Microsatellite Development in Platanus For

Home , Hamamelidales, Platanus, Platanus occidentalis, Platanus racemosa

MICROSATELLITE DEVELOPMENT IN PLATANUS FOR

DOCUMENTING GENE FLOW AMONG SPECIES

______

A Thesis

Presented

to the Faculty of

California State University, Chico

______

In Partial Fulfillment

of the Requirements for the Degree

Master of Science

Biological Sciences

______

Kylene R. Lang

Fall 2010 MICROSATELLITE DEVELOPMENT IN PLATANUS FOR

DOCUMENTING GENE FLOW AMONG SPECIES

A Thesis

Kylene R. Lang

Fall 2010

APPROVED BY THE DEAN OF GRADUATE STUDIES AND VICE PROVOST FOR RESEARCH:

Katie Milo, Ed.D.

APPROVED BY THE GRADUATE ADVISORY COMMITTEE:

______Abdel-Moaty M. Fayek Kristina A. Schierenbeck, Ph.D., Chair Graduate Coordinator

______Tag N. Engstrom, Ph.D.

______Kristopher A. Blee, Ph.D. TABLE OF CONTENTS

PAGE

List of Tables...... iv

List of Figures...... v

Abstract...... vi

CHAPTER

I. General Background...... 1

Systematics/Evolutionary History...... 1 Evidence of Platanus in the Fossil Record...... 4 Morphology ...... 4 Habitat and Range ...... 6 Growth and Reproduction ...... 8 Hybridization...... 10 Microsatellites ...... 12 Significance of this Research ...... 12

II. Methods...... 15

III. Results...... 21

IV. Discussion...... 27

Microsatellite Data ...... 27 Admixture Analysis...... 28 Conservation Implications...... 29 Potential Future Directions for Platanus Hybridization Studies... 31

Literature Cited...... 32

Appendix

A. Sample Names and Collection Information ...... 39

iii LIST OF TABLES

TABLE PAGE

1. Characterization of 13 Microsatellites in Platanus spp...... 22

2. Private Alleles Discovered in Platanus racemosa, P. occidentalis, and P. x acerifolia...... 23

3. Genetic Diversity Estimates: Average Number of Alleles Per Sample (A), Average Number of Phenotypes Per Sample (P), Average Number of Unshared Alleles Between Pairs of Individuals Within a Species (H’S), Average Number of Unshared Alleles Between Pairs of Individuals Across All Species (H’T), the Proportion of Total Diversity Found Between Species (F’ST), and A Yes/No Record of Locus Polymorphism (PM 1/0)...... 26

iv LIST OF FIGURES

FIGURE PAGE

1. Bar Plot of Estimates of Q (Estimated Membership Coefficient for Each Individual) Indicating Admixture in Platanus Populations...... 25

v ABSTRACT

MICROSATELLITE DEVELOPMENT IN PLATANUS FOR

DOCUMENTING GENE FLOW AMONG SPECIES

Kylene R. Lang

Master of Science in Biological Sciences

California State University, Chico

Fall 2010

Hybridization is a primary source of invasive genotypes and has been shown to contribute to the loss of diversity in a number of locally adapted species. The focus of this study is to develop microsatellite markers with the intent to quantify gene flow within the ancient genus Platanus between the native taxa (P. racemosa, P. racemosa var. wrightii, P. occidentalis, and P. orientalis) and the ornamental P. x acerifolia. Pla- tanus is wind-pollinated, and its species readily hybridize. The horticultural P. x acerifolia is widely planted for its tolerance to infection and other city stresses, and through hybridization events is endangering the genetic integrity of native Platanus populations in already compromised, shrinking riparian habitats. Thirteen of 28 developed microsatellite primer pairs amplified simple sequence repeat (SSR) loci for all Platanus taxa.

Species specific alleles were discovered in P. racemosa (n = 18), P. occidentalis

vi (n = 31), and P. orientalis (n = 13). Alleles otherwise found only in P. occidentalis and

P. orientalis were also found in putative P. racemosa X P. x acerifolia hybrids. Genetic admixture was apparent upon analysis with STRUCTURE; notably putative P. racemosa X P. x acerifolia hybrids clustered primarily with P. racemosa, but also with P. occidentalis and P. orientalis. Genetic differentiation estimates (F’ST) ranged from

0.047 to 0.549 (omitting 1 monomorphic locus). These data will serve as the basis for a larger scale sampling efforts to predict the long-term consequences of gene movement out of P. x acerifolia and into their native congeners at the regional and landscape level.

vii

CHAPTER I

GENERAL BACKGROUND

Systematics/evolutionary history—Platanus (plane tree, sycamore), the only genus within the Platanaceae, is a relict of an ancient lineage as evidenced by platanoid fossils dating to the early Cretaceous (Sudworth, 1967; Crane et al., 1993). There are seven extant species distributed in the Northern Hemisphere (Stuart and Sawyer, 2001; Nixon and Poole, 2003; Feng et al., 2005). Five distinct species and three varieties are native to

North America; Platanus racemosa Nutt. and Platanus racemosa var. wrightii (S.

Watson) L.D. Benson (Western North America); Platanus occidentalis L. and Platanus occidentalis var. palmeri (Kuntze) K. Nixon & J. Poole ex Geerinck (Eastern North

America); and Platanus rzedowskii Nixon & J.M. Poole; and Platanus mexicana Moric. and Platanus mexicana var. interior Nixon & J.M. Poole found in Mexico and adjacent

Guatemala (Nixon and Poole, 2003; Grimm and Denk, 2008). Platanus orientalis L. is native to southeastern Europe and western Asia, and Platanus kerrii Gagnep. is found in

Laos and North Vietnam (Hsiao, 1973; Nixon and Poole, 2003; Grimm and Denk, 2008).

Placement of Platanus in the Platanaceae seems secure, but the family recently has been placed within the clade Proteales with the Proteaceae and Nelumbonaceae (Grimm and

Denk 2008; Judd et al., 2008).

Hybridization is a documented phenomenon within Platanus, both ancient and recent

(Besnard et al., 2002; Feng et al., 2005), and poses a threat to the genetic integrity of P.

1 2 racemosa (Rhymer and Simberloff, 1996; Nixon and Poole, 2003; Whitlock, 2003;

Grimm and Denk, 2008). Platanus x acerifolia (Aiton) Willd., a hybrid between P. occidentalis and P. orientalis, is widely planted as an ornamental in temperate regions, in part due to its disease resistance and tolerance of air pollution (Besnard et al., 2002;

USDA, NRCS, 2008). Plantings in European cities are extensive, composing 40% of tree plantations in Paris, even more in London (Besnard et al., 2002), and as much as 60% in

Milano (Anselmi et al., 1994). Ornamental plantings are equally common in the United

States. Species within this ancient genus are hypothesized to be threatened with extinction via genetic homogenization mediated via the human dispersal of P. x acerifolia.

The historic placement of the Platanaceae (Sudworth, 1967; Hickman, 1993; Keator,

2002; USDA, NRCS, 2008; Nixon and Poole, 2003) within the subclass Hamamelidae

(Thorne, 1973; Cronquist, 1981; Zavada and Dilcher, 1986; Schwarzwalder and Dilcher,

1991) was based on the reduced, wind-pollinated flowers often aggregated into dangling inflorescences (Cronquist, 1981, 1988; Takhtajan, 1980) and was supported by comparative pollen data (Zavada and Dilcher, 1986). Cronquist (1981) recognized the

Platanaceae as an ancient taxon, well-established in the fossil record and suggested

Hamamelidales (an order containing Platanaceae within Hamamelidae) evolved from a

Magnoliid, or a Magnoliid-derived taxon. Morphological similarities between

Platanaceae and Hamamelidaceae, specifically gross leaf and floral resemblance with members of the recently separated Altingiaceae (includes Liquidambar), supported the alliance (Schwarzwalder and Dilcher, 1991; Nixon and Poole, 2003).

Although morphologic similarities are evident, it became increasingly apparent the subclass Hamamelidae is a polyphyletic group (Qiu et al., 1998). Cronquist (1981) recognized incongruence in the Platanaceae-Hamamelidaceae association determining neither family could be derived from the other. He described the flowers of Platanus as more primitive than those of Hamamelidaceae, while Tippo (1938) pointed out the more advanced nature of Platanus wood. Ernst (1963) described Platanus as belonging within

Hamamelidae, but maintained a direct relationship with Hamamelidaceae is not suggested based on floral morphology.

Despite the morphological similarities (thought now to be entirely superficial, see

Nixon and Poole, 2003), the Altingiaceae and Platanaceae are now recognized as ancient parallel clades. Although morphological studies repeatedly placed Platanaceae in close association with Hamamelidaceae, recent molecular work show a close relationship instead with Proteaeceae (Soltis et al., 2000; Nixon and Poole, 2003). The Platanaceae together with the Nelumbonaceae and Proteaceae have now been removed from the order

Hamamelidales and placed in a new order called the Proteales (Judd et al., 2008).

Although Platanaceae as currently defined contains a single extant genus Platanus, the taxonomy within the group has been variously treated (Hickman, 1993; USDA,

NRCS, 2008; Nixon and Poole, 2003). Santamour and McArdle (1986) broke the genus into two sub-genera, Platanus and Castaneophyllum, and others described one genus with

11 species (Hsiao, 1973). Seven species are currently recognized with a total of ten taxa, including three recognized varieties (Nixon and Poole, 2003; Judd et al., 2008). Platanus includes an ornamental species, Platanus x acerifolia, (London plane tree; Hickman,

1993), synonymous with Platanus hybrida (USDA, NRCS 2008). Platanus x acerifolia,

4 was developed in 1670 at the Oxford Botanical Garden in England (Henry and Flood,

1919), via hybridization between P. orientalis and P. occidentalis (Santamour, 1969) and has since been introduced widely as an ornamental.

Evidence of Platanus in the fossil record—The first platanoid leaf fossils appear in the Albian of the early Cretaceous (Hickey and Doyle, 1977). By the late Cretaceous, the

Platanaceae became an important component of the European fossil record of flowering plants (Hickey and Doyle, 1977), and evidence suggests a rapid radiation of the family during this time (Tidwell, 1998).

The Platanaceae is well-represented in the Early Cretaceous through Tertiary periods of North America, and indicates a much greater diversity than currently exists (Tidwell,

1998; Grimm and Denk, 2008). The leaf specimens found are similar to extant species in that they are alternate, simple, and have three to five lobes. Wood from Platanus is commonly found in the fossil record, and has been reported from the Eocene of

Yellowstone National Park, the Miocene of Nevada City, California, and in the Gingko

State Park, Washington (Tidwell, 1998). It is suggested early North American platanoid species were associated with riparian habitat, because of the association of fossils with channel-sand or stream levee deposits (Hickey and Doyle, 1977; Cronquist, 1981). A more recent view on the fossil record of platanoid leaves suggests a more detailed morphological analysis is needed to confirm the placement within the modern crown group of Platanaceae, due to lack of unequivocal synapomorphies (Nixon and Poole,

2003).

Morphology—Platanus species possess a characteristic bark, which is exceptionally thin, smooth, and often whitish or pale green (Sudworth, 1967; Keator, 2002). As the

5 trees grow and the bark ages, it turns a chalky white color and is shed in thin sheets annually, exposing fresh greenish bark beneath (Sudworth, 1967).

The large deciduous leaves that characterize Platanus are veined, simple, alternate, have three to five lobes, and possess collar like stipules (Sudworth, 1967; Hickman,

1993; Keator, 2002). Species within the genus are divided based on leaf lobing, amount of hair on the undersides of the leaves, the number of fruit balls, and the shape of the fruit

(Sudworth, 1967).

I will limit discussion to the 4 taxa that will remain the focus of this work; the native

P. racemosa, introduced hybrid P. x acerifolia, and the hybrid’s parental species P. occidentalis and P. orientalis. Platanus racemosa (Western sycamore) has deeply lobed, alternate leaves with a pubescent undersurface, and a distinctive multicolored, smooth bark (Keator, 2002; Hickman, 1993; Stuart and Sawyer, 2001). At the base of the trunk, however, the bark can become thick (2.5 to 7.5 cm) and furrowed and is dark brown in color (Sudworth, 1967; Keator, 2002). Platanus racemosa grows to heights of 10-35 m, with a base of less than one meter in diameter (Sudworth, 1967; Hickman, 1993). Trees can live to over 200 years and are erect, forked, or leaning, with relatively short, forked trunks and ascending, sometimes crooked branches (Sudworth, 1967; Stuart and Sawyer,

2001). The crooked nature of the branches leads to a relatively open crown (Sudworth,

1967). The leaves of P. racemosa are somewhat round, with three or five lobes, acute to acuminate, entire, and 10 to 25 cm in diameter (Hickman, 1993; Stuart and Sawyer,

2001). Stuart and Sawyer (2001) describe “the sinuses between lobes are about 50% of the lobe length.” Platanus racemosa var. wrightii (Arizona sycamore) is quite similar in

6 morphology to P. racemosa, but its stalked fruit heads distinguish it as well as its more deeply lobed leaves (Hsiao, 1973).

Platanus occidentalis (American sycamore, and Eastern sycamore) (USDA, NRCS

2008, Whitlock 2003), is one of the tallest trees of eastern deciduous forests, typically ranging in height from 18 to 37 m (Sullivan, 1994). Platanus occidentalis generally has the greatest diameter of any temperate hardwood tree (USDA, NRCS, 2008) with the largest individual measuring 51 m tall and a circumference of 10 m (Sullivan, 1994). The bark of P. occidentalis is similar to that of P. racemosa, except that young trees possess small scales on their trunks (USDA, NRCS, 2008). The leaves are characteristic of other sycamores and are 10 to 35 cm in length with three to five sharp lobes (USDA, NRCS,

2008).

Due to its hybrid background, P. x acerifolia is variable in both form and growth rate.

It can usually be distinguished from P. occidentalis by somewhat longer and narrower leaf lobes, and the larger size of its leaves (USDA, NRCS, 2008). Also, P. x acerifolia has only one to two fruiting heads per stalk, and its bark is usually greener than P. occidentalis (USDA, NRCS, 2008). It can be distinguished from P. racemosa by the presence of leaf serrations and shallower lobes.

Habitat and range—Platanus racemosa—Platanus racemosa is restricted to perpetual and intermittent streams or moist canyons in well-drained soils (Sudworth,

1965; Hickman, 2003). It is limited to California and Baja California (Hsiao, 1973), and grows primarily in riparian woodlands up to 2000 m where summers are hot (Stuart and

Sawyer, 2001; Keator, 2002; Hickman, 2003).

As the tallest tree in its native riparian habitat, the abundant shade provided by P. racemosa helps to cool streams and riparian zones, and provides habitat and food for nesting birds and small animals (Stuart and Sawyer, 2001). Platanus racemosa is an integral component of California riparian habitat commonly associated with Alnus rhombifolia, Acer macrophyllum, Juglans species, and Salix species (Sudworth, 1967).

Platanus racemosa var. wrightii is also associated with riparian habitats, and is found in the southwestern United States (Arizona and New Mexico), and adjacent parts of

Mexico (Hsiao, 1973; Bock and Bock, 1989). Deciduous forests of the Southwest contain extensive groves of P. racemosa var. wrightii, and in some areas it is the sole tree component of the habitat (Glinski, 1977). Platanus racemosa var. wrightii is considered to be an important component of habitat diversity, and has been documented to provide nesting sites for the Rose-throated Becard (Platypsaris aglaiae) (Glinski, 1977).

Platanus x acerifolia—Platanus x acerifolia (London plane tree) is naturalized along many valley and foothill streams in northern California (Oswald, 2002) and within the ranges of both parental species as well as beyond those ranges where neither parental species are present (Rhymer and Simberloff, 1996). It is widely planted as an ornamental, especially in cities, and provides a good example of the well-known phenomenon of hybrid vigor (heterosis), in which the hybrid is more robust than either parental species

(Rhymer and Simberloff, 1996; Judd et al., 2008; Rieseberg et al., 2000).

Platanus occidentalis—Platanus occidentalis grows primarily along streams and in bottomlands in alluvial soil from 0 to 300 m in elevation (Sullivan, 1994; USDA, NRCS,

2008). It is widespread along the eastern United States, occurring in Texas, Nebraska,

Iowa, and Wisconsin, north to southern Ontario, Canada and south to the mountains of

8 northeastern Mexico. Common associates include Liquidambar styraciflua, Acer negundo, A. saccharinum, A. rubrum, Populus species, and Salix species (USDA, NRCS,

2008). Platanus occidentalis is extirpated from Maine (USDA, NRCS, 2008).

Platanus orientalis—Platanus orientalis, (Oriental plane tree), occurs naturally from southeastern Europe and east through Central Asia (Boothroyd, 1930; Hsiao, 1973). It was introduced into England in the seventeenth century (Rhymer and Simberloff, 1996).

Brush (1917) described P. orientalis as a widely planted shade tree in temperate areas along streets and in parks, but it is possible he was actually describing P. x acerifolia and not the Oriental plane tree, given the lack of corroborative evidence.

Growth and reproduction—General characteristics of Platanaceae—The trees of

Platanaceae are monoecious (Sudworth, 1967; Hickman, 1993; Keator, 2002) with small flowers with reduced or absent perianths characteristic of wind-pollinated species that grow in a greenish globose raceme and hang from thin pendulous stems (Sudworth, 1967;

Hickman, 1993; Keator, 2002; Judd et al., 2008). The female clusters are much larger than the male clusters, 1.27 cm in diameter compared to 0.85 cm (Sudworth, 1967).

Staminate clusters break apart with age, while the pistillate clusters persist (Hickman,

1993).

The female inflorescences mature into balls of hard packed seed that range in size from 1.91 cm to 3.81 cm in diameter, and the seeds radiate outward from a central body forming an aggregate fruit (Sudworth, 1967; Judd et al., 2008). The heads become ripe in autumn, and usually stay attached to the tree until spring (Sudworth, 1967), at which time they break apart into single-seeded achenes (Hickman, 1993; Keator, 2002). Each seed has a circle of hair-like bristles at its base, which aid in dispersal (Sudworth, 1967; Judd

9 et al., 2008). Sycamores are widely dispersed via anemochory (Sudworth, 1967; Keator,

2002). In a study of long-distance seed dispersal in wind dispersed temperate tree species,

Nathan et al. (2002) predict dispersal distances up to several hundred meters, but their findings suggest that for those few seeds uplifted above the canopy on turbulent winds can travel tens of kilometers.

Platanus racemosa—Platanus racemosa is described as fast growing and intolerant of shade at any age (Sudworth, 1967). Seedling demographic data on this and all Platanus species are limited. Although described as moderately prolific seeders with unknown recruitment rates it has been noted to establish best on exposed sand or gravel with adequate moisture (Sudworth, 1967).

Glinski (1977) observed the distribution and regeneration of P. racemosa var. wrightii along Sonoita Creek in Santa Cruz County, Arizona and found primarily asexual propagules with 74% of individuals emerging from root or trunk sprouts. He found no seedlings and only one sapling likely produced from seed. Glinski postulated vegetative reproduction has been the main mode of reproduction for “some time,” noting the large size and variance of size in sprouts. Although the phenomenon of vegetative reproduction was prevalent, Glinski was unable to determine what stimulates an Arizona sycamore to sprout. Bock and Bock (1989) described sexual reproduction in P. racemosa var. wrightii but also observed P. racemosa var. wrightii stump sprouting from the base or stump of old trees.

Platanus x acerifolia—Platanus x acerifolia is demonstrated to be both disease resistant and tolerant of pollution (USDA, NRCS, 2008). It is tolerant of coal dust, smoke, compacted soils, and other challenges of urban environments (Rhymer and

Simberloff, 1996). It has become a very popular ornamental in North America and

Europe.

Platanus occidentalis—Platanus occidentalis is described as fast growing with weak limbs that are susceptible to wind and ice damage. It is however often a naturally occurring early colonizer of disturbed habitats. It can tolerant weeks of flooding and the seedlings can survive complete submersion, as long as the water is aerated (USDA,

NRCS, 2008). Platanus occidentalis forms a strongly branched and very widespread root system (Sullivan, 1994).

Platanus orientalis—Platanus orientalis like other members of the genus, is characterized by rapid growth and forms a strong and extensive root system. In a study comparing tree species for large building timber, in the first 15 years of growth P. orientalis grew even faster and took better advantage of available water and soil nutrients than the Norway Poplar (Populus x canadensis var. regenerate) (Naidenova and

Garelkov, 1986).

Hybridization—Platanus species are known to be highly interfertile despite the once allopatric distribution of species (Ernst, 1963; Rhymer and Simberloff, 1996; Nixon and

Poole, 2003; Whitlock, 2003; Grimm and Denk, 2008). Santamour (1972), successfully produced viable seeds between P. racemosa and either P. occidentalis or P. orientalis.

He determined the chromosome number of P. racemosa, P. racemosa var. wrightii, P. occidentalis, P. orientalis, P. x acerifolia, and P. mexicana all to be 2n = 42 (Santamour,

1969), which supports a lack of chromosomal barriers among the species.

Whitlock (2003) examined the ITS-1 and ITS-2 regions of nuclear ribosomal RNA from individuals of the species, P. racemosa (collected from native California

11 populations, N = 8), P. occidentalis (collected from Virginia populations, N = 8), and P. orientalis (collected in France, N = 7). She compared these sequences to sequences collected from suspected hybrid populations (near the Sacramento River, California, N =

22) to determine the degree to which hybridization between P. racemosa and the ornamental P. x acerifolia is occurring in California. Whitlock found that the majority of

Platanus individuals in riparian areas were in fact hybrids (91%), and support the hypothesis that human dispersal is increasing hybridization between P. racemosa, P. x acerifolia, P. occidentalis, and P. orientalis. Platanus x acerifolia may have a reproductive advantage over P. racemosa because it has an apparent resistance to sycamore anthracnose (Oswald, 2002). Sycamore anthracnose is a fungal disease

(Gnomonia platani) that readily infects native P. racemosa (Hickman, 1993), causing a dieback of twigs and flowers in the spring (Stuart and Sawyer, 2001; Whitlock, 2003).

Although it rarely kills an entire tree, sycamore anthracnose can completely defoliate or kill large portions of the tree crown, leaving the tree weakened and unattractive (Stuart and Sawyer, 2001; Whitlock, 2003). The resistance present in P. x acerifolia originates from P. orientalis (Anselmi et al., 1994), and when crossed with P. occidentalis, the resistance is strongly inherited (Whitlock, 2003). The resistance is only predictable in first generation hybrids, however and becomes variable with subsequent crosses between

F1 individuals (Santamour and McArdle, 1985).

If resistance to sycamore anthracnose is inherited by P. racemosa - P. x acerifolia hybrids, it could give them a selective advantage over native P. racemosa individuals.

Whitlock (2003) suggests the resistance to disease, which is a desirable characteristic in an ornamental street tree, could actually have negative ecological consequences such as

12 reduction of the prevalence of deadwood and trunk cavities and states these cavities are important nesting sites for wood ducks and ringtail. Lack of deadwood also could have detrimental effects on numerous detritivorous natives.

Microsatellites—Microsatellites (SSRs) are comprised of tandem repeats from one to six nucleotides and typically any given locus will be 5 to 40 repeats (Selkoe and Toonen,

2006). SSRs occur in both coding and non-coding regions within the euchromatic genome, and are found in higher than predicted frequency within the majority of taxa (Li et al., 2002; Selkoe and Toonen, 2006). Microsatellites are both a versatile and relatively cost efficient marker type and quickly have become the most popular marker type for answering ecological questions (Selkoe and Toonen, 2006).

Significance of this research—Interspecific hybridization occurs frequently in both plants and animals (Rieseberg et al., 2006), and hybridization between native and introduced species is also common, particularly in plants (Vilà et al., 2000). Human activities such as introducing non-natives, and fragmenting or otherwise degrading natural ecosystems promote hybridization of previously allopatric congeners (Vilà et al.,

2000). When introgression accompanies hybridization, dilution of the native gene pool can occur (Abbott, 1992), and can even result in extinction of the native species altogether (Anttila et al., 1998). Often underrated, human-mediated hybridization is one of the leading causes of biodiversity loss (Muhlfeld et al., 2009). Through introgressive hybridization genetic diversity is reduced, limiting evolutionary flexibility and locally adapted genes become lost along with the populations that once contained them

(Rieseberg, 1991; Ellstrand and Elam, 1993).

Hybridization among native and introduced fish species is particularly well documented and has been shown to have disastrous effects for native parental taxa

(Edwards, 1979; Siddiqui, 1979; Dowling and Childs, 1992; Muhlfeld et al., 2009).

Specifically, hybridization between introduced rainbow trout (Oncorhynchus mykiss) and the 14 subspecies of native cutthroat trout in the United States has resulted in the extinction of two subspecies, five subspecies are federally listed as threatened and the remaining seven have been petitioned for listing (Muhlfeld et al., 2009).

Also in the United States, the native red mulberry (Morus rubra) is endangered or threatened in several states (USDA, NRCS, 2008). It is a wind-pollinated species that readily hybridizes with the introduced East-Asian white mulberry (Morus alba) (Burgess et al., 2005; Burgess et al., 2006). In a reciprocal transplant and common garden study white mulberry and its hybrids were more fit in all conditions tested, suggesting imminent decline of the red mulberry (Burgess et al., 2006).

Like the red and white mulberry, Platanus racemosa is wind-pollinated and readily hybridizes with congeners including the introduced P. x acerifolia. The presence of highly variable intermediate morphologies between the two strongly suggests introgression. While arguably P. racemosa has greater abundance to red mulberry, it has a much smaller range and is endemic only to California. Platanus racemosa is an integral member of riparian communities in California and the threat of introgressive hybridization with P. x acerifolia warrants further investigation.

Platanus species are paleopolyploids (Grant, 1981). Results generated from the use of

ITS regions to determine the prevalence of hybridization between P. racemosa and P. x acerifolia are inconclusive due to probable high sequence copy numbers and lack of

14 concerted evolution among the sequences (Baldwin et al., 1993; Whitlock, 2003). Here I develop a more precise measure of level of gene flow among Platanus species in order to assess the threat that hybridization poses to genetic integrity of P. racemosa.

This project has two components. The first is to generate workable primers that will amplify microsatellite regions in the study species, P. racemosa, P. racemosa var. wrightii, P. occidentalis, P. orientalis, P. x acerifolia, and putative P. racemosa X P. x acerifolia hybrids. The goal is the development of species-specific markers to track gene flow in the genus. The second is to investigate the levels of inter- and intra-specific variation of the microsatellite loci sampled in P. racemosa, P. racemosa var. wrightii, P. occidentalis, P. orientalis, and P. x acerifolia and the extent of gene flow between

Platanus racemosa, P. racemosa var. wrightii, P. occidentalis, P. orientalis, and P. x acerifolia. If gene flow exists, alleles specific to P. occidentalis and P. orientalis, due to the hybrid origin of P. x acerifolia, should be detected in putative P. racemosa X P. x acerifolia hybrids. Specific hypotheses are there will be significant gene flow between

Platanus species or there will be no significant gene flow between the species.

CHAPTER II

METHODS

Collection information for specimens is provided in appendix 1. Individuals of pure

Platanus racemosa (n = 8 Northern California), pure P. racemosa var. wrightii (n = 3

Arizona), and the hybrid P. x acerifolia (n = 10 Chico, California) as well as pure representatives of its parental species P. occidentalis (n = 16 Virginia, West Virginia,

Illinois, and North Carolina) and P. orientalis (n = 18 England, Greece, Turkey,

Turkmenistan and Cyprus), were sampled to assign species-specific genotypes to observe gene flow in suspected P. racemosa X P. x acerifolia (n = 10 Northern California) hybrids. To maximize the likelihood of sampling individuals free from interspecific hybridization, mature trees of the putative pure species were selected at least 100 m apart with a diameter breast height of 95cm or greater except where otherwise noted (Appendix

A). By sampling large (i.e., old) trees, the likelihood they were established prior to widespread planting of P. x acerifolia is greatly increased. Sampling trees not growing directly adjacent to established P. x acerifolia pollen sources, likewise increases the chances of gaining genetically pure individuals. Platanus racemosa individuals collected by D. Whitlock (6 of 8 total) were obtained from old growth populations chosen by their distance and isolation from urban areas to minimize interspecific pollen exposure

(Whitlock, 2003). Leaf morphology was used as the main identifying characteristic based

15 16 on descriptions provided by Santamour and McArdle (1986) and Hickman (1993) and supported by molecular data (Feng et al., 2005; Whitlock, 2003).

Leaves were harvested using a slingshot and taken to a laboratory at California State

University Chico where they were stored at -80ºC until DNA extraction. Total genomic

DNA was extracted from fresh/frozen leaf tissue (40-50 mg) using the DNeasy Plant mini kit (Qiagen). A total of 20 mg of leaf tissue was used for dried specimens. Samples obtained in pre-extracted form are noted in Appendix A.

Microsatellites (n = 28; 27 dinucleotide repeats, 1 trinucleotide repeat) were developed in Platanus racemosa using the FIASCO (Fast Isolation by AFLP of

Sequences Containing repeats) technique with slight modification to maximize isolation efficiency (Zane et al., 2002). This technique involves enrichment of microsatellite containing regions of the genome, thus increasing the odds of detection. Approximately

100 ng genomic DNA (P. racemosa) was digested with the restriction enzyme MseI, and ligated using T4 ligase with a MseI adapter (5’-TACTCAGGACTCAT-3’ / 5’-

GACGATGAGTCCTGAG-3’). The restriction ligation mixture was incubated at 37 C overnight and then diluted in 50 l dH2O. A combined polymerase chain reaction (PCR) was conducted with all four MseI primers (5’-GATGAGTCCTGAGTAAN-3’) with program parameters of 72 C for 3 min; 20 cycles of 94 C 30 sec, 53 C 1 min, 72 C 2 min; and a final step of 72 C for 7 min. Hot start was not used in order to allow nicks in the ligated DNA to be filled by the Taq DNA polymerase. Resultant products were visualized on a 1% agarose gel showing a smear roughly 400 bp – 2,000 bp long. To concentrate the product it was dried with a vacufuge and resuspended in 43 l dH2O.

The resultant product (43 l) was hybridized to a 5’-biotinylated (AT)17 probe (8 l) with 42 l 10x SSC and 7 l 1% SDS in a 100 l reaction volume. The mixture was thermocycled at 95 C for 3 min and 25 C for 15 min. Streptavidin beads (1mg) were washed with TEN100 (10 mM Tris-HCl, 1 mM EDTA, 100 mM NaCl, pH 7.5) three times, resuspended in 40 l of TEN100, and unrelated PCR product (10 l) was added.

To capture the probe-DNA complex, the DNA-probe was first diluted with 300 l

TEN100 and then combined with the prepared Streptavidin beads. The mixture was incubated at room temperature for 30 min on a shaker (gentle agitation). Six nonstringency washes were then performed with 400 l TEN100, an incubation of 5 min at room temperature with gentle mixing and recovering of the DNA by magnetic field separation. Six stringency washes were then performed with 400 l SSC (0.2 x) and 0.1%

SDS, and an incubation of 5 min at room temperature with gentle mixing. The final wash was stored for further use.

To recover the DNA from the beads-probe complex two denaturation steps were performed, one with TE and one with NaOH. For the TE elution, 50 l of TE was added to the Streptavidin beads and incubated at 95 C for 5 min and the supernatant containing the target DNA was stored. For the NaOH elution, 12 l of 0.15 M NaOH was added after which the mixture was incubated for 5 min at 95 C. To the supernatant, 7.68 l

0.1667 M acetic acid was added to neutralize the pH, and TE (30.32 l) was added to reach the final volume of 50 l.

Once recovered from the Streptavidin beads, the DNA was precipitated. One volume of isopropanol and sodium acetate (0.15 M final concentration) was added to each of the

18 following: last non-stringency wash (400 l), last stringency wash (400 l), TE elution

(50 l), and NaOH elution (50 l). Each of these should contain DNA fragments containing the selected repeat (AT)17. The mixtures were kept at –20 C for 30 min then centrifuged at maximum speed for 15 min. The supernatant was discarded and tubes were placed in a speed-vac to completely dry remaining pellets. Each pellet was resuspended in 50 l dH2O.

Amplification via PCR was done on enriched fragments resulting from the last non- stringency wash, last stringency wash, TE elution and the NaOH elution. Once again,

MseI primers (5’-GATGAGTCCTGAGTAAN-3’) were used for amplification at 72 C for 3 min, then 20 cycles of 94 C 30 sec, 53 C 1 min, and 72 C, with a final step of 72

C for 7 min. PCR product was visualized on a 1% agarose gel. The non-stringency wash, stringency wash, and the NaOH elution produced smears, but the TE elution showed nothing. PCR was redone but results remained the same.

PCR product from the NaOH elution was dried with a speed-vac and resuspended in 4

l of dH2O to be used for cloning fragments into Escherichia coli. The 4 l microsatellite enriched DNA was combined with 1 l salt solution and 1 l Topo vector (Invitrogen) and very gently mixed. The ligation reaction was incubated for 30 min. To transform the

E. coli 25 l of TOP 10 competent cells (Invitrogen) were gently mixed with 6 l of vector containing target DNA and incubated on ice for 10 min. The cells were heat shocked at 42 C for 45 sec and then immediately transferred to ice. Room temperature

SOC medium (250 ul) was added to the cells and placed on a shaker at 225 rpm and 37

C for 1 hour. Half of the cell culture along with 40 l x-gal (40 mg/ml) was spread onto

19 a LB plate and the remaining culture was spread on a second plate with x-gal. Both plates were incubated overnight at 37 C.

Direct colony PCR was performed from isolated transformed (white) colonies. PCR was done in 25 l reactions with H2O (13.9 l), 10x buffer (2.5 l), dNTPs (5 l), MgCl2

(1 l), primers T7 and M13R (1.25 l each), and Taq polymerase (0.1 l). The program used consisted of an initial step of 97 C for 2 min, 30 cycles of 97 C 30 sec, 48 C 1 min, 72 C 2 min (+ 45 sec per cycle), and a final step of 72 C for 7 min. PCR products were visualized on a 1 % agarose gel and successfully amplified samples were purified with Exo1 (exonuclease) and antarctic phosphatase at 37 C for 15 min and 80 C for 15 min. Samples were sequenced and screened for microsatellite loci. A total of 191 colonies were amplified via PCR, 186 of which were screened for microsatellite loci. Of those, 52 microsatellite loci were discovered, although only 28 of those contained repeats

 4 with flanking regions sufficient to generate both forward and reverse primers.

Primers were developed in the range of 19 to 25 bp in length that produced fragments ranging from 100-400 bp, for later multiplexing. Primers were tested on a subset of individuals from each study taxon to check for primer compatibility, 13 of which successfully amplified. Labeled oligos were ordered and PCR was carried out on all individuals. The program used consisted of an initial step of 94 C for 7 min, 30 cycles of

94 C 30 sec, 61 C 30 sec, 72 C 1 min, and a final step of 72 C for 7 min. Amplified fragments were visualized on 1% agarose gels for quality control and samples were sent to the San Diego State University Microchemical Core Facility for purification and genotyping on an ABI Prism sequencer (model 310, and 3100).

Raw data files were analyzed with GeneMapper v4.0 (Applied Biosystems, Inc.).

Auto-binning was used, although each sample was checked manually for accuracy to prevent the calling of false alleles such as stutter peaks. STRUCTURE 2.3.2 was used to infer species identity, assign individuals to species and identify admixture and migrant individuals (Pritchard et al., 2000; Falush et al., 2003, 2007). The independent allele frequency option was selected, in which allele frequencies in different populations are expected to be somewhat different from one another. A K-value of 3 was chosen because there are only three true species in this study, P. racemosa, P. occidentalis, and P. orientalis. Both P. x acerifolia and putative P. racemosa X P. x acerifolia are hybrids. A burn-in of 10,000 followed by 100,000 dada collection repetitions were used. The admixture ancestry model was chosen, which assumes individuals may have mixed ancestry. Genetic diversity and differentiation statistics, including H’S, H’T, and F’ST were calculated using F-DASH, a program designed to calculate ad hoc statistics in polyploids perfect for higher order polyploids in which allele dosage is virtually impossible to determine (Obbard et al., 2006). These statistics are reported in place of HE and FST typically reported in diploids.

CHAPTER III

RESULTS

The primers generated in this study were functional across the genus. Useful microsatellite data were successfully amplified. Of the 65 total individual samples, only two Platanus orientalis samples (CG2 and CG3) failed to provide microsatellite amplifications. In 11 out of the 13 loci used in this study, over 84% of the remaining 63 individuals amplified successfully (Table 1). However, for loci plms68 and plms109 only

57% and 51%, respectively, of samples amplified. Eight of the 13 loci contained relatively high polymorphisms with greater than ten observed alleles. Only plms136 was monomorphic, suggesting high conservation of sequence, likely contained within an exon.

Eleven of the thirteen loci contained private alleles occurring in P. racemosa (N =

18), P. occidentalis (N = 31), and P. orientalis (N = 13) (Tables 1, and 2). Twenty-two alleles crossed over into P. x acerifolia and putative P. racemosa X P. x acerifolia hybrids. Twelve P. occidentalis and P. orientalis-specific alleles were found in putative hybrids. The only two loci showing little to no polymorphism and no private alleles were plms92 and plms136.

Admixture in Platanus populations sampled was apparent (Figure 1). Platanus racemosa individuals were relatively pure indicating minimal overlap of alleles with P. orientalis and P. occidentalis. The putative hybrid population was most like P. racemosa,

TABLE 1. Characterization of 13 microsatellites in Platanus spp. The repeat motif listed refers to the clone sequenced from P. racemosa. Includes annealing temperature (Ta), observed size range (bp) for entire data set, number of individuals (N) out of 65 attempted, number of revealed alleles (A), and number of private alleles (PA).

Locus Primer sequence 5'-3' Repeat motif Ta (˚C) Size range (bp) N A PA plms17 F: GGAGAAAGAGAAGAAGGAGAAAAA (CA)8 61 219 - 239 62 15 1 R: AGGGTCTTGGTCGTGATTTG plms29 F: GCCCATTAGATGGGTTGAAA (TC)9 61 198 - 233 61 21 12 R: AGCGAATCCATGTGCCTAAT plms53 F: GCAACTTGGTCTTGGTTGGT (CTT)4 61 324 - 329 61 5 2 R: CAGCCGATTGGGTATATGGT plms68 F: TGAATCCCAAAAGGCAAAAA (GT)8(AT)2(GT)5 61 176 - 206 36 15 7 R: AAACACCCAATCCGGTCTAC plms71 F: ACGGGTGAGCTCCCTACTTT (TG)10 61 126 - 137 63 5 2 R: GACATCCTCCACCAAACACC plms92 F: TCCTTACATCTTTGCCCACA (GA)4(GT)5 61 315 - 317 58 2 0 R: CCCATGAACCTCTCTGATCC plms109 F: TGATGACAAATACTCAGGGAAA (CA)18 61 121 - 153 32 14 12 R: CGATAGCCAAAAGCGAAAGA plms113 F: GGCAAGCCAGGATTTAGTTG (CT)11(CA)16 61 189 - 231 63 24 7 R: CGGGATAAGAGTTTGTTGAGTTG plms122 F: CTTCTGTGCTTGTGCCTCAC (AC)6 61 223 - 225 53 3 1 R: CTTTGCACCAATGTGCCTTA plms130 F: TACCACACCAACGTCCTTCC (CA)7 61 201 - 218 60 10 2 R: ACCCTCTCAAATATGCCAATTA plms136 F: GGCACCCTAATTACCCACCT (GT)9 61 216 63 1 0 R: TCTGATCCCGACAAAACCAT plms147 F: AAAGCTAACATCCCCTCATTG (GT)8 61 266 - 315 59 20 9 R: GCGGTCCTGTCCTTAGTATGT plms176 F: AACAGCAAAACAGCCCACTC (CA)9 61 259 - 279 60 13 7 R: AAACCAGCCAATCCAATTCC 22

TABLE 2. Private alleles discovered in Platanus racemosa, P. occidentalis, and P. x acerifolia. Alleles are named by size (bp). Alleles that also show up in putative P. racemosa X P. x acerifolia hybrids (Hyb) and P. x acerifolia (PLAC) are indicated in the two right-hand columns with a ‘yes.’

Found in Locus Private Allele Hyb PLAC plms17 P. occidentalis 237 yes yes plms29 P. racemosa 199 yes no P. occidentalis 205 no yes 212 no yes 217 yes yes 219 yes yes 221 yes yes 223 yes yes 225 no yes 227 no no P. orientalis 203 no no 207 yes yes 216 no no plms53 P. racemosa 324 yes no 326 yes no plms68 P. racemosa 178 no yes 184 no yes 186 yes yes P. occidentalis 189 no no 191 no no P. orientalis 180 no no 183 no no plms71 P. orientalis 137 yes no 139 no no plms109 P. racemosa 121 yes no 123 yes no 130 no no 145 no no 147 no no 149 no no 153 no no P. occidentalis 134 no no 138 yes yes

Table 2 (Continued)

Found in Locus Private Allele Hyb PLAC 140 yes yes 142 no yes P. orientalis 124 no no plms113 P. racemosa 206 no no 210 yes no P. occidentalis 219 no no 223 yes yes 227 no yes 229 no no 231 no no plms122 P. orientalis 223 no yes plms130 P. racemosa 201 yes no P. occidentalis 212 no yes plms147 P. racemosa 287 yes no 309 yes no P. occidentalis 285 yes yes 308 no no 315 no no P. orientalis 271 no no 296 no yes 288 no no 273 no no plms176 P. occidentalis 259 no no 261 yes yes 266 no no 272 no no 274 no no 276 no no 278 no no

with evidence of gene flow from P. x acerifolia, P. orientalis, and P. occidentalis.

Platanus x acerifolia indicated equal contributions from the parental species, P.

Fig. 1. Bar plot of estimates of Q (estimated membership coefficient for each individual) indicating admixture in Platanus populations. The x-axis is divided by population sampled, P. x acerifolia, putative P. racemosa X P. x acerifolia hybrids, P. racemosa, P. orientalis, and P. occidentalis. Each individual is represented by a single vertical line partitioned into colors associated with inferred genetic clusters. Blue is associated with P. racemosa, red with P. orientalis, and green with P. occidentalis.

orientalis and P. occidentalis. Two P. orientalis individuals showed similarity to P. racemosa and P. occidentalis.

All loci but one (plms136) were polymorphic, with an average number of alleles per sample ranging from 1 to 11.175, and an average number of phenotypes per sample ranging from 1 to 11.079 (Table 3). On average individuals within a species differed by

1.733 alleles, and differed by an average of 2.176 alleles across all species. The average

F’ST (a population differentiation measure for allopolyploids analogous to FST) across all loci was 0.203. One locus stood out (plms71) with the greatest population differentiation with an F’ST of 0.549.

TABLE 3. Genetic diversity estimates: average number of alleles per sample (A), average number of phenotypes per sample (P), average number of unshared alleles between pairs of individuals within a species (H’S), average number of unshared alleles between pairs of individuals across all species (H’T), the proportion of total diversity found between species (F’ST), and a yes/no record of locus polymorphism (PM 1/0). All calculations were completed using the computer program F-DASH (Obbard et al., 2006).

Locus A P H’S H’T F'st PM (1/0) plms17 10.726 10.548 3.503 4.803 0.271 1 plms29 7.475 7.115 2.39 2.979 0.198 1 plms53 2.77 2.934 1.14 1.605 0.29 1 plms68 6.167 4.278 2.551 3.043 0.162 1 plms71 1.73 2.143 0.486 1.077 0.549 1 plms92 2 2 0.863 0.92 0.062 1 plms109 4.562 3.844 1.569 2.002 0.216 1 plms113 11.175 11.079 3.509 3.683 0.047 1 plms122 1.811 1.811 0.7 0.906 0.227 1 plms130 3.65 3.833 1.308 1.649 0.207 1 plms136 1 1 0 0 0 0 plms147 9.966 9.797 3.428 4.157 0.175 1 plms176 4.557 4.295 1.222 1.577 0.225 1 Ave. - loci 5.234 5.085 1.733 2.176 0.203 0.914

CHAPTER IV

DISCUSSION

Microsatellite data—Most individuals amplified for all primer sets; however 13.5% of individuals (total number of successful amplifications over total attempts) did not. It is possible, given amplification was good for most samples, that primer sites were not equally conserved across all species or for all loci. A relatively high annealing temperature (61°F) was used for all microsatellite primers, which lends confidence in binding accuracy, but if reduced may allow for amplification in a greater number of individuals.

Despite small sample sizes, polymorphisms were relatively high over the thirteen loci with an average of 11.4 alleles per locus. Although promising, in order to have confidence in the primers, a subset of amplified samples should be sequenced. This would establish differences in fragment lengths are truly due to additions and reductions in repeat number of microsatellites, as opposed to other sequence variation. Genotyping while more efficient, lacks the resolution of sequencing.

Private alleles for the three respective parental taxa (P. racemosa, P. occidentalis, P. orientalis) were found in the putative P. racemosa X P. x acerifolia hybrids, as expected.

Specifically, alleles otherwise found only in P. occidentalis and P. orientalis also occurred in the putative hybrids. Pure P. racemosa individuals showed virtually no evidence of such genetic admixture. As expected, P. x acerifolia contained

27 28 many P. occidentalis and P. orientalis-specific alleles, due to its hybrid origin. In only one locus (plms68) did proposed P. racemosa-specific alleles occur in P. x acerifolia

(four individuals, three of which had two P. racemosa-specific alleles and one with three). This was not expected, and the simplest explanation for this is these are not true private alleles and more sampling is necessary to gain a more accurate genotypic sampling. The high number of private alleles is encouraging, but to gain confidence larger sample sizes are necessary.

Admixture analysis—Admixture was apparent upon analysis with STRUCTURE.

Putative P. racemosa X P. x acerifolia hybrids clustered primarily with P. racemosa, but also showed commonality with P. occidentalis and P. orientalis. If the putative hybrids had been pure native P. racemosa they should have been distinct from both P. occidentalis and P. orientalis. This implicates gene flow through hybridization with P. x acerifolia. Due to its hybrid origin, P. x acerifolia is capable of contributing alleles from both its parental taxa (P. occidentalis and P. orientalis) in hybridization events with P. racemosa. As one would expect, the hybrid nature of P. x acerifolia was evidenced upon analysis with STRUCTURE, displaying an even grouping with parental taxa, P. occidentalis and P. orientalis. The STRUCTURE analysis indicated sampling of P. racemosa and P. occidentalis populations was primarily pure, but some hybridization was indicated in P. orientalis individuals sampled. Genetic clustering of P. orientalis with P. racemosa could be explained by apparent genetic similarity of the species as indicated by Feng et al. (2005), while allelic similarity with P. occidentalis would more likely be attributable to genetic contamination via P. x acerifolia. Platanus. x acerifolia is widely planted throughout Europe, including regions from which the samples used here

29 were collected. It is possible and even likely that some contamination of the gene pool has occurred.

Population genetic work in polyploid species can be very challenging, particularly in higher order polyploids involved in hybridization events. It is difficult to know where these species fall along the spectrum between disomic and polysomic inheritance, or whether or not chromosomes have unique partners at meiosis. This makes calculating heterozygosity levels and FST impossible. Instead, H’ and F’ST were calculated. The average number of alleles per sample varied greatly among loci, with a high of 11.175.

This indicates a high ploidy level in Platanus or an otherwise high copy number of the flanking sequences. In three loci average number of phenotypes per sample was higher than average number of alleles per sample (plms53, plms71, and plms130), indicating meaningful allele combinations do exist. While genetic diversity estimates (H’S and H’T) were relatively high, the small sample sizes do not allow for meaningful interpretation.

Likewise for genetic differentiation of species (F’ST), values (ave. 0.203) were high, not surprising for such an ancient genus with historically great geographic separation.

Although again, small sample sizes do not allow for any reliable interpretation.

Conservation implications—This study has clearly demonstrated introgression of genes from introduced P. x acerifolia into the genome of P. racemosa in northern

California. Platanus racemosa is an integral part of riparian ecosystems and is a representative of phylogenetic heritage of Platanus lineage… This form of genetic pollution poses addition to beyond loss of habitat, introduction of diseases and other forces which affect populations of this species. With ever-increasing development and human encroachment into natural areas, including natural Platanus ranges, hybridization

30 among anemophilous Platanus species is virtually unavoidable. In all likelihood P. x acerifolia will remain a popular ornamental choice and the outcome for our native P. racemosa looks bleak.

Here we propose a series of concrete steps to minimize further propagation of genetic pollution. 1) Whatever can be done to educate city arborists on the potential genetic implications of P. x acerifolia plantings would be beneficial in the hopes of limiting introductions to current native Platanus stands. There are many alternative ornamental tree species to choose from. Although we cannot prevent private citizens from planting P. x acerifolia we can encourage cities not to. 2) An attempt to educate nurseries and ornamental tree farms should be made. Ultimately it is up to them whether or not they continue to produce P. x acerifolia for sale, and likely most growers will not change their ways, but perhaps a few will. 3) If the sale of invasive plant species to the public is going to remain legal, information on the implications of planting such species should be made visible at retailer locations. Perhaps a sentence in bold on the plant care tag could be included, in which states “problematic in California and potentially harmful to native species.” 4) Another avenue to consider is better control of stock used to replant particularly P. racemosa in Californian riparian restoration projects. Upon casual personal inspection of local Northern Californian supposed P. racemosa seedlings intended for planting along the Sacramento River, it was immediately apparent that the leaf morphology of said seedlings was suspiciously hybrid in nature. Special care should be given to determine genetic heritage of such seedlings. The last thing we want to do is unintentionally plant P. racemosa X P. x acerifolia hybrids in restoration areas when the whole goal of these projects is to restore natural and vibrant native communities. 5)

Native populations of P. racemosa should be restored. The previous abovementioned suggestions have dealt with limiting or eliminating the exotic species. Increasing native populations should be combined with this strategy (Rieseberg 1991) to maximize protection of the genetic integrity of P. racemosa. If we do nothing to limit or prevent further genetic admixture, we stand to lose the genetic integrity of all native Platanus species.

Potential future directions for Platanus hybridization studies—Further investigation into Platanus hybridization is necessary. Pending funding, we will undertake a large- scale gene flow study. This will involve extensive sampling of all Platanus species of the

Northern Hemisphere. More sources of variation will be included (LEAFY, cpDNA sequences, and perhaps additional SSRs). The goal of the project will be to characterize the genetic composition of native populations as well as the introduced P. x acerifolia, in order to examine the directionality and magnitude of genetic contamination. Finally, these data will be used to predict the consequences of genetic pollution via hybridization with P. x acerifolia.

LITERATURE CITED

ABBOTT, R. J. 1992. Plant invasions, interspecific hybridization and the evolution of new plant taxa. Trends in Ecology and Evolution 7: 401-405.

ANSELMI, N., L. CARDIN, AND G. NICOLOTTI. 1994. Plane decline in European and Mediterranean countries: associated pests and their interactions. Bulletin OEPP/EPPO 24: 159-171.

ANTTILA, C. K., C. C. DAEHLER, N. E. RANK, AND D. R. STRONG. 1998. Greater male fitness of a rare invader (Spartina alterniflora, Poaceae) threatens a common native (Spartina foliosa) with hybridization. American Journal of Botany 85: 1597-1601.

BALDWIN, B. G., C. S. CAMPBELL, J. M. PORTER, M. J. SANDERSON, M. F. WJCIECHOWSKI, AND M. J. DONOGHUE. 1993. Utility of nuclear ribosomal DNA ITS sequences in phylogenetic analyses of angiosperms. American Journal of Botany 80: 119.

BESNARD, G., A. TAGMOUNT, P. BARADAT, A. VIGOUROUX, AND A. BERVILLE. 2002. Molecular approach of genetic affinities between wild and ornamental Platanus. Euphytica 126: 401-412.

BOCK, J. H., AND C. E. BOCK. 1989. Factors limiting sexual reproduction in Platanus Wrightii in southeastern Arizona. Aliso 12: 295-301.

BOOTHROYD, L. E. 1930. The morphology and anatomy of the inflorescence and flower of the Platanaceae. American Journal of Botany 17: 678-693.

BRUSH, W. D. 1917. Distinguishing characters of North American sycamore woods. Botanical Gazette 64: 480-496.

BURGESS, K. S., M. MORGAN, L. DEVERNO, AND B. C. HUSBAND. 2005. Asymmetrical introgression between two Morus species (M. alba, M. rubra) that differ in abundance. Molecular Ecology 14: 3471-3483.

BURGESS, K. S., AND B. C. HUSBAND. 2006. Habitat differentiation and the ecological costs of hybridization: The effects of introduced mulberry (Morus alba) on a native congener (M. rubra). Journal of Ecology 94: 1061-1069.

CRANE, P. R., K. R. PEDERSEN, E. M. FRIIS, AND A. N. DRINNAN. 1993. Early Cretaceous (early to middle albian) Platanoid inflorescences associated with Sapindopsis leaves from the Potomac group of eastern North America. Systematic Botany 18: 328-344.

33 34

CRONQUIST, A. 1981. An integrated system of classification of flowering plants. Columbia University Press, New York, New York, USA.

CRONQUIST, A. 1988. The evolution and classification of flowering plants. The New York Botanical Garden, Bronx, New York, USA.

DIERINGER, D., AND C. SCHLÖTTERER. 2003. MICROSATELLITE ANALYSER (MSA): A platform independent analysis tool for large microsatellite data sets. Molecular Ecology Notes 3: 167-169.

DOWLING, T. E., AND M. R. CHILDS. 1992. Impact of hybridization on a threatened trout of the southwestern United States. Conservation Biology 6: 355-364.

EDWARDS, R. J. 1979. A report of Guadaloupe bass Micropterus treculi x smallmouth bass Micropterus dolomieui hybrids from two localities in the Guadaloupe River, Texas, U.S.A. Texas Journal of Science 31: 231-238.

ELLSTRAND, N. C., AND D. R. ELAM. 1993. Population genetic consequences of small population size: Implications for plant conservation. Annual Review of Ecology and Systematics 24: 217-242.

ERNST, W. R. 1963. The genera of Hamamelidaceae and Platanaceae in the southeastern United States. Journal of the Arnold Arboretum 44: 193-210.

FALUSH, D., M. STEPHENS, AND J. K. PRITCHARD. 2003. Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164: 1567-1587.

FALUSH, D., M. STEPHENS, AND J. K. PRITCHARD. 2007. Inference of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes 7(4): 574-578.

FENG, Y., S. OH, AND P. MANOS. 2005. Phylogeny and historical biogeography of the genus Platanus as inferred from nuclear and chloroplast DNA. Systematic Botany 30(4): 786-799.

GLINSKI, R. L. 1977. Regeneration and distribution of sycamore and cottonwood trees along Sonoita Creek, Santa Cruz County, Arizona. In R. R. Johnson and D. A. Jones [tech. coord.], Importance, preservation and management of riparian habitats: A symposium, 9 July 1977, USDA Forest Service GTR-RM-43, 116-123. Rocky Mountain Forest and Range Experiment Station, Fort Collins, Colorado, USA.

GRANT, V. 1981. Plant speciation, second edition. Columbia University Press, New York,, New York, USA.

GRIMM, GUIDO W., AND T. DENK. 2008. ITS evolution in Platanus (Platanaceae): homoelogues, pseudogenes and ancient hybridization. Annals of Botany 101: 403- 419.

HENRY, A., AND M. G. FLOOD. 1919. The history of the London plane, (Platanus acerifolia). Notes on the genus Platanus. Proceedings of the Royal Irish Academy Section B 35: 9-28.

HICKEY, L. J., AND J. A. DOYLE. 1977. Early Cretaceous fossil evidence for angiosperm evolution. Botanical Review 43: 3-104.

HICKMAN, J. C. 1993. The Jepson manual: Higher plants of California. University of California Press, Berkeley, California, USA.

HSIAO, J. 1973. A numerical taxonomic study of the genus Platanus based on morphological and phenolic characters. American Journal of Botany 60: 678-684.

INGRAM, A. L., AND J. J. DOYLE. 2003. The origin and evolution of Eragrostis tef (Poaceae) and related polyploids: Evidence from nuclear waxy and plastid rps16. American Journal of Botany 90: 116-122.

JUDD, W. S., C. S. CAMPBELL, E. A. KELLOGG, P. F. STEVENS, AND M. J. DONOGHUE. 2008. Plant systematics, a Phylogenetic approach, third edition. Sinauer Associates Inc., Sunderland, Massachusetts, USA.

KEATOR, G. 2002. Introduction to trees of the San Francisco bay region. University of California Press, Berkeley, CA.

LI, Y., A. B. KOROL, T. FAHIMA, A. BEILES, AND E. NEVO. 2002. Microsatellites: Genomic distribution, putative functions and mutational mechanisms: a review. Molecular Ecology 11: 2453-2465.

MUHLFELD, C. C., S.T. KALINOWSKI, T. E. MCMAHON, M. L. TAPER, S. PAINTER, R. F. LEARY, AND F.W. ALLENDORF. 2009. Hybridization rapidly reduces fitness of a native trout in the wild. Biology Letters 5: 328-331.

NATHAN, R., G. G. KATUL, H. S. HORN, S. M. THOMAS, R. OREN, R. AVISSAR, S. W. PACALA, AND S. A. LEVIN. 2002. Mechanisms of long-distance dispersal of seeds by wind. Nature 418: 409-413.

NAIDENOVA, T., AND D. GARELKOV. 1986. On the growth and productivity of the European Plane Platanus orientalis and possibilities for its utilization when establishing intensive forest plantations. Gorskostopanska 23(1): 29-36.

NIXON, K. C., AND J. M. POOLE. 2003. Revision of the Mexican and Guatemalan species of Platanus (Platanaceae). Lundellia 6: 103-137.

OBBARD, D. J., S. A. HARRIS, AND J. R. PANNELL. 2006. Simple allelic-phenotype diversity and differentiation statistics for allopolyploids. Heredity 97: 296-303.

OSWALD, V. H. 2002. Selected plants of Northern California and adjacent Nevada. California State University, Chico, California, USA.

QUI, Y., M. W. CHASE, S. B. HOOT, E. CONTI, P. R. CRANE, K. J. SYTSMA, AND C. R. PARKS. 1998. Phylogenetics of the Hamamelidae and their allies: Parsimony analyses of nucleotide sequences of the plastid gene rbcL. International Journal of Plant Sciences 159: 891-905.

PRITCHARD, J. K., M. STEPHENS, AND P. DONNELLY. 2000. Inference of population structure using multilocus genotype data. Genetics 155: 945-959.

RAYMOND, M., AND F. ROUSSET. 1995. GENEPOP (version-1.2)-population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248-249.

RIESEBERG, L. H. 1991. Hybridization in rare plants: insights from case studies in Cercocarpus and Helianthus. In D.A. Falk and K.E. Holsinger [eds.], Genetics and conservation of rare plants, 171-181. Oxford University Press, New York, New York, USA.

RIESEBERG, L. H., S. J. E. BAIRD, AND K. A. GARDNER. 2000. Hybridization, introgression, and linkage evolution. Plant Molecular Biology 42(1): 205-224.

RIESEBERG, L. H., T. E. WOOD, AND A. BAACK. 2006. The nature of plant species. Nature 440: 524-527.

RHYMER, J. M., AND D. SIMBERLOFF. 1996. Extinction by hybridization and introgression. Annual Review of Ecology and Systematics 27: 83-109.

SANTAMOUR, F. S., JR. 1969. New chromosome counts in Ulmus and Platanus. Rhodora 71: 544-547.

SANTAMOUR, F. S. JR. 1972. Interspecific hybridization in Platanus. Forrest Science 18: 236-239.

SANTAMOUR, F. S., AND A. J. MCARDLE. 1986. Checklist of cultivated Platanus (Plane tree). Journal of Arboriculture 12: 78-83.

SCHWARZWALDER, R. N. JR., AND D. L. DILCHER. 1991. Systematic placement of the Platanaceae in the Hamamelidae. Annals of the Missouri Botanical Garden 78: 962- 969.

SELKOE, K. A., AND R. J. TOONEN. 2006. Microsatellites for ecologists: a practical guide to using and evaluating Microsatellite markers. Ecology Letters 9: 615-629.

SIDDIQUI, A. Q. 1979. Changes in fish species composition in Lake Naivasha Kenya. Hydrobiologia 64: 131-138.

SMALL, R. L., J. A. RYBURN, R. C. CRONN, R. SEELANAN, AND J. F. WENDEL. 1998. The tortoise and the hare: Choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plant group. American Journal of Botany 85: 1301-1315.

SMITH, A. M., AND K. DENYER. 1992. Starch synthesis in developing pea embryos. New Phytologist 122: 21-33.

SOLTIS, D. E., P. S. SOLTIS, M. W. CHASE, M. E MORT, D. C. ALBACH, M. ZANIS, V. SAVOLAINEN, W. H. HAHN, S. B. HOOP, M.F. FAY, M. AXTELL, M. AXTELL, L. M. PRINCE, W. J. KRESS, K. C. NISON, J. S. FARRIS. 2000. Angiosperm phylogeny inferred from 18S rDNA, vbcL, and atpB sequences. Botanical Journal of the Linnean Society 133: 381–461.

STUART, J. D., AND J. O. SAWYER. 2001. Trees and shrubs of California. University of California Press, Berkeley, California, USA.

SUDWORTH, G. B. 1967. Forest trees of the pacific slope. Dover Publications Inc., New York, New York, USA.

SULLIVAN, J. 1994. Platanus occidentalis. In W. C. Fischer [compiler], The fire effects information system (database). USDA, Forest Service, Intermountain Research Station, Intermountain Fire Sciences Laboratory, Missoula, MT. website http://www.fs.fed.us/database/feis/.

TAKHTAJAN, A. 1980. Outline of the classification of flowering plants (Magnoliophyta). The Botanical Review 46: 225-359.

TIDWELL, W. D. 1998. Common fossil plants of western North America, second edition. Smithsonian Institution Press, Washington, DC, USA

THORNE, R. F. 1973. The “Amentiferae” or Hamamelidae as an artificial group: A summary statement. Brittonia 25: 395-405.

TIPPO, O. 1938. Comparative anatomy of the Moraceae and their presumed allies. Botanical Gazette 100: 1-99.

USDA, NRCS. 2008. The PLANTS database. website http://plants.usda.gov.

VAN OOSTERHOUT, C., W. F. HUTCHINSON, D. P. M. WILLS, AND P. SHIPLEY. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535-538.

VILÀ, M., E. WEBER, AND C. M. D. ANTONIO. 2000. Conservation implications of invasion by plant hybridization. Biological Invasions 2: 207-217.

WHITLOCK, D. L. 2003. The hybridization of California sycamore (Platanus racemosa) and the London plane tree (Platanus x acerifolia) in California’s Riparian Woodland. B. S. thesis, California State University, Chico, Chico, California, USA.

ZANE, L., L. BARGELLONI, T. PATARNELLO. 2002. Strategies for microsatellite isolation: A review. Molecular Ecology 11: 1-16.

ZAVADA, M. S., AND D. L. DILCHER. 1986. Comparative pollen morphology and its relationship to phylogeny of pollen in the Hamamelidae. Annals of the Missouri Botanical Garden 73: 348-381.

APPENDIX A

Sample names and collection information, including: sample name given, putative species assignment based on leaf morphology, diameter breast height (Dbh), global positioning coordinates if available or general location, collector and availability of voucher specimens.

Sample Species Dbh (cm) GPS coordinates Collected Location Name (as available) By Plac1 Platanus x 96.50 N 39º 43.940’ K. Lang Chico, CA, USA acerifolia W 121º 50.702’ Plac2 P. x acerifolia 162.30 N 39º 43.768’ K. Lang Chico, CA, USA W 121º 50.674’ Plac3 P. x acerifolia 99.80 N 39º 43.989’ K. Lang Chico, CA, USA W 121º 50.534’ Plac4 P. x acerifolia 97.50 N 39º 43.632’ K. Lang Chico, CA, USA W 121º 50.569’ Plac5 P. x acerifolia 104.90 N 39º 43.760’ K. Lang Chico, CA, USA W 121º 50.193’ Plac6 P. x acerifolia 103.40 N 39º 43.870’ K. Lang Chico, CA, USA W 121º 50.452’ Plac7 P. x acerifolia 100.00 N 39º 44.024’ K. Lang Chico, CA, USA W 121º 50.578’ Plac8 P. x acerifolia 99.85 N 39º 44.116’ K. Lang Chico, CA, USA W 121º 50.952’ Plac9 P. x acerifolia 98.60 N 39º 44.247’ K. Lang Chico, CA, USA W 121º 50.639’ Plac10 P. x acerifolia N 39º 44’ 5”W K. Lang Chico, CA, USA 121º 50’ 38” Hyb11 P. x acerifolia 99.65 N 39º 43.732’ K. Lang Chico, CA, USA X P. racemosa W 121º 50.915’ Hyb12 P. x acerifolia 108.65 N 39º 43.834’ K. Lang Chico, CA, USA X P. racemosa W 121º 50.660’ Hyb13 P. x acerifolia 99.50 N 39º 43.800’ K. Lang Chico, CA, USA X P. racemosa W 121º 50.796’ Hyb14 P. x acerifolia 128.50 N 39º 44.202’ K. Lang Chico, CA, USA X P. racemosa W 121º 49.681’ Hyb15 P. x acerifolia 153.70 N 39º 44.217’ K. Lang Chico, CA, USA X P. racemosa W 121º 49.707’

40 41

Sample Species Dbh (cm) GPS coordinates Collected Location Name (as available) By MV2 P. x acerifolia N 39º 07’ 42.22” D. Whitlock Marysville, CA, USA X P. racemosa W 121º 35’ 52.19” MV3 P. x acerifolia N 39º 07’ 42.22” D. Whitlock Marysville, CA, USA X P. racemosa W 121º 35’ 52.19” MC6 P. x acerifolia N 40º 02’ 33.70” D. Whitlock Mill Creek, Los X P. racemosa W 122º 06’ Molinos, CA, USA 00.56” MC13 P. x acerifolia N 40º 02’ 33.70” D. Whitlock Mill Creek, Los X P. racemosa W 122º 06’ Molinos, CA, USA 00.56” MC19 P. x acerifolia N 40º 02’ 33.70” D. Whitlock Mill Creek, Los X P. racemosa W 122º 06’ Molinos, CA, USA 00.56” Plra21 P. racemosa 105.30 N 39º 44.000’ K. Lang Chico, CA, USA W 121º 50.212’ Plra22 P. racemosa 105.00 N 39º 44.154’ K. Lang Chico, CA, USA W 121º 49.763’ MV8 P. racemosa N 39º 07’ 42.22” D. Whitlock Marysville, CA, USA W 121º 35’ 52.19” MV11 P. racemosa N 39º 07’ 42.22” D. Whitlock Marysville, CA, USA W 121º 35’ 52.19” GH18 P. racemosa N 38° 41’ 07.16” D. Whitlock Garden Hwy at W 121° 37’ Elkhorn off 54.32” Sacramento River, CA, USA RC15 P. racemosa N 39° 45’ 46.75” D. Whitlock Rock Creek, Butte W 121° 58’ Co, CA, USA 19.48” RC16 P. racemosa N 39° 45’ 46.75” D. Whitlock Rock Creek, Butte W 121° 58’ Co, CA, USA 19.48” RC17 P. racemosa N 39° 45’ 46.75” D. Whitlock Rock Creek, Butte W 121° 58’ Co, CA, USA 19.48” PorETSU P. orientalis C. R. Parks Izmer, Turkey PorG3 P. orientalis P. S. Manos Prokopif, Island of Evia, Greece

Sample Species Dbh GPS coordinates Collected By Location Name (cm) (as available) PorK1334 P. orientalis D. Kurbarov Ahal, Turkmenistan 24583 P. orientalis N 51° 28’ 58.12” KEW Gardens Richmond, Surrey, W 0° 17’ 12.30” England 24584 P. orientalis N 51° 28’ 58.12” KEW Gardens Richmond, Surrey, W 0° 17’ 12.30” England 24585 P. orientalis N 51° 28’ 58.12” KEW Gardens Richmond, Surrey, W 0° 17’ 12.30” England AG1 P. orientalis P. Manos In the Agora of Athens, Greece AG2 P. orientalis P. Manos In the Agora of Athens, Greece CG1 P. orientalis P. Manos Chios, Greece CG2 P. orientalis P. Manos Chios, Greece CG3 P. orientalis P. Manos Chios, Greece ET1 P. orientalis P. Manos Ephesus, Turkey ET2 P. orientalis P. Manos Ephesus, Turkey ET3 P. orientalis P. Manos Ephesus, Turkey OC1 P. orientalis P. Manos Orkontas, Cyprus OC2 P. orientalis P. Manos Orkontas, Cyprus OC3 P. orientalis P. Manos Orkontas, Cyprus Kos1 P. orientalis P. Manos Kos, Greece PwND1 P. wrightii N. A. Douglas Oak Creek Canyon, Coconino Co, AZ, USA PwMW994 P. wrightii M. F. Sycamore Creek, Wojciechowski Maricopa Co, AZ, USA PwND2130 P. wrightii N. A. Douglas Ramsey Canyon, Cochise Co, AZ, USA PoENO1 P. occidentalis P. S. Manos Durham, Durham Co, NC, USA PoDUR1 P. occidentalis P. S. Manos Durham, Durham Co, NC, USA PoIL62 P. occidentalis J. S. McLachlan Carlinville, IL, USA A1 P. occidentalis R. Dyer Alleghany Co, Virginia, USA

Sample Species Dbh GPS coordinates Collected By Location Name (cm) (as available) A2 P. occidentalis R. Dyer Alleghany Co, Virginia, USA A3 P. occidentalis R. Dyer Alleghany Co, Virginia, USA A4 P. occidentalis R. Dyer Alleghany Co, Virginia, USA B1 P. occidentalis R. Dyer Bath Co, Virginia, USA B2 P. occidentalis R. Dyer Bath Co, Virginia, USA B3 P. occidentalis R. Dyer Bath Co, Virginia, USA B4 P. occidentalis R. Dyer Bath Co, Virginia, USA G1 P. occidentalis R. Dyer Greenbriar Co, West Virginia, USA G2 P. occidentalis R. Dyer Greenbriar Co, West Virginia, USA G3 P. occidentalis R. Dyer Greenbriar Co, West Virginia, USA G4 P. occidentalis R. Dyer Greenbriar Co, West Virginia, USA G5 P. occidentalis R. Dyer Greenbriar Co, West Virginia, USA