OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC330195
PRPSAP2 (NM_001243941) Human Untagged Clone Product data:
Product Type: Expression Plasmids Product Name: PRPSAP2 (NM_001243941) Human Untagged Clone Tag: Tag Free Symbol: PRPSAP2 Synonyms: PAP41 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_001243941, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTCCTGATCATGGTGTATGCATGTAAGACCTCTTGTGCCAAGAGCATCATTGGCGTGATACCCT ACTTTCCTTACAGCAAGCAGTGCAAGATGAGAAAAAGAGGCTCCATTGTCTCTAAATTGCTGGCTTCCAT GATGTGCAAAGCTGGTCTAACTCATCTTATTACTATGGATTTACACCAGAAGGAAATTCAGGGCTTCTTC AATATTCCTGTTGACAATTTAAGAGCATCTCCCTTCTTATTACAGTATATTCAAGAAGAGATCCCAGATT ACAGGAATGCAGTAATCGTGGCCAAGTCTCCAGCCTCGGCGAAGAGGGCACAGTCTTTTGCTGAGCGCCT GCGCCTGGGAATTGCAGTGATTCATGGAGAGGCGCAGGATGCCGAGTCGGACTTGGTGGATGGACGGCAT TCCCCACCCATGGTCAGAAGTGTGGCTGCCATCCACCCCAGCCTGGAGATCCCCATGCTGATTCCTAAAG AAAAGCCCCCAATCACGGTTGTGGGTGATGTTGGAGGAAGGATTGCCATCATCGTGGATGACATCATTGA TGATGTTGACAGCTTTCTTGCTGCAGCAGAGACCCTGAAGGAAAGAGGTGCATATAAGATCTTTGTGATG GCAACTCATGGCTTGTTGTCTTCTGACGCCCCCCGGCGGATTGAAGAGTCTGCCATTGATGAGGTGGTGG TCACCAATACAATTCCACATGAAGTCCAGAAGCTCCAGTGCCCCAAGATTAAAACTGTGGATATCAGCAT GATCCTTTCAGAGGCGATCCGTCGGATCCACAATGGGGAGTCCATGTCCTACCTTTTCAGAAACATAGGC TTAGATGACTGA
Restriction Sites: SgfI-MluI ACCN: NM_001243941 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). RefSeq: NM_001243941.1, NP_001230870.1 RefSeq Size: 1872 bp RefSeq ORF: 852 bp
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 PRPSAP2 (NM_001243941) Human Untagged Clone – SC330195
Locus ID: 5636
UniProt ID: O60256 Protein Families: Druggable Genome Gene Summary: This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (4) differs in the 5' UTR, lacks an in-frame exon in the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. Variants 4 and 5 encode the same isoform (4), which has a shorter N-terminus compared to isoform 1.
This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2