisense 6-2-2F ATTTGAGAAGTGGGAGTT 760–777 Sense 2. Viral isolation Mosquito samples were collected in Medog County (altitude 6-2-2R TTCATGTACGGTGGTAAG 1549–1566 Antisense 1000 m) in the Nyingchi area of Tibet, China during the summer 6-2-3F TTATAGATGGTGATTTGCTT 1428–1447 Sense of 2009, and transported to the laboratory in liquid nitrogen 6-2-3R CATCCTTACTTCTGACGC 2270–2287 Antisense containers, following morphological classification and species 6-2-4F GGGCATACGGCGGAGAAT 2021–2038 Sense identification on-site. All specimens were homogenized and 6-2-4R GTAAGTTTAAACTGTGTGGTGATCG 2864–2888 Antisense centrifuged at 120006g for 30 min at 4uC. To isolate the virus, 6-3-1F GTAAAATTTCCGTGGCGATGGCTGA 1–25 Sense 150 mL of supernatant was then added to monolayers of both C6/ 36 and BHK-21 cells, and cultured at 28 and 37uC, respectively, 6-3-1R ACCGCAGGGTTTATAGGT 824–841 Antisense in a 5% CO2 incubator. Cells were monitored at 24-h intervals to 6-3-2F GCTCGGACCCACTTTACC 637–654 Sense identify cytopathic effects (CPE) associated with infection [11–13]. 6-3-2R TGCTGCCACAAGCATCAG 1515–1532 Antisense 6-3-3F TATAATGGATGGGCTGTC 1356–1373 Sense 3. dsRNA-polyacrylamide gel electrophoresis
Load more

Recommended publications
  • Development of a Real-Time Reverse Transcription
    DEVELOPMENT AND EVALUATION OF A REAL-TIME POLYMERASE CHAIN REACTION ASSAY FOR EQUINE ENCEPHALOSIS VIRUS by Ntungufhadzeni Maclaughlin Rathogwa Submitted in partial fulfillment of the requirements for the degree Master of Veterinary Science (MSc) in the Department of Veterinary Tropical Diseases Faculty of Veterinary Science University of Pretoria South Africa Supervisor: Prof Moritz van Vuuren Co-supervisor: Dr Melvyn Quan November, 2011 © University of Pretoria TABLE OF CONTENTS DEDICATION .......................................................................................................................................... II DECLARATION ..................................................................................................................................... III ACKNOWLEDGEMENTS ...................................................................................................................... IV ABBREVIATIONS ................................................................................................................................... V LIST OF FIGURES ................................................................................................................................ VII LIST OF TABLES ................................................................................................................................ VIII ABSTRACT ............................................................................................................................................ IX 1. GENERAL INTRODUCTION .........................................................................................................
    [Show full text]
  • Virus Particle Structures
    Virus Particle Structures Virus Particle Structures Palmenberg, A.C. and Sgro, J.-Y. COLOR PLATE LEGENDS These color plates depict the relative sizes and comparative virion structures of multiple types of viruses. The renderings are based on data from published atomic coordinates as determined by X-ray crystallography. The international online repository for 3D coordinates is the Protein Databank (www.rcsb.org/pdb/), maintained by the Research Collaboratory for Structural Bioinformatics (RCSB). The VIPER web site (mmtsb.scripps.edu/viper), maintains a parallel collection of PDB coordinates for icosahedral viruses and additionally offers a version of each data file permuted into the same relative 3D orientation (Reddy, V., Natarajan, P., Okerberg, B., Li, K., Damodaran, K., Morton, R., Brooks, C. and Johnson, J. (2001). J. Virol., 75, 11943-11947). VIPER also contains an excellent repository of instructional materials pertaining to icosahedral symmetry and viral structures. All images presented here, except for the filamentous viruses, used the standard VIPER orientation along the icosahedral 2-fold axis. With the exception of Plate 3 as described below, these images were generated from their atomic coordinates using a novel radial depth-cue colorization technique and the program Rasmol (Sayle, R.A., Milner-White, E.J. (1995). RASMOL: biomolecular graphics for all. Trends Biochem Sci., 20, 374-376). First, the Temperature Factor column for every atom in a PDB coordinate file was edited to record a measure of the radial distance from the virion center. The files were rendered using the Rasmol spacefill menu, with specular and shadow options according to the Van de Waals radius of each atom.
    [Show full text]
  • Molecular Characterization of a New Monopartite Dsrna Mycovirus from Mycorrhizal Thelephora Terrestris
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Virology 489 (2016) 12–19 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/yviro Molecular characterization of a new monopartite dsRNA mycovirus from mycorrhizal Thelephora terrestris (Ehrh.) and its detection in soil oribatid mites (Acari: Oribatida) Karel Petrzik a,n, Tatiana Sarkisova a, Josef Starý b, Igor Koloniuk a, Lenka Hrabáková a,c, Olga Kubešová a a Department of Plant Virology, Institute of Plant Molecular Biology, Biology Centre of the Czech Academy of Sciences, Branišovská 31, 370 05 České Budějovice, Czech Republic b Institute of Soil Biology, Biology Centre of the Czech Academy of Sciences, Na Sádkách 7, 370 05 České Budějovice, Czech Republic c Department of Genetics, Faculty of Science, University of South Bohemia in České Budějovice, Branišovská 31a, 370 05 České Budějovice, Czech Republic article info abstract Article history: A novel dsRNA virus was identified in the mycorrhizal fungus Thelephora terrestris (Ehrh.) and sequenced. Received 28 July 2015 This virus, named Thelephora terrestris virus 1 (TtV1), contains two reading frames in different frames Returned to author for revisions but with the possibility that ORF2 could be translated as a fusion polyprotein after ribosomal -1 fra- 4 November 2015 meshifting. Picornavirus 2A-like motif, nudix hydrolase, phytoreovirus S7, and RdRp domains were found Accepted 10 November 2015 in a unique arrangement on the polyprotein. A new genus named Phlegivirus and containing TtV1, PgLV1, Available online 14 December 2015 RfV1 and LeV is therefore proposed. Twenty species of oribatid mites were identified in soil material in Keywords: the vicinity of T.
    [Show full text]
  • RNA Silencing-Based Improvement of Antiviral Plant Immunity
    viruses Review Catch Me If You Can! RNA Silencing-Based Improvement of Antiviral Plant Immunity Fatima Yousif Gaffar and Aline Koch * Centre for BioSystems, Institute of Phytopathology, Land Use and Nutrition, Justus Liebig University, Heinrich-Buff-Ring 26, D-35392 Giessen, Germany * Correspondence: [email protected] Received: 4 April 2019; Accepted: 17 July 2019; Published: 23 July 2019 Abstract: Viruses are obligate parasites which cause a range of severe plant diseases that affect farm productivity around the world, resulting in immense annual losses of yield. Therefore, control of viral pathogens continues to be an agronomic and scientific challenge requiring innovative and ground-breaking strategies to meet the demands of a growing world population. Over the last decade, RNA silencing has been employed to develop plants with an improved resistance to biotic stresses based on their function to provide protection from invasion by foreign nucleic acids, such as viruses. This natural phenomenon can be exploited to control agronomically relevant plant diseases. Recent evidence argues that this biotechnological method, called host-induced gene silencing, is effective against sucking insects, nematodes, and pathogenic fungi, as well as bacteria and viruses on their plant hosts. Here, we review recent studies which reveal the enormous potential that RNA-silencing strategies hold for providing an environmentally friendly mechanism to protect crop plants from viral diseases. Keywords: RNA silencing; Host-induced gene silencing; Spray-induced gene silencing; virus control; RNA silencing-based crop protection; GMO crops 1. Introduction Antiviral Plant Defence Responses Plant viruses are submicroscopic spherical, rod-shaped or filamentous particles which contain different kinds of genomes.
    [Show full text]
  • Interactions Among Multiple Structural Proteins
    Hypothesis on particle structure and assembly of rice dwarf phytoreovirus: interactions among multiple structural Title proteins Author(s) Ueda, Shigenori; Masuta, Chikara; Uyeda, Ichiro Journal of General Virology, 78, 3135-3140 Citation https://doi.org/10.1099/0022-1317-78-12-3135 Issue Date 1997 Doc URL http://hdl.handle.net/2115/5819 Type article File Information JGV78.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP Journal of General Virology (1997), 78, 3135–3140. Printed in Great Britain ...............................................................................................................................................................................................................SHORT COMMUNICATION Hypothesis on particle structure and assembly of rice dwarf phytoreovirus: interactions among multiple structural proteins Shigenori Ueda, Chikara Masuta and Ichiro Uyeda Laboratory of Plant Virology and Mycology, Department of Agrobiology and Bioresources, Faculty of Agriculture, Hokkaido University, Sapporo 060, Japan and has non-specific nucleic acid-binding activity (Ueda & To study the morphogenesis and packaging of rice Uyeda, 1997). dwarf phytoreovirus (RDV), the interactions among Little is known about the replication and assembly process multiple structural proteins were analysed using of RDV or about interactions among multiple structural both the yeast two-hybrid system and far-Western proteins in viral particles. Therefore, in this study, we blotting analysis. The
    [Show full text]
  • Next Generation Sequencing Technologies for Insect Virus Discovery
    Viruses 2011, 3, 1849-1869; doi:10.3390/v3101849 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Review Next Generation Sequencing Technologies for Insect Virus Discovery Sijun Liu, Diveena Vijayendran and Bryony C. Bonning * Department of Entomology, Iowa State University, Ames, IA 50011, USA; E-Mails: [email protected] (S.L.); [email protected] (D.V.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-515-294-1989; Fax: +1-515-294-5957. Received: 2 September 2011; in revised form: 15 September 2011 / Accepted: 19 September 2011 / Published: 10 October 2011 Abstract: Insects are commonly infected with multiple viruses including those that cause sublethal, asymptomatic, and latent infections. Traditional methods for virus isolation typically lack the sensitivity required for detection of such viruses that are present at low abundance. In this respect, next generation sequencing technologies have revolutionized methods for the discovery and identification of new viruses from insects. Here we review both traditional and modern methods for virus discovery, and outline analysis of transcriptome and small RNA data for identification of viral sequences. We will introduce methods for de novo assembly of viral sequences, identification of potential viral sequences from BLAST data, and bioinformatics for generating full-length or near full-length viral genome sequences. We will also discuss implications of the ubiquity of viruses in insects and in insect cell lines. All of the methods described in this article can also apply to the discovery of viruses in other organisms. Keywords: insect virus; next generation sequencing; virus discovery; small RNA; transcriptome Viruses 2011, 3 1850 1.
    [Show full text]
  • 2017 National Veterinary Scholars Symposium 18Th Annual August 4
    2017 National Veterinary Scholars Symposium 18th Annual August – 4 5, 2017 Natcher Conference Center, Building 45 National Institutes of Health Bethesda, Maryland Center for Cancer Research National Cancer Institute with The Association of American Veterinary Medical Colleges https://www.cancer.gov/ Table of Contents 2017 National Veterinary Scholars Symposium Program Booklet Welcome .............................................................................................................................. 1 NIH Bethesda Campus Visitor Information and Maps .........................................................2 History of the National Institutes of Health ......................................................................... 4 Sponsors ............................................................................................................................... 5 Symposium Agenda .......................................................................................................6 Bios of Speakers ................................................................................................................. 12 Bios of Award Presenters and Recipients ........................................................................... 27 Training Opportunities at the NIH ...................................................................................... 34 Abstracts Listed Alphabetically .......................................................................................... 41 Symposium Participants by College of Veterinary Medicine
    [Show full text]
  • Genome Sequence Analysis of Csrv1: a Pathogenic Reovirus That Infects the Blue Crab Callinectes Sapidus Across Its Trans-Hemispheric Range
    fmicb-07-00126 February 8, 2016 Time: 17:51 # 1 View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Frontiers - Publisher Connector ORIGINAL RESEARCH published: 10 February 2016 doi: 10.3389/fmicb.2016.00126 Genome Sequence Analysis of CsRV1: A Pathogenic Reovirus that Infects the Blue Crab Callinectes sapidus Across Its Trans-Hemispheric Range Emily M. Flowers1,2, Tsvetan R. Bachvaroff1, Janet V. Warg3, John D. Neill4, Mary L. Killian3, Anapaula S. Vinagre5, Shanai Brown6, Andréa Santos e Almeida1 and Eric J. Schott1* 1 Institute of Marine and Environmental Technology, University of Maryland Center for Environmental Science, Baltimore, MD, USA, 2 University of Maryland School of Medicine, Baltimore, MD, USA, 3 National Veterinary Services Laboratories, Animal and Plant Health Inspection Service , United States Department of Agriculture, Ames, IA, USA, 4 National Animal Disease Center, Agricultural Research Service, United States Department of Agriculture, Ames, IA, USA, 5 Departamento de Fisiologia, Instituto de Ciências Básicas da Saúde, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil, 6 Department of Biology, Morgan State University, Baltimore, MD, USA The blue crab, Callinectes sapidus Rathbun, 1896, which is a commercially important Edited by: Ian Hewson, trophic link in coastal ecosystems of the western Atlantic, is infected in both North Cornell University, USA and South America by C. sapidus Reovirus 1 (CsRV1), a double stranded RNA virus. Reviewed by: The 12 genome segments of a North American strain of CsRV1 were sequenced Hélène Montanié, Université de la Rochelle, France using Ion Torrent technology. Putative functions could be assigned for 3 of the 13 Thierry Work, proteins encoded in the genome, based on their similarity to proteins encoded in other United States Geological Survey, USA reovirus genomes.
    [Show full text]
  • I CHARACTERIZATION of ORTHOREOVIRUSES ISOLATED from AMERICAN CROW (CORVUS BRACHYRHYNCHOS) WINTER MORTALITY EVENTS in EASTERN CA
    CHARACTERIZATION OF ORTHOREOVIRUSES ISOLATED FROM AMERICAN CROW (CORVUS BRACHYRHYNCHOS) WINTER MORTALITY EVENTS IN EASTERN CANADA A Thesis Submitted to the Graduate Faculty in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY In the Department of Pathology and Microbiology Faculty of Veterinary Medicine University of Prince Edward Island Anil Wasantha Kalupahana Charlottetown, P.E.I. July 12, 2017 ©2017, A.W. Kalupahana i THESIS/DISSERTATION NON-EXCLUSIVE LICENSE Family Name: Kalupahana Given Name, Middle Name (if applicable): Anil Wasantha Full Name of University: Atlantic Veterinary Collage at the University of Prince Edward Island Faculty, Department, School: Department of Pathology and Microbiology Degree for which thesis/dissertation was Date Degree Awarded: July 12, 2017 presented: PhD DOCTORThesis/dissertation OF PHILOSOPHY Title: Characterization of orthoreoviruses isolated from American crow (Corvus brachyrhynchos) winter mortality events in eastern Canada Date of Birth. December 25, 1966 In consideration of my University making my thesis/dissertation available to interested persons, I, Anil Wasantha Kalupahana, hereby grant a non-exclusive, for the full term of copyright protection, license to my University, the Atlantic Veterinary Collage at the University of Prince Edward Island: (a) to archive, preserve, produce, reproduce, publish, communicate, convert into any format, and to make available in print or online by telecommunication to the public for non-commercial purposes; (b) to sub-license to Library and Archives Canada any of the acts mentioned in paragraph (a). I undertake to submit my thesis/dissertation, through my University, to Library and Archives Canada. Any abstract submitted with the thesis/dissertation will be considered to form part of the thesis/dissertation.
    [Show full text]
  • Sequence Analysis and GTP-Binding Ability of the Minor Core Protein P5 of Rice Gall Dwarf Virus
    JARQ 36 (2), 83 – 87 (2002) http://www.jircas.affrc.go.jp GTP-Binding Ability of P5 of RGDV Sequence Analysis and GTP-Binding Ability of the Minor Core Protein P5 of Rice Gall Dwarf Virus Kenzaburo ICHIMI1, Akira KIKUCHI2, Yusuke MORIYASU3, Boxiong ZHONG4, Kyoji HAGIWARA5, Hiroshi KAMIUNTEN6 and Toshihiro OMURA5* 1,2,3,4,5 National Agricultural Research Center (Tsukuba, Ibaraki 305–8666, Japan) 6 Faculty of Agriculture, Miyazaki University (1–1 Gakuenkihanadai Nishi, Miyazaki 889–2155, Japan) Abstract Analysis of the nucleotide sequence of the genome segment S5 of Rice gall dwarf virus (RGDV), which belongs to the genus Phytoreovirus, revealed that this segment encodes a putative protein of approximately 91 kDa. Antiserum raised against the protein reacted with a minor structural protein of similar size in RGDV, demonstrating that S5 encodes the structural protein of RGDV. The protein named P5 appeared to be a component of viral core particles. Although no overall homology was found to any other proteins, including those of animal-infecting reoviruses, P5 of RGDV exhibited a significant homology to P5 of Rice dwarf virus (50%), which might be a guanylyltransferase, and to P5 of Wound tumor virus (55%). These results, together with the observation that P5 bound guanosine triphosphate suggest that P5 of RGDV shows a guanylyltransferase activity and, moreover, that plant- infecting reoviruses have a similar functional and/or structural organization to that of animal-infecting reoviruses. Discipline: Plant disease Additional key words: RGDV, Phytoreovirus animal reoviruses5, 18, 26. In RDV, the P5 protein encoded Introduction by the S5 segment of the dsRNA genome binds GTP covalently, suggesting that P5 of RDV can be a One of the notable properties of the viruses in the guanylyltransferase29.
    [Show full text]
  • The Reoviridae the VIRUSES
    The Reoviridae THE VIRUSES Series Editors HEINZ FRAENKEL-CONRAT, University of California Berkeley, California ROBERT R. WAGNER, University of Virginia School of Medicine Charlottesville, Virginia THE HERPESVIRUSES, Volumes I, 2, 3, and 4 Edited by Bernard Roizman THE REOVIRIDAE Edited by Wolfgang K. Joklik THE PARVOVIRUSES Edited by Kenneth I. Berns The Reoviridae Edited by WOLFGANG K. JOKLIK Duke University Medical Center Durham, North Carolina Springer Science+Business Media, LLC Library of Congress Cataloging in Publication Data Main entry under title: The Reoviridae. (Viruses) Includes bibliographical references and index. 1. Reoviruses. L Joklik, Wolfgang K. II. Series. QR414.R46 1983 576/.64 83-6276 ISBN 978-1-4899-0582-6 ISBN 978-1-4899-0582-6 ISBN 978-1-4899-0580-2 (eBook) DOI 10.1007/978-1-4899-0580-2 © Springer Science+Business Media New York 1983 Originally published by Plenum Press, New York in 1983 Softcover reprint of the hardcover 1st edition 1983 All rights reserved No part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise, without written permission from the Publisher Con tribu tors Guido 'Boccardo, Istituto di Fitovirologia Applicata del C.N.R., 10135 To­ rino, Italy Bernard N. Fields, Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, Massachusetts 02115; and Depart­ ment of Medicine, Brigham and Women's Hospital, Boston, Massa­ chusetts 02115 R. I. B. Fran'cki, Department of Plant Pathology, Waite Agricultural Re­ search Institute, The University of Adelaide, Adelaide 5064, South Australia Barry M.
    [Show full text]
  • REOVIRUS.Pdf
    REOVIRUS MAMMALIAN ORTHOREOVIRUS 1 (ATCC VR-230) REOVIRUS TYPE 2 (ATCC VR-231) REOVIRUS 3 (ATCC VR-824) PATHOGEN SAFETY DATA SHEET / INFECTIOUS SUBSTANCES INFECTIOUS AGENT NAME: Reovirus GENERAL: Reoviridae is a family of viruses that can affect the gastrointestinal system and respiratory tract. Viruses in the family Reoviridae have genomes consisting of segmented, double-stranded RNA (dsRNA). The name "Reoviridae" is derived from respiratory enteric orphan viruses. The term "orphan virus" means that a virus is not associated with any known disease. Even though viruses in the Reoviridae family have more recently been identified with various diseases, the original name is still used. Reovirus infection occurs often in humans, but most cases are mild or subclinical. Rotavirus, however, can cause severe diarrhea and intestinal distress in children. Reovirus can be readily detected in feces, and may also be recovered from pharyngeal or nasal secretions, urine, cerebrospinal fluid, and blood. Despite the ease of finding reovirus in clinical specimens, their role in human disease or treatment is still uncertain. The reovirus has been demonstrated to have oncolytic (cancer-killing) properties and has encouraged the development of reovirus-based therapies for cancer treatment. Reolysin is a formulation of reovirus that is currently in clinical trials for the treatment of various cancers. Some viruses of this family infect plants. Examples are Phytoreovirus and Oryzavirus. CHARACTERISTICS: Reoviruses are non-enveloped and have an icosahedral capsid (T-13) composed of an outer and inner protein shell. The genomes of viruses in Reoviridae contain 10-12 segments which are grouped into three categories corresponding to their size: L (large), M (medium) and S (small).
    [Show full text]