Phd Thesis Final

THE ROLES OF OXYGEN AND DISULFIDE REDUCTASES IN THE PHYSIOLOGY OF CAMPYLOBACTERALES

Nadeem O Kaakoush

A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy

School of Medical Sciences Faculty of Medicine The University of New South Wales Sydney, Australia

2008

“Science is a wonderful thing if one does not have to earn one's living at it.”

- Albert Einstein

ACKNOWLEDGEMENTS

This thesis would not have been possible without the contributions of many people who have helped and supported me throughout the various stages of this candidature.

I must thank my supervisor, Prof. George L Mendz, for giving me the opportunity to carry out my PhD degree in his laboratory at UNSW, and for his support throughout the years. I hope this quest was as rewarding for you as it was for me. You have taught me many valuable “tricks of the trade”; I hope we can continue to pursue not only a scientific collaboration together but also a good friendship.

I’d like to thank Prof. Hazel Mitchell for providing support, especially the necessary lab space, during the final stages of my candidature. To Edward, Megan, Arinze, Phil, Justin, Bernice, Zsuzsanna, Johnny, Alfred and Sophie fellow warriors of science, thank you for your friendship and support throughout the years, and best of luck in the future.

To A/Prof. Hilde De Reuse at the Institut Pasteur, thank you for allowing me to join your team and work in your lab for four months during my candidacy. To Damien Leduc, for your help and support in the lab and your countless translations of French to English; and to the rest of the group, especially Kristine and Marie for making me feel like I was part of the team.

On a more personal note, thank you to Ali in Orlando, Adeline in Sydney, Amer and Ziad in Beirut, and Hussein and Jana in Dubai for staying in touch all this time and for their concern about my well-being.

Finally, a special thank you to my sisters Nina and Nada, my Mum and Dad– you know how much you mean to me.

ABSTRACT

This work has studied several aspects of the physiology of the animal-colonizing species Campylobacter jejuni, Helicobacter pylori, Wolinella succinogenes and Arcobacter butzleri. C. jejuni and H. pylori were found to be obligate microaerophiles and W. succinogenes an anaerobe. A. butzleri was found to be an aerobe able to grow anaerobically. Comparative analyses of the responses of C. jejuni, H. pylori and W. succinogenes to various oxygen concentrations were investigated using transcriptomics and genes differentially expressed at higher oxygen concentrations were identified. At the time of this study no microarrays were available for A. butzleri. These comparative studies provided a better understanding of bacterial adaptation to and interaction with their environment. Several enzymes involved in oxireduction processes, including disulfide reductases, were upregulated under oxidative stress.

Disulfide reductases of host-colonizing bacteria are involved in the expression of virulence factors, resistance to drugs, and elimination of toxic compounds. CXXC and CXXC-derived motifs are present in the active sites of disulfide reductases and are essential for the catalysis of these redox reactions. Large-scale genome analyses of 281 prokaryotes identified CXXC and CXXC-derived motifs in each microorganism. The total number of these motifs showed correlations with genome size and oxygen tolerance of the prokaryotes. Specific bioinformatic analyses served to identify putative disulfide reductases in the four Campylobacterales species.

The project investigated the involvement of these enzymes in resistance to the antibiotic metronidazole, cadmium detoxication and pathogenesis. The activities of disulfide reductases were modulated by the presence of metronidazole, and its reduction was inhibited by the presence of disulfide reductase substrates. In addition, proteins involved in oxireduction of the low redox potential ferredoxin were downregulated in metronidazole resistant strains, suggesting that ferredoxin is involved in the resistant phenotype. Cellular processes and pathways regulated under cadmium stress included fatty acid biosynthesis, protein biosynthesis, chemotaxis and mobility, the tricarboxylic

acid cycle, protein modification, redox processes and heat shock response. Notably, the data provided evidence for a role of oxireduction processes in the development of metronidazole resistance and the detoxication of cadmium.

Furthermore, a method was developed to identify thiol disulfide oxidoreductases in the four Campylobacterales. The results suggested that H. pylori contained a novel disulfide bond formation system. Investigation of their potential involvement in virulence or colonization indicated that the putative thiol disulfide oxidoreductases HP0231 and HP0595 are related to the colonization efficiency of H. pylori.

Finally, the only known disulfide reduction system in Campylobacterales, the thioredoxin system, was investigated in more detail. Phylogenetic analyses of the thioredoxin reductases TrxB1 and TrxB2 of the four bacteria were performed. The phylogenetic features of the TrxB2 suggested a special role for this enzyme in the physiology of these bacteria; thus, the enzyme was investigated further in H. pylori. TrxB2 was found to be an NADPH reductase, possibly involved in important oxireduction processes within the cell.

CERTIFICATE OF ORIGINALITY

I hereby declare that this submission is my own work, and to the best of my knowledge materials previously published or written by another person have been properly acknowledged. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis.

I also declare that the intellectual content of this thesis is the product of my own work to the extent that assistance from others in the project’s design and conception or in style, presentation and linguistic expression is acknowledged.

Nadeem O Kaakoush

PUBLICATIONS

JOURNAL ARTICLES

N. O. Kaakoush and G. L. Mendz (2005) Helicobacter pylori Disulphide Reductases: Role in Metronidazole Reduction. FEMS Immunology and Medical Microbiology 44: 137-142.

N. O. Kaakoush and G. L. Mendz (2006) Involvement of disulphide reductases in the response of Campylobacter jejuni to cadmium stress. Metal Ions in Biology and Medicine (Eds. Collery P., Morais P. V., Alpoim M. C.) Vol. 9 John Libbey & Co., Montrouge, France.

S. Bury-Moné, N. O. Kaakoush, C. Asencio, F. Mégraud, A. Labigne, H. De Reuse and G. L. Mendz (2006) Is Helicobacter pylori a true microaerophile? Helicobacter 11: 296- 303.

N. O. Kaakoush, Z. Kovach and G. L. Mendz (2007) Potential Role of Thiol:disulfide Oxidoreductases in the Pathogenesis of Helicobacter pylori. FEMS Immunology and Medical Microbiology 50: 177-183.

N. O. Kaakoush, T. Sterzenbach, W. G. Miller, S. Suerbaum and G. L. Mendz (2007) Identification of Disulphide Reductases in Campylobacterales: a bioinformatics investigation. Antonie van Leeuwenhoek 92: 429-441.

N. O. Kaakoush, W. G. Miller, H. De Reuse, G. L. Mendz (2007) The oxygen requirement and tolerance of Campylobacter jejuni. Research in Microbiology 158: 644- 650.

N. O. Kaakoush and G. L. Mendz (2008) Responses of four Campylobacterales to cadmium stress. Metal Ions in Biology and Medicine (Eds. Collery P., Morais P. V., Alpoim M. C.) Vol. 10 John Libbey & Co., Montrouge, France.

N. O. Kaakoush, M. Raftery and G. L. Mendz (2008) Molecular responses of Campylobacter jejuni to cadmium stress. FEBS Journal. (Accepted).

JOURNAL ARTICLES IN PREPARATION

N. O. Kaakoush, C. Baar, E. M. Fox, J. MacKichan, S. C. Schuster and G. L. Mendz (2008) Comparative analysis of the response of three Campylobacterales species to different oxygen tensions. International Journal of Biochemistry and Cell Biology.

N. O. Kaakoush, C. Asencio, M. Raftery, F. Mégraud and G. L. Mendz (2008) A redox basis for metronidazole resistance in Helicobacter pylori. Antimicrobial Agents and Chemotherapy.

N. O. Kaakoush and G. L. Mendz (2008) Inhibition of disulfide reductases as a therapeutic strategy. Current Enzyme Inhibition.

CONFERENCE PROCEEDINGS

N. O. Kaakoush and G. L. Mendz (2008) Responses of four Campylobacterales to cadmium stress. Metal Ions in Biology and Medicine 10th International Symposium. Corsica, France. Oral Presentation.

N. O. Kaakoush (2007) Molecular responses of Campylobacter jejuni to cadmium stress. UMR INRA/ENV SECALIM, l'Ecole Nationale Veterinaire de NANTES. Nantes, France. Invited talk.

N. O. Kaakoush, C. Asencio, F. Mégraud and G. L. Mendz (2007) A redox basis for metronidazole resistance in Helicobacter pylori. European Helicobacter Study Group XX International Workshop. Istanbul, Turkey. Oral Presentation.

N. O. Kaakoush, M. Raftery and G. L. Mendz (2007) Molecular responses of Campylobacter jejuni to cadmium stress. 14th International Workshop on Campylobacter, Helicobacter and Related Organisms. Rotterdam, The Netherlands. (ESCMID grant winner).

N. O. Kaakoush, E. M. Fox, J. MacKichan and G. L. Mendz (2006) Molecular responses of Helicobacter pylori to changes in oxygen tension. European Helicobacter Study Group XIX International Workshop. Wroclaw, Poland. Oral presentation.

N. O. Kaakoush and G. L. Mendz (2006) Involvement of disulphide reductases in the response of Campylobacter jejuni to cadmium stress. Metal Ions in Biology and Medicine 9th International Symposium. Lisbon, Portugal. Oral presentation.

N. O. Kaakoush and G. L. Mendz (2005) Disulphide reductases of Campylobacterales: Are they involved in drug resistance and response to environmental stresses? European Helicobacter Study Group XVIII International Workshop. Copenhagen, Denmark.

N. O. Kaakoush, M. Raftery and G. L. Mendz (2005) The Response of Campylobacter jejuni to Cadmium Chloride Stress. ASM 2005 Annual Scientific Meeting. Canberra, ACT, Australia.

N. O. Kaakoush and G. L. Mendz (2005) Specific Features of the Disulphide reductases of Campylobacterales. 13th International Workshop on Campylobacter, Helicobacter and Related Organisms. Gold Coast, Queensland, Australia. Oral presentation.

N. O. Kaakoush and G. L. Mendz (2004) Helicobacter pylori Disulphide Reductases: Role in Metronidazole Reduction. 6th International Workshop on Pathogenesis and Host Response in Helicobacter infections. Helsingor, Denmark.

N. O. Kaakoush, C. Asencio, F. Mégraud and G. L. Mendz (2004) Modulation of Helicobacter pylori resistance to metronidazole by oxidoreductases. European Helicobacter Study Group XVII International Workshop. Vienna, Austria. (First Prize Poster).

N. O. Kaakoush and G. L. Mendz (2004) Identification and Characterisation of Disulphide Reductases in – Subdivision Bacteria. ASM 2004 Annual Scientific Meeting. Sydney, NSW, Australia. Oral presentation.

TABLE OF CONTENTS

LIST OF FIGURES vi

LIST OF TABLES viii

LIST OF ABBREVIATIONS x

CHAPTER 1: GENERAL INTRODUCTION 1 1.1 CAMPYLOBACTER 3 1.2 HELICOBACTER 4 1.3 WOLINELLA 5 1.4 ARCOBACTER 6 1.5 HOST REACTIONS TO INFECTIONS: OXIDATIVE AND NITRATIVE BURSTS 7 1.6 HYPOTHESIS AND AIMS OF THE THESIS 8

CHAPTER 2: MATERIALS AND METHODS 9 2.1 GENERAL MICROBIOLOGY 10 2.1.1 Materials 10 2.1.2 Regular bacterial growth conditions 10 2.2 PROTEOMICS 11 2.2.1 Preparation of lysate fractions and cell-free extracts for enzyme assays 11 2.2.2 Preparation of cell-free protein extracts for 2D-gel electrophoresis 11 2.2.3 Protein determination 11 2.2.4 Protein precipitation, SDS-PAGE and Western blotting 11 2.2.5 Nuclear magnetic resonance spectroscopy 12 2.2.6 Two-dimensional PAGE electrophoresis and image analysis 13 2.2.7 Mass spectrometry identification of proteins 14 2.2.8 Bioinformatics 14 2.3 MOLECULAR BIOLOGY 15 2.3.1 Polymerase chain reaction 15 2.3.2 Colony PCR 15 2.3.3 Transformation of Escherichia coli 16 2.3.4 Dye-Terminator sequencing 16

PART 1: EFFECTS OF OXYGEN 17

CHAPTER 3: PART 1INTRODUCTION 18 3.1 BACKGROUND 19 3.2 EFFECTS OF OXYGEN ON MICROORGANISMS AND THEIR RESPONSES 21 3.2.1 Effects of reactive oxygen species on organisms 21

3.2.2 Cellular defenses against oxidative stress 23 3.2.3 Repair of oxidative DNA damage 24 3.2.4 Regulators involved in the response to oxidative stress 24 3.2.5 Oxygen sensing during deprivation 27 3.3 EFFECTS OF OXYGEN ON CAMPYLOBACTERALES AND THEIR RESPONSES 27 3.3.1 Effects of oxygen on Campylobacter jejuni 27 3.3.2 Effects of oxygen on Helicobacter pylori 28 3.3.3 Effects of oxygen on Wolinella succinogenes 31 3.3.4 Effects of oxygen on Arcobacter butzleri 31

CHAPTER 4: OXYGEN REQUIREMENTS AND TOLERANCE OF CAMPYLOBACTERALES 32 4.1 INTRODUCTION 33 4.2 EXPERIMENTAL PROCEDURES 34 4.2.1 Growth conditions of Campylobacter jejuni 34 4.2.2 Growth conditions of Helicobacter pylori 37 4.2.3 Growth conditions of Arcobacter butzleri 37 4.3 RESULTS AND DISCUSSION 38 4.3.1 The oxygen requirement and tolerance of Campylobacter jejuni 38 4.3.2 The oxygen requirement and tolerance of Helicobacter pylori 44 4.3.3 The oxygen requirement and tolerance of Arcobacter butzleri 49 4.4 CONCLUSION 49

CHAPTER 5: MOLECULAR RESPONSES OF CAMPYLOBACTERALES TO OXIDATIVE STRESS 52 5.1 INTRODUCTION 53 5.2 EXPERIMENTAL PROCEDURES 53 5.2.1 Bacterial strains and growth conditions 53 5.2.2 RNA extraction and Microarrays 54 5.2.3 Bioinformatics 54 5.3 RESULTS AND DISCUSSION 56 5.3.1 Degree of significance of the microarray data 56 5.3.2 Transcriptome regulation in Campylobacter jejuni 57 5.3.3 Transcriptome regulation in Helicobacter pylori 62 5.3.4 Transcriptome regulation in Wolinella succinogenes 64 5.3.5 Comparative analyses of responses to higher oxygen conditions 66 5.3.6 Identification of oxygen response signatures 68 5.4 CONCLUSION 69

PART 1SUMMARY 70

PART 2: ROLES OF DISULFIDE REDUCTASES 72

CHAPTER 6: PART 2INTRODUCTION 74 6.1 CHARACTERISTICS OF DISULFIDE OXIDATION AND REDUCTION 75

6.2 DISULFIDE REDUCTASES AND DRUG RESISTANCE 77 6.2.1 Involvement of disulfide reduction in drug resistance 77 6.2.2 Metronidazole activation and resistance in microorganisms 78 6.3 HEAVY METALS AND DISULFIDE REDUCTASES 79 6.3.1 Disulfide reductases in heavy metal detoxication and resistance 79 6.3.2 Cadmium resistance and detoxication 81 6.4 DISULFIDE REDUCTASES AND PATHOGENESIS 83 6.5 DISULFIDE REDUCTASES IN FOUR CAMPYLOBACTERALES 84

CHAPTER 7: IDENTIFICATION OF DISULFIDE REDUCTASES IN CAMPYLOBACTERALES 86 7.1 INTRODUCTION 87 7.2 EXPERIMENTAL PROCEDURES 87 7.2.1 Bacterial cultures and preparation of lysates 87 7.2.2 Nuclear magnetic resonance spectroscopy 88 7.2.3 Bioinformatics 88 7.3 RESULTS AND DISCUSSION 88 7.3.1 Disulfide reduction activities in the four Campylobacterales 88 7.3.2 Identification of CXXC and CXXC-derived motifs 90 7.3.3 Identification of disulfide reductases 96 7.3.4 Redox proteins common to the four Campylobacterales 98 7.4 CONCLUSION 98

CHAPTER 8: DISULFIDE REDUCTASES AND DRUG RESISTANCE IN CAMPYLOBACTERALES 103 8.1 INTRODUCTION 104 8.2 EXPERIMENTAL PROCEDURES 107 8.2.1 Bacterial susceptibility to metronidazole 107 8.2.2 Helicobacter pylori strains 107 8.2.3 Metronidazole ;tests 107 8.2.4 Nuclear magnetic resonance spectroscopy 109 8.2.5 Spectrophotometry 109 8.2.6 Redox assays 110 8.2.7 Calculation of kinetic parameters 110 8.2.8 Statistical analyses of results 111 8.2.9 Effects of metronidazole on enzyme activities 111 8.2.10 Other procedures 111 8.3 RESULTS AND DISCUSSION 111 8.3.1 Campylobacterales susceptibility to metronidazole 111 8.3.2 Helicobacter pylori disulfide reductases and metronidazole 113 8.3.3 Molecular basis of a novel metronidazole resistance mechanism 118 8.3.3.1 Helicobacter pylori matched pairs of susceptible and resistant strains 118 8.3.3.2 Metronidazole reduction in matched pairs of strains 119 8.3.3.3 Redox status of matched pairs of strains 122 8.3.3.4 Metabolic changes in matched pairs of strains 124 8.3.3.5 Proteomic analyses of strains HER 126 V1 and HER 126 V4 126

iii

8.3.3.6 Analyses of the proteome of strain HER 126 V4 grown under Mtr stress 132 8.3.4 Metronidazole resistance of Campylobacter jejuni strains 137 8.4 CONCLUSION 137

CHAPTER 9: DISULFIDE REDUCTASES AND METAL DETOXICATION IN CAMPYLOBACTERALES 140 9.1 INTRODUCTION 141 9.2 EXPERIMENTAL PROCEDURES 143 9.2.1 Bacterial strains and growth conditions 143 9.2.2 Enzyme assays 143 9.2.3 Effects of cadmium ions on enzyme activities 144 9.2.4 Interactions of cadmium ions with glutathione and Gor 144 9.2.5 Other procedures 145 9.3 RESULTS AND DISCUSSION 145 9.3.1 Analyses of the responses of four Campylobacterales to cadmium 145 9.3.2 Molecular responses of C. jejuni to cadmium stress 150 9.3.2.1 Effects of cadmium on the survival of C. jejuni 150 9.3.2.2 Proteomic analyses of C. jejuni under cadmium stress 150 9.3.2.3 Bioinformatics analyses on regulated proteins 153 9.3.2.3.1 Effects on central metabolic pathways 153 9.3.2.3.2 Effects on amino acid biosynthesis 159 9.3.2.3.3 Effects on protein repair and oxireduction systems 159 9.3.2.3.4 Effects on chemotaxis and motility 160 9.3.2.3.5 Effects on metal uptake and storage 161 9.3.2.3.6 Effects on other cellular processes 163 9.3.2.4 Confirmation of changes in the proteome 163 9.3.3 Disulfide reductases in cadmium detoxication 164 9.4 CONCLUSION 170

CHAPTER 10: THIOL DISULFIDE OXIDOREDUCTASES IN CAMPYLOBACTERALES 172 10.1 INTRODUCTION 173 10.2 EXPERIMENTAL PROCEDURES 175 10.3 RESULTS AND DISCUSSION 176 10.3.1 Identification of H. pylori thiol disulfide oxidoreductases 176 10.3.2 Thiol disulfide oxidoreductases in the three other species 180 10.4 CONCLUSION 185

PART 2SUMMARY 186

PART 3: THE THIOREDOXIN SYSTEM 189

CHAPTER 11: PART 3INTRODUCTION 190 11.1 BACKGROUND 191 11.2 THIOREDOXIN SYSTEMS OF MICROORGANISMS 191

11.3 THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES 195

CHAPTER 12: THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES 196 12.1 INTRODUCTION 197 12.2 EXPERIMENTAL PROCEDURES 197 12.2.1 Bioinformatics 197 12.2.2 Generation of linear expression templates 198 12.2.3 Small-scale protein expression 201 12.2.4 Large-scale protein expression 202 12.2.5 Ni-NTA purification 202 12.2.6 Assays of recombinant enzyme 202 12.2.7 Protein modeling 203 12.2.8 Tandem affinity purification 203 12.2.9 Other procedures 205 12.3 RESULTS AND DISCUSSION 207 12.3.1 Phylogenetic analyses 207 12.3.2 Expression, purification and recombinant enzyme activity assays 209 12.3.3 Bioinformatic analyses and protein modeling 216 12.3.4 Tandem affinity purification 220 12.4 CONCLUSION 220

PART 3SUMMARY 222

GENERAL SUMMARY 224

REFERENCES 229

APPENDICES A1 APPENDIX 1: SUPPLEMENTARY TABLES A1 Table S5.1 A2 Table S5.2 A5 Table S5.3 A7 Table S7.1 A9

LIST OF FIGURES

Figure 3.1: Formation of reactive oxygen species 20 Figure 3.2: ROS, oxidative damage and human diseases 22 Figure 4.1: Growth of C. jejuni under aerobic or microaerobic conditions 39 Figure 4.2: Effects of initial culture conditions on the growth of C. jejuni 41 Figure 4.3: Growth of C. jejuni under oxygen-depleted conditions 42 Figure 4.4: Growth of H. pylori under microaerobic or aerobic atmospheres 45 Figure 4.5: Growth of H. pylori under microaerobic or aerobic atmospheres 46 Figure 4.6: Growth of H. pylori at different cell densities and atmospheres 48 Figure 4.7: Growth of A. butzleri under aerobic or microaerobic conditions 50 Figure 5.1: The flagellar assembly regulon downregulated in C. jejuni 61 Figure 6.1: Enzymatic disulfide bond oxidation and reduction 76 Figure 6.2: Uptake, transport, storage and excretion of cadmium in humans 82 Figure 7.1: 1H spectra of glutathione reduction in cell-free extract suspensions 89 Figure 7.2: Total number of motifs as a function of the total genome size 93 Figure 8.1: Metronidazole 105 Figure 8.2: Growth of the four Campylobacterales species at different Mtr concentrations 112 Figure 8.3: Mtr reduction in H. pylori susceptible and resistant lysates 117 Figure 8.4: 2D profiles of Helicobacter pylori HER 126 V1 and HER 126 V4 proteomes 128 Figure 8.5: 2D protein profiles of H. pylori HER 126 V4 cells grown without Mtr and in the presence of 8 µg ml-1 Mtr 133 Figure 9.1: Growth of the four Campylobacterales species in medium

containing CdCl2 at different concentrations 146

Figure 9.2: Growth of Campylobacter jejuni in medium containing CdCl2 at different concentrations 151

Figure 9.3: 2D protein profiles of C. jejuni cells grown without CdCl2

and in the presence of 0.1 mM CdCl2 152 Figure 9.4: Duplicates of 2D-gel sections of the C. jejuni proteome 165

113 Figure 9.5: Cd-NMR resonances of 50 mM CdCl2 169 Figure 10.1: Disulfide reducing and oxidizing pathways in Escherichia coli 174 Figure 10.2: Alignment of three H. pylori Dsb proteins with E. coli Dsb proteins 179 Figure 10.3: Number of proteins containing a thioredoxin-like fold and a CXXC motif per 1000 proteins of the bacterial genome 182 Figure 10.4: Number of putative Dsb proteins in the four Campylobacterales 184 Figure 11.1: The thioredoxin and glutaredoxin systems 192 Figure 12.1: RTS 100 E. coli linear template generation scheme 199 Figure 12.2: Construction of C-terminal TAP fusion genes for recombination 204 Figure 12.3: Principle of the modified tandem affinity purification method 206

Figure 12.4: Phylogram of bacterial TrxB1 enzymes 208 Figure 12.5: Cladogram of TrxB, TrxR and Gor enzymes 210 Figure 12.6: Recombinant enzyme expression at different temperatures 212

Figure 12.7: E. coli lysate fractions with expressed TrxB2 213 Figure 12.8: Recombinant enzyme purified with an imidazole gradient 215

Figure 12.9: In silico 3D model of TrxB2 219

Figure 12.10: TrxB2 tandem affinity purification eluants 221

vii

LIST OF TABLES

Table 3.1: Selected genes induced by the SoxRS system 25

Table 3.2: Members of H2O2-stress regulons 26 Table 4.1: The different atmospheres employed in Chapter 4 35 Table 4.2: Oxygen requirements and tolerance of the four Campylobacterales 51 Table 5.1: The different atmospheres employed in Chapter 5 55 Table 5.2: Pathways regulated under higher oxygen in the three species 58 Table 5.3: Proteins with a redox function upregulated at higher oxygen 67 Table 7.1: Percentages of proteins which contain motifs 91 Table 7.2: Motifs per 1000 ORF as a function of the oxygen requirement 95 Table 7.3: Number of proteins containing at least one motif in the four Campylobacterales species 97 Table 7.4: Putative disulfide reductases of the four Campylobacterales species 100 Table 7.5: Redox proteins with homologues in the four bacterial species 102 Table 8.1: The status of the rdxA and frxA genes in four H. pylori genetic backgrounds with susceptible and resistant matched pairs 108 Table 8.2: Disulfide reduction activities in H. pylori 10593/2 Mtr-susceptible and resistant cells 115 Table 8.3: Mtr inhibition constants of disulfide reductase activities 116 Table 8.4: Metronidazole reduction activities of H. pylori matched pairs 120 Table 8.5: XTT reduction as a function of bacterial density 123 Table 8.6: Michaelis constants for GSSG, FAD, Fdx and nitrofurazone reduction activities in H. pylori matched pairs 125 Table 8.7: Differences in the proteomes of the H. pylori strains HER 126 V1 and HER 126 V4 mapped using 2D-gel electrophoresis 129 Table 8.8: H. pylori HER 126 V4 proteins modulated in the presence of 8 µg ml-1 Mtr 134 Table 8.9: Oxygen tolerance and metronidazole susceptibility of C. jejuni 138 Table 9.1: Homologues of Czc proteins found in the four Campylobacterales 148 Table 9.2: ATPase enzymes encoded by the four Campylobacterales species 149

viii

Table 9.3: Isoelectric point and molecular weight of disulphide reductases 154 Table 9.4: C. jejuni proteins identified as downregulated in the presence

of 0.1 mM CdCl2 155 Table 9.5: C. jejuni proteins identified as upregulated in the presence

of 0.1 mM CdCl2 156 Table 9.6: Changes in glutathione and thioredoxin reduction rates of

bacteria grown with 0.1 mM CdCl2 167 Table 10.1: H. pylori proteins containing a thioredoxin-like fold 177 Table 10.2: Proteins containing a thioredoxin-like fold and a CXXC motif in the four Campylobacterales species 181 Table 10.3: Putative Dsb proteins in the four Campylobacterales species 183 Table 11.1: Roles of thioredoxins 194 Table 12.1: Primer sequences employed for all PCR reactions in Chapter 12 200 Table 12.2: Peptides identified through analysis of the recombinant enzyme 214 Table 12.3: Activities tested for the recombinant enzyme 217

LIST OF ABBREVIATIONS

CH3CN Acetonitrile NH4CO3 Ammonium carbonate APS Ammonium persulphate Fungizone® Amphotericin B Sb Antimonial BSA Bovine serum albumin BHI Brain heart infusion CSA Campylobacter selective agar Cd2+ Cadmium ions CDF Cation diffusion facilitators cfu Colony forming units CECF Continuous exchange cell-free Cu Copper Cys-Cys L-cystine DNA Deoxyribonucleic acid DAVID Database for Annotation, Visualization and Integrated Discovery D2O Deuterium oxide DTNB Dithiobis-2-nitrobenzoic acid DSP Dithiobis-(succinimidyl)-propionate DTT Dithiothreitol EndoIII Endonuclease III EndoVIII Endonuclease VIII -Proteobacteria Epsilon-Proteobacteria FAD Flavin adenine dinucleotide Fdx Ferredoxin GSSG Glutathione (oxidised) GSH Glutathione (reduced) GFP Green fluorescent protein GBS Guillain–Barré syndrome HRP Horseradish peroxidase H2O2 Hydrogen peroxide •OH Hydroxyl radical IA Iodoacetamide S.a. Induced in Staphylococcus aureus B.s. Induced in Bacillus subtilis iNOS Induced nitric oxide synthase Ki Inhibition constant Fe-S Iron-Sulfur FeSOD Iron superoxide mutase OOR -ketoglutarate oxidoreductase KEGG Kyoto Encyclopedia of Genes and Genomes LB Luria-Bertani

Vmax Maximal velocities Mtr Metronidazole Km Michaelis constant MIC Minimum inhibitory concentration O2 Molecular oxygen NAD(P)H NADH or NADPH NCBI National Center for Biotechnology Information NADH Nicotinamide adenine dinucleotide-reduced form NADPH Nicotinamide adenine dinucleotide phosphate-reduced form NO Nitric oxide TNB- p-Nitrobenzoate anion 14N-NMR Nitrogen-14 nuclear magnetic resonance NMR Nuclear magnetic resonance pO2 O2 tensions ppm Parts per million PBS Phosphate buffered saline PAGE Polyacrylamide gel electrophoresis PCR Polymerase chain reaction PVDF Polyvinylidine difluoride KCl Potassium chloride 1H-NMR Proton nuclear magnetic resonance PFOR Pyruvate ferredoxin oxidoreductase ROS Reactive oxygen species RNS Reactive nitrogen species RND Resistance-nodulation cell division rpm Rounds per minute RTS Rapid translation system SAM S-adenosylmethionine SAH S-adenosylhomocysteine STRING Search Tool for the Retrieval of Interacting Proteins SDHase Serine dehydratase NaCl Sodium chloride SDS Sodium dodecyl sulfate SRH S-ribosylhomocysteine SMD Stanford MicroArray Database - O2 Superoxide TAP Tandem affinity purification TIGR The Institute for Genomic Research Th1 T-helper 1 TDHase Threonine dehydratase TOF MS Time-of-flight mass spectrometry TCA Tricarboxylic acid CHAPS 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate TMB 5,5’-tetramethylbenzidine MTA 5'-methylthioadenosine MTR 5'-methylthioribose

xi Chapter 1 General Introduction

CHAPTER 1:

GENERAL INTRODUCTION

1 Chapter 1 General Introduction

Proteobacteria is the second largest group of eubacteria containing more than 30% of all known species. This phylum represents a diverse range of organisms such as the purple phototrophic, nitrifying bacteria, enteric bacteria and the bacteria responsible for animal bioluminescence [Dworkin & Falkow, 2006]. It includes a wide variety of pathogens, such as Escherichia, Salmonella, Vibrio and many other notable genera. The group is named after the Greek god Proteus who could change his shape, because of the great diversity of forms found in it. Some Proteobacteria move using flagella or rely on gliding [Dworkin & Falkow, 2006]. The latter include the myxobacteria which are capable of aggregating into multicellular fruiting bodies. Nutrition is usually heterotrophic, but there are two groups of Proteobacteria called purple bacteria that conduct photosynthesis [Dworkin & Falkow, 2006]. The purple sulfur bacteria use hydrogen sulfide as an electron donor, and the purple non-sulfur bacteria use hydrogen. The Proteobacteria are divided into five divisions referred to by the Greek letters alpha through epsilon.

The epsilon-Proteobacteria (-Proteobacteria) are a diverse group of microorganisms that inhabit unique environments, from oceanic hydrothermal vents to the gastrointestinal tracts of animals. Two orders, Campylobacterales and Nautiliales, have been identified in the -Proteobacteria [Nakagawa et al., 2005], but many genera have not been assigned to higher taxonomic groupings yet. Gene sequence data of symbionts of shrimps and polychaete annelids suggest that some -Proteobacteria may occupy important niches in the habitats of deep-sea hydrothermal vents, where they contribute to overall carbon and sulfur cycling at moderate thermophilic temperatures [Campbell et al., 2006; Polz & Cavanaugh, 1995]. A thermophilic sulfur-reducing bacterium isolated from the deep-sea hydrothermal vent polychaete, Alvinella pompejana, was assigned to the genus Nautilia [Miroshnichenko et al., 2002]. Another member of the -Proteobacteria is Thiovulum, whose phylogenetic relationship to -Proteobacteria was shown by partial rDNA analysis [Polz & Cavanaugh, 1995]. The sulfur-oxidizing Thiovulum forms large ovoid cells with a diameter often reaching 25 mm. The cytoplasm contains orthorhombic sulfur inclusions, and the bacterium is considered a chemolithotroph occurring in marine and freshwater environments, where sulfide-containing water and mud layers are in contact with overlaying oxygen-containing water [Polz & Cavanaugh, 1995]. The environmental

2 Chapter 1 General Introduction

Thiomicrospira denitrificans belongs also in the -Proteobacteria division, whereas the other six Thiomicrospira spp. including the species T. pelophila, are affiliated to the Piscirickettsia group of the gamma-Proteobacteria.

Sulfur metabolism plays an important role in the physiology of -Proteobacteria [Lane et al., 1992; Takai et al., 2005; Wirsen et al., 2002], and some species are chemolithotrophs whereas others are chemoorganotrophs. The latter include bacteria which colonize higher animals in either commensal relationships with the host, or as pathogens. Host-adapted species include the four genera, Campylobacter, Helicobacter, Wolinella and Arcobacter [Roy et al., 2002] of the Campylobacterales order.

1.1 CAMPYLOBACTER The Campylobacter genus comprises at present 17 species [Poly & Guerry, 2007] of spiral-shaped bacteria that can cause disease in humans and animals [Moore et al., 2005]. The primary reservoir of Campylobacter spp. is the alimentary tract of wild and domesticated birds, but these bacteria are found also in surface waters, rivers and lakes. Campylobacter species have been isolated from laboratory and husbandry animals, pets, and birds. Most human diseases caused by organisms of this genus are due to Campylobacter jejuni [Moore et al., 2005]. C. jejuni is motile with a single flagellum at each pole of the cell and is a widespread commensal of avians; thus, most cases of Campylobacteriosis are associated with handling raw poultry or eating raw or undercooked poultry meat, but other sources like unpasteurized milk or water are not uncommon. Symptoms of C. jejuni infection can include fever, headache, dizziness and myalgia. Such infections tend to be self-limiting [Moore et al., 2005]; however, reactive arthritis and temporary paralysis caused by Guillain–Barré syndrome (GBS) can be late- onset complications [Acheson, 1999]. The development of GBS is associated with lipooligosaccharides that mimic human gangliosides [Nachamkin et al., 2002; Poly & Guerry, 2007]; thus, antibodies to the lipooligosaccharide core structures result in an autoimmune response affecting peripheral nerves. Furthermore, C. jejuni has been associated with a rare form of mucosa-associated lymphoid tissue lymphoma called immunoproliferative small intestinal disease [Lecuit et al., 2004].

3 Chapter 1 General Introduction

Bacterial factors such as motility, glycosylation, and capsular synthesis have been implicated in C. jejuni invasion of eukaryotic cells [Watson & Galán, 2008]. Bacterial invasion has also been correlated with C. jejuni’s ability to stimulate the activation of MAP kinases leading to the production of the pro-inflammatory cytokine, IL-8 [Hickey et al., 2000; Watson & Galán, 2008]. C. jejuni is internalized into intestinal epithelial cells in a microtubule-dependent, actin-independent fashion [Oelschlaeger et al., 1993], suggesting that this bacterium employs an entry mechanism unlike those reported for other bacterial pathogens. In addition, C. jejuni has evolved specific adaptations to survive within intestinal epithelial cells by avoiding delivery into lysosomes [Watson & Galán, 2008].

The high incidence of Campylobacteriosis in the world [Wilson et al., 2008] calls for efficient treatments of these infections. The bacterium is susceptible to antibiotics such as erythromycin and fluoroquinolones [Moore et al., 2005]; thus, these compounds are used to treat C. jejuni infections if the symptoms persist or if the patient is immunocompromised.

1.2 HELICOBACTER The genus Helicobacter comprises pathogenic, spiral-shaped bacteria that have been isolated from the intestinal tract of animals, including humans [Fox, 2002; Marshall & Warren, 1984; Warren, 1983]. Helicobacter spp. have metabolic pathways that include both aerobic and anaerobic processes. The specific pathways employed depend on the environmental conditions and nutrients available. Helicobacter pylori is found in the gastric mucous layer or adhering to the epithelial lining of the human stomach, and is one of the most prevalent infections in humans (approximately 15.4% in Australia) [Alarcon et al., 1999; Moujaber et al., 2008]. Its presence is associated with the development of gastritis, ulcers and gastric cancers. The organism is about 3.5 )m long and 0.5 )m to 1.0 )m wide. H. pylori has up to seven polar, sheathed flagella and a unique composition of fatty acids in the cell wall, giving it a smooth surface. The bacterium uses oxygen as a terminal electron acceptor in the respiratory electron transport chain.

4 Chapter 1 General Introduction

Colonization of the gastric mucosa by H. pylori first results in the induction of an inflammatory response, predominantly of the T-helper 1 (Th1) type. This local inflammatory response is characterized by an influx of neutrophils, mononuclear cells, natural killer cells and T-cells, typically aimed at clearing the infection [Kusters et al., 2006]. However, H. pylori is not an intracellular pathogen, and thus the Th1 response results in epithelial cell damage rather than in the removal of H. pylori [Kusters et al., 2006]. The ongoing presence of H. pylori thus causes a lifelong inflammatory response, responsible for the continuous production of species that cause cellular damage.

Urease plays an important part in H. pylori colonization of its host. H. pylori urease has a role in the pathogenicity by producing toxic ammonia from urea hydrolysis [Sommi et al., 1996], promoting colonization by buffering the microenvironment of the bacterium [Weeks et al., 2000], and contributing to generate reactive nitrogen species (RNS) through the ammonia produced and the recruitment of neutrophils [Suzuki et al., 1992]. In addition, the bacterial urease activates induced nitric oxide synthase (iNOS) in macrophages, and the enhanced production of nitric oxide (NO) contributes to H. pylori pathogenesis [Gobert et al., 2002]. A mechanism to avoid being killed by NO is the production of arginase by the bacterium which competes with iNOS for the substrate arginine. Thus, NO synthesis is regulated by the competition for the common substrate, and arginase provides a protective mechanism to H. pylori [Gobert et al., 2001].

A standard treatment for H. pylori infection consists of one to two weeks of a triple therapy including two antibiotics, such as amoxicillin, tetracycline, metronidazole, or clarithromycin, plus another compound, either ranitidine bismuth citrate, bismuth subsalicylate, or a proton pump inhibitor [Scarpignato, 2004]. Antibiotic therapies are becoming increasingly complex due to the higher levels of H. pylori antibiotic resistance.

1.3 WOLINELLA Wolinella succinogenes was originally isolated from the bovine rumen [Wolin et al., 1961] and is the only species of the genus. W. succinogenes is a nonfermenting

5 Chapter 1 General Introduction

cylindrical-shaped organism with a single flagellum at one of its poles [Baar et al., 2003]. There is no evidence of glucose fermentation by W. succinogenes; however, it has a gene encoding a phosphofructokinase which provides a pathway for the conversion of glucose- 6-phosphate to pyruvate suggesting that W. succinogenes could use glycolytic enzymes for gluconeogenesis [Baar et al., 2003]. Complete genome sequencing of W. succinogenes has revealed that it shares 1,269 of its 2,046 genes with H. pylori and C. jejuni [Baar et al., 2003; Eppinger et al., 2004]. To date, this bacterium is not considered pathogenic, but has an extensive repertoire of genes homologous to known bacterial virulence factors [Baar et al., 2003]. In particular, Antigen B, a key pathogenic agent of C. jejuni is found in W. succinogenes. In a pilot study, Wolinella DNA was detected in 40% of South African patients with oesophageal carcinoma [Bohr et al., 2003]. Also, W. succinogenes DNA was found in gastric biopsies from a sea lion with gastritis [Oxley et al., 2004]. The detection of organisms closely related to W. succinogenes in the colon of children [Zhang et al., 2006], represents the first documented report of this organism inhabiting the gastrointestinal tract of humans. These findings suggest that the status of W. succinogenes as a nonpathogen may need to be reevaluated.

1.4 ARCOBACTER The genus Arcobacter is an unusual -Proteobacteria taxon in that it contains both pathogenic and free-living species found in a wide range of environments. Bacteria of the genus Arcobacter were first isolated from aborted bovine foetuses [Ellis et al., 1977]. They are found in marine sediments, hypersaline environments, and can colonize vertebrates [Donachie et al., 2005; Hsueh et al., 1997; Kiehlbauch et al., 1991; Wirsen et al., 2002]. Some species have the ability to grow at low temperatures and at atmospheric oxygen concentrations.

Currently, Arcobacter contains four recognized species: Arcobacter butzleri [Kiehlbauch et al., 1991], Arcobacter cryaerophilus [Neill et al., 1985], Arcobacter skirrowii [Vandamme et al., 1992] and Arcobacter nitrofigilis [McClung et al., 1983]. A. butzleri, A. cryaerophilus and A. skirrowii have been isolated from animals and humans [Forsythe, 2006], while A. nitrofigilis is a nitrogen-fixing bacterium isolated from Spartina

6 Chapter 1 General Introduction

aterniflora roots [McClung et al., 1983]. In addition to these established Arcobacter species, several other species have been described in places varying from broiler carcasses [Houf et al., 2005], to a low-salinity petroleum reservoir [Grabowski et al., 2005], to the flora of deep-sea hydrothermal vents [Moussard et al., 2006].

Arcobacter butzleri is the best characterized species of the genus. The cells are small, spiral and motile [Forsythe, 2006; Miller et al., 2007], similar morphologically to Campylobacter species. A. butzleri is psychrophilic with a temperature range between 15 °C and 37 °C, although some strains can grow at 42 °C [Forsythe, 2006]. The bacterium has been associated with enteritis and bacteremia in husbandry animals and humans [Hsueh et al., 1997; Kiehlbauch et al., 1991; Vandenberg et al., 2004]. The clinical symptomatology described for A. butzleri typically includes diarrhea and recurrent abdominal cramps [Forsythe, 2006]. Although A. butzleri has been isolated often from animals or food sources, it has been isolated frequently from water or water systems [Assanta et al., 2002]. Published data suggests that A. butzleri is an emerging pathogen [Forsythe, 2006], where transmission, similarly to C. jejuni, occurs probably through consumption of contaminated food or water [Miller et al., 2007].

1.5 HOST REACTIONS TO INFECTIONS: OXIDATIVE AND NITRATIVE BURSTS A variety of factors influence the fate of infecting bacteria, two of them are their abilities to avoid inducing an oxidative metabolic burst response from the host [Beaman & Beaman, 1984], and to resist changes in their oxygen metabolism resulting in reactive products.

In response to bacteria, several types of host cells including macrophages, neutrophils, epithelial cells, etc. can produce a metabolic burst in which there is an enhanced production of reactive oxygen species (ROS) including oxygen ions (superoxide anion), free radicals (hydroxyl radicals) and both inorganic and organic peroxides. Similarly, RNS are produced in response to infection [Nathan & Shiloh, 2000]. Increased levels of these reactive species can produce significant damage to microbial cells and biomolecules [Imlay, 2003], leading to oxidative and/or nitrative stress.

7 Chapter 1 General Introduction

1.6 HYPOTHESIS AND AIMS OF THE THESIS The interest in -Proteobacteria stemmed in part from their ability to have a profound impact on human health. A comprehensive understanding of the physiology of these bacteria will make possible the design of vaccines and therapeutic strategies, crucial steps to combat these infections.

This work focused on four genera from the Campylobacterales order capable of colonizing animals and humans, namely C. jejuni, H. pylori, W. succinogenes and A. butzleri. Reflecting their habitats, these Campylobacterales species have a unique relationship with oxygen. At the same time, these Campylobacterales are subjected to host-induced oxidative stress during their colonization. Hence, it was concluded that oxygen metabolism is pivotal to the survival of these bacterial species. Disulfide reductases are associated with maintenance of intracellular redox balance and thus, with intracellular oxygen status. For this reason, it was hypothesized that disulfide reductases play an important role in the physiology of the four Campylobacterales.

The aims of the thesis were to investigate the aerophily of these bacteria and the organisms’ responses to oxidative stress. This will lend insights into their adaptation to the host. The approach taken to study the disulfide reductases was to identify these enzymes and examine their roles in different processes of the physiology of the four bacterial species; namely, drug resistance, heavy metal detoxication and pathogenesis.

The work focused on C. jejuni and H. pylori owing to the fact that the literature on C. jejuni and H. pylori is far greater than on W. succinogenes and A. butzleri, which allowed for more in-depth analyses of experimental results. In addition, several other reasons for focusing on these two bacteria are detailed as the various parts of the project are described.

8 Chapter 2 Materials and Methods

CHAPTER 2:

MATERIALS AND METHODS

9 Chapter 2 Materials and Methods

This work encompasses a variety of experimental conditions that are explained more appropriately in the chapters where the relevant results are described. This chapter addresses experimental methods and conditions employed in multiple parts of this work.

2.1 GENERAL MICROBIOLOGY 2.1.1 Materials Blood Agar Base No. 2, Brain Heart Infusion (BHI) media, defibrinated horse blood, gas generating AnaeroGen, CampyGen and CO2Gen packs, and horse serum were from Oxoid (Heidelberg West, VIC, Australia). Amphotericin B (Fungizone®), bicinchoninic acid, bovine serum albumin, cadmium chloride, chloramphenicol, copper II sulfate, ß- cyclodextrin, L-cystine, dithiobis-2-nitrobenzoic acid (DTNB), dithiothreitol (DTT), flavin adenine dinucleotide (FAD), spinach ferredoxin (Fdx), fumaric acid, oxidized glutathione (GSSG), reduced glutathione (GSH), bovine glutathione reductase, menadione, metronidazole (Mtr), mineral oil, ß–nicotinamide adenine dinucleotide (NADH), ß–nicotinamide adenine dinucleotide phosphate (NADPH), polymyxin B, sodium formate, trimethoprim and sodium 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H- tetrazolium-5-carboxanilide (XTT) were from Sigma (Castle Hill, NSW, Australia). Vancomycin was from Eli Lilly (North Ryde, NSW, Australia). Deuterium oxide was from Cambridge Isotope Laboratories (Cambridge, England, UK). Tris base and sodium dodecyl sulfate (SDS) were from Amersham Biosciences (Melbourne, VIC, Australia). TRIzol® Reagent was purchased from Invitrogen Life Technologies Inc. (Mount Waverly, VIC, Australia). All other reagents were of analytical grade.

2.1.2 Regular bacterial growth conditions Helicobacter pylori, C. jejuni and A. butzleri strains were grown on Campylobacter- selective agar (CSA) supplemented with 6% defibrinated horse blood, 2.0 μg ml-1 amphotericin B, 5.0 μg ml-1 vancomycin, 1250 U ml-1 polymyxin B, and 2.5 μg ml-1 trimethoprim. Cultures were incubated under the microaerobic conditions 5% CO2, 5%

O2 and 90% N2, at 37 °C for H. pylori and C. jejuni, and at 30 °C for A. butzleri. W. succinogenes was grown on the same solid media supplemented with 4 mM ammonium chloride, 38 mM potassium phosphate, 26 mM fumaric acid, and 44 mM sodium formate;

10 Chapter 2 Materials and Methods

cultures were incubated at 37 °C under the microaerobic conditions 5% CO2, 2% O2 and

93% N2. The purity of bacterial cultures was confirmed by motility and morphology observed under phase contrast microscopy, and where applicable, by positive urease, oxidase and catalase tests.

2.2 PROTEOMICS 2.2.1 Preparation of lysate fractions and cell-free protein extracts for enzyme assays Bacteria were harvested in sterile saline (150 mM NaCl), washed three times by centrifuging at 17000 g for 4 min at 4 °C, and resuspended in saline after each wash. Following the final wash, packed cells were resuspended in saline at a density of 109-1010 cells ml-1 and lysed by two freeze-thawing cycles in liquid nitrogen; Phase-contrast microscopy was employed to verify greater than 99% cell lysis. To separate the supernatant and particulate fractions, bacterial suspensions were centrifuged at 20000 g for 15 min at 4 °C.

2.2.2 Preparation of cell-free protein extracts for two-dimensional gel electrophoresis After 18 h of incubation, chloramphenicol was added to bacterial suspensions to a final concentration of 128 μg ml-1. Cultures were centrifuged at 2900 g for 25 min at 4 oC, and the pellet was washed three times with 0.2 M ice-cold sucrose. Bacterial cells were disrupted by freeze-thawing the pellet three times. The disrupted cells were resuspended in 1 ml TSU buffer (50 mM Tris pH 8.0, 0.1% SDS, 2.5 M Urea). Cell debris was removed by centrifugation at 14000 g for 20 minutes at 4 oC.

2.2.3 Protein determination Estimation of the protein content of samples was made by the bicinchoninic acid method employing a microtitre protocol (Pierce; Rockford, ILL, USA). Absorbances were measured using a Beckman Du 7500 spectrophotometer.

2.2.4 Protein precipitation, SDS-PAGE and Western blotting For SDS-PAGE analysis of the expression products, the resolution of proteins was improved employing precipitation with 100% acetone. Briefly, 50 µl of acetone was

11 Chapter 2 Materials and Methods

added to 10 µl of RTS reaction mixture and precipitated on ice for 5 min. The precipitate was collected by centrifuging the suspension for 5 min at 3680 g. The dried pellet was resuspended in SDS-PAGE sample buffer (0.375 M Tris pH 6.8, 0.01% SDS, 20% glycerol, 40 mg ml-1 SDS, 31 mg ml-1 DTT, 1 µg ml-1 bromophenol blue). For electrophoretic analyses proteins were further denatured by heating at 100 °C for 5 min. Proteins were separated on 12% SDS-PAGE gels by electrophoresis for 2 h at 100 V. The gels were stained with GelCode blue. Alternatively, gels were transferred to methanol- treated polyvinylidine difluoride (PVDF) membranes (Millipore; North Ryde, NSW, Australia) overnight at 15 V using the Trans-blot cell transfer system (Bio-Rad; Sydney, NSW, Australia) and following the protocol of the manufacturer. Membranes were blocked for 60 min in 5% skim milk powder in phosphate buffered saline (PBS), containing 0.05% v/v Tween 20. Anti-His tag antibody labelled with horseradish peroxidase (HRP) at a dilution of 1:2000 was added and incubated for a further 90 min, and the membranes were developed using 5,5’-tetramethylbenzidine (TMB). Colour development was halted and background colour reduced with the addition of H2O.

2.2.5 Nuclear magnetic resonance spectroscopy Suspensions of bacterial lysates or cell-free extracts were placed in 5 mm or 10 mm tubes (Wilmad; Buena, NJ, USA), the appropriate substrates added, and measurements of enzyme activities were carried out at 37 °C. Proton nuclear magnetic resonance spectroscopy (1H-NMR) and nitrogen-14 nuclear magnetic resonance (14N-NMR) free induction decays were collected using a Bruker DMX-600 or a Bruker DMX-500 spectrometer, respectively, operating in the pulsed Fourier transform mode with quadrature detection. The instrumental parameters for the DMX-600 spectrometer were: operating frequency 600.13 MHz, spectral width 6009.61 Hz, memory size 16 K, acquisition time 1.36 s, number of transients 64, pulse angle 50° (3 µs) and relaxation delay with solvent presaturation 1.7 s. Spectral resolution was enhanced by Gaussian multiplication with line broadening of -0.7 Hz and Gaussian broadening factor of 0.19. Proton spectra were acquired with presaturation of the water resonance. The instrumental parameters for the DMX-500 spectrometer were: operating frequency 36.14 MHz, spectral width 19841 Hz, memory size 8 K, acquisition time 0.21 s, number of transients

12 Chapter 2 Materials and Methods

2488, pulse angle 90° (30 µs) and relaxation delay 0.1 s. Spectra were acquired with composite pulse decoupling of protons. Exponential filtering of 15 Hz was applied prior to Fourier transformation.

The time-evolution of substrates and products were followed by acquiring sequential spectra of the reactions. Progress curves were obtained by measuring the integrals of compounds at different points in time. Maximal rates were calculated from good fits to straight lines (correlation coefficients 1 0.95) of the data. Calibrations of the peaks arising from substrates were performed by extrapolating the resonance intensity data to zero time and assigning to this intensity the appropriate concentration value.

2.2.6 Two-dimensional PAGE electrophoresis and image analysis Protein aliquots (200 μg) were suspended in 490 μl of a rehydration buffer consisting of 8 M urea, 100 mM DTT, 65 mM 3-[(3-cholamidopropyl)-dimethylammonio]-1- propanesulfonate (CHAPS), 40 mM Tris-HCl pH 8.0, 10 μl pH 4-7 and IPG buffer (Amersham Biosciences). Nuclease buffer (10 μl) was added, and the mixture was incubated at 4 oC for 20 minutes. The sample was centrifuged at 14000 g for 20 minutes at 4 oC, and the supernatant was loaded for the first dimension chromatography on to an 18 cm Immobiline DryStrip pH 4-7 (Amersham Biosciences), and left to incubate sealed for 20 h at room temperature. Isoelectric focusing was performed using a flatbed Multiphor II unit (Amersham Biosciences) programmed for 2 h at 100 V; followed by 0.5 h at 500 V, 1500 V, and 2500 V; and a final 18 h step at 3500 V. Focused Immobiline DryStrips were equilibrated sequentially in two buffers of 6 M urea, 20% (w/w) glycerol, 2% (w/v) SDS, 375 mM Tris-HCl, the first one contained 130 mM DTT, and the second one contained 135 mM iodoacetamide (IA). For the second dimension, sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed on 11.5% acrylamide gels using the Protean II system (Bio-Rad) at 50 V for 1 h, followed by 64 mA until the dye front reached the bottom of the gel. Gels were fixed individually in 0.2 l fixing solution (50% (v/v) methanol, 10% (v/v) acetic acid) for a minimum of 1 h, and were subsequently stained using a sensitive ammoniacal silver method. For comparative image analysis, statistical data were acquired and analyzed using the Z3 Compugen software

13 Chapter 2 Materials and Methods

(Sunnyvale, CA, USA). Proteins were considered to be regulated if the intensities of the corresponding spots on test and control gels differed at least two-fold.

2.2.7 Mass spectrometry identification of proteins Protein-containing spots excised from the gels were washed twice with 0.2 ml of 100 mM o NH4HCO3 for 10 min, reduced with 50 μl of 10 mM DTT at 37 C for 1 h, alkylated in 50 μl of 10 mM IA at 37 oC for 1 h, washed three times for 10 min with 0.2 ml milli-Q water, washed with 0.2 ml of 10 mM NH4HCO3 for 10 min, dehydrated in acetonitrile, and rehydrated in a buffer containing 10.5 ng μl-1 trypsin. After digestion for 14 h, peptides were extracted by washing the gel slices with 25 μl 1% formic acid for 15 min, followed by dehydration with acetonitrile. Digests were separated by nano-LC using an Ultimate/Famos/Switchos system. Samples (5 μl) were loaded on to a Micron C18 precolumn (500 μm x 2 mm) with buffer A (H2O:CH3CN 98:2 v/v and 0.1% formic acid) and eluted at 25 μl min-1. After a 4 min wash, the flow was switched into line with a PEPMAP C18 RP analytical column (75 μm x 15 cm) and eluted using a gradient of -1 buffer A to H2O:CH3CN (40:60, 0.1 % formic acid) at 200 nl min over 30 min. The nano electrospray needle was positioned ≈ 1 cm from the orifice of an API QStar Pulsar I tandem MS instrument. The QStar was operated in information-dependent acquisition mode. A time-of-flight mass spectrometry (TOF MS) survey scan was acquired (m/z 350- 1700, 0.5 s), and the two largest precursors (counts >10) were selected sequentially by Q1 for tandem MS analysis (m/z 50-2000, 2.5 s). A processing script generated data suitable for submission to database search programmes. Collision induced dissociation spectra were analyzed using the Mascot MS/MS ion search tool (Matrix Science; http://www.matrixscience.com/) with the following parameters: trypsin digestion allowing up to one missed cleavage, oxidation of methionine, peptide tolerance of 1.0 Da, and MS/MS tolerance of 0.8 Da. Protein searches were performed on the NCBI nr database.

2.2.8 Bioinformatics BLASTP searches were performed using the complete protein sequences available at the NCBI database (http://www.ncbi.nlm.nih.gov/). The functional classification tool in the

14 Chapter 2 Materials and Methods

Database for Annotation, Visualization and Integrated Discovery (DAVID) [Dennis et al., 2003] available at (http://david.abcc.ncifcrf.gov) was employed to determine the functional categories to which regulated transcripts belonged. Genes were classified using the lowest stringency option to avoid losing any functional categories. The Kyoto Encyclopedia of Genes and Genomes (KEGG) [Kanehisa et al., 2008] available at (www.genome.jp/kegg) was employed to determine the biochemical pathways the genes/proteins were assigned to. The MicrobesOnline website available at (www.microbesonline.org) was employed to determine the predicted operons and regulons in which the genes are found. The Search Tool for the Retrieval of Interacting Proteins (STRING) is a database of known and predicted protein-protein interactions available at (http://string.embl.de/). STRING was employed to examine predicted interactions between proteins. The Helicobacter pylori Database of Protein Interactomes available at (http://dpi.nhri.org.tw/) was employed to identify protein interactions in this bacterium.

2.3 MOLECULAR BIOLOGY 2.3.1 Polymerase chain reaction Unless stated otherwise, all PCR reactions were carried out in 20 µl volumes and consisted of the appropriate volume of PCR buffer, 2 mM MgCl2, dNTPs (final concentration of 0.1 mM of each dNTP), 10-100 ng template DNA, 0.2 µM of each primer, and 0.1 µl AmpliTaq GOLD (Promega; Sydney, NSW, Australia) per 1 kb. All primers were synthesised by SigmaGenosys (Sigma-Aldrich). The following parameters were employed for PCR cycling: 94 °C for 4 min, 25-30 cycles at 94 °C for 15 s, 56 °C for 15 s and 72 °C for 1 min per kilobase amplified, and a final extension step of 72 °C for 7 min. All PCR reactions were performed in a Hybaid PCR sprint thermocycler (Hybaid instruments; Waltham, MA, USA).

2.3.2 Colony PCR Colony PCR was performed on all E. coli transformants to confirm successful cloning. Briefly, one colony was transferred to 30 µl sterile water and cells were lysed at 95 °C for 5 min. PCR reactions employing the standard conditions described previously were

15 Chapter 2 Materials and Methods

performed with 2 µl of cell lysis suspension as DNA template. All pGEM-T (Promega) clones were analyzed with the primers T7 promoter (T7p) 5’- TAATACGACTCACTATAGGG -3’ and Sp6 5’- TATTTAGGTGACACTATAG -3’ available from Promega.

2.3.3 Transformation of Escherichia coli Cultures of Escherichia coli DH5 cells were grown using Luria-Bertani (LB) agar or broth comprising sodium chloride 10 g l-1, tryptone 10 g l-1 and yeast extract 5 g l-1, with addition of agar 15 g l-1 for solid media.

Escherichia coli cells were chemically treated to induce competency for transformation reactions. Cells were grown at 30 °C to an OD600 of 0.3 and transferred to ice. Bacteria were treated and washed on ice with in the following two transformation buffers; buffer

1: 10 mM MES, 100 mM RbCl, 10 mM CaCl2, 50 mM MnCl2; buffer 2: 10 mM MOPS,

10 mM RbCl, 75 mM CaCl2, 15% glycerol. Cells were stored as 80 µl aliquots at -70 °C.

For the transformation of competent E. coli cells with DNA, suspensions of cells combined with DNA were incubated on ice for 30 min, heat shocked at 42 °C for 90 s, and placed on ice for 3 min. Bacteria were then incubated at 37 °C in LB media prior to transfer to LB plates supplemented with the appropriate antibiotics. Transformed cells were grown overnight at 37 °C prior to the screening of colonies for successful transformants.

2.3.4 Dye-Terminator sequencing DNA sequencing reactions were carried out using the BigDye™ Terminator kit version 3.1 (Applied Biosystems; Scoresby, VIC, Australia). Unincorporated dye was removed by ethanol precipitation. The separation of labelled fragments of DNA was performed with an Automated DNA Sequence Analyzer ABI3730 (Applied Biosystems) at the Sequencing Facility of the School of Biotechnology and Biomolecular Sciences, The University of New South Wales. Sequencing data were analyzed using the FinchTV v1.4 program available from www.geospiza.com.

PART 1: EFFECTS OF OXYGEN

CHAPTER 3: PART 1INTRODUCTION 18 3.1 BACKGROUND 19 3.2 EFFECTS OF OXYGEN ON MICROORGANISMS AND THEIR RESPONSES 21 3.2.1 Effects of reactive oxygen species on organisms 21 3.2.2 Cellular defenses against oxidative stress 23 3.2.3 Repair of oxidative DNA damage 24 3.2.4 Regulators involved in the response to oxidative stress 24 3.2.5 Oxygen sensing during deprivation 27 3.3 EFFECTS OF OXYGEN ON CAMPYLOBACTERALES AND THEIR RESPONSES 27 3.3.1 Effects of oxygen on Campylobacter jejuni 27 3.3.2 Effects of oxygen on Helicobacter pylori 28 3.3.3 Effects of oxygen on Wolinella succinogenes 31 3.3.4 Effects of oxygen on Arcobacter butzleri 31

PART 1SUMMARY 70

17 Chapter 3 Part 1 Introduction

CHAPTER 3:

PART 1INTRODUCTION

18 Chapter 3 Part 1 Introduction

3.1 BACKGROUND Oxygen plays a critical role in the life of many microorganisms. Its high redox potential and ubiquity make it a very common electron acceptor in cellular metabolism. At the same time many products or by-products of oxygen reactions are toxic (Fig. 3.1), and organisms have developed complex resistance mechanisms against them. Criteria on the requirement, use, and need for oxygen, as well as resistance to ROS have been employed to classify microorganisms into five major groups [Unden, 1999]. Namely, (a) strict aerobes that need atmospheric O2 tensions (pO2) for growth, and grow and proliferate at pO2 of 21%, e.g. some Bacillus spp.; (b) microaerophiles which need O2 for growth but are susceptible to atmospheric oxygen tensions, and grow best at pO2 of 5-10%, e.g. some

Campylobacter spp.; (c) facultative-anaerobes that use and tolerate O2 but can grow without oxygen, e.g. some Enterobacteria; (d) aerotolerant anaerobes which do not use

O2, but tolerate it owing to their resistance mechanisms to ROS, e.g. some lactic bacteria; and (e) strict anaerobes that do not use O2, are unable to survive long exposures to oxygen, and grow only at a pO2 < 0.5-2%, e.g. Clostridium spp [Unden, 1999].

Microorganisms such as Neisseria spp. which need an atmosphere with an elevated CO2 partial pressure of 5-10% for growth are defined as capnophilic or capneic [Krieg & Hoffman, 1986]. Microaerophilic microorganisms are generally capnophilic and their sensitivity to high pO2 is caused by oxygen-dependent inactivation of some vital cellular components such as enzymes involved in redox reactions [Krieg & Hoffman, 1986]. Microaerophilic microorganisms have oxygen-dependent growth, but under full aerobic conditions cannot grow, or grow very poorly. The existence of microaerophiles has been known for some time, but the study of their specific characteristics has been neglected owing to the inclination to regard them as aerobes, facultative anaerobes, or aerotolerant anaerobes. This lack of understanding of the fundamental properties which define microaerophily has left significant gaps in our knowledge of microorganisms which have widespread habitats and are important in several scientific and technological fields.

It is possible to group microaerophiles into three categories: (i) obligate microaerophiles that require low oxygen tensions for growth, such as some deep sea marine bacteria; (ii)

19 Chapter 3 Part 1 Introduction

O2 molecular oxygen

Spontaneous univalent electron e- transfer from reduced components of the electron transport chain

•- O2 superoxide

Enzymatic or spontaneous e- dismutation

Reduction H2O2 hydrogen peroxide

Reaction with Fe2+ e-

•OH hydroxyl radical

H2O water

Figure 3.1 Formation of reactive oxygen species [Kiley & Storz, 2004]. The four-electron reduction of molecular O2 generates two molecules of H2O, the most reduced form of - oxygen. H2O2 is also produced by the enzymatic or spontaneous dismutation of O2 , and

•OH is generated by the reaction of iron with H2O2 (the Fenton reaction).

20 Chapter 3 Part 1 Introduction

microaerophiles that can grow aerobically only under certain conditions, such as the nitrogen-fixing bacteria Azospirillum spp. or Rhizobium spp.; and (iii) facultative microaerophiles which have anaerobic metabolism and phenotype but can grow at low pO2, such as sulfur-reducing bacteria [Finster et al., 1997] and several anaerobic phototrophes [Romagnoli et al., 2002]. Some obligate microaerophiles live at the limit between oxic and anoxic environments because they use O2 as an electron acceptor and products of anaerobic metabolism as electron donors; for example, aquatic chemolithotroph and chemoorganotroph bacteria such as Gallionella ferruginea and Aquaspirillum magnetotacticum, respectively [Krieg & Hoffman, 1986; Unden, 1999]. Microaerophiles are found also among pathogenic microorganisms including the protozoans Treponema pallidum, Plasmodium falciparum, Giardia spp., and bacteria such as Borrelia spp. [Krieg & Hoffman, 1986; Lloyd et al., 2000]. Understanding their physiology is important to combat these infections since many antibiotics act by producing toxic redox products and microorganisms have developed resistance mechanisms to protect themselves against oxidative host responses.

3.2 EFFECTS OF OXYGEN ON MICROORGANISMS AND THEIR RESPONSES 3.2.1 Effects of reactive oxygen species on organisms The molecules from which cells are made -amino acids, lipids, and nucleic acids- are reasonably stable in aerobic buffers yet organisms still exhibit susceptibility to ROS. Generally, cells lose the ability to grow without supplements of nicotinamide and branched-chain, aromatic, and sulfurous amino acids in the presence of high amounts of •- •-2 ROS [Imlay, 2003]. Several types of ROS such as superoxide (O2 ), peroxide (O ), hydrogen peroxide (H2O2), and the hydroxyl radical (•OH) may have detrimental effects on organisms (Figs. 3.1, 3.2); although, molecular oxygen (O2) could have negative effects as well.

•- The effects of O2 arise from its ability to affect iron-sulfur (Fe-S) clusters of several enzymes such as dihydroxyacid dehydratase, aconitase B and fumarase [Boehme et al., 1976; Imlay, 2003], leading to the impairment of the TCA cycle. Interestingly, it does not

21 Chapter 3 Part 1 Introduction

Modulation of stress- Oxidative damage induced proteins and to proteins genes

ROS

Chemical changes in DNA conformational nucleobases or nucleotides changes Induction of lipid peroxidation

Mutation

Figure 3.2 ROS and oxidative damage [Matés & Sánchez-Jiménez, 1999]. Consequences of an imbalance in reactive oxygen species on cellular growth and function.

22 Chapter 3 Part 1 Introduction

•- influence Fe-S clusters of respiratory enzymes [Imlay, 2003]. Additionally, O2 causes a high rate of mutation and auxotrophies for aromatic amino acids and sulfur-containing amino acids [Carlioz & Touati, 1986; Farr et al., 1986].

Hydrogen peroxide is believed to cause oxidation of sulfur atoms, protein carbonylation and oxidation of Fe-S clusters [Imlay, 2003]. H2O2 oxidizes protein cysteinyl residues creating sulfenic acid adducts than can either form disulfide cross-links with other cysteines or be oxidized further to sulfinic acid moieties. In addition, tyrosine and tryptophan residues are electron-rich sinks, thus, are very susceptible to the actions of oxidants [Imlay, 2003]. If any of these residues are critical for the function of a protein then oxidation reactions might disrupt the activity of the enzyme.

The only oxygen species that can damage directly most biomolecules is the hydroxyl radical which is formed when ferrous iron transfers an electron to H2O2. It can cause major DNA damage leading to bacterial death. Finally, the attention given to ROS may have distracted from the possibility that O2 directly can injure cells [Imlay, 2003].

3.2.2 Cellular defenses against oxidative stress Bacteria express enzymes as their frontline defense against oxidative stress. Cytoplasmic - and periplasmic superoxide dismutases scavenge excess O2 in the cell, while peroxidases (Equation 1) and catalases (Equation 2) scavenge hydrogen peroxide.

1. RH2 + H2O2 R + 2H2O

2. H2O2 + H2O2 O2 + 2H2O

Furthermore, thiol based defenses such as reduced glutathione, glutathione reductase, thioredoxin, thioredoxin reductase, glutaredoxin, peroxiredoxin and methionine sulfoxide reductase (Msr) are involved also in the response to oxidative stress [Seib et al., 2006].

23 Chapter 3 Part 1 Introduction

3.2.3 Repair of oxidative DNA damage Alongside enzymatic defense systems, bacterial cells induce systems which help repair DNA damage caused by ROS. This includes the repair of oxidized free nucleotides, oxidized pyrimidines, and oxidized purines, as well as mismatch repair [Lu et al., 2001].

Oxidized products from thymine such as thymine glycol block DNA synthesis in vitro when found in the template. These oxidized products are primarily recognized by endonuclease III (EndoIII) and endonuclease VIII (EndoVIII) in E. coli [Cunningham, 1997]. The AlkA, EndoIII, EndoVIII, and MutM proteins are all involved in the repair pathways for formyluracil, a potentially mutagenic lesion of thymine produced in DNA by various chemical oxidants [Lu et al., 2001; Zhang et al., 2000]. The E. coli MutM glycosylase removes purine lesions and mutagenic 8-oxoG adducts [Chetsanga & Lindahl, 1979; Tchou et al., 1991], while the adenine and guanine glycosylase MutY is active on mispairs [Lu et al., 2001]. The E. coli MutT protein eliminates 8-oxodGTP from the nucleotide pool with its nucleoside triphosphatase activity [Akiyama et al., 1989; Lu et al., 2001]. Finally, mismatch repair is involved also in the repair of oxidative DNA damage [Lu et al., 2001]. The E. coli mismatch repair system which enhances the fidelity of DNA replication requires more than 10 proteins, including MutH, MutL, and MutS [Modrich & Lahue, 1996].

3.2.4 Regulators involved in the response to oxidative stress Different bacterial species often contain specific regulators in their response to oxidative stress, besides common types of regulators. The response to superoxide stress is governed by two proteins, SoxR, which is a sensor protein that detects redox stress, and SoxS, a transcriptional activator that positively regulates approximately 17 genes around the chromosome (Table 3.1) [Imlay, 2008]. The OxyR and PerR are regulators of responses to hydrogen peroxide stress [Georgiou, 2002; Imlay, 2008]. Under activating conditions, the OxyR protein binds at least 20 regulon members (Table 3.2) [Imlay, 2008], where it stimulates transcription through direct contact with RNA polymerase [Tao et al., 1993].

24 Chapter 3 Part 1 Introduction

Table 3.1 Genes induced by the SoxRS system [Imlay, 2008].

Functional classification Gene Enzyme or activity Oxidant-resistant dehydratase isozymes fumC Fumarase C acnA Aconitase A Suspected cluster repair yggX Fe/S cluster repair protein? zwf Glucose-6-phosphate dehydrogenase fpr NADPH:flavodoxin/ferredoxin oxidoreductase fldA Flavodoxin A fldB Flavodoxin B Drug efflux and/or resistance acrAB Drug efflux pump tolC OMP component of drug efflux pump micF OmpF antisense sRNA marAB Multiple antibiotic resistance operon nfnB Nitroreductase rimK Modification of ribosomal protein S6 Other nfo Endonuclease IV fur Iron-uptake regulatory protein sodA Manganese-containing superoxide dismutase ribA cGMP hydrolase

25 Chapter 3 Part 1 Introduction

Table 3.2

Members of H2O2-stress regulons [Imlay, 2008].

Role Escherichia coli OxyR Bacillus subtilis and/or Staphylococcus aureus PerR*

H2O2 scavenging AhpCF AhpCF (B.s., S.a.) Catalase G Catalase A (B.s., S.a.) Bcp (thiol peroxidase) (S.a.) Heme synthesis Ferrochetalase HemAXCDBL (B.s.) Fe-S cluster assembly SufABCDE Iron scavenging Dps MrgA (Dps) (B.s., S.a.) Ferritin (S.a.) Iron-import control Fur Fur (B.s., S.a.) Divalent cation import MntH MntABC (S.a.) ZosA (B.s.) Disulfide reduction Thioredoxin C Thioredoxin reductase (S.a.) Glutaredoxin A Glutathione reductase DsbG (periplasmic reductase) Unknown function Several Several *S.a.: Induced in Staphylococcus aureus. B.s.: Induced in Bacillus subtilis.

26 Chapter 3 Part 1 Introduction

3.2.5 Oxygen sensing during deprivation Organisms have evolved oxygen sensing systems which activate adaptive transcriptional programs during times of O2 deprivation. The activities of these transcription factors are affected not only by cellular O2 levels but also by ROS produced during hypoxia [Cash et al., 2007].

Most O2 sensors respond to the O2-dependent redox status of the cell. For example, decreased O2 levels in E. coli result in activation of the fumarate and nitrate reduction transcription factor via effects on the bound Fe-S cluster [Cash et al., 2007; Kiley & Beinert, 2003]. In parallel, the two-component ArcAB system induces transcription of adaptive genes in response to the redox state of electron carriers during hypoxic stress [Alexeeva et al., 2003; Cash et al., 2007; Unden & Schirawski, 1997]. In Rhizobia and

Bradyrhizobia, O2 deprivation results in the release of O2 from a heme moiety bound to the histidine kinase FixL which activates the transcription factor FixJ [Fischer, 1994; Gong et al., 2000].

3.3 EFFECTS OF OXYGEN ON CAMPYLOBACTERALES AND THEIR RESPONSES The four bacterial species in this study were considered to be microaerophiles; thus, the concentrations of ROS in their environment are likely to have critical effects on the growth and metabolism of these organisms.

3.3.1 Effects of oxygen on Campylobacter jejuni Campylobacter jejuni expresses several proteins involved in oxygen tolerance such as alkyl hydroperoxide reductase AhpC, ferredoxin FdxA, protease HtrA and a truncated haemoglobin Ctb [Baillon et al., 1999; Brondsted et al., 2005; van Vliet et al., 2001; Wainwright et al., 2005]. It expresses also oxygen-sensitive proteins such as L-serine dehydratase and rubredoxin oxidoreductase which contribute to the oxygen susceptibility of the bacterium [Velayudhan et al., 2004; Yamasaki et al., 2004]. A cb’-type cyanide- sensitive cytochrome oxidase plays a role in the microaerophily of C. jejuni [Jackson et al., 2006]. Microarray studies found significant transcriptome modulation in C. jejuni grown under different oxygen tensions suggesting important changes in their physiology

27 Chapter 3 Part 1 Introduction

[Gaynor et al., 2004]. Recent studies showed that addition of pyruvate to growth media decreases hydrogen peroxide levels and allows C. jejuni to grow aerobically [Verhoeff- Bakkenes et al., 2008]. Furthermore, the effect of oxidative stress was less in C. jejuni grown at 37 ºC; higher temperatures (42 ºC) combined with oxidative stress resulted in a rapid decrease in the C. jejuni population [Garénaux et al., 2008].

3.3.2 Effects of oxygen on Helicobacter pylori Since its discovery, H. pylori has been considered a microaerophile [Andersen & Wadström, 2001]. Analyses of its enzymes and metabolic pathways reveal interesting relations between H. pylori and oxygen tolerance. The presence of fumarate reductase, menaquinones, oxoacid:acceptor oxidoreductases, a terminal cbb3-type cytochrome c oxidase, as well as an unusual citric acid cycle, point to aspects of the physiology of H. pylori which are common with organisms of reduced tolerance for oxygen. Also, the bacterium can readily modulate the expression of oxidative-resistance factors as a compensatory response to the loss of a major oxidative-stress resistance component [Olczak et al., 2002].

The fact that H. pylori is not able to grow under anoxic conditions [Donelli et al., 1998; Yamaguchi et al., 1999; unpublished observations] even in the presence of additional fumarate [Kelly & Hughes, 2001], suggests that anaerobic respiration and fermentation are not sufficient to support growth of the bacterium in spite of its active fumarate reductase [Mendz et al., 1995]. The pyruvate:ferredoxin oxidoreductase (PFOR) and - ketoglutarate oxidoreductase (OOR) oxidoreductases are oxygen-sensitive essential enzymes of H. pylori which usually are found in anaerobic metabolism, but able to function under oxic conditions provided they have sufficient protection from ROS

[Hughes et al., 1998]. The cbb3-type cytochrome c oxidase of H. pylori belongs to a family of terminal oxidases often associated with microaerophilic bacteria. However, the affinity of the H. pylori enzyme for O2 (KM = 0.4 µM) is significantly lower [Nagata et al., 1996] than that of bacteria requiring microoxic conditions which have KM in the nanomolar range [D'Mello et al., 1996; Kelly et al., 2001; Unden, 1999]. Previous data

28 Chapter 3 Part 1 Introduction

confirmed that the citric acid cycle of H. pylori is atypical but may function oxidatively like that of E. coli under oxic conditions [Kather et al., 2000].

Although H. pylori can be grown under atmospheres with very different oxygen contents, there is evidence that significant changes occur in the physiology of the bacterium. In vivo H. pylori effects on the inflamed gastric mucosa were mimicked by using in vitro co- cultures of the bacterium with epithelial cells kept under a 5% O2, 5% CO2 atmosphere [Cottet et al., 2002]. These effects were not observed in systems which kept bacteria under aerobic conditions [Cottet et al., 2002; Olczak et al., 2003]. Moreover, the growth atmosphere of the bacterium has an impact on its haemolytic activity [Xia et al., 1994].

Helicobacter pylori has evolved complex molecular machinery to reduce the efficiency of oxygen-dependent host antimicrobial systems [Wang et al., 2006]. Some of its protective mechanisms are common to aerobic bacteria, but H. pylori has devised also a battery of unique strategies which play a central role in its survival and colonization of the host.

Like many other bacteria, H. pylori avoids damage from by-products of oxygen metabolism or oxidative host responses by expressing the ROS scavengers catalase (KatA) and superoxide dismutase (SodB). Most Helicobacter spp. express KatA, and the activity of this protein has been strongly related to pathogenicity. To protect cells from the damaging effects of H2O2, KatA catalyzes its decomposition into water and oxygen [Nicholls et al., 2001]. KatA is more important for survival in the presence of extracellular ROS [Basu et al., 2004] than for elimination of endogenously generated

H2O2 [Harris et al., 2002]. A catalase-associated protein (KapA) specific to H. pylori is involved also in resistance to H2O2 [Harris et al., 2002]. SodB catalyzes the dismutation of superoxide to H2O2 which is removed by catalase or peroxidase, and prevents the formation of the highly toxic RNS peroxinitrite [Nathan & Shiloh, 2000].

Helicobacter pylori acquires protection against organic peroxides through the activities of AhpC, the bacterioferritin co-migratory protein Bcp and a thioredoxin-linked peroxidase

29 Chapter 3 Part 1 Introduction

Tpx. AhpC is a thiol-peroxidase specific for hydroperoxide substrates [Baker et al., 2001], and its activity is required for normal catalase activity [Wang et al., 2004]. This enzyme protects also against RNS via its peroxinytrite reductase activity [Byrk et al., 2000]. The other two thiol-peroxidases Bcp and Tpx have important roles in preventing lipid peroxidation and unsaturated fatty acid-mediated toxicity [Wang et al., 2005].

The NADPH-quinone reductase MdaB and the neutrophil-activating protein NapA are involved in the resistance of H. pylori to oxidative stress [Evans et al., 1995; Olczak et al., 2002; Olczak et al., 2005]. H. pylori mutants with disrupted mdaB have increased sensitivity to H2O2, organic hydroperoxides and molecular oxygen [Wang & Maier, 2004]; and a napA-negative mutant resists oxidative stress less well than the wild-type [Cooksley et al., 2003].

Systems to repair damaged DNA and proteins constitute additional defenses against the deleterious effects of oxidative stress which impact on cell survival. H. pylori has proteins involved in general DNA repair such as RecA and UvrABC [Thompson & Blaser, 1995; Thompson et al., 1998], as well as proteins specific for repair of oxidative DNA damage including the endonuclease III Nth which excises lethal or mutagenic pyrimidine lesions [O'Rourke et al., 2003], the component of methyl-directed mismatch repair system MutS which inhibits DNA strand exchange [Pinto et al., 2005], and the endonuclease RuvC which repairs damage by homologous recombination [Loughlin et al., 2003].

Mechanisms to repair oxidized proteins indirectly confer cells resistance against oxidative stress, in particular methionine-rich proteins are the most sensitive to irreversible oxidation [Vogt, 1995]. The reduction of methionine sulfoxide to methionine is catalyzed by the thioredoxin-dependent methionine sulfoxide reductases MsrA and MsrB which in H. pylori are fused into one polypeptide [Alm et al., 1999]. H. pylori mutants with inactivated MsrB domain or both domains showed compromised growth under oxidative stress conditions [Alamuri & Maier, 2006].

30 Chapter 3 Part 1 Introduction

Helicobacter pylori has a low number of regulators potentially involved in the expression of antioxidant proteins. The involvement of the ferric uptake regulator Fur in Pfr, KatA and SodB expression indicates the close connection between iron homeostasis and resistance to oxidative stress [Ernst et al., 2005a; Ernst et al., 2005b; Harris et al., 2002; Waidner et al., 2002]. The post-transcriptional regulator CsrA is involved in regulating Fur and the heat shock protein regulator HspR, suggesting a regulatory hierarchy in which post-transcriptional regulation plays a major role in stress responses in H. pylori [Barnard et al., 2004]. CsrA is necessary for H. pylori full motility and survival to oxidative stress, probably by contributing to mRNA stabilization [Barnard et al., 2004].

3.3.3 Effects of oxygen on Wolinella succinogenes Wolinella succinogenes has been classified as an anaerobe by many researchers owing to its ability to grow in the absence of oxygen. Accordingly, work carried out on this bacterium has focused on anaerobic respiration pathways and the enzymes involved in them. Different types of anaerobic respiration pathways have been observed, such as nitrate respiration [Kern et al., 2007], nitrite ammonification [Simon et al., 2004], polysulfide respiration [Braatsch et al., 2002; Klimmek et al., 1998], fumarate respiration [Kröger et al., 2002], and DMSO respiration [Lorenzen et al., 1994]. Studies on the growth of W. succinogenes under limited amounts of oxygen are yet to be performed.

3.3.4 Effects of oxygen on Arcobacter butzleri Arcobacter butzleri isolated from humans and animals with diarrhoeal illness were classified as aerotolerant bacteria [Kiehlbauch et al., 1991]. The research on A. butzleri has focused on detection and isolation of the bacterium from different habitats. The effects of other environmental factors have been studied, for example, pH, temperature and NaCl concentrations modulated the growth of the bacterium [D’Sa & Harrison, 2005]. The susceptibilities of A. butzleri strains and isolates to antibiotics such as erythromycin and ciprofloxacin have been determined [Houf et al., 2004]. In addition, the toxic effects of different organic acids on the growth of the bacterium have been reported [Cervenka et al., 2004]. To date no detailed investigations of the oxygen requirement, tolerance and metabolism of A. butzleri have been performed.

31 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

CHAPTER 4:

OXYGEN REQUIREMENTS AND TOLERANCE OF CAMPYLOBACTERALES

32 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

4.1 INTRODUCTION The ability of C. jejuni to grow in vitro under atmospheres with high oxygen tensions (15-21%) [Bolton & Coates, 1983] has not been studied systematically, although growth of the bacterium under these oxic conditions has been reported in many studies. Addition of antioxidants such as superoxide dismutase, catalase, sodium dithionite or histidine to the growth media enhances significantly the survival of C. jejuni at pO2 of 17-21% [Hodge & Krieg, 1994; Hoffman et al., 1979; Juven & Rosenthal, 1985]. This increased resistance to oxygen in the presence of antioxidants suggested that the bacterium has higher susceptibility to free radicals than aerotolerant bacteria [Hoffman et al., 1979; Juven & Rosenthal, 1985].

The sensitivity of H. pylori to oxygen has been reported in a number of studies and has been debated for considerable time [Henriksen et al., 2000; Kangatharalingam & Amy, 1994]. The bacterium is equipped against oxidative stress with enzymes such as superoxide dismutase, peroxidases, and a highly active catalase [Hazell et al., 2001; Kelly et al., 2001]. At the same time, published data suggest that H. pylori may not be too sensitive to high pO2. In several laboratories H. pylori strains are grown in regular 5%-

10% CO2-air incubators, in atmospheres containing between 19% and 20% O2 [McGowan et al., 1998; Mendz et al., 1997; Rektorschek et al., 1998]. The bacterial viability of H. pylori co-cultured with macrophages in a CO2-air incubator was not affected after 24 h incubation [Gobert et al., 2001]. Similarly, there are several reports of H. pylori strains cultivated under or adapted to high oxygen tensions [Goodwin et al., 1985; Henriksen et al., 2000; Kangatharalingam & Amy, 1994; Kelly, 1998; Marcelli et al., 1996; Tompkins et al., 1994; Xia et al., 1994]. Finally, H. pylori requires oxygen in its growth atmosphere given that it is not able to grow under anoxic conditions ([Donelli et al., 1998; Yamaguchi et al., 1999] and our unpublished observations).

Wolinella succinogenes is a non-fermenting bacterium which uses anaerobic respiration and has been reported to grow in the presence of 2% oxygen [Wolin et al., 1961]. The bacterium is unable survive in growth atmospheres where oxygen levels are greater than

33 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

2-5%. Thus, W. succinogenes is either an anaerobe which tolerates small amounts of oxidative stress or a microaerophile capable of anaerobic respiration.

Studies on A. butzleri have focused on the isolation and identification of the bacterium from different sources. In addition, several studies have measured its antibiotic susceptibility, or have observed the effects of environmental factors such as temperature on the bacterium [Hilton et al., 2001]. A. butzleri is usually grown under microaerobic conditions upon isolation to ensure the sample is not lost, but it has been shown to grow anaerobically or aerobically [Cervenka et al., 2008; Lau et al., 2002]. To date there are no studies which investigate the effects of oxygen on A. butzleri, even though the bacterium has been shown to grow under varying oxygen tensions.

This chapter addresses the statuses of C. jejuni, H. pylori and A. butzleri as microaerophilic organisms by comparing the growth of several strains from each species under varying growth atmospheres. The inability of W. succinogenes to grow in conditions with high oxygen tensions excludes it from further experimentation.

4.2 EXPERIMENTAL PROCEDURES 4.2.1 Growth conditions of Campylobacter jejuni Campylobacter jejuni strains NCTC 11168 [Parkhill et al., 2000], 81116 [Palmer et al., 1983], 100 [Skirrow & Benjamin, 1980], and RM1221 [Fouts et al., 2005] were grown at

37 °C under the following atmospheres: atm.1: 6% CO2, 15% O2 in jars with gas generating CO2Gen packs; atm.2: 10% CO2, 6% O2, in jars with gas generating

CampyGen packs; and atm.3: 10% CO2, ~1% O2 in jars with gas generating AnaeroGen packs (Table 4.1). The C. jejuni strains were grown under aerobic, microaerobic or oxygen-depleted atmospheres for 18 h.

For growth experiments in liquid cultures, bacterial cells were harvested from plates and inoculated into BHI broth. Growth media were dispensed on shallow layers in vented

34 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

Table 4.1 The different atmospheres employed in this study.

Atmospheric condition* % O2 % CO2 atm.1 15 6 atm.2 6 10 atm.3 1 10 atm.4 21 5 atm.5 5 5 atm.6 20-19 5-10

* The gas balance was achieved using N2 gas.

35 Chapter 4 Oxygen requirements and tolerance of Campylobacterales culture flasks and allowed to equilibrate overnight with the appropriate atmosphere by gentle shaking. The initial densities of bacterial cultures were determined by counting the number of colony forming units (cfu ml-1) using the method of Miles and Misra [Miles & Misra, 1938]. Bacterial growth in cultures shaken gently was determined by measuring the optical density of the cell suspensions at 600 nm at 0 h and 18 h, and calculating the differences between absorbances (A600) at 18 h and 0 h. The errors on bacterial growth were calculated by determining the standard deviation from the mean of triplicate experiments. The errors are presented as percentages of the relative growth. An estimate of the accuracy of this method was obtained by measuring the changes in absorbance of growth media without bacteria. These negative controls showed changes in absorbance less than 0.005 units.

To investigate potential factors involved in causing the bactericidal effects observed under aerobic conditions, C. jejuni NCTC 11168 cells were grown in 24-well cell-culture plates with cultures separated into two compartments using Nunc 25 mm transwell inserts with 0.2 )m anapore membranes (Medos; Mt Waverley, VIC, Australia). The compartments are separated by a membrane which stops bacteria moving between them, but allows the exchange of chemical compounds, metabolites, and macromolecules. Suspensions of bacteria at different cell densities were inoculated in the inner and outer compartments. Independent control cultures were grown at the same bacterial density in each compartment.

To determine the effects of adaptation to the gas environment on bacterial growth, C. jejuni strain NCTC 11168 was cultured under atm.1 or atm.2 conditions. The bacteria were harvested and each culture was passaged again either under atm.1 or atm.2 conditions. The atmospheric conditions of the successive cultures is described as atm.1/atm.1 for bacteria passaged twice under atm.1; atm.1/atm.2 for bacteria passaged firstly under atm.1 and secondly under atm.2; etc.

The growth of C. jejuni strains 81116, 100 and RM1221 also was investigated in BHI broth cultures. Strain RM1221 was included because its genome has been sequenced and

36 Chapter 4 Oxygen requirements and tolerance of Campylobacterales published, and strains 81116 and 100 were chosen because they shared colonization properties with strains NCTC 11168 and RM1221, respectively.

4.2.2 Growth conditions of Helicobacter pylori Helicobacter pylori strains 26695, J99, N6, NCTC 11639 and SS1, and low-passage isolates BLE 107, LC 11 and LC 20 from patients with gastritis are from the University of NSW culture collection, and CAS 015, HER 126 and RIG 117 from the Université Bordeaux II collection, were grown at 37 °C for 24 h under the following atmospheres: atm.1: 6% CO2, 15% O2 in jars with gas generating CO2Gen packs; atm.2: 10% CO2, 6 %

O2, in jars with gas generating CampyGen packs; atm.4: 5% CO2, 21% O2 in a Sony Tri-

Carb incubator; atm.5: 5% CO2, 5% O2 in a Sony Tri-Carb incubator; or atm.6: 5% or

10% CO2 in air, in regular CO2 incubators (Table 4.1). The low-passage isolates used in this work have been grown always under microaerobic conditions. Some cultures of the laboratory adapted strains have been grown always under microaerobic conditions, and some under both aerobic and microaerobic atmospheres.

For growth experiments in liquid cultures bacterial cells were harvested from plates and inoculated into BHI broth supplemented with either 0.2% β-cyclodextrin [Skouloubris et al., 2001] or 10% horse serum [Mendz et al., 1997]. The growth media were dispensed on shallow layers in vented culture flasks and allowed to equilibrate with the appropriate atmosphere by gentle shaking overnight. Bacterial growth in cultures shaken gently was determined at different time points up to 60 h by either measuring the optical density of the cell suspensions at 600 nm, or counting the number of colony forming units (cfu ml-1) by the method of Miles and Misra [Miles & Misra, 1938]. Bacteria were grown also in 24-well cell-culture plates with cultures separated into two compartments using Nunc 25 mm transwell inserts with 0.2 µm anapore membranes (Medos, Mt Waverley, VIC, Australia).

4.2.3 Growth conditions of Arcobacter butzleri Arcobacter butzleri strains were grown as previously described under microaerobic conditions (atm. 2) and aerobic conditions (atm. 1).

37 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

4.3 RESULTS AND DISCUSSION 4.3.1 The oxygen requirement and tolerance of Campylobacter jejuni To determine the type of microaerophily of C. jejuni, its oxygen susceptibility and oxygen requirement were studied under an atmosphere enriched with CO2. The growth of C. jejuni strain NCTC 11168 at several cell densities was investigated in BHI broth cultures. Cultures at initial cell densities between 102 and 108 cfu ml-1 were grown under aerobic (atm.1) and microaerobic (atm.2) conditions. At cell densities higher than 107 cfu ml-1, the bacterium grew better aerobically than microaerobically (Fig. 4.1). The bacterium grew similarly under aerobic and microaerobic conditions at cell densities 105- 106 cfu ml-1 (Fig. 4.1). Finally, C. jejuni NCTC 11168 grew better microaerobically than aerobically at cell densities lower than 105 cfu ml-1. There was no bacterial growth under aerobic conditions at cell densities less than 104 cfu ml-1 (Fig. 4.1). These observations suggested that oxygen played a growth-limiting role in high-density bacterial cultures under microaerobic conditions, and was toxic in low-density cultures under aerobic conditions.

Two factors could be involved in the lack of growth observed in low-density cultures under atm.1: an insufficient population density or oxygen toxicity. Cell-to-cell signaling regulates important microbial processes such as growth, toxin production, virulence, motility, and colonization in a variety of bacteria through alterations in gene expression in response to cell density [Cloak et al., 2002]. In addition, this intercellular communication contributes to the enhanced ability of bacteria to survive environmental changes [Cloak et al., 2002]. Many Gram-negative bacteria employ such signaling; and C. jejuni produces autoinducer-2 which is a component of autoinducer quorum-sensing systems [Cloak et al., 2002]. Coordination of behaviour depends on bacterial density. In the high-density cultures under atm.1 bacteria would communicate more effectively via signaling molecules. In low-density cultures under atm.1 dilution of population density would result in inefficient interactions between bacteria. Regarding oxygen toxicity, bacteria in high-density cultures would be protected from the toxic effects of ROS by modulating oxygen concentrations in the liquid cultures. For example, studies with other

38 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

0.4

0.3

0.2

Net Growth (A600) 0.1

0 5.00E+08 5.00E+07 5.00E+06 5.00E+05 5.00E+04 5.00E+03 5.00E+02

Initial Bacterial Density (cfu/ml)

Figure 4.1 Net growth of C. jejuni NCTC 11168 at different bacterial densities under aerobic (atm.1) or microaerobic (atm.2) conditions. The histogram patterns correspond to net growth at A600 for atm.1: inclined lines; and atm.2: no pattern. The errors on bacterial growth were calculated by determining the standard deviation from the mean of triplicate experiments and presented as percentages of the relative growth.

39 Chapter 4 Oxygen requirements and tolerance of Campylobacterales organisms showed that at high bacterial densities microaerobic cultures become anaerobic [Smith et al., 1998]. Low-density bacterial cultures would not benefit from this protection.

Factors modulating bacterial growth under aerobic conditions were investigated using two-compartment cultures. Suspensions of bacteria at densities of 108 and 103 cfu ml-1 were inoculated in the inner and outer compartments, respectively. Cells grew well under the microaerobic conditions (atm.2) in all compartments and cultures. However, under aerobic conditions (atm.1) bacteria grew well in the compartments with high bacterial density cultures, but did not grow in the compartments with low bacterial density cultures. Interestingly, low-density cultures grown exchanging media with high-density cultures lost viability more slowly than low-density cultures by themselves (controls). However, the observed bacterial death depicted in Figure 4.1 could not be accounted for by effects arising from the density of bacteria in the cultures.

For C. jejuni NCTC 11168 passaged twice under atm.1 or atm.2, cells grew similarly at cell densities between 105 and 107 cfu ml-1 independently of the atmosphere of the initial culture (Fig. 4.2). Thus, the oxygen tension of the initial culture had no effect on bacterial growth. The results suggested that the failure of C. jejuni to grow at low bacterial densities under aerobic conditions was not due to the inability of the bacterium to adapt to its environment.

The growth of C. jejuni strain NCTC 11168 in liquid cultures at several cell densities was measured under oxygen limitation conditions. C. jejuni had low proliferation rates under these conditions, in agreement with previous studies of the growth of strain 11168 under microaerobic and oxygen-depleted conditions [Hodge & Krieg, 1994]. Cultures were inoculated to cell densities between 106 and 109 cfu ml-1, and grown under oxygen- depleted conditions (atm.3). At cell densities of 108 and 109 cfu ml-1, the bacteria did not grow under oxygen-depleted conditions (Fig. 4.3), but was able to grow under microaerobic conditions (Fig. 4.1). At cell densities of 106 – 107 cfu ml-1, C. jejuni was

40 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

0.35

0.3

) 0.25

0.2

0.15

0.1 Net Growth (A600 Growth Net 0.05

0 3.00E+07 3.00E+06 3.00E+05

Initial Bacterial Density (cfu/ml)

Figure 4.2 Effects of initial culture conditions on the growth of C. jejuni cells under aerobic or microaerobic conditions, as described in Materials and Methods. The histogram patterns correspond to net growth at A600 for atm.1/atm.1: horizontal lines; atm.2/atm.1: inclined lines; atm.1/ atm.2: dots; and atm.2/atm.2: no pattern. The errors on bacterial growth were calculated by determining the standard deviation from the mean of triplicate experiments and presented as percentages of the relative growth.

41 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

0.06

0.04

0.02

-0.02

-0.04 Net Growth (A600)

-0.06

-0.08

-0.1 1.00E+09 1.00E+08 1.00E+07 1.00E+06

Initial Bacterial Density (cfu/ml)

Figure 4.3 Growth of C. jejuni at different bacterial densities under oxygen-depleted conditions

(atm.3). The histogram patterns correspond to net growth at A600 for 11168: vertical lines; 100: squares; 81116: inclined lines; and RM1221: circles. The errors on bacterial growth were calculated by determining the standard deviation from the mean of triplicate experiments and presented as percentages of the relative growth.

42 Chapter 4 Oxygen requirements and tolerance of Campylobacterales able to grow both under oxygen-depleted and microaerobic conditions supporting the view that oxygen played a limiting role in the growth of the denser cultures (Fig. 4.3), and providing evidence of the essential requirement for oxygen of the bacterium.

Cultures of strains 81116, 100 and RM1221 at initial cell densities between 102 and 108 cfu ml-1 were grown under aerobic (atm.1) and microaerobic conditions (atm.2). At cell densities 107 - 108 cfu ml-1, the three strains showed similar results to those of strain NCTC 11168. At lower cell densities, the three C. jejuni strains grew better microaerobically than aerobically. No aerobic bacterial growth was recorded at cell densities under 3 x 106 cfu ml-1 for strain RM1221, 1 x 106 cfu ml-1 for strain 81116, and 5 x 105 cfu ml-1 for strain 100.

The oxygen requirements of C. jejuni strains 81116, 100 and RM1221 were investigated by growing these cultures at cell densities 106 – 109 cfu ml-1 in BHI broth under oxygen- depleted conditions (atm.3). At cell densities 108 - 109 cfu ml-1, the bacteria did not grow, but at cell densities of 107 cfu ml-1 and lower, the bacteria were able to grow under oxygen-depleted conditions (Fig. 4.3). These results suggested that the four C. jejuni strains had similar oxygen requirements. The results indicated overall similar effects on the growth of the four strains of the oxygen tension in the atmosphere, with some strain- specific differences.

Two important factors in the general physiology of a bacterium are its oxygen requirement and the tolerance to the resulting metabolic products. This study demonstrated that C. jejuni is an obligate microaerophile. Nonetheless, at high cell densities the bacterium was able to grow in vitro in atmospheres with oxygen concentrations between 5 and 19%, with some variations between strains. The ability to proliferate under oxygen-depleted conditions reflects colonization capabilities in the oxygen-limited environment of the intestine.

It is important to understand that C. jejuni strains have different oxygen tolerances that could result in phenotypic and physiological differences even when they are grown under

43 Chapter 4 Oxygen requirements and tolerance of Campylobacterales the same conditions. These variations could in turn modulate the outcome of experiments, and may explain observed discrepancies in results between C. jejuni strains.

4.3.2 The oxygen requirement and tolerance of Helicobacter pylori Five strains and six isolates of H. pylori showed similar growth on CSA plates after 24 h incubation under the microaerobic and aerobic conditions atm.2 and atm.6, respectively (Table 4.1). H. pylori strains and isolates were grown at 37 ºC in BHI broth supplemented with 10% horse serum under conditions atm.4 and atm.5. Bacterial growth in the cultures was determined at 0, 4, 8, 12, 18, and 24 h by counting the number of colony-forming units at each time point. The strains and isolates grew similarly under both atmospheres; and in the absence of CO2 no growth was observed under the same oxygen tensions (data not shown). The experiments were repeated three times with qualitatively the same results. Figure 4.4 shows the data corresponding to one such experiment for strains J99, LC11 and LC20.

Helicobacter pylori strains 26695, SS1 and N6 were grown at 37 °C in BHI liquid medium supplemented with 0.2% β-cyclodextrin in jars under the conditions atm.1 and atm.2. Cell growth in the cultures was determined at 0, 5, 10, 15, 24 and 50 h, by measuring the optical density of the cell suspensions at 600 nm. The experiments were repeated at least three times with independent cell cultures. Similar growth curves were obtained for each strain under the two different atmospheres when cultures were inoculated at high density (0.1-0.2 OD at 600 nm, approximately to 5x107 to 108 cfu ml-1) (Fig. 4.5). The cells from cultures under different atmospheres did not show differences in the bacterial morphology or in the evolution towards coccoid forms as determined by optic or electron microscopy. Strain 26695 was grown also in BHI medium adjusted to pH 5 under the conditions atm.1 and atm.2, and comparable growth was observed under both conditions (data not shown).

The growth of H. pylori strain 26695 at lower cell densities was investigated in BHI broth cultures supplemented with 0.2% β-cyclodextrin. Cultures were inoculated to cell

44 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

Microoxic atmosphere Oxic atmosphere Log (cfu / ml) enriched with CO2 Log (cfu / ml) enriched with CO2

8 8

7 7

H. pylori strains : J99 J99 LC11 LC11 6 LC206 LC20 0102030 0 102030

Time Time

Figure 4.4 Growth curves of H. pylori J99 strain and LC11 and LC20 clinical isolates cultured under microaerophilic or aerobic atmospheres with CO2 in liquid medium supplemented with horse serum. Bacteria were incubated at 37 ºC in BHI broth with

10% horse serum in a Sony Tri-Carb incubator under aerobic (5% CO2, 21% O2) and microaerobic conditions (5% CO2, 5% O2) as described in the Experimental Procedures section.

45 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

Microoxic atmosphere Oxic atmosphere enriched with CO2 enriched with CO2 OD OD 600nm 600nm 5 5

1 1

H. pylori strains SS1

26695

0.1 0.1 N6 0 12345 0 123 45

Time Time

Figure 4.5 Growth curves of H. pylori laboratory strains SS1, 26695 and N6 cultured under microaerophilic or aerobic atmospheres with CO2 in liquid medium supplemented with βββ-cyclodextrin. Strains were cultivated at neutral pH in BHI liquid medium containing 0.2% β-cyclodextrin. The inoculums of the cultures were started at 0.1-0.2 OD at 600 nm (corresponding to approximately to 5x107-108 cfu ml-1). The microaerophilic atmosphere was generated with CampyGen gas packs (10% CO2, 7% O2). The aerobic atmosphere with CO2 was generated with CO2Gen gas packs (6% CO2, 15% O2). Errors are shown as standard deviations of the measurements. Curves are representative of five experiments for SS1, three experiments for 26695 and two experiments for N6.

46 Chapter 4 Oxygen requirements and tolerance of Campylobacterales densities of approximately 107 cfu ml-1 (0.03 OD at 600 nm in this medium), and grown under the conditions atm.1 and atm.2. The bacteria grew well microaerobically but did not grow under aerobic conditions (Fig. 4.6). In media supplemented with 10% horse serum instead of 0.2% β-cyclodextrin, bacterial cells grew under the atm.6 aerobic conditions at cells densities of approximately 5x105 cfu ml-1 but were unable to grow under this atmosphere at lower densities (data not shown).

Factors modulating bacterial growth under aerobic conditions were investigated using two-compartment cultures. Suspensions of bacteria at densities of 108 and 103 cfu ml-1 were inoculated in the inner and outer compartments, respectively. Independent control cultures were carried out at both bacterial densities. Cells grew well under the microaerobic atm.5 conditions in all compartments and cultures. Under the aerobic atm.6 conditions, bacteria grew well in the compartments and cultures with high bacterial densities, but did not grow in the compartments and cultures with low bacterial densities.

To circumvent potential artifacts owing to the presence of membranes separating the cultures, H. pylori was grown in broth constituted by adding fresh nutrients to media in which bacteria had already been grown. Cells grown under the atm.6 conditions for 48 h at densities of 108 cfu ml-1 in BHI with 10% horse serum were removed from the media by centrifuging the cultures, collecting the supernatant, and filtering it through a 0.22 µm membrane. The cell-free supernatant was supplemented with fresh media (3:1, v/v) constituted at four times the normal concentration, such that the final concentration of nutrients was at least equal to that of standard cultures. Bacteria were inoculated into this ‘recycled media’ at densities of 103 or 108 cfu ml-1 and grown under the microaerobic atm.5 or aerobic atm.6 conditions. To control for potential artifacts arising from employing used media, bacteria were grown also in media constituted in a similar way as the ‘recycled media’, but in which the fraction corresponding to cell-free supernatants was substituted by fresh media. Cells grew in all cultures incubated under microaerobic conditions and the recycled media did not have any effect on growth. Under aerobic conditions bacteria grew at high density cell cultures, and did not grow at low cell density cultures.

47 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

OD600 nm

0.8

1st Microaerobic culture 0.6 2nd Microaerobic culture

1st Aerobic culture

0.4 2nd Aerobic culture

0.2

0 0102030405060

Time (h)

Figure 4.6 Growth curves of H. pylori strain 26695 cultured under microaerophilic or aerobic atmospheres with CO2 in liquid medium supplemented with βββ-cyclodextrin. Bacteria were cultivated at neutral pH in BHI liquid medium containing 0.2% β-cyclodextrin. The inoculums of the cultures were started at 0.03-0.035 OD at 600 nm (corresponding to approximately to 107 cfu ml-1). The microaerophilic atmosphere was generated with

CampyGen gas packs (10% CO2, 7% O2). The aerobic atmosphere with CO2 was generated with CO2Gen gas packs (6% CO2, 15% O2). Errors are shown as standard deviations of the measurements.

48 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

Thus, it has been demonstrated that H. pylori is a microaerophile, which under elevated

CO2 conditions and high cell densities is able to grow in vitro in atmospheres with oxygen concentrations between 5 and 21%. Considering the relatively small genome of H. pylori, it is of great interest to elucidate how this bacterium manages to adapt to the different oxygen tensions it may encounter until it reaches the mucosa of the human stomach.

4.3.3 The oxygen requirement and tolerance of Arcobacter butzleri To determine the type of microaerophily of A. butzleri, its oxygen susceptibility was studied under an atmosphere enriched with CO2. The growth of A. butzleri strain NC97 at several cell densities was investigated in BHI broth cultures. Cultures at initial cell densities between 102 and 1010 cfu ml-1 were grown under aerobic (atm.1) and microaerobic (atm.2) conditions. At cell densities higher than 107 cfu ml-1, the bacterium grew similarly under aerobic and microaerobic conditions (Fig. 4.7). The bacterium grew grew better aerobically than microaerobically at cell densities 104-106 cfu ml-1 (Fig. 4.7). Finally, A. butzleri NC97 once again grew similarly under aerobic and microaerobic conditions at cell densities lower than 104 cfu ml-1. These observations suggested that oxygen did not play a growth-limiting role and was not toxic at any bacterial density. These interpretations combined with the ability of A. butzleri to grow under anaerobic conditions suggest the bacterium is an aerobe that does not require oxygen, which may explain how this species survives many different habitats.

4.4 CONCLUSION In conclusion, C. jejuni and H. pylori are obligate microaerobes which require oxygen; W. succinogenes is either an anaerobe which tolerates small amounts of oxidative stress or a microaerophile capable of anaerobic respiration; A. butzleri is an aerobe that does not require oxygen, or in other terms, a facultative anaerobe (Table 4.2).

49 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

0.8

0.7

0.6 )

0.5

0.4

0.3 Net Growth(A600 0.2

0.1

0 1.00E+10 1.00E+09 1.00E+08 1.00E+07 1.00E+06 1.00E+05 1.00E+04 1.00E+03 1.00E+02

Initial Bacterial Density (cfu/ml)

Figure 4.7 Net growth of A. butzleri NC97 at different bacterial densities under aerobic (atm.1) or microaerobic (atm.2) conditions, as described in Experimental Procedures. The histogram patterns correspond to net growth at A600 for atm.1: inclined lines; and atm.2: no pattern. The errors on bacterial growth were calculated by determining the standard deviation from the mean of triplicate experiments and presented as percentages of the relative growth.

50 Chapter 4 Oxygen requirements and tolerance of Campylobacterales

Table 4.2 Oxygen requirements and tolerance of the four Campylobacterales species.

Species Oxygen tolerance Oxygen requirement

Campylobacter jejuni Obligate microaerobe Yes

Helicobacter pylori Obligate microaerobe Yes

Wolinella succinogenes Anaerobe* No

Arcobacter butzleri Aerobe No

* W. succinogenes is capable of growth under low oxygen tensions in the atmosphere.

51 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

CHAPTER 5:

MOLECULAR RESPONSES OF CAMPYLOBACTERALES TO OXIDATIVE STRESS

52 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

5.1 INTRODUCTION Although the oxygen requirement and tolerance of C. jejuni and H. pylori were examined closely, the molecular basis of their microaerophily is not understood completely. W. succinogenes possesses the machinery to employ both oxidative phosphorylation and anaerobic respiration. There is no direct data which serve to classify this bacterium into one of the five major groups mentioned previously; thus, whether it is a microaerophile capable of surviving anaerobically or an aerotolerant anaerobe is yet to be determined. In addition, there is no explanation why W. succinogenes is unable to survive in atmospheres above 2-5% O2 [Wolin et al., 1961].

The Campylobacterales have diverse habitats but are genetically related [Eppinger et al., 2004]. Comparative analyses of their responses to stresses would help to identify shared responses and serve to understand better this diverse order of bacteria. Oxygen plays an important role in the metabolism of these bacteria, and is involved in many of their cellular processes; thus, global analyses of their adaptation to various oxygen tensions will provide insights into their microaerophily. In this study, the effects of different oxygen tensions on the transcriptomes of C. jejuni, H. pylori and W. succinogenes were characterised, and their responses were compared to elucidate similarities and differences between the three species. The microarray experimental work was performed by collaborators in different laboratories (see Section 5.2); subsequent data analyses were performed in our laboratory. At the time of this study no microarrays were available for A. butzleri; thus, this chapter focused on C. jejuni, H. pylori and W. succinogenes.

5.2 EXPERIMENTAL PROCEDURES 5.2.1 Bacterial strains and growth conditions The growth conditions of C. jejuni strain NCTC 11168 have been reported by Gaynor et al. [2004]. The bacterium was grown under microaerobic (7.5% O2) or oxygen-depleted

(1% O2) conditions. H. pylori strain 26695 was grown as previously described. Liquid cultures at initial densities of 107 cfu ml-1 were incubated at 37 °C under microaerobic

(5% O2) and aerobic (21% O2) conditions. W. succinogenes strain DSMZ 1740 was grown also as previously described; cultures were incubated at 37 °C under anaerobic

53 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

(0% O2) or microaerobic (1% O2) conditions. A summary of the oxygen tensions in the growth conditions of the bacterial species is provided in Table 5.1.

5.2.2 RNA extraction and Microarrays Microarray data for C. jejuni were obtained from the Stanford MicroArray Database (SMD) available at (http://genome-www5.stanford.edu/) and from the study of Gaynor et al. [2004]. Total RNA was isolated from H. pylori cells incubated for 0, 4.5, 9, 14 and 24 h using the TRIzol® Reagent method following the manufacturer’s instructions (Invitrogen Life Technologies Inc.). RNA quality and quantity were determined with an ND-1000 NanoDrop® spectrophotometer (NanoDrop Technologies Inc.; Wilmington, DE, USA), and the A260/A280 ratios determined were 1.8–2.2. H. pylori microarrays were obtained under similar protocols found in Thompson et al. [2003], and are also available from the SMD. W. succinogenes microarray experiments were performed using Geniom®One available from febit (Heidelberg, Baden-Württemberg, Germany), and were kindly provided to us by Dr. Claudia Baar (Max Planck Institute for Developmental Biology, Tübingen, Germany). The transformed microarray data were analyzed with the CLUSTER software [Eisen et al., 1998], and the results were displayed using the TREEVIEW software [Saldanha, 2004]. Only spots which contained data for > 80% of the arrays were used.

The measure of accuracy of the microarray data was obtained by calculating the total transcription under each oxygen condition. A measure of the significance for regulated genes was determined by calculating the relative expression of house-keeping genes of each species.

5.2.3 Bioinformatics Bioinformatics analyses were performed as previously described. The MicrobesOnline website available at (www.microbesonline.org) was employed to determine the predicted operons and regulons in which the genes are found. In this analysis, operons with 50% or more of their genes regulated were chosen as significantly regulated operons.

54 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Table 5.1 The different oxygen tensions in the growth atmospheres employed in this study.

Bacterial species Low (% O2) High (% O2)

Campylobacter jejuni 1 7.5

Helicobacter pylori 5 21

Wolinella succinogenes 0 1

55 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

5.3 RESULTS AND DISCUSSION 5.3.1 Degree of significance of the microarray data The total transcript measured in the arrays under each oxygen condition should be equal because equal amounts of cDNA are used for each bacterium. The relative difference in absolute transcription between the two conditions for each bacterium provided a measure of accuracy of the data. These differences amounted to 4% for C. jejuni, 4% for H. pylori and 40% for W. succinogenes. With a larger number of repeats replicates, the C. jejuni and H. pylori results were more reliable than the W. succinogenes results.

To obtain a threshold for the significance of gene regulation, the relative expression of house-keeping genes were calculated. The house-keeping genes were selected from studies on C. jejuni and H. pylori [Achtman et al., 1999; Dingle et al., 2001]. The genes were aspA, glnA, gltA, glyA, pgm, tkt and uncA for C. jejuni; and atpA, efp, mutY, ppA, trpC, ureI, yphC for H. pylori. No studies identifying house-keeping genes have been published on W. succinogenes, thus homologs of C. jejuni and H. pylori house-keeping genes were chosen as a reference set of genes. These homologs were the genes, ws0085, ws0514, ws0662, ws0745, ws1279, ws1453, ws1784, ws1912, ws2039 and ws2124. For each bacterium, the mean of the absolute expression of all the house-keeping genes was taken for each oxygen condition and the relative change was determined to be the threshold of significance. The results from these analyses yielded 30% variation in expression of the house-keeping genes for C. jejuni, 20% for H. pylori and 50% for W. succinogenes. From these thresholds, genes whose relative expression were modulated greater than 1.5-fold and lower than 0.67-fold were considered significantly regulated under higher oxygen tensions for the three bacteria.

The transcriptomic data were analyzed to determine genes which were downregulated or upregulated at higher oxygen tensions in each of the species. In C. jejuni, 158 genes were upregulated and 46 were downregulated; in H. pylori, there were 58 and 40 genes, respectively; and in W. succinogenes, the numbers of genes were 82 and 65, respectively. The lists of these genes are provided in the supplementary tables S5.1, S5.2 and S5.3. In the three species, the number of upregulated genes at higher oxygen tensions was larger

56 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

than the number of genes downregulated, suggesting that at higher oxygen levels more components of their metabolic machinery were activated to survive and proliferate.

The responses of each of the three bacteria to an increase in oxygen in the growth atmosphere were then studied in greater detail to perform comparisons between their adaptation mechanisms.

5.3.2 Transcriptome regulation in Campylobacter jejuni The ensembles of upregulated and downregulated genes were analyzed using the functional classification tool in DAVID to group the genes according to their functions. Under higher oxygen tensions, C. jejuni genes involved in protein biosynthesis, chemotaxis, transmembrane transport, transfer of amino groups, generation of precursor metabolites and energy, ribosomal/redox were upregulated as well as genes encoding enzymes and proteins of oxygen metabolism such as alkyl hydroperoxide reductase, - ketoglutarate oxidoreductase, and flavodoxin (Table 5.2). Genes participating in flagellar assembly and nitrogen metabolism were downregulated (Table 5.2); e.g. genes encoding a periplasmic nitrate reductase, a putative helicase, and an MdaB protein homolog.

The functional relatedness established using DAVID did not assign all the genes to specific functional categories. Therefore, the genes were analyzed individually using the KEGG pathways. The analyses revealed that genes whose expression was modulated at higher oxygen tensions belonged to several biochemical pathways. Upregulated genes encoded proteins of purine metabolism, oxidative phosphorylation, citrate cycle and ribosome-related processes (Table 5.2). Downregulated genes encoded flagellar assembly proteins, ATPases and ABC transporters (Table 5.2). A total of 68 genes were not classified using KEGG. To help in assigning biological roles to proteins encoded by these genes, they were analyzed for predicted operons and regulons.

The regulated genes were assigned to their predicted operons using the MicrobesOnline database. The criterion employed was that operons were considered regulated if 50% or more of their genes were modulated by the change in oxygen tension. Likewise, regulons

57 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Table 5.2 Functional categories and biochemical pathways regulated under higher oxygen tensions in the three species of Campylobacterales. The categories and pathways were identified using DAVID, KEGG and the MicrobesOnline database.

Species Regulation Method Functional category or pathway C. jejuni Upregulated DAVID Protein biosynthesis Chemotaxis Transmembrane transport Aminotransferases Generation of precursor metabolites and energy Ribosomal and redox KEGG Purine metabolism Oxidative phosphorylation Ribosome Citrate cycle MicrobesOnline Purine metabolism Oxidative phosphorylation Ribosome Fatty acid biosynthesis Downregulated DAVID Flagellar assembly and cell motility Nitrogen metabolism KEGG Flagellar assembly ATPases ABC transporters MicrobesOnline Flagellar assembly

H. pylori Upregulated DAVID Protein biosynthesis Nucleic acid metabolism Establishment of localization Generation of precursor metabolites and energy Redox KEGG Oxidative phosphorylation Protein folding and associated processing Pentose phosphate pathway MicrobesOnline Nucleic acid metabolism Oxidative phosphorylation Pentose phosphate pathway Downregulated DAVID Nucleotide binding (DNA-related) KEGG Protein folding and associated processing MicrobesOnline -

W. succinogenes Upregulated DAVID Nucleic acid metabolism Generation of precursor metabolites and energy Ribosomal and Redox KEGG Flagellar assembly Ribosome Protein folding and associated processing MicrobesOnline Nucleic acid metabolism Ribosome Flagellar assembly

58 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Table 5.2 - continued

Species Regulation Method Functional category or pathway Downregulated DAVID Chemotaxis Establishment of localization KEGG Glycine, serine and threonine metabolism ABC transporters MicrobesOnline Transport

59 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

with a significant number of regulated operons were considered to respond to variations in the oxygen tension. Regulons found to be upregulated were purine metabolism, ribosomal processes, oxidative phosphorylation and fatty acid biosynthesis (Table 5.2). The regulon downregulated at higher oxygen tensions was that of flagellar assembly (Table 5.2, Fig. 5.1).

Reactive oxygen species are capable of causing DNA and protein damage, for example oxidative deamination [Ozben, 2007]. The upregulation of nucleic acid metabolism in the form of purine metabolism suggested an increase in nucleic acids which in turn may facilitate the repair of damaged DNA. Generation of precursor metabolites and energy refers to the synthesis from simpler components of metabolites used as energy sources, and the processes involved in the liberation of energy from these compounds [Dennis et al., 2003]. The upregulation of this functional group indicated that the bacterium required more metabolic energy at higher oxygen tensions. Two possible reasons for this extra energy requirement could be to combat the effect of ROS, and/or to increase energy- requiring synthetic processes, for example, upregulation of protein biosynthesis and ribosome-related translation processes. These analyses suggested that at higher oxygen tensions the bacteria were assembling more protein, and thus required more energy in the form of ATP. The upregulation of genes encoding aminotransferases, which are central to the production of various amino acids, supported the interpretation that at higher oxygen tensions C. jejuni assembled proteins at a higher rate. The upregulation of redox processes under higher oxygen tensions would support also the interpretation that an increase in energy was required to combat the effect of an increase in ROS.

The upregulation of specific metabolic pathways that generate chemical energy provided further evidence of an increased energy requirement by the cells. Oxidative phosphorylation generates stores of chemical energy and requires oxygen as a terminal acceptor [Haddock & Jones, 1977]. The increased availability of oxygen and the preference of oxidative phosphorylation by many bacteria [Haddock & Jones, 1977] would allow for a greater use of oxidative phosphorylation, and possibly the downregulation of nitrogen metabolism as a form of obtaining high-energy metabolites.

60 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

cj0040-cj0043

cj0697-cj0698 cj0525c-cj0528c

* cj0687c cj1462-cj1463 cj1639-cj1649

cj0855-cj0856

* cj0798c-cj0803

cj1362-cj1363

Figure 5.1 The flagellar assembly regulon downregulated in C. jejuni grown under higher oxygen tensions. The genes in the predicted operons are given by their ORF number in the genome of C. jejuni strain NCTC 11168 and enclosed by an oval without an asterix are significantly regulated, that is more of their genes are regulated.

61 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Moreover, the citrate cycle which also generates chemical energy was upregulated too. These results provided an understanding of the energy-generating pathways preferred by C. jejuni under high oxygen tensions. A greater energy requirement could be accommodated also in other ways. For example, non-essential processes which consume energy could be downregulated. This could explain the downregulation of ABC transporters and some ATPases which are linked to membrane transport.

Obligate aerobes have a strong positive aerotaxis, microaerophiles are attracted by low oxygen concentrations and repelled by high oxygen levels and anaerobic conditions, and obligate anaerobes are strictly repulsed by oxygen [Grishanin & Bibikov, 1997]. C. jejuni is a microaerophile and the upregulation of chemotaxis at the higher oxygen tension may reflect its choice of microaerobic conditions in preference to quasi-anaerobic conditions. In addition, oxidases serve as primary receptors for oxygen, a characteristic that relates aerotaxis to oxidative phosphorylation [Haddock & Jones, 1977]; thus, in C. jejuni the upregulation of oxidative phosphorylation and chemotaxis appeared to be directly related. This behaviour by C. jejuni provided evidence to identify its preferred growth environment, which is discussed below in more detail.

5.3.3 Transcriptome regulation in Helicobacter pylori The results of the microarray analyses performed on H. pylori yielded 58 upregulated and 40 downregulated genes at higher oxygen tensions. Examples of upregulated genes were those encoding alkyl hydroperoxide reductase, thioredoxin, thioredoxin reductase, and superoxide dismutase; examples of genes downregulated were those encoding ketol-acid reductoisomerase and lipopolysaccharide biosynthesis protein. The two sets of regulated genes were analyzed using the functional classification tool in DAVID. Under an atmosphere with higher oxygen tensions, genes functionally involved in protein biosynthesis, nucleic acid metabolism, establishment of localization, generation of precursor metabolites and energy, and redox processes were upregulated (Table 5.2). A group of downregulated genes was functionally classified as nucleotide-binding/DNA- related (Table 5.2).

62 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Similarly to the analysis performed with C. jejuni genes, functional classification using DAVID did not assign all the genes to specific functional categories. Hence, the genes were analyzed individually using the KEGG pathways. Genes coding for proteins participating in oxidative phosphorylation, protein folding and associated processing, and the pentose phosphate pathway were upregulated (Table 5.2). Downregulated under higher oxygen tensions were genes encoding some of the proteins participating in protein folding and associated processing (Table 5.2). A total of 41 genes were not classified using the KEGG library, thus the lists of genes were analyzed for predicted operons and regulons employing the same criteria as described before. Regulons found to be upregulated were those participating in nucleic acid metabolism, oxidative phosphorylation, protein folding and associated processing and the pentose phosphate pathway (Table 5.2). No regulon was found to be downregulated.

Genes coding for tRNA synthetases which participate in protein biosynthesis and nucleic acid metabolism were upregulated. Protein synthesis is not limited by the activity of tRNA synthetases, but the upregulation of these enzymes would indicate that the bacterium was synthesizing more proteins. The function ‘establishment of localization’ refers to the directed movement of a macromolecule or cellular entity, such as a protein complex or organelle, to a specific location. Upregulation of genes participating in this process suggested an increase in synthesized protein.

The requirement to upregulate nucleic acid metabolism could be attributed in part to the DNA damage caused by ROS, as was the case of C. jejuni. Evidence supporting this interpretation was that a group of nucleotide-binding/DNA-related genes were downregulated in H. pylori. These genes encode mostly restriction enzymes responsible for DNA cleavage. The upregulation of ‘generation of precursor metabolites and energy’ indicated that the bacterium also required more energy at higher oxygen tensions. Similarly to C. jejuni, the increase in available oxygen and the preference for aerobic respiration of many bacteria [Haddock & Jones, 1977] could explain the upregulation by H. pylori of oxidative phosphorylation.

63 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

The pentose phosphate pathway generates NADPH which serves for biosynthesis and to counteract oxidative stress in bacteria [Singh et al., 2007]. Upregulation of genes coding for proteins of this pathway suggested that H. pylori may use this metabolite to adapt to an increase in oxidative stress caused by increased generation of ROS. The modulation of genes encoding proteins involved in redox processes provided further evidence supporting the presence of an antioxidant response of H. pylori to increased oxygen tensions in the growth atmosphere. Finally, some genes encoding proteins connected with protein folding and associated processing were found to be upregulated and others were downregulated. The encoded proteins are involved in a diverse set of metabolic reactions connected to different cellular functions. For example, genes classified in this category encode heat shock proteins, molecular chaperones, hydrogenase formation/expression proteins, urease accessory proteins, and thioredoxin. Thus, this diversity makes possible a dual regulation of this functional group.

5.3.4 Transcriptome regulation in Wolinella succinogenes Analyses of the results of microarray experiments performed on W. succinogenes gave 82 upregulated and 65 downregulated genes at higher oxygen tensions. Examples of upregulated genes were those encoding alkyl hydroperoxide reductase, aldehyde oxidoreductase, ferredoxin and cysteine synthase, while the genes coding for molybdopterin oxidoreductase and acyl-CoA dehydrogenase were downregulated. The two sets of regulated genes were analyzed using the functional classification tool in DAVID. Under higher oxygen tensions, groups of genes related to nucleic acid metabolism, generation of precursor metabolites and energy, and ribosomal/redox functions were upregulated (Table 5.2). Groups of genes involved in chemotaxis and the establishment of localization were downregulated (Table 5.2).

Similarly to the analyses of C. jejuni and H. pylori, the classification using DAVID did not assign all the genes to functional categories. Therefore, the genes were analyzed individually using the KEGG pathways. The results showed that the flagellar assembly, ribosome-related processes and protein folding and associated processing were upregulated (Table 5.2). On the other hand, glycine, serine and threonine metabolism and

64 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

ABC transporters were downregulated (Table 5.2). A total of 69 genes were not classified using the KEGG library, thus the genes were analyzed for predicted operons and regulons. Regulons found to be upregulated were nucleic acid metabolism, ribosomal processes and flagellar assembly (Table 5.2). A regulon involved in general transport was downregulated (Table 5.2).

Generally, the responses of W. succinogenes to higher oxygen tensions were similar to those of the other two bacteria. The upregulation of the ribosomal processes of translation and nucleic acid metabolism suggested an increased protein assembly and DNA repair. Like C. jejuni and H. pylori, the increase in requirement for energy was characterized by the upregulation of ‘generation of precursor metabolites and energy’. Similarly to the case of C. jejuni, the utilization of ATP by ABC transporters could have led to the downregulation of the transcription of genes encoding them, in order to save in energy expenditure.

The upregulation of ribosomal processes in W. succinogenes and protein synthesis in the other two bacterial species suggested that amino acids were required for biosynthesis and less utilized for the production of energy; thus, for example utilization of serine and threonine could shift to protein biosynthesis. Worth noticing is that these two amino acids are required as building blocks for CXXS and CXXT redox motifs in disulfide reductases [Fomenko & Gladyshev, 2003]. The bacteria grown under higher oxygen tensions upregulated processes involved in cellular redox balance, and consequently may require serine and threonine to generate reductases containing these motifs. A decrease in the catabolism of amino acids would result in smaller concentrations of intermediates and thus, less compounds to drive accessory branches of amino acid metabolism. Closer inspection of the genes downregulated in the glycine, serine and threonine metabolism pathways showed that three of these genes are involved in ectoine biosynthesis. Ectoine serves to stabilize proteins and other cellular structures and is employed by many halophilic microorganisms for protection against salt and temperature stress [Klein et al., 2007]. The downregulation of ectoine biosynthesis suggested that W. succinogenes adaptation to oxygen is different from the responses to salt or temperature stress. The two

65 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

main enzymes involved in the glycine, serine and threonine catabolism are serine dehydratase (SDHase) and threonine dehydratase (TDHase). Unlike H. pylori which encodes SDHase and not TDHase and C. jejuni which encodes both enzymes, W. succinogenes encodes TDHase and not SDHase. The differences between catabolic enzymes of these amino acids in the three species could explain that the downregulation of glycine, serine and threonine metabolism was found only in W. succinogenes.

Since its discovery W. succinogenes has been classified either as an anaerobe capable of surviving at low oxygen concentrations or a microaerophile capable of surviving under anaerobic conditions. The upregulation of genes encoding the flagellar assembly suggested that bacteria grown under higher oxygen tensions would be more motile. This phenotypic characteristic will serve to avoid potential stresses posed by oxygen. Obligate microaerophiles are attracted by low oxygen concentrations and repelled by both aerobic and anaerobic conditions, whereas obligate anaerobes are strictly repelled by oxygen [Grishanin & Bibikov, 1997]. The downregulation of chemotaxis in W. succinogenes at higher oxygen tensions suggested that the bacterium exhibited negative aerotactic behavior by avoiding oxygen. These responses by W. succinogenes provided insights into its preferred environment, as discussed below.

5.3.5 Comparative analyses of responses to higher oxygen conditions Searches for protein homologs employed the criterion of having sequence similarities greater than 50%, and were performed on the predicted proteins of regulated genes to identify those common to all three species. The only regulated gene common to the three Campylobacterales was ahpC encoding alkyl hydroperoxide reductase which was upregulated at higher oxygen tensions. A common response in the three species was the upregulation of genes encoding proteins involved in cellular redox balance (Table 5.3). In these microaerophilic bacteria redox processes play an important role in their survival and in the control of major aspects of their physiology such as virulence [Miki et al., 2004; Wang et al., 2006]. For this reason, some therapies against microaerophilic bacteria consist of drugs which target redox processes [Kohanski et al., 2007].

66 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Table 5.3 Genes encoding proteins with a predicted function in maintaining cellular redox balance which are upregulated at higher oxygen tensions in the three species of Campylobacterales.

Species ORF Gene Name Protein Name H. pylori hp0147 fixP Cytochrome C oxidase hp0389 sodB Superoxide dismutase hp0824 trxA1 Thioredoxin hp0825 trxB1 Thioredoxin reductase hp1267-hp1268 nqo8 NADH oxidoreductase I hp1452 tdhF Thiophene & furan oxidiser hp1563 ahpC Alkyl hydroperoxide reductase

C. jejuni cj0169 sodB Superoxide dismutase cj0239c nifU NifU protein homolog cj0334 ahpC Alkyl hydroperoxide reductase cj0354c fdxB Putative ferredoxin cj0414 - Putative oxidoreductase subunit cj0415 - Putative oxidoreductase subunit cj0535-cj0538 oorABCD 2-oxoglutarate oxidoreductase cj0779 tpx Thiol peroxidase cj1184c-cj1186c petC Putative ubiquinol-cytochrome C reductase cj1382c fldA Flavodoxin cj1476c - Pyruvate-flavodoxin oxidoreductase cj1487c-cj1490c ccoP Cb-type cytochrome C oxidase cj1568c-cj1571c nuoL NADH dehydrogenase I

W. succinogenes ws0116 fdhA Thiosulfate reductase ws0395 glnH Aldehyde oxidoreductase ws0708 - Pentaheme cytochrome ws0970 nrfH Cytochrome C nitrite reductase ws1143 fdxB Putative ferredoxin ws1433 - Putative oxidoreductase component ws1744 ahpC Alkyl hydroperoxide reductase ws1849 - Dimethyl sulfoxide reductase precursor ws1850 - Putative cytochrome C-type haem binding protein ws1911 fdxA Ferredoxin ws1995 ahpC Alkyl hydroperoxide reductase subunit C ws2205 nifU NifU-like protein

67 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

Other functions regulated in response to higher oxygen tensions shared by C. jejuni, H. pylori and W. succinogenes were nucleic acid metabolism and generation of precursor metabolites and energy. The upregulation of these two processes in each of the three species was attributed to higher requirements of DNA repair and of energy. In C. jejuni and W. succinogenes downregulation of the transcription of genes encoding ABC and ion-coupled transporters was attributed to the possible aim of conserving energy by the bacteria.

Oxidative phosphorylation was upregulated in C. jejuni and H. pylori but not in W. succinogenes indicating a preference for this form of energy-generation by the former two bacteria. The finding corresponds to the responses expected for microaerophiles such as C. jejuni and H. pylori. W. succinogenes has several pathways for anaerobic respiration, and may prefer to use them instead of oxidative phosphorylation even in the presense of low oxygen tensions. The motility and chemotactic responses of W. succinogenes were opposite to those of C. jejuni, in accordance to the preferred oxygen levels of each bacterium, less that 2% for W. succinogenes and 5-10% for C. jejuni. The lower oxygen tensions suited better W. succinogenes and the higher oxygen tensions suited better C. jejuni. These findings supported the microaerophilic nature of C. jejuni, and suggested that W. succinogenes may not be a microaerophile but an anaerobe capable of surviving under limited oxygen tensions.

5.3.6 Identification of oxygen response signatures An advantage of global genome transcription analyses is their ability to investigate at the molecular level whole responses of bacteria to specific conditions. Comparative studies serve to identify genes which perform specific roles across species, and thus, could provide more insights on the physiology and genetics of bacteria. Gupta [2006] identified 49 genes that comprise molecular signatures unique to the -Proteobacteria. These 49 were compared to those regulated by oxygen in the three Campylobacterales species. Four genes of C. jejuni, two of H. pylori and two of W. succinogenes belonging to the characteristic -Proteobacteria genes were regulated by the oxygen tension in the growth atmosphere; cj0331c, cj0403, cj0700, cj1488c, hp0149, ws0030 were upregulated and

68 Chapter 5 Molecular responses of Campylobacterales to oxidative stress

hp1258, ws0172 were downregulated. Seven of the eight genes identified encoded hypothetical proteins and cj1488c encoded a subunit of Cbb3-type cytochrome oxidase.

The predicted interactions of the proteins encoded by these genes with other proteins were determined to elucidate some of their probable functions. In C. jejuni, no specific functional groups were identified for cj0331c and cj0700; cj0403 showed interactions with proteins involved in amino acid metabolism and, as expected, cj1488c interacted with other cytochrome c oxidase subunits. In H. pylori, hp0149 showed interactions with cytochrome c oxidase subunits and virulence-related proteins, and hp1258 interacted with NADH-ubiquinone oxidoreductase subunits. In W. succinogenes, no functional groups were identified for ws0172, and ws0030 showed interactions with formate dehydrogenase subunits. An interesting outcome of these analyses was that ‘signature genes’ characteristic of -Proteobacteria that encode proteins involved in respiration were regulated by the oxygen tension.

5.4 CONCLUSION The central role played by oxygen in the general physiology of microorganisms indicated the importance of understanding the molecular differences that occur when host- colonizing bacterial species are grown under different oxygen tensions. For example, for some bacteria the ability to proliferate under oxygen-depleted conditions is required to colonize the oxygen-limited environment of the intestine. Also, oxygen tolerance plays an essential role in bacteria which could be exposed to high oxygen tensions in the host or during their transmission between hosts. This study served to identify transcriptional changes that occurred in three different Campylobacterales species exposed to different oxygen conditions. It compared these changes and identified common genes and functions regulated under oxygen, and related them to specific characteristics of - Proteobacteria, thus providing insights into the molecular basis of the microaerophily of this diverse Proteobacteria division.

PART 1SUMMARY

Most Campylobacterales species are considered to be microaerophiles before proper testing. This First Part focused on the role of oxygen in four animal-colonizing species. First, the aerophily of each bacterial species was investigated. The studies presented in Chapters 4 and 5 established that H. pylori and C. jejuni are obligate microaerophiles, W. succinogenes is an anaerobe that could tolerate small amounts of oxygen and A. butzleri is an aerobe that does not require oxygen. The characterization of the preferred environment of an organism provided the foundation for the ensuing studies. For example, discrepancies often found between experimental results may arise from differences in the experimental design such as variations in the growth atmosphere. In addition, future research will be able to employ this information in their experimental designs to avoid artifacts that may arise from stressing the organism under the wrong environment.

Following the study of the aerophily of these bacterial species, the molecular response of the organisms to an increase in oxygen tension in the atmosphere was analyzed. Comparative analyses of microarray data provided to us by collaborators, or obtained through databases, furthered our understanding of the interactions of these bacteria with oxygen. The analyses provided associations in the responses of these Campylobacterales species. The comparison of the responses of the microaerobes C. jejuni and H. pylori to that of the anaerobe W. succinogenes offered experimental evidence of the differences in usage of aerobic respiration between organisms with different oxygen requirements and tolerances. Interestingly, the only gene commonly regulated in all three species was the gene encoding alkyl hydroperoxide reductase, an important antioxidant enzyme linked to several systems such as the thioredoxin system. Further investigations identified the upregulation of the functional category ‘redox processes’ in all three species. This category includes enzymes involved in maintaining intracellular redox balance and enzymes with antioxidant roles. Oxygen status and redox potential are associated when redox is a measure of a system’s capacity to oxidize material. Investigation of disulfide reductases in these bacterial species was prompted by the fact that disulfide reduction is involved in maintaining the redox potential balance of the cell.

PART 2: ROLES OF DISULFIDE REDUCTASES

CHAPTER 6: PART 2INTRODUCTION 74 6.1 CHARACTERISTICS OF DISULFIDE OXIDATION AND REDUCTION 75 6.2 DISULFIDE REDUCTASES AND DRUG RESISTANCE 77 6.2.1 Involvement of disulfide reduction in drug resistance 77 6.2.2 Metronidazole activation and resistance in microorganisms 78 6.3 HEAVY METALS AND DISULFIDE REDUCTASES 79 6.3.1 Disulfide reductases in heavy metal detoxication and resistance 79 6.3.2 Cadmium resistance and detoxication 81 6.4 DISULFIDE REDUCTASES AND PATHOGENESIS 83 6.5 DISULFIDE REDUCTASES IN FOUR CAMPYLOBACTERALES 84

8.3.3.2 Metronidazole reduction in matched pairs of strains 119 8.3.3.3 Redox status of matched pairs of strains 122 8.3.3.4 Metabolic changes in matched pairs of strains 124 8.3.3.5 Proteomic analyses of strains HER 126 V1 and HER 126 V4 126 8.3.3.6 Analyses of the proteome of strain HER 126 V4 grown under Mtr stress 132 8.3.4 Metronidazole resistance of Campylobacter jejuni strains 137 8.4 CONCLUSION 137

PART 2SUMMARY 186

73 Chapter 6 Part 2 Introduction

CHAPTER 6:

PART 2INTRODUCTION

74 Chapter 6 Part 2 Introduction

6.1 CHARACTERISTICS OF DISULFIDE OXIDATION AND REDUCTION Two cysteine residues which are adjacent in the tertiary or quaternary structure of a protein can be oxidized to form a disulfide bond [Raina & Missiakas, 1997]. Disulfide bonds are permanent features of the final folded product in many proteins. The formation of these bonds may be essential steps in the folding pathway towards an active conformation (e.g. bovine pancreatic trypsin inhibitor) and/or they may enhance the stability of the protein (e.g. ß-lactamase) [Creighton, 1997; Darby et al., 1995; Rietsch & Beckwith, 1998; Schultz et al., 1987; Vanhove et al., 1997]. In another class of proteins the oxidation state of some cysteine residues varies according to environmental conditions and serves as a regulatory response for the cell (e.g. OxyR) [Rietsch & Beckwith, 1998; Zheng et al., 1998]. For other proteins that act as reductases, the formation of a covalent bond between two cysteinyls is a consequence of their enzymatic activity and the reduction of that bond is an essential feature of their catalytic cycle (e.g. ribonucleotide reductase) [Rietsch & Beckwith, 1998].

Disulfide bonds in proteins can be formed spontaneously in vitro, but the rate of their formation is much slower than that observed in vivo [Anfinsen, 1973; Rietsch & Beckwith, 1998; Saxena & Wetlaufer, 1970]. The formation and reduction of disulfide bonds in cells are catalyzed processes, where almost all the proteins involved in these reactions belong to a class with similarity to thioredoxin [Rietsch & Beckwith, 1998]. These oxidoreductases are capable of catalyzing both disulfide bond formation and reduction, but they have evolved to perform one or the other reaction more efficiently. Oxidation and reduction of disulfide bonds is mediated by thiol-disulfide exchange between the active site cysteine residues of the enzyme and cysteinyls in the target protein (Fig. 6.1) [Darby & Creighton, 1995; Frech et al., 1996; Kallis & Holmgren, 1980; Rietsch & Beckwith, 1998]. The efficiency with which these enzymes perform their various functions is determined by a number of factors, including the redox potential of the active site disulfide bond, which reflects whether an enzyme is more reducing or oxidizing, and the ability of the enzyme to bind to polypeptides [Darby & Creighton, 1995; Darby et al., 1998; Grauschopf et al., 1995; Rietsch & Beckwith, 1998].

75 Chapter 6 Part 2 Introduction

Figure 6.1 Enzymatic disulfide bond oxidation and reduction of proteins [Rietsch & Beckwith, 1998]. Disulfide bond oxidation and reduction are thought to proceed via a mixed disulfide intermediate of the enzyme and the substrate protein. The enzyme is shown as a round disc; the substrate protein is depicted as a simple line.

76 Chapter 6 Part 2 Introduction

The formation of disulfide bonds occurs in the periplasm of Gram-negative bacteria [Bardwell, 1994], while the reducing environment of the cytoplasm does not contain proteins with stable disulfide bonds [Derman & Beckwith, 1991; Hwang et al., 1992]. However, several reductases in the cytoplasm go through cycles of oxidation and reduction of cysteinyls as part of their activity [Holmgren, 1989; Russel, 1995; Russel et al., 1990].

The thiol group is exceptional among the functionalities found in amino acids [Fahey, 2001]. Its pKa, nucleophilicity, redox properties, metal ion affinity, and bonding characteristics make it a versatile site for many chemical processes that define cell function [Fahey, 2001]. A central function of disulfide reduction is the maintenance of intracellular redox balance [Chivers et al., 1997]. Disulfide reductases are involved also in various cellular processes such as drug resistance [Hayashi et al., 2000; Mendz & Mégraud, 2002], heavy metal detoxication [Hayashi et al., 2000; Moore et al., 1992; Zegers et al., 2001], and pathogenesis [Leong et al., 1993; Miki et al., 2004].

6.2 DISULFIDE REDUCTASES AND DRUG RESISTANCE 6.2.1 Involvement of disulfide reduction in drug resistance Disulfide reductases are involved in drug resistance in several microorganisms, for example the system in Burkholderia cepacia. Mutations in the disulfide system of B. cepacia makes the bacterium more susceptible to beta-lactams, kanamycin, erythromycin, novobiocin and ofloxacin [Hayashi et al., 2000]. These results suggest that the oxidoreductases are part of a multi-drug resistance system [Hayashi et al., 2000]. Protein disulfide isomerases appear to be involved in the formation of resistance against nitazoxanide and metronidazole in Giardia lamblia [Müller et al., 2007]. Several antimicrobial compounds have been designed to modulate disulfide reduction activities. For example, the antimicrobial effect of allicin has been linked to its effect on thiol groups of various enzymes such as thioredoxin reductase [Ankri & Mirelman, 1999]. Eosin B inhibits both the growth of Toxoplasma gondii and Plasmodium falciparum by inhibiting dihydrofolate reductase-thymidylate synthase, thioredoxin reductase and glutathione reductase [Massimine et al., 2006].

77 Chapter 6 Part 2 Introduction

6.2.2 Metronidazole activation and resistance in microorganisms Metronidazole was investigated because this compound is considered a prodrug whose activation is dependent on its reduction by redox systems. In addition, the toxic effects of the compound arise from its ability to produce free radicals which are harmful for the organism. This suggested that redox systems and enzymes with antioxidant properties may be involved in Mtr activation, combating its effects, and developing resistance to this drug.

Examples of organisms treated with Mtr and capable of developing resistance upon exposure to Mtr are species from the Bacteroides, Giardia, Entamoeba and Trichomonas genera. Bacteroides are obligate, non-spore forming, Gram-negative, anaerobic rods. Some pathogenic Bacteroides cause gastrointestinal infection through formation of abscesses. The abscesses make Bacteroides difficult to kill because antibiotics are unable to penetrate them, making the bacteria antibiotic resistant [Stubbs et al., 2000]. The nitroimidazole resistance nim genes are responsible for the resistant phenotype of Bacteroides [Stubbs et al., 2000]. The presence of nim genes was shown by PCR in twenty-five out of twenty-eight strains that exhibited reduced susceptibility to Mtr [Stubbs et al., 2000]. Their absence in three strains suggested the presence of an alternative mechanism of Mtr resistance.

Giardia lamblia is a teardrop shaped flagellated protozoan, which lives in the small intestine and is transmitted primarily when infective cysts are ingested by the host. In G. lamblia, two crucial metabolic components are involved in Mtr activation, the PFOR and Fdx [Kirkwood & Johnson, 1999]. G. lamblia PFOR is one of its two major cytosolic oxidoreductases, it transfers electrons to Fdx with simultaneous reduction of Mtr [Kirkwood & Johnson, 1999].

Entamoeba histolytica is a small parasitic amoeba that causes infections most commonly in the intestine, but may spread to other organs such as liver, lungs, brain, spleen, skin and urogenital tract. Infection occurs by ingesting fecally contaminated food or water.

78 Chapter 6 Part 2 Introduction

Resistance to Mtr in E. histolytica has been described, but its molecular basis has not been studied extensively. The activities of E. histolytica PFOR and iron superoxide dimutase (FeSOD) were higher in resistant strains than in susceptible strains [Kirkwood & Johnson, 1999]. The hypothesis of a potential role of FeSOD in Mtr resistance was strengthened when resistant organisms were shown to overexpress FeSOD, and repress ferredoxin and flavin reductase. Using transfection techniques, FeSOD and PFOR were expressed in susceptible organisms; this gave rise to E. histolytica with increased resistance to Mtr and demonstrated a direct role for these proteins in Mtr susceptibility [Kirkwood & Johnson, 1999].

Trichomonas vaginalis is a flagellated human parasitic protist which infects the urogenital tract. Drug activation in trichomonad parasites is thought to occur via similar metabolic pathways as those of E. histolytica and G. lamblia, with the difference that in T. vaginalis these biochemical pathways are compartmentalized into a specialized organelle called the hydrogenosome [Kirkwood & Johnson, 1999]. Two possible hypotheses have been proposed for resistance: (i) a defective Fdx protein in resistant isolates; or (ii) lower levels of Fdx in resistant isolates [Kirkwood & Johnson, 1999].

6.3 HEAVY METALS AND DISULFIDE REDUCTASES 6.3.1 Disulfide reductases in heavy metal detoxication and resistance The release of heavy metals in the environment as a consequence of anthropogenic activity poses serious pollution and health risks. The ability of microorganisms to remove metals from their external environment, the involvement of microorganisms in metal transformations, and the microbial transfer of metals to higher plants and animals make the study of microbe-metal interactions essential. In addition, since drugs employing heavy metals have been extremely effective for cancer treatment and other life- threatening diseases, it is worth while to consider the use of heavy metals as anti- infectives.

Several reductases have been implicated in metal resistance or detoxication, and metal- ion catalyzed oxidation is usually countered by thiols [Kwon et al., 1994]. Arsenate

79 Chapter 6 Part 2 Introduction

reductase (ArsC) plays a role in heavy metal resistance in Staphylococcus aureus [Zegers et al., 2001]. This resistance to arsenate is mediated by a nucleophilic attack by cysteinyl on arsenate. This reaction induces major structural changes in ArsC [Zegers et al., 2001], which correspond to the modulation of disulfide bond formation in the protein. Mercuric ion reductase (MerA) catalyzes the reduction of Hg (II) to Hg (0) in the last step of the bacterial mercury detoxification pathway [Moore et al., 1992; Walsh et al., 1988]. This reductase is a member of the disulfide oxidoreductase family. The presence of two cysteine residues, apart from the active site cysteinyls, is responsible for high levels of mercuric ion reductase activity [Moore et al., 1992; Walsh et al., 1988]. The conversion of either cysteinyl to an alaninyl inhibited the Hg (II) detoxification pathway in vivo [Moore et al., 1992]. MerA has homology to glutathione reductase [Walsh et al., 1988], another disulfide reductase which has been implicated in heavy metal detoxification. In B. cepacia, mutations in the thiol disulfide oxidoreductases DsbA or DsbB increased bacterial sensitivity to cadmium and zinc ions [Hayashi et al., 2000]. This suggested that the DsbA-DsbB complex might be involved in the formation of metal efflux systems [Hayashi et al., 2000]. Mutations in another thiol disulfide oxidoreductase DsbD made E. coli strain K12 slightly more sensitive to copper (II) ions [Metheringham et al., 1996].

Conversely, several heavy metals are used to disrupt disulfide-controlled processes. Antimonial (Sb) drugs have been used in Leishmania donovani infections. In the process, Sb (V) is transformed into active Sb (III); this form of the metal decreases thiol-buffering capacity by inducing rapid efflux of intracellular trypanothione and glutathione in approximately equimolar amounts [Wyllie et al., 2004]. Sb (III) also inhibits trypanothione reductase in intact parasitic cells resulting in the accumulation of disulfide forms of trypanothione and glutathione [Wyllie et al., 2004]. Antimonials compromise the thiol-redox potential in certain stages of the parasitic life cycle.

The association between disulfide proteins or compounds and heavy metals is also found in higher organisms. Lead poisoning in human erythrocytes resulted in a decrease of glutathione:glutathione-disulfide levels [Gurer-Orhan et al., 2004], which might be the basis of the metal’s toxicity.

80 Chapter 6 Part 2 Introduction

6.3.2 Cadmium resistance and detoxication Cadmium ions are very toxic even at low concentrations, but the basis for their toxicity in Campylobacterales is not fully understood. Cadmium has multiple molecular effects on different organisms. In Chlamydomonas reinhardtii, exposure to cadmium resulted in the downregulation of ribulose-1,5-bisphosphate carboxylase/oxygenase [Gillet et al., 2006] and central metabolic pathways such as fatty acid biosynthesis, tricarboxylic acid cycle, and amino acid and protein biosynthesis [Gillet et al., 2006]. In contrast, proteins involved in glutathione synthesis, ATP metabolism, response to oxidative stress and protein folding were upregulated in the presence of cadmium [Gillet et al., 2006]. The effect of cadmium on protein expression in Rhodobacter capsulatus B10 involved the upregulation of heat-shock proteins GroEL and DnaK, S-adenosylmethionine synthetase, ribosomal protein S1, aspartate aminotransferase and phosphoglycerate kinase [El-Rab et al., 2006]. Cadmium-treated R. capsulatus cells have a filamentous structure and contain less phosphorus than untreated cells [El-Rab et al., 2006]. An interesting study on E. coli found that cadmium-stressed cells recovered more rapidly than unexposed cells when subsequently subjected to other stresses such as ethanol, osmotic, heat shock, and nalidixic acid treatment [Ferianc et al., 1998]. In Saccharomyces cerevisiae, cells exposed to cadmium increased the synthesis of glutathione and of proteins with antioxidant properties [Vido et al., 2001]. A proteomic evaluation of cadmium toxicity on Chironomus riparius Meigen larvae showed downregulation of energy production, nucleotide biosynthesis, cell division, transport and binding of ions, signal transduction regulating citrate/malate metabolism, and fatty acid and phospholipid metabolism [Lee et al., 2006]. In a study performed on Arabidopsis thaliana roots, cadmium ions triggered the synthesis of the glutathione-derived metal-binding peptides phytochelatins, and were found to regulate key metabolic enzymes [Herbette et al., 2006]. In humans, cadmium is involved in the generation of ROS, modulation of signal transduction pathways, reduction of the activities of proteins involved in antioxidant defenses, inhibition of DNA repair, induction of apoptosis and modification of the expression of heat shock proteins [Bertin & Averbeck, 2006]. The uptake, transport, storage, and excretion of cadmium in humans involve several thiol-based residues, compounds and proteins (Figure 6.2).

81 Chapter 6 Part 2 Introduction

1. Skin: Absorption as Cd-MT Uptake 2. Lung: Absorption as Cd-Cysteine 3. Gastrointestinal tract: Absorption through metal transporting complexes or endocytosis of proteins

1. Blood: Cd transported in complexes with Transport MT, protein, cysteine and glutathione

1. Liver: Absorption as Cd-MT Storage 2. Kidney: Absorption as Cd-MT

1. Urine and Feces: Excreted as Cd- Excretion MT or Cd-Protein

Figure 6.2 Uptake, transport, storage and excretion of cadmium in humans. MT: Metallothionein. (http://www.occup-med.com/content/figures/1745-6673-1-22-1.jpg)

82 Chapter 6 Part 2 Introduction

6.4 DISULFIDE REDUCTASES AND PATHOGENESIS Examples of the involvement of antioxidant defenses of microorganisms in their virulence are found in Cryptococcus neoformans and Mycobacterium tuberculosis [Jaeger et al., 2004; Missall et al., 2004]. In the fungal pathogen C. neoformans, a thiol peroxidase is critical for virulence [Missall et al., 2004]. The high reducing antioxidant capacity in Mycoplasma fermentans is believed to be a principal defense mechanism playing a major role in the resistance of the organism to oxidative stress within host cells [Yavlovich et al., 2006]. Actinobacillus pleuropneumoniae, the etiological agent of porcine pleuropneumonia, is able to persist on respiratory epithelia, in tonsils, and in the anaerobic environment of encapsulated lung sequesters [Baltes et al., 2005]. It was demonstrated that putative HlyX-regulated genes coding for dimethyl sulfoxide reductase and aspartate ammonia lyase are upregulated during infection and that deletions of these genes result in attenuation of the organism [Baltes et al., 2005]. Another example of a virulence factor is the golden pigment of S. aureus which impairs neutrophil killing and promotes virulence through its antioxidant activity [Liu et al., 2005].

Oxidoreductases, and specifically disulfide reductases, play a major role in the antioxidant defense mechanisms of bacteria. Similarly to other antioxidant defenses, disulfide reductases are involved also in virulence. For example, StoA is a membrane- bound thiol disulfide oxidoreductase important in spore cortex synthesis in Bacillus subtilis [Erlendsson et al., 2004]. The cortex is composed of a thick peptidoglycan layer that helps to maintain the dehydrated state of the spore [Erlendsson et al., 2004]. Peptide methionine sulfoxide reductase activity is involved in the virulence of the pathogens E. coli, Streptococcus pneumoniae, Erwinia chrysanthemi, Mycoplasma genitalium, and Neisseria gonorrhoeae [Dhandayuthapani et al., 2001; El Hassouni et al., 1999; Taha et al., 1991; Wizemann et al., 1996]. The PilB protein has three subdomains which contain Msr activity [Olry et al., 2002]. This protein participates in the virulence of bacteria of the Neisseria genus in a similar fashion to that of Msr in other bacteria [Olry et al., 2002]. A Salmonella enterica serovar typhimurium trxA-negative mutant did not exhibit any growth defects or decreased tolerance to oxidative or nitric oxide stress in vitro, yet it had a pronounced decrease in intracellular replication and virulence in mice [Bjur et al.,

83 Chapter 6 Part 2 Introduction

2006]. The attenuation of virulence in mice was caused by a thioredoxin deficiency, and was restored by expression of wild-type thioredoxin in a complemented mutant [Bjur et al., 2006].

6.5 DISULFIDE REDUCTASES IN FOUR CAMPYLOBACTERALES The autoxidation of thiols produces as co-products ROS that can be highly toxic to cells [Fahey, 2001; Held & Biaglow, 1994]. Adaptation to an aerobic environment required development of mechanisms to minimize the occurrence of thiol oxidation and to mitigate its consequences [Fahey, 2001]. The adaptation to an aerobic environment presumably took different courses in different families of bacteria; some did not adapt and remained confined to anaerobic environments. A common trait of Campylobacterales is their ability to grow at low oxygen tensions. Most species of the order require growth under microaerobic conditions, suggesting that these bacteria have low intracellular redox potentials and that the redox status of the cell plays a fundamental role in cell viability, growth and metabolism.

Relatively few studies have been performed on the disulfide reductases of Campylobacterales considering the number of studies performed on these species. A thioredoxin system and a thioredoxin-dependent peroxiredoxin system have been identified and characterized in H. pylori [Baker et al., 2001; Windle et al., 2000]. It has been hypothesized that thioredoxin assists H. pylori in the process of colonization by inducing focal disruption of the oligomeric structure of mucin while rendering host antibody inactive through catalytic reduction [Windle et al., 2000]. H. pylori Bcp is a thiol peroxidase that depends on the reducing activity of the thioredoxin system, and plays a significant role in efficient host colonization [Baker et al., 2001]. Mouse colonization studies in H. pylori showed that Msr is an important factor, especially for effective longer-term colonization [Alamuri & Maier, 2004]. Complementation of the msr knockout strain by chromosomal insertion of a functional gene restored its mouse colonization ability [Alamuri & Maier, 2004]. New DsbB-like thiol oxidoreductases of C. jejuni and H. pylori have been characterized and classified based on phylogenomic, structural and functional criteria [Raczko et al., 2005]. A dsbI-knockout mutant in H.

84 Chapter 6 Part 2 Introduction

pylori impaired in disulfide bond formation revealed a greatly reduced ability to colonize the gastric mucosa of mice [Godlewska et al., 2006]. Recently, high-resolution crystal structures of oxidized and reduced thioredoxin reductase from H. pylori were published [Gustafsson et al., 2007]. No studies on disulfide reductases have been performed on W. succinogenes and A. butzleri.

85 Chapter 7 Identification of disulfide reductases in Campylobacterales

CHAPTER 7:

IDENTIFICATION OF DISULFIDE REDUCTASES IN CAMPYLOBACTERALES

86 Chapter 7 Identification of disulfide reductases in Campylobacterales

7.1 INTRODUCTION Cysteinyl clusters in proteins preferentially form CXXC motifs. These motifs are present in the active sites of disulfide reductases [Rosata et al., 2002], and are essential for the catalysis of these redox reactions. CXXC-derived motifs contain either a serine or threonine instead of the second cysteine residue, CXXS or CXXT, respectively. CXXC- derived motifs have been shown to function also as redox motifs of disulfide reductases [Fomenko & Gladyshev, 2003]. Often, the three motifs are involved in metal coordination, and when not flanked by specific secondary structures, they are found in proteins which perform other functions, such as metal detoxication. For example, the presence of a helix downstream of CXXC influences the ionization properties of the two cysteinyls such that the N-terminal cysteine residue has a reduced pKa compared to the pKa of free cysteine, making the motif more reducing [Kortemme & Creighton, 1995].

Disulfide reductases and their motifs, which are an essential component of many multifunctional redox systems, were investigated in this study. Searches were performed in the genomes of 281 prokaryotes to identify proteins with CXXC and CXXC-derived motifs. The frequency of proteins containing these motifs was studied in relation to the genome size and oxygen tolerance of the microorganisms. A method was developed to distinguish disulfide reductases from other proteins containing CXXC and CXXC- derived motifs, and was applied to discover genes encoding disulfide reductases of the four Campylobacterales species.

7.2 EXPERIMENTAL PROCEDURES 7.2.1 Bacterial cultures and preparation of lysates The strains used in this chapter were H. pylori 26695 and J99, C. jejuni NCTC 11168 and 100, W. succinogenes DSMZ 1740 and A. butzleri RM4018 and NC97 (kindly provided by Dr Nalini Chinivasagam, Department of Primary Industries and Fisheries, Queensland, Australia). C. jejuni, H. pylori, W. succinogenes and A. butzleri strains were grown as previously described.

87 Chapter 7 Identification of disulfide reductases in Campylobacterales

7.2.2 Nuclear magnetic resonance spectroscopy Reduction rates of GSSG were measured employing 1H-NMR spectroscopy in cell-free 2 extracts suspended in H2O:H2O (1:5 v/v), 10 mM KCl, 25 mM NaCl, and 50 mM potassium phosphate buffer, pH 7.2. Instrument parameters were described previously. Maximal rates were calculated from good fits to straight lines (correlation coefficients 1 0.95) of the data for 30 minutes for GSSG reduction.

7.2.3 Bioinformatics Searches for proteins with CXXC, CXXS and/or CXXT motifs were performed using The Institute for Genomic Research (TIGR) genome databases of H. pylori strain 26695 and J99, C. jejuni strain NCTC 11168 and W. succinogenes strain DSMZ 1740 (http://www.tigr.org/). The A. butzleri RM4018 genome has been deposited on the National Center for Biotechnology Information (NCBI) database with the accession number CP000361 and is available from Dr. William G. Miller (USDA, Albany, CA, USA). In addition, searches for these motifs were performed using the complete proteomes of 253 bacterial genomes and 24 archaeal strains available at the NCBI database (http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi), and the complete proteomes of the four bacterial species held in Dr. Miller’s databases. The ensembles of proteins with the required motifs were filtered to select for disulfide reductases by first discarding proteins which contained only metal-associated domains and signatures as defined in the Interpro database [Mulder et al., 2005]. A further selection was performed on the remaining proteins using the PSIPRED protein structure prediction server [McGuffin et al., 2000] to determine the secondary structure of the polypeptide segment following the motif(s).

7.3 RESULTS AND DISCUSSION 7.3.1 Disulfide reduction activities in the four Campylobacterales BLASTP searches performed on C. jejuni, H. pylori, W. succinogenes and A. butzleri indicated the absence of genes encoding glutathione reductases. Thus, GSSG and NADH were used as substrates to observe non-specific disulfide reduction activities in these bacteria (Fig. 7.1). Employing 1H-NMR spectroscopy, disulfide reduction was detected in

88 Chapter 7 Identification of disulfide reductases in Campylobacterales

Figure 7.1 1H spectra of glutathione reduction in cell-free extract suspensions. Spectra were acquired at the time points indicated on the right-hand side. Resonances arising from the substrates GSSG and NADH are indicated on the bottom spectrum. Resonances arising from the products GSH and NAD+ are indicated on the top spectrum. The GSSG signals decrease with time as the compound is reduced, and the rate of reduction is calculated by measuring this decrease with respect to time.

89 Chapter 7 Identification of disulfide reductases in Campylobacterales

cell-free extracts of C. jejuni strain 100, H. pylori strain J99, W. succinogenes strain DSMZ 1740, and A. butzleri strain NC 97 (Fig. 7.1). Maximal rates of 43 ± 2, 149 ± 8, 47 ± 2 and 153 ± 5 nmol mg-1 min-1 and Michaelis constants of 5 ± 1, 6 ± 1, 8 ± 1 and 14 ± 1 mM were measured for each bacterium, respectively. These results indicated a relatively low affinity for GSSG as a substrate, and suggested that the natural disulfide substrates of these enzymes may be different ones. Nonetheless, the detection of glutathione reduction in situ indicated the presence of disulfide reduction activities in these bacterial species.

7.3.2 Identification of CXXC and CXXC-derived motifs CXXC and CXXC-derived motifs are essential to the redox reactions catalyzed by disulfide reductases. In silico searches of 281 bacterial and archaeal genomes were performed to determine the number of proteins with these motifs in each microorganism class and sub-class. The genomes included those of 126 Proteobacteria, 19 Actinobacteria, 1 Aquificae, 7 Bacteroidetes/Chlorobi, 10 Chlamydiae/Verrucomicrobia, 2 Chloroflexi, 14 Cyanobacteria, 3 Deinococcus/Thermus, 66 Firmicutes, 1 Fusobacteria, 1 Planctomycetes, 6 Spirochaetales, 1 Thermotogae, 5 Crenarchaeota, 18 Euryarchaeota, and 1 Nanoarchaeota. The complete list of organisms and the number of proteins with each type of motif are provided in the appendix as supplementary material (Table S7.1). The percentages of proteins containing either of these motifs relative to the total number of proteins encoded in each genome are given in Table 7.1 by class and sub-class. The occurrence of motifs was 5.6% to 19.1% for CXXC, 6.7% to 29.0% for CXXS, and 6.8% to 22.6% for CXXT. Comparisons of the percentage of proteins with CXXC or CXXC- derived motifs between different groups of bacteria for which there are data for many species, indicated that the proportion of these proteins in -Proteobacteria (42.3%) is substantially larger than in the Gram-positive Firmicutes (30.1%) or Actinobacteria (34.1%). The results for some classes may be underrepresented owing to the small number of sequenced and annotated genomes currently available in them.

The total number of CXXC and CXXC-derived motifs plotted as a function of genome size for the 281 genomes showed a linear correlation which fitted the equation y = 0.371x + 11.309 (r = 0.916) (Fig. 7.2). On average, the number of these motifs within a genome

90 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.1 Percentages of proteins which contain CXXC, CXXS and/or CXXT motifs in 257 bacterial and 24 archaeal genomes.

Class Sub-class Percentage of proteins with the motifs CXXC CXXS CXXT Total Eubacteria Proteobacteria 10.4 17.1 14.2 41.7 Alpha 7.5 15.2 13.4 36.1 Beta 8.7 15.0 13.8 37.6 Delta 15.2 19.7 17.4 52.3 Epsilon 12.1 18.4 11.8 42.3 Gamma 8.6 17.0 14.6 40.1 Firmicutes 7.6 12.0 10.6 30.2 Bacillales 6.6 11.0 10.6 28.2 Clostridia 12.1 15.8 13.1 41.0 Lactobacillales 5.6 9.0 8.8 23.4 Mollicutes 5.9 12.0 9.9 27.8 Actinobacteria 7.0 13.2 13.9 34.1 Aquificae 14.0 10.2 9.2 33.4 Bacteroidetes/Chlorobi 11.0 22.3 19.1 52.4 Chlamydiae 13.4 29.0 22.6 65.0 Chloroflexi 18.8 19.5 17.5 55.8 Cyanobacteria 9.0 17.7 14.6 41.3 Thermus/Deinococcus 7.8 6.7 7.7 22.2 Fusobacteria 7.4 12.5 11.5 31.3 Planctomycetes 11.7 24.1 19.1 54.9 Spirochaetes 8.6 17.5 12.3 38.5 Thermotogae 11.4 10.8 10.9 33.2 Archaea Crenarchaeota 10.6 11.0 8.0 29.6 Desulfurococcales 8.8 16.0 9.3 34.0 Sulfolobales 11.1 9.6 7.2 27.9 Thermoproteales 11.2 10.0 8.8 30.0

91 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.1 - continued

Class Sub-class Percentage of proteins with the motifs CXXC CXXS CXXT Total Euryarchaeota 15.1 14.0 12.5 41.6 Archaeoglobales 16.7 14.4 12.8 43.9 Halobacteriales 11.8 10.4 12.4 34.6 Methanobacteriales 17.4 16.1 13.3 46.8 Methanococcales 17.4 17.6 15.2 50.2 Methanopyrales 19.1 14.3 17.5 51.0 Methanosarcinales 15.8 20.0 15.0 50.7 Thermococcales 11.8 8.3 6.8 26.9 Thermoplasmales 10.9 11.0 7.1 29.0 Nanoarchaeota 13.2 6.7 7.3 27.2

92 Chapter 7 Identification of disulfide reductases in Campylobacterales

Figure 7.2 Plot of total number of CXXC and CXXC-derived motifs as a function of the total size of the genome for 281 prokaryote microorganisms. The closed symbols (J) represent archaeal genomes and the open symbols (T) bacterial genomes. The data was fitted by the equation y = 0.371x + 11.309 (r = 0.916).

93 Chapter 7 Identification of disulfide reductases in Campylobacterales

was approximately 37 % of the total number of proteins in the proteome of the organism. Linear correlations were found also separating bacterial and archaeal genomes; they fitted the equations y = 0.368x + 20.921 (r = 0.918) and y = 0.474x – 241.81 (r = 0.873), respectively. The total number of proteins containing the CXXC and CXXC-derived motifs increased linearly [0.371 motifs/(total protein number)] with genome size for the 281 microbial genomes studied (Fig. 7.2). These data agreed with those obtained for the subset of proteins with 4Fe-4S motifs determined for 120 prokaryotic genomes [Major et al., 2004]. Proteins with CXXC and CXXC-derived motifs include disulfide reductases and metalloproteins which are involved in numerous fundamental cell functions, such as cell replication, energy production, protection against various stresses, etc. Generally, a larger genome will allow a microorganism to perform a greater variety of functions. The positive correlation between the number of proteins containing these motifs and the genome size manifested the more sophisticated capabilities of prokaryotes with larger genomes. A smaller and more uniform rate of increase of CXXC and CXXC-derived motifs was determined for bacteria [0.368 motifs/(total protein number)] than for archaea [0.474 motifs/(total protein number)]. These results reflected the greater capacity for adaptation needed by archaea which commonly are environmental microorganisms, in agreement with the findings for intracellular signal transduction proteins in environmental bacteria relative to those which inhabit more stable ecological niches [Galperin, 2005].

The number of proteins with CXXC or CXXC-derived motifs per 1000 proteins in the genome correlated with the oxygen requirement of the bacterial and archaeal species. The microorganisms were classified as aerobes, facultative anaerobes, microaerobes and anaerobes, depending on whether they can live under atmospheric conditions, reduced oxygen tensions or in the absence of oxygen. The average values of the number of proteins with CXXC or CXXC-derived motifs per 1000 proteins calculated for bacteria and archaea within each oxygen-requirement category are given in Table 7.2. The average number of motifs was significantly higher for anaerobic bacteria than for bacteria which can use oxygen at atmospheric or reduced tensions. The same result was found for

94 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.2 Average number of motifs per 1000 ORF as a function of the oxygen requirement of the organism. The errors correspond to standard deviations. The levels of significance relative to the aerobic group of microorganisms were determined using Student’s t-test, p-values smaller than 0.05 were considered significant.

Average total number of CXXC and CXXC-derived

motifs per 1000 proteins

Physiological groups Bacteria Archaea

Aerobes 349 ± 63 - 310 ± 35 -

Facultative anaerobes 334 ± 87 (p > 0.2) 304 ± 16 (p > 0.7)

Microaerobes 417 ± 37 (p < 0.001)* - -

Anaerobes 525 ± 128 (p < 0.001)* 407 ± 112 (p < 0.02)*

*p-values smaller that 0.05 were considered significant

95 Chapter 7 Identification of disulfide reductases in Campylobacterales

archaea, but the difference in the average values between aerobic and anaerobic archaea was smaller than for bacteria. Thus, there was a negative correlation between the oxygen- requirement of the microorganisms and the number of CXXC and CXXC-derived motifs. Aerobes had a smaller number of CXXC and CXXC-derived motifs per 1000 proteins than anaerobes (Table 7.2). This distribution was similar to that of CXXCXXCXXXC motifs (4Fe-4S clusters) found in 120 bacterial and archaeal genomes [Major et al., 2004]. Two differences between both studies are that in this work the CXXC and CXXC- derived motifs were more abundant in bacteria than in archaea, and that the motifs were found in similar numbers in aerobic and facultative anaerobic archaea. CXXC and CXXC-derived motifs in proteins are employed for redox functions and metal binding; the former is the major redox motif utilized for the formation, reduction, and isomerization of disulfide bonds [Fomenko & Gladyshev, 2003]. The higher relative abundance of these motifs in anaerobic than in aerobic prokaryotes suggested a molecular basis for the requirements of the former to maintain a more reducing intracellular environment and to employ metals in their physiology.

7.3.3 Identification of disulfide reductases The numbers of proteins which contained these motifs encoded by the genomes of C. jejuni, H. pylori, W. succinogenes and A. butzleri are shown in Table 7.3. The data indicated that they occurred in approximately 40% of the total number of proteins encoded by each genome. The percentage of proteins with CXXC, CXXS and CXXT motifs in the four Campylobacterales was similar to those of the other Gram-negative Proteobacteria but significantly higher than those of the Gram-positive Firmicutes and Actinobacteria. Most proteins which contain these motifs have functions associated with either redox status or metals. Thus, the numbers of motifs found in the genomes of the four Campylobacterales may reflect habitats which pose considerable oxygen and/or metal stresses to them.

The proteins in the four Campylobacterales species which contained these motifs were screened first to distinguish those bearing metal-associated motifs from proteins not bearing these motifs. The latter were retained for further analysis. Examples of sequences

96 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.3 Number of proteins containing at least one CXXC, CXXS, or CXXT motif in C. jejuni strain NCTC 11168, H. pylori strain 26695, W. succinogenes strain DSMZ 1740 and A. butzleri strain RM4018.

Bacterial Species Number of proteins with the motif CXXC CXXS CXXT C. jejuni 226 324 182 H. pylori 149 294 193 W. succinogenes 263 327 211 A. butzleri 248 322 242

97 Chapter 7 Identification of disulfide reductases in Campylobacterales

found in the former proteins include signatures of heavy metal associated domains, neutral zinc metallopeptidases, metalloproteinase inhibitors, metallothionein, high potential Fe-S proteins, serine carboxypeptidase active sites, molybdenum cofactor biosynthesis protein A, nitrogenase cofactor biosynthesis protein B and coenzyme PQQ biosynthesis protein E family. Secondly, proteins bearing metal-associated motifs were examined for the presence of other CXXC or CXXC-derived motifs not associated with a metal-binding sequence. These proteins were added to those retained earlier and the rest were filtered out. The remaining pool of proteins was subjected to a third selection process via secondary structure prediction. Proteins which contained an α-helix directly after the CXXC or CXXC-derived motif were considered redox proteins and retained; the other proteins were filtered out. The numbers of disulfide reductases identified in the four species were relatively similar: 35 in C. jejuni, 25 in H. pylori, 28 in W. succinogenes and 34 in A. butzleri (Table 7.4). Genome size was not a determining factor of the total number of disulfide reductases identified in each species since the genomes of C. jejuni (1598 ORF) and H. pylori (1566 ORF) are considerably smaller than those of W. succinogenes (2044 ORF) and A. butzleri (2335 ORF). The similarity in the number of disulfide reductases between all four species and lack of correlation with the size of their genomes probably reflects their phylogenetic relatedness, and to some extent their ecological niches in higher vertebrates, although A. butzleri is found also in marine sediments.

7.3.4 Redox proteins common to the four Campylobacterales Redox proteins with homologues in the four species were identified by performing BLASTP searches of the protein sequences found in each genome against the genomes of the other three species. These analyses identified the ten proteins listed in Table 7.5. Interestingly, four of these proteins were part of the thioredoxin system of the bacteria.

7.4 CONCLUSION Proteins with CXXC and CXXC-derived motifs from 281 prokaryotes were identified and the number of these proteins was shown to correlate with genome size and oxygen tolerance. The data provided evidence for a relationship between these motifs and the

98 Chapter 7 Identification of disulfide reductases in Campylobacterales

intracellular oxygen status, and thus the redox status of the cell. Putative disulfide reductases from the four Campylobacterales species were identified bioinformatically, and ten of those proteins were found to be common across the four species.

99 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.4 Putative disulfide reductases of C. jejuni, H. pylori, W. succinogenes and A. butzleri. The analyses were performed on the genomes of C. jejuni strain NCTC 11168, H. pylori strain 26695, W. succinogenes strain DSMZ 1740 and A. butzleri strain RM4018 genome databases.

Bacterium Putative Proteins CXXC CXXS CXXT C. jejuni CJ0012c CJ0058 CJ0262c CJ0017c CJ0256 CJ0280 CJ0119 CJ0264c CJ0425 CJ0146c CJ0701 CJ0559 CJ0147c CJ0757 CJ0911 CJ0415 CJ1019c CJ1006c CJ0535 CJ1168c CJ1049c CJ0537 CJ1295 CJ1293 CJ0603c CJ1633 CJ0637c CJ0865 CJ1106 CJ1112c CJ1278 CJ1380 CJ1457c CJ1505c CJ1665

H. pylori HP0022 HP0169 HP0013 HP0231 HP0224 HP0285 HP0377 HP0472 HP0554 HP0588 HP0825 HP0840 HP0590 HP0893 HP0842 HP0595 HP1269 HP0880 HP0682 HP1570 HP1164 HP0824 HP1288 HP1042 HP1458

W. succinogenes WS0073 WS0643 WS0010 WS0452 WS0760 WS0201 WS0454 WS1035 WS0537 WS1001 WS1052 WS0847 WS1374 WS1069 WS1515 WS1557 WS1156 WS1903 WS1747 WS1205 WS2061 WS2008 WS1624 WS2120 WS2119 WS1849 WS2122 WS2069

100 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.4 - continued

Bacterium Locus CXXC CXXS CXXT A. butzleri Abu_0284 Abu_0350 Abu_0518 Abu_0566 Abu_0372 Abu_0575 Abu_0778 Abu_0477 Abu_0579 Abu_0854 Abu_0580 Abu_1127 Abu_0856 Abu_0622 Abu_1556 Abu_0890 Abu_1474 Abu_2010 Abu_1055 Abu_1502 Abu_2165 Abu_1450 Abu_1519 Abu_2243 Abu_1877 Abu_1820 Abu_2328 Abu_2090 Abu_1983 Abu_2091 Abu_2318 Abu_2143 Abu_2187 Abu_2197

101 Chapter 7 Identification of disulfide reductases in Campylobacterales

Table 7.5 Redox proteins with homologues in the four bacterial species. To identify disulfide reductases common to all four Campylobacterales species, BLASTP searches were performed with each of the proteins of Table 7.4 on the translated genomes of the other three bacteria. For identification purposes the ORF numbers corresponding to the H. pylori proteins are given.

Protein ORF Function H. pylori 26695

Thioredoxin (TrxA1) HP0824 Energy metabolism: Electron transport

Thioredoxin (TrxA2) HP1458 Energy metabolism: Electron transport

Thioredoxin reductase (TrxB1) HP0825 Deoxyribonucleotide metabolism

Thioredoxin reductase (TrxB2) HP1164 Energy metabolism: Electron transport Ferredoxin oxidoreductase (OorB) HP0590 Energy metabolism: Anaerobic Ferredoxin oxidoreductase (OorD) HP0588 Energy metabolism: Electron transport Peptidase, U32 family HP0169 Degradation of proteins and peptides Hypothetical protein HP0285 Unknown Disulfide isomerase (Dsb) HP0231 Disulfide bond breakage and formation Putative dehydratase HP0840 Flagellar modification

102 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

CHAPTER 8:

DISULFIDE REDUCTASES AND DRUG RESISTANCE IN CAMPYLOBACTERALES

103 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

8.1 INTRODUCTION Metronidazole (Figure 8.1A) is an important component of therapeutic regimes currently used to treat many microbial infections. Metronidazole is considered a pro-drug whose uptake and activation requires intracellular reduction resulting in the production of cytotoxic short-lived radicals and other reactive species (Figure 8.1B) [Scarpignato, 2004]. The 5-nitroimidazole is activated via interactions with redox systems capable of reducing the low potential (-415 mV) nitro group in position 5 of the imidazole ring (Figure 8.1C) [Scarpignato, 2004]. This property makes Mtr effective against organisms of low intracellular redox state, such as anaerobic bacteria and protozoa, as well as some microaerophiles [Land & Johnson, 1999].

Most C. jejuni strains are considered Mtr-resistant because they survive at concentrations above the 8 )g ml-1 “resistance threshold” defined for the drug [Mendz & Mégraud, 2002]. Although Wolinella DNA has been found in patients with cancer, W. succinogenes is yet to be considered a pathogenic organism. No studies have been published on the susceptibility of A. butzleri to Mtr. On the other hand, Mtr has been used significantly to treat H. pylori infections; thus, H. pylori is the best candidate to study the resistant phenotype further.

The frequent use of metronidazole has resulted in increased resistance to the antibiotic by H. pylori. The emergence of resistant isolates that do not respond to the drug fostered an interest to understand the primary causes of resistance to metronidazole in this bacterium. Extensive investigations on H. pylori established that main causes of metronidazole resistance are mutations in the genes rdxA which encodes an oxygen-insensitive NADPH nitroreductase or frxA which encodes an NAD(P)H flavin oxidoreductase [Debets- Ossenkopp et al., 1999; Goodwin et al., 1998; Kwon et al., 2000a; Kwon et al., 2000b]. However, insufficient data correlating RdxA and/or FrxA with the resistant phenotype, and the fact that a small percentage of resistant strains do not have mutations in either rdxA or frxA indicated that the molecular basis of H. pylori resistance to Mtr has not been characterized completely.

104 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

B Metronidazole Ferredoxin Red

Ferredoxin Oxi Metabolites

DNA fragmentation

Bacterium

C Oxidized DNA and protein Red Ferredoxin - - R-NO2 ˙ O2 ˙ Oxidative damage Ferredoxin Oxi R-NO2 O2

Figure 8.1 Metronidazole. A: the chemical structure of metronidazole; B: the effects of metronidazole inside the cell; C: the futile cycle.

105 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Early studies showed that the oxygen tension has a large impact on the resistance of H. pylori to Mtr [Mendz & Trend, 2001; Smith & Edwards, 1995; Smith & Edwards, 1997; Smith et al., 1998], and several investigations have linked the activities of specific oxidoreductases to the Mtr-susceptible phenotype of the bacterium [Hoffman et al., 1996; Mendz & Trend, 2001; Trend et al., 2001]. These results suggested a possible role in Mtr activation of enzymes catalyzing redox reactions which modulate the intracellular redox status. A type of such enzymes are disulfide reductases whose reactions contribute to the redox balance of the cell. A study with matched pairs of H. pylori Mtr-susceptible strains and Mtr-resistant mutants demonstrated that susceptible strains have higher levels of disulfide reduction, and that the total disulfide reduction activity of the cell is modulated by Mtr [Mendz & Trend, 2001]. Evidence for a role of disulfide reductases in the susceptibility of H. pylori to Mtr was provided by the finding that the alkyl hydroperoxide reductase activity of Mtr-susceptible strains was absent in their Mtr- resistant counterparts [Mendz & Mégraud, 2002; Trend et al., 2001]. Thus, it became important to investigate the role of specific disulfide reduction activities in H. pylori resistance to Mtr.

In this study, the susceptibility of the four Campylobacterales species to Mtr was measured. To investigate the resistant phenotype, Fdx oxidoreductase and two other enzyme activities which use GSSG, L-cystine (Cys-Cys) and DTNB as substrates were identified in H. pylori, and the effects of Mtr on their activities were characterized. The potential involvement of these disulfide reductases in Mtr activation was investigated by measuring the effects of their substrates on the rates of Mtr reduction.

Furthermore, four matched pairs of susceptible and resistant H. pylori strains with different mutations in their rdxA and frxA genes were investigated. The redox state of the cells and the metabolic reduction of five substrates were measured. A more global approach was required to understand the resistant phenotype; thus, changes in the proteome of a matched pair of strains with no mutations in rdxA or frxA and changes induced in the proteome of the Mtr-resistant strain subjected to Mtr were investigated using two-dimensional gel electrophoresis and mass spectrometry. Finally, the

106 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

relationship between intracellular redox status and Mtr resistance was investigated in C. jejuni.

8.2 EXPERIMENTAL PROCEDURES 8.2.1 Bacterial susceptibility to metronidazole C. jejuni strains NCTC 11168 and 81116, H. pylori strains 26695 and J99, W. succinogenes strain DSMZ 1740 and A. butzleri strains NC78, NC97 and NC281 were grown at 37 ºC on CSA plates under microaerobic conditions as previously described. Liquid cultures were grown in vented flasks using 50 ml BHI supplemented with metronidazole at concentrations of 0, 1, 2, 4, 8, 32, 64, 128 and 256 µg ml-1. The susceptibility of C. jejuni strains NCTC 11168, 81116, 100 and RM1221 was measured also using ;test® strips (AB BIODISK, Solna, Sweden).

8.2.2 Helicobacter pylori strains Helicobacter pylori strains SS1, 10827/6, 10593/2 and 10593a/2 from the University of NSW culture collection, and CAS 015 J0, CAS 015 J56, HER 126 V1, HER 126 V4, RIG 117 J0 and RIG 117 J56 from the Université Bordeaux II collection, were grown at 37 °C under an aerobic atmosphere of 5% CO2 in air, in regular CO2 incubators; or a microaerobic atmosphere of 5% CO2, 5% O2 and 90% N2 in a Sony Tri-Carb incubator. The strains were matched pairs isolated from patients with gastritis whose treatment with metronidazole failed. The SS1 resistant strains were constructed by sequential passing on plates containing increasing concentrations of Mtr. Their susceptibilities to metronidazole were confirmed with ;tests. The purity of the cultures was confirmed as H. pylori by positive urease and catalase tests, and motility and morphology observed under phase contrast microscopy. The Mtr phenotype and the status of the rdxA and frxA genes of all these strains are presented in Table 8.1.

8.2.3 Metronidazole ;tests A loopful of bacteria grown microaerobically was inoculated into 1 ml BHI, and the suspension adjusted to a McFarland turbidity of 1.0 (~ 108 cfu ml-1). The suspension was

107 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.1 The status of the rdxA and frxA genes in four H. pylori genetic backgrounds with susceptible and resistant matched pairs. Mtr susceptibilities of the strains were determined using ;tests. The rdxA and frxA genes of each of the strains were sequenced. The (+) symbol represents a gene that is conserved with respect to the sequenced strain H. pylori 26695 and the (-) symbol represents a gene that is nonfunctional either by site or frameshift mutations.

Helicobacter pylori Metronidazole Genes Involved in Nitro Moiety Reduction Strain susceptibility rdxA frxA 10593/2 Susceptible + + 10593a/2 Resistant - + RIG 117 J0 Susceptible + + RIG 117 J56 Resistant + - CAS 015 J0 Susceptible + + CAS 015 J56 Resistant - - HER 126 V1 Susceptible + + HER 126 V4 Resistant + +

108 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

spread onto Blood Agar Base No. 2 containing 5% defibrinated horse blood by swabbing 50 )l of inoculum with a sterile cotton applicator. Using sterile tweezers and avoiding contact with the ;test strip, the antibiotic containing ;test strip was applied at the centre of the agar plate. After 18 h incubation any visible zone of inhibition around the ;test strip was used to determine the susceptibility of the strain. ;test experiments were performed in triplicate.

8.2.4 Nuclear magnetic resonance spectroscopy Proton nuclear magnetic resonance and 14N-NMR free induction decays were collected using a Bruker DMX-600 or a Bruker DMX-500 spectrometer, respectively, operating in the pulsed Fourier transform mode with quadrature detection as previously described.

Reduction rates of GSSG or Cys-Cys were measured employing 1H-NMR spectroscopy 2 in lysates or cell-free extracts suspended in H2O:H2O (1:5 v/v), 10 mM KCl, 25 mM NaCl, and 50 mM potassium phosphate buffer, pH 7.2. Metronidazole reduction was measured employing 14N-NMR spectroscopy in lysate suspensions in the same buffer as 2 for disulfide reduction assays but with H2O:H2O (1:10 v/v), 12 mM Mtr and 30 mM NADH. To assay Mtr reduction, dissolved oxygen was substituted by argon in the samples by bubbling them with the inert gas for 30 min at 4 °C. Mineral oil was layered on top of the samples to stop argon exchange with atmospheric oxygen.

8.2.5 Spectrophotometry DTNB reduction was measured in a Cary-100 UV-visible spectrophotometer using 1 cm path-length cuvettes. The reaction mixture contained cell-free extracts and DTNB suspended in 50 mM Tris-HCl, pH 7.2 buffer in a final volume of 1 ml. DTNB was added just prior to measuring activities, and the change in absorbance at 412 nm over 2 minutes was recorded. At 412 nm, the coefficient of molar absorbance of this ion is 13.6 x 103 mol-1 cm-1.

The kinetics of NADH:ferredoxin oxidoreductase and NADH:FAD reduction for several strains were determined in cell-free extracts by measuring spectrophotometrically at 340

109 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

nm and 25 °C the rates of decrease of NADH levels in the presence of ferredoxin or FAD, respectively. The assay mixture consisted of Tris-HCl (20 mM, pH 7.4), 0.15 mM NADH and ferredoxin at concentrations between 2.2 and 130 )g ml-1 or FAD at concentrations between 0.5 )M and 100 )M. The method was validated by establishing that no oxidation of NADH took place in the absence of cell free extracts. NADH oxidation was observed in suspensions of extracts in the absence of ferredoxin or FAD. Thus, for each sample reductase rates were calculated by subtracting the rate of NADH oxidation in the absence of substrate from the value measured in the presence of substrate. At 340 nm, the coefficient of molar absorbance of NADH is 6.22 x 103 mol-1 cm-1.

The kinetics of nitrofurazone reduction for several strains were determined in cell-free extracts by measuring spectrophotometrically at 400 nm and 25 °C the rates of decrease of nitrofurazone levels in the presence of NADH. The assay mixture consisted of Tris- HCl (20 mM, pH 7.4), 0.15 mM NADH and nitrofurazone at concentrations between 0.5 )M and 100 )M. The method was validated by establishing that no oxidation of nitrofurazone took place in the absence of cell free extracts.

8.2.6 Redox assays Tetrazolium salts are used widely for detecting the redox potential of cells in viability, proliferation and cytotoxicity assays. Bacterial redox potential was determined using the method of Bensaid et al. [2000]. XTT reduction was measured at five different bacterial densities for each of the eight susceptible and resistant strains grown microaerobically or aerobically. XTT reduction was plotted as a function of bacterial density. The method was validated by measuring the change in absorbance of XTT buffer solutions with no bacteria, and including these results in the fits of the data to a straight line.

8.2.7 Calculation of kinetic parameters Michaelis constants (Km) and maximal velocities (Vmax) were calculated by non-linear regression using the Enzyme Kinetics® program (Trinity Software, Compton, NH, USA). The errors in these calculations are determined by the program as ± standard deviation.

110 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

8.2.8 Statistical analyses of results Statistical analyses were performed by determining the mean values and standard deviations for all the susceptible and resistant strains with respect to all substrates. Errors are quoted as ± standard deviation. The mean percentile values and standard deviations for metronidazole reduction rates in assays with specific substrates were determined independently for susceptible and resistant strains using the values obtained in all the assays performed. Errors are quoted as ± standard deviation.

8.2.9 Effects of metronidazole on enzyme activities The effects of Mtr on glutathione and L-cystine reduction was determined by measuring the rates of reduction of the substrates in suspensions of whole bacterial lysates employing 1H-NMR spectroscopy. At substrate concentrations well below the Km the inhibition constant can be calculated from the expression

vo/ v = 1 + I / Ki, where vo and v are the uninhibited and inhibited rates of reduction, respectively, and I is the concentration of inhibitor [Schulz, 1994].

8.2.10 Other procedures Two-dimensional PAGE electrophoresis, image analysis, mass spectrometry identification and subsequent bioinformatics analyses were performed as previously described in the Materials and Methods chapter.

8.3 RESULTS AND DISCUSSION 8.3.1 Campylobacterales susceptibility to metronidazole The net growth of the four Campylobacterales species at Mtr concentrations between 0 and 256 µg ml-1 is shown in Figure 8.2. A. butzleri and C. jejuni were the most tolerant species to Mtr, H. pylori and W. succinogenes were the most susceptible. The results confirmed the resistance of C. jejuni strains to the drug and demonstrated that A. butzleri

111 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

120

100

40 Net growth (%) 20

0 0 2 4 8 32 64

Mtr concentration (µg/ml)

Figure 8.2 Growth of A. butzleri NC281, C. jejuni 81116, H. pylori 26695 and W. succinogenes DSMZ 1740 in media containing Mtr at different concentrations. Liquid cultures were grown at 37 °C under microaerobic conditions. Controls were cultures grown without Mtr. The histogram patterns correspond to percentage growth for A. butzleri: no pattern; C. jejuni: inclined lines; H. pylori: dots; and W. succinogenes: horizontal lines.

112 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

is also resistant. On the other hand, W. succinogenes was shown to be susceptible to the toxic effects of the drug although the bacterium was not totally eradicated at 8 µg ml-1.

The bacterial species from Helicobacteraceae were more susceptible to Mtr than those from Campylobacteraceae. An explanation at the molecular level could be differences between the enzymes responsible for Mtr activation within the species. RdxA and FrxA are involved in the activation of Mtr in H. pylori and W. succinogenes has homologs of the two enzymes, whereas C. jejuni and A. butzleri have a homolog of one. BLASTP searches indicated that WS0720 and WS1508 were homologous to RdxA and FrxA respectively, while CJ1066 and Abu_1062 were the only homologs. The susceptibility of H. pylori to Mtr and its subsequent development of resistance provided a suitable background to study the molecular bases of the activation of the drug.

8.3.2 Helicobacter pylori disulfide reductases and metronidazole Three disulfide reduction activities were detected in H. pylori cell-free extracts which used DTNB, GSSG or Cys-Cys and NADH, and Fdx and NADH as substrates. These activities were measured in all strains tested (data not shown). The enzyme assays were validated with the following controls: (a) no chemical reduction of DTNB, GSSG, Cys- Cys or Fdx was observed under the conditions of the assays in the absence of lysates or cell-free extracts; (b) the enzymatic origin of the reactions was established by determining that no activity was present in suspensions of lysates or cell-free extracts which had been denatured by heating at 80 °C for 2 hours; (c) reduction of GSSG, Cys- Cys or Fdx did not take place if NADH was not present.

Matched pairs of Mtr susceptible and resistant strains were employed to investigate the relationships between disulfide reduction and Mtr reduction. The kinetic parameters of DTNB, GSSG, and Fdx reduction for the 10593/2 matched pair of isolates are given in Table 8.2. The Km and Vmax of DTNB reduction in the resistant strain were smaller than in the susceptible strain. No significant differences were observed in the kinetic parameters of GSSG reduction for the pair of isolates. Ferredoxin reduction was observed in the susceptible isolate but was absent in the resistant one (Table 8.2). In the other

113 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

matched pairs of isolates, Fdx reduction was observed in the resistant strain but the Km values of the reaction were significantly smaller in the resistant isolates than in the susceptible counterparts.

The effects of Mtr on disulfide reduction were investigated by measuring the rates of reduction in the presence of different concentrations of Mtr. The three disulfide reduction activities were inhibited by Mtr. The mode of inhibition was determined by measuring the kinetic parameters of the reductions with and without 0.5 mM Mtr. In the presence of Mtr, larger Km and similar Vmax values were measured, indicating that the inhibition of these activities by Mtr was competitive.

The Ki values for the inhibition of GSSG and Cys-Cys reduction activities of four matched pairs are given in Table 8.3. Larger Ki values were observed in resistant strains than in their susceptible counterparts, suggesting stronger effects of Mtr on the latter. Similar observations were made for the other matched pairs of strains. Statistical analyses of these results were performed and the Ki mean value of the susceptible strains for both substrates, 1.2 ± 0.3 mM, was significantly lower than the mean value for the resistant strains, 3.8 ± 1.1 mM. The data demonstrated that Mtr modulated directly the disulfide reductases and suggested a role for them in Mtr reduction.

Metronidazole reduction was measured in H. pylori lysate suspensions employing 14N- NMR spectroscopy. The rate of Mtr reduction in the 10593/2 Mtr-resistant isolate was significantly lower (p < 0.02) than in the susceptible isolate (Figure 8.3), correlating with the phenotype of the isolates. Similar results were obtained for the RIG 117 and SS1 matched pairs of strains (data not shown). The potential roles of disulfide reductases in Mtr reduction were investigated by performing substrate competition experiments. Metronidazole reduction rates for the susceptible strains were inhibited in the presence of the substrates DTNB (p < 0.03), GSSG (p < 0.02) or Fdx (p < 0.02). The reduction rates for the resistant strains were also inhibited in the presence of the substrates DTNB (p < 0.03), GSSG (p < 0.03) or Fdx (p < 0.03). The results for the 10593/2 matched pair of

114 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.2 Disulfide reduction activities in H. pylori 10593/2 Mtr-susceptible and -resistant cells. DTNB concentrations ranged from 10 μM to 1 mM; GSSG concentrations from 0.5 to 70 mM; and Fdx concentrations from 0 to 80 μg ml-1. NADH concentrations were 50 mM for GSSG assays and 0.2 mM for Fdx assays. Kinetic fits to the Michaelis-Menten equation were performed using 10-13 measured reaction rates. Errors were calculated using the Enzyme Kinetics program from non-linear regression fits to the data.

Isolate Substrates Km Vmax (nmole mg-1 min-1) 10593/2 DTNB 45 ± 3 μM 17 ± 2 Susceptible GSSG:NADH 2.3 ± 0.2 mM 129 ± 4

Fdx:NADH 3.0 ± 0.4 µg ml-1 10 ± 1

10593/2 DTNB 17 ± 2 μM 12 ± 1 Resistant GSSG:NADH 2.8 ± 0.2 mM 166 ± 2

Fdx:NADH No reduction No reduction

115 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.3 Metronidazole inhibition constants (Ki) of disulfide reductase activities for Mtr- susceptible and Mtr-resistant strains. Enzyme activities were measured in lysates suspended in potassium phosphate or Tris-HCl buffer for the GSSG and Fdx assays, respectively. Five rates were used for each inhibition plot. Errors were determined from the best-fitted line in each inhibition plot.

Ki (mM)

Strain Substrates Susceptible Resistant

SS1 GSSG 1.1 ± 0.2 5.5 ± 0.8

10593/2 GSSG 1.6 ± 0.1 2.8 ± 0.3

Cys-Cys 1.3 ± 0.2 3.9 ± 0.5

10827/6 Cys-Cys 0.7 ± 0.1 2.7 ± 0.4

RIG 117 Cys-Cys 1.2 ± 0.2 4.1 ± 0.6

116 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

35 10593/2 Susceptible 30 10593/2 Resistant

Reduction rateReduction (nmole/min/mg) 5

0 Control DTNB GSSG Fdx Metabolite added

Figure 8.3 Metronidazole reduction activities of H. pylori 10593/2 susceptible and resistant lysates from cells grown under microaerobic conditions. Lysates were suspended in phosphate buffer and subjected to argon treatment for 30 minutes to substitute oxygen by this inert gas. Initial substrate concentrations were 12 mM Mtr and 30 mM NADH. DTNB, GSSG and Fdx were added at concentrations of 15 μM, 4 mM and 0.17 mg ml-1 for the susceptible lysates and 30 μM, 6 mM and 0.17 mg ml-1 for the resistant lysates. Errors were calculated from the straight line fitting of the values used to determine the Mtr reduction rates.

117 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

isolates are shown in Figure 8.3. Together with previous findings these results provided evidence that disulfide reductases play a role in the activation of Mtr, and thus, in the susceptibility of H. pylori to this antibiotic.

The role of these reductase activities in the resistant phenotype needed to be investigated further, as well as putative molecular mechanisms relating these disulfide reductases to the activities of RdxA and FrxA.

8.3.3 Molecular basis of a novel metronidazole resistance mechanism 8.3.3.1 Helicobacter pylori matched pairs of susceptible and resistant strains Several factors besides RdxA and FrxA affect H. pylori resistance to Mtr, but none have been considered causes of resistance. One such example is the oxygen content of the growth atmosphere, where resistant bacteria grown under oxygen-depleted conditions become susceptible to Mtr [Smith & Edwards, 1995; Smith & Edwards, 1997]. The majority of studies on Mtr resistance focused on the two genes involved in the resistant phenotype of the bacterium, rdxA and frxA. The emergence of resistant strains that have no mutations in either gene implied that other factors not only affected but caused the resistant phenotype.

The rdxA and frxA genes of matched pairs of strains isolated from patients after a failed treatment with Mtr were sequenced. H. pylori matched pairs were chosen to eliminate any bias arising from differences in the genetic backgrounds of the strains studied. The Mtr susceptibilities of the matched pairs were tested using ;tests repeated in triplicate. The “resistance threshold” of 8 µg ml-1 was employed to classify strains as susceptible or resistant following standard clinical practice. The MIC values of susceptible strains were less than 0.38 µg ml-1 and for resistant strains ranged between 128 and 256 µg ml-1.

Four matched pairs were chosen because they contained the four different possible combinations of changes in the two genes of interest. In the 10593/2 matched pair, the 10593a/2 resistant counterpart contains a mutation which deactivated the rdxA gene; in the RIG 117 matched pair, the resistant strain contains a mutation which deactivated the

118 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

frxA gene; in the CAS 015 matched pair, the resistant strain contains a mutation which deactivated both genes; and in the HER 126 matched pair, the resistant strain contains no mutations in either gene (Table 8.1). Thus, the matched pairs include four susceptible parent strains and four resistant mutants.

8.3.3.2 Metronidazole reduction in matched pairs of strains Metronidazole reduction was measured in lysate suspensions of each of the eight strains grown microaerobically and aerobically (Table 8.4). Mtr reduction was measured also in the same lysates subjected to argon treatment which was employed to displace oxygen from the samples (Table 8.4). The measurements under aerobic conditions served to establish the effect of oxygen in the growth atmosphere on the enzymes involved in the Mtr resistant phenotype. The measurements on the samples subjected to argon treatment served to determine if oxygen in the samples modulated the activities of the enzymes involved in the reduction of the nitro group of Mtr.

The results indicated that all resistant strains reduced Mtr less than their susceptible parent strains whether grown microaerobically or aerobically (Table 8.4). The general hypothesis is that H. pylori strains become resistant when the activation of the drug, i.e. reduction is inhibited. The finding that resistant strains reduce Mtr less than their susceptible counterparts supported this observation.

The effect of the oxygen tension in the growth atmosphere on reduction rates was variable. Mtr reduction increased in some H. pylori strains grown aerobically but in other cases the increase was not significant (Table 8.4). In the 10593/2 matched pair no significant difference was observed between cells grown microaerobically or aerobically, while a difference was measured for the RIG 117 matched pair. Only the resistant strains of the CAS 015 and HER 126 matched pairs showed significantly different rates when grown aerobically. These findings indicated that H. pylori cells grown aerobically may become slightly more susceptible to Mtr than cells grown microaerobically. A study on Trichomonas vaginalis found that susceptibilities of strains were also modulated by the

119 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.4 Metronidazole reduction activities of H. pylori lysates from matched pairs of susceptible and resistant strains prepared from cells grown under microaerobic and aerobic conditions. Lysates were suspended in phosphate buffer and, where stated, subjected to argon treatment for 30 minutes. Initial substrate concentrations were 12 mM Mtr and 30 mM NADH. Errors were calculated from the straight line fitting of the values used to determine the Mtr reduction rates.

Helicobacter Metronidazole reduction velocities (nmol min-1 mg-1) pylori Strain Microaerobic Aerobic

Oxygenated Argonized Oxygenated Argonized

10593/2 14 ± 2 32 ± 4 16 ± 2 36 ± 4

10593a/2 9 ± 1 13 ± 2 10 ± 1 15 ± 2

RIG 117 J0 19 ± 2 32 ± 3 27 ± 3 33 ± 4

RIG 117 J56 13 ± 1 16 ± 2 19 ± 2 20 ± 2

CAS 015 J0 15 ± 2 29 ± 3 18 ± 2 31 ± 3

CAS 015 J56 9 ± 1 14 ± 1 13 ± 1 15 ± 1

HER 126 V1 18 ± 2 20 ± 2 22 ± 2 25 ± 3

HER 126 V4 10 ± 1 11 ± 1 14 ± 1 18 ± 2

120 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

oxygen content of the growth atmosphere [Meri et al., 2000]. Interestingly, two of the T. vaginalis strains showed similar characteristics to some H. pylori strains where their resistance followed a bell-shaped curve when plotted against the oxygen content of the growth atmosphere. Other T. vaginalis strains showed no change between microaerobically and aerobically grown cells similar to the other H. pylori strains.

Metronidazole reduction increased dramatically in most samples subjected to argon treatment (Table 8.4); hence, the availability of oxygen in the sample correlated inversely with drug reduction. Subjecting a sample to argon treatment created a more reducing environment, and would explain the higher reduction rates of Mtr. These findings supported a role for oxygen and the redox potential in metronidazole activation. In addition, they provided further evidence that resistant strains grown anaerobically become susceptible. Interestingly, subjecting the sample to argon treatment had little or no effect on Mtr reduction in the HER 126 matched pair of strains. This may reflect differences in the intracellular redox status of the HER 126 strains relative to the other strains.

The ratios between the rates of reduction of susceptible and resistant strains grown microaerobically or aerobically and not subjected to argon were approximately 1.5. This result indicated that irrespective of the oxygen tension of the growth atmosphere susceptible strains not subjected to argon treatment reduced Mtr about 1.5 times more than their resistant counterparts for all matched pairs. Also, the data indicated that Mtr reduction increased under aerobic conditions in both susceptible and resistant strains reflecting an increase in the activity of Mtr-reducing enzyme(s) under aerobic conditions. To be noted is that these enzymes are not directly involved in the formation of the Mtr resistant phenotype.

The ratios of the rates of reduction between susceptible and resistant strains grown microaerobically or aerobically and subjected to argon treatment were higher than those untreated except for the HER 126 matched pair for which the ratio did not change. Excluding these strains, the results demonstrated that argon treatment affected the

121 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

activities of susceptible strains more than those of the resistant strains. This revealed a direct association between displacement of oxygen from the samples and the activities of enzymes involved in the resistant phenotype. In addition, the findings provided evidence of differences between the HER 126 resistant phenotype and the other matched pairs. An explanation is that the enzymes of the HER 126 susceptible strain which reduce Mtr have unique characteristics and the modulation of their activity was sufficient to develop resistance to Mtr. Thus, the resistant phenotype does not need inactivation of the rdxA or frxA genes. Moreover, it is possible that in the other matched pairs the combined effects of the regulation of these enzyme activities and mutations of rdxA and/or frxA were the cause of resistance.

8.3.3.3 Redox status of matched pairs of strains The results of this chapter implicated the intracellular redox status of the cells in H. pylori Mtr resistance. Tetrazolium salts were used for determining the redox potential of cells, thus, the redox status of the bacterial cells was assessed using XTT.

XTT reduction was measured for each strain at several bacterial densities. Graphs of XTT reduction versus bacterial density were plotted for cells grown microaerobically or aerobically. The experimental points fitted linear equations with squared regression coefficient values equal to or greater than 0.95. The slopes of the lines for each strain and condition represented the rate of XTT reduction with respect to bacterial density and are given in Table 8.5. The slope values increased from susceptible to resistant strains for each matched pair, although for the HER matched pair of strains grown microaerobically it did not increase significantly. The slope values also increased from cells grown microaerobically to aerobically, except for the CAS 015 susceptible strain which remained the same.

XTT reduction is linked to the electron transport chain of the bacterium. An increase in XTT reduction would reflect activated aerobic respiration. This in turn is a sign of an elevated intracellular redox potential (as in aerobes), which would result in the decrease in activation of Mtr (-415 mV).

122 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.5 XTT reduction as a function of bacterial density for each of the eight susceptible and resistant strains grown microaerobically and aerobically. XTT reduction was measured at five different bacterial densities as described by Bensaid et al. [2000]. The method was validated by measuring the change in absorbance with no bacteria.

Helicobacter pylori strain XTT reduction as a function of bacterial density

Microaerobic Aerobic

10593/2 0.08 (R2 = 0.998) 0.11 (R2 = 0.997)

10593a/2 0.55 (R2 = 0.997) 0.64 (R2 = 0.962)

RIG 117 J0 0.18 (R2 = 0.954) 0.21 (R2 = 0.997)

RIG 117 J56 0.24 (R2 = 0.996) 0.69 (R2 = 0.999)

CAS 015 J0 0.18 (R2 = 0.996) 0.18 (R2 = 0.998)

CAS 015 J56 0.35 (R2 = 0.985) 0.55 (R2 = 0.950)

HER 126 V1 0.09 (R2 = 0.980) 0.13 (R2 = 0.986)

HER 126 V4 0.09 (R2 = 0.990) 0.18 (R2 = 0.989)

123 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

The experiments identified variations in the reduction of a redox potential indicator between Mtr susceptible and resistant strains of different genetic backgrounds.

8.3.3.4 Metabolic changes in the matched pairs of strains Several enzyme activities were measured to determine if there are differences in the metabolism of the matched pairs. The four substrates chosen were GSSG, FAD, Fdx and nitrofurazone. Glutathione is a redox metabolite and was shown to inhibit Mtr reduction (Fig. 8.3); FAD is a substrate of FrxA; Fdx is a low potential protein and was shown to inhibit Mtr reduction (Fig. 8.3); and nitrofurazone is a high redox potential nitrogen based drug and a substrate of RdxA.

The Km value for GSSG reduction did not change between susceptible and resistant strains for the RIG 117 and CAS 015 matched pairs (Table 8.6). A slight increase in the Km of the resistant strain was observed for the 10593/2 matched pair (Table 8.6), and the resistant strain in the HER 126 matched pair had a significantly higher Km than its susceptible counterpart. An increase in Km meant that the enzymes reducing GSSG had less affinity for the substrate, suggesting a difference in the modulation of the redox environment of the resistant strain.

The Km value for FAD reduction was higher in the resistant strains except for the HER 126 matched pair (Table 8.6). The change in Km did not correlate with the inactivation of FrxA suggesting that several other enzymes were involved in the reduction of FAD. The difference in Km between susceptible and resistant strains suggested that at least some of those other enzymes participated also in Mtr reduction. For example, in the 10593/2 matched pair which contains an active FrxA, the Km value was approximately 50 times higher in the resistant strain.

The Km values of Fdx reduction did not follow any pattern. In the 10593/2 matched pair, no activity was detected in the resistant strain (Table 8.6). In the RIG 117 and HER 126

124 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.6 Michaelis constants for GSSG, FAD, Fdx and nitrofurazone reduction activities in H. pylori Mtr-susceptible and -resistant matched pairs of strains. GSSG concentrations used ranged from 0.5 to 70 mM; FAD and nitrofurazone concentrations from 0.5 )M to 100 )M; and Fdx concentrations from 0 to 80 μg ml-1. NADH concentrations were 0.15 mM for FAD, Fdx and nitrofurazone assays, and 50 mM for GSSG assays. Kinetic fits were performed using 10-13 rates. Errors were calculated using the Enzyme Kinetics® program from non-linear regression fits to the data.

Helicobacter Michaelis constants for reduction activities pylori Strain GSSG (mM) FAD ()M) Ferredoxin ()g ml-1) Nitrofurazone ()M)

10593/2 2.3 ± 0.2 2.1 ± 0.3 3.0 ± 0.4 2.8 ± 0.3

10593a/2 2.8 ± 0.2 95 ± 10 No activity 8.1 ± 1.4

RIG 117 J0 4.9 ± 0.4 2.4 ± 0.3 44 ± 5 8.8 ± 1.8

RIG 117 J56 4.5 ± 0.5 6 ± 1 24 ± 4 13.1 ± 2.1

CAS 015 J0 5.0 ± 0.5 5 ± 1 23 ± 4 6.0 ± 0.9

CAS 015 J56 4.7 ± 0.5 11 ± 2 40 ± 5 8.5 ± 2.1

HER 126 V1 3.0 ± 0.2 24 ± 2 44 ± 7 3.3 ± 0.6

HER 126 V4 5.2 ± 0.6 17 ± 2 11 ± 2 6.8 ± 1.1

125 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

matched pairs, the Km values decreased in the resistant strain, and in the CAS 015 the value increased in the resistant strain (Table 8.6). These results suggest that H. pylori has a system of enzymes involved in Fdx reduction, some of which also participated in Mtr reduction.

The Km value for nitrofurazone reduction was higher in the resistant strains; however, the increase in the CAS 015 matched pair was not significant (Table 8.6). Nitrofurazone is a medium redox potential (-257 mV) nitrogen-based compound with a nitro group similar to that in Mtr. Thus, the enzymes capable of reducing Mtr would be capable of reducing nitrofurazone. The higher Km values in the resistant strains meant the enzymes had less affinity for the substrate which would result in a lower drug reduction. The data support our previous findings where resistant strains decreased Mtr activation.

These data demonstrated that the reduction of substrates that compete with Mtr involved a more complex metabolism that the activities of RdxA and FrxA. Hence, a more global approach was undertaken to investigate the resistant phenotype in H. pylori.

8.3.3.5 Proteomic analyses of Helicobacter pylori strains HER 126 V1 and HER 126 V4 Two-dimensional gel electrophoresis combined with tandem mass spectrometry were employed to identify the differences in protein expression between H. pylori strains HER 126 V1 and HER 126 V4 (Fig. 8.4, Table 8.7). Eight proteins were identified as downregulated and ten upregulated in the resistant strain relative to the susceptible one (Table 8.7). In addition, three proteins showed a change in pI in the HER 126 V4 gel in comparison to the HER 126 V1 gel. Protein identifications were performed using the three available H. pylori genomes and are presented using the open reading frame numbers in the 26695 genome.

A subunit of DNA polymerase III encoded by hp0500 and a RNA polymerase encoded by hp1293 were downregulated in strain HER 126 V4. Metronidazole was found to be a rapid inhibitor of DNA replication in Bacteroides fragilis but did not have an effect on DNA polymerase activity [Sigeti et al., 1983]. Exposure of H. pylori to Mtr may result in

126 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

the inhibition of DNA replication and could lead the bacterium to downregulate DNA polymerases and associated enzymes. Hence, the regulation of these enzymes may be a response of the bacterium to direct effects of Mtr and not a factor of the resistant phenotype.

Glutamine synthetase was downregulated in HER 126 V4. This enzyme has a central role in nitrogen metabolism by synthesizing glutamine from glutamate and ammonia. The enzyme’s downregulation would lead to increased levels of glutamate and decreased levels of glutamine in the cell. The excess glutamate could be converted to - ketoglutarate, an intermediate of the citric acid cycle and thus, results in the upregulation of the cycle. Upregulation of the TCA cycle would yield an increase in ATP synthesis by substrate level phosphorylation in the reaction catalyzed by succinyl-CoA synthetase. Glutamine is a precursor of ornithine which can be converted to citrulline in a reaction that requires ATP [Leigh & Dodsworth, 2007]. Lower concentrations of glutamine could lead to a decline in ornithine levels. Bacterial cells may compensate for an ornithine deficit by converting arginine to ornithine through citrulline [Poolman et al., 1987]. Upregulation of HP0049, a hypothetical protein predicted as peptidyl arginine deaminase responsible for the conversion of arginine to citrulline suggested that this was the mechanism employed by H. pylori to restore ornithine levels.

A subunit of 3-oxoadipate-CoA transferase encoded by hp0691 was downregulated in the HER 126 V4 strain. The protein is a component of a functional pathway in which benzoate is degraded via hydroxylation and converts succinyl-CoA and 3-oxoadipate to succinate and 3-oxoadipyl-CoA. Benzoate hydroxylation is a measure of oxidative stress in humans [Gronow et al., 2005], and has been used also to determine hydroxyl radical production in cells [Chen & Schopfer, 1999]. Thus, the downregulation of the transferase in H. pylori may be related to an increase in oxidative stress resulting from the initial addition of Mtr to the cells. In addition, the conserved succinyl-CoA could be employed in the TCA cycle to generate ATP as discussed before.

127 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

HER 126 V1 HER 126 V4

A B C

Figure 8.4 Two-dimensional profiles of Helicobacter pylori HER 126 V1 (left) and HER 126 V4 (right) proteomes (pI 4–7). Proteins differentially expressed between the two growth conditions are listed on Table 8.7. The protein spots labelled in both gels represent (A) thioredoxin reductase and fructose-1,6-bisaldolase; (B) thioredoxin reductase; (C) fructose-1,6-bisaldolase.

128 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.7 Differences in the proteomes of the H. pylori strains HER 126 V1 and HER 126 V4 mapped using two-dimensional gel electrophoresis. Protein spots with changes in their intensity (0 0.5-fold or 1 2-fold) or in their position along the horizontal axis (pI) were identified by mass spectrometry analyses.

Regulation Gene ORF Protein Name Downregulated hp0500 DNA polymerase III subunit beta hp0512 Glutamine synthetase hp0591 Ferredoxin oxidoreductase " subunit hp0691 3-Oxoadipate CoA transferase subunit A hp0695 Hydantoin utilization protein A hp0697 Hypothetical protein hp1110 Pyruvate ferredoxin oxidoreductase hp1293 DNA-directed RNA polymerase, alpha subunit

Upregulated hp0002 Riboflavin synthase subunit beta hp0049 Hypothetical protein hp0105 S-ribosyl homocysteinase hp0107 Cysteine synthase hp0115 Flagellin B hp0601 Flagellin A hp0783 Hypothetical protein hp0870 Flagellar hook protein hp1046 Hypothetical protein hp1134 ATP synthase subunit A pI change hp0389 Superoxide dismutase hp0825 Thioredoxin reductase hp1563 Alkyl hydroperoxide reductase

129 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

The beta subunit of riboflavin synthase which is encoded by hp0002 was upregulated in the Mtr resistant strain. The enzyme is involved in the generation of riboflavin which is a central component of FAD and FMN. Interestingly, FAD is a substrate of FrxA and increased levels of the dinucleotide would compete with Mtr as a substrate of the enzyme resulting in the inhibition of Mtr reduction. Riboflavin plays a key role in energy metabolism, and is required for the metabolism of fats, carbohydrates, and proteins, thus, the resistant cells may use increased concentrations of riboflavin to repair the damage caused by exposure to Mtr.

Cysteine synthase was upregulated in the resistant strain HER 126 V4. This protein converts O3-acetyl-L-serine and hydrogen sulfide to L-cysteine and acetate [Warrilow & Hawkesford, 2000]. An increase in the requirements for cysteine arising from its role in redox metabolism may explain the upregulation of the synthase. S-ribosyl homocysteinase (LuxS) is found in the same predicted operon as cysteine synthase and also was upregulated. It has a critical role in global regulation of flagellar gene transcription in H. pylori [Rader et al., 2007]. This finding together with the upregulation of the flagellin proteins encoded by HP0115 and HP0601, and the flagellar hook protein encoded by hp0870 suggested an increased motility in the resistant phenotype. Upregulation of ATP synthase subunit A suggested an increase in energy requirement in the form of ATP, possibly required for the higher motility and was consistent with increased synthesis of ATP in the TCA cycle. Finally, the gene encoding the upregulated hypothetical protein HP1046 is predicted to be in a regulon with LuxS and cysteine synthase. The predicted regulon also includes HP1505, a riboflavin biosynthesis protein. Thus, these results suggested that the regulon was upregulated in the resistant strain.

The hydantoin utilization protein A encoded by hp0695 was downregulated in the resistant strain. Hydantoin, also known as glycolylurea, is a heterocyclic organic compound produced from glycolic acid and urea [Ware, 1950]. Its chemical structure is similar to imidazolidine, the hydrogen-saturated analogue of imidazole, except that the molecule has carbonyl groups at the 2 and 4 positions of the ring [Ware, 1950]. The ability of HP0695 to utilize hydantoin could mean it is able to metabolize compounds

130 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

with structures similar to imidazole such as Mtr. Thus, the resistant strain would downregulate this protein to decrease the activation of the drug. The protein HP0697 is a hypothetical protein predicted to be in the same operon as HP0695. Downregulation of HP0697 supported its involvement in hydantoin utilization.

Ferredoxin oxidoreductase " subunit and pyruvate ferredoxin oxidoreductase were downregulated in the resistant strain. Both proteins have a common function in the reduction of the low potential Fdx. The decrease in the levels of enzymes capable of reducing low potential substrates meant that if they are involved in Mtr reduction activation of the drug would decrease. Reduced Fdx is capable of activating Mtr [Sisson et al., 2000], hence, downregulation of enzymes capable of converting Fdx to its reduced form would result in a decrease in the concentration of reduced Fdx in the system, leading to a decrease in reduction of Mtr. The downregulation of Fdx reduction is a potential novel resistance mechanism in H. pylori which is discussed further below.

The three proteins thioredoxin reductase, superoxide dismutase and alkyl hydroperoxide reductase were identified in different positions on the HER 126 V1 and HER 126 V4 gels. The protein spot labeled A on the HER 126 V1 gel was identified as both thioredoxin reductase and fructose-1,6-bisaldolase; the protein spots labeled B and C on the HER 126 V4 gel were identified as thioredoxin reductase and fructose-1,6- bisaldolase, respectively (Fig. 8.4). In addition, bioinformatic analyses demonstrated that the spots identified as superoxide dismutase and alkyl hydroperoxide reductase in the black boxes had different positions on the HER 126 V1 and HER 126 V4 gels (Fig. 8.4). There is an association between the redox potential of a protein and its pI [Moore et al., 1986; Wait et al., 2005]. The change on the horizontal (pI) axis of three redox proteins indicated a change in their pI, which could reflect a modification to suit the intracellular milieu of the Mtr resistant strain. Moreover, the change in XTT reduction rates between the susceptible and resistant strains measured in three matched pairs but not in the HER 126 strains could be a result of HER 126 V4 undergoing alterations in the pI of individual proteins, and not necessarily the overall intracellular redox status of the cell.

131 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

8.3.3.6 Analyses of the proteome of H. pylori strain HER 126 V4 grown under Mtr stress Two-dimensional gel electrophoresis combined with tandem mass spectrometry were employed to identify changes in protein expression of H. pylori strain HER 126 V4 exposed to 8 µg ml-1 Mtr (Fig. 8.5, Table 8.8). Eleven proteins were identified as downregulated and eight as upregulated in the resistant strain exposed to Mtr (Table 8.8). No proteins were identified as having a different position across the horizontal axis indicating this change was restricted to the resistant strain relative to the susceptible one. Protein identifications were performed using the three available H. pylori genomes and were presented using the open reading frames in the 26695 genome. Five proteins downregulated under Mtr stress were of unknown function or not considered contributors to the resistance against Mtr. Their downregulation was believed to be a result of a response of the cells to the negative effects of the drug. These included a hypothetical protein encoded by hp0152 predicted to be a periplasmic solute-binding protein, the heat shock protein ClpB, a trigger factor encoded by hp0795, the peptide chain release factor 2, and a transaldolase encoded by hp1495.

Cystathionine gamma-synthase (MetS) encoded by hp0106 was downregulated under Mtr stress. The gene is in an operon with the genes encoding LuxS and cysteine synthase found to be upregulated in the resistant strain with respect to the susceptible one. MetS converts O-phosphohomoserine and cysteine to cystathionine in the first reaction of a pathway that converts cysteine to methionine [Kim et al., 2002]. The requirement of cysteine to combat the oxidative stress caused by Mtr could lead to the downregulation of this enzyme in order to maintain the levels of the free amino acid. A decrease in methionine concentrations owing to downregulation of MetS could lead to a downregulation of S-adenosylmethionine (SAM) synthetase which converts methionine into SAM [Kim et al., 2002]. Cysteine desulfurase is involved in the conversion of L- cysteine into L-alanine [Mihara & Esaki, 2002]. The downregulation of this enzyme could be intended to conserve cysteine in order to be used in combating oxidative stress. The upregulation of alkyl hydroperoxide reductase (AhpC) supported the hypothesis of a general cell response to counteract oxidative and/or nitrosive stress since this enzyme is known to be important for defending bacteria against both stresses [Baker et al., 2001].

132 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

HER 126 V4 HER 126 V4 & Mtr

Figure 8.5 Two-dimensional protein profiles (pI 4–7) of Helicobacter pylori HER 126 V4 cells grown without Mtr (left) or in the presence of 8 µg ml-1 Mtr (right). Proteins differentially expressed between the two growth conditions are listed in Table 8.8. Examples of regulated proteins are shown with arrows.

133 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.8 Helicobacter pylori HER 126 V4 proteins (pI 4-7) whose expression is modulated in the presence of 8 µg ml-1 Mtr. Proteins with changes in their intensity (0 0.5-fold or 1 2- fold) were identified by mass spectrometry analyses.

Regulation Gene ORF Protein Name Downregulated hp0106 Cystathionine gamma-synthase hp0152 Hypothetical protein hp0171 Peptide chain release factor 2 hp0197 S-adenosylmethionine synthetase hp0220 Cysteine desulfurase hp0264 Heat shock protein (ClpB) hp0589 Ferredoxin oxidoreductase subunit hp0795 Trigger factor hp0900 Hydrogenase expression/formation protein hp1164 NADPH reductase hp1495 Transaldolase

Upregulated hp0072 Urease beta subunit hp0115 Flagellin B hp0570 Leucyl aminopeptidase hp0601 Flagellin A hp0653 Ferritin hp0837 Conserved hypothetical protein hp1134 ATP synthase F1, subunit alpha hp1563 Alkyl hydroperoxide reductase AhpC

134 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Its upregulation in H. pylori under Mtr stress was observed also in a study by McAtee et al. [2001]. Exposure to Mtr induced also an upregulation of ferritin which is involved in iron storage and has an important function in controling the production of hydroxyl radicals arising from Fenton reactions in which iron participates. Furthermore, leucyl aminopeptidase has a role in glutathione turnover in the cell owing to its ability to hydrolyze Cys-Gly [Cappiello et al., 2004], and this enzyme was upregulated under Mtr stress. Although H. pylori does not synthesize glutathione, this enzyme may be involved in the turnover of this and other disulfide-containing compounds. The increased requirement of cysteine, the possible increase in disulfide turnover, and the upregulation of proteins involved in oxireduction suggested that an important component of the response of H. pylori was to defend itself against the oxidative and nitrosive stresses that arose from Mtr activation.

Flagellin A and B and the flagellin hook protein were upregulated in the resistant strain compared to the susceptible one (Table 8.7). Exposure to Mtr upregulated the expression of both flagellins in the resistant strain. These proteins appear to be induced by stress to help the bacterium escape the harmful effects of the drug. At variance with McAtee et al. [2001], a subunit of ATP synthase was found to be upregulated. This result is cogent with the finding that another subunit of ATP synthase was upregulated in the resistant strain relative to the susceptible one. An increase in the requirement for ATP would arise from the need to combat effects of Mtr, such as powering the flagella. Protein HP0837 annotated as a hypothetical protein was upregulated. The gene encoding this protein is predicted to be in the same operon as hp0840 which encodes for FlaA1, and in the same regulon as several other genes encoding flagella-associated proteins such as a flagellar hook assembly protein, FliQ and FliI. This indicated the upregulation of a hypothetical protein whose function is predicted to be associated with the flagella of H. pylori.

The hydrogenase expression/formation protein encoded by hp0900 was downregulated under Mtr stress. Hydrogenases have been implicated in the activation of Mtr in other organisms [Hrdý et al., 2005]. For example, an alternative pathway of Mtr activation was identified in T. vaginalis hydrogenosomes which involved also an NADH oxidoreductase

135 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

[Hrdý et al., 2005]. The beta subunit of urease was upregulated under Mtr stress. Both H. pylori hydrogenase and urease are involved in nickel homeostasis [Schauer et al., 2007], and the upregulation of urease expression may be a compensatory effect to the downregulation of another nickel-associated enzyme. Alternatively, the upregulation could be related to nitrogen metabolism since this process was already implicated with the downregulation of glutamine synthetase previously. Both urease and flagella- associated proteins have been identified as essential for H. pylori colonization of its host. The upregulation of these proteins pointed towards an enhanced ability of bacteria exposed to Mtr to colonize the host, thus, posing a greater risk to humans.

The expression of two proteins involved in the Fdx reduction cycle were found to be downregulated in the presence of Mtr as was found in the resistant strain compared to the susceptible one. The proteins are ferredoxin oxidoreductase subunit encoded by hp0589, and NADPH reductase (TrxB2 re-named FqrB) encoded by hp1164. It has been hypothesized that FqrB functions in providing electrons for PFOR activity [St. Maurice et al., 2007]; PFOR directly reduces Fdx in the presence of pyruvate [Hughes et al., 1998], providing Mtr with reduced ferredoxins for its activation. It has been shown that Mtr inhibits ferredoxin-associated processes [Tetley & Bishop, 1979], and that resistance mechanisms in various organisms are dependent on the availability of reduced Fdx. The downregulation of the two proteins involved in Fdx reduction suggested a decreased capacity to reduce ferredoxin that would decrease the activation of Mtr. The downregulation of pyruvate ferredoxin oxidoreductase more than two-fold in a rdxA knockout mutant upon addition of Mtr [McAtee et al., 2001], indicated that the phenotype is not only associated with HER 126 V4 but other resistant strains with mutations in the genes of interest. Finally, the results of enzymatic investigations showed that the addition of Fdx inhibited the reduction of Mtr in H. pylori 10593/2 matched pair of susceptible and resistant strains (Fig. 8.3), as well as in strains RIG 117 J0, J99, RSB6 and 26695 (data not shown). Interestingly, after addition of Fdx, Mtr reduction levels in susceptible strains were equal to levels found in the resistant counterpart (Fig. 8.3). The enzymatic and proteomic data provided evidence for a novel Mtr resistance mechanism in H. pylori, and revealed that Fdx-reducing enzymes could be potential therapeutic targets

136 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

for both Mtr susceptible and resistant strains, since they are essential to H. pylori [Hughes et al., 1998].

8.3.4 Metronidazole resistance of Campylobacter jejuni strains Differences in the oxygen susceptibility of various strains of a bacterium could reflect subtle changes in the redox status of the cells and, by modulating metabolic functions, the different intracellular redox potentials could result in other phenotypic changes. For example, resistance to drugs whose activation depends on the intracellular redox potential may differ between strains with various oxygen tolerances. The levels of metronidazole resistance were found to be different among four C. jejuni strains tested (Table 8.9). For the strains investigated, their metronidazole resistance correlated inversely with their oxygen susceptibility; determined by the highest cell density which did not grow under aerobic conditions. The more susceptible to oxygen was a strain, the less resistant to metronidazole (Table 8.9).

An interpretation of these results is that a greater oxygen tolerance would represent an intracellular milieu with a higher redox potential (more aerobic); or conversely, the redox potential of a strain more susceptible to oxygen will be an intracellular environment with a low redox potential (more anaerobic). Reduction of Mtr requires a low redox potential, hence a more anaerobic environment would facilitate activation of Mtr and render the cells more susceptible to the drug.

8.4 CONCLUSION This investigation determined the susceptibility of four Campylobacterales species to metronidazole. It provided a conclusive association between Mtr reduction and resistance to the drug in H. pylori. It showed that the resistance phenotype is more complex than the inactivation of the two rdxA and frxA genes and provided support for oxygen and the intracellular redox status to have a role in the resistant phenotype. This conclusion was supported by the observation of changes in the pI of proteins involved in oxireduction reactions. The study identified novel aspects of the resistance mechanisms of H. pylori to

137 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Table 8.9 The oxygen tolerance and metronidazole susceptibility of four C. jejuni strains. The values under ‘oxygen tolerance’ correspond to the highest density of cells where no aerobic growth was observed (Chapter 4).

C. jejuni strain Oxygen tolerance Metronidazole MIC NCTC 11168 5 x 104 cfu ml-1 256 ± 30 )g ml-1 100 5 x 105 cfu ml-1 20 ± 4 )g ml-1 81116 1 x 106 cfu ml-1 14 ± 4 )g ml-1 RM1221 3 x 106 cfu ml-1 10 ± 4 )g ml-1

138 Chapter 8 Disulfide reductases and drug resistance in Campylobacterales

Mtr; namely, the downregulation of hydantoin-utilizing proteins and ferredoxin reduction. Finally, the upregulation of flagella-associated proteins and urease in a resistant strain meant that resistant strains are likely to be more pathogenic than their susceptible counterparts. Further evidence associating Mtr resistance and intracellular redox status was provided when metronidazole resistance of C. jejuni strains correlated inversely with their oxygen susceptibility.

139 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

CHAPTER 9:

DISULFIDE REDUCTASES AND METAL DETOXICATION IN CAMPYLOBACTERALES

140 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

9.1 INTRODUCTION Cadmium ions (Cd2+) are a potent carcinogen in animals, and cadmium is a toxic metal of significant environmental and occupational importance for humans [Bertin & Averbeck, 2006; Filipi6 et al., 2006; Navarro Silvera & Rohan, 2007; Valko et al., 2006]. Cadmium is not a redox-active metal and does not participate in Fenton type-reactions. Moreover, it does not bind to DNA or interact with DNA in a stable manner [Bertin & Averbeck, 2006; Filipi6 et al., 2006]. The negative effects of cadmium on human health are accentuated by its low excretion rate (half-life of 30 years), and consequent accumulation in the organism [Filipi6 et al., 2006; Nau6ien et al., 2002].

Several mechanisms have been proposed to explain how bacteria and lower eukaryotes protect themselves against cadmium toxicity. These include the accumulation of intracellular Zn2+, the reduction of Cd2+ uptake, the enhanced expression of the low- molecular weight cysteine-rich protein metallothionein which sequesters cadmium, the binding of cadmium ions by other heavy metal-associated proteins, and the increase in intracellular disulfide content that will contribute to binding cadmium effectively [Ron et al., 1992].

Disulfide reductases are responsible for the modulation of intracellular disulfide concentrations. They are essential enzymes in the antioxidant mechanisms of many bacteria, and also have a role in protecting them from the toxic effects of heavy metals [Hayashi et al., 2000; Kwon et al., 1994; Zegers et al., 2001]. CXXC motifs and CXXC- derived motifs are present in the active sites of disulfide reductases [Rosato et al., 2002], and are capable of metal coordination and metal detoxication. For example, clusters of cysteinyls capable of coordinating zinc atoms are known as “zinc knuckles” or “zinc fingers” [Maret, 2006; Rosato et al., 2002]. Other examples include the P-type ATPases which contain the putative metal-binding site GMCXXC in the N-terminal region [Voskoboinik et al., 1999]. Among these are heavy metal-transporting Cu+, Cu2+ and Cd2+ ATPases [Møller et al., 1996].

141 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Glutathione reductase (Gor) is an enzyme responsible principally for maintaining intracellular levels of reduced glutathione (GSH, "-Glu-Cys-Gly) by recycling the oxidized tripeptide to its reduced form at the expense of oxidating a molecule of NAD(P)H; most Gor use NADPH as cofactor, but a number of these reductases employ also NADH. GSH has many roles in cellular processes, including protection against ROS and detoxication of xenobiotic compounds [Masip et al., 2006]. Owing to its properties, GSH is an essential metabolite in the antioxidant mechanisms of many organisms, and protects them from the toxic effects of heavy metals [Herbette et al., 2006; Seib et al., 2006]. For example, Gor was found to be upregulated under cadmium stress in Lemna polyrrhiza [John et al., 2007].

The inhibition of C. jejuni, H. pylori, W. succinogenes and A. butzleri growth by cadmium cations was measured in vitro, and the molecular bases of their cadmium tolerance was investigated employing bioinformatics analyses, and by comparing in situ enzyme activities of bacteria grown under standard conditions and bacteria subjected to Cd2+ stress. To date, out of the four species only C. jejuni and A. butzleri have known niches outside the animal host. At the time of this study the A. butzleri genome was not published; thus, C. jejuni was the best candidate to study the molecular response towards cadmium stress.

Little is known about the detoxication defenses against metals of C. jejuni which lives in habitats subject to continual change. In the human gut, this pathogen experiences the turnover of the proliferative intestinal epithelium and is exposed to the ever-changing chemical environment of the gastric tract that results from the variety and combinations of food ingested by higher animals. In addition, the bacterium may encounter environments with diverse chemical compositions before transmission to the host. The inhibition of C. jejuni growth by cadmium ions [Kazmi et al., 1985], and the reduction of inhibition by ferrous sulfate [Stern et al., 1988] have been reported. Campylobacter isolates from meat samples were shown to have higher tolerance to Cd2+ than clinical isolates [Kazmi et al., 1985], providing evidence that strains with different habitats vary in their physiologies.

142 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Changes induced in vitro in the proteome of C. jejuni cells subjected to cadmium stress were determined using two-dimensional gel electrophoresis and mass spectrometry. In particular, a better understanding of the cellular role of disulfide reduction in this microaerophilic human pathogen was achieved by investigating in situ and in vitro the inhibition of glutathione reduction by Cd2+, and the interactions of these ions with glutathione and Gor.

9.2 EXPERIMENTAL PROCEDURES 9.2.1 Bacterial strains and growth conditions Arcobacter butzleri strains NC78, NC97 and NC281, C. jejuni strains NCTC 11168 and 81116, H. pylori strains 26695 and J99, and W. succinogenes strain DSMZ 1740 were grown as previously described. Liquid cultures were grown in vented flasks using 50 ml BHI supplemented with cadmium chloride at concentrations of 0, 0.1, 0.2, 0.3, 0.5, 1 and 2 mM. The H. pylori and W. succinogenes cultures were supplemented also with 10% Horse Serum.

9.2.2 Enzyme assays Proton NMR spectroscopy was employed to measure disulfide reduction. Free induction decays were collected using a Bruker DMX-600 NMR spectrometer operating in the pulsed Fourier transform mode with quadrature detection as previously described. Disulfide reduction activities were measured at 37 °C in cell-free extracts of the four bacterial species using GSSG and NADH as substrates.

Assays of fumarate reductase, fumarate dehydratase and 2-oxoglutarate ferredoxin oxidoreductase activities were performed in whole-cell lysates as previously described [Pitson et al., 1999]. Thioredoxin reductase activity was measured by DTNB reduction in the presence of NADPH using a Cary-100 UV-visible spectrophotometer. The reaction mixtures contained cell-free extracts and substrates suspended in 50 mM Tris-HCl, pH 7.2 buffer and 1 mM EDTA in a total volume of 1 ml, and were placed in 1 cm path- length disposable cuvettes. The cell-free extracts were added just prior to performing the

143 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

assays, and the change in absorbance was measured at 412 nm over 2 min. The coefficient of molar absorbance for DTNB is 13.6 x 103 mol-1 cm-1 at 412 nm.

9.2.3 Effects of cadmium ions on enzyme activities The effects of cadmium ions on glutathione reduction was determined by measuring glutathione rates of reduction in suspensions of whole bacterial lysates employing 1H- NMR spectroscopy. At substrate concentrations well below the Km the inhibition constant can be calculated from the expression

vo/ v = 1 + I / Ki, where vo and v are uninhibited and inhibited rates of reduction, respectively, and I is the concentration of inhibitor [Schulz, 1994].

9.2.4 Interactions of cadmium ions with glutathione and glutathione reductase The interactions of oxidized and reduced glutathione with Cd2+ were studied employing 1H- and 13C-NMR. Solutions of GSSG or GSH were placed 5 or 10 mm tubes at concentrations between 2 and 50 mM. 1H-NMR free induction decays were collected using a Bruker DMX-500 NMR spectrometer, operating in the pulsed Fourier transform mode with quadrature detection. Proton spectra were acquired with presaturation of the water resonance. The instrumental parameters were: operating frequency 500.13 MHz, spectral width 5000 Hz, memory size 16 K, acquisition time 1.64 s, number of transients 64, pulse angle 50° (3 µs) and relaxation delay with solvent presaturation 1.4 s. Spectral resolution was enhanced by Gaussian multiplication with line broadening of -0.6 Hz and Gaussian broadening factor of 0.19. Chemical shifts are quoted relative to sodium 4,4- dimethyl-4-silapentane-1-sulfonate at 0 ppm.

One-dimensional natural-abundance 13C-NMR spectra were acquired with composite pulse proton decoupling in an ACP-300 Bruker NMR spectrometer. The instrumental parameters were: operating frequency 75.5 MHz, spectral width 16129 Hz, memory size 16 K, acquisition time 0.508 s, number of transients 1600, and pulse angle 66° (9 µs). Exponential filtering of 1 Hz was applied prior to Fourier transformation. Chemical shifts - are quoted with respect to HCO3 at 160 ppm.

144 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

The interactions of Cd2+ with reduced or oxidized glutathione, and with bovine mucus glutathione reductase were studied employing 113Cd-NMR spectroscopy. Solutions of

CdCl2 (50 mM) in buffers were placed in 10 mm tubes, and titrated with either metabolite, the enzyme or both. The changes in the spectral position and linewidth of the 113Cd resonance were measured from spectra of mixtures at different concentrations of GSSG, GSH or glutathione reductase. 113Cd-NMR spectra were acquired using a Bruker DMX-500 NMR spectrometer with composite pulse decoupling of protons. The instrumental parameters for observing 113Cd were: operating frequency 110.9 MHz, spectral width 8865 Hz, memory size 16 K, acquisition time 0.92 s, relaxation delay 30 s, and pulse angle 90° (12 µs). The number of transients was 128. Exponential filtering of 3 Hz was applied prior to Fourier transformation. Chemical shifts are quoted with respect to 0.1 M aqueous Cd(ClO4)2 at 0 ppm.

9.2.5 Other procedures Two-dimensional PAGE electrophoresis, image analysis, mass spectrometry identification and subsequent bioinformatics analyses were performed as previously described in the Materials and Methods chapter.

9.3 RESULTS AND DISCUSSION 9.3.1 Comparative analyses of the response of four Campylobacterales to cadmium

The net growth of the four Campylobacterales species at CdCl2 concentrations between 0 and 2 mM is shown in Figure 9.1. H. pylori was the most tolerant species to cadmium stress, W. succinogenes the most susceptible, and A. butzleri and C. jejuni had similar levels of resistance.

To understand the molecular bases of these differences in Cd2+ tolerance, the genomes of the four Campylobacterales species were analyzed to identify genes encoding proteins potentially involved in the efflux of cadmium cations.

145 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

120

100

Bacterial growth (%) 40

0 0 0.1 0.2 0.3 0.5 1 2 Cadmium concentration (mM)

Figure 9.1 Growth of A. butzleri NC78, C. jejuni NCTC 11168, H. pylori J99 and W.

succinogenes DSMZ 1740 in medium containing CdCl2 at different concentrations.

Controls were cultures grown without CdCl2. The histogram patterns correspond to percentage growth for A. butzleri: no pattern; C. jejuni: inclined lines; H. pylori: dots; and W. succinogenes: horizontal lines.

146 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Efflux of divalent heavy metal cations from bacterial cells is mediated by resistance- nodulation cell division (RND) transenvelope exporters, cation diffusion facilitators (CDF) and P-type ATPases [Nies, 2003]. The CzcABC efflux pump is an RND exporter which mediates the efflux of Co2+, Zn2+ and Cd2+ [Anton et al., 2004]. CzcA has a specific domain for cadmium and zinc and another for cobalt [Thilakaraj et al., 2007]. Several CzcA homologues with the cadmium and zinc domain were found in the genomes of A. butzleri and W. succinogenes; in C. jejuni and H. pylori the only homologues were CJ0336c and HP0969, respectively. Since the genes czcABC form an operon, it was possible to reduce the number of putative cadmium-associated CzcA in A. butzleri and W. succinogenes to one for each bacterium (Table 9.1). A. butzleri, C. jejuni and W. succinogenes proteins with homology to CzcB and CzcC were identified and the genes encoding them form part of the respective operon in each species (Table 9.1). No significant homologues of CzcB and CzcC were found in H. pylori, but hp0969 forms part of an operon with two other genes which encode proteins with the characteristics of the other two members of the efflux pump (Table 9.1). The protein CzcD has a CDF motif and confers resistance to these metals; also, it is involved in the regulation of the CzcABC pump [Anton et al., 2004]. Genes coding for homologues of CzcD were identified in the genomes of A. butzleri, C. jejuni and W. succinogenes, but not in the genome of H. pylori (Table 9.1). CzcR and CzcS constitute the cognate two-component system which regulates the expression of CzcABC; homologues of these proteins were found in the four Campylobacterales (Table 9.1). Metal-binding ATPases containing the GMTCXXC or similar motifs and potentially involved in cadmium-cation efflux were identified in the four bacterial species (Table 9.2). H. pylori lacked a CzcD single subunit CDF transporter, but genes encoding homologues of this protein were found in the genomes of the other three species.

The results of the bioinformatic analyses suggested that the four bacteria have RND cadmium exporters and ATPase enzymes potentially involved in cadmium-ion efflux, but the similarities between the enzyme sequences and the number of export systems found in each of the four Campylobacterales did not support a correlation between the observed tolerances to cadmium and the efflux systems.

147 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.1 Homologues of Czc proteins found for the four Campylobacterales species employing sequence searches.

Bacterium CzcA CzcB CzcC CzcD CzcR CzcS

A. butzleri Abu_0813 Abu_0814 Abu_0815 Abu_0344 Abu_0375 Abu_0433

C. jejuni CJ0366c CJ0367c CJ0365c CJ1163c CJ0355c CJ1222c

H. pylori HP0969 HP0970* HP0971* ------HP1043 HP1044

W. succinogenes WS0411 WS0412 WS0413 WS1661 WS0366 WS0640

*The putative CzcB and CzcC proteins were not identified through sequence homology searches but by the genes encoding them forming part of a predicted operon with HP0969.

148 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.2 ATPase enzymes encoded by the four Campylobacterales species containing the GMTCXXC or similar motifs.

Bacterium ATPase Enzymes

A. butzleri ABU0480; ABU0546; ABU0711; ABU1501; ABU1506; ABU1859

C. jejuni CJ1155c; CJ1161c; CJ1377c

H. pylori HP0791; HP1072; HP1503

W. succinogenes WS0379; WS0421; WS0730; WS1121; WS1571; WS2171

149 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

These novel data revealed the existence of mechanisms for cadmium cation detoxication in the four Campylobacterales species but did not provide evidence that would explain the differences in Cd2+ susceptibility between A. butzleri, C. jejuni, H. pylori and W. succinogenes.

9.3.2 Molecular responses of Campylobacter jejuni to cadmium stress 9.3.2.1 Effects of cadmium on the survival of Campylobacter jejuni The effects of cadmium ions on the growth of C. jejuni NCTC 11168 were measured using a more precise technique at Cd2+ concentrations of 0.05, 0.1, 0.3, 0.5 and 1 mM. Two colony-forming unit (cfu ml-1) counts were taken at 0 and 20 h from each culture (n=3). The bacteria grew approximately 1.5 log(cfu ml-1) at 0 mM Cd2+ (Fig. 9.2). Inhibition of C. jejuni growth increased with Cd2+concentration, and the cation was lethal at 1 mM concentration (Fig. 9.2), changes in C. jejuni growth were observed at micromolar concentrations of cadmium (Fig. 9.2). These effects were comparable to those observed in other bacteria and yeast [El-Rab et al., 2006; Gillet et al., 2006; Vido et al., 2001]. The results indicated that cadmium is highly toxic to C. jejuni similarly to other microorganisms.

The growth-inhibition data served to determine a Cd2+ concentration at which C. jejuni cells could be subjected to cadmium stress with only partial inhibition of cell growth. At 0.1 mM Cd2+, C. jejuni growth was significantly decreased but the bacteria remained viable.

9.3.2.2 Proteomic analyses of Campylobacter jejuni under cadmium stress The response of C. jejuni to 0.1 mM Cd2+ in the growth media was analyzed by using two dimensional gel electrophoresis to determine the changes in the proteome of the bacterium (Fig. 9.3). 2D-Gel electrophoresis was performed with proteins extracted from pairs of bacterial cultures grown with and without Cd2+; they included three independent biological repeats and one technical repeat. The four pairs of gels obtained from cultures under both conditions were analyzed to identify spots corresponding to proteins whose expression was regulated under cadmium stress.

150 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

1.5

1 Growth (log cfu ml-1) 0.5

-0.5

-8 0 0.05 0.1 0.3 0.5 1

Cadmium concentration (mM)

Figure 9.2

Growth of Campylobacter jejuni NCTC 11168 in medium containing CdCl2 at

different concentrations. Controls were cultures grown without CdCl2. Bacteria were grown for 18 h in liquid cultures under microaerobic conditions and at 37 °C.

151 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

26 24 23 11 10 27 46 13 53 12 21 65 42 9 36 17 45 48 35 28 3 34 25 2 7 16 5 50 40 67 29 55 14 52 61 6 64 19 44 30 4 15 20 51 18 60 33 66 8 59 58 32 54 39 37 47 43 1 62 38 63

22 41 56

57 31 49

44pI 77pI

Figure 9.3 Two-dimensional pI 4–7 protein profiles of Campylobacter jejuni NCTC 11168 cells grown without CdCl2 (left) and in the presence of 0.1 mM CdCl2 (right). Proteins differentially expressed between the two growth conditions are listed in Tables 9.4 and 9.5.

152 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Campylobacter jejuni contains 35 putative disulfide reductases which have been identified bioinformatically (Chapter 7). Sequence analyses were performed on the disulfide reductases of C. jejuni to calculate the pI values of these proteins and determine their approximate positions on 2D-gels (Table 9.3). This evaluation helped to map the spots corresponding to disulfide reductases on the gels.

The regulated proteins were identified using tandem mass spectrometry analyses. Sixty- seven proteins were differentially expressed, of which 38 were downregulated and 29 were upregulated in the presence of Cd2+ (Tables 9.4 and 9.5).

9.3.2.3 Bioinformatics analyses on regulated proteins 9.3.2.3.1 Effects on central metabolic pathways Applying the functional classifications available on KEGG to the downregulated proteins in Table 9.4, it was concluded that fatty acid biosynthesis and the TCA cycle were downregulated. The former pathway is downregulated by metal ions in both prokaryotes and eukaryotes [Leal, 1965; Pennanen et al., 1996; Strydom et al., 2006]. Previous studies suggest that the effect of metals on fatty acid biosynthesis is indirect, arising from changes induced on other metabolic pathways such as carbohydrate metabolism [Pennanen et al., 1996; Strydom et al., 2006]. Nonetheless, the modulation of fatty acid biosynthesis in C. jejuni subjected to cadmium stress was notable. The enzymes CJ1290c responsible for conversion of acetyl-CoA to malonyl-CoA, and CJ0116 and CJ0442 responsible for conversion of acetyl-CoA to acetyl-[acp] and malonyl-CoA to malonyl- [acp], respectively, were all downregulated. In addition, the enzymes CJ0442 and CJ1400c responsible for producing hexadecanoyl-[acp] from acetyl-[acp] or malonyl- [acp] were downregulated also indicating an extensive downregulation of this synthesis.

Fatty acid biosynthesis is the first step in membrane lipid biogenesis. The downregulation of CJ0858c which catalyzes the first step of lipopolysaccharide synthesis indicated the pathway was disrupted from its beginning. Similarly, CJ1054c which catalyzes the first step of peptidoglycan biosynthesis also was downregulated indicating the disruption of

153 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.3 Isoelectric point and molecular weight of disulphide reductases identified bioinformatically in Campylobacter jejuni NCTC 11168.

ORF Protein name pI MW (kDa) CJ0012c Non-haem iron protein 5.5 24.5 CJ0017c Putative ATP /GTP binding protein 8.6 56.8 CJ0058 Putative periplasmic protein 7.8 23.0 CJ0119 Hypothetical protein 6.0 19.9 CJ0146c Thioredoxin reductase 5.6 33.1 CJ0147c Thioredoxin 4.5 11.3 CJ0256 Putative integral membrane protein 8.3 59.3 CJ0262c Chemotaxis signal transduction protein 4.9 72.8 CJ0264c Molybdopterin-containing oxidoreductase 8.5 93.3 CJ0280 Hypothetical protein 9.8 16.2 CJ0415 Putative GMC oxidoreductase subunit 8.8 63.7 CJ0425 Putative periplasmic protein 5.4 15.6 CJ0535 2-oxoglutarate:acceptor oxidoreductase delta subunit 6.9 11.4 CJ0537 2-oxoglutarate:acceptor oxidoreductase beta subunit 8.0 31.2 CJ0559 Oxidoreductase 5.7 33.7 CJ0603c Putative thiol disulfide interchange protein 9.0 63.8 CJ0637c Peptide methionine sulfoxide reductase 5.7 18.9 CJ0701 Putative protease 7.9 47.3 CJ0757 Putative heat shock regulator 5.2 30.9 CJ0865 Putative disulfide oxidoreductase 8.2 30.4 CJ0911 Putative periplasmic protein 8.4 21.8 CJ1006c Hypothetical protein 8.6 47.1 CJ1019c ABC transport system periplasmic binding 8.8 40.1 CJ1049c Putative integral membrane protein 9.3 22.4 CJ1106 Possible periplasmic thioredoxin 5.3 23.0 CJ1112c Hypothetical protein 6.8 13.4 CJ1168c Putative integral membrane protein 8.9 22.6 CJ1278 Hypothetical protein 9.0 46.2 CJ1293 Possible sugar nucleotide epimerase 8.4 37.4 CJ1295 Hypothetical protein 6.0 49.9 CJ1380 Putative periplasmic protein 8.8 26.6 CJ1457c Hypothetical protein 9.0 43.4 CJ1505c Hypothetical protein 5.3 21.3 CJ1633 Hypothetical protein 7.6 36.8 CJ1665 Possible lipoprotein thioredoxin 7.6 18.9

154 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.4 Campylobacter jejuni NCTC 11168 proteins identified as downregulated in the presence of 0.1 mM CdCl2 from three independent cultures (n=3). Proteins in spots were identified by LC-MS tandem mass spectrometry analyses. The ORF numbers correspond to those of the annotated genome of C. jejuni strain NCTC 11168.

Functional Category Protein Protein Name Spot No. Amino acid metabolism CJ0117 Probable MTA/SAH nucleosidase 1 CJ0402 Serine hydroxymethyl transferase 2 CJ0665c Argininosuccinate synthase 3 CJ0806 Dihydrodipicolinate synthase 4 CJ0858c UDP-N-acetyl glucosamine carboxyl transferase 5 CJ0897c Phenyl alanyl tRNA synthetase subunit 6 CJ1054c UDP-N-acetylmuramate-L-alanine ligase 7 CJ1681c CysQ protein homolog 8 Cell division CJ0695 Cell division protein ftsA 9 Chemotaxis and Mobility CJ0144 Methyl-accepting chemotaxis protein 10 CJ0262c Putative methyl-accepting chemotaxis protein 11 CJ1338c Flagellin B 12 CJ1339c Flagellin A 13 CJ1462 Flagellar P-ring protein precursor 14 Fatty acid biosynthesis CJ0116 Acyl-carrier protein S-malonyltransferase 15 CJ0442 3-oxoacyl-(acyl carrier protein) synthase II 16 CJ1290c Acetyl-CoA carboxylase 17 CJ1400c Enoyl-acyl carrier protein reductase 18 Glycolysis CJ0597 Fructose bis-phosphate aldolase 19 Nucleic acid metabolism CJ0146c Thioredoxin reductase 20 CJ0953c Bifunctional formyltransferase/IMP cyclohydrolase 21 Redox CJ0779 Probable thiol peroxidase 22 TCA cycle CJ0409 Fumarate reductase 23 CJ0531 Isocitrate dehydrogenase 24 CJ0533 Succinyl-CoA synthetase ß chain 25 CJ0835c Aconitase 26 CJ0933c Putative pyruvate carboxylase B subunit 27 CJ1287c Malate oxidoreductase 28 CJ1682c Citrate synthase 29 Transport/binding CJ1443c KpsF protein 30 proteins CJ1534c Possible bacterioferritin 31 CJ1663 Putative ABC transport system ATP-binding protein 32 Metabolism of vitamins CJ1046c Thiamine biosynthesis protein ThiF 33 Unknown CJ0172c Hypothetical protein 34 CJ0662c ATP-dependent protease ATP-binding subunit 35 CJ1024c Signal transduction regulatory protein 36 CJ1214c Hypothetical protein 37 CJ1725 Putative periplasmic protein 38

155 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.5 Campylobacter jejuni NCTC 11168 proteins identified as upregulated in the presence of 0.1 mM CdCl2 from three independent cultures (n=3). Proteins in spots were identified by LC-MS tandem mass spectrometry analyses. The ORF numbers correspond to those of the annotated genome of C. jejuni strain NCTC 11168.

Functional Category Protein Protein Name Spot No. Amino acid metabolism CJ0087 Aspartate-ammonia lyase 39 CJ0389 Seryl-tRNA synthetase 40 CJ1096c S-adenosylmethionine synthetase 41 CJ1197c Aspartyl/glutamyl-tRNA amidotransferase subunit B 42 CJ1604 pAMP/APP hydrolase 43 Cell division CJ0276 Homolog of E. coli rod shape-determining protein 44 Chaperones, heat shock CJ0759 Molecular chaperone DnaK 45 CJ1221 Heat shock protein GroEL 46 Metabolism of vitamins CJ1045c Thiazole synthase 47 Oxidative phosphorylation CJ0107 ATP synthase subunit B 48 Protein translation and CJ0115 Peptidyl-prolyl cis-trans isomerase 49 modification CJ0193c Trigger factor 50 CJ0239c NifU protein homolog 51 CJ0470 Elongation factor Tu 52 CJ0493 Elongation factor EF-G 53 Redox CJ0012c Rbo/Rbr-like protein 54 CJ0037c Putative cytochrome c 55 CJ0169 Superoxide dismutase 56 CJ0414 Putative oxidoreductase subunit 57 Signal transduction CJ0355c Two component regulator 58 CJ0448c Putative MCP-type signal transduction protein 59 TCA cycle CJ0536 2-oxoglutarate ferredoxin oxidoreductase 60 CJ1364c Fumarate dehydratase 61 Transcription/Replication CJ0440c Putative transcriptional regulator 62 CJ1071 Single-strand DNA-binding protein 63 Transport/binding proteins CJ0612c Ferritin 64 CJ0734c Histidine-binding protein precursor 65 Unknown CJ1136 Putative galactosyl transferase 66 Virulence CJ0039c GTP-binding protein TypA homolog 67

156 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

this pathway too. These effects together with the downregulation of the cell division protein FtsA (CJ0695), could explain the decreased cell growth observed in bacteria subjected to cadmium stress.

An interesting finding was the downregulation of CJ0117 which catalyzes the hydrolysis of 5'-methylthioadenosine (MTA) to 5'-methylthioribose (MTR) or of S- adenosylhomocysteine (SAH) to S-ribosylhomocysteine (SRH) and adenine in prokaryotes but not in mammalian cells; both MTA and SAH are potent inhibitors of important cellular processes in prokaryotes, such as transmethylation [Lu, 2000; Ueland, 1982]. The accumulation of these intermediates in the bacterium could induce metabolic changes responsible for the inhibition of C. jejuni central metabolic pathways, such as the TCA cycle (Table 9.4) It has been proposed that adenylated compounds alert cells to the onset of stress, thus, the accumulation of the adenylated compounds MTA and SAH could be the result of the onset of cadmium stress. This response has been shown in Salmonella typhimurium and Synechococcus spp. [Bochner et al., 1984; Pálfi et al., 1991]. Moreover, phenylalanyl and seryl-tRNA synthetases are the only two synthesases involved in the production of adenylated nucleotides [Pietrowska-Borek et al., 2003], and these two enzymes were found to be regulated under cadmium stress.

Inhibitory effects of cadmium on the TCA cycle of other organisms have been reported [Strydom et al., 2006]. The presence of Cd2+ modulated the expression of all the enzymes of the TCA cycle of C. jejuni, seven were downregulated and two were upregulated: 2- oxoglutarate oxidoreductase and fumarate dehydratase. The data suggested that the operation of the TCA cycle was downregulated and that the upregulation of the expression of the latter two enzymes responded to their other metabolic roles. Some bacteria have developed metal detoxication pathways in which the metal ion is first reduced by various c-type cytochromes, hydrogenases, and reduced ferredoxins, and subsequently transported outside the cell [Michel et al., 2003; Ron et al., 1992]. 2- Oxoglutarate oxidoreductase can reduce the low redox potential protein ferredoxin, and its activity can lead to higher intracellular concentrations of reduced ferredoxin than normal basal conditions. In the presence of cadmium, the increased expression by C.

157 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

jejuni of 2-oxoglutarate oxidoreductase leading to elevated reduced ferredoxin concentrations, and the upregulation of a putative cytochrome c encoded by cj0037c appeared to be important responses to cadmium ions that may act as detoxication pathways in the bacterium.

The downregulation of the expression of malate oxidoreductase and pyruvate decarboxylase would decrease the entry of pyruvate into the TCA cycle via malate or oxaloacetate, respectively, and avoid futile cycling of pyruvate driven by these two enzymes. Malate could still be produced at normal concentrations from phosphoenol pyruvate via oxaloacetate, and converted to aspartate through the activities of pyruvate dehydrogenase and aspartate lyase whose expression was upregulated in the presence of cadmium ions. Similarly to H. pylori [Pitson et al., 1999], the dicarboxylic acid branch of the TCA cycle of C. jejuni would function in the reductive direction in the presence of excess malate converting it to pyruvate and then to succinate, the last step is catalyzed by pyruvate reductase. Under cadmium stress, expression of this enzyme was downregulated; as a result, the pyruvate produced by pyruvate dehydrogenase could be directed to the synthesis of aspartate. Increased production of this amino acid could reduce intracellular cadmium concentrations by chelating the metal ions [Gasque et al., 2002; Rollin-Genetet et al., 2004], and could remove free ammonium by incorporating it into aspartate. A reduction of the intracellular ammonium concentration could explain the downregulation of the expression of the urea cycle enzyme argininosuccinate lyase, since the bacterium would require a lesser use of the urea cycle to maintain homeostasis of intracellular nitrogen levels.

At the same time, an increase in malate concentration in the cells could play an important role in the solubilization of cadmium since malate and other organic acids perform this function, as shown in the rhizosphere soil [Chiang et al., 2006]. The ability of malate to bind cadmium [Filella et al., 1999] and to detoxify metals in other organisms [Jócsák et al., 2005; Ueno et al., 2005], suggested that it could be a cadmium detoxication process employed by C. jejuni.

158 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

9.3.2.3.2 Effects on amino acid biosynthesis Effects of cadmium on amino acid biosynthesis have been reported previously; for example, cadmium inhibits or blocks the threonine pathway in E. coli [Chassagnole et al., 2003]. In C. jejuni, cadmium appeared to enhance the synthesis of aspartate from pyruvate through upregulation of the expression of aspartate-ammonia lyase (CJ0087). Upregulation of pAMP/APP hydrolase encoded by cj1604 under cadmium stress suggested an increase in purine and/or histidine biosynthesis. Since the expression of the last enzyme of the de novo purine biosynthesis PurH (CJ0953c) is downregulated, the results suggested that synthesis of histidine, an amino acid with very high affinity to metal ions, was upregulated. The downregulation of PurH (CJ0665c) and dihydrodipicolinate synthase (CJ0806) suggested a decrease in the synthesis of arginine and lysine using aspartate as a precursor. The increased production of aspartate could constitute another mechanism used by the bacterium to detoxicate cadmium ions. Downregulation of serine hydroxymethyl transferase (CJ0402) suggested inhibition of glycine synthesis, since this is the only de novo glycine pathway which has been identified in C. jejuni.

In summary, cadmium had an inhibitory effect on central metabolic pathways of C. jejuni, and appeared to enhance the production of metabolites which may be utilized to detoxicate the metal.

9.3.2.3.3 Effects on protein repair and oxireduction systems The expression of proteins involved in translation and modification, oxireduction and chaperones was upregulated. Cadmium is capable of displacing metal ions in proteins and affect their structure and folding [Wang & Crowley, 2005]. The upregulation of protein translation and modification and chaperones such as heat shock proteins in response to Cd2+ stress has been reported previously [El-Rab et al., 2006]. The elongation factors upregulated in C. jejuni exposed to cadmium are required for extending the polypeptide chain in protein translation; and the heat shock proteins are required for proper protein folding. These findings indicated the cells were responding to the negative effects of cadmium on protein synthesis. Further evidence was provided by the downregulation of

159 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

an ATP-dependent protease subunit encoded by cj0662c which is capable of degrading heat shock proteins. The NifU protein homolog encoded by cj0239c participates in iron- sulfur centre assembly [Yuvaniyama et al., 2000]; its upregulation may help to counter cadmium-induced displacement of iron from proteins.

Removal of iron bound to various cellular components can cause a cascade of reactions leading to an increase in oxidative stress in the cells. Upregulation of proteins involved in oxireduction reactions would help to combat the toxic effects of oxidative stress. This response is found in E. coli where cadmium upregulated proteins in the heat shock and oxidative stress regulons [Van Bogelen et al., 1987]. Similarly, exposure to cadmium of anterior gills of the Chinese mitten crab Eriocheir sinensis upregulated the expression of several antioxidant enzymes and chaperonins [Silvestre et al., 2006]. Metaproteomic analyses of the response of bacterial communities to cadmium indicated that oxidoreductases were differentially expressed [Lacerda et al., 2007]. Finally, transcriptional analyses of Caulobacter crescentus cells exposed to cadmium showed that the principal response to this metal was protection against oxidative stress [Hu et al., 2005]. These observations support the view that induction of oxidative stress and binding of sulfhydryl-groups are mechanisms of cadmium toxicity [Silvestre et al., 2006].

An important detoxication mechanism is the transformation of metals into organometallic compounds by methylation, and the synthesis of several organocadmium compounds has been demonstrated [Jones and Desio, 1978; Ron et al., 1992]. Adenosylmethionine occupies a central metabolic position in both eukaryotes and prokaryotes serving as a major methyl group donor in biological systems [Lu, 2000]. The upregulation of S- adenosylmethionine synthetase encoded by cj1096c in bacteria exposed to cadmium could promote cadmium methylation, and thus neutralize the toxic effect of the metal.

9.3.2.3.4 Effects on chemotaxis and motility The expression of no chemotaxis or motility genes is regulated under cadmium stress in E. coli and C. crescentus [Hu et al., 2005; Wang & Crowley, 2005], but heavy metal ions strongly affect Borrelia burgdorferi motility [Shi et al., 1998]. The downregulation of

160 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

five proteins involved in chemotaxis and motility in C. jejuni exposed to Cd2+ (Table 9.4) suggested a decrease in these functions of the bacterium. Bacterial motion is driven by either a proton motive force or a sodium motive force [Butler & Camilli, 2005; Maurer et al., 2005], and the presence of heavy metal ions may interfere with this function leading to the downregulation of genes involved in motility.

The N-terminus half of CJ1024c has a REC signal-receiver domain for proteins such as CheY, OmpR, NtrC, and PhoB; and in its middle segment there is a sigma-54 interaction domain Sigma54_activat [Parkhill et al. 2000]. The transcription of the gene flaB encoding flagellin B is under the regulation of sigma factor 54 [Parkhill et al. 2000]. Thus, the downregulation of CJ1024c in the presence of cadmium may result in the downregulation of signaling by chemotaxis proteins and of transcription of flagellin B.

9.3.2.3.5 Effects on metal uptake and storage A putative ABC transport system ATP-binding protein encoded by cj1663 and a hypothetical protein encoded by cj0172c were downregulated. The STRING tool [von Mering et al., 2007], predicted that the gene cj0172c is in a network with cj0173c, cj0174c and cj0175c which encode an iron uptake ABC transport system, and with cj0271 which encodes a bacterioferritin conjugatory protein homolog. The bacterioferritin CJ1534c which contains a haem and is involved in iron uptake was also downregulated. In contrast, the haem-free ferritin encoded by cj0612c involved in intracellular iron storage was upregulated. Ferritin is a primary detoxication response to heavy metals including Cd2+ in Xenopus laevis cells [Muller et al., 1991]. The principal function of ferritins is to store iron inside cells in the ferric form; a secondary function could be detoxication of iron or protection against O2 and its reactive products. A C. jejuni CJ0612c-deficient mutant was more susceptible to killing by oxidant agents than the parent strain, thus demonstrating that this ferritin makes a significant contribution to the protection of the bacterium against oxidative stress [Wai et al., 1996]. It has been hypothesized that C. jejuni CJ0612c plays a role mainly in regulating cellular iron homeostasis by storing and releasing iron under iron-restricted conditions, whereas C. jejuni CJ1534c contributes mainly to protection against oxidative stress by sequestering

161 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

cellular free iron to prevent the generation of hydroxyl radicals [Ishikawa et al., 2003]. This bacterioferritin may have a greater involvement than ferritin CJ0612c in protection against oxidative stress, but it contains a haem whose synthesis might be affected by cadmium ions. For instance, in Bradyrhizobium japonicum an engineered - aminolevulinic acid dehydratase (ALAD) which uses Zn2+ for activity is inhibited by Cd2+ ions [Chauhan et al., 1997]. ALAD is an enzyme of the haem synthesis pathway which exists in C. jejuni. This may explain why expression of the haem-free ferritin was upregulated, and expression of the haem-containing bacterioferritin was downregulated.

CJ0355c has 58% similarity with CzcR of Streptococcus agalactiae and was upregulated under cadmium stress. Czc systems have been studied in detail in Alcaligenes eutrophus and Pseudomonas aeruginosa [Grosse et al., 1999; Perron et al., 2004]. Induced mechanisms of bacterial resistance to heavy metals increase the expression of the heavy metal efflux pump CzcCBA and its cognate two-component regulator genes CzcR-CzcS in A. eutrophus [Grosse et al., 1999] and P. aeruginosa [Perron et al., 2004]. Furthermore, the cadmium stress response of C. crescentus included also reducing the intracellular cadmium concentration with multiple efflux pumps [Hu et al., 2005].

Finally, the rubredoxin-like protein encoded by cj0012c was upregulated. This type of proteins are sensitive to oxidative stress and are capable of forming complexes such as

[Cd(CysS)4]2 with metals [Henehan et al., 1993]. The ugregulation of CJ0012c may be another mechanism employed by C. jejuni to protect itself against Cd2+ toxicity.

In summary, these observations suggested that in the presence of cadmium C. jejuni downregulated proteins involved in metal uptake, and upregulated proteins capable of binding, storing and exporting metals. In addition, the upregulation of proteins involved in iron storage is in agreement with the potential of cadmium to displace iron from proteins.

162 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

9.3.2.3.6 Effects on other cellular processes The proteins CJ0355c and CJ0448c which participate in signal transduction, and CJ0440c and CJ1071 which are involved in transcription were upregulated. Signal transduction cascades are essential for metal-inducible protein transcription [Adams et al., 2002]. The upregulation of these four proteins suggested that C. jejuni may contain a metal- responsive signal transduction pathway.

The upregulated ATP synthase subunit B encoded by cj0107 forms part of the oxidative phosphorylation pathway responsible for the production of ATP; this pathway is upregulated also in other organisms subjected to metal stress [Strydom et al., 2006]. Oxidative phosphorylation generates high-energy ATP and upregulation of the expression of this synthase may serve to offset the downregulation of the expression of TCA cycle enzymes under cadmium stress.

Finally, a TypA homolog encoded by cj0039c and a rod shape-determining protein encoded by cj0276 were upregulated. Homologs of both these proteins have been associated with virulence in other organisms [Lin et al., 2006; Scott et al., 2003]. Cadmium-stressed E. coli were found to recover more rapidly during subsequent stress conditions than unexposed cells [Ferianc et al., 1998]. Since cadmium is capable of upregulating proteins involved in the virulence phenotype of C. jejuni and possibly make the bacterium more tolerant to stresses such as the oxidative bursts by the host’s immune system, then exposure of C. jejuni to cadmium ions may enhance its virulence, and pose significant consequences to the hosts.

9.3.2.4 Confirmation of changes in the proteome Confirmation of changes in the proteome of C. jejuni exposed to cadmium stress was performed by measuring several enzyme activities which would reflect changes in protein levels. Many studies employ quantitative real-time PCR to verify the results of proteomic analyses, but this method detects regulation at the transcription level and is more suitable for confirmation of transcriptome data. The activities of several enzymes of the TCA cycle were measured because they are involved in the central metabolism of the cell, and

163 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

previous studies have shown that it is a pathway commonly regulated under cadmium stress. Thioredoxin reductase activity was determined because this enzyme is involved in the response of other organisms to cadmium; thus, the downregulation of its expression by C. jejuni required verification.

Upregulation of fumarate dehydratase and 2-oxoglutarate ferredoxin oxidoreductase activities was verified using 1H-NMR spectroscopy. Fumarate dehydratase activity was 1.4-fold higher in whole-cell lysates of cells grown with 0.1 mM cadmium than in lysates of cells grown without cadmium. The activity of 2-oxoglutarate ferredoxin oxidoreductase was 2-fold higher in cell-free extracts of cells grown with cadmium than in extracts of cells grown without cadmium. Downregulation of fumarate reductase and thioredoxin reductase activities were confirmed using 1H-NMR spectroscopy and spectrophotometry, respectively. Their activities were 1.3-fold lower in lysates and 1.5- fold lower in cell-free extracts of cells grown with cadmium than in cells grown without cadmium, respectively. The changes in the reduction rates of the four enzymes were in agreement with the regulation of protein expression observed in the proteomic analyses.

9.3.3 Disulfide reductases in cadmium detoxication The involvement of disulfide reductases, including thioredoxin reductase, in cadmium detoxication has been demonstrated in several microorganisms. For example, Saccharomyces cerevisiae strains lacking thioredoxin and thioredoxin reductase are hypersensitive to cadmium [Rollin-Genetet et al., 2004; Vido et al., 2001]. The genomes of many species of Campylobacterales bacteria do not contain genes orthologous to those in other organisms encoding glutathione reductases or the enzymes of the "-glutamyl cycle for the synthesis of glutathione; and the thioredoxin system is the only disulfide redox system present in these bacteria. Cadmium induces oxidative stress, although it does not produce directly reactive oxygen species [Salin, 1988]. The activity of the metalloenzyme thioredoxin reductase is required also to supply reduced thioredoxin for the reduction of pyrimidine nucleotides by ribonucleotide reductase. The downregulation of thioredoxin reductase in C. jejuni exposed to cadmium was unexpected (Fig. 9.4)

164 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

A C

B D

Figure 9.4 Duplicates of 2D-gel sections of the Campylobacter jejuni NCTC 11168 proteome. Protein spots from gels of C. jejuni cells grown without cadmium (A, C), and in the presence of cadmium (B, D). The circled spots correspond to TrxB. Ten peptide sequences from the spot were matched to the enzyme TrxB from the C. jejuni strain 11168 genome.

165 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

owing to its unique roles in cellular metabolism, but this result was confirmed by the measurement of enzyme activity obtained from spectrophotometric analyses. Furthermore, the thioredoxin reduction activity was inhibited in the other three species grown in the presence of cadmium cations (Table 9.6). Cadmium interferes with metalloproteins by displacing and replacing their metal centres, and disrupting interactions with target proteins. Since thioredoxin reductase is a metalloenzyme, the observed decrease in thioredoxin reduction activity in the four Campylobacterales may be due to the inactivation of the reductase.

The absence of glutathione-specific metabolic pathways in C. jejuni allowed the use of GSSG as a non-specific disulfide substrate. The presence of glutathione reduction activities in C. jejuni was established by observing the reduction of GSSG to GSH with concomitant oxidation of NADH employing 1H-NMR spectroscopy. This measurement of disulfide reduction was validated using several controls described in the experimental procedures of enzyme assays. An increase of approximately 1.6-fold in the rate of GSSG reduction was observed in cells grown with 0.1 mM Cd2+. The result indicated that disulfide reductases capable of reducing GSSG were involved in the response of C. jejuni to cadmium ions. Moreover, the other three Campylobacterales species increased their glutathione reduction activity when grown under cadmium stress (Table 9.6), but there was no correspondence between the relative increase of glutathione reduction and the cadmium tolerance of each species (Fig. 9.1).

Glutathione reduction was investigated further by determining the kinetic parameters of this activity in lysate suspensions; the values calculated for the Michaelis constants and maximal velocities were 4.7 ± 0.4 mM and 43 ± 2 nmol mg-1 min-1 for GSSG, and 2.7 ± 0.1 mM and 42 ± 2 nmol mg-1 min-1 for NADH. The presence of Cd2+ inhibited GSSG reduction activity. The inhibition constant of the cadmium ions was determined by measuring enzyme activities in the presence of different concentrations of the metal, and the Ki value was 6.2 ± 0.6 )M. Addition of GSH to the assay mixtures relaxed the inhibition imposed by CdCl2 on glutathione reduction.

166 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Table 9.6 Changes in glutathione and thioredoxin reduction rates of bacteria grown with 0.1 mM CdCl2 relative to the rates measured in bacteria grown under standard conditions. Rates were measured in situ employing 1H-NMR spectroscopy for glutathione reduction and spectrophotometry for thioredoxin reduction.

Bacterium Relative Glutathione Relative Thioredoxin Reduction Activity* Reduction Activity* A. butzleri 1.4 0.6 C. jejuni 1.6 0.7 H. pylori 1.5 0.5 W. succinogenes 1.5 0.4 *Changes in activity are given as the ratios of reduction rates in the presence and absence of Cd2+.

167 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

The results suggested several possible Cd2+ detoxication mechanisms in which the metal is bound by: 1) GSSG, 2) the enzyme, and/or 3) GSH. To differentiate between these alternatives, the interactions of Cd2+ ions with GSSG, GSH and glutathione reductase (Gor) were investigated employing 1H-, 13C-, and 113Cd-NMR spectroscopy. The 1H-

NMR spectrum of 2 mM GSSG was not affected by the presence of 2 mM CdCl2; under the same experimental conditions the ß-CH2 cysteinyl proton resonances of GSH were strongly broadened in the presence of cadmium. The 13C-NMR resonances of the "- glutamate, cysteine and glycine residues of 50 mM GSSG suspensions were slightly broadened by the addition of 10 mM CdCl2. At similar concentrations of the cadmium salt the resonances arising from the "-glutamate and glycine residues of 50 mM GSH were slightly broadened, but strong broadenings and upfield shifts were observed in the

C and Cß of the cysteine residues. Moderate broadening and a small change in chemical 113 shift were observed in the Cd-NMR resonance of 50 mM CdCl2 solutions by adding 5 mM GSSG. However, strong broadening and a marked upfield shift occurred in the 113 Cd-NMR resonance of CdCl2 in the presence of 5 mM GSH, a binding constant Kb = 7 ± 1 )M was determined from the data (Fig. 9.5). The NMR spectroscopy data suggested that Cd2+ ions interacted weakly with the residues of oxidized glutathione, but showed strong and specific interactions with the cysteinyl of reduced glutathione.

The interactions of Cd2+ ions with bovine Gor were studied employing 113Cd-NMR spectroscopy by titrating 50 mM CdCl2 solutions with the purified protein. Bovine Gor was utilized because it is commercially available and able to reduce GSSG. Addition of 113 the enzyme to the CdCl2 solutions produced downfield shifts of the Cd-NMR resonance that were a linear function of the protein concentration. Thus, the NMR spectroscopy data showed significant binding of Cd2+ ions to Gor and GSH, but not to GSSG.

These results could be explained by a simplified model that considers three populations of Cd2+ ions: (1) bound to the enzyme, (2) bound to the reduced thiol, and (3) a heterogenous ensemble free in solution, bound to cellular components, etc. The

168 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Figure 9.5 113 Cd-NMR resonances of 50 mM CdCl2 in aqueous NaCl (75 mM), KCl (75 mM) buffer (bottom), and with 5 mM GSH added to the solution (top). Instrument parameters are described in the experimental procedures.

169 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

proportion of Cd2+ ions bound by the reduced thiol will increase with time as more thiol is produced by the reaction. This binding will induce a redistribution of ions in the other two populations. In particular, the removal of Cd2+ cations available to interact with the protein will decrease the inhibition of the enzyme activity. The redistribution of ions between the three populations will continue until it reached a new equilibrium which would depend on factors such as total Cd2+ ion concentration, substrate concentration, maximal rates of enzyme activity, etc.

9.4 CONCLUSION The tolerance to cadmium cations of four Campylobacterales species was determined and compared to understand better bacterial mechanisms of resistance to cadmium stress. Growth inhibition experiments indicated that there were differences between the susceptibilities to cadmium of the four bacterial species. Bioinformatic analyses showed that these bacteria had considerable repertoires of proteins that could be involved in cadmium ion detoxication, but the cadmium susceptibility of each of the Campylobacterales did not correlate with the putative molecular mechanisms to reduce intracellular cadmium concentration identified in each one of them.

This study also identified features in the response of C. jejuni to cadmium stress unique to it as well as others common with the responses of other bacteria. The modulation of the expression of enzymes of fatty acid biosynthesis and the TCA cycle by C. jejuni is similar to that reported previously for other organisms [Leal, 1965; Strydom et al., 2006]. On the other hand, the downregulation by C. jejuni of thioredoxin reductase expression and the upregulation of the expression of a disulfide-reducing system capable of reducing GSSG were demonstrated here for the first time. Cadmium affected the central metabolism of C. jejuni, and the bacterium responded by downregulating proteins involved in metal uptake, and upregulating proteins involved in metal storage and xenobiotic detoxication. Further studies will serve to characterize the glutathione- reducing system of C. jejuni that is modulated by the presence of Cd2+ ions; the identification of 35 putative redox proteins in this bacterium (Table 7.4) provides a set of proteins potentially responsible for this activity.

170 Chapter 9 Disulfide reductases and metal detoxication in Campylobacterales

Finally, similar GSSG reduction activities have been observed in four genera belonging to two families of the order Campylobacterales, suggesting that these bacteria may have in common a novel system capable of detoxicating metals.

171 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

CHAPTER 10:

THIOL DISULFIDE OXIDOREDUCTASES IN CAMPYLOBACTERALES

172 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

10.1 INTRODUCTION A way in which pathogenic bacteria interact with their hosts is by secreting proteins. In Gram-negative bacteria, several types of secretion pathways have been identified. Many of the proteins residing in or transiting through the periplasmic space form disulfide bonds after their translocation across the inner membrane, suggesting that disulfide bond formation is crucial for the protein-folding pathway of many cell envelope proteins [Miki et al., 2004]. The family of thiol disulfide reductases Dsb, contribute in this specific way to the structural integrity of some enzymes and modulate their activities [Fabianek et al., 2000]. Furthermore, they have been implicated in cytochrome c maturation [Fabianek et al., 2000].

Periplasmic oxidoreductases have different types of activities compared to those in the cytoplasm. The cytoplasmic proteins are generally reducing proteins, while the periplasmic proteins are oxidizing, reducing or isomerizing [Fabianek et al., 2000]. The function of these proteins is either the oxidative formation of disulfide bonds, which is often necessary for folding and stability of secretory proteins; the reduction of non-native disulfides; or the isomerization of disulfide bonds in proteins, especially when wrong disulfide bonds are formed (Fig. 10.1) [Fabianek et al., 2000]. A periplasmic enzyme, DsbA, and an integral membrane protein, DsbB, are involved in the oxidation pathway in the periplasm of many Gram-negatives [Fabianek et al., 2000; Raina & Missiakas, 1997; Rietsch & Beckwith, 1998]. The isomerization pathway is provided by a periplasmic protein, DsbC, and an inner membrane protein, DsbD, which transports electrons across the inner membrane from thioredoxin [Fabianek et al., 2000; Raina & Missiakas, 1997; Rietsch & Beckwith, 1998]. The periplasmic enzyme DsbG has not been fully characterized although evidence suggests that it is responsible for the redox balance in the periplasm.

Thiol disulfide oxidoreductases contribute to the pathogenicity of diverse organisms through their role as an essential catalyst promoting the correct folding of secreted or surface-presented factors such as toxins, adherence factors, and components of type III

173 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Figure 10.1 Disulfide reducing and oxidizing pathways in Escherichia coli [Ritz & Beckwith, 2001]. Thioredoxin reductase and glutathione reductase can reduce thioredoxins and glutaredoxins, respectively. In the periplasm, DsbA/DsbB are responsible for thiol oxidation, whereas DsbD is involved in disulfide bond isomerization (via DsbC), cytochrome c maturation (via CcmG), and maybe other processes. The arrows indicate the direction of the electron flow.

174 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

secretory systems [Yu & Kroll, 1999]. Examples of these virulence factors are the cholera toxin of Vibrio cholerae [Peek & Taylor, 1992; Yu et al., 1992], the heat-stable toxin of enterotoxigenic E. coli [Okamoto et al., 1995; Yamanaka et al., 1994], the molecular chaperone, PapD, of the P pili of uropathogenic E. coli [Jacob-Dubuisson et al., 1994], the bundle-forming pili and intimin of enteropathogenic E. coli [Hicks et al., 1998; Zhang & Donnenberg, 1996], and the invasin of Yersinia pseudotuberculosis [Leong et al., 1993]. DsbA is required also for the proper function of the Type III secretion pathway in Yersinia pestis [Jackson & Plano, 1999], Shigella flexneri [Watarai et al., 1995], Salmonella enterica serovar Typhimurium [Miki et al., 2004] and Pseudomonas aeruginosa [Ha et al., 2003]. Inactivation of DsbA was found to affect the intracellular survival and virulence of S. flexneri [Yu, 1998]. This protein is involved also in the correct folding of the cellulase EGZ in the plant pathogen Erwinia chrysanthemi [Yu & Kroll, 1999]. DsbA and DsbC are required for secretion of Pertussis toxin by Bordetella pertussis [Stenson & Weiss, 2002].

Little is known about the enzymes catalyzing disulfide bond formation in - Proteobacteria; thus, a bioinformatics method to identify putative thiol disulfide oxidoreductases was developed and applied on the genomes of C. jejuni, H. pylori, W. succinogenes and A. butzleri.

10.2 EXPERIMENTAL PROCEDURES Searches for proteins with CXXC motifs were performed using TIGR genome databases of H. pylori strain 26695, C. jejuni strain NCTC 11168 and W. succinogenes strain DSMZ 1740 (http://www.tigr.org/). The A. butzleri RM4018 genome has been deposited on the NCBI database (http://www.ncbi.nlm.nih.gov/). Proteins which contain the thioredoxin-like fold in their structure were identified using the database Interpro [Mulder et al., 2005]. Proteins found to contain the thioredoxin-like fold, which also contained the CXXC motif were considered putative thiol disulfide oxidoreductases. Signal peptide prediction was performed using the SignalP 3.0 Server available at (http://www.cbs.dtu.dk/services/SignalP/).

175 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

10.3 RESULTS AND DISCUSSION 10.3.1 Identification of Helicobacter pylori thiol disulfide oxidoreductases In H. pylori, a DsbB-like protein DsbI encoded by hp0595, has been identified experimentally [Raczko et al., 2005], and a putative DsbC encoded by hp0377 has been annotated in the genome of H. pylori strain 26695. Also, the cytochrome c biogenesis protein encoded by hp0265 has sequence similarity to thiol disulfide oxidoreductases from related bacterial species.

Generally, thiol disulfide oxidoreductases are characterized by two features. They share an active site containing two cysteines arranged in a CXXC motif, which are either in the reduced state forming two thiols or in the oxidized state forming an intramolecular disulfide bond [Fabianek et al., 2000]. The second feature of most of these proteins is a common tertiary structure known as the thioredoxin-like fold present in them, despite very low primary sequence similarities [Fabianek et al., 2000]. Bioinformatic identification of Dsb proteins in H. pylori using these two features was performed. Searches in the genome of H. pylori strain 26695 for proteins which contained a CXXC motif identified a total of 149 proteins (Chapter 7, Table 7.3).

The thioredoxin-like fold common to enzymes that catalyze disulfide bond formation and isomerization is an example of an alpha/beta protein fold that has oxidoreductase activity. Its spatial topology consists of a four-stranded beta sheet sandwiched between two alpha helices [Copley et al., 2004]. Helicobacter pylori proteins which contain this fold in their structure were identified using the database Interpro [Mulder et al., 2005]. A total of 8 proteins were found to contain the thioredoxin-like fold, 4 of which also contained the CXXC motif (Table 10.1). These four proteins were the two thioredoxins, the putative DsbC and a hypothetical protein encoded by hp0231. The DsbI protein encoded by hp0595 was found to contain a CXXC motif in its sequence but did not contain a thioredoxin-like fold in its structure.

176 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Table 10.1 Helicobacter pylori strain 26695 proteins containing a thioredoxin-like fold as identified by Interpro. The proteins were identified among those containing CXXC motifs in their sequences.

ORF Protein CXXC motif hp0096 2-Hydroxyacid dehydrogenase No hp0136 Bacterioferritin comigratory protein No hp0231 Hypothetical protein Yes hp0377 Putative thiol disulfide interchange protein Yes hp0390 Adhesin-thiol peroxidase No hp0824 Thioredoxin Yes hp1458 Thioredoxin Yes hp1563 Alkyl hydroperoxide reductase No

177 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Sequence alignments of the three putative H. pylori Dsb proteins with the E. coli Dsb proteins were performed. An indication of the functional similarity within each pair was the alignment and conservation of the motifs (Fig. 10.2). The sixth residue before the N- terminal cysteine of the motif was also highly conserved among the three pairs of proteins (Fig. 10.2). The predicted coding region HP0231 aligned with the DsbG of E. coli; H. pylori putative DsbC aligned with E. coli DsbC; the first part of the H. pylori DsbI protein aligned with the E. coli DsbB, as was mentioned by Raczko et al. [2005]. This study also speculated that the second part of the H. pylori DsbI protein, a !-propeller domain, could act as a platform for recruiting a protein with an active missing second pair of cysteines [Raczko et al., 2005]. In H. pylori, the functional replacement of DsbB with DsbI and the absence of DsbA provided evidence for a novel Dsb oxidizing system.

Four proteins of interest encoded by hp0231, hp0265, hp0377 and hp0595 were identified bioinformatically to be putative Dsb proteins in H. pylori. Literature searches performed to investigate their involvement in virulence or colonization indicated that HP0231 and HP0595 are related to the colonization efficiency of H. pylori, but to date no studies have linked HP0265 or HP0377 to the pathogenesis of the bacterium.

Helicobacter pylori secreted proteins may contribute to gastric inflammation and epithelial damage in the host. In vitro analysis identified HP0231 as a secreted protein enriched more than 10-fold compared to UreB, and it may be implicated in H. pylori- induced effects on the gastric epithelium [Kim et al., 2002]. HP0231 was recognized by H. pylori positive sera in a systematic, proteome-based approach used to detect candidate antigens of H. pylori for diagnosis, therapy and vaccine development and to investigate potential associations between specific immune responses and manifestations of disease [Haas et al., 2002]. A study of H. pylori antigens in specific-pathogen-free mice using multiparameter selection, demonstrated that HP0231 conferred protective immunity in the mouse Helicobacter infection model with levels of protection generally considered the gold standard for Helicobacter immunization [Sabarth et al., 2002]. These studies demonstrated that this protein is involved in the colonization by H. pylori.

178 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Figure 10.2 Sequence alignment of the motifs of the three putative Helicobacter pylori Dsb proteins with the motifs of the Escherichia coli Dsb proteins.

179 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

The protein DsbI encoded by hp0595 is a novel component of the Dsb system in H. pylori important for disulfide bond formation in periplasmic proteins [Raczko et al., 2005]. A dsbI-knockout mutant impaired in disulfide bond formation revealed a greatly reduced ability to colonize the gastric mucosa of mice suggesting a role for DsbI in the pathogenesis of H. pylori [Godlewska et al., 2006].

10.3.2 Thiol disulfide oxidoreductases in the other three species The same identification method was applied on the genomes of C. jejuni NCTC 11168, W. succinogenes DSMZ 1740 and A. butzleri RM4018. Proteins which contained CXXC motifs were identified previously in Chapter 3. Nine, twelve and fourteen proteins in C. jejuni, W. succinogenes and A. butzleri, respectively, were found to contain both a CXXC motif and a thioredoxin-like fold (Table 10.2). Literature searches were carried out to locate published experimental work performed on the proteins identified in the three species but no studies were found.

The identification of putative Dsb proteins increased with genome size of the organism. The numbers of putative Dsb proteins per 1000 proteins of each bacterial genome were calculated for each species for comparison purposes (Fig. 10.3). C. jejuni, W. succinogenes and A. butzleri all had approximately 6 putative Dsb proteins per 1000 genomic proteins whereas H. pylori had only 2.5 (Fig. 10.3), providing further evidence that H. pylori could possess a unique Dsb system.

The method yielded false positives because other proteins such as thioredoxin share the two characteristics employed to identify putative Dsb proteins. In addition, the H. pylori genome contained characterized Dsb proteins without the usual thioredoxin-like fold. Thus, further analyses were performed involving comparative BLASTP searches and signal peptide prediction. The Dsb system is located in the periplasm of these species which allowed the use of SignalP 3.0 Server as a further filtration process. These analyses filtered the proteins in Table 10.2 to 8, 4, 8 and 7 Dsb proteins in C. jejuni, H. pylori, W. succinogenes and A. butzleri, respectively (Table 10.3). H. pylori contained approximately half the number of putative thiol disulfide oxidoreductases (Figure 10.4),

180 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Table 10.2 C. jejuni strain NCTC 11168, H. pylori strain 26695, W. succinogenes strain DSMZ 1740 and A. butzleri strain RM4018 proteins containing a thioredoxin-like fold and at least one CXXC motif in their sequences.

Species ORF Protein name Campylobacter jejuni cj0147c Thioredoxin (TrxA) cj0603c Putative thiol disulfide interchange protein (DsbD) cj0779 Probable thiol peroxidase (Tpx) cj0872 Putative disulphide isomerase (DsbA) cj1106 Possible periplasmic thioredoxin cj1207c Putative lipoprotein thioredoxin cj1380 Putative periplasmic protein cj1664 Possible periplasmic thioredoxin cj1665 Possible lipoprotein thioredoxin cj1666c Putative periplasmic protein

Helicobacter pylori hp0231 Hypothetical protein hp0377 Putative thiol disulfide interchange protein hp0824 Thioredoxin hp1458 Thioredoxin

Wolinella succinogenes ws0073 Putative lipoprotein thioredoxin ws0393 Hypothetical protein ws0452 Thioredoxin (TrxA) ws0556 Conserved hypothetical protein ws0582 Cytochrome c biogenesis thioredoxin (ResA) ws0755 Hypothetical protein ws0758 Hypothetical protein ws1557 Hypothetical protein ws1747 Protein disulfide isomerase ws1847 Putative protein disulfide isomerase ws2008 Hypothetical protein ws2158 Conserved hypothetical protein

Arcobacter butzleri abu_0284 Putative DsbA oxidoreductase abu_0312 NADH-quinone oxidoreductase, E subunit abu_0457 Hypothetical protein abu_0557 Thiol peroxidase abu_0573 Hypothetical protein abu_0890 Putative lipoprotein thioredoxin abu_1055 Conserved hypothetical periplasmic protein abu_1448 Putative lipoprotein thioredoxin abu_1449 DsbA-like thioredoxin domain protein abu_1733 Hypothetical protein abu_1880 Thioredoxin abu_1933 Putative redox-active disulfide protein abu_1980 Glutaredoxin-like protein abu_2091 Thioredoxin

181 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

6 5 Putative Dsb 4 proteins per 1000 3 genomic proteins 2 1 0 Campylobacter Helicobacter Wolinella Arcobacter jejuni pylori succinogenes butzleri

Bacterial Species

Figure 10.3 Number of proteins containing a thioredoxin-like fold and a CXXC motif in their sequences per 1000 proteins of the bacterial genome.

182 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

Table 10.3 Putative Dsb proteins in C. jejuni, H. pylori, W. succinogenes and A. butzleri.

Species ORF Species ORF Species ORF Species ORF C. jejuni CJ0017c H. pylori HP0231 W. succinogenes WS0073 A. butzleri Abu_0284 CJ0603c HP0265 WS0393 Abu_0890 CJ0872 HP0377 WS0556 Abu_1055 CJ1106 HP0595 WS0582 Abu_1448 CJ1207c WS1558 Abu_1449 CJ1380 WS1747 Abu_1733 CJ1664 WS1847 Abu_2187 CJ1666c WS2158

183 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

9 8 Total number of 7 putative Dsb 6 5 proteins 4 3 2 1 0 Campylobacter Helicobacter Wolinella Arcobacter jejuni pylori succinogenes butzleri

Bacterial Species

Figure 10.4 Total number of putative Dsb proteins in C. jejuni, H. pylori, W. succinogenes and A. butzleri.

184 Chapter 10 Thiol disulfide oxidoreductases in Campylobacterales

which supports the hypothesis that H. pylori expresses an unusual Dsb system.

10.4 CONCLUSION The importance of the Dsb system in the pathogenesis of bacteria has emerged in the past decade. Among the large number of studies published on -Proteobacteria, only a few have addressed the family of thiol disulfide oxidoreductases. Evidence supported the hypothesis that H. pylori has a novel Dsb system, and characterizing this system will be required to understand fully the bacterium’s periplasmic environment, and how it interacts with the host. This chapter has served to highlight the importance of these enzymes and to identify avenues for future experimental investigations. Finally, this bioinformatics method can be applied on all organisms with uncharacterized Dsb systems as an initial identification process.

185

PART 2SUMMARY

186

The presence of disulfide reductases and their roles in several processes were investigated in four bacterial species. Analyses of the sequences that form the active sites of these enzymes were performed in 281 genomes available at the time. The presence of these sites in the proteome of an organism was found to correlate with its aerophily, providing evidence for a role of these sites in oxygen metabolism. Following these analyses, a method was developed to identify the reductases bioinformatically. The method detected 25 to 35 putative disulfide reductases in each of the four species. Subsequently, the role of these enzymes in drug resistance, heavy metal detoxication and pathogenesis was investigated.

The drug chosen for examination was metronidazole, a prodrug whose activation is dependent on redox reactions within the organism. The susceptibility of the four species to the drug was tested and it was found that the two Campylobacteraceae species were more resistant than the two Helicobacteraceae. Owing to its use in many H. pylori therapeutic regimens, metronidazole resistance was investigated further in this bacterium. The role of disulfide reductases in the resistant phenotype was examined, and a global study identified a putative novel resistance mechanism which involves ferredoxin reduction. This reduction has been implicated in resistant phenotypes in other organisms but had not been associated with resistance in H. pylori. Finally, more evidence of a role for intracellular redox status in Mtr resistance was found in C. jejuni where differences in resistance correlated with oxygen tolerances.

Heavy metal detoxication was studied in the four species. Cadmium was chosen because it is toxic at low concentrations and its increase in the environment as a result of pollution. Very few enzymes are cadmium specific, one of which is a carbonic anhydrase expressed by a marine Diatom T. weissflogii [Strasdeit, 2001]. The effects of cadmium on the growth of the four species were analyzed. Bioinformatic analyses identified several proteins that were putatively involved in cadmium detoxication in these organisms. A global approach was applied to investigate the molecular response of C. jejuni to this metal. This bacterium was chosen owing to its known pathogenesis and its ability to survive in the environment outside the host. The metal had detrimental effects on many

187

processes in the bacterium, but C. jejuni upregulated proteins with antioxidant functions. In addition, disulfide reduction was found to be involved in the detoxication process in C. jejuni, and likely to be involved in the other three species.

A method capable of identifying thiol disulfide oxidoreductases (Dsb proteins) was developed. Putative enzymes were identified in the four species, and their role in pathogenesis was reviewed. It is important to recognize that some thiol disulfide oxidoreductases identified in these bacteria could have been overlooked in the previous identification method because their CXXC motifs were not followed by an alpha-helix. An explanation is that the roles of these enzymes are not limited to reduction but also involve oxidation and isomerization.

Glutathione reduction in the presence of NADH was measured in the four Campylobacterales species. There is no glutathione reductase in these bacterial species; thus, other enzyme(s) are responsible for these activities. There are two thioredoxin reductases identified bioinformatically in the genomes of the species, and only one characterized experimentally. Therefore, the Third Part of the thesis focused on investigating the thioredoxin systems of the four species and characterizing the second putative thioredoxin reductase.

188

PART 3: THE THIOREDOXIN SYSTEM

CHAPTER 11: PART 3INTRODUCTION 190 11.1 BACKGROUND 191 11.2 THIOREDOXIN SYSTEMS OF MICROORGANISMS 191 11.3 THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES 195

CHAPTER 12:THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES 196 12.1 INTRODUCTION 197 12.2 EXPERIMENTAL PROCEDURES 197 12.2.1 Bioinformatics 197 12.2.2 Generation of linear expression templates 198 12.2.3 Small-scale protein expression 201 12.2.4 Large-scale protein expression 202 12.2.5 Ni-NTA purification 202 12.2.6 Assays of recombinant enzyme 202 12.2.7 Protein modeling 203 12.2.8 Tandem affinity purification 203 12.2.9 Other procedures 205 12.3 RESULTS AND DISCUSSION 207 12.3.1 Phylogenetic analyses 207 12.3.2 Expression, purification and recombinant enzyme activity assays 209 12.3.3 Bioinformatic analyses and protein modeling 216 12.3.4 Tandem affinity purification 220 12.4 CONCLUSION 220

PART 3SUMMARY 222

189 Chapter 11 Part 3 Introduction

CHAPTER 11:

PART 3INTRODUCTION

190 Chapter 11 Part 3 Introduction

11.1 BACKGROUND Following the investigation of disulfide reductases and the processes they modulate in Campylobacterales, a more detailed study was performed of a disulfide reduction system of these bacterial species. Among the disulfide reductases identified in the four Campylobacterales species, ten proteins functionally related to central metabolism had homologues across all four taxa (Table 7.5). Four of these proteins form part of the thioredoxin system which is ubiquitous from prokaryotes to man. The thioredoxin systems serve as electron donors for enzymes performing redox reactions, e.g. ribonucleotide reductases (Fig. 11.1), peroxiredoxins and methionine sulfoxide reductases. These systems are critical for redox regulation of protein function and signaling via thiol redox control, and they participate in the defense against oxidative stress. Also, major detoxification systems rely on reducing equivalents from thioredoxin.

11.2 THIOREDOXIN SYSTEMS OF MICROORGANISMS A large superfamily of proteins that contain one or multiple thioredoxin domains are grouped into at least six classes: thioredoxins, glutaredoxins, DsbA, protein disulfide isomerase, glutathione transferases, and glutathione peroxidases [Arnér & Holmgren, 2000]. The first four are redox-active proteins containing a CXXC motif. The remaining two classes of proteins, the glutathione transferases, and glutathione peroxidases lack the CXXC motif, but share with the glutaredoxins their ability to interact with GSH [Arnér & Holmgren, 2000].

Thioredoxin reductase is a member of a family of pyridine nucleotide-disulfide oxidoreductases which includes lipoamide dehydrogenase, glutathione reductase, and mercuric ion reductase [Mulrooney & Williams, 1994]. Thioredoxin reductase is a dimer of identical subunits, each having one redox-active disulfide and one FAD. The reaction sequence is initiated by binding of NADPH to oxidized thioredoxin reductase and passage of the electrons to FAD (Fig. 11.1) [Mulrooney & Williams, 1994]. Electrons are equilibrated with the disulfide, and these three steps constitute the reductive half-reaction [Mulrooney & Williams, 1994]. The oxidative half-reaction involves dithiol-disulfide

191 Chapter 11 Part 3 Introduction

Figure 11.1 The thioredoxin and glutaredoxin systems. The reaction sequence is initiated by binding of NADPH to oxidized thioredoxin reductase and passage of the electrons to FAD. Subsequently, dithiol-disulfide interchange occurs between the nascent dithiol of thioredoxin reductase and the disulfide of thioredoxin. (http://www.cs.stedwards.edu/chem/)

192 Chapter 11 Part 3 Introduction

interchange between the nascent dithiol of thioredoxin reductase and the disulfide of thioredoxin (Fig. 11.1) [Mulrooney & Williams, 1994].

As dithiol/disulfide oxidoreductases all thioredoxins catalyze the reduction of protein disulfides orders of magnitude faster than dithiothreitol or GSH [Arnér & Holmgren, 2000]. The N-terminal active site Cys residue has a low pKa value and is the attacking nucleophile in disulfide reduction of proteins [Holmgren, 1995]. The mechanism involves a transient mixed disulfide intermediate and fast thiol/disulfide exchange in a hydrophobic environment [Holmgren, 1995]. The reaction is reversible and thioredoxin may either break or form disulfides depending on the redox potential of its substrate.

The common roles of the thioredoxin systems of various organisms have been summarized in Table 11.1. Additional roles for these proteins have been identified; for example, this system is capable of repairing tubulin damaged by peroxynitrite [Landino et al., 2004]. In E. coli, the thioredoxin system mediates iron binding and delivery, possesses chaperone and protein disulfide isomerase activities, reduces glutaredoxin, and is involved in reductive assimilation of selenite [Ding et al., 2005; Fernandes et al., 2005; Jurado et al., 2006; Kern et al., 2003; Takahata et al., 2008]. The thioredoxin system of the filamentous fungus Aspergillus nidulans has an impact on its development and oxidative stress response [Thön et al., 2007]. Finally, reduced thioredoxin is capable of reducing glutathione in Drosophila melanogaster [Cheng et al., 2007].

The advances in the study of redox systems have led to the identification of novel disulfide oxidoreductases with thioredoxin reduction activity. For example, the causative agent of schistosomiasis Schistosoma mansoni possesses an unusual thiol redox system centered on a thioredoxin-glutathione reductase [Alger & Williams, 2002]. This enzyme represents an unusual fusion of a pyridine nucleotide disulfide oxidoreductase and a redox active glutaredoxin extension, and is capable of thioredoxin reduction, glutathione reduction, and glutaredoxin activity [Alger & Williams, 2002].

193 Chapter 11 Part 3 Introduction

Table 11.1 Roles of thioredoxins [Arnér & Holmgren, 2000].

Organism Role of thioredoxin Comments All organisms DNA synthesis Hydrogen donor for ribonucleotide reductase Protein disulfide reduction Keeps intracellular protein disulfides generally reduced

Many Reduction of H2O2 Through reduction of peroxiredoxins organisms Protein repair by methionine sulfoxide Hydrogen donor for methionine sulfoxide reductases reduction

E. coli phages Subunit of T7 DNA polymerase Increases processivity Participates in filamentous phage Required for phage assembly and export assembly

Bacteria and Hydrogen donor for PAPS reductase Assimilation of sulfur by sulfate to sulfite yeast reduction

Plants Regulation of chloroplast photosynthetic Photosynthesis regulation by light via enzymes ferredoxin

Mammals Redox regulation of transcription factors Activation or inhibition of transcription factors Regulation of apoptosis Prevents downstream signaling for apoptosis Immunomodulation Both a co-cytokine and chemokine Pregnancy Assists implantation and establishment of pregnancy Birth Protection from hyperoxia at birth CNS Promotion of neuronal survival at ischemia/reperfusion

194 Chapter 11 Part 3 Introduction

11.3 THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES Pathways to synthesize glutathione or other thiol redox compounds are not present in H. pylori. Instead the bacterium has a thioredoxin system comprising two thioredoxins

(TrxA1 and TrxA2) and a thioredoxin reductase (TrxB1) [Windle et al., 2000]. Another protein has been annotated as a second thioredoxin reductase (TrxB2) [Alm et al., 1999]. The thioredoxin system mediates resistance to oxidative and nitrosative stress in H. pylori [Comtois et al., 2003]. The system is active in reducing AhpC [Baker et al., 2001], Tpx and Bcp [Comtois et al., 2003], as well as methionine sulfoxide reductase [Alamuri &

Maier, 2004]. TrxA1 also acts as an arginase chaperone capable of renaturing the enzyme to a catalytically active state [McGee et al., 2006]. Similarly to H. pylori, pathways to synthesize glutathione or other thiol redox compounds are not present in C. jejuni, W. succinogenes and A. butzleri. Thioredoxin has been identified as a biomarker for sub- speciating C. jejuni [Fagerquist et al., 2006]. Excluding this finding, no major investigations have been performed on the thioredoxin systems of C. jejuni, W. succinogenes and A. butzleri.

195 Chapter 12 Thioredoxin systems of Campylobacterales

CHAPTER 12:

THIOREDOXIN SYSTEMS OF CAMPYLOBACTERALES

196 Chapter 12 Thioredoxin systems of Campylobacterales

12.1 INTRODUCTION Thioredoxin reductases have evolved in two forms, one is found in prokaryotes, archaea and lower eukaryotes and is abbreviated as TrxB in this study, and the other form is found in higher eukaryotes and is abbreviated as TrxR [Williams et al., 2000]. In bacteria, fungi and plants thioredoxin reductases are approximately 70 kDa dimeric flavoproteins, with specificity for substrates containing disulfides. In contrast, thioredoxin reductases of higher eukaryotes are selenium-dependent, 112-130 kDa dimeric flavoproteins with broad substrate specificity that can reduce also non-disulfide substrates such as hydroperoxides [Williams et al., 2000]. All mammalian thioredoxin reductase isozymes are homologous to glutathione reductase [Williams et al., 2000].

Two putative thioredoxin reductases TrxB1 and TrxB2 were identified, and thioredoxin reductase activity was detected in the four bacteria. Evolutionary relationships between the two thioredoxin reductases were investigated by constructing phylogenetic trees and comparing them to the reductases found in other bacteria. The properties of H. pylori

TrxB2, encoded by hp1164, were characterized further.

12.2 EXPERIMENTAL PROCEDURES 12.2.1 Bioinformatics The programs employed to generate the phylogenetic trees are on the bioinformatic database BioManager (http://www.angis.org.au). Multiple sequence alignments were generated for the thioredoxin reductase sequences using the program ClustalW [Thompson et al., 1994]. The BLOSUM30 protein weight matrix was applied with a gap opening penalty of 10, gap extension penalty of 0.05, and gap separation distance of 8. The SeqBoot tool [Felsenstein, 1989] was used to produce multiple data sets from the ClustalW sequence alignments by bootstrap resampling, and one hundred replicates were generated using this method. The Protdist program [Felsenstein, 1989] was applied to compute a distance measure for the bootstrapped data sets, using maximum likelihood estimates based on the Dayhoff PAM matrix. The parameters employed were: the George/Hunter/Barker amino acid characterization method, 0.4570 probability of category change, transition/transversion ratio of 2.0, and equal base frequencies. The

197 Chapter 12 Thioredoxin systems of Campylobacterales

Neighbor program [Felsenstein, 1989] was utilized to produce an unrooted tree using the neighbor-joining tree building method, and the Consense tool [Felsenstein, 1989] was employed to compute a tree by the majority-rule consensus tree method.

12.2.2 Generation of linear expression templates The Roche ProteoExpert Rapid Translation System (RTS) E. coli HY software (Mannheim, Baden-Württemburg, Germany) available at www.proteoexpert.com was employed to design templates for use in protein expression with the RTS (Roche). Three progressive rounds of PCR (Fig. 12.1) were utilized to generate a linear expression template encoding a thrombin recognition site, the T7 promoter, the T7 terminator, a C- terminal hexa-histidine tag and the trxB2 gene from H. pylori strain 26695, with optimized codons at the 5’-end for use in E. coli. Dye-terminator sequencing was employed after each PCR step to confirm the absence of errors introduced during amplification.

The initial PCR reactions were performed on H. pylori strain 26695 chromosomal DNA to generate a single product containing the trxB2 gene and a thrombin recognition sequence employing the primers F1-TrxB269 and R1-TrxB2 (Table 12.1). Primer R1- TrxB2 was specifically designed for the addition of a thrombin cleavage site (LVPRGS) at the 3’-end of trxB2. PCR reactions were carried out in 50 µl volumes and consisted of the appropriate volume of reaction buffer, 2 mM MgCl2, dNTPs (final concentration 0.1 mM of each dNTP), 5-10 ng plasmid DNA template, 0.2 µM of each primer and 1.25 U of AmpliTaq GOLD polymerase. The following parameters were employed for PCR cycling: 94 °C for 4 min, 25 cycles at 94 °C for 15 s, 56 °C for 15 s and 72 °C for 45 s, and a final elongation step at 72 °C for 7 min. PCR products were purified using the QIAquick purification kit (Qiagen; Doncaster, VIC, Australia), and purity was confirmed by agarose gel electrophoresis. The purified PCR products were cloned into E. coli DH5 by overnight ligation with pGEM-T and transformation of E. coli DH5 cells. Plasmid inserts were confirmed by colony PCR employing the primers T7p and Sp6 available from Promega.

198 Chapter 12 Thioredoxin systems of Campylobacterales

Figure 12.1 RTS 100 E. coli linear template generation scheme (https://www.roche-applied-science.com/sis/proteinexpression/index.jsp)

199 Chapter 12 Thioredoxin systems of Campylobacterales

Table 12.1 The primer sequences employed for all PCR reactions in this chapter. The primers were designed for this study with the exception of those indicated by (*) which were from Promega and (#) which were from Roche’s ProteoExpert.

Primer name Primer sequence (5’ - 3’)

T7 promoter* TAATACGACTCACTATAGGG T7 terminator* GCTAGTTATTGCTCAGCGG SP6* TATTTAGGTGACACTATAG F1-TrxB269 GGATAGAAATGAATCAAG R1-TrxB2 GCTGCCTCTCGGCACTAAAGAGTGCAACCT IR1-TrxB2 GCTTGGCGTGATCTCATG IF1-TrxB2 GAGCTGGATCCTAGCACC Fwt-TrxB2# CTTTAAGAAGGAGATATACCATGAATCAAGAAATTTTAGACG Rwt-TrxB2# TGATGATGAGAACCCCCCCCGCTGCCTCTCGGCAC FV5-TrxB2# CTTTAAGAAGGAGATATACCATGAACCAAGAAATCTTAGATGTGTTGATAGTGGGTG FV8-TrxB2# CTTTAAGAAGGAGATATACCATGAACCAGGAAATTTTAGACGTGTT FV10-TrxB2# CTTTAAGAAGGAGATATACCATGAACCAGGAGATTTTAGATGTGTTGATAGTGGGTG H650 AACTGCAGAAATCCCTGTTGCGCTCTCTAAACAAGTGG H651 CTCTTTTCCATGGATCCAGAGTGCAACCTTTTAGCGATTTC H652 TAGTACCTGGAGGGAATAATGTAAAGCCGCTCACTCATCAAACGG H653 CCATCGATCGCCCGTCTTTTTTATGAGCCATTTTCAAA

200 Chapter 12 Thioredoxin systems of Campylobacterales

The second round of PCR involved the first step of linear-expression template generation shown in Figure 12.1 in which 5’ and 3’ linker sequences were added to trxB2. Primers used in these reactions served also to modify the 5’ sequence of trxB2 for optimal expression. Three of the ten forward primers recommended by the ProteoExpert system were chosen randomly for linear template generation (Table 12.1). These primers were used to determine the codon modifications that would produce the best yield of protein. The forward primers used were Fwt-TrxB2, FV5-TrxB2, FV8-TrxB2, and FV10-TrxB2; the same reverse primer Rwt-TrxB2 (Table 12.1) was used for generating all variants. The PCR conditions employed in this round were the same as for the first round. The third round of PCR involved the use of the RTS linear template generation kit (Roche) for overlap extension PCR (Fig. 12.1). Reactions were carried out in 50 µl volumes and consisted of the appropriate volume of reaction buffer, 3 mM MgCl2, dNTP (final concentration 0.25 mM of each dNTP), 5-10 ng template DNA, 0.48 µM of each primer, 2 U of AmpliTaq GOLD polymerase and 1 µl of linear template generation kit vial 3 (Roche). The following parameters were employed for PCR cycling: 94 °C for 4 min, 35 cycles at 94 °C for 15 s, 56 °C for 15 s and 72 °C for 1 min, and a final elongation step at 72 °C for 7 min.

12.2.3 Small-scale protein expression The cell-free Rapid Translation System RTS-100 for in vitro coupled transcription/translation was employed following the protocol of the manufacturer (Roche) for analysis of expression yields and optimization of reaction conditions using linear expression templates. Reactions of 50 µl were prepared as per instructions without alterations. Successful expression and recombinant protein yields were determined using Western blotting. The variant linear template that produced the greatest yield of His- tagged protein was cloned into E. coli DH5 by overnight ligation with the pGEM-T plasmid, and transformation into E. coli cells. The small-scale expression of soluble protein from the circular template was analyzed at 20 °C, 25 °C or 30 °C. Insoluble protein was separated from soluble reaction products by centrifugation and the two fractions compared by Western blot analysis.

201 Chapter 12 Thioredoxin systems of Campylobacterales

12.2.4 Large-scale protein expression

To express recombinant H. pylori TrxB2 in sufficient quantities for biochemical characterization, the Rapid Translation System RTS-500 E. coli circular template kit was employed following the protocol of the manufacturer (Roche). Reactions were prepared in a continuous exchange cell-free (CECF) reaction device with approximately 17 µg of purified plasmid template.

Reactions were performed with the Proteomaster instrument (Roche) for 24 h at 30 °C, and operating at 900 rpm. Reactions employing a null pGEM-T plasmid as a negative control and the RTS positive control vector pIVEX-gfp (Roche) were included in the expression procedure. The pIVEX-gfp vector encodes template for expression of a hexa- His tagged green fluorescent protein (GFP).

12.2.5 Ni-NTA purification

The C-terminal hexa-His tagged TrxB2 was purified at 4 °C by batch purification using Nickel-Nitrilo triacetic acid (Ni-NTA) resin and following the protocol of the manufacturer for miniprep purification under native conditions (Qiagen). The protein was detached from the Ni-NTA resin employing a 300 mM imidazole buffer.

12.2.6 Assays of recombinant enzyme DTNB reduction was observed in the presence of NADH or NADPH using a Cary-100 UV-visible spectrophotometer. The reaction mixtures contained purified recombinant enzyme and the appropriate substrates suspended in 50 mM Tris-HCl, pH 7.2 buffer in a final volume of 1 ml, and were placed in 1 cm path-length cuvettes. The concentration of DTNB used was 1 mM, and that of NAD(P)H 0.5 mM. The recombinant enzyme was added just prior to measurement, and the change in absorbance at 412 nm over 2 minutes was recorded. The coefficient of molar absorbance for DTNB is 13.6 x 103 mol-1 cm-1 at 412 nm.

GSSG reduction was measured in the presence of NADH or NADPH. The reaction mixtures contained recombinant enzyme and the appropriate substrates suspended in 50

202 Chapter 12 Thioredoxin systems of Campylobacterales

mM potassium phosphate buffer, pH 7.2 buffer in a final volume of 1 ml, and were placed in 1 cm path-length cuvettes. The concentration of GSSG used was 1 mM, and that of NAD(P)H 100 µM. The recombinant enzyme was added just prior to measurement, and the change in absorbance at 340 nm over 5 minutes was recorded.

NADPH and NADH oxidation were measured in the presence of menadione. The reaction mixtures contained recombinant enzyme and the appropriate substrates suspended in 50 mM potassium phosphate buffer, pH 7.2 buffer in a final volume of 1 ml, and were placed in 1 cm path-length cuvettes. The concentration of NAD(P)H used was 100 µM, and that of menadione 150 µM. The recombinant enzyme was added just prior to measurement, and the change in absorbance at 340 nm over 2 minutes was recorded.

12.2.7 Protein modeling Modeling was performed using the LOOPP parallel driver version 3.2 available at http://cbsuapps.tc.cornell.edu/loopp.aspx. Protein structure files were compiled from the protein data bank available at www.rcsb.org/pdb. Protein structures were viewed using DEEPVIEW/SWISS-PDBVIEWER [Kaplan & Littlejohn, 2001].

12.2.8 Tandem affinity purification The construction of hp1164 fused to the tandem affinity purification (TAP) tag and subsequent purification of TAP-tagged HP1164 were performed on H. pylori strain 26695 as previously described (Figs. 12.2, 12.3) [Stingl et al., submitted]. Briefly, the H650/H651 and H652/H653 primer pairs were designed to amplify around 500 base pairs of the 5’ and the 3’ regions flanking the TAP insertion site (Fig. 12.2). The two PCR products and the C-terminal TAP coding region on pILL851C were amplified using the primer pair H650 and H653. The full fragment was transformed into H. pylori 26695; cells which had recombined the tag into the chromosome were selected by their resistance to kanamycin, and were checked for expression of a tagged HP1164 protein by Western blot.

203 Chapter 12 Thioredoxin systems of Campylobacterales

pILL851C 6.7 kb

CBP ProtA KmNP TEV

KmNP end H652 H650

N TrxB2 C H653

H651 CBP start

PCR “sewing”

H650

TrxB2 C H653 X X

Figure 12.2 Construction of C-terminal TAP fusion genes for recombination into the H. pylori chromosome [Stingl et al., submitted]. Chromosomal regions flanking the insertion site of the TAP tag were amplified using the primer pairs H650/H651 and H652/H653. The H650 and H652 primers carry additional nucleotides complementary to the 5’ end of the 3’ end of the TAP tag (in pILL851-C), respectively, to enable fusion of the TAP tag with the flanking regions by PCR “sewing”. Sites at which homologous recombination into the chromosome can occur are indicated by crosses. CBP, calmodulin binding protein; KmNp, kanamycin non-polar cassette; TEV, cleavage site of the TEV protease; C, region of the target gene encoding the C-terminus of the protein; N, region of the target gene encoding the N-terminus of the protein.

204 Chapter 12 Thioredoxin systems of Campylobacterales

Helicobacter pylori cells of late logarithmic phase were harvested, washed once with 1% KCl and stored at -80 ºC. Cells were suspended in 10 ml g-1 of lysis buffer (100 mM HEPES/KOH pH 7.4, 100 mM KCl, 8% glycerol, and Complete protease inhibitor (Roche)), and subsequently disrupted by French press. The cell debris was centrifuged at 33000 g for 30 min. The cell-free extract was incubated with 0.2 ml of Sepharose-IgG beads (Amersham) for 2 h at 4 ºC. The beads were recovered by low-speed centrifugation and washed with 10 ml of binding buffer (50 mM HEPES/KOH, pH 7.4, 100 mM KCl, 0.1% NP-40, Complete protease inhibitor (Roche)) supplemented with 0.5 mM DTT. To release the IgG bound complex, 250 µl binding buffer with 0.5 mM DTT and 10 units of Ac-TEV protease (Invitrogen) were added to the beads and incubated at 16 ºC for 2 h. The eluant was added to the same volume of binding buffer supplemented with 4 mM

CaCl2 and incubated with 75 µl of Calmodulin beads at 4 ºC for 1 h. The beads were washed with 5 ml of binding buffer supplemented with 2 mM CaCl2, followed by the elution of the protein complex with 400 µl of elution buffer (20 mM Tris-HCl pH 8, 50 mM NaCl, 5 mM ethylene glycol tetraacetic acid (EGTA)). Proteins were precipitated with 10% TCA, washed once with 95% ethanol and solubilized in Lämmli loading buffer with 50 mM DTT at 80 ºC for 20 min. Proteins were separated on a 5-20% gradient Lämmli SDS polyacrylamide gel and stained with colloidal Coomassie.

The protein complexes were crosslinked using the thiol-cleavable crosslinker, dithiobis- (succinimidyl)-propionate (DSP) as depicted in Figure 12.3 [Stingl et al., submitted]. DSP was added at a concentration of 200 µg ml-1 and incubated on ice for 5 min. The crosslink reaction was stopped by the addition of 10 mM Tris-HCl pH 7.4.

12.2.9 Other procedures SDS-PAGE electrophoresis, image analysis, mass spectrometry analyses, Western blotting, polymerase chain reactions, transformation of E. coli and Dye-Terminator sequencing were performed as previously described in the Materials and Methods chapter.

205 Chapter 12 Thioredoxin systems of Campylobacterales

A B

Cell disruption Cell disruption

target target CBP CBP ProtA ProtA IgG beads IgG beads

pH 3 elution TEV cleavage readjustment to pH 7

Ca2+ Ca2+ target Ca2+ target Ca2+ Ca2+ Ca2+ Calmodulin beads Calmodulin beads

EGTA elution EGTA elution

target target

Figure 12.3 Principle of the modified tandem affinity purification method [Stingl et al., submitted]. A, purification under native conditions; B, purification after cross-linking protein complexes in whole cells using DSP. Both purifications were performed in parallel for each TAP-tagged protein.

206 Chapter 12 Thioredoxin systems of Campylobacterales

12.3 RESULTS AND DISCUSSION 12.3.1 Phylogenetic analyses Thioredoxin reductase activities were detected in all four Campylobacterales species using DTNB and NADPH as substrates, indicating that the enzymes were expressed under standard microaerobic growth conditions.

The protein sequences of the enzymes TrxB1 and TrxB2 from Table 7.5 were subjected to evolutionary analysis. A phylogram was generated for TrxB1 (Fig. 12.4), and a cladogram for TrxB1, TrxB2, TrxR, and glutathione reductases (Fig. 12.5). The enzymes of the Campylobacterales clustered together as expected (Figs. 12.4, 12.5), but interestingly, the

TrxB1 of the four Campylobacterales were more closely related to the corresponding enzymes of the Firmicutes than to those of the other Proteobacteria (Fig. 12.4). Analyses using the database Interpro [Mulder et al., 2005], showed no differences in the domain composition between the TrxB1 enzymes from each class of bacteria, which shared the Adxrdtase, Pyr_redox, Fadpnr, Trx_reduct, and Pyr_redox_2 signatures (data not shown). The absence of a specific glutathione reduction system in the Campylobacterales and many genera of Firmicutes [Patel et al., 1998] may explain the close evolutionary relationship between the TrxB1 of these two bacterial classes.

The Campylobacterales TrxB2 enzymes showed low homology (22-24% similarity) to the

TrxB1 enzymes. The trxB1 loci generally exist in the proximity of trxA genes encoding thioredoxins; this was the organization found in the Campylobacterales. In contrast, trxA genes were not present in the proximity of the trxB2 genes of the Campylobacterales.

The SMART database [Letunic et al., 2004] was employed to identify two major domains in TrxB2: Pfam:Pyr_redox and Pfam:Pyr_redox_2. These types of domains are common to enzymes with redox-related functions, such as glutathione reductases; conversely, Gor has a putative TrxB domain. The phylogenetic relationships between

TrxB1, TrxB2, TrxR, and Gor were investigated to obtain a better understanding of the presence of the two putative thioredoxin reductases TrxB1 and TrxB2 in

207 Chapter 12 Thioredoxin systems of Campylobacterales

Geobacillus kaustophilus 98 80 Bacillus anthracis

51 Bacillus clausii

56 Oceanobacillus iheyensis

87 Staphylococcus aureus Firmicutes Listeria monocytogenes 100 Lactobacillus plantarum 80 73 Enterococcus faecalis Thermoanaerobacter tengcongensis Campylobacter coli 100 100 80 Campylobacter jejuni 100 Campylobacter upsaliensis Campylobacter lari -Proteobacteria 100 Helicobacter hepaticus 84 Helicobacter pylori 100 61 Wolinella succinogenes 91 Arcobacter butzleri

Anabaena variabilis 51 Cyanobacteria Synechococcus elongatus 100 Chlamydiae 100 Thermosynechococcus elongatus -Proteobacteria 100 62 Clamydophila pneumoniae Anaeromyxobacter dehalogenans Caulobacter crescentus Rhodopseudomonas palustris -Proteobacteria Brucella abortus

90 Novosphingobium aromaticivorans Rickettsia akari Shigella flexneri 100 96 Escherichia coli

73 Yersinia pestis "-Proteobacteria

99 Vibrio cholerae Haemophilus influenzae Geobacter sulfurreducens Neisseria meningitidis -Proteobacteria Methylobacillus flagellatus Ralstonia solanacearum !-Proteobacteria Burkholderia cepacia Bordetella parapertussis

100

Figure 12.4

Phylogram of bacterial TrxB1 enzymes. ClustalW, SeqBoot, Protdist, Neighbor and Consense programs [Felsenstein, 1989; Thompson et al., 1994] were applied to construct a consensus tree from thirty-eight species of bacteria chosen from most bacterial classes.

208 Chapter 12 Thioredoxin systems of Campylobacterales

Campylobacterales and several other bacterial classes. In the cladogram represented in

Figure 12.5, the TrxB1 proteins clustered together, and the TrxB2 proteins were more related to Gor, and mammalian and parasite TrxR. The cladogram was constructed with the divisions showing specific generations at which the enzyme families diverged from each other. The TrxB1 enzymes of the Campylobacterales diverged from the TrxB2, nd TrxR, and Gor enzymes at the 2 division, while Campylobacterales TrxB2 proteins diverged from TrxR and Gor proteins at the 4th division (Fig. 12.5). The results indicated a closer relationship between Campylobacterales TrxB2, mammalian and parasite TrxR, and Gor, than between Campylobacterales TrxB2 and TrxB1. On this basis, it was hypothesized that TrxB2 of Campylobacterales is a broad substrate specificity disulfide reductase which evolved close to the higher eukaryote TrxR form.

Another interesting outcome of these analyses was the relationship between

Campylobacterales TrxB2 and the Plasmodium falciparum TrxR. Although the parasite proteome contains a glutathione reductase, its thioredoxin reductase has been shown to be a potential therapeutic target against P. falciparum. The parasite is very sensitive to reactive oxygen species and the enzyme is essential for its survival [Davioud-Charvet et al., 2003]. Compounds such as Mannich bases induce mechanism-based inactivation of thioredoxin reductases in P. falciparum by attacking specific locations at the active sites of the enzymes [Davioud-Charvet et al., 2003]. Campylobacterales are microaerophiles with high sensitivity to reactive oxygen species and their TrxB2 enzymes are significantly different from those of their hosts. If P. falciparum TrxR enzymes, which have evolved relatively closer to the human enzymes, have been identified as potential targets for treatment, analogously, the Campylobacterales TrxB2 enzymes could constitute potential therapeutic targets against these bacteria.

12.3.2 Expression, purification and recombinant enzyme activity assays

Characterization of TrxB2 was performed on the H. pylori enzyme because the molecular techniques on the bacterium are better described compared to the other three species. Also, the tandem affinity purification procedure has been optimized for H. pylori.

209 Chapter 12 Thioredoxin systems of Campylobacterales

1st 2nd 3rd 4th Mus musculus TrxR1 Mus musculus TrxR2 Homo sapiens TrxR1 Homo sapiens TrxR3 Mus musculus TrxR3 Homo sapiens TrxR2.1 Homo sapiens TrxR2.3 Homo sapiens TrxR2.2 Plasmodium falciparum TrxR Escherichia coli Gor Salmonella enterica Gor Homo sapiens Gor TrxR Sparus aurata Gor Lactobacillus plantarum Gor Burkholderia pseudomallei Gor Rhodopseudomonas palustrus Gor TrxB Campylobacter jejuni TrxB2 2 Campylobacter coli TrxB2 Campylobacter upsaliensis TrxB2 Campylobacter lari TrxB2 Wolinella succinogenes TrxB2 Gor Helicobacter hepaticus TrxB2 Helicobacter pylori TrxB2 Novosphingobium aromaticivorans TrxB2 Bacillus clausii TrxB2 Geobacillus kaustophilus TrxB2 Staphylococcus aureus TrxB2 Oceanobacillus iheyensis TrxB2 Rickettsia akari TrxB2 Rhodopseudomonas palustrus TrxB2 Enterococcus faecalis TrxB2 Thermus thermophilus TrxB2 Chlorobium tepidum TrxB2 Campylobacter jejuni TrxB1 Campylobacter coli TrxB1 Campylobacter upsaliensis TrxB1 Campylobacter lari TrxB1 Wolinella succinogenes TrxB1 Helicobacter pylori TrxB1 Helicobacter hepaticus TrxB1 Mycoplasma penetrans TrxB1 Rickettsia akari TrxB1 Rhodopseudomonas palustrus TrxB1 Novosphingobium aromaticivorans TrxB1 Escherichia coli TrxB Haemophilus influenzae TrxB1 TrxB1 Chlorobium tepidum TrxB1 Bacteroides thetaiotaomicron TrxB1 Halobacterium spp. TrxB1a Halobacterium spp. TrxB1b Bacillus clausii TrxB1 Geobacillus kaustophilus TrxB1 Oceanobacillus iheyensis TrxB1 Staphylococcus aureus TrxB1 Enterococcus faecalis TrxB1 Lactobacillus plantarum TrxB1 Thermoanaerobacter tengcongensis TrxB1 Treponema denticola TrxB1 Moorella thermoacetica TrxB1 Thermus thermophilus TrxB1 Figure 12.5 Cladogram of TrxB, TrxR and Gor enzymes. The sequences of enzymes from twenty- eight bacterial species, one archaea species, the protozoan parasite P. falciparum, Mus musculus, and Homo sapiens were used to perform this analysis. Bacterial species were selected from several classes.

210 Chapter 12 Thioredoxin systems of Campylobacterales

A modified pGEM-T plasmid was constructed containing the sequence of the hp1164 gene from H. pylori 26695 coding for TrxB2 and all the necessary components for expression of the enzyme.

Expression of the enzyme was performed in several steps. First, TrxB2 was expressed at several temperatures in order to determine the temperature with the highest yield (Fig. 12.6). The data in figure 12.6 showed that the optimal temperature for expression was 30 ºC; thus, this temperature was employed for future enzyme expression. Small-scale expression systems were used to optimize the procedure which meant the yield of the recombinant enzyme would not be strong. The size of the enzyme with the thrombin cleavage site and the His-tag is approximately 37.7 kDa, which corresponded to the size of the band observed on the western blot (Fig. 12.6). Second, TrxB2 was expressed and the E. coli lysate extract containing the recombinant enzyme was chromatographed on a gel (Fig. 12.7). Based on their location on the gel and their prominence, the bands marked with an arrow were cut out, digested and identified by mass spectrometry. H. pylori

TrxB2 was found among the E. coli proteins, and the identified peptides are listed in Table 12.2. The peptide score indicated the identification was significant. Third, to determine if the expressed enzyme was in the soluble fraction, TrxB2 was expressed at 30 ºC and the soluble fraction was separated from the pellet by centrifugation. The protein band was detected in the supernatant fraction and not in the pellet indicating the protein was expressed in the soluble fraction and thus, the expression system did not require the addition of any detergents (data not shown). Fourth, the optimal conditions to purify the enzyme without the addition of excess imidazole were investigated. The enzyme was expressed at 30 ºC and subsequently purified using an imidazole gradient (10-500 mM). The purified fractions were western blotted and stained (Fig. 12.8). The data in the figure showed that 300 mM imidazole released most of the bound recombinant enzyme from the Ni-NTA resin. A small amount of recombinant enzyme was released during elution at 500 mM imidazole (Fig. 12.8). In addition, a small quantity of recombinant enzyme did not bind to the Ni-NTA resin at all. An imidazole concentration of 300 mM was employed for subsequent purifications in order to minimize the effect of imidazole on activity assays.

211 Chapter 12 Thioredoxin systems of Campylobacterales

MW 209 A B C 124 80

49.1

TrxB2 34.8

28.9

20.6

7.1

Figure 12.6 Western blot analysis of recombinant enzyme expression at different temperatures. Lane A: expression at 25 ºC; B: expression at 20 ºC; C: expression at 30 ºC. The calculated size of TrxB2 with a thrombin cleavage site and a His-tag is approximately 37.7 kDa.

212 Chapter 12 Thioredoxin systems of Campylobacterales

MW A B 209 124

49.1

34.8 28.9

20.6

7.1

Figure 12.7

SDS-PAGE electrophoresis on E. coli lysate fractions with expressed TrxB2. Lane A: expression at 30 ºC; B: expression at 25 ºC. The gels were stained with GelCode blue. The arrow indicates the bands sent for mass spectrometry analyses based on their position on the gel.

213 Chapter 12 Thioredoxin systems of Campylobacterales

Table 12.2 Peptides identified through mass spectrometry analysis of the recombinant enzyme.

The total score of the mass spectrometry identification of TrxB2 was 343.

Peptide Number Peptide Score Peptide Sequence

1 38 RINEDNAKN

2 24 KTESHSGMLEKF*

3 64 KVNFTDNTSESFDRL

4 41 RLLYAIGGSTPLEFFKR

5 46 KDSFKEETLENFTNLLKE

6 38 KTLVIGGGNSAVEYAIALCKT#

7 41 KSGASIATALNHGYDVAIEIAKRL

8 51 KENLESNNIPNLFIVGDILFKS

*The peptide was modified by oxidation. #The peptide contained a carbamidomethyl modification.

214 Chapter 12 Thioredoxin systems of Campylobacterales

MW 209 E D C B A 124 80

49.1

34.8

28.9

20.6

7.1

Figure 12.8 Western blots of the recombinant enzyme purified with an imidazole gradient. Lane A: crude extract; B: unbound fraction; C: eluant with 20 mM imidazole; D: eluant with 300 mM imidazole; E: eluant with 500 mM imidazole. Expression was performed at 30 ºC.

215 Chapter 12 Thioredoxin systems of Campylobacterales

TrxB2 was expressed at 30 ºC, purified using 300 mM imidazole, and the fractions collected for enzyme assays. The results of St. Maurice et al. [2007] indicated that TrxB2 in H. pylori and C. jejuni are NADPH oxidoreductases that function in the pyruvate reduction cycle with PFOR. Confirmation of this activity was obtained by measuring activities of the recombinant enzyme (Table 12.3). The enzyme was capable of oxidizing NADH using either DTNB, GSSG or menadione as cofactors, but this activity was very weak (Table 12.3). The rate of oxidation approximately doubled for NADPH using DTNB or GSSG as cofactors (Table 12.3). The oxidation of NADPH using menadione as a cofactor was about 50 times greater than using DTNB or GSSG as cofactors (Table 12.3), confirming the findings of St. Maurice et al. [2007] that HP1164 is an oxidoreductase with specificity to NADPH.

12.3.3 Bioinformatic analyses and protein modeling St. Maurice et al. [2007] pointed out that the enzyme is conserved only among the - Proteobacteria but the results of homology searches and the data of Figure 12.5 suggested otherwise. Initial BLASTP searches did not identify a homologous enzyme in E. coli, but further analyses showed that an enzyme annotated as a soluble pyridine nucleotide transhydrogenase (PntA) encoded by c4923 in E. coli strain CFT073 was a possible candidate. E. coli PntA is made up of 466 residues while the H. pylori TrxB2 is only 324 residue-long which implied that the enzymes followed separate evolutionary paths.

Phylogenetic trees were constructed by adding the E. coli PntA sequence to the TrxB1,

TrxB2 and Gor sequences, and the enzyme clustered with the group of TrxB2 and Gor enzymes (data not shown). In addition, sequence alignments showed that the E. coli PntA and H. pylori TrxB2 share a glycine rich region at the beginning of the protein. Glycine rich regions are usually associated with NAD, FMN or FAD binding motifs [Smith et al.,

2000; Tarrío et al., 2004]; H. pylori TrxB2 contained a ‘GAGPGG’ sequence likely to be a FAD binding motif.

A 3D model of TrxB2 was created using in silico methods. The LOOPP software generates 5 models based on the top 5 available enzyme structures. The model illustrated in Figure 12.9 is the H. pylori TrxB2 structure with the highest score which used alkyl

216 Chapter 12 Thioredoxin systems of Campylobacterales

Table 12.3 Activities tested for the recombinant enzyme. Equal concentrations of recombinant enzyme were added to all the reactions. The enzyme assays were performed in triplicate.

Enzyme activity (nmol min-1)

Substrates DTNB GSSG Menadione

NADH 174 143 192

NADPH 331 322 16.2 x 103

217 Chapter 12 Thioredoxin systems of Campylobacterales

hydroperoxide reductase from E. coli as the base structure to thread the sequence of the H. pylori enzyme. This model and the second best model generated from the structure of NADPH dependent thioredoxin reductase from Arabidopsis thaliana were analyzed further.

Both models were very similar which suggested that despite threading from the structure of other enzymes the structure of TrxB2 was relatively stable. Visually, the models were made of a top and a bottom region (Fig. 12.9), and further analysis indicated that the top region was made up of two separate segments. Thus, the TrxB2 models presented N- terminus top (1-130) and bottom (164-252) domains, and a C-terminus domain (262- 324). The N-terminus domains are connected by a long loop (130-163), and the bottom N-terminus domain is connected to the C-terminus domain by a short loop (253-261).

Both models yielded very similar N-terminus top domains comprising two helices (16- 26; 77-89) and 6 or 7 !-strands. A long loop was present also in both models (36-75). Likewise, the N-terminus bottom domains were similar in both models with two helices (172-182; 205-212) and 7 !-strands. On the other hand, the C-terminus domains of both models showed differences. This segment contained a strand-loop-helix conformation (289-324) in both models, but different conformations for residues 262 to 288. Thus, the structure of this region remained undefined. Finally, domain analyses using SMART [Letunic et al., 2004] identified a Pfam:Pyr_redox domain from amino acids 164 to 254 which corresponds to the N-terminus bottom domain in Figure 12.9.

In summary, the protein contained 3 separate domains. Its N-terminus and C-terminus folded onto each other leaving the middle section to form a different domain. The N- terminus top domain contained a loop composed of about 40 residues, and a distinctive loop connected the N-terminus top and bottom domain (~33 residues). These analyses provided a basis for future 3D-modeling and inhibitor design experiments.

218 Chapter 12 Thioredoxin systems of Campylobacterales

A B

C D

Figure 12.9

In silico 3D model of H. pylori TrxB2. Modeling was performed using the LOOPP driver version 3.2 available at http://cbsuapps.tc.cornell.edu/loopp.aspx. The model was thread from the best available model, the catalytic core component of the alkyl hydroperoxide reductase AhpF from E. coli. Diagrams A, B, C, and D are illustrations of

H. pylori TrxB2 successively rotated 90º anticlockwise around a vertical axis.

219 Chapter 12 Thioredoxin systems of Campylobacterales

12.3.4 Tandem affinity purification Enzymes responsible for NADPH oxidation often are not confined to one functional pathway within the cell. In addition to the enzyme’s involvement in pyruvate reduction proposed by St. Maurice et al. [2007], TrxB2 may belong to other pathways within the bacterium. The STRING database linked TrxB2 with the proteins HP0825, HP1161, HP1162, HP1163 and HP1240. Thus, at the Institut Pasteur, an H. pylori strain was constructed to enable copurification of TrxB2 with its functional partners (Fig. 12.2). The enzyme was purified without and with cross-linking and the purified fractions were chromatographed on SDS-PAGE electrophoresis (Figs. 12.3, 12.10). Bioinformatic image analyses of lanes A and B identified 13 and 18 bands, respectively (Fig. 12.10), which suggested that the enzyme has several partners in the cell. Owing to time constraints and mass spectrometer malfunction at the Institut Pasteur, the analyses of all the bands were not completed. The bands marked with arrows were identified as HP1164 confirming that the purification had worked (Fig. 12.10). The difference in size between the bands in lanes A and B further validated the purification process because Protein A is not cleaved in the cross-linked purification and remained bound with HP1164 upon elution (Fig. 12.3).

12.4 CONCLUSION

Phylogenetic trees constructed for the two thioredoxin reductases TrxB1 and TrxB2 showed characteristics of the latter suggesting that it is an interesting candidate for further characterization, and possibly a potential target for therapeutic intervention.

Characterization of TrxB2 indicated this enzyme was a NADPH oxidoreductase and not a thioredoxin reductase. Bioinformatic modeling provided a basis for future experimental structural studies and inhibitor design, while purification of the TAP-tagged HP1164 suggested this protein had several partners within the cell possibly with different biological functions.

220 Chapter 12 Thioredoxin systems of Campylobacterales

MW A B 250

150

100

25 20 15 10

Figure 12.10

SDS-PAGE electrophoresis of TrxB2 tandem affinity purification eluants. Lane A represents the eluants from the native purification; and B represents the eluants from the cross-linked purification. Bioinformatic analyses identified 13 bands in lane A and 18 in B.

221

PART 3SUMMARY

222

The thioredoxin systems of the four species of Campylobacterales were analyzed phylogenetically. Interesting results revealed that TrxB1 was more closely associated to thioredoxin reductase of Firmicutes than to the enzymes of other Proteobacteria. The absence of a specific glutathione reduction system is a property shared among Campylobacterales and many genera of Firmicutes [Patel et al., 1998], and possibly, it is associated with the evolution of thioredoxin reductase. Proteobacteria evolved from a common ancestor; the difference between their thioredoxin reductases is a reminder that enzymes also follow their own path of evolution depending on the needs of the organism.

Further analyses on the second uncharacterized thioredoxin reductases TrxB2 of the four species were performed. These enzymes were found to be closer to glutathione reductases of other organisms than to the TrxB1 of Campylobacterales suggesting a different physiological role for these enzymes. This result led to the characterization of H. pylori

TrxB2. Expression and purification of the enzyme were performed, and several activities were tested. During the experimental work on H. pylori TrxB2, St. Maurice et al. [2007] hypothesized that the enzyme functions to provide electrons for PFOR activity by the reduction of NADPH. Our activity assays confirmed specificity towards NADPH but the results suggested that the enzyme has a more complex role in the cell, in addition to the role indicated by St. Maurice et al. [2007]. These findings established that TrxB2 was not responsible for the GSSG reduction measured previously in H. pylori lysates and cell-free extracts.

At the Institut Pasteur, a H. pylori 26695 strain capable of expressing a modified TrxB2 was constructed. Purification of modified TrxB2 was performed, and the gel chromatography indicated that several proteins were copurified with this enzyme, supporting a more complex role for TrxB2 in the physiology of the bacterium.

Identification of these proteins will help to elucidate the cellular functions of TrxB2. In addition, the enzyme is essential for H. pylori viability and characterizing its functions may help promote it as a new therapeutic target against this bacterium and possibly, against the three other Campylobacterales species.

223

GENERAL SUMMARY

224

The discovery of H. pylori in 1983 led to a large amount of research focused on this bacterial species. The pathogenicity of H. pylori in humans increased its scientific interest, but has overshadowed sometimes other important species of the -Proteobacteria division. For example, C. jejuni and W. succinogenes were discovered as early as 1973 and 1961 [Wolin et al., 1961], and yet many aspects of their physiology and genetics are still unknown, and research on them lags behind that on H. pylori. C. jejuni is a major cause of gastroenteritis [Moore et al., 2005], but attention has been diverted from this species because the infection is usually self-limiting. A. butzleri was isolated in 1991 and is a relatively new species [Kiehlbauch et al., 1991]. The bacterium’s versatility matches that of E. coli; it has been found in places ranging from marine sediments to the gastrointestinal tract of animals and humans. Many -Proteobacteria species identified from DNA sequences are yet to be cultured owing to their requiring very specific growth conditions. The discovery of A. butzleri identified a species that is capable of living in environments of marine as well as animal-colonizing species of the -Proteobacteria [Donachie et al., 2005; Kiehlbauch et al., 1991]. This project undertook a deeper study of the physiology of Campylobacterales, choosing one species from each of the animal- colonizing genera of this order: C. jejuni, H. pylori, W. succinogenes and A. butzleri. The experimental work focused on C. jejuni and H. pylori for several reasons: 1) the amount of information available on these organisms, 2) the simpler growth requirements than for W. succinogenes, and 3) the existence of several annotated genomes of these species, whereas A. butzleri genome only recently has become available [Miller et al., 2007].

Oxygen has a fundamental role in the life of most organisms whether it is positive, negative or both [Krieg & Hoffman, 1986]. The differences in environments and growth conditions of the four bacteria and the conflicting findings about their oxygen requirements led to the investigation of the role of oxygen in these species. The studies in the first part of the thesis found similarities and differences between the four species. The two important human pathogens C. jejuni and H. pylori required lower oxygen in the environment while W. succinogenes preferred no oxygen. A. butzleri survived in environments ranging from zero to full atmospheric oxygen, providing further evidence of its versatility. The differences in preferred environments indicated that these

225

organisms, although belonging to the same order, have different physiologies. Their oxygen tolerances and requirements can be summarized as follows: Tolerance: A. butzleri > C. jejuni 1 H. pylori > W. succinogenes Requirement: C. jejuni = H. pylori > A. butzleri 1 W. succinogenes

The higher oxygen tolerance of the two Campylobacteraceae species may be a result of their environmental backgrounds. The differences in oxygen requirements may arise from the availability of effective anaerobic respiration pathways in A. butzleri and W. succinogenes [Baar et al., 2003; Miller et al., 2007]. Interestingly, despite their evolutionary relatedness and their similar niches inside the animal host, the physiologies of these bacterial species represent the extremes of oxygen tolerance; namely an aerobe, two microaerobes and an anaerobe.

The responses of three species to increased oxygen tensions in the atmosphere were studied. C. jejuni and H. pylori responded like microaerophiles, while W. succinogenes responded like an anaerobe. The key factor in determining the differences between these organisms was their use of aerobic respiration. This process was upregulated in both C. jejuni and H. pylori, but W. succinogenes did not regulate its oxidative phosphorylation pathway. Taking into consideration the ability of the bacterium to grow under a wide range of oxygen concentrations, it would be interesting to determine the preferred oxygen tension of A. butzleri.

Although the four Campylobacterales species prefer different atmospheric conditions, similarities were observed in their responses to increases in oxygen tensions. One was the upregulation of genes encoding antioxidant proteins, including disulfide reductases. There is a limited number of studies on disulfide reductases in the four Campylobacterales, even though they are involved in many important cellular processes in other organisms. To understand the physiology of these bacterial species one must understand the enzymes that regulate processes linked to their survival, proliferation and colonization capabilities; processes vital to the life of host-colonizing bacterial species.

226

Understanding the physiology of these Campylobacterales involved the identification of disulfide reductases in the four species. Thus, a method to identify these enzymes was developed similar to the one proposed by Fomenko & Gladyshev [2003]. Following the identification of these reductases, their involvement in drug resistance, heavy metal detoxication and pathogenesis were examined. Several functional associations were established between the disulfide reductases and the processes mentioned above. Notably, a novel mechanism of drug resistance and a novel uncharacterized disulfide system involved in heavy metal detoxication were discovered. Interestingly, the drug resistance mechanism comprised downregulation of the expression of ferredoxin oxidoreductase which was previously classified as a putative disulfide reductase.

Following these analyses, the largely overlooked class of thiol disulfide oxidoreductases were studied in these four species. A method was developed to identify these enzymes, and their role in bacterial pathogenesis or colonization was assessed. Owing to the limited amount of information on disulfide reductases in C. jejuni, and on W. succinogenes and A. butzleri in general, not many associations have been found between pathogenesis and these proteins. In addition, many of the identified proteins were hypothetical proteins which are frequently disregarded in experimental work. Nonetheless, several interesting associations were found in H. pylori, namely the identification of HP0231 as a novel thiol disulfide oxidoreductase with similarity to DsbG in E. coli. This protein is potentially a key contributor to the pathogenesis of H. pylori, by participating in the modulation of the structural integrity of virulence factors.

Finally, the research of the project focused on the only known disulfide system in these bacteria, the thioredoxin system [Windle et al., 2000]. Several novel characteristics were discovered bioinformatically, including the differences between the two proteins annotated as thioredoxin reductases. The expression and characterization of the TrxB2 indicated that the enzyme was not a thioredoxin reductase but a NADPH reductase. In an H. pylori strain competent for expressing proteins for tandem affinity purification a construct was made with HP1164 (TrxB2), and several proteins were copurified with

TrxB2.

227

FUTURE DEVELOPMENTS Future directions of this project could involve the identification of the enzyme(s) responsible for glutathione reduction in the four Campylobacterales species. The enzyme(s) could constitute a novel disulfide-reducing system in these bacteria. Additionally, this activity is involved in many important processes in cells and its characterization is essential to our understanding of these organisms. Investigation of the response of A. butzleri to oxidative stress may reveal the source of its versatility compared to other Campylobacterales. The Arcobacter genus is believed to be the evolutionary connection between free-living ͅ-Proteobacteria and the host-adapted species; thus, understanding their physiology would progress our knowledge on the ͅ- Proteobacteria.

Another important area of investigation would be the characterization of the thiol disulfide oxidoreductase systems of these organisms. These systems have been linked to the pathogenicity of many Gram-negative bacteria. H. pylori possesses a unique system, whose elucidation will throw light into our understanding of the interactions of H. pylori with its host.

Finally, more extensive tandem affinity purification of HP1164 and other proteins will yield insights into the functions of the proteins in the cell. A broad activity such as NADPH reduction is likely to be involved in other processes besides pyruvate reduction.

CONCLUSION The thesis aimed to investigate key processes in C. jejuni, H. pylori, W. succinogenes and A. butzleri, species with significant impact on human and animal health. The studies focused on a specific family of enzymes and demonstrated that they are capable of affecting the outcome of infection. The exposure of bacteria to drugs, heavy metals and reactive oxygen species from the host or the environment could modify many characteristics of their physiology including their virulence and resistance to antibiotics which depend to various degrees on the activities of disulfide reductases.

228

REFERENCES

Acheson D.W. 1999. Foodborne infections. Curr Opin Gastroenterol. 15: 538.

Achtman M., Azuma T., Berg D.E., Ito Y., Morelli G., Pan Z.-J., Suerbaum S., Thompson S.A., van der Ende A., & van Doorn L.-J. 1999. Recombination and clonal groupings within Helicobacter pylori from different geographical regions. Mol Microbiol. 32: 459-470.

Adams T.K., Saydam N., Steiner F., Schaffner W., & Freedman J.H. 2002. Activation of gene expression by metal-responsive signal transduction pathways. Environ Health Perspect. 110: 813-817.

Akiyama M., Maki H., Sekiguchi M., & Horiuchi T. 1989. A specific role of MutT protein: to prevent dGdA mispairing in DNA replication. Proc Natl Acad Sci USA. 86: 3949–3952.

Alamuri P., & Maier R.J. 2004. Methionine sulphoxide reductase is an important antioxidant enzyme in the gastric pathogen Helicobacter pylori. Mol Microbiol. 53: 1397-1406.

Alamuri P., & Maier R.J. 2006. Methionine sulfoxide reductase in Helicobacter pylori: interaction with methionine-rich proteins and stress-induced expression. J Bacteriol. 188: 5839- 5850.

Alarcon T., Domingo D., & Lopez-Brea M. 1999. Antibiotic resistance problems with Helicobacter pylori. Int J Antimicrob Agents. 12: 19-26.

Alexeeva S., Hellingwerf K.J., & Teixeira de Mattos M.J. 2003. Requirement of ArcA for redox regulation in Escherichia coli under microaerobic but not anaerobic or aerobic conditions. J Bacteriol. 185: 204–209.

Alger H.M., & Williams D.L. 2002. The disulfide redox system of Schistosoma mansoni and the importance of a multifunctional enzyme, thioredoxin glutathione reductase. Mol Biochem Parasitol. 121: 129-139.

Alm R.A., Ling L.S., Moir D.T., King B.L., Brown E.D., Doig P.C., Smith D.R., Noonan B., Guild B.C., de Jonge B.L., Carmel G., Tummino P., Caruso A., Uria-Nickelsen M., Mills D.M., Ives C., Gibson R., Merberg D., Mills S.D., Jiang Q., Taylor D.E., Vovis G.F., & Trust T.J. 1999. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 397: 176-180.

Andersen LP, & Wadström T. 2001. Basic bacteriology and culture. In Mobley H.L.T., Mendz G.L., Hazell S.L. (eds): Helicobacter pylori: physiology and genetics. Washington: ASM Press.

Anfinsen C.B. 1973. Principles that govern the folding of protein chains. Science. 181: 223-230.

Ankri S., & Mirelman D. 1999. Antimicrobial properties of allicin from garlic. Microbes Infect. 2: 125-129.

229

Anton A., Weltrowski A., Haney C.J., Franke S., Grass G., Rensing C., & Nies D.H. 2004. Characteristics of zinc transport by two bacterial cation diffusion facilitators from Ralstonia metallidurans CH34 and Escherichia coli. J Bacteriol. 186: 7499-7507.

Arnér E.S.J., & Holmgren A. 2000. Physiological functions of thioredoxin and thioredoxin reductase. Eur J Biochem. 267: 6102-6109.

Assanta M.A., Roy D., Lemay M.J., & Montpetit D. 2002. Attachment of Arcobacter butzleri, a new waterborne pathogen, to water distribution pipe surfaces. J Food Prot. 65: 1240-1247.

Baar C., Eppinger M., Raddatz G., Simon J., Lanz C., Klimmek O., Nandakumar R., Gross R., Rosinus A., Keller H., Jagtap P., Linke B., Meyer F., Lederer H., & Schuster S.C. 2003. Complete genome sequence and analysis of Wolinella succinogenes. Proc Natl Acad Sci USA. 100: 11690-11695.

Baillon M.L., van Vliet A.H., Ketley J.M., Constantinidou C., & Penn C.W. 1999. An iron- regulated alkyl hydroperoxide reductase (AhpC) confers aerotolerance and oxidative stress resistance to the microaerophilic pathogen Campylobacter jejuni. J Bacteriol. 181: 4798-4804.

Baker L.M., Raudonikiene A., Hoffman P.S., & Poole L.B. 2001. Essential thioredoxin- dependent peroxiredoxin system from Helicobacter pylori: genetic and kinetic characterization. J Bacteriol. 183: 1961-1973.

Baltes N., N'diaye M., Jacobsen I.D., Maas A., Buettner F.F.R., & Gerlach G.-F. 2005. Deletion of the anaerobic regulator HlyX causes reduced colonization and persistence of Actinobacillus pleuropneumoniae in the porcine respiratory tract. Infect Immun. 73: 4614–4619.

Bardwell J.C. 1994. Building bridges: disulphide bond formation in the cell. Mol Microbiol. 14: 199-205.

Barnard F.M., Loughlin M.F., Fainberg H.P., Messenger M.P., Ussery D.W., Williams P., & Jenks P.J. 2004. Global regulation of virulence and the stress response by CsrA in the highly adapted human gastric pathogen Helicobacter pylori. Mol Microbiol. 51: 15-32.

Basu M., Czinn S.J., & Blanchard T.G. 2004. Absence of catalase reduces long-term survival of Helicobacter pylori in macrophage phagosomes. Helicobacter. 9: 211-216.

Beaman L., & Beaman B.L. 1984. The role of oxygen and its derivatives in microbial pathogenesis and host defense. Annu Rev Microbiol. 38: 27-48.

Bensaid A., Thierie J., & Penninckx M. 2000. The use of the tetrazolium salt XTT for the estimation of biological activity of activated sludge cultivated under steady-state and transient regimes. J Microbiol Methods. 40: 255-263.

Bertin G., & Averbeck D. 2006. Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review). Biochimie. 88: 1549–1559.

Bjur E., Eriksson-Ygberg S., Slund F., & Rhen M. 2006. Thioredoxin 1 promotes intracellular replication and virulence of Salmonella enterica serovar Typhimurium. Infect Immun. 74: 5140– 5151.

230

Bochner B.R., Lee P.C., Wilson S.W., Cutler C.W., & Ames B.N. 1984. AppppA and related adenylylated nucleotides are synthesized as a consequence of oxidation stress. Cell. 37: 225-232.

Boehme D.E., Vincent K., & Brown O.R. 1976. Oxygen and toxicity: inhibition of amino acid biosynthesis. Nature. 262: 418–420.

Bohr U.R., Segal I., Primus A., Wex T., Hassan H., Ally R., & Malfertheiner P. 2003. Detection of a putative novel Wolinella species in patients with squamous cell carcinoma of the esophagus. Helicobacter. 8: 608-612.

Bolton F.J., & Coates D. 1983. A study of the oxygen and carbon dioxide requirements of thermophilic campylobacters. J Clin Path. 36: 829-834.

Braatsch S., Krafft T., Simon J., Gross R., Klimmek O., & Kröger A. 2002. PsrR, a member of the AraC family of transcriptional regulators, is required for the synthesis of Wolinella succinogenes polysulfide reductase. Arch Microbiol. 178: 202-207.

Brondsted L., Andersen M.T., Parker M., Jorgensen K., & Ingmer H. 2005. The HtrA protease of Campylobacter jejuni is required for heat and oxygen tolerance and for optimal interaction with human epithelial cells. Appl Environ Microbiol. 71: 3205-3212.

Bryk R., Griffin P., & Nathan C. 2000. Peroxynitrite reductase activity of bacterial peroxiredoxins. Nature. 407: 211-215.

Butler S.M., & Camilli A. 2005. Going against the grain: chemotaxis and infection in Vibrio cholerae. Nat Rev Microbiol. 3: 611-620.

Campbell B.J., Engel A.S., Porter M.L., & Takai K. 2006. The versatile -proteobacteria: key players in sulphidic habitats. Nat Rev Microbiol. 4: 458-468.

Cappiello M., Lazzarotti A., Buono F., Scaloni A., D’Ambrosio C., Amodeo P., Mendez B.L., Pelosi P., Del Corso A., & Mura U. 2004. New role for leucyl aminopeptidase in glutathione turnover. Biochem J. 378: 35-44.

Carlioz A., & Touati D. 1986. Isolation of superoxide dismutase mutants in Escherichia coli: is superoxide dismutase necessary for aerobic life? EMBO J. 5: 623-630.

Cash T.P., Pan Y., & Simon M.C. 2007. Reactive oxygen species and cellular oxygen sensing. Free Radic Biol Med. 43: 1219–1225.

Cervenka L., Malíková Z., Zachová I., & Vytrasová J. 2004. The effect of acetic acid, citric acid, and trisodium citrate in combination with different levels of water activity on the growth of Arcobacter butzleri in culture. Folia Microbiol (Praha). 49: 8-12.

Cervenka L., Peskova I., Pejchalova M., & Vytrasová J. 2008. Inhibition of Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii by plant oil aromatics. J Food Prot. 71: 165-169.

Chassagnole C., Quentin E., Fell D.A., de Atauri P., & Mazat J.P. 2003. Dynamic simulation of pollutant effects on the threonine pathway in Escherichia coli. C R Biol. 326: 501-508.

231

Chauhan S., Titus D.E., & O'Brian M.R. 1997. Metals control activity and expression of the heme biosynthesis enzyme delta-aminolevulinic acid dehydratase in Bradyrhizobium japonicum. J Bacteriol. 179: 5516-5520.

Chen S.-X., & Schopfer P. 1999. Hydroxyl-radical production in physiological reactions A novel function of peroxidase. Eur J Biochem. 260: 726-735.

Cheng Z., Arscott L.D., Ballou D.P., & Williams Jr C.H. 2007. The relationship of the redox potentials of thioredoxin and thioredoxin reductase from Drosophila melanogaster to the enzymatic mechanism: reduced thioredoxin is the reductant of glutathione in Drosophila. Biochemistry. 46: 7875-7885.

Chetsanga C.J., & Lindahl T. 1979. Release of 7-methylguanine residues whose imidazole rings have been opened from damaged DNA by a DNA glycosylase from Escherichia coli. Nucleic Acids Res. 6: 3673-3684.

Chiang P.N., Wang M.K., Chiu C.Y., & Chou S.Y. 2006. Effects of cadmium amendments on low-molecular-weight organic acid exudates in rhizosphere soils of tobacco and sunflower. Environ Toxicol. 21: 479-488.

Chivers P.T., Prehoda K.E., & Raines R.T. 1997. The CXXC motif: a rheostat in the active site. Biochemistry. 36: 4061-4066.

Cloak O.M., Solow B.T., Briggs C.E., Chen C.-Y., & Fratamico P.M. 2002. Quorum sensing and production of Autoinducer-2 in Campylobacter spp., Escherichia coli O157:H7, and Salmonella enterica serovar Typhimurium in foods. Appl Environ Microbiol. 68: 4666-4671.

Comtois S.L., Gidley M.D., & Kelly D.J. 2003. Role of the thioredoxin system and the thiol- peroxidases Tpx and Bcp in mediating resistance to oxidative and nitrosative stress in Helicobacter pylori. Microbiology. 149: 121-129.

Cooksley C., Jenks P.J., Green A., Cockayne A., Logan R.P., & Hardie K.R. 2003. NapA protects Helicobacter pylori from oxidative stress damage, and its production is influenced by the ferric uptake regulator. J Med Microbiol. 52: 461-469.

Copley S.D., Novak W.R.P., & Babbitt P.C. 2004. Divergence of function in the thioredoxin fold suprafamily: Evidence for evolution of peroxiredoxins from a thioredoxin-like ancestor. Biochemistry. 43: 13981-13995.

Cottet S., Corthesy-Theulaz I., Spertini F., & Corthesy B. 2002. Microaerophilic conditions permit to mimic in vitro events occurring during in vivo Helicobacter pylori infection and to identify Rho/Ras-associated proteins in cellular signaling. J Biol Chem. 277: 33978-33986.

Creighton T.E. 1997. Protein folding coupled to disulphide bond formation. Biol Chem. 378: 731-744.

Cunningham R.P. 1997. DNA repair: caretakers of the genome? Curr Biol. 7: R576-579.

Darby N., & Creighton T.E. 1995. Disulfide bonds in protein folding and stability. Methods Mol Biol. 40: 219-252.

232

Darby N.J., Morin P.E., Talbo G., & Creighton T.E. 1995. Refolding of bovine pancreatic trypsin inhibitor via non-native disulphide intermediates. J Mol Biol. 249: 463-477.

Darby N.J., Raina S., & Creighton T.E. 1998. Contributions of substrate binding to the catalytic activity of DsbC. Biochemistry. 37: 783-791.

Davioud-Charvet E., McLeish M.J., Veine D.M., Giegel D., Arscott L.D., Andricopulo A.D., Becker K., Muller S., Heiner Schirmer R., Williams C.H., & Kenyon G.L. 2003. Mechanism- based inactivation of thioredoxin reductase from Plasmodium falciparum by mannich bases. Implication for cytotoxicity. Biochemistry. 42: 13319-13330.

Debets-Ossenkopp Y.J., Pot R.G.J., Van Westerloo D.J., Goodwin A., Vandenbroucke- Grauls C.M.J.E., Berg D., Hoffman P.S., & Kusters J.G. 1999. Insertion of mini-IS605 and deletion of adjacent sequences in the nitroreductase (rdxA) gene cause metronidazole resistance in Helicobacter pylori NCTC11637. Antimicrob Agents Chemother. 43: 2657-2662.

Dennis Jr G., Sherman B.T., Hosack D.A., Yang J., Gao W., Lane H.C., & Lempicki R.A. 2003. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biology. 4: 3.

Derman A.I., & Beckwith J. 1991. Escherichia coli alkaline phosphatase fails to acquire disulfide bonds when retained in the cytoplasm. J Bacteriol. 173: 7719-7722.

Dhandayuthapani S., Blaylock M.W., Bebear C.M., Rasmussen W.G., & Baseman J.B. 2001. Peptide Methionine Sulfoxide Reductase (MsrA) Is a virulence determinant in Mycoplasma genitalium. J Bacteriol. 183: 5645–5650.

Ding H., Harrison K., & Lu J. 2005. Thioredoxin reductase system mediates iron binding in IscA and iron delivery for the iron-sulfur cluster assembly in IscU. J Biol Chem. 280: 30432- 30437.

Dingle K.E., Colles F.M., Wareing D.R.A., Ure R., Fox A.J., Bolton F.E., Bootsma H.J., Willems R.J.L., Urwin R., & Maiden M.C.J. 2001. Multilocus sequence typing system for Campylobacter jejuni. J Clin Microbiol. 39: 14-23.

D'Mello R., Hill S., & Poole R.K. 1996. The cytochrome bd quinol oxidase in Escherichia coli has an extremely high oxygen affinity and two oxygen-binding haems: implications for regulation of activity in vivo by oxygen inhibition. Microbiology. 142: 755-763.

Donachie S.P., Bowman J.P., On S.L., & Alam M. 2005. Arcobacter halophilus sp. nov., the first obligate halophile in the genus Arcobacter. Int J Syst Evol Microbiol. 55: 1271-1277.

Donelli G., Matarrese P., Fiorentini C., Dainelli B., Taraborelli T., DiCampli E., DiBartolomeo S., & Cellini L. 1998. The effect of oxygen on the growth and cell morphology of Helicobacter pylori. FEMS Microbiol Lett. 168: 9-15.

D'Sa E.M., & Harrison M.A. 2005. Effect of pH, NaCl content, and temperature on growth and survival of Arcobacter spp. J Food Prot. 68: 18-25.

Dworkin M., & Falkow S. 2006. The Prokaryotes: a handbook on the biology of bacteria. New York: Springer.

233

Eisen M.B., Spellman P.T., Brown P.O., & Botstein D. 1998. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA. 95: 14863-14868.

El Hassouni M., Chambost J.P., Expert D., Gijsegem F.V., & Barras F. 1999. The minimal gene set member msrA, encoding peptide methionine sulfoxide reductase, is a virulence determinant of the plant pathogen Erwinia chrysanthemi. Proc Natl Acad Sci USA. 96: 887–892.

Ellis W.A., Neill S.D., O'Brien J.J., Ferguson H.W., & Hanna J. 1977. Isolation of Spirillum/Vibrio-like organisms from bovine fetuses. Vet Res. 100: 451-452.

El-Rab S.M.F.G., Shoreit A.A.-F., & Fukumori Y. 2006. Effects of cadmium stress on growth, morphology, and protein expression in Rhodobacter capsulatus B10. Biosci Biotechnol Biochem. 70: 2394-2402.

Eppinger M., Baar C., Raddatz G., Huson D.H., & Schuster S.C. 2004. Comparative analysis of four Campylobacterales. Nat Rev Microbiol. 2: 872-885.

Erlendsson L.S., Möller M., & Hederstedt L. 2004. Bacillus subtilis StoA is a thiol-disulfide oxidoreductase important for spore cortex synthesis. J Bacteriol. 186: 6230–6238.

Ernst F.D., Bereswill S., Waidner B., Stoof J., Mader U., Kusters J.G., Kuipers E.J., Kist M., van Vliet A.H.M., & Homuth G. 2005. Transcriptional profiling of Helicobacter pylori Fur- and iron-regulated gene expression. Microbiology. 151: 533-546.

Ernst F.D., Homuth G., Stoof J., Mader U., Waidner B., Kuipers E.J., Kist M., Kusters J.G., Bereswill S., & van Vliet A.H.M. 2005. Iron-responsive regulation of the Helicobacter pylori iron-cofactored superoxide dismutase SodB is mediated by Fur. J Bacteriol. 187: 3687- 3692.

Evans Jr D.J., Evans D.G., Takemura T., Nakano H., Lampert H.C., Graham D.Y., Granger D.N., & Kvietys P.R. 1995. Characterization of a Helicobacter pylori neutrophil- activating protein. Infect Immun. 63: 2213-2220.

Fabianek R.A., Hennecke H., & Thöny-Meyer L. 2000. Periplasmic protein thiol:disulfide oxidoreductases of Escherichia coli. FEMS Microbiol Rev. 24: 303-316.

Fagerquist C.K., Bates A.H., Heath S., King B.C., Garbus B.R., Harden L.A., & Miller W.G. 2006. Sub-speciating Campylobacter jejuni by proteomic analysis of its protein biomarkers and their post-translational modifications. J Proteome Res. 5: 2527- 2538.

Fahey R.C. 2001. Novel thiols of prokaryotes. Annu Rev Microbiol. 55: 333-356.

Farr S.B., D'Ari R., & Touati D. 1986. Oxygen-dependent mutagenesis in Escherichia coli lacking superoxide dismutase. Proc Natl Acad Sci USA. 83: 8268-8272.

Felsenstein J. 1989. PHYLIP -- Phylogeny Inference Package (Version 3.2). Cladistics. 5: 164- 166.

Ferianc P., Farewell A., & Nyström T. 1998. The cadmium-stress stimulon of Escherichia coli K-12. Microbiology. 144: 1045–1050.

234

Fernandes A.P., Fladvad M., Berndt C., Andrésen C., Lillig C.H., Neubauer P., Sunnerhagen M., Holmgren A., & Vlamis-Gardikas A. 2005. A novel monothiol glutaredoxin (Grx4) from Escherichia coli can serve as a substrate for thioredoxin reductase. J Biol Chem. 280: 24544-24552.

Filella M., Town R.M., & Bugarin M.G. 1999. Cadmium succinate and cadmium malate stability constants revisited. J Chem Eng Data. 44: 1009-1019.

Filipi6 M., Fatur T., & Vudrag M. 2006. Molecular mechanisms of cadmium induced mutagenicity. Hum Exp Toxicol. 25: 67-77.

Finster K., Liesack W., & Tindall B.J. 1997. Sulfospirillum arcachonense sp. nov., a new microaerophilic sulfur-reducing bacterium. Int J System Bacteriol. 47: 1212-1217.

Fischer H.M. 1994. Genetic regulation of nitrogen fixation in rhizobia. Microbiol Rev. 58: 352- 386.

Fomenko D.E., & Gladyshev V.N. 2003. Identity and functions of CXXC-derived motifs. Biochemistry. 42: 11214-11225.

Forsythe SJ. 2006. Arcobacter. In Motarjemi Y., Adams M. (eds): Emerging foodborne pathogens. Cambridge: Woodhead Publishing Ltd.

Fouts D.E., Mongodin E.F., Mandrell E.R., Miller W.G., Rasko D.A., Ravel J., Brinkac L.M., DeBoy R.T., Parker C.T., Daugherty S.C., Dodson R.J., Durkin A.S., Madupu R., Sullivan S.A., Shetty J.U., Ayodeji M.A., Shvartsbeyn A., Schatz M.C., Badger J.H., Fraser C.M., & Nelson K.E. 2005. Major structural differences and novel potential virulence mechanisms from the genomes of multiple Campylobacter species. PLoS Biol. 3: 72-85.

Fox J.G. 2002. The non-H pylori helicobacters: their expanding role in gastrointestinal and systemic diseases. Gut. 50: 273-283.

Frech C., Wunderlich M., Glockshuber R., & Schmid F.X. 1996. Competition between DsbA- mediated oxidation and conformational folding of RTEM1 beta-lactamase. Biochemistry. 35: 11386-11395.

Galperin M.Y. 2005. A census of membrane-bound and intracellular signal transduction proteins in bacteria: bacterial IQ, extroverts and introverts. BMC Microbiol. 5: 35.

Garénaux A., Jugiau F., Rama F., de Jonge R., Denis M., Federighi M., & Ritz M. 2008. Survival of Campylobacter jejuni strains from different origins under oxidative stress conditions: Effect of temperature. Curr Microbiol. 56: 293-297.

Gasque L., Bernès S., Ferrari R., & Mendoza-Díaz G. 2002. Cadmium complexation by aspartate. NMR studies and crystal structure of polymeric Cd(AspH)NO3. Polyhedron. 21: 935- 941.

Gaynor E.C., Cawthraw S., Manning G., MacKichan J.K., Falkow S., & Newell D.G. 2004. The genome-sequenced variant of Campylobacter jejuni NCTC 11168 and the original clonal

235

clinical isolate differ markedly in colonization, gene expression, and virulence-associated phenotypes. J Bacteriol. 186: 503-517.

Georgiou G. 2002. How to flip the (Redox) switch. Cell. 111: 607–610.

Gillet S., Decottignies P., Chardonnet S., & Le Maréchal P. 2006. Cadmium response and redoxin targets in Chlamydomonas reinhardtii: a proteomic approach. Photosynth Res. 89: 201- 211.

Gobert A.P., Cheng Y., Wang J.Y., Boucher J.L., Iyer R.K., Cederbaum S.D., Casero Jr R.A., Newton J.C., & Wilson K.T. 2002. Helicobacter pylori induces macrophage apoptosis by activation of arginase II. J Immunol. 168: 4692-4700.

Gobert A.P., McGee D.J., Akhtar M., Mendz G.L., Newton J.C., Cheng Y., Mobley H.L., & Wilson K.T. 2001. Helicobacter pylori arginase inhibits nitric oxide production by eukaryotic cells: A strategy for bacterial survival. Proc Natl Acad Sci USA. 98: 13844-13849.

Godlewska R., Dzwonek A., Mikula M., Ostrowski J., Pawlowski M., Bujnicki J.M., & Jagusztyn-Krynicka E.K. 2006. Helicobacter pylori protein oxidation influences the colonization process. Int J Med Microbiol. 296: 321-324.

Gong W., Hao B., & Chan M.K. 2000. New mechanistic insights from structural studies of the oxygen-sensing domain of Bradyrhizobium japonicum FixL. Biochemistry. 39: 3955-3962.

Goodwin A., Kersulyte D., Sisson G., Veldhuyzen van Zanten S.J.O., Berg D.E., & Hoffman P.S. 1998. Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insenstive NADPH nitroreductase. Mol Microbiol. 28: 383-393.

Goodwin C., Blincow E., Warren J., Waters T.E., Sanderson C.R., & Easton L. 1985. Evaluation of cultural techniques for isolating Campylobacter pyloridis from endoscopic biopsies of gastric mucosa. J Clin Pathol. 38: 1127-1131.

Grabowski A., Nercessian O., Fayolle F., Blanchet D., & Jeanthon C. 2005. Microbial diversity in production waters of a low-temperature biodegraded oil reservoir. FEMS Microbiol Ecol. 54: 427-443.

Grauschopf U., Winther J.R., Korber P., Zander T., Dallinger P., & Bardwell J.C. 1995. Why is DsbA such an oxidizing disulfide catalyst? Cell. 83: 947-955.

Grishanin R.N., & Bibikov S.I. 1997. Mechanisms of oxygen taxis in bacteria. Biosci Rep. 17: 77-83.

Gronow G., Kähler W., Koch A., & Klause N. 2005. Benzoate hydroxylation: a measure of oxidative stress in divers. Adv Exp Med Biol. 566: 223-229.

Grosse C., Grass G., Anton A., Franke S., Santos A.N., Lawley B., Brown N.L., & Nies D.H. 1999. Transcriptional organization of the czc heavy-metal homeostasis determinant from Alcaligenes eutrophus. J Bacteriol. 181: 2385-2393.

Gupta R.S. 2006. Molecular signatures (unique proteins and conserved indels) that are specific for the epsilon proteobacteria (Campylobacterales). BMC Genomics. 7: 1-17.

236

Gurer-Orhan H., Sabir H.U., & Ozgünes H. 2004. Correlation between clinical indicators of lead poisoning and oxidative stress parameters in controls and lead-exposed workers. Toxicology. 195: 147-154.

Gustafsson T.N., Sandalova T., Lu J., Holmgren A., & Schneider G. 2007. High-resolution structures of oxidized and reduced thioredoxin reductase from Helicobacter pylori. Acta Crystallogr D Biol Crystallogr. 63: 833-843.

Ha U.H., Wang Y., & Jin S. 2003. DsbA of Pseudomonas aeruginosa is essential for multiple virulence factors. Infect Immun. 71: 1590-1595.

Haas G., Karaali G., Ebermayer K., Metzger W.G., Lamer S., Zimny-Arndt U., Diescher S., Goebel U.B., Vogt K., Roznowski A.B., Wiedenmann B.J., Meyer T.F., Aebischer T., & Jungblut P.R. 2002. Immunoproteomics of Helicobacter pylori infection and relation to gastric disease. Proteomics. 2: 313–324.

Haddock B.A., & Jones C.W. 1977. Bacterial respiration. Bacteriol Rev. 41: 47-99.

Harris A.G., Hinds F.E., Beckhouse A.G., Kolesnikow T., & Hazell S.L. 2002. Resistance to hydrogen peroxide in Helicobacter pylori: role of catalase (KatA) and Fur, and functional analysis of a novel gene product designated 'KatA-associated protein', KapA (HP0874). Microbiology. 148: 3813-3825.

Hayashi S., Abe M., Kimoto M., Furukawa S., & Nakazawa T. 2000. The dsbA-dsbB disulfide bond formation system of Burkholderia cepacia is involved in the production of protease and alkaline phosphatase, motility, metal resistance, and multi-drug resistance. Microbiol Immunol. 44: 41-50.

Hazell S.L., Harris A.G., & Trend M.A. 2001. Evasion of the toxic effects of oxygen. In Mobley H.L.T., Mendz G.L., Hazell S.L. (eds): Helicobacter pylori: physiology and genetics. Washington: ASM Press.

Held K.D., & Biaglow J.E. 1994. Mechanisms for the oxygen radical-mediated toxicity of various thiol-containing compounds in cultured mammalian cells. Radiat Res. 139: 15-23.

Henehan C.J., Pountney D.L., Zerbe O., & Vasak M. 1993. Identification of cysteine ligands in metalloproteins using optical and NMR spectroscopy: Cadmium-substituted rubredoxin as a model [Cd(CysS)(4)](2-) center. Protein Sci. 2: 1756-1764.

Henriksen T.H., Lia A., Schøyen R., Thoresen T., & Berstad A. 2000. Assessment of optimal atmospheric conditions for growth of Helicobacter pylori. Eur J Clin Microbiol Infect Dis. 19: 718-720.

Herbette S., Taconnat L., Hugouvieux V., Piette L., Magniette M.-L.M., Cuine S., Auroy P., Richaud P., Forestier C., Bourguignon J., Renou J.-P., Vavasseur A., & Leonhardt N. 2006. Genome-wide transcriptome profiling of the early cadmium response of Arabidopsis roots and shoots. Biochimie. 88: 1751–1765.

237

Hickey T.E., McVeigh A.L., Scott D.A., Michielutti R.E., Bixby A., Carroll S.A., Bourgeois A.L., & Guerry P. 2000. Campylobacter jejuni cytolethal distending toxin mediates release of interleukin-8 from intestinal epithelial cells. Infect Immun. 68: 6535-6541.

Hicks S., Frankel G., Kaper J.B., Dougan G., & Phillips A.D. 1998. Role of intimin and bundle-forming pili in enteropathogenic Escherichia coli adhesion to pediatric intestinal tissue in vitro. Infect Immun. 66: 1570-1578.

Hilton C.L., Mackey B.M., Hargreaves A.J., & Forsythe S.J. 2001. The recovery of Arcobacter butzleri NCTC 12481 from various temperature treatments. J Appl Microbiol. 91: 929-932.

Hodge J.P., & Krieg N.R. 1994. Oxygen tolerance estimates in Campylobacter species depend on the testing medium. J Appl Bacteriol. 77: 666-673.

Hoffman P.S., George H.A., Krieg N.R., & Smibert R.M. 1979. Studies of the microaerophilic nature of Campylobacter fetus subsp. jejuni. II. Role of exogenous superoxide anions and hydrogen peroxide. Can J Microbiol. 25: 8-16.

Hoffman P.S., Goodwin A., Johnson J., Magee K., & Veldhuyzen van Zanten S.J.O. 1996. Metabolic activities of metronidazole-sensitive and -resistant strains of Helicobacter pylori: repression of pyruvate oxidoreductase and expression of isocitrate lyase activity correlate with resistance. J Bacteriol. 178: 4822-4829.

Holmgren A. 1989. Thioredoxin and glutaredoxin systems. J Biol Chem. 264: 13963-13966.

Holmgren A. 1995. Thioredoxin structure and mechanism: conformational changes on oxidation of the active-site sulfhydryls to a disulfide. Structure. 3: 239-243.

Houf K., Devriese L.A., Haesebrouck F., Vandenberg O., Butzler J.P., van Hoof J., & Vandamme P. 2004. Antimicrobial susceptibility patterns of Arcobacter butzleri and Arcobacter cryaerophilus strains isolated from humans and broilers. Microb Drug Resist. 10: 243-247.

Houf K., On S.L., Coenye T., Mast J., van Hoof J., & Vandamme P. 2005. Arcobacter cibarius sp. nov., isolated from broiler carcasses. Int J Syst Evol Microbiol. 55: 713-717.

Hrdý I., Cammack R., Stopka P., Kulda J., & Tachezy J. 2005. Alternative pathway of metronidazole activation in Trichomonas vaginalis hydrogenosomes. Antimicrob Agents Chemother. 49: 5033-5036.

Hsueh P.R., Teng L.J., Yang P.C., Wang S.K., Chang S.C., Ho S.W., Hsieh W.C., & Luh K.T. 1997. Bacteremia caused by Arcobacter cryaerophilus 1B. J Clin Microbiol. 35: 489-491.

Hu P., Brodie E.L., Suzuki Y., McAdams H.H., & Andersen G.L. 2005. Whole-genome transcriptional analysis of heavy metal stresses in Caulobacter crescentus. J Bacteriol. 187: 8437- 8449.

Hughes N.J., Clayton C.L., Chalk P.A., & Kelly D.J. 1998. Helicobacter pylori porCDAB and oorDABC genes encode distinct pyruvate:flavodoxin and 2-oxoglutarate:acceptor oxidoreductases which mediate electron transport to NADP. J Bacteriol. 180: 1119-1128.

238

Hwang C., Sinskey A.J., & Lodish H.F. 1992. Oxidized redox state of glutathione in the endoplasmic reticulum. Science. 257: 1496-1502.

Imlay J.A. 2003. Pathways of oxidative damage. Annu Rev Microbiol. 57: 395-418.

Imlay J.A. 2008. Cellular defenses against superoxide and hydrogen peroxide. Annu Rev Biochem. 77: 4.1-4.22.

Ishikawa T., Mizunoe Y., Kawabata S., Takade A., Harada M., Wai S.N., & Yoshida S. 2003. The iron-binding protein Dps confers hydrogen peroxide stress resistance to Campylobacter jejuni. J Bacteriol. 185: 1010-1017.

Jackson M.W., & Plano G.V. 1999. DsbA is required for stable expression of outer membrane protein YscC and for efficient Yop secretion in Yersinia pestis. J Bacteriol. 181: 5126-5130.

Jackson R.J., Elvers K.T., Lee L.J., Gidley M.D., Wainwright L.M., Lightfoot J., Park S.F., & Poole R.K. 2007. Oxygen reactivity of both respiratory oxidases in Campylobacter jejuni: the "cydAB" genes encode a cyanide-resistant, low affinity oxidase that is not of the cytochrome bd- type. J Bacteriol. 189: 1604-1615.

Jacob-Dubuisson F., Pinkner J., Xu Z., Striker R., Padmanhaban A., & Hultgren S.J. 1994. PapD chaperone function in pilus biogenesis depends on oxidant and chaperone-like activities of DsbA. Proc Natl Acad Sci USA. 91: 11552-11556.

Jaeger T., Budde H., Flohé L., Menge U., Singh M., Trujillo M., & Radic R. 2004. Multiple thioredoxin-mediated routes to detoxify hydroperoxides in Mycobacterium tuberculosis. Arch Biochem Biophys. 423: 182–191.

Jócsák I., Végvári G., & Droppa M. 2005. Heavy metal detoxication by organic acids in barley seedlings. Proceedings of the Eighth Hungarian Congress on Plant Physiology and the Sixth Hungarian Conference on Photosynthesis. 49: 99-101.

John R., Ahmad P., Gadgil K., & Sharma S. 2007. Antioxidative response of Lemna polyrrhiza L. to cadmium stress. J Environ Biol. 28: 583-589.

Jones P.R., & Desiot P.J. 1978. The less familiar reactions of organocadmium reagents. Chem Rev. 78: 491-516.

Jurado P., de Lorenzo V., & Fernández L.A. 2006. Thioredoxin fusions increase folding of single chain Fv antibodies in the cytoplasm of Escherichia coli: evidence that chaperone activity is the prime effect of thioredoxin. J Mol Biol. 357: 49-61.

Juven B.J., & Rosenthal I. 1985. Effect of free-radical and oxygen scavengers on photochemically generated oxygen toxicity and on the aerotolerance of Campylobacter jejuni. J Appl Bacteriol. 59: 413-419.

Kallis G.B., & Holmgren A. 1980. Differential reactivity of the functional sulfhydryl groups of cysteine-32 and cysteine-35 present in the reduced form of thioredoxin from Escherichia coli. J Biol Chem. 255: 10261-10265.

239

Kanehisa M., Araki M., Goto S., Hattori M., Hirakawa M., Itoh M., Katayama T., Kawashima S., Okuda S., Tokimatsu T., & Yamanishi Y. 2008. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 36: D480-D484.

Kangatharalingam N., & Amy P.S. 1994. Helicobacter pylori comb nov exhibits facultative acidophilism and obligate microaerophilism. Appl Environ Microbiol. 60: 2176-2179.

Kaplan W., & Littlejohn T.G. 2001. Swiss-PDB Viewer (Deep View). Brief Bioinformatics. 2: 195-197.

Kather B., Stingl K., van der Rest M.E., Altendorf K., & Molenaar D. 2000. Another unusual type of citric acid cycle enzyme in Helicobacter pylori: the malate:quinone oxidoreductase. J Bacteriol. 182: 3204-3209.

Kazmi S.U., Roberson B.S., & Stern N.J. 1985. Cadmium chloride susceptibility, a characteristic of Campylobacter spp. J Clin Microbiol. 21: 708-710.

Kelly D.J. 1998. The physiology and metabolims of the human gastric pathogen Helicobacter pylori. Adv Microb Physiol. 40: 137-189.

Kelly D.J., & Hughes N.J. 2001. The citric acid cycle and fatty acid biosynthesis. In Mobley H.L.T, Mendz G.L., Hazell S.L. (eds): Helicobacter pylori: physiology and genetics. Washington: ASM Press.

Kelly D.J., Hughes N.J., & Poole R.K. 2001. Microaerobic physiology: aerobic respiration, anaerobic respiration, and carbon dioxide metabolism. In Mobley H.L.T., Mendz G.L., Hazell S.L. (eds): Helicobacter pylori: physiology and genetics. Washington: ASM Press.

Kern M., Mager A.M., & Simon J. 2007. Role of individual nap gene cluster products in NapC- independent nitrate respiration of Wolinella succinogenes. Microbiology. 153: 3739-3747.

Kern R., Malki A., Holmgren A., & Richarme G. 2003. Chaperone properties of Escherichia coli thioredoxin and thioredoxin reductase. Biochem J. 371: 965-972.

Kiehlbauch J.A., Brenner D.J., Nicholson M.A., Baker C.N., Patton C.M., Steigerwalt A.G., & Wachsmuth I.K. 1991. Campylobacter butzleri sp. nov. isolated from humans and animals with diarrheal illness. J Clin Microbiol. 29: 376-385.

Kiley P.J., & Beinert H. 2003. The role of Fe-S proteins in sensing and regulation in bacteria. Curr Opin Microbiol. 6: 181-185.

Kiley P.J., & Storz G. 2004. Exploiting thiol modifications. PLoS Biol. 2: e400.

Kim J., Lee M., Chalam R., Martin M.N., Leustek T., & Boerjan W. 2002. Constitutive overexpression of ã-cystathionine -synthase in Arabidopsis leads to accumulation of soluble methionine and S-methylmethionine. Plant Physiol. 128: 95-107.

Kirkwood M.L., & Johnson P.J. 1999. Molecular basis of metronidazole resistance in pathogenic bacteria and protozoa. Drug Resist Updat. 2: 289-294.

240

Klein J., Schwarz T., & Lentzen G. 2007. Ectoine as a natural component of food: detection in red smear cheeses. J Dairy Res. 76: 446-451.

Klimmek O., Kreis V., Klein C., Simon J., Wittershagen A., & Kröger A. 1998. The function of the periplasmic Sud protein in polysulfide respiration of Wolinella succinogenes. Eur J Biochem. 253: 263-269.

Kohanski M.A., Dwyer D.J., Hayete B., Lawrence C.A., & Collins J.J. 2007. A common mechanism of cellular death induced by bactericidal antibiotics. Cell. 130: 797-810.

Kortemme T., & Creighton T.E. 1995. Ionisation of cysteine residues at the termini of model alpha-helical peptides. Relevance to unusual thiol pKa values in proteins of the thioredoxin family. J Mol Biol. 253: 799-812.

Krieg N.R., & Hoffman P.S. 1986. Microaerophily and oxygen toxicity. Ann Rev Microbiol. 40: 107-130.

Kröger A., Biel S., Simon J., Gross R., Unden G., & Lancaster C.R. 2002. Fumarate respiration of Wolinella succinogenes: enzymology, energetics and coupling mechanism. Biochim Biophys Acta. 1553: 23-38.

Kusters J.G., van Vliet A.H.M., & Kuipers E.J. 2006. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 19: 449-490.

Kwon D.H., El-Zaatari F.A.K., Kato M., Osato M.S., Reddy R., Yamaoka Y., & Graham D.Y. 2000. Analysis of rdxA and involvement of additional genes encoding NAD(P)H flavin oxidoreductase (FrxA) and ferrodoxin-like protein (FdxB) in metronidazole resistance in Helicobacter pylori. Antimicrob Agents Chemother. 44: 2133-2142.

Kwon D.H., Kato M., El-Zaatari F.A.K., Osato M.S., & Graham D.Y. 2000. Frame-shift mutations in NAD(P)H flavin oxidoreductase encoding gene (frxA) from metronidazole resistant Helicobacter pylori ATCC43505 and its involvement in metronidazole resistance. FEMS Microbiol Lett. 118: 197-202.

Kwon S.J., Park J.W., & Kim K. 1994. Inhibition of metal-catalyzed oxidation systems by a yeast protector protein in the presence of thiol. Biochem Mol Biol Int. 32: 419-427.

Lacerda C.M., Choe L.H., & Reardon K.F. 2007. Metaproteomic analysis of a bacterial community response to cadmium exposure. J Proteome Res. 6: 1145-1152.

Land K.M., & Johnson P.J. 1999. Molecular basis of metronidazole resistance in pathogenic bacteria and protozoa. Drug Resist Updat. 2: 289-294.

Landino L.M., Iwig J.S., Kennett K.L., & Moynihan K.L. 2004. Repair of peroxynitrite damage to tubulin by the thioredoxin reductase system. Free Radic Biol Med. 36: 497-506.

Lane D.J., Harrison A.P., Stahl D., Pace B., Giovannoni S.J., Olsen G.J., & Pace N.R. 1992. Evolutionary relationships among sulfur- and iron-oxidizing Eubacteria. J Bacteriol. 174: 269- 278.

241

Lau S.K.P., Woo P.C.Y., Teng J.L.L., Leung K.W., & Yuen K.Y. 2002. Identification by 16S ribosomal RNA gene sequencing of Arcobacter butzleri bacteraemia in a patient with acute gangrenous appendicitis. J Clin Pathol. 55: 182–185.

Leal R.S. 1965. Effects of alkali-metal ions on phospholipid and triglyceride synthesis in rat liver slices. J Lipid Res. 6: 80-83.

Lecuit M., Abachin E., Martin A., Poyart C., Pochart P., Suarez F., Bengoufa D., Feuillard J., Lavergne A., Gordon J.I., Berche P., Guillevin L., & Lortholary O. 2004. Immunoproliferative small intestinal disease associated with Campylobacter jejuni. N Engl J Med. 350: 239-248.

Lee S.-E., Yoo D.-h., Son J., & Cho K. 2006. Proteomic evaluation of cadmium toxicity on the midge Chironomus riparius Meigen larvae. Proteomics. 6: 945-957.

Leigh J.A., & Dodsworth J.A. 2007. Nitrogen regulation in Bacteria and Archaea. Annu Rev Microbiol. 61: 349-377.

Leong J.M., Morrissey P.E., & Isberg R.R. 1993. A 76-amino acid disulfide loop in the Yersinia pseudotuberculosis invasin protein is required for integrin receptor recognition. J Biol Chem. 268: 20524-20532.

Letunic I., Copley R.R., Schmidt S., Ciccarelli F.D., Doerks T., Schultz J., Ponting C.P., & Bork P. 2004. SMART 4.0: towards genomic data integration. Nucleic Acids Res. 32: D142- D144.

Lin Y.-F., Wu M.-S., Chang C.-C., Lin S.-W., Lin J.-T., Sun Y.-J., Chen D.-S., & Chow L.- P. 2006. Comparative immunoproteomics of identification and characterization of virulence factors from Helicobacter pylori related to gastric cancer. Mol Cell Proteomics. 5: 1484-1496.

Liu G.Y., Essex A., Buchanan J.T., Datta V., Hoffman H.M., Bastian J.F., Fierer J., & Nizet V. 2005. Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity. J Exp Med. 202: 209–215.

Lloyd D., Harris J.C., Maroulis S., Biagini G.A., Wadley R.B., Turner M.P., & Edwards M.R. 2000. The microaerophilic flagellate Giardia intestinalis: oxygen and its reaction products collapse membrane potential and cause cytotoxicity. Microbiology. 146: 109-118.

Lorenzen J., Steinwachs S., & Unden G. 1994. DMSO respiration by the anaerobic rumen bacterium Wolinella succinogenes. Arch Microbiol. 162: 277-281.

Loughlin M.F., Barnard F.M., Jenkins D., Sharples G.J., & Jenks P.J. 2003. Helicobacter pylori mutants defective in RuvC Holliday junction resolvase display reduced macrophage survival and spontaneous clearance from the murine gastric mucosa. Infect Immun. 71: 2022- 2031.

Lu A.-L., Li X., Gu Y., Wright P.M., & Chang D.-Y. 2001. Repair of oxidative DNA damage. Cell Biochem Biophys. 35: 141-170.

Lu S.C. 2000. S-Adenosylmethionine. Int J Biochem Cell Biol. 32: 391-395.

242

Major T.A., Burd H., & Whitman W.B. 2004. Abundance of 4Fe-4S motifs in the genomes of methanogens and other prokaryotes. FEMS Microbiol Lett. 239: 177-123.

Marcelli S.W., Chang H.T., Chapman T., Chalk P.A., Miles R.J., & Poole R.K. 1996. The respiratory chain of Helicobacter pylori: identification of cytochromes and the effects of oxygen on cytochrome and menaquinone. FEMS Microbiol Lett. 138: 59-64.

Maret W. 2006. Zinc coordination environments in proteins as redox sensors and signal transducers. Antioxid Redox Signal. 8: 1419-1441.

Marshall B.J., & Warren J.R. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1: 1311-1315.

Masip L., Veeravalli K., & Georgiou G. 2006. The many faces of glutathione in bacteria. Antioxid Redox Signal. 8: 753-762.

Massimine K.M., McIntosh M.T., Doan L.T., Atreya C.E., Gromer S., Sirawaraporn W., Elliott D.A., Joiner K.A., Schirmer R.H., & Anderson K.S. 2006. Eosin B as a novel antimalarial agent for drug-resistant Plasmodium falciparum. Antimicrob Agents Chemother. 50: 3132–3141.

Matés J.M., & Sánchez-Jiménez F. 1999. Antioxidant enzymes and their implications in pathophysiologic processes. Front Biosci. 4: 339-345.

Maurer L.M., Yohannes E., Bondurant S.S., Radmacher M., & Slonczewski J.L. 2005. pH regulates genes for flagellar motility, catabolism, and oxidative stress in Escherichia coli K-12. J Bacteriol. 187: 304-319.

McAtee C.P., Hoffman P.S., & Berg D.E. 2001. Identification of differentially regulated proteins in metronidazole resistant Helicobacter pylori by proteome techniques. Proteomics. 1: 516-521.

McClung C.R., Patriquin D.G., & Davis R.E. 1983. Campylobacter nitrofigilis sp nov., a nitrogen fixing bacterium associated with roots of Spartina aterniflora Loisel. Int J Syst Bacteriol. 33: 605-612.

McGee D.J., Kumar S., Viator R.J., Bolland J.R., Ruiz J., Spadafora D., Testerman T.L., Kelly D.J., Pannell L.K., & Windle H.J. 2006. Helicobacter pylori thioredoxin is an arginase chaperone and guardian against oxidative and nitrosative stresses. J Biol Chem. 281: 3290-3296.

McGowan C.C., Necheva A., Thompson S.A., Cover T.L., & Blaser M.J. 1998. Acid-induced expression of an LPS-associated gene in Helicobater pylori. Mol Microbiol. 30: 19-31.

McGuffin L.J., Bryson K., & Jones D.T. 2000. The PSIPRED protein structure prediction server. Bioinformatics. 16: 404-405.

Mendz G.L., Hazell S.L., & Srinivasan S. 1995. Fumarate reductase: a target for therapeutic intervention against Helicobacter pylori. Arch Biochem Biophys. 321: 153-159.

Mendz G.L., & Mégraud F. 2002. Is the molecular basis of metronidazole resistance in microaerophilic organisms understood? TRENDS Microbiol. 10: 370-375.

243

Mendz G.L., Shepley A.J., Hazell S.L., & Smith M.A. 1997. Purine metabolism and the microaerophily of Helicobacter pylori. Arch Microbiol. 168: 448-456.

Mendz G.L., & Trend M.A. 2001. Intracellular redox status and antibiotic resistance in enterogastric microaerophilic bacteria: evidence for the 'scavenging of oxygen' hypothesis. Redox Rep. 6: 179-181.

Meri T., Jokiranta T.S., Suhonen L., & Meri S. 2000. Resistance of Trichomonas vaginalis to metronidazole: Report of the first three cases from Finland and optimization of in vitro susceptibility testing under various oxygen concentrations. J Clin Microbiol. 38: 763-768.

Metheringham R., Tyson K.L., Crooke H., Missiakas D., Raina S., & Cole J.A. 1996. Effects of mutations in genes for proteins involved in disulphide bond formation in the periplasm on the activities of anaerobically induced electron transfer chains in Escherichia coli K12. Mol Gen Genet. 253: 95-102.

Michel C., Giudici-Orticoni M.-T., Baymann F., & Bruschi M. 2003. Bioremediation of chromate by sulfate-reducing bacteria, cytochromes c3 and hydrogenases. Water Air Soil Pollut. 3: 161-169.

Mihara H., & Esaki N. 2002. Bacterial cysteine desulfurases: their function and mechanisms. Appl Microbiol Biotechnol. 60: 12-23.

Miki T., Okada N., & Danbara H. 2004. Two periplasmic disulfide oxidoreductases, DsbA and SrgA, target outer membrane protein SpiA, a component of the Salmonella pathogenicity island 2 type III secretion system. J Biol Chem. 279: 34631-34642.

Miles A.A., & Misra S.S. 1938. The estimation of the bactericidal power of blood. J Hyg. 8: 732-749.

Miller W.G., Parker C.T., Rubenfield M., Mendz G.L., Wösten M.M.S.M., Ussery D.W., Stolz J.F., Binnewies T.T., Hallin P.F., Wang G., Malek J.A., Rogosin A., Stanker L.H., & Mandrell R.E. 2007. The complete genome sequence and analysis of the Epsilonproteobacterium Arcobacter butzleri. PLoS ONE. 2: e1358.

Miroshnichenko M.L., Kostrikina N.A., L’Haridon S., Jeanthon C., Hippe H., Stackebrandt E., & Bonch-Osmolovskaya E.A. 2002. Nautilia lithotrophica gen. nov., sp. nov., a thermophilic sulfur-reducing å-proteobacterium isolated from a deep-sea hydrothermal vent. Int J Syst Evol Microbiol. 52: 1299-1304.

Missall T.A., Pusateri M.E., & Lodge J.K. 2004. Thiol peroxidase is critical for virulence and resistance to nitric oxide and peroxide in the fungal pathogen, Cryptococcus neoformans. Mol Microbiol. 51: 1447–1458.

Modrich P., & Lahue R. 1996. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu Rev Biochem. 65: 101-133.

Møller J.V., Juul B., & le Maire M. 1996. Structural organization, ion transport, and energy transduction of P-type ATPases. Biochim Biophys Acta. 1286: 1-51.

244

Moore G.R., Pettigrew G.W., & Rogers N.K. 1986. Factors influencing redox potentials of electron transfer proteins. Proc Natl Acad Sci USA. 83: 4998-4999.

Moore J.E., Corcoran D., Dooley J.S.G., Fanning S., Lucey B., Matsuda M., McDowell D.A., Mégraud F., Millar B.C., O’Mahony R., O’Riordan L., O’Rourke M., Rao J.R., Rooney P.J., Sails A., & Whyte P. 2005. Campylobacter. Vet Res. 36: 351-382.

Moore M.J., Miller S.M., & Walsh C.T. 1992. C-terminal cysteines of Tn501 mercuric ion reductase. Biochemistry. 31: 1677-1685.

Moujaber T., MacIntyre C.R., Backhouse J., Gidding H., Quinn H., & Gilbert G.L. 2008. The seroepidemiology of Helicobacter pylori infection in Australia. Int J Infect Dis. 12: 500-504.

Moussard H., Corre E., Cambon-Bonavita M.A., Fouquet Y., & Jeanthon C. 2006. Novel uncultured Epsilonproteobacteria dominate a filamentous sulphur mat from the 13 degrees N hydrothermal vent field, East Pacific Rise. FEMS Microbiol Ecol. 58: 449-463.

Mulder N.J., Apweiler R., Attwood T.K., Bairoch A., Bateman A., Binns D., Bradley P., Bork P., Bucher P., Cerutti L., Copley R., Courcelle E., Das U., Durbin R., Fleischmann W., Gough J., Haft D., Harte N., Hulo N., Kahn D., Kanapin A., Krestyaninova M., Lonsdale D., Lopez R., Letunic I., Madera M., Maslen J., McDowall J., Mitchell A., Nikolskaya A.N., Orchard S., Pagni M., Ponting C.P., Quevillon E., Selengut J., Sigrist C.J., Silventoinen V., Studholme D.J., Vaughan R., & Wu C.H. 2005. InterPro, progress and status in 2005. Nucleic Acids Res. 33: D201-D205.

Müller J., Sterk M., Hemphill A., & Müller N. 2007. Characterization of Giardia lamblia WB C6 clones resistant to nitazoxanide and to metronidazole. J Antimicrob Chemother. 60: 280-287.

Muller J.P., Vedel M., Monnot M.J., Touzet N., & Wegnez M. 1991. Molecular cloning and expression of ferritin mRNA in heavy metal-poisoned Xenopus laevis cells. DNA Cell Biol. 10: 571-579.

Mulrooney S.B., & Williams Jr C.H. 1994. Potential active-site base of thioredoxin reductase from Escherichia coli: examination of Histidine245 and Aspartate39 by site-directed mutagenesis. Biochemistry. 33: 3148-3154.

Nachamkin I., Liu J., Li M., Ung H., Moran A.P., Prendergast M., & Sheikh K. 2002. Campylobacter jejuni from patients with Guillain-Barré syndrome preferentially expresses a GD(1a)-like epitope. Infect Immun. 70: 5299-5303.

Nagata K., Tsukita S., Tamura T., & Sone N. 1996. A cb-type cytochrome-c oxidase terminates the respiratory chain in Helicobacter pylori. Microbiology. 142: 1757-1763.

Nakagawa S., Takai K., Inagaki F., Hirayama H., Nunoura T., Horikoshi K., & Sako Y. 2005. Distribution, phylogenetic diversity and physiological characteristics of epsilon- Proteobacteria in a deep-sea hydrothermal field. Environ Microbiol. 7: 1619-1632.

Nathan C., & Shiloh M.U. 2000. Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens. Proc Natl Acad Sci USA. 97: 8841-8848.

245

Nau6iene Z., Mildaziene V., & Baniene R. 2002. Interactions of cadmium and copper ions with Complex I of the respiratory chain in rat liver mitochondria. Ekologija. 2: 18-21.

Neill S.D., Campbell J.N., O'Brien J.J., Weatherup S.T.C., & Ellis W.A. 1985. Taxonomic position of Campylobacter cryaerophila sp. nov. Int J Syst Bacteriol. 35: 342-356.

Nicholls P., Fita I., & Loewen P.C. 2001. Enzymology and structure of catalases. Adv Inorg Chem. 51: 51-106.

Nies D.H. 2003. Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev. 27: 313-339.

Oelschlaeger T.A., Guerry P., & Kopecko D.J. 1993. Unusual microtubule-dependent endocytosis mechanisms triggered by Campylobacter jejuni and Citrobacter freundii. Proc Natl Acad Sci USA. 90: 6884-6888.

Okamoto K., Baba T., Yamanaka H., Akashi N., & Fujii Y. 1995. Disulfide bond formation and secretion of Escherichia coli heat-stable enterotoxin II. J Bacteriol. 177: 4579-4586.

Olczak A.A., Olson J.W., & Maier R.J. 2002. Oxidative-stress resistance mutants of Helicobacter pylori. J Bacteriol. 184: 3186-3193.

Olczak A.A., Seyler Jr R.W., Olson J.W., & Maier R.J. 2003. Association of Helicobacter pylori antioxidant activities with host colonization proficiency. Infect Immun. 71: 580-583.

Olczak A.A., Wang G., & Maier R.J. 2005. Up-expression of NapA and other oxidative stress proteins is a compensatory response to loss of major Helicobacter pylori stress resistance factors. Free Radic Res. 39: 1173-1182.

Olry A., Boschi-Muller S., Marraud M., Sanglier-Cianferani S., Van Dorsselear A., & Branlant G. 2002. Characterization of the methionine sulfoxide reductase activities of PILB, a probable virulence factor from Neisseria meningitidis. J Biol Chem. 277: 12016–12022.

O'Rourke E.J., Chevalier C., Pinto A.V., Thiberge J.M., Ielpi L., Labigne A., & Radicella J.P. 2003. Pathogen DNA as target for host-generated oxidative stress: role for repair of bacterial DNA damage in Helicobacter pylori colonization. Proc Natl Acad Sci USA. 100: 2789-2794.

Oxley A.P., Powell M., & McKay D.B. 2004. Species of the family Helicobacteraceae detected in an Australian sea lion (Neophoca cinerea) with chronic gastritis. J Clin Microbiol. 42: 3505- 3512.

Ozben T. 2007. Oxidative stress and apoptosis: impact on cancer therapy. J Pharm Sci. 96: 2181- 2196.

Pálfi Z., Surányi G., & Borbély G. 1991. Alterations in the accumulation of adenylylated nucleotides in heavy-metal-ion-stressed and heat-stressed Synechococcus sp. strain PCC 6301, a cyanobacterium, in light and dark. Biochem J. 276: 487-491.

Palmer S.R., Gully P.R., White J.M., Pearson A.D., Suckling W.G., Jones D.M., Rawes J.C., & Penner J.L. 1983. Water-borne outbreak of Campylobacter gastroenteritis. Lancet. 8319: 287- 290.

246

Parkhill J., Wren B.W., Mungall K., Ketley J.M., Churcher C., Basham D., Chillingworth T., Davies R.M., Feltwell T., Holroyd S., Jagels K., Karlyshev A.V., Moule S., Pallen M.J., Pennk C.W., Quail M.A., Rajandream M.-A., Rutherford K.M., van Vliet A.H.M., Whitehead S., & Barrell B.G. 2000. The genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable sequences. Nature. 403: 665-668.

Patel M.P., Marcinkeviciene J., & Blanchard J.S. 1998. Enterococcus faecalis glutathione reductase: purification, characterization and expression under normal and hyperbaric O2 conditions. FEMS Microbiol lett. 166: 155-163.

Peek J.A., & Taylor R.K. 1992. Characterization of a periplasmic thiol:disulfide interchange protein required for the functional maturation of secreted virulence factors of Vibrio cholerae. Proc Natl Acad Sci USA. 89: 6210-6214.

Pennanen T., Frostegard Å., Fritze H., & Baath E. 1996. Phospholipid fatty acid composition and heavy metal tolerance of soil microbial communities along two heavy metal-polluted gradients in coniferous forests. Appl Environ Microbiol. 62: 420-428.

Perron K., Caille O., Rossier C., Van Delden C., Dumas J.L., & Kohler T. 2004. CzcR-CzcS, a two-component system involved in heavy metal and carbapenem resistance in Pseudomonas aeruginosa. J Biol Chem. 279: 8761-8768.

Pietrowska-Borek M., Stuible H.-P., Kombrink E., & Guranowski A. 2003. 4- Coumarate:coenzyme A ligase has the catalytic capacity to synthesize and reuse various (di)adenosine polyphosphates. Plant Physiol. 131: 1401-1410.

Pinto A.V., Mathieu A., Marsin S., Veaute X., Ielpi L., Labigne A., & Radicella J.P. 2005. Suppression of homologous and homeologous recombination by the bacterial MutS2 protein. Mol Cell. 17: 113-120.

Pitson S.M., Mendz G.L., Srinivasan S., & Hazell S.L. 1999. The tricarboxylic acid cycle of Helicobacter pylori. Eur J Biochem. 260: 258-267.

Poly F., & Guerry P. 2008. Pathogenesis of Campylobacter. Curr Opin Gastroenterol. 24: 27-31.

Polz M.F., & Cavanaugh C.M. 1995. Dominance of one bacterial phylotype at a Mid-Atlantic Ridge hydrothermal vent site. Proc Natl Acad Sci USA. 92: 7232-7236.

Poolman B., Driessen A.J., & Konings W.N. 1987. Regulation of arginine-ornithine exchange and the arginine deiminase pathway in Streptococcus lactis. J Bacteriol. 169: 5597–5604.

Raczko A.M., Bujnicki J.M., Pawlowski M., Godlewska R., Lewandowska M., & Jagusztyn- Krynicka E.K. 2005. Characterization of new DsbB-like thiol oxidoreductases of Campylobacter jejuni and Helicobacter pylori and classification of the DsbB family based on phylogenomic, structural and functional criteria. Microbiology. 151: 219–231.

Rader B.A., Campagna S.R., Semmelhack M.F., Bassler B.L., & Guillemin K. 2007. The quorum-sensing molecule Autoinducer 2 regulates motility and flagellar morphogenesis in Helicobacter pylori. J Bacteriol. 189: 6109-6117.

247

Raina S., & Missiakas D. 1997. Making and breaking disulfide bonds. Annu Rev Microbiol. 51: 179–202.

Rektorschek M., Weeks D., Sachs G., & Melchers K. 1998. Influence of pH on metabolism and urease activity of Helicobacter pylori. Gastroenterol. 115: 628-641.

Rietsch A., & Beckwith J. 1998. The genetics of disulfide bond metabolism. Annu Rev Genet. 32: 163–184.

Ritz D., & Beckwith J. 2001. Roles of thiol-redox pathways in bacteria. Annu Rev Microbiol. 55: 21–48.

Rollin-Genetet F., Berthomieu C., Davin A.-H., & Quemeneur E. 2004. Escherichia coli thioredoxin inhibition by cadmium Two mutually exclusive binding sites involving Cys32 and Asp26. Eur J Biochem. 271: 1299-1309.

Romagnoli S., Packer H.L., & Armitage J.P. 2002. Tactic response to oxygen in the phototrophic bacterium Rhodobacter sphaeroides WS8N. J Bacteriol. 184: 5590-5598.

Ron E.Z., Minz D., Finkelstein N.P., & Rosenberg E. 1992. Interactions of bacteria with cadmium. Biodegradation. 3: 161-170.

Rosato V., Pucello N., & Giuliano G. 2002. Evidence for cysteine clustering in thermophilic proteomes. Trends Genet. 18: 278-281.

Roy C., Lancaster D., & Simon J. 2002. Succinate:quinone oxidoreductases from - proteobacteria. Biochim Biophys Acta. 1553: 84-101.

Russel M. 1995. Thioredoxin genetics. Methods Enzymol. 252: 264-274.

Russel M., Model P., & Holmgren A. 1990. Thioredoxin or glutaredoxin in Escherichia coli is essential for sulfate reduction but not for deoxyribonucleotide synthesis. J Bacteriol. 172: 1923- 1929.

Sabarth N., Hurwitz R., Meyer T.F., & Bumann D. 2002. Multiparameter selection of Helicobacter pylori antigens identifies two novel antigens with high protective efficacy. Infect Immun. 70: 6499–6503.

Saldanha A.J. 2004. Java Treeview—extensible visualization of microarray data. Bioinformatics. 20: 3246-3248.

Salin M.L. 1988. Toxic oxygen species and protective systems of the chloroplast. Physiol Plant. 72: 681-689.

Saxena V.P., & Wetlaufer D.B. 1970. Formation of three-dimensional structure in proteins. I. Rapid nonenzymic reactivation of reduced lysozyme. Biochemistry. 9: 5015-5023.

Scarpignato C. 2004. Towards the ideal regimen for Helicobacter pylori eradication: the search continues. Dig Liver Dis. 36: 243-247.

248

Schauer K., Gouget B., Carrière M., Labigne A., & de Reuse H. 2007. Novel nickel transport mechanism across the bacterial outer membrane energized by the TonB/ExbB/ExbD machinery. Mol Microbiol. 63: 1054-1068.

Schultz S.C., Dalbadie-McFarland G., Neitzel J.J., & Richards J.H. 1987. Stability of wild- type and mutant RTEM-1 beta-lactamases: effect of the disulfide bond. Proteins. 2: 290-297.

Schulz A.R. 1994. Enzyme kinetics, from diastase to multienzyme systems. New York: Cambridge University Press.

Scott K., Diggle M.A., & Clarke S.C. 2003. TypA is a virulence regulator and is present in many pathogenic bacteria. Br J Biomed Sci. 60: 168-170.

Seib K.L., Wu H.-J., Kidd S.P., Apicella M.A., Jennings M.P., & McEwan A.G. 2006. Defenses against oxidative stress in Neisseria gonorrhoeae: a system tailored for a challenging environment. Microbiol Mol Biol Rev. 70: 344-361.

Shi W., Yang Z., Geng Y., Wolinsky L.E., & Lovett M.A. 1998. Chemotaxis in Borrelia burgdorferi. J Bacteriol. 180: 231-235.

Sigeti J.S., Guiney D.G., & Davis C.E. 1983. Mechanism of action of metronidazole on Bacteroides fragilis. J Infect Dis. 148: 1083-1089.

Silvera S.A., & Rohan T.E. 2007. Benign proliferative epithelial disorders of the breast: a review of the epidemiologic evidence. Breast Cancer Res Treat. DOI: 10.1007/s10549-007-9740- 3.

Silvestre F., Dierick J.F., Dumont V., Dieu M., Raes M., & Devos P. 2006. Differential protein expression profiles in anterior gills of Eriocheir sinensis during acclimation to cadmium. Aquat Toxicol. 76: 46-58.

Simon J., Einsle O., Kroneck P.M., & Zumft W.G. 2004. The unprecedented nos gene cluster of Wolinella succinogenes encodes a novel respiratory electron transfer pathway to cytochrome c nitrous oxide reductase. FEBS Lett. 569: 7-12.

Singh R., Mailloux R.J., Puiseux-Dao S., & Appanna V.D. 2007. Oxidative stress evokes a metabolic adaptation that favors increased NADPH synthesis and decreased NADH production in Pseudomonas fluorescens. J Bacteriol. 189: 6665-6675.

Sisson G., Jeong J.-Y., Goodwin A., Bryden L., Rossler N., Lim-Morrison S., Raudonikiene A., Berg D.E., & Hoffman P.S. 2000. Metronidazole activation is mutagenic and causes DNA fragmentation in Helicobacter pylori and in Escherichia coli containing a cloned H. pylori rdxA+ (nitroreductase) gene. J Bacteriol. 182: 5091-5096.

Skirrow M.B., & Benjamin J. 1980. Campylobacters: cultural characteristics of intestinal camplyobacters from man and animals. J Hyg. 85: 427-442.

Skouloubris S., Labigne A., & de Reuse H. 2001. The AmiE aliphatic amidase and AmiF formamidase of Helicobacter pylori: natural evolution of two enzyme paralogs. Mol Microbiol. 40: 596-609.

249

Smith M.A., & Edwards D.I. 1995. Redox potential and oxygen concentration as factors in the susceptibility of Helicobacter pylori to nitroheterocyclic drugs. J Antimicrob Chemother. 35: 751-764.

Smith M.A., & Edwards D.I. 1997. Oxygen scavenging, NADH-oxidase and metronidazole resistance in Helicobacter pylori. J Antimicrob Chemother. 39: 347-353.

Smith M.A., Finel M., Korolik V., & Mendz G.L. 2000. Characteristics of the aerobic respiratory chains of the microaerophiles Campylobacter jejuni and Helicobacter pylori. Arch Microbiol. 174: 1-10.

Smith M.A., Jorgensen M.A., Mendz G.L., & Hazell S.L. 1998. Metronidazole resistance and microaerophily in Campylobacter species. Arch Microbiol. 170: 279-284.

Sommi P., Ricci V., Fiocca R., Romano M., Ivey K.J., Cova E., Solcia E., & Ventura U. 1996. Significance of ammonia in the genesis of gastric epithelial lesions induced by Helicobacter pylori: an in vitro study with different bacterial strains and urea concentrations. Digestion. 57: 299-304.

St. Maurice M., Cremades N., Croxen M.A., Sisson G., Sancho J., & Hoffman P.S. 2007. Flavodoxin:quinone reductase (FqrB): a redox partner of pyruvate:ferredoxin oxidoreductase that reversibly couples pyruvate oxidation to NADPH production in Helicobacter pylori and Campylobacter jejuni. J Bacteriol. 189: 4764-4773.

Stenson T.H., & Weiss A.A. 2002. DsbA and DsbC are required for secretion of pertussis toxin by Bordetella pertussis. Infect Immun. 70: 2297–2303.

Stern N.J., Kazmi S.U., Roberson B.S., Ono K., & Juven B.J. 1988. Response of Campylobacter jejuni to combinations of ferrous sulphate and cadmium chloride. J Appl Bacteriol. 64: 247-255.

Stingl K., Schauer K., Ecobichon C., Labigne A., Lenormand P., Rouselle J.-C., Namane A., & de Reuse H. 2008. Tandem affinity purification reveals new links between virulence and metabolic pathways in Helicobacter pylori. Mol Cell Proteomics. Submitted.

Strasdeit H. 2001. The first cadmium-specific enzyme. Angew Chem Int Ed. 40: 707-709.

Strydom C., Robinson C., Pretorius E., Whitcutt J.M., Marx J., & Bornman M.S. 2006. The effect of selected metals on the central metabolic pathways in biology: A review. Water SA. 32: 543-554.

Stubbs S.L., Brazier J.S., Talbot P.R., & Duerden B.I. 2000. PCR-restriction fragment length polymorphism analysis for identification of Bacteroides spp. and characterization of nitroimidazole resistance genes. J Clin Microbiol. 38: 3209-3213.

Suzuki M., Miura S., Suematsu M., Fukumura D., Kurose I., Suzuki H., Kai A., Kudoh Y., Ohashi M., & Tsuchiya M. 1992. Helicobacter pylori-associated ammonia production enhances neutrophil-dependent gastric mucosal cell injury. Am J Physiol. 263: G719-725.

250

Taha M.K., Dupuy B., Saurin W., So M., & Marchal C. 1991. Control of pilus expression in Neisseria gonorrhoeae as an original system in the family of two-component regulators. Mol Microbiol. 5: 137-148.

Takahata M., Tamura T., Abe K., Mihara H., Kurokawa S., Yamamoto Y., Nakano R., Esaki N., & Inagaki K. 2008. Selenite assimilation into formate dehydrogenase H depends on thioredoxin reductase in Escherichia coli. J Biochem. 143: 467-473.

Takai K., Campbell B.J., Cary S.C., Suzuki M., Oida H., Nunoura T., Hirayama H., Nakagawa S., Suzuki Y., Inagaki F., & Horikoshi K. 2005. Enzymatic and genetic characterization of carbon and energy metabolisms by deep-sea hydrothermal chemolithoautotrophic isolates of Epsilonproteobacteria. Appl Environ Microbiol. 71: 7310- 7320.

Tao K., Fujita N., & Ishihama A. 1993. Involvement of the RNA polymerase alpha subunit C- terminal region in co-operative interaction and transcriptional activation with OxyR protein. Mol Microbiol. 7: 859-864.

Tarrío N., Prado S.D., Cerdán M.E., & Siso M.I.G. 2004. Isolation and characterization of two nuclear genes encoding glutathione and thioredoxin reductases from the yeast Kluyveromyces lactis. Biochim Biophys Acta. 1678: 170-175.

Tchou J., Kasai H., Shibutani S., Chung M.H., Laval J., Grollman A.P., & Nishimura S. 1991. 8-oxoguanine (8-hydroxyguanine) DNA glycosylase and its substrate specificity. Proc Natl Acad Sci USA. 88: 4690-4694.

Tetley R.M., & Bishop N.I. 1979. The differential action of metronidazole on nitrogen fixation, hydrogen metabolism, photosynthesis and respiration in Anabaena and Scenedesmus. Biochim Biophys Acta. 546: 43-53.

Thilakaraj R., Raghunathan K., Anishetty S., & Pennathur G. 2007. In silico identification of putative metal binding motifs. Bioinformatics. 23: 267-271.

Thompson J.D., Higgins D.G., & Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680.

Thompson L.J., Merrell D.S., Neilan B.A., Mitchell H., Lee A., & Falkow S. 2003. Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression. Infect Immun. 71: 2643-2655.

Thompson S.A., & Blaser M.J. 1995. Isolation of the Helicobacter pylori recA gene and involvement of the recA region in resistance to low pH. Infect Immun. 63: 2185-2193.

Thompson S.A., Latch R.L., & Blaser J.M. 1998. Molecular characterization of the Helicobacter pylori uvr B gene. Gene. 209: 113-122.

Thön M., Al-Abdallah Q., Hortschansky P., & Brakhage A.A. 2007. The thioredoxin system of the filamentous fungus Aspergillus nidulans: impact on development and oxidative stress response. J Biol Chem. 282: 27259-27269.

251

Tompkins D.S., Dave J., & Mapstone N. 1994. Adaptation of Helicobacter pylori to aerobic growth. Eur J Clin Microbiol Infect Dis. 13: 409-412.

Trend M.A., Jorgensen M.A., Hazell S.L., & Mendz G.L. 2001. Oxidases and reductases are involved in metronidazole sensitivity in Helicobacter pylori. Int J Biochem Cell Biol. 33: 143- 153.

Ueland P.M. 1982. Pharmacological and biochemical aspects of S-Adenosylhomocysteine and S- Adenosylhomocysteine hydrolase. Pharmacol Rev. 34: 223-253.

Ueno D., Ma J.F., Iwashita T., Zhao F.-J., & McGrath S.P. 2005. Identification of the form of Cd in the leaves of a superior Cd-accumulating ecotype of Thlaspi caerulescens using 113Cd- NMR. Planta. 221: 928-936.

Unden G. 1999. Aerobic respiration and regulation of aerobic/anaerobic metabolism. In Lengeler J.W., Drews G., Schlegel H.G. (eds): Biology of the Prokaryotes. New York: Blackwell Science.

Unden G., & Schirawski J. 1997. The oxygen-responsive transcriptional regulator FNR of Escherichia coli: the search for signals and reactions. Mol Microbiol. 25: 205-210.

Valko M., Rhodes C.J., Moncola J., Izakovic M., & Mazura M. 2006. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact. 160: 1-40.

Van Bogelen R.A., Kelley P.M., & Neidhart F.C. 1987. Differential induction of heat shock, SOS, and oxidation stress regulons and accumulation of nucleotides in Escherichia coli. J Bacteriol. 169: 26-32.

Vandamme P., Vancanneyt M., Pot B., Mels L., Hoste B., Dewettinck D., Vlaes L., van den Borre C., Higgins R., & Hommez J. 1992. Polyphasic taxonomic study of the emended genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an aerotolerant bacterium isolated from veterinary specimens. Int J Syst Bacteriol. 42: 344-356.

Vandenberg O., Dediste A., Houf K., Ibekwem S., Souayah H., Cadranel S., Douat N., Zissis G., Butzler J.P., & Vandamme P. 2004. Arcobacter species in humans. Emerg Infect Dis. 10: 1863-1867.

Vanhove M., Guillaume G., Ledent P., Richards J.H., Pain R.H., & Frère J.M. 1997. Kinetic and thermodynamic consequences of the removal of the Cys-77-Cys-123 disulphide bond for the folding of TEM-1 beta-lactamase. Biochem J. 321: 413-417.

Velayudhan J., Jones M.A., Barrow P.A., & Kelly D.J. 2004. L-serine catabolism via an oxygen-labile L-serine dehydratase is essential for colonization of the avian gut by Campylobacter jejuni. Infect Immun. 72: 260-268.

Verhoeff-Bakkenes L., Arends A.P., Snoep J.L., Zwietering M.H., & de Jonge R. 2008. Pyruvate relieves the necessity of high induction levels of catalase and enables Campylobacter jejuni to grow under fully aerobic conditions. Lett Appl Microbiol. 46: 377-382.

Vido K., Spector D., Lagniel G., Lopez S., Toledano M.B., & Labarre J. 2001. A proteome analysis of the cadmium response in Saccharomyces cerevisiae. J Biol Chem. 276: 8469-8474.

252

van Vliet A.H., Baillon M.A., Penn C.W., & Ketley J.M. 2001. The iron-induced ferredoxin FdxA of Campylobacter jejuni is involved in aerotolerance. FEMS Microbiol Lett. 196: 189-193.

Vogt W. 1995. Oxidation of methionyl residues in proteins: tools, targets, and reversal. Free Radic Biol Med. 18: 93-105. von Mering C., Jensen L.J., Kuhn M., Chaffron S., Doerks T., Kruger B., Snel B., & Bork P. 2007. STRING 7-recent developments in the integration and prediction of protein interactions. Nucleic Acids Res. 35: D358-D362.

Voskoboinik I., Strausak D., Greenough M., Brooks H., Petris M., Smith S., Mercer J.F., & Camakaris J. 1999. Functional analysis of the N-terminal CXXC metal-binding motifs in the human Menkes copper-transporting P-type ATPase expressed in cultured mammalian cells. J Biol Chem. 274: 22008-22012.

Wai S.N., Nakayama K., Umene K., Moriya T., & Amako K. 1996. Construction of a ferritin- deficient mutant of Campylobacter jejuni: contribution of ferritin to iron storage and protection against oxidative stress. Mol Microbiol. 20: 1127-1134.

Waidner B., Greiner S., Odenbreit S., Kavermann H., Velayudhan J., Stahler F., Guhl J., Bisse E., van Vliet A.H.M., Andrews S.C., Kusters J.G., Kelly D.J., Haas R., Kist M., & Bereswill S. 2002. Essential role of ferritin Pfr in Helicobacter pylori iron metabolism and gastric colonization. Infect Immun. 70: 3923-3929.

Wainwright L.M., Elvers K.T., Park S.F., & Poole R.K. 2005. A truncated haemoglobin implicated in oxygen metabolism by the microaerophilic food-borne pathogen Campylobacter jejuni. Microbiology. 151: 4079-4091.

Wait R., Begum S., Brambilla D., Carabelli A.M., Conserva F., Guerini A.R., Eberini I., Ballerio R., Gemeiner M., Miller I., & Gianazza E. 2005. Redox options in two-dimensional electrophoresis. Amino Acids. 28: 239-272.

Walsh C.T., Distefano M.D., Moore M.J., Shewchuk L.M., & Verdine G.L. 1988. Molecular basis of bacterial resistance to organomercurial and inorganic mercuric salts. FASEB J. 2: 124- 130.

Wang A., & Crowley D.E. 2005. Global gene expression responses to cadmium toxicity in Escherichia coli. J Bacteriol. 187: 3259-3266.

Wang G., Alamuri P., & Maier R.J. 2006. The diverse antioxidant systems of Helicobacter pylori. Mol Microbiol. 61: 847-860.

Wang G., Conover R.C., Benoit S., Olczak A.A., Olson J.W., Johnson M.K., & Maier R.J. 2004. Role of a bacterial organic hydroperoxide detoxification system in preventing catalase inactivation. J Biol Chem. 279: 51908-51914.

Wang G., & Maier R.J. 2004. An NADPH quinone reductase of Helicobacter pylori plays an important role in oxidative stress resistance and host colonization. Infect Immun. 72: 1391-1396.

253

Wang G., Olczak A.A., Walton J.P., & Maier R.J. 2005. Contribution of the Helicobacter pylori thiol peroxidase bacterioferritin comigratory protein to oxidative stress resistance and host colonization. Infect Immun. 73: 378–384.

Ware E. 1950. The chemistry of the hydantoins. Chem Rev. 46: 403-470.

Warren J.R. 1983. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1: 1273-1275.

Warrilow A.G.S., & Hawkesford M.J. 2000. Cysteine synthase (O-acetylserine (thiol) lyase) substrate specificities classify the mitochondrial isoform as a cyanoalanine synthase. J Exp Bot. 51: 985-993.

Watarai M., Tobe T., Yoshikawa M., & Sasakawa C. 1995. Disulfide oxidoreductase activity of Shigella flexneri is required for release of Ipa proteins and invasion of epithelial cells. Proc Natl Acad Sci USA. 92: 4927-4931.

Watson R.O., & Galán J.E. 2008. Campylobacter jejuni survives within epithelial cells by avoiding delivery to lysosomes. PLoS Pathog. 4: e14.

Weeks D.L., Eskandari S., Scott D.R., & Sachs G. 2000. A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonization. Science. 287: 482-485.

Williams C.H., Arscott L.D., Muller S., Lennon B.W., Ludwig M.L., Wang P.-F., Veine D.M., Becker K., & Heiner Schirmer R. 2000. Thioredoxin reductase Two modes of catalysis have evolved. Eur J Biochem. 267: 6110-6117.

Wilson D.J., Gabriel E., Leatherbarrow A.J., Cheesbrough J., Gee S., Bolton E., Fox A., Fearnhead P., Hart C.A., & Diggle P.J. 2008. Tracing the source of campylobacteriosis. PLoS Genet. 4: e1000203.

Windle H.J., Fox A., Eidhin D.N., & Kelleher D. 2000. The thioredoxin system of Helicobacter pylori. J Biol Chem. 275: 5081–5089.

Wirsen C.O., Sievert S.M., Cavanaugh C.M., Molyneaux S.J., Ahmad A., Taylor L.T., De Long E.F., & Taylor C.D. 2002. Characterization of an autotrophic sulfide-oxidizing marine Arcobacter sp. that produces filamentous sulfur. Appl Environ Microbiol. 68: 316-325.

Wizemann T.M., Moskovitz J., Pearce B.J., Cundell D., Arvidson C.G., So M., Weissbach H., Brot N., & Masure H.R. 1996. Peptide methionine sulfoxide reductase contributes to the maintenance of adhesins in three major pathogens. Proc Natl Acad Sci USA. 93: 7985-7990.

Wolin M.J., Wolin E.A., & Jacobs N.J. 1961. Cytochrome-producing anaerobic Vibrio, Vibrio succinogenes, sp. n. J Bacteriol. 81: 911-917.

Wyllie S., Cunningham M.L., & Fairlamb A.H. 2004. Dual action of antimonial drugs on thiol redox metabolism in the human pathogen Leishmania donovani. J Biol Chem. 279: 39925-39932.

Xia H.X., Keane C.T., & O'Morain C.A. 1994. Culture of Helicobacter pylori under aerobic conditions on solid media. Eur J Clin Microbiol Infect Dis. 13: 406-409.

254

Yamaguchi H., Osaki T., Takahashi M., Taguchi H., & Kamiya S. 1999. Colony formation by Helicobacter pylori after long-term incubation under anaerobic conditions. FEMS Microbiol Lett. 175: 107-111.

Yamanaka H., Kameyama M., Baba T., Fujii Y., & Okamoto K. 1994. Maturation pathway of Escherichia coli heat-stable enterotoxin I: requirement of DsbA for disulfide bond formation. J Bacteriol. 176: 2906-2913.

Yamasaki M., Igimi S., Katayama Y., Yamamoto S., & Amano F. 2004. Identification of an oxidative stress-sensitive protein from Campylobacter jejuni, homologous to rubredoxin oxidoreductase/rubrerythrin. FEMS Microbiol Lett. 235: 57-63.

Yavlovich A., Kohen R., Ginsburg I., & Rottem S. 2006. The reducing antioxidant capacity of Mycoplasma fermentans. FEMS Microbiol Lett. 259: 195–200.

Yu J. 1998. Inactivation of DsbA, but not DsbC and DsbD, affects the intracellular survival and virulence of Shigella flexneri. Infect Immun. 66: 3909-3917.

Yu J., & Kroll J.S. 1999. DsbA: a protein-folding catalyst contributing to bacterial virulence. Microbes Infect. 1: 1221-1228.

Yu J., Webb H., & Hirst T.R. 1992. A homologue of the Escherichia coli DsbA protein involved in disulphide bond formation is required for enterotoxin biogenesis in Vibrio cholerae. Mol Microbiol. 6: 1949-1958.

Yuvaniyama P., Agar J.N., Cash V.L., Johnson M.K., & Dean D.R. 2000. NifS-directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc Natl Acad Sci USA. 97: 599-604.

Zegers I., Martins J.C., Willem R., Wyns L., & Messens J. 2001. Arsenate reductase from S. aureus plasmid pI258 is a phosphatase drafted for redox duty. Nat Struct Biol. 8: 843-847.

Zhang H.Z., & Donnenberg M.S. 1996. DsbA is required for stability of the type IV pilin of enteropathogenic Escherichia coli. Mol Microbiol. 21: 787-797.

Zhang L., Day A., McKenzie G., & Mitchell H. 2006. Nongastric Helicobacter species detected in the intestinal tract of children. J Clin Microbiol. 44: 2276-2279.

Zhang Q.M., Miyabe I., Matsumoto Y., Kino K., Sugiyama H., & Yonei S. 2000. Identification of repair enzymes for 5-formyluracil in DNA. Nth, nei, and MutM proteins of Escherichia coli. J Biol Chem. 275: 35471–35477.

Zheng M., Aslund F., & Storz G. 1998. Activation of the OxyR transcription factor by reversible disulfide bond formation. Science. 279: 1718-1721.

255

APPENDICES

APPENDIX 1: SUPPLEMENTARY TABLES A1

Table S5.1 A2 Table S5.2 A5 Table S5.3 A7 Table S7.1 A9

A1 SUPPLEMENTARY TABLES Table S5.1 Campylobacter jejuni NCTC 11168 genes regulated under higher oxygen tensions.

Regulation ORF Regulation ORF Upregulation cj0024 Downregulation cj0040 cj0059c cj0042 cj0073c cj0261c cj0074c cj0265c cj0089 cj0527c cj0091 cj0528c cj0092 cj0571 cj0093 cj0621 cj0105 cj0636 cj0106 cj0652 cj0107 cj0676 cj0108 cj0677 cj0112 cj0678 cj0115 cj0687c cj0149c cj0697 cj0150c cj0707 cj0169 cj0772c cj0203 cj0780 cj0239c cj0808c cj0240c cj0830 cj0245 cj0846 cj0268c cj0855 cj0273 cj0864 cj0274 cj0874c cj0276 cj0876c cj0283c cj0887c cj0284c cj0939c cj0298c cj0945c cj0311 cj1040c cj0331c cj1203c cj0334 cj1224 cj0335 cj1242 cj0343c cj1293 cj0349 cj1341c cj0354c cj1356c cj0361 cj1357c cj0403 cj1358c cj0414 cj1362 cj0415 cj1450 cj0426 cj1462 cj0427 cj1464 cj0428 cj1544c cj0435 cj1545c cj0442 cj1587c cj0443 cj1616 cj0450c cj1633 cj0469 cj1662 cj0470

Regulation ORF Regulation ORF Upregulation cj0472 Downregulation cj0473 cj0474 cj0477 cj0497 cj0511 cj0512 cj0533 cj0534 cj0535 cj0536 cj0537 cj0538 cj0545 cj0546 cj0556 cj0574 cj0575 cj0604 cj0606 cj0628 cj0629 cj0632 cj0638c cj0639c cj0643 cj0696 cj0700 cj0702 cj0714 cj0779 cj0802 cj0806 cj0838c cj0891c cj0892c cj0912c cj0925 cj0928 cj0936 cj0942c cj0953c cj1017c cj1018c cj1019c cj1020c cj1022c cj1054c cj1058c cj1061c cj1070 cj1071 cj1082c cj1086c cj1096c cj1171c

Regulation ORF Regulation ORF Upregulation cj1172c Downregulation cj1181c cj1182c cj1183c cj1184c cj1185c cj1186c cj1190c cj1196c cj1204c cj1226c cj1260c cj1280c cj1324 cj1328 cj1366c cj1382c cj1420c cj1424c cj1425c cj1427c cj1476c cj1478c cj1479c cj1480c cj1487c cj1488c cj1489c cj1490c cj1518 cj1568c cj1569c cj1570c cj1571c cj1578c cj1592 cj1593 cj1594 cj1605c cj1606c cj1688c cj1690c cj1691c cj1692c cj1693c cj1695c cj1696c cj1697c cj1700c cj1701c cj1702c cj1703c cj1704c cj1707c cj1708c

Table S5.2 Helicobacter pylori 26695 genes regulated under higher oxygen tensions. Regulation ORF Regulation ORF Upregulation hp0047 Downregulation hp0033 hp0055 hp0091 hp0064 hp0092 hp0068 hp0109 hp0140 hp0110 hp0147 hp0111 hp0149 hp0112 hp0238 hp0229 hp0284 hp0252 hp0294 hp0299 hp0313 hp0327 hp0382 hp0330 hp0389 hp0331 hp0423 hp0332 hp0520 hp0333 hp0614 hp0428 hp0630 hp0432 hp0647 hp0501 hp0653 hp0524 hp0697 hp0549 hp0701 hp0625 hp0742 hp0705 hp0807 hp0805 hp0821 hp0869 hp0824 hp0871 hp0825 hp0906 hp0828 hp0969 hp0859 hp1083 hp0900 hp1140 hp0919 hp1209 hp0927 hp1210 hp0936 hp1211 hp0952 hp1258 hp1009 hp1415 hp1011 hp1416 hp1067 hp1420 hp1167 hp1430 hp1168 hp1517 hp1173 hp1518 hp1179 hp1572 hp1192 hp1223 hp1227 hp1241 hp1253 hp1265 hp1268 hp1278 hp1323 hp1372 hp1385 hp1386

Regulation ORF Regulation ORF Upregulation hp1452 Downregulation hp1480 hp1494 hp1495 hp1563 hp1627

Table S5.3 Wolinella succinogenes DSMZ 1740 genes regulated under higher oxygen tensions. Regulation ORF Regulation ORF Upregulation ws0008 Downregulation ws0006 ws0009 ws0110 ws0030 ws0172 ws0065 ws0334 ws0072 ws0346 ws0116 ws0573 ws0117 ws0587 ws0120 ws0591 ws0171 ws0593 ws0228 ws0612 ws0329 ws0660 ws0395 ws0661 ws0463 ws0689 ws0464 ws0691 ws0468 ws0749 ws0549 ws0764 ws0595 ws0765 ws0598 ws0785 ws0621 ws0854 ws0663 ws0855 ws0684 ws0856 ws0708 ws0858 ws0730 ws0955 ws0732 ws0977 ws0735 ws0983 ws0742 ws0985 ws0859 ws0991 ws0970 ws1001 ws1054 ws1007 ws1143 ws1036 ws1144 ws1062 ws1145 ws1078 ws1146 ws1110 ws1147 ws1138 ws1188 ws1193 ws1262 ws1213 ws1299 ws1232 ws1368 ws1240 ws1433 ws1256 ws1445 ws1276 ws1497 ws1290 ws1587 ws1321 ws1592 ws1326 ws1679 ws1342 ws1691 ws1408 ws1694 ws1409 ws1696 ws1454 ws1700 ws1549 ws1701 ws1583 ws1703 ws1606

Regulation ORF Regulation ORF Upregulation ws1704 Downregulation ws1611 ws1705 ws1637 ws1706 ws1768 ws1707 ws1808 ws1709 ws1809 ws1710 ws1829 ws1711 ws1830 ws1712 ws1884 ws1713 ws1923 ws1714 ws1953 ws1715 ws2027 ws1716 ws2143 ws1744 ws2172 ws1760 ws2200 ws1761 ws2202 ws1801 ws2223 ws1817 ws1849 ws1850 ws1864 ws1872 ws1873 ws1904 ws1911 ws1957 ws1991 ws1995 ws2105 ws2137 ws2149 ws2205 ws2206 ws2226

Table S7.1 Numbers of proteins containing CXXC, CXXS and CXXT motifs in 281 organisms.

Organism Group # Proteins CXXC CXXS CXXT Agrobacterium tumefaciens str. C58 Alphaproteobacteria 5402 308 727 653 Anaplasma marginale str. St. Maries Alphaproteobacteria 949 169 352 223 Bartonella henselae str. Houston-1 Alphaproteobacteria 1488 118 261 223 Bartonella quintana str. Toulouse Alphaproteobacteria 1142 97 217 193 Bradyrhizobium japonicum USDA 110 Alphaproteobacteria 8317 597 1253 1117 Brucella abortus biovar 1 str. 9-941 Alphaproteobacteria 3085 200 361 365 Brucella melitensis 16M Alphaproteobacteria 3198 227 413 401 Brucella suis 1330 Alphaproteobacteria 3264 210 390 386 Candidatus Pelagibacter ubique HTCC1062 Alphaproteobacteria 1354 110 238 195 Caulobacter crescentus CB15 Alphaproteobacteria 3737 215 448 395 Ehrlichia canis str. Jake Alphaproteobacteria 925 136 304 180 Ehrlichia ruminantium str. Gardel Alphaproteobacteria 950 119 298 220 Ehrlichia ruminantium str. Welgevonden Alphaproteobacteria 958 120 290 216 Gluconobacter oxydans 621H Alphaproteobacteria 2664 225 467 417 Mesorhizobium loti MAFF303099 Alphaproteobacteria 7275 448 963 878 Nitrobacter winogradskyi Nb-255 Alphaproteobacteria 3122 211 418 327 Rhodobacter sphaeroides 2.4.1 Alphaproteobacteria 4126 333 517 548 Rhodopseudomonas palustris CGA009 Alphaproteobacteria 4814 350 659 595 Rickettsia conorii str. Malish 7 Alphaproteobacteria 1374 89 211 165 Rickettsia felis URRWXCal2 Alphaproteobacteria 1512 94 241 193 Rickettsia prowazekii str. Madrid E Alphaproteobacteria 834 72 185 146 Rickettsia typhi str. Wilmington Alphaproteobacteria 838 76 181 142 Silicibacter pomeroyi DSS-3 Alphaproteobacteria 4252 370 607 621 Sinorhizobium meliloti 1021 Alphaproteobacteria 3341 213 384 439 Wolbachia endosymbiont of Drosophila melanogaster Alphaproteobacteria 1195 110 264 187 Wolbachia endosymbiont strain TRS of Brugia malayi Alphaproteobacteria 805 86 177 128 Zymomonas mobilis subsp. mobilis ZM4 Alphaproteobacteria 1998 139 288 211

Organism Group # Proteins CXXC CXXS CXXT Azoarcus sp. EbN1 Betaproteobacteria 4599 508 812 712 Bordetella bronchiseptica RB50 Betaproteobacteria 4994 336 668 635 Bordetella parapertussis 12822 Betaproteobacteria 4185 311 564 544 Bordetella pertussis Tohama I Betaproteobacteria 3447 236 401 426 Burkholderia mallei ATCC 23344 Betaproteobacteria 4764 443 730 593 Burkholderia pseudomallei 1710b Betaproteobacteria 6347 628 1173 983 Burkholderia pseudomallei K96243 Betaproteobacteria 5729 468 849 798 Burkholderia sp. 383 Betaproteobacteria 7717 568 1175 1093 Chromobacterium violaceum ATCC 12472 Betaproteobacteria 4407 348 695 511 Dechloromonas aromatica RCB Betaproteobacteria 4171 471 663 573 Neisseria gonorrhoeae FA 1090 Betaproteobacteria 2002 182 312 270 Neisseria meningitidis MC58 Betaproteobacteria 2079 189 307 292 Neisseria meningitidis Z2491 Betaproteobacteria 2065 177 288 282 Nitrosomonas europaea ATCC 19718 Betaproteobacteria 2461 243 374 373 Ralstonia eutropha JMP134 Betaproteobacteria 6446 540 975 959 Ralstonia solanacearum GMI1000 Betaproteobacteria 3440 283 434 494 Thiobacillus denitrificans ATCC 25259 Betaproteobacteria 2827 325 354 358 Bdellovibrio bacteriovorus HD100 Deltaproteobacteria 3583 273 663 527 Desulfotalea psychrophila LSv54 Deltaproteobacteria 3236 495 748 594 Desulfovibrio desulfuricans G20 Deltaproteobacteria 3775 609 778 724 Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough Deltaproteobacteria 3379 568 641 641 Geobacter metallireducens GS-15 Deltaproteobacteria 3532 614 657 590 Geobacter sulfurreducens PCA Deltaproteobacteria 3445 583 606 525 Pelobacter carbinolicus DSM 2380 Deltaproteobacteria 3118 505 656 579 Arcobacter butzleri RM4018 Epsilonproteobacteria 2320 248 322 242 Campylobacter coli RM2228 Epsilonproteobacteria 1822 234 369 208 Campylobacter jejuni RM1221 Epsilonproteobacteria 1794 223 337 192 Campylobacter jejuni subsp. jejuni NCTC 11168 Epsilonproteobacteria 1598 226 324 182 Campylobacter lari RM2100 Epsilonproteobacteria 1534 206 316 197 Campylobacter upsaliensis RM3195 Epsilonproteobacteria 1802 218 338 206

A10

Organism Group # Proteins CXXC CXXS CXXT Helicobacter hepaticus ATCC 51449 Epsilonproteobacteria 1875 239 396 270 Helicobacter pylori 26695 Epsilonproteobacteria 1566 149 294 193 Helicobacter pylori J99 Epsilonproteobacteria 1491 160 284 192 Thiomicrospira denitrificans ATCC 33889 Epsilonproteobacteria 2097 249 359 233 Wolinella succinogenes DSM 1740 Epsilonproteobacteria 2044 263 327 211 Acinetobacter sp. ADP1 Gammaproteobacteria 3325 240 547 480 Buchnera aphidicola str. APS (Acyrthosiphon pisum) Gammaproteobacteria 574 55 141 96 Buchnera aphidicola str. Bp (Baizongia pistaciae) Gammaproteobacteria 504 54 136 105 Buchnera aphidicola str. Sg (Schizaphis graminum) Gammaproteobacteria 546 55 124 92 Candidatus Blochmannia floridanus Gammaproteobacteria 583 74 161 115 Candidatus Blochmannia pennsylvanicus str. BPEN Gammaproteobacteria 610 70 164 113 Colwellia psychrerythraea 34H Gammaproteobacteria 4910 422 848 731 Coxiella burnetii RSA 493 Gammaproteobacteria 2009 134 310 277 Erwinia carotovora subsp. atroseptica SCRI1043 Gammaproteobacteria 4472 378 764 659 Escherichia coli CFT073 Gammaproteobacteria 5379 494 970 855 Escherichia coli K12 MG1655 Gammaproteobacteria 4237 409 731 686 Escherichia coli K12 W3110 Gammaproteobacteria 4390 416 743 692 Escherichia coli O157:H7 Gammaproteobacteria 5341 518 877 841 Escherichia coli O157:H7 EDL933 Gammaproteobacteria 5324 497 888 848 Francisella tularensis subsp. tularensis SCHU S4 Gammaproteobacteria 1603 126 302 254 Haemophilus ducreyi 35000HP Gammaproteobacteria 1717 157 260 227 Haemophilus influenzae 86-028NP Gammaproteobacteria 1791 159 271 232 Haemophilus influenzae Rd KW20 Gammaproteobacteria 1657 151 250 219 Idiomarina loihiensis L2TR Gammaproteobacteria 2628 219 385 343 Legionella pneumophila str. Lens Gammaproteobacteria 2934 248 596 494 Legionella pneumophila str. Paris Gammaproteobacteria 3166 265 631 529 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 Gammaproteobacteria 2942 254 621 492 Mannheimia succiniciproducens MBEL55E Gammaproteobacteria 2384 201 326 316 Methylococcus capsulatus str. Bath Gammaproteobacteria 2960 350 500 450 Nitrosococcus oceani ATCC 19707 Gammaproteobacteria 3017 295 461 401

A11

Organism Group # Proteins CXXC CXXS CXXT Pasteurella multocida subsp. multocida str. Pm70 Gammaproteobacteria 2014 187 345 325 Photobacterium profundum SS9 Gammaproteobacteria 5480 471 1056 911 Photorhabdus luminescens subsp. laumondii TTO1 Gammaproteobacteria 4683 356 881 737 Pseudoalteromonas haloplanktis TAC125 Gammaproteobacteria 3486 286 600 514 Pseudomonas aeruginosa PAO1 Gammaproteobacteria 5567 459 833 657 Pseudomonas fluorescens Pf-5 Gammaproteobacteria 6137 463 1082 786 Pseudomonas fluorescens PfO-1 Gammaproteobacteria 5736 434 890 767 Pseudomonas putida KT2440 Gammaproteobacteria 5350 461 870 706 Pseudomonas syringae pv. phaseolicola 1448A Gammaproteobacteria 5169 369 869 679 Pseudomonas syringae pv. syringae B728a Gammaproteobacteria 5090 378 859 718 Pseudomonas syringae pv. tomato str. DC3000 Gammaproteobacteria 5607 446 945 772 Psychrobacter arcticus 273-4 Gammaproteobacteria 2120 195 317 302 Salmonella enterica subsp. enterica serovar Choleraesuis SC-B67 Gammaproteobacteria 4666 431 786 712 Salmonella enterica subsp. enterica serovar Paratyphi ATCC9150 Gammaproteobacteria 4093 385 678 627 Salmonella enterica subsp. enterica serovar Typhi Ty2 Gammaproteobacteria 4318 385 713 675 Salmonella enterica subsp. enterica serovar Typhi str. CT18 Gammaproteobacteria 4395 393 724 689 Salmonella typhimurium LT2 Gammaproteobacteria 4451 422 755 697 Shewanella oneidensis MR-1 Gammaproteobacteria 4778 419 798 637 Shigella flexneri 2a str. 2457T Gammaproteobacteria 4068 456 719 677 Shigella flexneri 2a str. 301 Gammaproteobacteria 4180 461 752 690 Shigella sonnei Ss046 Gammaproteobacteria 4461 398 741 654 Thiomicrospira crunogena XCL-2 Gammaproteobacteria 2192 184 320 265 Vibrio cholerae O1 biovar eltor str. N16961 Gammaproteobacteria 3835 307 640 534 Vibrio fischeri ES114 Gammaproteobacteria 3802 314 677 605 Vibrio parahaemolyticus RIMD 2210633 Gammaproteobacteria 4832 384 843 688 Vibrio vulnificus CMCP6 Gammaproteobacteria 4488 345 750 657 Vibrio vulnificus YJ016 Gammaproteobacteria 5024 395 872 767 Wigglesworthia glossinidia endosymbiont of G.brevipalpis Gammaproteobacteria 611 56 146 83 Xanthomonas axonopodis pv. citri str. 306 Gammaproteobacteria 4312 337 664 560 Xanthomonas campestris pv. campestris str. 8004 Gammaproteobacteria 4273 307 587 549

A12

Organism Group # Proteins CXXC CXXS CXXT Xanthomonas campestris pv. campestris str. ATCC 33913 Gammaproteobacteria 4181 302 580 558 Xanthomonas campestris pv. vesicatoria str. 85-10 Gammaproteobacteria 4726 377 709 579 Xanthomonas oryzae pv. oryzae KACC10331 Gammaproteobacteria 4637 519 854 701 Xylella fastidiosa 9a5c Gammaproteobacteria 2766 242 490 382 Xylella fastidiosa Temecula1 Gammaproteobacteria 2036 175 366 321 Yersinia pestis CO92 Gammaproteobacteria 3885 286 630 517 Yersinia pestis KIM Gammaproteobacteria 4202 296 732 565 Yersinia pestis biovar Medievalis str. 91001 Gammaproteobacteria 4142 304 723 552 Yersinia pseudotuberculosis IP 32953 Gammaproteobacteria 4038 295 664 557 Bacillus anthracis str. 'Ames Ancestor' Firmicutes 5617 377 642 617 Bacillus anthracis str. Ames Firmicutes 5311 357 621 587 Bacillus anthracis str. Sterne Firmicutes 5287 361 656 607 Bacillus cereus ATCC 10987 Firmicutes 5844 407 696 654 Bacillus cereus ATCC 14579 Firmicutes 5255 362 638 607 Bacillus cereus E33L Firmicutes 5641 389 704 677 Bacillus clausii KSM-K16 Firmicutes 4096 256 461 466 Bacillus halodurans C-125 Firmicutes 4066 298 428 422 Bacillus licheniformis ATCC 14580 Firmicutes 4161 280 504 455 Bacillus subtilis subsp. subtilis str. 168 Firmicutes 4105 266 515 481 Bacillus thuringiensis serovar konkukian str. 97-27 Firmicutes 5117 352 623 590 Carboxydothermus hydrogenoformans Z-2901 Firmicutes 2620 379 259 261 Clostridium acetobutylicum ATCC 824 Firmicutes 3848 450 754 579 Clostridium perfringens str. 13 Firmicutes 2660 322 488 365 Clostridium tetani E88 Firmicutes 2373 271 463 398 Enterococcus faecalis V583 Firmicutes 3113 190 284 309 Geobacillus kaustophilus HTA426 Firmicutes 3540 298 399 423 Lactobacillus acidophilus NCFM Firmicutes 1864 87 163 144 Lactobacillus johnsonii NCC 533 Firmicutes 1821 93 170 156 Lactobacillus plantarum WCFS1 Firmicutes 3009 138 239 275 Lactobacillus sakei subsp. sakei 23K Firmicutes 1880 97 110 147

A13

Organism Group # Proteins CXXC CXXS CXXT Lactococcus lactis subsp. lactis Il1403 Firmicutes 2321 123 183 171 Listeria innocua Clip11262 Firmicutes 2968 167 272 285 Listeria monocytogenes EGD-e Firmicutes 2846 156 281 276 Listeria monocytogenes str. 4b F2365 Firmicutes 2821 153 275 269 Mesoplasma florum L1 Firmicutes 683 51 90 74 Mycoplasma gallisepticum R Firmicutes 726 44 84 80 Mycoplasma genitalium G37 Firmicutes 484 36 75 64 Mycoplasma hyopneumoniae 232 Firmicutes 691 31 80 41 Mycoplasma hyopneumoniae 7448 Firmicutes 663 34 74 38 Mycoplasma hyopneumoniae J Firmicutes 665 32 71 36 Mycoplasma mobile 163K Firmicutes 633 28 45 38 Mycoplasma mycoides subsp. mycoides SC str. PG1 Firmicutes 1016 46 157 132 Mycoplasma penetrans HF-2 Firmicutes 1037 66 160 149 Mycoplasma pneumoniae M129 Firmicutes 689 48 91 84 Mycoplasma pulmonis UAB CTIP Firmicutes 782 30 55 50 Mycoplasma synoviae 53 Firmicutes 672 35 66 42 Oceanobacillus iheyensis HTE831 Firmicutes 3496 214 336 318 Onion yellows phytoplasma OY-M Firmicutes 754 72 89 105 Staphylococcus aureus subsp. aureus COL Firmicutes 2618 155 261 237 Staphylococcus aureus subsp. aureus MRSA252 Firmicutes 2656 167 269 245 Staphylococcus aureus subsp. aureus MSSA476 Firmicutes 2598 158 257 239 Staphylococcus aureus subsp. aureus MW2 Firmicutes 2632 157 257 237 Staphylococcus aureus subsp. aureus Mu50 Firmicutes 2731 174 286 260 Staphylococcus aureus subsp. aureus N315 Firmicutes 2619 170 273 246 Staphylococcus epidermidis ATCC 12228 Firmicutes 2419 152 217 239 Staphylococcus epidermidis RP62A Firmicutes 2526 156 234 261 Staphylococcus haemolyticus JCSC1435 Firmicutes 2676 204 284 251 Staphylococcus saprophyticus ATCC 15305 Firmicutes 2514 152 236 226 Streptococcus agalactiae 2603V/R Firmicutes 2124 121 203 181 Streptococcus agalactiae A909 Firmicutes 1996 123 200 166

A14

Organism Group # Proteins CXXC CXXS CXXT Streptococcus agalactiae NEM316 Firmicutes 2094 112 211 174 Streptococcus mutans UA159 Firmicutes 1960 112 178 149 Streptococcus pneumoniae R6 Firmicutes 2043 116 182 180 Streptococcus pneumoniae TIGR4 Firmicutes 2094 114 183 183 Streptococcus pyogenes M1 GAS Firmicutes 1697 104 165 167 Streptococcus pyogenes MGAS10394 Firmicutes 1886 122 178 191 Streptococcus pyogenes MGAS315 Firmicutes 1865 109 168 174 Streptococcus pyogenes MGAS5005 Firmicutes 1865 108 173 176 Streptococcus pyogenes MGAS6180 Firmicutes 1894 109 185 192 Streptococcus pyogenes MGAS8232 Firmicutes 1845 113 171 188 Streptococcus pyogenes SSI-1 Firmicutes 1861 109 165 167 Streptococcus thermophilus CNRZ1066 Firmicutes 1915 108 189 142 Streptococcus thermophilus LMG 18311 Firmicutes 1889 109 185 138 Thermoanaerobacter tengcongensis MB4 Firmicutes 2588 278 257 248 Ureaplasma parvum serovar 3 str. ATCC 700970 Firmicutes 614 44 82 66 Bifidobacterium longum NCC2705 Actinobacteria 1729 134 317 287 Corynebacterium diphtheriae NCTC 13129 Actinobacteria 2320 149 336 362 Corynebacterium efficiens YS-314 Actinobacteria 2950 170 380 371 Corynebacterium glutamicum ATCC 13032 Actinobacteria 2993 151 316 325 Corynebacterium jeikeium K411 Actinobacteria 2137 143 269 279 Leifsonia xyli subsp. xyli str. CTCB07 Actinobacteria 2030 107 185 173 Mycobacterium avium subsp. paratuberculosis K-10 Actinobacteria 4350 272 630 613 Mycobacterium bovis AF2122/97 Actinobacteria 3920 281 556 589 Mycobacterium leprae TN Actinobacteria 1605 127 272 282 Mycobacterium tuberculosis CDC1551 Actinobacteria 4189 296 611 629 Mycobacterium tuberculosis H37Rv Actinobacteria 3918 270 553 599 Nocardia farcinica IFM 10152 Actinobacteria 5936 384 606 756 Propionibacterium acnes KPA171202 Actinobacteria 2297 219 411 437 Streptomyces avermitilis MA-4680 Actinobacteria 7671 543 1009 1057 Streptomyces coelicolor A3(2) Actinobacteria 7897 508 863 1017

A15

Organism Group # Proteins CXXC CXXS CXXT Symbiobacterium thermophilum IAM 14863 Actinobacteria 3337 324 363 418 Thermobifida fusca YX Actinobacteria 3110 226 405 395 Tropheryma whipplei TW08/27 Actinobacteria 783 72 185 148 Tropheryma whipplei str. Twist Actinobacteria 808 83 196 159 Aquifex aeolicus VF5 Aquificae 1553 217 159 143 Bacteroides fragilis NCTC 9343 Bacteroidetes/Chlorobi 4236 457 1004 900 Bacteroides fragilis YCH46 Bacteroidetes/Chlorobi 4625 510 1106 921 Bacteroides thetaiotaomicron VPI-5482 Bacteroidetes/Chlorobi 4778 504 1241 1070 Chlorobium chlorochromatii CaD3 Bacteroidetes/Chlorobi 2002 249 390 366 Chlorobium tepidum TLS Bacteroidetes/Chlorobi 2252 246 395 320 Pelodictyon luteolum DSM 273 Bacteroidetes/Chlorobi 2083 245 361 300 Porphyromonas gingivalis W83 Bacteroidetes/Chlorobi 1909 201 380 312 Chlamydia muridarum Nigg Chlamydiae/Verrucomicrobia 911 148 306 206 Chlamydia trachomatis A/HAR-13 Chlamydiae/Verrucomicrobia 919 136 290 210 Chlamydia trachomatis D/UW-3/CX Chlamydiae/Verrucomicrobia 895 137 284 208 Chlamydophila abortus S26/3 Chlamydiae/Verrucomicrobia 932 138 288 231 Chlamydophila caviae GPIC Chlamydiae/Verrucomicrobia 1005 149 303 238 Chlamydophila pneumoniae AR39 Chlamydiae/Verrucomicrobia 1112 145 323 262 Chlamydophila pneumoniae CWL029 Chlamydiae/Verrucomicrobia 1052 141 320 260 Chlamydophila pneumoniae J138 Chlamydiae/Verrucomicrobia 1069 142 324 265 Chlamydophila pneumoniae TW-183 Chlamydiae/Verrucomicrobia 1113 143 336 268 Parachlamydia sp. UWE25 Chlamydiae/Verrucomicrobia 2031 206 423 346 Dehalococcoides ethenogenes 195 Chloroflexi 1580 287 317 266 Dehalococcoides sp. CBDB1 Chloroflexi 1458 285 276 266 Anabaena variabilis ATCC 29413 Cyanobacteria 5657 511 980 839 Gloeobacter violaceus PCC 7421 Cyanobacteria 4430 398 705 577 Nostoc sp. PCC 7120 Cyanobacteria 5366 455 843 746 Prochlorococcus marinus str. MIT 9312 Cyanobacteria 1809 150 345 261 Prochlorococcus marinus str. MIT 9313 Cyanobacteria 2265 211 454 362 Prochlorococcus marinus str. NATL2A Cyanobacteria 1890 144 389 247

A16

Organism Group # Proteins CXXC CXXS CXXT Prochlorococcus marinus subsp. marinus str. CCMP1375 Cyanobacteria 1882 159 371 266 Prochlorococcus marinus subsp. pastoris str. CCMP1986 Cyanobacteria 1712 140 343 251 Synechococcus elongatus PCC 6301 Cyanobacteria 2525 253 441 381 Synechococcus sp. CC9605 Cyanobacteria 2638 240 513 395 Synechococcus sp. CC9902 Cyanobacteria 2304 205 455 368 Synechococcus sp. WH 8102 Cyanobacteria 2517 234 463 379 Synechocystis sp. PCC 6803 Cyanobacteria 3169 270 528 479 Thermosynechococcus elongatus BP-1 Cyanobacteria 2475 290 379 382 Deinococcus radiodurans R1 Deinococcus-Thermus 2997 230 314 321 Thermus thermophilus HB27 Deinococcus-Thermus 2210 179 94 127 Thermus thermophilus HB8 Deinococcus-Thermus 2238 172 94 124 Fusobacterium nucleatum subsp. nucleatum ATCC 25586 Fusobacteria 2068 152 259 237 Rhodopirellula baltica SH 1 Planctomycetes 7325 860 1765 1397 Borrelia burgdorferi B31 Spirochaetes 922 59 121 75 Borrelia garinii PBi Spirochaetes 932 62 125 70 Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130 Spirochaetes 3658 304 657 431 Leptospira interrogans serovar Lai str. 56601 Spirochaetes 4727 308 728 466 Treponema denticola ATCC 35405 Spirochaetes 2767 276 507 404 Treponema pallidum subsp. pallidum str. Nichols Spirochaetes 1031 197 324 285 Thermotoga maritima MSB8 Thermotogae 1846 211 200 201

Aeropyrum pernix K1 Crenarchaeota 2694 237 431 250 Pyrobaculum aerophilum str. IM2 Crenarchaeota 2605 291 260 230 Sulfolobus acidocaldarius DSM 639 Crenarchaeota 2223 253 212 152 Sulfolobus solfataricus P2 Crenarchaeota 2977 327 278 210 Sulfolobus tokodaii str. 7 Crenarchaeota 2826 308 284 218 Archaeoglobus fulgidus DSM 4304 Euryarchaeota 2407 402 346 308 Haloarcula marismortui ATCC 43049 Euryarchaeota 4240 466 463 531 Halobacterium sp. NRC-1 Euryarchaeota 2605 298 259 305 Methanocaldococcus jannaschii DSM 2661 Euryarchaeota 1715 293 268 217

A17

Organism Group # Proteins CXXC CXXS CXXT Methanococcus maripaludis S2 Euryarchaeota 1722 305 337 304 Methanopyrus kandleri AV19 Euryarchaeota 1687 323 242 295 Methanosarcina acetivorans C2A Euryarchaeota 4540 710 954 685 Methanosarcina barkeri str. fusaro Euryarchaeota 3625 572 722 529 Methanosarcina mazei Go1 Euryarchaeota 3371 536 626 518 Methanothermobacter thermautotrophicus str. Delta H Euryarchaeota 1869 326 301 248 Natronomonas pharaonis DSM 2160 Euryarchaeota 2822 378 287 361 Picrophilus torridus DSM 9790 Euryarchaeota 1535 154 170 114 Pyrococcus abyssi GE5 Euryarchaeota 1765 222 146 111 Pyrococcus furiosus DSM 3638 Euryarchaeota 2065 260 156 144 Pyrococcus horikoshii OT3 Euryarchaeota 2064 225 231 147 Thermococcus kodakarensis KOD1 Euryarchaeota 2306 258 151 154 Thermoplasma acidophilum DSM 1728 Euryarchaeota 1478 169 168 105 Thermoplasma volcanium GSS1 Euryarchaeota 1526 172 161 105 Nanoarchaeum equitans Kin4-M Nanoarchaeota 536 71 36 39

A18