Page 1 of 603 Diabetes
Identification of sucrose non-fermenting related kinase (SNRK) as a suppressor of adipocyte inflammation
Yujie Li1,2, Yaohui Nie1,3, Ynes Helou4, Guoxian Ding2, Bin Feng1, Gang Xu3, Arthur Salomon5,6, Haiyan Xu1,7
1 Hallett Center for Diabetes and Endocrinology, Rhode Island Hospital, Warren Alpert Medical School of Brown University, Providence, RI 02903 2 Department of Geriatric Endocrinology, Jiangsu Province Hospital, Nanjing Medical University, Nanjing, China 3 Department of Medicine and Therapeutics, The Chinese University of Hong Kong, The Prince of Wales Hospital, Shatin, Hong Kong SAR, China 4 Department of Molecular Pharmacology and Physiology, Brown University, Providence, RI 02903 5 Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI 02903 6 Department of Chemistry, Brown University, Providence, RI 02903 7 Pathobiology Program, Brown University, Providence, RI 02903
Running title: SNRK and adipocyte inflammation
Correspondence to be addressed to: Haiyan Xu MD, PhD, Hallett Center for Diabetes and Endocrinology, Rhode Island Hospital, Warren Alpert Medical School of Brown University, 55 Claverick St., Rm 318, Providence, RI 02903, Tel: 401 444 0347; Fax: 401 444 3784; E mail: [email protected]
Word count: 4302 Tables: 2 Figures: 6 Supplementary tables: 3 Supplementary figures: 0
1
Diabetes Publish Ahead of Print, published online March 21, 2013 Diabetes Page 2 of 603
ABSTRACT
In this study, the role of sucrose non fermenting related kinase (SNRK) in white adipocyte biology was investigated. SNRK is abundantly expressed in adipose tissue and the expression level is decreased in obese mice. SNRK expression is repressed by inflammatory signals but increased by insulin sensitizer in cultured adipocytes. In vivo, adipose tissue SNRK expression can be decreased by lipid injection but enhanced by macrophage ablation. Knocking down SNRK in cultured adipocytes activates both JNK and IKKβ pathways as well as promotes lipolysis. Insulin stimulated Akt phosphorylation and glucose uptake are impaired in SNRK knockdown adipocytes. Phosphoproteomic analysis with SNRK knock down adipocytes revealed significantly decreased phosphorylation of 49 proteins by 25% or more, which are involved in various aspects of adipocyte function with a clear indication of attenuated mTORC1 signaling. Phosphorylation of 43 proteins is significantly increased by 1 fold or higher, among which several proteins are known to be involved in inflammatory pathways. The inflammatory responses in SNRK knock down adipocytes can be partially attributable to defective mTORC1 signaling since rapamycin treatment activates IKKβ and induces lipolysis in adipocytes. In summary, SNRK may act as a suppressor of adipocyte inflammation and its presence is necessary for maintaining normal adipocyte function.
2 Page 3 of 603 Diabetes
INTRODUCTION
Sedentary lifestyle and excessive energy intake have caused obesity epidemics. Extensive studies
have demonstrated that obesity related insulin resistance and type 2 diabetes are associated with a
low degree of inflammation in adipose tissue (1). Obese adipose tissue secretes a variety of
inflammatory markers, cytokines and chemokines at elevated levels. Some of these factors, such
as TNFα, IL 6, IL 1β and MCP 1, have been reported to impair insulin signaling (2 5).
Dysregulation of adipocyte lipolysis, induced by increased expression of adipose inflammatory
cytokines, contributes to systemic insulin resistance through elevated circulating free fatty acid
(FFA) levels. Multiple types of immune cells have been identified to regulate inflammatory
pathways in obese adipose tissue, such as macrophages, neutrophils, T cells and mast cells (6; 7).
Potent anti inflammatory effects, such as suppression of adipose macrophage gene expression in
vitro and in vivo and inhibition of proinflammatory mononuclear cells, have been reported for the
only class of insulin sensitizer thiozolidinediones (8 11). Curbing inflammation of obese patients
with salsalate, a prodrug of salicylate for treating arthritis, has been reported to improve glycemic
control (12). These results indicate that obesity related adipose inflammation plays an important
role for the development of insulin resistance. However, the molecular pathways involved in the
development of adipose inflammation in response to over nutrition are not fully understood.
Being the most extensively studied member of the family, AMPK has been described as a master
energy sensing enzyme activated by increased AMP/ATP ratio. Activation of AMPK turns on
catabolic pathways that generate ATP while switching off ATP consuming anabolic pathways.
Recent studies also indicate an anti inflammatory role for AMPKα1 in macrophages through
diminishing inflammasome formation and activation of SIRT1 (13; 14). Extensive research
efforts have established a clear role for AMPK in energy metabolism in muscle, liver and
macrophages. In contrast, limited and contradictory information is available on the role of AMPK
3 Diabetes Page 4 of 603
in adipocytes. AMPK phosphorylates Ser565 of hormone sensitive lipase (HSL), which was proposed to exert an anti lipolytic effect through preventing phosphorylation of Ser563 by protein
kinase A (PKA) (15). However, the significance of this mechanism has been questioned because
of the recent finding that Ser 563 is not essential for HSL activation (16). In addition, both pro
and anti lipolytic effects have been described for AMPK in adipocytes (17; 18). Although the
AMPK activator AICAR stimulates glucose uptake in both muscle cells and adipocytes, AMPK
only appears to mediate AICAR induced glucose uptake in muscle cells, not in adipocytes (19).
AMPKα2 knockout mice have unchanged fat mass despite impaired glucose tolerance when fed
on a normal chow diet, suggesting that AMPKα2 is not important for energy metabolism in
adipose tissue of normal mice (20). Interestingly, AMPKα2 knockout mice develop adipocyte
hypertrophy when fed on a high fat diet, indicating that AMPKα2 may be able to prevent excess
lipogenesis in states of nutrition surplus (21). However, it is unclear whether this is due to the
deficiency of AMPKα2 in adipocyte or due to the secondary effects of AMPKα2 deficiency in liver or muscle because AMPKα2 is expressed at a low level in fat. AMPKα1 has been reported
to be the major isoform of AMPK in adipose tissue yet global AMPKα1 knock out mice derived
from the same founders were reported to increase adiposity from one laboratory and decrease
adiposity from another (18; 22). These results raise questions regarding the importance of
AMPKα1 in adipocyte function.
The biological functions of many AMPK related family members have not been clearly defined.
In this study, we describe the potential role of an AMPK related kinase, sucrose non fermenting
related kinase (SNRK), as a potential suppressor of inflammation in adipocytes. As a family
member of AMPK related kinases, the function of SNRK has not been previously studied in
adipose tissue. SNRK was initially cloned from fat cell cDNA library (23). The N terminus
catalytic domain has a low homology to AMPKα but the non catalytic domain is unique (23).
4 Page 5 of 603 Diabetes
SNRK can be activated by LKB1, the same upstream kinase that activates AMPK (24). Gene
knockdown study in zebrafish indicates that SNRK may play a role in angioblast development
(25; 26). A recent study reported that SNRK inhibits colon cancer cell proliferation (27). It is
worthy to note that SNRK is a completely different protein from sucrose non fermenting AMPK
related kinase (SNARK), which is also a member of the AMPK/SNF1 family and can be
activated by LKB1(28; 29).
5 Diabetes Page 6 of 603
RESEARCH DESIGN AND METHODS
Cells, reagents, and treatments. 3T3 L1 cells were obtained from American Type Tissue
Culture Collection. 3T3 L1 CAR cells, a 3T3 L1 subline stably expressing the truncated
adenovirus receptor, were provided by Dr. David Orlicky (University of Colorado Health
Sciences Center) (30). Preadipocytes were differentiated as previously described (31). Free fatty acid mixture, dexamethasone, insulin, and IBMX were purchased from Sigma. Liposyn II was purchased from Webster Veterinary. JNK, ACC and IKKβ antibodies were purchased from
Santa Cruz Biotechnology. Phospho JNK and phospho IKKβ antibodies were purchased from
Cell Signaling Technology. SNRK antibody was purchased from University of Dundee (24).
Tubulin antibody was purchased from Abcam. Phospho ACC antibody was purchased from
Millipore. LC3 antibody was purchased from Novus Biologicals. Raptor expression constructs
and antibodies were provided by Dr. Diane Finger (University of Michigan Medical School).
Clodronate liposomes were purchased from clodronateliposomes.org (Vrije Universiteit,
Netherlands) as previously described (32). Stable isotope labeling with amino acids in cell
culture (SILAC) medium was purchased from Thermo Scientific. Rapamycin was purchased
from Calbiochem. Adenoviruses expressing inducible myr Akt1 and the tetracycline
transactivator (tTA) were purchased from Cell Biolabs Inc.
Mouse models. Male ob/ob mice and littermate controls were purchased from The Jackson
Laboratory. These mice were fed standard chow and sacrificed at 9 weeks of age for tissue
collection. For DIO mice, C57BL/6J mice were purchased from The Jackson Laboratory at 3
weeks of age, acclimated for a week and fed on either a chow diet (5% Kcal from fat) or a high
fat diet (60% Kcal from fat, D12492, Research Diets Inc.) for up to 20 weeks. For macrophage
ablation experiment, mice were injected with clodronate liposomes at the dose of 110mg/kg. At
the end of the study, mice were sacrificed by CO2 inhalation and epididymal fat pads were
6 Page 7 of 603 Diabetes
collected. All animal experiments were approved by the Institutional Animal Care and Use
Committee of Rhode Island Hospital.
Isolation of primary adipocytes. Epididymal white fat pads from DIO mice were excised,
weighed, and rinsed in isolation buffer. Fat pads were then cut into small pieces in isolation
buffer supplemented with 1mg/ml type I collegenase and digested at 37°C in shaking water bath
at 100 rpm for 45 min. Digested tissues were filtered through 400 M mesh to get single cell
suspension. After centrifugation, floating adipocytes were rinsed twice with isolation buffer.
Adenovirus construction. To construct adenoviral vector for mouse SNRK, the coding sequence
was amplified by PCR, cloned into the entry vector and sequence confirmed. The coding
sequence was then recombined into the Gateway based pAd CMV DESTTM vector (Invitrogen)
according to the manufacturer’s instructions. To construct adenoviral vector for short hairpin
interfering RNA against SNRK, six short hairpin oligonucleotides and complementary strands
were designed to target SNRK and ligated into the Gateway based pENTR/U6 vector (Invitrogen)
and recombined into the BLOCK iTTM RNAi system after sequence confirmation. As a negative
control, adenovirus expressing shGFP was used as previously described (33). Amplification of
recombinant adenovirus was performed according to the manufacturer’s instructions using HEK
293A cells.
RNA isolation and real time PCR analysis. RNA samples were extracted using the TRIZOL
reagent. Gene expression was measured using real time PCR analysis. Random hexamers were
used for reverse transcription. Real time PCR analysis was performed in a 15 l reaction on 96
well clear plate using Power SYBR Green RT PCR Reagents Kit on ABI Prism thermal cycler
model StepOnePlus. The relative mRNA expression levels were normalized to expression of β
actin or 28S rRNA. The sequences of primers are shown in supplemental table 1.
7 Diabetes Page 8 of 603
Immunoprecipitation and western-blot analysis. To immunoprecipitate endogenous SNRK
from adipose tissue, thirty microliters of A/G plus matrix (Santa Cruz Biotechnology) slurry were
used to preclear 1mg protein lysates at 4°C for 30 min. Then 3 g of SNRK antibody was added for 1h followed by forty microliters of A/G plus matrix slurry for overnight incubation at 4ºC. For immunoblot analysis, immunoprecipitated protein or one hundred micrograms of protein lysates from each sample were used. Following PAGE on 4 12% gel (Bio Rad Laboratories), the resolved proteins were transferred onto PVDF membranes. Membranes were blocked in 1%
BSA/1x TBST or 5% milk/1xTBST for 1hr then incubated with the appropriate primary antibodies in the presence of 1% BSA/1x TBST or 5% milk/1xTBST followed by incubation with appropriate horseradish peroxidase linked secondary antibodies for 1hr in 5% milk/ 1x TBST.
Protein bands were detected by ECL western blotting detection reagent (Perkin Elmer).
Phosphoproteomic study. 3T3 L1 CAR preadipocytes were cultured in SILAC medium for eight doublings and then seeded on 6 well plates for differentiation in SILAC medium. Half of the cells were labeled with light arginine and lysine and infected with adenovirus expressing shSNRK. The other half were labeled with heavy arginine and lysine and infected with adenovirus expressing shGFP. For each sample, 2.5mg of light arginine and lysine labeled protein lysates were mixed with 2.5mg of heavy arginine and lysine labeled protein lysates.
Samples were reduced with 45mM DTT at 60ºC for 20 minutes, alkylated with 100mM iodoacetimide for 15 min in the dark, and digested overnight with TPCK treated trypsin. Peptides were then desalted using Sep Pak C18 columns and enriched for phosphopeptides using
Titansphere Phos Tio kit before loading to Orbitrap Velos ETD mass spectrometer. Results from four biological replicates were used for data analysis. Q values for multiple hypothesis tests
8 Page 9 of 603 Diabetes
were also calculated based on the determined p values using the R package QVALUE as
previously described (34).
Statistical analysis. Student T test was used to analyze experiments involving two groups. Two
way ANOVA and Bonferroni posttests were used to analyze multiple experimental groups. Error
bars represent mean ± standard errors.
9 Diabetes Page 10 of 603
RESULTS
Expression and regulation patterns of SNRK in adipocyte and adipose tissue. By studying
tissue distribution patterns of more than 300 human kinases including all family members of
AMPK/SNF1 related kinases, SNRK gene was found to be abundantly and predominantly
expressed in white adipose tissue in human and in both white and brown adipose tissue in mouse
(Figure 1A B). SNRK protein expression pattern confirmed its predominant presence in adipose
tissue (Figure 1C). AMPKα1 has been shown to be the major isoform of AMPK in adipose tissue
(18). However, the relative mRNA expression level of SNRK is 74% higher than that of
AMPKα1 in human white adipose tissue and 2.1 fold higher than that of AMPKα1 in mouse adipose tissue. Expression levels of AMPKα2 are very low in both human and mouse adipose
tissue, supporting the hypothesis that AMPKα2 may not play an important role in adipocyte
energy metabolism. SNRK has a nuclear localization signal and has been shown to be localized in
nucleus of cultured rat cerebellar granule neurons by immunohistochemistry (35). To localize
SNRK in adipocyte, SNRK GFP fusion protein was expressed via adenoviral mediated gene
transfer and reveals a large overlapping with lysosomal tracker (Figure 1D), indicating that
SNRK may have different cellular localization patterns in different cell types. SNRK expression
in white adipose tissue is significantly reduced in both ob/ob and DIO mice at both mRNA and protein levels (Figure 2A C). Further analysis indicates that the decrease of SNRK gene expression in adipose tissue of DIO mice occurs in adipocyte, not in stromal vascular cells
(Figure 2D). Interestingly, SNRK mRNA and protein levels can be induced by fasting in adipose tissue of lean mice but this regulation is lost in DIO mice (Figure 2A and 2C, bottom graphs), suggesting that SNRK may be involved in regulating metabolism in response to fasting in lean mice.
10 Page 11 of 603 Diabetes
It is well established that FFA release and production of inflammatory factors are increased in
adipose tissue of obese state, which contribute to the development of insulin resistance and
hyperglycemia. To explore whether these factors are potentially responsible for down regulating
SNRK expression in adipose tissue, free fatty acids and proinflammatory factor TNFα were used
to treat cultured adipocytes. As shown in figure 3A B, SNRK gene expression was significantly
reduced by treatment with both FFA and TNFα, indicating that activation of inflammatory
pathways suppresses SNRK expression. The constitutively active form of IκB kinase β (IKKβ
SE), a master kinase that turns on transcription of many inflammatory genes, was also over
expressed in 3T3 L1 CAR adipocytes by adenovirus mediated gene transfer. IKKβ SE
significantly repressed SNRK gene expression (Figure 3C). In addition, significantly decreased
SNRK gene expression is observed in isolated adipocytes prepared from lean mice treated with
intravenous injection of liposyn II (Figure 3D), suggesting that the decreased SNRK expression in
obese adipose tissue is likely due to the occurrence of obesity induced adipose inflammation
and/or lipid toxicity. In contrast, treatment with rosiglitazone, an insulin sensitizer with potent
anti inflammation effect, increased SNRK gene expression in cultured adipocytes (Figure 3E).
Ablation of adipose macrophages, an important source of inflammatory factors in obesity, by
clodronate liposomes significantly increased SNRK gene expression in adipose tissue of DIO
mice (Figure 3F). Further experiments confirmed that SNRK protein expression levels are also
decreased by inflammatory signals and increased by rosiglitazone in cultured adipocytes (Figure
3G J).
Effect of SNRK knockdown in cultured adipocytes. To understand the function of SNRK,
adenovirus mediated short hairpin interfering RNA was used to knock down SNRK expression in
3T3 L1 CAR adipocytes. Expression levels of SNRK mRNA and protein were significantly
reduced by interfering RNA against SNRK compared to control adipocytes expressing interfering
11 Diabetes Page 12 of 603
RNA against GFP (Figure 4A). Reduction of SNRK expression in 3T3 L1 CAR adipocytes
activated IKKβ and JNK pathways as shown by increased phosphorylation (Figure 4B), which is
accompanied by increased basal lipolysis as reflected by elevated glycerol release (Figure 4C).
Consistent with activation of inflammatory pathways, markedly increased expression levels of proinflammatory cytokines, including TNFα and IL 6, were observed in SNRK knockdown 3T3
L1 CAR adipocytes compared to control cells (Figure 4D F). TNFα is a potent inducer of lipolysis, which may contribute to increased lipolysis. It has been previously reported that multiple monocyte chemotactic factors are upregulated in adipose tissue and adipocytes of diet induced obese mice (31). Reduction of SNRK expression in cultured adipocytes also led to increased gene expression of three monocyte chemotactic factors, MCP 1, MCP 2 and MCP 3, indicating that decreased SNRK expression in adipocytes may potentially enhance macrophage infiltration in obesity. Reduced SNRK expression also increased expression of chop gene. In contrast, mRNA expression levels of insulin responsive glucose transporter 4 (glut4) and insulin sensitizing adiponectin are significantly decreased upon SNRK knockdown (Figure 4G). Insulin stimulated Akt phosphorylation on Ser473 and glucose uptake are significantly reduced (Figure
4H I). Expression levels of very long chain acyl coA dehydrogenase (VLACAD) and medium chain acyl coA dehydrogenase (MACAD) are also significantly reduced in SNRK knockdown adipocytes, suggesting impaired fatty acid oxidation. Furthermore, Atg12 gene was significantly decreased, suggesting deficiency in autophagy.
Effect of SNRK knockdown on protein phosphorylation in cultured adipocytes. To get a broad understanding regarding the function of SNRK in adipocytes and the downstream signaling events, a quantitative phosphoproteomic approach was used to evaluate changes of global phosphorylation in SNRK knockdown adipocytes compared to control adipocytes expressing shGFP. To ensure accurate comparison, the stable isotope labeling with amino acids in cell
12 Page 13 of 603 Diabetes
culture (SILAC) method was used. SNRK knockdown adipocytes were labeled with light (12C or
14N) arginine and lysine whereas control adipocytes were labeled with heavy (13C or 15N)
arginine and lysine. All peptide sequence assignments were filtered down to 1% false discovery
rate by a logistic spectral score (36). Results shown in supplemental Tables 2 and 3 are the
statistically significant (q value < 0.05) average peak ratios of light versus heavy amino acids
from four biological replicates. Reduction of SNRK expression in adipocytes significantly
reduced signals of 55 phosphopeptides by 25% or more, which are derived from 49 proteins
involved in various aspects of cell function (Table 1), including transcription, mRNA processing,
translation, glucose and lipid metabolism, and cytoskeleton. Most of the phosphosites have not
been functionally annotated but reduced phosphorylation occurs in factors normally required for
transcription initiation, RNA processing and protein synthesis. Interestingly, several components
of mTORC1 signaling pathway have reduced phosphorylation, including regulatory associated
protein of mTOR (raptor) on Ser863, programmed cell death protein 4 (PDCD4) on Thr93 and
Ser94, insulin receptor substrate 1 (IRS 1) on Ser1097 and proline rich Akt1 substrate 1
(PRAS40) on Thr247. Phosphorylation on Ser863 of raptor activates mTORC1 signaling (37).
Ser1097 of IRS1 is reported to be a site for S6K phosphorylation (38). PRAS40 inhibits mTOR
signaling and Akt phosphorylates PRAS 40 on Thr247 to relieve the inhibition. Decreased
phosphorylation on raptor Ser863, IRS1 Ser1097 and PRAS40 Thr247 indicates attenuated
mTOR signaling. Phosphorylation of acetyl CoA carboxylase 1 (ACC1), a well characterized
AMPK substrate, is decreased on Ser29 which is an uncharacterized site. In addition, SNRK
knockdown also decreased phosphorylation of several enzymes involved in glucose and lipid
metabolism, including mitochondrial phosphoenolpyruvate carboxykinase, mitochondrial
pyruvate carboxylase, patatin like phospholipase domain containing protein 2, ATP citrate lyase,
oxysterol binding protein and oxysterol binding protein related protein 11.
13 Diabetes Page 14 of 603
Reduction of SNRK expression in adipocytes also significantly increased signals of 55 phospho peptides by one fold or more, which are derived from 43 proteins (Table 2). These proteins also affect various aspects of adipocyte function. Distinct from the dataset of decreased phosphorylation, several proteins involved in inflammatory pathways have increased phosphorylation. Among these proteins, caspase recruitment domain family member 6 (Card6), interferon induced helicase C domain containing protein 1 (IFIH1), Z DNA binding protein 1
(ZBP1) and receptor interacting serine/threonine protein kinase 2 (RIPK2) are known to activate
NF κB transcription factors, the substrate of IKKβ. Interferon induced double stranded RNA activated protein kinase (PRKRA) has been characterized as a critical component of an inflammatory complex that activates JNK and IKKβ pathways and induces insulin resistance
(39). Phosphorylation levels of multiple sites of protein PML, a potent growth suppressor and proapoptotic factor, are significantly increased. In addition, increased phosphorylation occurs in proteins normally involved in repression of transcription (Trim 28, Ifi204 and HDGF), promotion of mRNA degradation (IFIH1, Patl1) and inhibition of protein synthesis (PRKRA).
Phosphorylation also increases in proteins involved in hydrolysis of glycerophospholipids
(phospholipase A2 on Ser437) and triglycerides (perilipin on Ser81, a PKA phosphorylation site), consistent with observed increase of basal lipolysis. Phosphorylation on Ser358 of SIK2 increased 15 fold, a site that has been reported to be phosphorylated by PKA in response to forskolin and CL316,243 in adipocytes (40).
Effect of SNRK over-expression in hepatocytes. Despite successful SNRK knock down in 3T3
L1 CAR adipocytes, SNRK protein can not be over expressed at a high level in this cell type despite hugely over expressed SNRK mRNA but SNRK GFP fusion protein could be expressed at a low level that is observable under fluorescence microscope. One possibility is that the C terminal of SNRK contains two regions of PEST rich sequences, which are motifs indicative of
14 Page 15 of 603 Diabetes
rapid protein turn over (23). In addition, there may be a mechanism in adipocytes to limit SNRK
overload due to abundantly expressed endogenous SNRK protein in this cell type. We therefore
used a liver cell line to examine whether SNRK over expression can increase phosphorylation of
raptor and ACC. As shown in figure 5A, SNRK protein was over expressed in Fao hepatoma
cells and significantly increased phosphorylation of ACC on serine 79 (an AMPK
phosphorylation site) and raptor on serine 863. SNRK kinase assay confirmed that over expressed
SNRK is active in hepatoma cells (Figure 5B). To determine whether raptor and SNRK exist in
the same protein complex, raptor and SNRK were co expressed in 293A cells.
Immunoprecipitation of SNRK brought down raptor as evidenced by immunoblot analysis
(Figure 5C). SNRK over expression also suppressed Chop gene expression (Figure 5D),
consistent with increased chop gene expression in SNRK knockdown adipocytes. Interestingly,
SNRK over expression significantly increased LC3II/LC3I ratio under fed condition when treated
with chloroquine and rapamycin and under fasted condition when treated with rapamycin,
indicating activation of autophagy (Figure 5E).
mTOR pathway and adipocyte inflammation. The effects of SNRK on autophagy and
ACC/raptor phosphorylation were further confirmed in adipocytes. In SNRK knock down
adipocytes, both LC3I and LC3II have been significantly reduced after normalization to tubulin
control but LC3II/LC3I ratio was not affected (Figure 6A). Reduction of SNRK also significantly
reduced phosphorylation levels of raptor S863 and ACC S79. Defective autophagy has been
linked to induction of inflammation and may be partially responsible for the inflammatory
phenotype in adipocytes with reduced SNRK expression. In addition, phospho proteomic study
revealed many potential downstream targets of SNRK. The mTORC1 pathway stood out due to
decreased phosphorylation of several components. To explore whether defective mTOR signaling
pathway contributes to adipocyte inflammation, 3T3 L1 adipocytes were treated with rapamycin
and examined for activations of JNK and IKKβ pathways, lipolysis and expression of
15 Diabetes Page 16 of 603
inflammatory cytokines. Treatment with rapamycin increased phosphorylation of IKKβ but not
JNK and stimulated lipolysis (Figure 6B C). Gene expression levels of proinflammatory factors
IL 6, MCP 1 and MCP 3 are also significantly up regulated (Figure 6D). Consistent with these
results, activation of mTOR signaling by over expressing the constitutively active Akt1 (myr
Akt) repressed lipolysis and decreased expression of proinflammatory factors (figure 6E F).
These data indicate that defective mTOR signaling in SNRK knockdown adipocytes maybe partially responsible for the inflammatory phenotype and other pathways are likely involved since
JNK is not activated by rapamycin treatment.
16 Page 17 of 603 Diabetes
DISCUSSION
The underlying molecular mechanism responsible for origination of inflammation in adipocyte
upon over nutrition is still not fully understood. In this study, we identified SNRK as a potential
suppressor of adipocyte inflammation and hypothesize that decreased SNRK expression in
adipose tissue may contribute to the development of adipose inflammation commonly observed in
obesity. AMPKα has been reported to repress inflammation in macrophages and polarize
macrophages to an anti inflammatory phenotype (13; 14; 41). AMPKα1 deficient bone marrow
macrophages are proinflammatory and are sufficient to induce insulin resistance when
transplanted to irradiated wild type mice upon high fat diet feeding (22). In addition, AMPKα
activity is decreased in adipose tissue of obese and insulin resistant humans (42), suggesting that
AMPKα is potentially another candidate for suppressing obesity induced adipose tissue
inflammation. However, further experiments are necessary to elucidate the anti inflammatory role
of AMPKα in adipose tissue to determine the site of action since literature data are mostly done
in macrophages. Despite the fact that AMPKα1 is the major isoform in adipocytes, contradictory
phenotypes of AMPKα1 global knock out mice have been reported. Zhang et al showed that
deficiency of AMPKα1 increases adipocyte size and adipose mass in vivo and AMPKα1
knockdown adipocytes are proinflammatory but accumulate more lipids (22). In contrast, Daval
et al reported that absence of AMPKα1 reduces adipocyte size and adipose mass, possibly
attributed to increased lipolysis (18). Interestingly, both laboratories obtained AMPKα1 knock
out mice from the same source.
It will be interesting to determine whether SNRK and AMPKα have redundant roles in
suppressing inflammatory responses in adipocytes. In our study, AMPKα expression levels were
not changed in SNRK knockdown adipocytes and SNRK antibody does not cross react with
17 Diabetes Page 18 of 603
AMPKα even under the condition of over expression (data not shown), indicating that SNRK likely functions independent of AMPKα. This is the first study to elucidate the role of SNRK in adipocyte biology, which is a protein with very little available literature information regarding its function. Phosphoproteomic analysis revealed increased phosphorylation levels of several additional inflammatory proteins in SNRK knockdown adipocytes, many of them are known to activate the NF κB pathway. These results suggest that the presence of SNRK in adipocytes is necessary to inhibit inflammatory responses. When SNRK expression is reduced, activation of inflammatory pathways leads to increased lipolysis, impairs insulin signaling, and reduces insulin stimulated glucose uptake.
Interestingly, phosphoproteomic analysis reveals attenuation of mTOR signaling pathway in
SNRK knockdown adipocytes. Phosphorylation of raptor ser863 is critical to activate mTOR
(37). We demonstrated that SNRK interacts with raptor and phosphorylates raptor on Ser863, suggesting that raptor maybe a target of SNRK. In adipocytes, treatment with rapamycin elicited weak inflammatory responses as reflected by IKKβ activation, increased expression of proinflammatory factors and elevated lipolysis. However, the extent of IKKβ activation and fold of increase in proinflammatory gene expression are milder than those observed in SNRK knockdown adipocytes, indicating that impairment in mTOR signaling pathway is most likely partially responsible for the effects elicited by reduced SNRK expression. The role of mTOR in linking nutrient sensing and obesity is complex depending on the tissue examined. In adipocytes, acute inhibition of mTOR signaling by rapamycin increases insulin stimulated glucose uptake but chronic rapamycin treatment impairs insulin stimulated glucose uptake by reducing Akt2 activation despite improved PI3K activation (43). Mice with adipose tissue specific raptor deficiency are protected from diet induced obesity and have increased energy expenditure (44).
However, it is unclear whether adipose inflammation has been examined. Several transgenic
18 Page 19 of 603 Diabetes
models with over expression of components in the inflammatory pathway prior to obesity
development also display reduced adiposity (45 47). However, it is well established that adipose
inflammation and impairment of energy homeostasis co exist in obesity.
Another potential mechanism to explain increased inflammation in SNRK knockdown adipocytes
is defective autophagy. Autophagy has been demonstrated to play a role in repressing adipocyte
inflammation (48). Our data indicate that SNRK is localized to lysosomes in adipocyte, an
important site for degradation of large intracellular organelles or protein aggregates through
autophagy. In addition, our results support a role of SNRK in promoting autophagy. The potential
role of SNRK in linking over nutrition and activation of inflammatory pathways as well as
impairment of energy metabolism in adipocytes requires further investigation. Loss of function in
vivo study in the near future will provide more useful information regarding the role of SNRK in
obesity induced adipose inflammation. In addition to the inflammatory pathway, the global
phosphoproteomic study also provided evidence to show that SNRK has profound effects on
adipocyte biology and impacts multiple pathways that are common to most cell types, such as
transcription, translation and mRNA processing. The overall changes in protein phosphorylation
patterns suggest a role for SNRK in maintaining normal cell growth and function.
19 Diabetes Page 20 of 603
ACKNOWLEDGMENTS
We want to thank Dr. Diane Finger (University of Michigan Medical School) for providing expression constructs of raptor and raptor S863A, as well as phospho raptor and raptor antibodies. This work was supported by the scientist development grant from American Heart Association 0830190N and NIDDK R01 DK 080746 awarded to HX. The authors declare that no conflict of interest exists. YL, YN,YH and BF performed experiments, analyzed data and contributed to the writing of the manuscript; GD, GX and AS were involved in experimental design, data analysis and manuscript writing H.X. designed and supervised experiments, drafted and finalized the manuscript. Dr. Haiyan Xu is the guarantor of this work, had full access to all the data, and takes full responsibility for the integrity of data and the accuracy of data analysis.
REFERENCES
1. Hotamisligil GS: Inflammation and metabolic disorders. Nature 444:860 867, 2006 2. Hotamisligil GS, Murray DL, Choy LN, Spiegelman BM: Tumor necrosis factor alpha inhibits signaling from the insulin receptor. Proc Natl Acad Sci U S A 91:4854 4858, 1994 3. Rotter V, Nagaev I, Smith U: Interleukin 6 (IL 6) induces insulin resistance in 3T3 L1 adipocytes and is, like IL 8 and tumor necrosis factor alpha, overexpressed in human fat cells from insulin resistant subjects. J Biol Chem 278:45777 45784, 2003 4. Tack CJ, Stienstra R, Joosten LA, Netea MG: Inflammation links excess fat to insulin resistance: the role of the interleukin 1 family. Immunol Rev 249:239 252, 2012 5. Sartipy P, Loskutoff DJ: Monocyte chemoattractant protein 1 in obesity and insulin resistance. Proc Natl Acad Sci U S A 100:7265 7270, 2003 6. Schipper HS, Prakken B, Kalkhoven E, Boes M: Adipose tissue resident immune cells: key players in immunometabolism. Trends Endocrinol Metab 23:407 415, 2012 7. Sun S, Ji Y, Kersten S, Qi L: Mechanisms of inflammatory responses in obese adipose tissue. Annu Rev Nutr 32:261 286, 2012 8. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK: The peroxisome proliferator activated receptor gamma is a negative regulator of macrophage activation. Nature 391:79 82, 1998 9. Li AC, Brown KK, Silvestre MJ, Willson TM, Palinski W, Glass CK: Peroxisome proliferator activated receptor gamma ligands inhibit development of atherosclerosis in LDL receptor deficient mice. J Clin Invest 106:523 531, 2000 10. Ghanim H, Garg R, Aljada A, Mohanty P, Kumbkarni Y, Assian E, Hamouda W, Dandona P: Suppression of nuclear factor kappaB and stimulation of inhibitor kappaB by troglitazone: evidence for an anti inflammatory effect and a potential antiatherosclerotic effect in the obese. J Clin Endocrinol Metab 86:1306 1312, 2001 11. Mohanty P, Aljada A, Ghanim H, Hofmeyer D, Tripathy D, Syed T, Al Haddad W, Dhindsa S, Dandona P: Evidence for a potent antiinflammatory effect of rosiglitazone. J Clin Endocrinol Metab 89:2728 2735, 2004 12. Goldfine AB, Fonseca V, Jablonski KA, Pyle L, Staten MA, Shoelson SE: The effects of salsalate on glycemic control in patients with type 2 diabetes: a randomized trial. Ann Intern Med 152:346 357, 2010
20 Page 21 of 603 Diabetes
13. Wen H, Gris D, Lei Y, Jha S, Zhang L, Huang MT, Brickey WJ, Ting JP: Fatty acid induced NLRP3 ASC inflammasome activation interferes with insulin signaling. Nat Immunol 12:408 415, 2011 14. Yang Z, Kahn BB, Shi H, Xue BZ: Macrophage alpha1 AMP activated protein kinase (alpha1AMPK) antagonizes fatty acid induced inflammation through SIRT1. J Biol Chem 285:19051 19059, 2010 15. Garton AJ, Campbell DG, Carling D, Hardie DG, Colbran RJ, Yeaman SJ: Phosphorylation of bovine hormone sensitive lipase by the AMP activated protein kinase. A possible antilipolytic mechanism. Eur J Biochem 179:249 254, 1989 16. Anthonsen MW, Ronnstrand L, Wernstedt C, Degerman E, Holm C: Identification of novel phosphorylation sites in hormone sensitive lipase that are phosphorylated in response to isoproterenol and govern activation properties in vitro. J Biol Chem 273:215 221, 1998 17. Yin W, Mu J, Birnbaum MJ: Role of AMP activated protein kinase in cyclic AMP dependent lipolysis In 3T3 L1 adipocytes. J Biol Chem 278:43074 43080, 2003 18. Daval M, Diot Dupuy F, Bazin R, Hainault I, Viollet B, Vaulont S, Hajduch E, Ferre P, Foufelle F: Anti lipolytic action of AMP activated protein kinase in rodent adipocytes. J Biol Chem 280:25250 25257, 2005 19. Sakoda H, Ogihara T, Anai M, Fujishiro M, Ono H, Onishi Y, Katagiri H, Abe M, Fukushima Y, Shojima N, Inukai K, Kikuchi M, Oka Y, Asano T: Activation of AMPK is essential for AICAR induced glucose uptake by skeletal muscle but not adipocytes. Am J Physiol Endocrinol Metab 282:E1239 1244, 2002 20. Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R, Vaulont S: The AMP activated protein kinase alpha2 catalytic subunit controls whole body insulin sensitivity. J Clin Invest 111:91 98, 2003 21. Villena JA, Viollet B, Andreelli F, Kahn A, Vaulont S, Sul HS: Induced adiposity and adipocyte hypertrophy in mice lacking the AMP activated protein kinase alpha2 subunit. Diabetes 53:2242 2249, 2004 22. Zhang W, Zhang X, Wang H, Guo X, Li H, Wang Y, Xu X, Tan L, Mashek MT, Zhang C, Chen Y, Mashek DG, Foretz M, Zhu C, Zhou H, Liu X, Viollet B, Wu C, Huo Y: AMP Activated Protein Kinase alpha1 Protects Against Diet Induced Insulin Resistance and Obesity. Diabetes 61:3114 3125, 2012 23. Becker W, Heukelbach J, Kentrup H, Joost HG: Molecular cloning and characterization of a novel mammalian protein kinase harboring a homology domain that defines a subfamily of serine/threonine kinases. Eur J Biochem 235:736 743, 1996 24. Jaleel M, McBride A, Lizcano JM, Deak M, Toth R, Morrice NA, Alessi DR: Identification of the sucrose non fermenting related kinase SNRK, as a novel LKB1 substrate. FEBS Lett 579:1417 1423, 2005 25. Chun CZ, Kaur S, Samant GV, Wang L, Pramanik K, Garnaas MK, Li K, Field L, Mukhopadhyay D, Ramchandran R: Snrk 1 is involved in multiple steps of angioblast development and acts via notch signaling pathway in artery vein specification in vertebrates. Blood 113:1192 1199, 2009
21 Diabetes Page 22 of 603
26. Pramanik K, Chun CZ, Garnaas MK, Samant GV, Li K, Horswill MA, North PE, Ramchandran R: Dusp 5 and Snrk 1 coordinately function during vascular development and disease. Blood 113:1184 1191, 2009 27. Rines AK, Burke MA, Fernandez RP, Volpert OV, Ardehali H: Snf1 related kinase inhibits colon cancer cell proliferation through calcyclin binding protein dependent reduction of beta catenin. Faseb J, 2012 28. Koh HJ, Toyoda T, Fujii N, Jung MM, Rathod A, Middelbeek RJ, Lessard SJ, Treebak JT, Tsuchihara K, Esumi H, Richter EA, Wojtaszewski JF, Hirshman MF, Goodyear LJ: Sucrose nonfermenting AMPK related kinase (SNARK) mediates contraction stimulated glucose transport in mouse skeletal muscle. Proc Natl Acad Sci U S A 107:15541 15546, 2010 29. Rune A, Osler ME, Fritz T, Zierath JR: Regulation of skeletal muscle sucrose, non fermenting 1/AMP activated protein kinase related kinase (SNARK) by metabolic stress and diabetes. Diabetologia 52:2182 2189, 2009 30. Orlicky DJ, DeGregori J, Schaack J: Construction of stable coxsackievirus and adenovirus receptor expressing 3T3 L1 cells. J Lipid Res 42:910 915, 2001 31. Jiao P, Chen Q, Shah S, Du J, Tao B, Tzameli I, Yan W, Xu H: Obesity related upregulation of monocyte chemotactic factors in adipocytes: involvement of nuclear factor kappaB and c Jun NH2 terminal kinase pathways. Diabetes 58:104 115, 2009 32. Feng B, Jiao P, Nie Y, Kim T, Jun D, van Rooijen N, Yang Z, Xu H: Clodronate liposomes improve metabolic profile and reduce visceral adipose macrophage content in diet induced obese mice. PLoS One 6:e24358, 2011 33. Xu H, Wilcox D, Nguyen P, Voorbach M, Suhar T, Morgan SJ, An WF, Ge L, Green J, Wu Z, Gimeno RE, Reilly R, Jacobson PB, Collins CA, Landschulz K, Surowy T: Hepatic knockdown of mitochondrial GPAT1 in ob/ob mice improves metabolic profile. Biochem Biophys Res Commun 349:439 448, 2006 34. Storey JD, Tibshirani R: Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100:9440 9445, 2003 35. Yoshida K, Yamada M, Nishio C, Konishi A, Hatanaka H: SNRK, a member of the SNF1 family, is related to low K(+) induced apoptosis of cultured rat cerebellar granule neurons. Brain Res 873:274 282, 2000 36. Yu K, Sabelli A, DeKeukelaere L, Park R, Sindi S, Gatsonis CA, Salomon A: Integrated platform for manual and high throughput statistical validation of tandem mass spectra. Proteomics 9:3115 3125, 2009 37. Foster KG, Acosta Jaquez HA, Romeo Y, Ekim B, Soliman GA, Carriere A, Roux PP, Ballif BA, Fingar DC: Regulation of mTOR complex 1 (mTORC1) by raptor Ser863 and multisite phosphorylation. J Biol Chem 285:80 94, 2010 38. Zhang J, Gao Z, Yin J, Quon MJ, Ye J: S6K directly phosphorylates IRS 1 on Ser 270 to promote insulin resistance in response to TNF (alpha) signaling through IKK2. J Biol Chem 283:35375 35382, 2008 39. Nakamura T, Furuhashi M, Li P, Cao H, Tuncman G, Sonenberg N, Gorgun CZ, Hotamisligil GS: Double stranded RNA dependent protein kinase links pathogen sensing with stress and metabolic homeostasis. Cell 140:338 348, 2010 40. Henriksson E, Jones HA, Patel K, Peggie M, Morrice N, Sakamoto K, Goransson O: The AMPK related kinase SIK2 is regulated by cAMP via phosphorylation at Ser358 in adipocytes. Biochem J 444:503 514, 2012
22 Page 23 of 603 Diabetes
41. Sag D, Carling D, Stout RD, Suttles J: Adenosine 5' monophosphate activated protein kinase promotes macrophage polarization to an anti inflammatory functional phenotype. J Immunol 181:8633 8641, 2008 42. Xu XJ, Gauthier MS, Hess DT, Apovian CM, Cacicedo JM, Gokce N, Farb M, Valentine RJ, Ruderman NB: Insulin sensitive and resistant obesity in humans: AMPK activity, oxidative stress, and depot specific changes in gene expression in adipose tissue. J Lipid Res 53:792 801, 2012 43. Veilleux A, Houde VP, Bellmann K, Marette A: Chronic inhibition of the mTORC1/S6K1 pathway increases insulin induced PI3K activity but inhibits Akt2 and glucose transport stimulation in 3T3 L1 adipocytes. Mol Endocrinol 24:766 778, 2010 44. Polak P, Cybulski N, Feige JN, Auwerx J, Ruegg MA, Hall MN: Adipose specific knockout of raptor results in lean mice with enhanced mitochondrial respiration. Cell Metab 8:399 410, 2008 45. Xu H, Hirosumi J, Uysal KT, Guler AD, Hotamisligil GS: Exclusive action of transmembrane TNF alpha in adipose tissue leads to reduced adipose mass and local but not systemic insulin resistance. Endocrinology 143:1502 1511, 2002 46. Tang T, Zhang J, Yin J, Staszkiewicz J, Gawronska Kozak B, Jung DY, Ko HJ, Ong H, Kim JK, Mynatt R, Martin RJ, Keenan M, Gao Z, Ye J: Uncoupling of inflammation and insulin resistance by NF kappaB in transgenic mice through elevated energy expenditure. J Biol Chem 285:4637 4644, 2010 47. Jiao P, Feng B, Ma J, Nie Y, Paul E, Li Y, Xu H: Constitutive activation of IKKbeta in adipose tissue prevents diet induced obesity in mice. Endocrinology 153:154 165, 2012 48. Jansen HJ, van Essen P, Koenen T, Joosten LA, Netea MG, Tack CJ, Stienstra R: Autophagy activity is up regulated in adipose tissue of obese individuals and modulates proinflammatory cytokine expression. Endocrinology 153:5866 5874, 2012
23 Diabetes Page 24 of 603
FIGURE LEGENDS
Figure 1. Tissue distribution of SNRK and AMPKααα. A. Relative mRNA expression levels of SNRK, AMPKα1 and AMPKα2 in human tissues. RNA samples from pooled human tissues were purchased from Clonetech (stomach #636126, small intestine #636125, pancreas #636119, WAT #636162, lung #636105, heart #636113, testis #636115, liver #636101, kidney #636118, brain #636102, spleen #636121, skeletal muscle #636120). B. Relative mRNA expression levels of SNRK, AMPKα1 and AMPKα2 in mouse tissues. Tissues from four male C57BL/6 mice were pooled for RNA preparation. C. SNRK protein levels in mouse tissues. Tissues from four male C57BL/6 mice were pooled for protein preparation. SNRK was immunoprecipitated from 1mg of protein lysates. D. SNRK localization. The SNRK GFP fusion protein was expressed in 3T3 L1 CAR adipocytes via adenovirus mediated gene transfer. Forty eight hours after infection, adipocytes were stained with Lyso tracker (red, Invitrogen 10,000x stock #L 7528) for presence of lysosomes and DAPI (blue, final concentration at 1 g/ml)) for presence of nucleus during a 2h incubation. The images were overlayed and the orange color indicates overlapping of SNRK GFP and Lyso tracker. . Figure 2. Regulation of SNRK expression in adipose tissue. A. Regulation of SNRK gene expression in adipose tissue of ob/ob mice (top panel, n=5 per group) and high fat diet induced obese (DIO) mice (bottom panel, n=4 per group). B. Regulation of SNRK protein expression in adipose tissue of ob/ob mice (n=3 per group). C. Regulation of SNRK protein expression in adipose tissue of DIO mice (n=4 per group). D. Regulation of SNRK gene expression in adipocytes and stromal vascular cells isolated from chow fed and DIO mice (fat pads were pooled from 6 8 mice in each group). HF. High fat; SV, stromal vascular cells; Adi, adipocytes. * P<0.05. Error bars stand for mean± standard error.
Figure 3. Effect of proinflammatory signals on SNRK expression. A. Effect of FFA on SNRK gene expression in cultured adipocytes. FFA mixture (Sigma #F7050) was used at a final concentration of 0.25 M for 6h. B. Effect of TNFα on SNRK gene expression in cultured adipocytes. TNFα was used at a final concentration of 25ng/ml for 6h. C. Effect of over expressing the constitutively active IKKβ (IKKβ SE) on SNRK gene expression in L1 CAR adipocytes. D. Effect of intravenous lipid injection in lean mice on SNRK gene expression in isolated adipocytes. Epididymal fat pads were pooled from 3 mice in each group for adipocyte isolation 30 minutes after injection with liposyn II at 3ml/kg/h. E. Effect of rosiglitazone (Rosi) treatment on SNRK gene expression in cultured adipocytes. Rosiglitazone was used at a final concentration of 10 M for 6h. F. Effect of adipose tissue macrophage depletion on SNRK gene expression in lean and diet induced obese mice (n=4 each group). Mice were 23 weeks old and on HFD for 19 weeks. Clodronate or PBS liposomes were injected into peritoneal cavity at the dose of 110mg/kg. G. Effect of FFA on SNRK protein expression in cultured adipocytes. H. Effect of TNFα on SNRK protein expression in cultured adipocytes. I. Effect of over expressing IKKβ SE on SNRK protein expression in L1 CAR adipocytes. J. Effect of rosiglitazone treatment on SNRK protein expression in cultured adipocytes. * P<0.05. FFA, free fatty acid; Veh, vehicle; Lipid, liposyn II; PBS, PBS liposomes; Clod, clodronate liposomes; HFD, high fat diet; V, vehicle; F, FFA; T, TNFα; R, rosiglitazone. For cell based experiments, triplicate samples were used in gene expression and duplicate samples were used in protein expression. Results shown were representative from three independent experiments. Error bars stand for mean± standard error.
Figure 4. Effect of SNRK knockdown on adipocyte biology. A. SNRK knockdown by adenovirus mediated shRNA on mRNA (top panel) and protein (bottom panel) levels. B. Effect
24 Page 25 of 603 Diabetes
of SNRK knockdown on phosphorylation of IKKβ and JNK. C. Effect of SNRK knockdown on lipolysis. D. Effect of SNRK knockdown on expression of TNFα, IL 6, MCP 1, MCP 2, MCP 3 and Chop genes. E. Effect of SNRK knockdown on TNFα secretion. F. Effect of SNRK knockdown on IL6 secretion. G. Effect of SNRK knockdown on expression of Glut4, adiponectin (Adipo), very long chain acyl CoA dehydrogenase (VLACAD), medium chain acyl CoA dehydrogenase (MACAD) and Atg12 genes. H. Effect of SNRK knockdown on insulin stimulated Akt phosphorylation. I. Effect of SNRK knockdown on insulin stimulated glucose uptake. * P<0.05. Triplicate samples were used in each experiment. Results shown were representative from three independent experiments. Error bars stand for mean± standard error.
Figure 5. SNRK over-expression in hepatoma cells. A. SNRK over expression and phosphorylation on ACC and raptor. B. SNRK activity in hepatoma cells over expressing GFP or mouse SNRK. For kinase assay, SNRK was immunoprecipitated and incubated with the reaction mixture (200 M AMARA peptide, 1mM ATP, 10 ci γ 32P ATP, 10mM magnesium acetate, 50mM Tris.Cl, pH7.5, 0.1mM EGTA, and 0.1% v/v 2 mercaptoethanol) for 30 minutes at 30ºC in a shaking water bath. Reactions were then loaded on p81 filters. Radioactivities were counted after four washes with 0.5% phosphoric acid and once with water. Background activities were determined using IgG immunoprecipitated samples and subtracted from SNRK antibody immunoprecipitated samples. C. SNRK and raptor co IP in 293A cells. D. SNRK over expression and Chop gene expression. E. Effect of SNRK over expression on authophagy. * P<0.05, Ad SNRK infected hepatoma cells vs. Ad GFP infected hepatoma cells. Duplicate samples were used in western blots and triplicate samples were used in gene expression and kinase activity experiments. Results shown were representative from three independent experiments. Error bars stand for mean± standard error.
Figure 6. mTOR pathway and adipocyte inflammation A. SNRK knock down in 3T3 L1 CAR adipocyte and the effect on raptor and ACC phosphorylation. B. Rapamycin activates IKKβ in 3T3 L1 adipocytes. C. Rapamycin induces lipolysis in 3T3 L1 adipocytes. D. Rapamycin increases expression of proinflammatory factors. *P<0.05, shSNRK infected adipocytes vs. shGFP infected adipocytes, or rapamycin (Rapa) treated adipocytes vs vehicle (Veh) treated adipocytes. Duplicate samples were used in western blots and triplicate samples were used in gene expression and lipolysis experiments. E. Over expression of the constitutively active Akt1 (myr Akt) activates mTOR signaling. tTA, the tetracycline controlled transactivator. F. Over expression of myr Akt suppresses lipolysis. G. Over expression of myr Akt decreases expression of inflammatory genes. *P<0.05, cells expressing tTA plus myr Akt vs. cells expressing tTA alone. Error bars stand for mean± standard error.
Table 1. Phosphoproteins decreased by 25% or more in SNRK knockdown adipocytes. Experiments were done with four independent replicates and data was analyzed with ratio of mean.
Table 2. Phosphoproteins increased by one fold or more in SNRK knockdown adipocytes. Experiments were done with four independent replicates and data was analyzed with ratio of mean.
25 Diabetes Page 26 of 603
Table 1.
Symbol Name Phosphorylation KD/Control Q Value sites ratio for SILAC Insulin signaling/ protein synthesis/ amino acid metabolism RPTOR Regulatory associated protein of mTOR S863 0.25 0.031 PDCD4 Programmed cell death protein 4 T93, S94 0.26 0.010
IRS1 Insulin receptor substrate 1 S1097 0.29 0.030 PI4K2A Phosphatidylinositol 4 kinase type 2 alpha S47 0.45 0.025 PEA15 Astrocytic phosphoprotein PEA 15 S116 0.51 0.025
BCKDK 3 methyl 2 oxobutanoate dehydrogenase kinase, S33 0.67 0.029 mitochondrial AKT1S1 Proline rich AKT1 substrate 1 (PRAS40) T247 0.75 0.025 Transcription HDAC1 Histone deacetylase 1 S393 0.18 0.023 TCOF1 Treacle protein S1191 0.23 0.006 NF1 Nuclear factor 1 S265 0.66 0.040 PTRF Polymerase I and transcript release factor T198, S218 0.74 0.046 Messenger RNA processing SNRNP70 Snrnp 70 protein S81 0.11 0.026 SF1 Splicing factor 1 S80, S82 0.39 0.029 SCAF1 Splicing factor, arginine/serine rich 19 S676, S682 0.41 0.044 Smg9 Protein SMG9 S32 0.47 0.026 SRRM1 Serine/arginine repetitive matrix 1 S3 87, S391 0.47 0.011 CSTF3 Cleavage stimulation factor subunit 3 S691 0.56 0.039 G3BP2 Ras GTPase activating protein binding protein 2 T227 0.61 0.027 FIP1L1 Pre mRNA 3’ end processing factor FIP1 S479 0.66 0.031 Translation EEF1D Eef1d protein S128 0.38 0.022 Glucose and lipid metabolism Pck2 Phosphoenolpyruvate carboxykinase [GTP], S2 0.11 0.010 mitochondrial PC Pyruvate carboxylase, mitochondrial S19, S20 0.42 0.007 ACC1 Acetyl CoA carboxylase 1 S29 0.52 0.025 ATGL Patatin like phospholipase domain containing protein 2 S406 0.67 0.026 ATGL Patatin like phospholipase domain containing protein 2 S409 0.70 0.037 OSBP Oxysterol binding protein S188, S191 0.70 0.026 ACLY ATP citrate lyase S455 0.71 0.023 OSBPL11 Oxysterol binding protein related protein 11 S186 0.72 0.025 Cytoskeleton VCL Vinculin S290 0.00035 0.009 Sdccag8 Serologically defined colon cancer antigen 8 homolog T430, S438 0.0013 0.023 Mylk Myosin, light polypeptide kinase S611 0.013 0.023 Ppfia1 Ppfia1 protein T770 0.16 0.025 RABGAP1 Rab GTPase activating protein 1 S42 0.44 0.023 PXN Paxillin S321, S328 0.63 0.022 SH3PXD2A SH3 and PX domain containing protein 2A S420 0.67 0.025 Tpr Nuclear pore complex associated intranuclear coiled coil S2067 0.74 0.031 protein TPR Membrane trafficking PLVAP Plasmalemma vesicle associated protein S4 0.40 0.040 Tgoln1 Trans Golgi network integral membrane protein 1 S266, S267 0.56 0.035 Tgoln2 Trans Golgi network integral membrane protein 2 S277 0.63 0.016 TRAM1 Translocating chain associated membrane protein 1 S365 0.73 0.028 CANX Calnexin S563 0.75 0.037 Miscellaneous SSFA2 Sperm specific antigen 2 S90 0.11 0.022 SASH1 SAM and SH3 domain containing protein 1 S805 0.13 0.009 CLASP2 Clasp2 protein S376 0.45 0.042
26 Page 27 of 603 Diabetes
SDPR Serum deprivation response protein S363 0.49 0.029 THUMPD1 THUMP domain containing protein 1 S86, S88 0.50 0.030 HMOX1 Heme oxygenase 1 S174 0.57 0.047 FAM73B Protein FAM73B T208 0.68 0.011 BAG3 BAG family molecular chaperone regulator 3 S270, S274 0.69 0.034 LUC7I3 Luc7 like protein 3 S425, S431 0.71 0.044
27 Diabetes Page 28 of 603
Table 2 Symbol Name Phosphorylation KD/Control Q value for sites ratio SILAC Inflammatory pathways/ apoptosis Card 6 Caspase recruitment domain family, member S870, T873 687.5 0.0065 6 IFIH1 Inteferon induced helicase C domain S289 11.2 0.0397 containing protein 1 ZBP1 Z DNA binding protein 1 S384 7.5 0.0334 PML protein PML S515, T527, S528 4.8 0.0270 PML protein PML S514 4.5 0.0440 RIPK2 Receptor interacting serine/threonine protein S414 3.7 0.0372 kinase 2 SAMHD1 Sam domain and HD domain containing T21, S24, T29 2.6 0.0221 protein 1 H2 L H 2 class I histocompatibility antigen, L D S353, S356 2.3 0.0293 alpha chain SAMHD1 Sam domain and HD domain containing T25 2.2 0.0397 protein 1 Insulin signaling/ protein synthesis Sik2 Serine/threonine protein Kinase SIK2 S358 16.2 0.0095 PI4KB Phosphatidylinositol 4 kinase beta S511 7.2 0.0230 PRKRA Interferon induced double stranded RNA S32 4.7 0.0264 activated protein kinase Transcription/ messenger RNA processing /translation RBM 15 RNA binding motif protein 15 S655 6.8 0.0497 Trim28 Transcription intermediary factor 1 beta S473 3.5 0.0308 EIF4G3 Eukaryotic translation initiation factor 4 S267 2.9 0.0095 gamma 3 EIF4G1 Eukaryotic translation initiation factor 4 S1189 2.7 0.0434 gamma 1 RBM8A RNA binding protein 8A S56 2.7 0.0317 Ifi204 Interferon activable protein 204 T106 2.3 0.0331 INTS1 Integrator complex subunit 1 S1320, T1321, S1328, 2.3 0.0246 S1329 Srrm1 Serine/arginine repetitive matrix protein 1 S610, S612 2.3 0.0313 Patl1 Protein PAT1 homolog 1 S179 2.2 0.0120 NFIB Nuclear factor 1B type S328 2.0 0.0461 Glucose and lipid metabolism PLIN1 perilipin 1 S81 3.0 0.0366 PLA2G4B cytosolic phospholipase A2 S437 2.6 0.0230 Cytoskeleton/ scaffolding protein/ endocytosis/ exocytosis AaK1 AP 2 ssociated protein kinase 1 T618, S621 80.6 0.0065 AKAP13 Akap 13 A kinase anchor protein 13 S1910 4.1 0.0340 MAPT Microtubule associated protein S761 3.5 0.0289 CLASP1 CLIP associating protein 1 S600 3.5 0.0246 Sept2 Septin 2 S218 2.8 0.0308 ACTB Actin, cytoplasmic 1 S239 2.8 0.0441 Ctnnb1 Catenin beta 1 T556 2.4 0.0441 AP3D1 AP 3 complex subunit delta 1 S755, T758, S760 2.1 0.0230 Cell growth MEK5 Mitogen activated protein kinase kinase S433 3.5 0.0321 kinase kinase 5 HDGF Hepatoma derived growth factor S165 3.5 0.0332 Miscellaneous Likely ortholog of H. sapiens chromosome 9 T311 1030.4 0.0065 ORF 138 TNKS1BP1 182 kDa tankyrase 1 binding protein S429 5.5 0.0387 TMCC2 Transmembrane and coiled coil domains S435 5.5 0.0366 protein 2 Testis expressed gene 2 S195 5.5 0.0276 Arhgef17 Rho guanine nucleotide exchange factor 17 S458 3.2 0.0380 Myl12a MCG5400 T19, S20 3.0 0.0343 DCLK1 Dclk1 protein S330, S332, T336 2.9 0.0246 Tjp1 Tjp1 S617 2.9 0.0481
28 Page 29 of 603 Diabetes
Rplp2 ps1 MCG10050 S105 2.5 0.0246 Marcksl1 MARCKS related protein S104 2.2 0.0492 Nop58 NUcleolar protein 58 S509, S521 2.2 0.0366
29 Diabetes Page 30 of 603 Figure 1 A B 4.5 35 4.0 30 3.5 25 3.0 20 2.5 2.0 15 1.5 10
1.0 Mouse SNRK/28S 5 Human Human SNRK/28S 0.5 0 0.0 9 8 7
2.5 1/28S
6 2.0 5 4 1/28S
1.5 3 2 1.0 Mouse AMPK 1 0 0.5 20
Human Human AMPK 18 0.0 16 14 2/8S
12 14 10
12 8 6 10 4 2/28S
Mouse AMPK 2 8 0 6 BAT liver heart WAT WAT
4 brain Testis Testis spleen spleen kidney kidney stomach stomach Human Human AMPK pancreas 2 s. muscle S. intestine S. 0 C Nonspecific
liver SNRK Lung Lung heart WAT WAT brain Testis Testis spleen spleen kidney kidney stomach stomach pancreas s. muscle s. muscle
S. intestine S. Tubulin liver BAT heart WAT WAT brain Testis Testis spleen spleen kidney kidney stomach stomach pancreas s. muscle s. muscle S. intestine S. Page 31 of 603 Diabetes
D SNRK-GFP Lyso tracker
DAPI Merge Diabetes Page 32 of 603 Figure 2
A B 1.2 1.0 Lean Ob/ob 0.8
actin actin SNRK 0.6 * 0.4 Tubulin 0.2 SNRK/ SNRK/ 0.0 lean Ob/ob
2.5 16 14 * * 2.0 12
1.5 10 actin actin * 8 1.0 6 SNRK/ SNRK/ SNRK /Tubulin SNRK 4 0.5 2 * 0.0 0 Fed Fasted Fed Fasted lean Ob/ob Chow HF Page 33 of 603 Diabetes Figure 2
C D
2.5 * * 2.0 1.5 Chow fast Chow fed HFD fast HFD fed 1.0 SNRK SNRK/ 28S SNRK/ 0.5 0.0 Tubulin Chow HF Chow HF SV Adi
3.0 * * 2.5
2.0
1.5 *
1.0 SNRK /Tubulin SNRK 0.5
0.0 Fed Fasted Fed Fasted Chow HF Diabetes Page 34 of 603
Figure 3 A B C 1.2 1.2 1.2 1.0 1.0 1.0 0.8 0.8 0.8 -actin -actin -actin -actin 0.6 0.6 0.6 * 0.4 0.4 0.4 * SNRK/ SNRK/ SNRK/ SNRK / 0.2 * 0.2 0.2 0.0 0.0 0.0 Control FFA control TNF GFP IKKβ SE D E F 1.2 * 1.6 * 1.4 1.2 0.8 1.2 * actin 1.0 * -actin -actin
0.8 0.8 0.4 0.6 SNRK SNRK 28S/ 0.4 0.4 SNRK/ SNRK/
SNRK/ SNRK/ 0.2 0.0 0.0 0.0 Veh Lipid veh Rosi PBS Clod PBS Clod Chow HFD Page 35 of 603 Diabetes
Figure 3 G H
SNRK SNRK Tubulin Tubulin
V F V V F F V V T T V V T T
IgG SNRK Ab IgG SNRK Ab
I J
SNRK SNRK Tubulin Tubulin V V R R V V R R GFP IKKSE GFP GFP IKKSE IKKSE IgG SNRK Ab IgG SNRK Ab Diabetes Page 36 of 603 Figure 4 A B C pJNK 90 * 80 70 1.4 tJNK 60 1.2 50 1.0 pIKK g/mg protein) 40 0.8 30 0.6 tIKK 20 SNRK/28S 0.4 * 10 0.2 0 Tubulin Glycerol ( shGFP shSNRK 0.0 shGFP shSNRK shGFP shGFP
shSNRK shSNRK D shGFP E shSNRK
7 SNRK * * 1.2 6 * 1.0 * 5 0.8 Tubulin 4 * * 3 0.6 *
shGFP shSNRK 2 TNF(pg/ml) 0.4 1 0.2 0
Relative gene expression TNF IL-6 MCP-1 MCP-2 MCP-3 Chop 0.0 shGFP shSNRK Page 37 of 603 Diabetes Figure 4 continued
F G
12 1.2 * * * * * * 10 1.0 8 0.8 6 0.6
IL6 (pg/ml) IL6 (pg/ml) 4 0.4 2 0.2 0 0.0 Relative gene expression shGFP shSNRK Glut4 Adipo VLACAD MACAD Atg12
H I
140000 120000 pAkt * * 100000 S473 80000 60000 * Akt 40000 Cpm/mg proteinCpm/mg 20000 Tubulin 0 shGFP shSNRK shGFP shSNRK
shGFP shSNRK shGFP shSNRK Veh Insulin
Veh Insulin Figure 5 Diabetes Page 38 of 603 A B 1.2 * SNRK 1.0 0.8 140000 120000 * pACC 0.6 100000 (S79) 0.4 80000
pAcc/ACC pAcc/ACC 0.2
Cpm Cpm 60000 ACC 0.0 40000 Ad-GFP Ad-SNRK 20000 Tubulin 0 2.0 * -20000 1.8 p-Raptor 1.6 GFP SNRK (S863) 1.4 1.2 1.0 Raptor 0.8 0.6 0.4 Tublin pRaptor/Raptor 0.2 0.0 Ad-GFP Ad-SNRK Ad-GFP + + - - D 1200 * Ad-SNRK - - + + 1000 800 C 600 IP: SNRK; WS, SNRK 400 SNRK/28S IP: SNRK; WS, p-Raptor 200 IP, SNRK; WS, Raptor 0 GFP SNRK Vec + + - + + + + + + + + - - - - SNRK + - + ------+ + + + + + 1.2 Raptor WT - + + - - + + - - - - + + - - 1.0 Raptor S863A ------+ + - - - - + + 0.8 IgG SNRK Ab 0.6 * SNRK 0.4 Chop/28S pRaptor 0.2 Raptor 0.0 GFP SNRK
Input samples Input samples Tubulin Page 39 of 603 Diabetes Figure 5 Continued
E LC3-I 8 LC3-II 7 * 6 SNRK 5 4 * Fed Fed 3 Tubulin 2 1 0 Ratio of LC3II/LC3I GFP SNRK GFP SNRK GFP SNRK LC3-I Veh Chloroquine Rapamycin LC3-II SNRK 4.5 Fast 2hFast Tublin 4.0 3.5 3.0 Ad-GFP + + - - + + - - + + - - 2.5 * - - + + - - + + - - + + 2.0 Ad-SNRK 1.5 Vehicle + + + + ------1.0 0.5
Chloroquine - - - - + + + + - - - - Ratio of LC3II LC3I / 0.0 Rapamycin ------+ + + + GFP SNRK GFP SNRK GFP SNRK Veh Chloroquine Rapamycin Figure 6 Diabetes Page 40 of 603 A LC3-I 0.30 1.2 LC3-II 0.25 1.0 0.20 0.8 * Tublin 0.15 * 0.6 0.4 pRaptor 0.10 LC3I/Tubulin LC3I/Tubulin (S863) LC3II/Tubulin 0.05 0.2 0.00 0.0
Raptor 0.7 18 0.6 16 14 Tublin 0.5 12 0.4 10 0.3 8 * pACC 6 0.2 *
pACC/ACC pACC/ACC 4 (S79) pRaptor/raptor 0.1 2 0.0 0 ACC shGFP shSNRK shGFP shSNRK
Tublin
shGFP + + - - shSNRK - - + + FigurePage 41 of 6 603 conti Diabetes
B C D 2.0 * * pIKK 1.8 tIKK 250 1.6 * * 1.4 pJNK 200 1.2 1.0 150 JNK 0.8 100 0.6
pS6 g/mg protein) 50 0.4 Glycerol release (
Relative gene expression 0.2 Tubulin 0 0.0 Veh Rapa Veh Rapa Veh Rapa Veh Rapa Veh Rapa IL-6 MCP-1 MCP-3
E F G
Myr-Akt 1.4 60 Endogenous 1.2
Akt 50 1.0 pS6 40 0.8 * 30 0.6 * S6 20 0.4 g/mg g/mg protein)
* 0.2 Glycerol release ( 10
Tubulin 0 Relative gene expression 0.0 tTA tTA+ tTA + + + + + + myr-Akt Myr-Akt + + + IL-6 MCP-1 TNF Diabetes Page 42 of 603
Supplemental table 1. Sequences of real-time PCR primers
Genes Accession Forward primer Reverse primer number hSNRK NM_017719 ATGGCAGGATTTAAGCGAGGG ATGCCTGGCAAGTTTAACCAC hAMPKα1 NM_006251 GCAGTTGCCTACCATCTCATAAT GGGCTTGTCGCCAAATAGAAATC hAMPKα2 NM_006252 GTGAAGATCGGACACTACGTG CTGCCACTTTATGGCCTGTTA mSNRK NM_133741 TTTAGGCGAGGATATGATGGGA GTCCAGCTTCGTCTTGTCAAT mAMPKα1 NM_001013367 TTCGGGAAAGTGAAGGTGGG TTATGTCCGGTCAACTCGTGC mAMPKα2 NM_178143 ACAGGCCATAAAGTGGCAGTT AAAAGTCTGTCGGAGTGCTGA mTNFα NM_013693.2 GACCCTCACACTCAGATCATCTTCT CCACTTGGTGGTTTGCTACGA mIL-6 NM_031168 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC mMCP-1 NM_011333 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT mMCP-2 NM_021443 CCCTTCGGGTGCTGAAAAG CCACTTCTGTGTGGGGTCTAC mMCP-3 NM_013654 AGAAACAAAAGATCCCCAAGAGG CCAGGGACACCGACTACTG mChop NM_007837 CACGCACATCCCAAAGCC GGGCACTGACCACTCTGTT mGlut4 NM_009204 ACCGGATTCCATCCCACAAG TCCCAACCATTGAGAAATGATGC mAdiponectin NM_009605 TGTTCCTCTTAATCCTGCCCA CCAACCTGCACAAGTTCCCTT mVLACAD NM_017366 TCAGGTGTTCCCATACCCATC AAGGCGTCGTTCTTGGCAG mMACAD NM_007382 GATCGCAATGGGTGCTTTTGATAGAA AGCTGATTGGCAATGTCTCCAGCAAA mATG12 NM_026217 GGCCTCGGAACAGTTGTTTA CAGCACCGAAATGTCTCTGA 28S NR_003279.1 TTCACCAAGCGTTGGATTGTT TGTCTGAACCTGCGGTTCCT
Page 43 of 603 Diabetes
timecourse manual naming::protein name counter manual all protein name index 1959017 Vinculin Manual Assigned Name:Vinculin SwissPROT>VINC_MOUSE> Vinculin OS=Mus musculus 1959847 Serologically defined colon cancer antigen 8 ManualGN=Vcl Assigned homolog Name:Serologically defined colon cancer antigen 8 homolog 1960283 Myosin, light polypeptide kinase ManualSwissPROT>SDCG8_MOUS Assigned Name:Myosin, light polypeptide kinase SwissPROT>B1B1A8_MOUS 1960202 Uncharacterized protein (Fragment) ManualE>S611>"Myosin, Assigned light Name:Uncharacterized protein (Fragment) 1959753 Sperm specific antigen 2 Manual Assigned Name:Sperm specific antigen 2 SwissPROT>A2AQD4_MOU 1959761 Snrnp70 protein ManualSE>S90>Sperm Assigned specific Name:Snrnp70 protein IPI>Q99LY5>S81>Snrnp70 protein 1959338 SAM and SH3 domain-containing protein 1 ManualIPI>Q62376>S81>U1 Assigned Name:SAM small and SH3 domain-containing protein 1 HPRD>06408_1>S813>SAS 1960221 Ppfia1 protein ManualH1 Assigned Name:Ppfia1 protein SwissPROT>B2RXW8_MOU SE>T770>Ppfia1 protein 1960061 Histone deacetylase ManualOS=Mus Assigned musculus Name:Histone deacetylase SwissPROT>D3YYI8_MOUS E>S393>MCG128529 OS=Mus musculus Diabetes Page 44 of 603
1960329 Treacle protein Manual Assigned Name:Treacle protein SwissPROT>Q7TPZ2_MOUS E>S1227>Tcof1 protein 1959304 Regulatory-associated protein of mTOR Manual(Fragment) Assigned OS=Mus Name:Regulatory-associated protein of mTOR SwissPROT>A2ACM0_MOU 1959669 Programmed cell death protein 4 ManualSE>S863>Novel Assigned protein Name:Programmed cell death protein 4 SwissPROT>PDCD4_MOUS 1959926 Programmed cell death protein 4 ManualE>T93>Programmed Assigned cell Name:Programmed cell death protein 4 SwissPROT>PDCD4_MOUS 1960269 Insulin receptor substrate 1 ManualE>S94>Programmed Assigned cell Name:Insulin receptor substrate 1 SwissPROT>IRS1_MOUSE> 1958881 Eef1d protein ManualS1097>Insulin Assigned receptor Name:Eef1d protein HPRD>00560_1>S499>Eukar yotic translation elongation 1959816 Splicing factor 1 Manualfactor 1, Assigned delta Name:Splicing factor 1 HPRD>03306_1>S80S82>Sp licing factor 1 1959768 Plasmalemma vesicle associated protein ManualHPRD>03306_2>S80S82>Sp Assigned Name:Plasmalemma vesicle associated protein SwissPROT>B8JK32_MOUS 1958819 Splicing factor, arginine/serine-rich 19 ManualE>S527>Heterogeneous Assigned Name:Splicing factor, arginine/serine-rich 19 IPI>Q5U4C3>S676S682>Spli 1959657 Pyruvate carboxylase, mitochondrial Manualcing factor, Assigned arginine/serine- Name:Pyruvate carboxylase, mitochondrial SwissPROT>PYC_MOUSE> S20>"Pyruvate carboxylase, Page 45 of 603 Diabetes
1960267 Pyruvate carboxylase, mitochondrial Manual Assigned Name:Pyruvate carboxylase, mitochondrial SwissPROT>PYC_MOUSE> 1960219 Rab GTPase-activating protein 1 ManualS19>"Pyruvate Assigned carboxylase, Name:Rab GTPase-activating protein 1 SwissPROT>A2AWA7_MOU SE>S42>RAB GTPase 1960239 Phosphatidylinositol 4-kinase type 2-alpha Manualactivating Assigned protein 1 Name:Phosphatidylinositol 4- kinase type 2-alpha SwissPROT>P4K2A_MOUSE 1959918 Clasp2 protein Manual>S47>Phosphatidylinositol Assigned 4- Name:Clasp2 protein HPRD>12054_1>S603>Cytop lasmic linker associated 1959139 Protein SMG9 Manualprotein 2Assigned Name:Protein SMG9 SwissPROT>D3Z719_MOUS E>S32>Uncharacterized 1959641 Serine/arginine repetitive matrix 1 Manualprotein OS=MusAssigned musculus Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>S389S393> 1960064 Serum deprivation-response protein ManualSerine arginine Assigned repetitive Name:Serum deprivation- response protein SwissPROT>SDPR_MOUSE 1959170 THUMP domain-containing protein 1 Manual>S363>Serum Assigned deprivation- Name:THUMP domain- containing protein 1 SwissPROT>THUM1_MOUS 1960361 Astrocytic phosphoprotein PEA-15 ManualE>S86S88>THUMP Assigned domain- Name:Astrocytic phosphoprotein PEA-15 HPRD>04579_1>S116>PEA1 1958617 Acetyl-CoA carboxylase 1 Manual5 Assigned Name:Acetyl-CoA carboxylase 1 HPRD>01938_1>S66>Acetyl- CoA carboxylase alpha Diabetes Page 46 of 603
1959268 Trans-Golgi network integral membrane Manual Assigned protein 1 Name:Trans-Golgi network integral membrane protein 1 SwissPROT>TGON1_MOUS 1960387 Trans-Golgi network integral membrane ManualE>S266>Trans-Golgi Assigned network protein 1 Name:Trans-Golgi network integral membrane protein 1 SwissPROT>TGON1_MOUS 1960008 Cleavage stimulation factor subunit 3 ManualE>S267>Trans-Golgi Assigned network Name:Cleavage stimulation factor subunit 3 HPRD>02651_1>S691>Cleav 1960139 Heme oxygenase 1 Manualage stimulation Assigned factor, 3 Name:Heme oxygenase 1 SwissPROT>HMOX1_MOUS E>S174>Heme oxygenase 1 1959209 Ras GTPase-activating protein-binding ManualOS=Mus Assigned musculus Name:Ras protein 2 GTPase-activating protein- binding protein 2 SwissPROT>G3B2_MOUSE> 1958637 Paxillin ManualT227>Ras-GTPase-activating Assigned Name:Paxillin SwissPROT>PAXI_MOUSE> S287>Isoform Alpha of 1958638 Paxillin ManualPaxillin OS=MusAssigned musculus Name:Paxillin SwissPROT>PAXI_MOUSE> S294>Isoform Alpha of 1959198 Trans-Golgi network integral membrane ManualPaxillin OS=MusAssigned musculus protein 2 Name:Trans-Golgi network integral membrane protein 2 SwissPROT>TGON2_MOUS 1960338 Pre-mRNA 3'-end-processing factor FIP1 ManualE>S277>Trans-Golgi Assigned Name:Pre- network mRNA 3'-end-processing factor FIP1 HPRD>09646_1>S492>FIP1 1959826 Nuclear factor 1 Manuallike 1 Assigned Name:Nuclear factor 1 HPRD>09007_1>S287>Nucle ar factor I/A SwissPROT>B1AUB9_MOUS Page 47 of 603 Diabetes
1959941 SH3 and PX domain-containing protein 2A Manual Assigned Name:SH3 and PX domain-containing protein 2A HPRD>10228_1>S393>SH3 1960110 Patatin-like phospholipase domain-containing Manualmultiple Assigneddomains 1 protein 2 Name:Patatin-like phospholipase domain- containing protein 2 1960253 [3-methyl-2-oxobutanoate dehydrogenase ManualSwissPROT>PLPL2_MOUSE Assigned Name:[3- [lipoamide]] kinase, mitochondrial methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial 1960039 Protein FAM73B ManualSwissPROT>BCKD_MOUSE Assigned Name:Protein FAM73B SwissPROT>FA73B_MOUSE >T208>Isoform 2 of Protein 1959048 BAG family molecular chaperone regulator 3 ManualFAM73B Assigned OS=Mus Name:BAG musculus family molecular chaperone regulator 3 SwissPROT>A6H663_MOUS 1958635 Patatin-like phospholipase domain-containing ManualE>S270S274>BCL2- Assigned protein 2 Name:Patatin-like phospholipase domain- containing protein 2 1960331 Oxysterol-binding protein ManualSwissPROT>PLPL2_MOUSE Assigned Name:Oxysterol-binding protein IPI>E9QPD4>S188S191>Oxy 1960205 ATP citrate lyase Manualsterol-binding Assigned protein Name:ATP citrate lyase HPRD>00155_1>S455>ATP citrate lyase 1959628 Luc7-like protein 3 ManualHPRD>00155_2>S455>ATP Assigned Name:Luc7- like protein 3 HPRD>16759_1>S425S431> Cisplatin resistance 1960229 Luc7-like protein 3 Manualassociated Assigned overexpressed Name:Luc7- like protein 3 HPRD>16759_1>S425T429> Cisplatin resistance associated overexpressed Diabetes Page 48 of 603
1959345 Oxysterol-binding protein-related protein 11 Manual Assigned Name:Oxysterol-binding protein-related protein 11 SwissPROT>OSB11_MOUSE 1959886 Translocating chain-associated membrane Manual>S186>Oxysterol-binding Assigned protein 1 Name:Translocating chain- associated membrane protein 1 1959869 Nuclear pore complex-associated ManualSwissPROT>TRAM1_MOUS Assigned intranuclear coiled-coil protein TPR Name:Nuclear pore complex- associated intranuclear coiled- coil protein TPR 1958680 Polymerase I and transcript release factor ManualSwissPROT>Q7M739_MOUS Assigned Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1958786 Calnexin ManualT198S218>Polymerase Assigned I and Name:Calnexin SwissPROT>CALX_MOUSE> S563>Calnexin OS=Mus 1958949 Proline-rich AKT1 substrate 1 Manualmusculus Assigned GN=Canx Name:Proline-rich AKT1 substrate 1 HPRD>12441_1>T246>AKT1 1959917 High mobility group protein HMG-I/HMG-Y Manualsubstrate Assigned 1 Name:High mobility group protein HMG- I/HMG-Y HPRD>02829_1>S102S103> 1960171 SRA stem-loop-interacting RNA-binding ManualHigh mobility Assigned group Name:SRA AT hook 1 protein, mitochondrial stem-loop-interacting RNA- binding protein, mitochondrial IPI>Q9D8T7>SRA stem-loop- 1959501 Rapamycin-insensitive companion of mTOR Manualinteracting Assigned RNA-binding Name:Rapamycin-insensitive companion of mTOR HPRD>10682_1>S1591>Rict 1960043 Bcl-2-associated transcription factor 1 Manualor Assigned Name:Bcl-2- associated transcription factor 1 SwissPROT>BCLF1_MOUSE >S654>Isoform 3 of Bcl-2- Page 49 of 603 Diabetes
1959423 Ankyrin repeat domain-containing protein 57 Manual Assigned Name:Ankyrin repeat domain- containing protein 57 SwissPROT>ANR57_MOUSE 1959375 Kif13b kinesin family member 13B Manual>S205>Ankyrin Assigned repeat Name:Kif13b kinesin family member 13B SwissPROT>Q6A029_MOUS 1959325 BCL2/adenovirus E1B 19 kDa protein- ManualE>MKIAA0639 Assigned protein interacting protein 3 Name:BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 1960449 RNA-binding protein 14 ManualSwissPROT>BNIP3_MOUSE Assigned Name:RNA- binding protein 14 HPRD>11485_1>T206>RNA binding motif protein 14 1959010 Translocation protein SEC62 ManualSwissPROT>Q62019_MOUS Assigned Name:Translocation protein SEC62 SwissPROT>SEC62_MOUSE 1960160 Polymerase I and transcript release factor Manual>T375>Translocation Assigned protein Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1958646 Polymerase I and transcript release factor ManualT373S389S391>Polymerase Assigned I Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1959495 Cation-independent mannose-6-phosphate ManualT198S204>Polymerase Assigned I and receptor Name:Cation-independent mannose-6-phosphate receptor 1960092 Protein FAM73B ManualSwissPROT>MPRI_MOUSE> Assigned Name:Protein FAM73B HPRD>12965_1>S276>C9orf 54 protein 1959517 Kif13b kinesin family member 13B ManualSwissPROT>FA73B_MOUSE Assigned Name:Kif13b kinesin family member 13B SwissPROT>Q6A029_MOUS E>MKIAA0639 protein Diabetes Page 50 of 603
1959848 Kif13b kinesin family member 13B Manual Assigned Name:Kif13b kinesin family member 13B SwissPROT>Q6A029_MOUS 1960364 Glycogen [starch] synthase, muscle ManualE>MKIAA0639 Assigned protein Name:Glycogen [starch] synthase, muscle HPRD>00721_1>S641S649> 1960307 ATP citrate lyase ManualGlycogen Assigned synthase Name:ATP 1 citrate lyase HPRD>00155_1>S481>ATP citrate lyase 1960328 Epidermal growth factor receptor substrate 15-ManualSwissPROT>Q3TS02_MOUS Assigned like 1 Name:Epidermal growth factor receptor substrate 15- like 1 1958756 RNA polymerase-associated protein CTR9 ManualHPRD>09445_1>S255>EPS1 Assigned Name:RNA homolog polymerase-associated protein CTR9 homolog SwissPROT>CTR9_MOUSE> 1960190 RNA polymerase-associated protein CTR9 ManualS925>Isoform Assigned 3 of Name:RNA RNA homolog polymerase-associated protein CTR9 homolog SwissPROT>CTR9_MOUSE> 1959992 Ahnak AHNAK nucleoprotein isoform 1 ManualT930>Isoform Assigned 3 of RNA Name:Ahnak AHNAK nucleoprotein isoform 1 IPI>IPI00553798.2>Ahnak 1959470 Nuclear factor 1 ManualAHNAK Assignednucleoprotein isoform Name:Nuclear factor 1 SwissPROT>B1AUB9_MOUS E>S278>Nuclear factor 1 1959834 Nuclear factor 1 ManualOS=Mus Assigned musculus GN=Nfia Name:Nuclear factor 1 SwissPROT>B1AUB9_MOUS E>S285>Nuclear factor 1 1959124 cAMP-dependent protein kinase type II-beta ManualOS=Mus Assigned musculus GN=Nfia regulatory subunit Name:cAMP-dependent protein kinase type II-beta regulatory subunit HPRD>01486_1>S114>Protei Page 51 of 603 Diabetes
1959474 Ehd2 protein Manual Assigned Name:Ehd2 protein SwissPROT>EHD2_MOUSE> S438>EH domain-containing 1959105 Sec1 family domain-containing protein 1 Manualprotein 2Assigned OS=Mus Name:Sec1 musculus family domain-containing protein 1 SwissPROT>SCFD1_MOUS 1959486 Kinesin light chain 4 ManualE>S300>Isoform Assigned 3 of Sec1 Name:Kinesin light chain 4 SwissPROT>KLC4_MOUSE> S590>Kinesin light chain 4 1958708 Eukaryotic translation initiation factor 4E- ManualOS=Mus Assigned musculus GN=Klc4 binding protein 1 Name:Eukaryotic translation initiation factor 4E-binding protein 1 1959301 Regulatory-associated protein of mTOR ManualSwissPROT>4EBP1_MOUSE Assigned Name:Regulatory-associated protein of mTOR SwissPROT>A2ACM0_MOU 1958758 Myristoylated alanine-rich C-kinase substrate ManualSE>S859S863>Novel Assigned protein Name:Myristoylated alanine- rich C-kinase substrate SwissPROT>MARCS_MOUS 1959603 Myristoylated alanine-rich C-kinase substrate ManualE>T143>Myristoylated Assigned Name:Myristoylated alanine- rich C-kinase substrate SwissPROT>MARCS_MOUS 1960272 E>S141>Myristoylated
1959250 SH3 domain-binding protein 5-like Manual Assigned Name:SH3 domain-binding protein 5-like SwissPROT>3BP5L_MOUSE >S361>SH3 domain-binding 1960304 Membrane-associated progesterone receptor Manualprotein 5-likeAssigned OS=Mus component 2 Name:Membrane-associated progesterone receptor component 2 SwissPROT>PGRC2_MOUS Diabetes Page 52 of 603
1959606 Calnexin Manual Assigned Name:Calnexin SwissPROT>CALX_MOUSE> S553S563>Calnexin OS=Mus 1958829 Protein Njmu-R1 Manualmusculus Assigned GN=Canx Name:Protein Njmu-R1 HPRD>11392_1>S18>Protein kinase Njmu-R1 1959035 Tyrosine-protein phosphatase non-receptor ManualSwissPROT>NJMU_MOUSE Assigned type 14 Name:Tyrosine-protein phosphatase non-receptor type 14 1958772 Calnexin ManualHPRD>04402_1>S314>Protei Assigned Name:Calnexin SwissPROT>CALX_MOUSE> S553>Calnexin OS=Mus 1960423 Trans-Golgi network integral membrane Manualmusculus Assigned GN=Canx protein 1 Name:Trans-Golgi network integral membrane protein 1 SwissPROT>TGON1_MOUS 1959709 Endoplasmin ManualE>S210>Trans-Golgi Assigned network Name:Endoplasmin HPRD>01860_1>S306>Tumo r rejection antigen 1 1959598 Nuclear ubiquitous casein and cyclin- ManualSwissPROT>ENPL_MOUSE> Assigned dependent kinases substrate Name:Nuclear ubiquitous casein and cyclin-dependent kinases substrate 1959548 Hormone-sensitive lipase ManualSwissPROT>NUCKS_MOUS Assigned Name:Hormone-sensitive lipase SwissPROT>LIPS_MOUSE> 1958664 Enhancer of mRNA-decapping protein 4 ManualS557>Hormone-sensitive Assigned Name:Enhancer of mRNA- decapping protein 4 HPRD>06911_1>T727>Autoa 1960112 Phosphoglycerate kinase 1 Manualntigen RCD8 Assigned Name:Phosphoglycerate kinase 1 HPRD>02412_1>S203>Phos phoglycerate kinase 1 Page 53 of 603 Diabetes
1959153 Ankyrin repeat domain-containing protein 17 Manual Assigned Name:Ankyrin repeat domain- containing protein 17 IPI>Q99NH0>Ankyrin repeat 1958990 Ankyrin repeat and SAM domain containing 1 Manualdomain-containing Assigned protein 17 Name:Ankyrin repeat and SAM domain containing 1 HPRD>10610_1>S647>Odin 1958873 Ubiquitin-associated protein 2-like ManualSwissPROT>ANKS1_MOUS Assigned Name:Ubiquitin-associated protein 2-like SwissPROT>Q8BJ53_MOUS 1960237 Ubiquitin-associated protein 2-like ManualE>S477>Putative Assigned Name:Ubiquitin-associated protein 2-like SwissPROT>Q8BJ53_MOUS 1958887 Serum deprivation-response protein ManualE>S470>Putative Assigned Name:Serum deprivation- response protein SwissPROT>SDPR_MOUSE 1958683 Polymerase I and transcript release factor Manual>S218>Serum Assigned deprivation- Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1958618 ATP-binding cassette sub-family F member 1 ManualS367S389S391>Polymerase Assigned Name:ATP- binding cassette sub-family F member 1 SwissPROT>ABCF1_MOUSE >S138>ATP-binding cassette Diabetes Page 54 of 603
heatmap peakarea assigned phosphosite accession number Final for display sequence annotated for psite labelfree 1 R.DPNAS*PG S290* UNI:Q64727 18339.32376 DAGEQAIR.Q
K.VT*REKTA T430S438 UNI:Q80UF4 160558.4017 AVS*HLEEIQ NHVASQEMD VTK.V R.EHRLS*PA S611 UNI:B1B1A8 20652.6232 R.S
- S2 UNI:Q3UGF0 334172.8891 .PS*PPSLSP R.L R.TPLGAS*L S90 UNI:A2AQD5 5646867.194 DEQSSGTPK. G
R.GGGGS*G S81 UNI:Q99LY5 620715.8396 QDNGLEGLG SDGR.D
R.S*LPVSICR S805 UNI:P59808 10515894.41 .S
K.GAPHT*VS T770 UNI:B2RXW8 476478.7854 HEDIR.D
R.MLPHAPG S393* UNI:D3YYI8 7769107.264 VQMQAIPED AIPEES*GDE DEEDPDKR.I Page 55 of 603 Diabetes
R.KLS*GDLE S1191* UNI:O08784 1269085.56 AGAPK.N
R.ILDTSSLTQ S863 UNI:Q8K4Q0 9143747.43 SAPAS*PTNK .G
R.SGVAVPT* T93* UNI:Q61823 4418378.816 SPK.G
R.SGVAVPTS S94* UNI:Q61823 4418378.816 *PK.G
R.HSS*ETFS S1097* UNI:P35569 445440.3075 APTR.A
R.ATAPQTQH S128* UNI:Q91VK2 615444.2782 VS*PMR.Q
R.TGDLGIPP S80S82* UNI:Q64213 27253795.71 NPEDRS*PS* PEPIYNSEGK .R R.MGLS*MDR S4 UNI:G3X924 1194900.224 .M
R.APS*PAPA S676S682 UNI:Q5U4C3 1861131.011 VS*PK.R
R.SS*SAPVA S20 UNI:Q05920 1441365.245 SPNVR.R Diabetes Page 56 of 603
R.S*SSAPVA S19 UNI:Q05920 1441365.245 SPNVR.R
R.QGDETPST S42 UNI:A2AWA9 509704.4443 NNGS*DDEK TGLK.I
R.VAAAAGS S47* UNI:Q2TBE6 1212713.546 GPS*PPCSP GHDR.E
R.SRS*DIDVN S376* UNI:B9EJA4 860333.1585 AAAGAK.A
R.WKEPGSS S32 UNI:Q9DB90 1041955.799 GPQNLS*GP GGR.E
R.RLS*PSAS* S387S391* UNI:A2A8V8 8594158.087 PPR.R
R.RGNNSAV S363 UNI:Q63918 343005.2364 GS*NADLTIE EDEEEEPVA LQQAQQVR. K.FIDKDQQPY S86S88* UNI:Q99J36 6462276.978 S*GS*EGEDD DAEAALKK.E
R.QPS*EEEII S116* UNI:Q62048 24251065.72 K.L
R.FIIGSVSED S29* UNI:Q5SWU9 8747264.912 NS*EDEISNL VK.L Page 57 of 603 Diabetes
K.VPGPS*SS S266 UNI:Q62313 1806850.158 ENQEGTLTD SMK.N
K.VPGPSS*S S267 UNI:Q62313 1806850.158 ENQEGTLTD SMK.N
K.RPNEDS*D S691* UNI:Q99LI7 2251703.367 EDEEKGAVV PPVHDIYR.A
K.AMALPSSG S174 UNI:P14901 2234828.148 EGLAFFTFPN IDS*PTK.F
K.SAT*PPPA T227* UNI:P97379 11909942.93 EPASLPQEP PK.A
K.TGSS*SPP S321 UNI:Q8VI36 2157246.557 GGLSKPGSQ LDSMLGSLQ SDLNK.L K.TGSSSPPG S328 UNI:Q8VI36 2157246.557 GLS*KPGSQL DSMLGSLQS DLNK.L K.VSGPSS*S S277 UNI:Q62314 2039123.21 ENQEGTLTD SMK.N
R.ERDHS*PT S479* UNI:Q9D824 2452806.243 PSVFNSDEE R.Y
K.SVEDEMD S265* UNI:B1AUB9 2792055.174 S*PGEEPFYT GQGR.S Diabetes Page 58 of 603
R.AQISS*PNL S420 UNI:O89032 852183.8491 R.T
R.AQS*LPSV S406 UNI:Q8BJ56 9564365.316 PLSCATYSE ALPNWVR.N
R.STS*ATDT S33* UNI:O55028 537429.0221 HHVELAR.E
R.GDGGSTP T208 UNI:Q8BK03 2065514.592 T*PGDSLQN PDTASEALS EPESQR.R R.AAS*PFRS* S270S274* UNI:Q9JLV1 3130125.534 PVR.G
R.AQSLPS*V S409 UNI:Q8BJ56 8566361.337 PLSCATYSE ALPNWVR.N
K.MLAES*DD S188S191 UNI:E9QPD4 1089324.864 S*GDEESVS QTDK.T
R.TAS*FSES S455* UNI:Q3TS02 3269192.189 R.A
K.NEVNGTSE S425S431 UNI:Q5SUF2 966551.1649 DIKS*EGDTQ S*N.-
K.NEVNGTSE S425T429 UNI:Q5SUF2 966551.1649 DIKS*EGDT* QSN.- Page 59 of 603 Diabetes
R.SFSLASSG S186* UNI:Q8CI95 11546441.05 NS*PISQR.R
R.KGTENGV S365* UNI:Q91V04 219471.6322 NGTVTSNGA DS*PR.N
R.QTPQAPQ S2067 UNI:Q7M739 949541.2378 S*PR.R
K.EGDELGE T198S218* UNI:O54724 7057654.528 GERPEDDT* AAIELSSDEA VEVEEVIEES K.SDAEEDGV*R.A S563* UNI:P35564 1072678.478 TGS*QDEED SKPK.A
R.LNT*SDFQ T247* UNI:Q9D1F4 4102877.304 K.L
K.KLEKEEEE S102S103 UNI:P17095 5053026.507 GISQES*S*E EEQ.-
K.ALHGAQTS S105 UNI:Q9D8T7 468395.4753 *DEER.F
K.S*TELLLGV S1591 UNI:Q6QI06 1635993.345 K.T
R.RIDIS*PSA S656* UNI:Q8K019 2791974.427 LR.K Diabetes Page 60 of 603
R.DLVLGSS* S205 UNI:Q8C0J6 2838546.043 PQLK.R
R.WES*QQD S1409 UNI:IPI00761751.2 6146753.542 VSQTLVSR.G
K.NSTLS*EE S88 UNI:O55003 13733433.4 DYIER.R
R.QPT*PPFF T206* UNI:Q8C2Q3 19404705.08 GR.D
K.EELEQQT* T375 UNI:Q8BU14 6913848.095 DGDCDEEDD DKDGEVPK.S
R.GSSPDVHT T373S389S391* UNI:O54724 4298702.556 *LLEITEESDA VLVDKS*DS* D.- K.EGDELGE T198S204* UNI:O54724 34060509.99 GERPEDDT* AAIELS*SDE AVEVEEVIEE K.AEALSSLHSR.A S2401 UNI:Q07113 17035843.33 GDDQDS*ED EVLTVPEVK. V R.TLMLPLTE S276 UNI:Q8BK03 6982835.313 GS*LR.L
R.APLLSEPA T1653 UNI:IPI00761751.2 3649247.556 SAVPT*SPFR .I Page 61 of 603 Diabetes
R.APLLSEPA S1654 UNI:IPI00761751.2 3649247.556 SAVPTS*PFR .I
R.YPRPAS*V S641S649* UNI:Q9Z1E4 14048617.38 PPSPSLS*R. H
K.AKPAMPQ S481* UNI:Q3TS02 7869495.416 DSVPS*PR.S
R.STPSHGSV S255* UNI:Q60902 1538036.211 SSLNSTGSL S*PK.H
K.GEEGS*EE S970* UNI:Q62018 579268.7208 EETENGPKP K.K
K.GEEGSEEE T975* UNI:Q62018 579268.7208 ET*ENGPKPK .K
K.FKAEAPLP S4890 UNI:IPI00553798.2 2314522.172 S*PK.L
R.S*PGSGSQ S278* UNI:B1AUB9 11174076.44 SSGWHEVEP GLPSPSTLK. K R.SPGSGSQ S285* UNI:B1AUB9 11174076.44 S*SGWHEVE PGLPSPSTLK .K R.RAS*VCAE S112* UNI:P31324 3079919.042 AYNPDEEED DAESR.I Diabetes Page 62 of 603
R.GPDEAIED S338* UNI:Q8R2X0 104674997.8 GEEGS*EDD AEWVVTK.D
R.VNLEESTG S300* UNI:Q8BRF7 5652643.312 VENS*PAGA RPK.R
R.AAS*LNYL S590 UNI:Q9DBS5 9085439.123 NQPNAAPLQ VSR.G
R.NS*PVAKT* S64T69 UNI:Q60876 1292695.067 PPK.D
R.ILDTSSLTQ S859S863 UNI:Q8K4Q0 4304256.713 S*APAS*PTN K.G
K.AEDGAAPS T143* UNI:P26645 1627171.296 PSSET*PK.K
K.AEDGAAPS S141* UNI:P26645 1627171.296 PSS*ETPK.K
K.KIS*IR.R Phosphorylated on 1320524.853 non-tryptic peptide, or a tryptic peptide with greater than 2 R.GLSDHAS* S361internal cleavage UNI:Q99LH9 7899036.832 LDGQELGAQ SR.G
R.LLKPGEEP S202* UNI:Q80UU9 1837452.939 S*EYTDEEDT KDHSK.Q Page 63 of 603 Diabetes
K.QKS*DAEE S553S563* UNI:P35564 3292854.433 DGVTGS*QD EEDSKPK.A
K.ELES*SEE S18 UNI:Q9CYI0 300181.1027 GGSAEER.R
K.ICTEQSNS* S314 UNI:Q62130 1674308.319 PPPIR.R
K.QKS*DAEE S553* UNI:P35564 1392505.273 DGVTGSQDE EDSKPK.A
K.TES*GETL S210 UNI:Q62313 2485857.19 AGDSDFSLK PEK.G
K.EES*DDEA S306 UNI:P08113 580404.4357 AVEEEEEEK. K
K.EEDEEAES S214* UNI:Q80XU3 497754.5858 *PPEK.K
R.S*VSEAAL S557* UNI:P54310 142436091.9 AQPEGLLGT DTLK.K
R.T*RSPDVIS T731* UNI:Q3UJB9 3617806.619 SASTALSQDI PEIASEALSR. G K.ALES*PER S203* UNI:P09411 11953725.9 PFLAILGGAK. V Diabetes Page 64 of 603
R.APS*PAPS S2401 UNI:Q99NH0 7802174.384 SVPLGSEKP SSVSQDR.K
R.SES*LSNC S663* UNI:Q3UHP6 3219862.029 SIGK.K
K.STSAPQMS S497* UNI:Q80X50 1571660.811 PGSSDNQSS S*PQPAQQK. L K.STSAPQMS S490* UNI:Q80X50 1571660.811 PGS*SDNQS SSPQPAQQK .L R.DEEALEDS S218 UNI:Q63918 27605977.09 *AEEK.M
R.GS*SPDVH S367S389S391* UNI:O54724 35219746.16 TLLEITEESD AVLVDKS*DS *D.- K.GGNVFEAL S138* UNI:Q6P542 5103259.246 IQDDS*EEEE EEEENR.V Page 65 of 603 Diabetes
peakarea manual peakarea manual peakarea manual peakarea manual 1 rep1 1 rep2 1 rep3 1 thresholded thresholded thresholded 18339.32376 24208 21669 8232
160558.4017 136514 240497
20652.6232 27390 47944 1901
334172.8891 241624 262889 419228
5646867.194 3757016 8637979 8265986
620715.8396 908251 387562 898546
10515894.41 8889244 16486756 12203937
476478.7854 874088 467435 231424
7769107.264 4805151 9797309 7286085 Diabetes Page 66 of 603
1269085.56 1732753 1352984 1054076
9143747.43 2379156 13053945 12868848
4418378.816 3851766 5460507 5478363
4418378.816 3851766 5460507 5478363
445440.3075 725072 280341 428212
615444.2782 749760 750019 656143
27253795.71 12474110 50288074 30771452
1194900.224 361560 1627930 2472248
1861131.011 1325729 2230202 1963007
1441365.245 1123787 1954281 1311904 Page 67 of 603 Diabetes
1441365.245 1123787 1954281 1311904
509704.4443 477915 478218 522050
1212713.546 963054 1521391 1290574
860333.1585 937923 1054433 642889
1041955.799 852949 1408472 1501707
8594158.087 5551107 9542065 11988907
343005.2364 41607 55905
6462276.978 2686817 7750201 6946341
24251065.72 29994910 27344460 24232165
8747264.912 9946298 11247682 13744072 Diabetes Page 68 of 603
1806850.158 3011729 1405351 1717932
1806850.158 3011729 1405351 1717932
2251703.367 339587 467759 82068
2234828.148 2724139 2246473 1733873
11909942.93 10555730 12512597 12916858
2157246.557 786121 4071104 1408999
2157246.557 786121 4071104 1408999
2039123.21 1619383 2380279 2394304
2452806.243 3103118 3231598 1730059
2792055.174 1033493 5034883 3239557 Page 69 of 603 Diabetes
852183.8491 585322 857077 1052196
9564365.316 9603978 12998863 6090255
537429.0221 469690 498280 696958
2065514.592 945745 3078198 2338573
3130125.534 2600631 3992287 4340278
8566361.337 9603978 12998863 6090255
1089324.864 794443 2169091 1180185
3269192.189 2900887 4573391 4326784
966551.1649 534918 1161778 1055190
966551.1649 534918 1161778 1055190 Diabetes Page 70 of 603
11546441.05 5624638 14557210 13609109
219471.6322 184690 174342 69083
949541.2378 942875 1098260 894628
7057654.528 5649017 7928173 7595773
1072678.478 288438 1570617 1814713
4102877.304 3699512 4493161 3695950
5053026.507 59764 108938 23212
468395.4753 371733 406635 566473
1635993.345 2452082 2574090 1133354
2791974.427 1891735 1749041 874104 Page 71 of 603 Diabetes
2838546.043 2669569 4311159 2919448
6146753.542 6473896 9648498 6292197
13733433.4 7002082 17499972 11161269
19404705.08 22561635 21887040 21118877
6913848.095 2012751 7337709 6888738
4298702.556 1449593 6324043 5122472
34060509.99 27121386 70113016 38667874
17035843.33 15374960 30037869 13050967
6982835.313 4755868 8767634 7425004
3649247.556 4696042 5660572 2793601 Diabetes Page 72 of 603
3649247.556 4696042 5660572 2793601
14048617.38 5763796 15240579 17687141
7869495.416 9875047 8724464 7991832
1538036.211 849754 1740586 1525098
579268.7208 363613 806013 978078
579268.7208 363613 806013 978078
2314522.172 2377035 2736062 1720315
11174076.44 6897911 16438091 14891947
11174076.44 6897911 16438091 14891947
3079919.042 2680971 4630858 3818018 Page 73 of 603 Diabetes
104674997.8 52353345 176650169 122891485
5652643.312 6591897 6424327 5436426
9085439.123 3939518 16790453 8071906
1292695.067 814613 1273993 2394807
4304256.713 3666625 4753870 4562101
1627171.296 1374239 1447433 1552721
1627171.296 1374239 1447433 1552721
1320524.853 1938999 1358248 1044101
7899036.832 4807707 8155058 8529308
1837452.939 1342850 2192594 1351949 Diabetes Page 74 of 603
3292854.433 1161164 2670914 3125029
300181.1027 264014 378333 494523
1674308.319 1386680 1903903 2205273
1392505.273 738621 717497 730670
2485857.19 2095917 4024774 2766038
580404.4357 478033 1017390 818236
497754.5858 370350 586586 1026674
142436091.9 136521675 175501742 176926416
3617806.619 4022340 5077628 2300493
11953725.9 15184893 13380212 7296072 Page 75 of 603 Diabetes
7802174.384 5854394 11608561 6760789
3219862.029 2121572 3649880 4421481
1571660.811 666138 1983208 1976016
1571660.811 666138 1983208 1976016
27605977.09 16784839 30864323 55960642
35219746.16 24153543 43279395 38226300
5103259.246 3404832 8940332 8063259 Diabetes Page 76 of 603
peakarea manual peakarea manual peakarea manual 1 rep4 peakarea manual 2 rep1 2 rep2 thresholded 2 thresholded thresholded 19248 52902838.05 22125661 69670402
104665 120217215.2 43091732 289175845
5376 1537226.245 1734397 1641439
412951 2997002.9 1725486 3415435
1926487 50490032.11 31508585 56217663
288504 5411673.012 2307598 7322073
4483641 84070362.32 66182044 156303135
332968 3062996.922 2509836 3092226
9187884 43335379.37 16470509 64833267 Page 77 of 603 Diabetes
936528 5483716.664 6987942 5897247
8273041 36224682.11 33713100 45984048
2882880 17208769.45 12369849 21955441
2882880 17208769.45 12369849 21955441
348136 1511731.361 1623420 1918350
305855 1614881.549 1468573 1889856
15481546 70489608.47 67500367 107816063
317863 3016672.768 783391 3722919
1925587 4504209.884 4479282 5150198
1375489 3465730.986 2660517 4359176 Diabetes Page 78 of 603
1375489 3465730.986 2660517 4359176
560635 1171561.611 1134226 1136205
1075836 2705326.55 1704183 2877546
806087 1899932.576 2158174 2478498
404696 2238269.717 2643395 3134658
7294553 18295049.47 11995298 20459640
931503 697355.0543 186619 239660
8465749 12889149.07 5747446 9343100
15432728 47701328.51 42437386 57168570
51008 16916770.39 13462760 15937764 Page 79 of 603 Diabetes
1092389 3244104.386 3891337 3932466
1092389 3244104.386 3891337 3932466
8117400 4029204.416 2688029 1382241
3929419.38 4142017 5306267
11654587 19408726.17 12690834 23483638
2362763 3450568.474 1479623 5853058
2362763 3450568.474 1479623 5853058
1762526 3245717.437 2358284 4252236
1746450 3728935.197 4349551 3897736
1860287 4211088.863 1912225 8362056 Diabetes Page 80 of 603
914141 1275933.545 971619 1490700
14314091.36 15772893 18725389
484788 804138.6086 572782 758285
1899542 3018531.766 1262168 4604359
1587307 4517223.205 3749034 5577754
5572349 12183828.1 15772893 18725389
213581 1546870.738 1052045 2843514
1275707 4613589.073 3685402 7152378
1114319 1353492.908 761979 1889722
1114319 1353492.908 761979 1889722 Page 81 of 603 Diabetes
12394807 16024341.17 9665617 20336306
449772 300464.6012 249717 295115
862401 1291167.447 1273185 1205408
9552472.406 6358997 12132230
616946 1435702.425 571317 2285196
4522887 5463496.281 5212934 5499215
20020192 6639625.753 58140 106269
528740 612089.1334 471079 623342
384448 2120997.118 3150108 3437315
6653017 3605746.419 1994763 2637442 Diabetes Page 82 of 603
1454008 3653365.701 4600133 4906625
2172423 7835479.496 8289104 11386400
19270412 17498285.41 9992965 26527333
12051268 24538923.49 25822150 29456523
11416194 8704323.112 2615118 10239938
5409854.922 1789344 7015904
339764 42818454.85 32795477 91339847
9679578 21355542.26 17864566 39214213
8709692.526 6303591 11355193
1446775 4551570.62 6388380 6481572 Page 83 of 603 Diabetes
1446775 4551570.62 6388380 6481572
17502953 17499884.07 7883949 21414953
4886639 9797603.643 12627454 11563522
2036707 1904707.747 1336303 2032405
169371 714104.295 397824 938959
169371 714104.295 397824 938959
2424676 2850322.698 3426606 3151850
6468358 13513073.38 9253878 17263744
6468358 13513073.38 9253878 17263744
1189830 3694600.712 2899871 5056857 Diabetes Page 84 of 603
66804992 125064470.5 60262090 217636181
4157924 6717622.834 7595008 8104644
7539879 10755734.46 5150160 19448918
687367 1517724.165 993820 1656391
4234432 5024019.973 3723395 5766849
2134291 1895901.135 1886583 1665790
2134291 1895901.135 1886583 1665790
940752 1528842.7 2207371 1568579
10104075 9117916.943 6225811 10551630
2462418 2120050.157 1658755 2789775 Page 85 of 603 Diabetes
6214310 3780423.723 1335810 3519532
63854 343351.0384 335470 402118
1201377 1907695.741 1582431 2371309
3383232 1583659.098 827633 1033066
1056700 2806451.312 2133952 4290742
7959 654696.4814 378942 815399
7408 558848.9724 332479 474227
80794535 158784759.7 142694538 205372152
3070766 4032986.774 4612772 5216388
13288822.13 17082431 14946226 Diabetes Page 86 of 603
6984954 8668501.98 6538057 11643998
2686515 3577213.93 2154693 3952625
1661280 1744434.586 657055 2195428
1661280 1744434.586 657055 2195428
6814104 29815506.6 17760614 34839301
37950015.3 24696830 47787048
4615 5387862.587 2278062 6751943 Page 87 of 603 Diabetes
peakarea manual peakarea manual 2 rep3 2 rep4 thresholded thresholded shSNRK/shGFP qvalues for SILAC 71534833 48280457 0.00034666 0.009488101
89837324 58763961 0.001335569 0.023035228
1169284 1603785 0.013434993 0.022627204
3926110 2920981 0.111502358 0.010406962
65597521 48636359 0.111841228 0.022143962
8562036 3454985 0.114699436 0.026299006
71237233 42559038 0.125084443 0.009488101
3964619 2685306 0.155559668 0.02461838
22959773 69077968 0.179278626 0.023035228 Diabetes Page 88 of 603
4691426 4358251 0.231427996 0.005885893
44584763 20616818 0.252417603 0.031260141
20136684 14373104 0.256751584 0.010406962
20136684 14373104 0.256751584 0.010406962
1852490 652666 0.29465573 0.030427144
2007571 1093527 0.381108001 0.022143962
78279280 28362725 0.386635652 0.029300234
4653659 2906722 0.396098721 0.039652747
6593261 1794099 0.41319811 0.044046738
3557023 3286208 0.415890688 0.006527052 Page 89 of 603 Diabetes
3557023 3286208 0.415890688 0.006527052
863431 1552384 0.43506414 0.022627204
2802997 3436580 0.448268822 0.02461838
2162834 800225 0.452822995 0.041736861
2174392 1000634 0.465518428 0.026008372
22209449 18515811 0.469753203 0.011398117
84277 2278865 0.491865993 0.028508578
15338550 21127501 0.501373438 0.029723372
52857029 38342329 0.508393927 0.02461838
21349787 0.517076529 0.02461838 Diabetes Page 90 of 603
3591707 1560907 0.556964247 0.035154749
3591707 1560907 0.556964247 0.035154749
976184 11070364 0.558845651 0.0388827
2339973 0.568742588 0.047041541
20818837 20641596 0.613638568 0.026963524
2706960 3762632 0.625185842 0.022143962
2706960 3762632 0.625185842 0.022143962
3766874 2605477 0.628250379 0.016086
3373866 3294588 0.65777658 0.031260141
4647663 1922412 0.66302452 0.039652747 Page 91 of 603 Diabetes
1350714 1290701 0.667890465 0.02461838
8443992 0.668178306 0.026441449
969331 916156 0.668328838 0.028508578
3296010 2911591 0.684277905 0.01143977
5377092 3365013 0.692931341 0.033543599
8443992 5793038 0.703092761 0.037014184
2019839 272085 0.704211953 0.026441449
5886331 1730245 0.708600644 0.022627204
1688118 1074153 0.714116165 0.044088092
1688118 1074153 0.714116165 0.044088092 Diabetes Page 92 of 603
17121789 16973653 0.720556367 0.02461838
116946 540080 0.730440895 0.027575892
1417096 1268981 0.735412932 0.031260141
10166190 0.73883014 0.046411288
2013317 872980 0.747145411 0.037074696
4456656 6685180 0.750961855 0.02461838
19754469 0.761040862 0.033543599
701984 651952 0.765240632 0.02461838
1468884 427682 0.771332187 0.02461838
1028426 8762355 0.774312473 0.039652747 Page 93 of 603 Diabetes
3040106 2066599 0.776967398 0.049744307
7941785 3724629 0.784477012 0.033543599
14074977 19397868 0.784844519 0.041736861
22252293 20624728 0.790772468 0.0490369
8324311 13637926 0.794300488 0.023035228
7424317 0.794605885 0.049445582
46767094 371401 0.795463314 0.025487227
14971320 13372070 0.79772469 0.026441449
8470294 0.801731553 0.034548735
3378188 1958143 0.801755671 0.02461838 Diabetes Page 94 of 603
3378188 1958143 0.801755671 0.02461838
19222492 21478142 0.802783454 0.030514486
9924361 5075077 0.803206141 0.033345923
1814984 2435138 0.80749197 0.035113117
1292558 227077 0.811182239 0.029709629
1292558 227077 0.811182239 0.029709629
1874748 2948086 0.8120211 0.036239668
19005364 8529308 0.826908589 0.031747009
19005364 8529308 0.826908589 0.031747009
5267677 1553998 0.833627036 0.0388827 Page 95 of 603 Diabetes
153562658 68796953 0.836968304 0.03461207
5677536 5493303 0.841464823 0.035154749
10933369 7490491 0.844706529 0.045307861
2640725 779960 0.851732546 0.026974997
5653091 4952745 0.856735589 0.036609927
1615445 2415786 0.858257462 0.043529901
1615445 2415786 0.858257462 0.043529901
1107863 1231557 0.863741478 0.034548735
9549752 10144476 0.866320332 0.044910374
1645142 2386529 0.866702579 0.046990182 Diabetes Page 96 of 603
3400506 6865848 0.871027873 0.034548735
562070 73746 0.874268807 0.031381487
2348698 1328344 0.877660039 0.031441733
1017598 3456339 0.879296103 0.046348557
3505526 1295585 0.885765301 0.047041541
769749 0.886524446 0.046953448
869841 0.89067818 0.032656278
204382161 82690189 0.89703881 0.043412508
2487128 3815660 0.897053926 0.041596747
7837809 0.899532388 0.02721905 Page 97 of 603 Diabetes
8435994 8055959 0.900060287 0.043939
5008502 3193036 0.90010329 0.039652747
2259000 1866256 0.900957148 0.045497702
2259000 1866256 0.900957148 0.045497702
59031890 7630221 0.925893276 0.026642592
41366168 0.928056178 0.049937177
7133583 0.947176949 0.044088092 Diabetes Page 98 of 603
isolated mass mass error timepoints timepoints xcorr timepoints ascorr timepoints 794.337095 0.303590126 50.23 100
1118.188228 0.333775769 20.91 9.782928361
355.8419777 0.956348295 24.45 100
514.245235 1.500754468 25.91
838.38702 0.11218745 63.8 70.79450791
890.36169 0.456252543 23.48 52.30935402
506.23904 1.510671379 33.37 31.09144469
466.8767037 0.423990705 23.71 7.87106093
932.1547815 0.246940268 23.06 100 Page 99 of 603 Diabetes
641.323725 1.484035873 30.35 100
637.6420877 0.554185727 22.02 16.83853399
515.75671 0.133914776 22.82 93.04804387
515.756895 0.492961462 31.96 21.21395681
650.27203 0.213922378 46.08 13.3355922
757.346125 0.443949705 37.64 47.79906413
982.0981407 1.048813336 21.21 35.13058657
450.17291 0.5025916 28.67 100
591.253535 0.424883695 30.04 100
626.289855 0.361145697 29.42 Diabetes Page 100 of 603
626.29095 1.388650713 24.18 16.80486599
724.9692937 0.224125129 24.93 12.33468246
627.6047937 0.732135325 36.93 19.69505857
485.5592907 0.104491532 34.6 11.95526977
630.9547707 0.189332863 25.31 24.6363937
624.276425 0.639655989 26.44 18.66287339
1232.901364 0.221008551 51.18 5.14104821
926.3925737 0.746445156 44.16 100
576.76306 0.41474376 25.32 100
1142.030025 0.3801927 25.5 25.44112358 Page 101 of 603 Diabetes
1026.43896 0.585806908 58.39 12.08620484
1022.4317 0.744670811 52.84 6.532125138
712.3209815 0.25647673 21.4 18.26209739
862.7404137 0.391693364 26.7 10.88136089
631.9716137 0.500026322 29.66
1009.145261 0.944661842 44.9 1.191864077
1014.489131 1.99181125 27.09
1021.429745 0.537747047 49.11 8.223549129
694.6230437 0.678721755 28.73 5.624397344
1160.452755 0.190525598 52.51 42.29987946 Diabetes Page 102 of 603
538.262325 0.277075951 23.81 13.89166084
1313.62109 0.830847231 27.29 37.29610889
807.860715 0.335663125 62.12
1030.774168 1.0610593 20.67
423.1882907 0.353437643 29.7 100
1318.62744 0.852727184 52.69 16.94605199
737.5992407 0.935415115 28.86 59.02161579
482.69253 0.661566461 36.34 16.11801956
731.2762407 0.612278182 29.68 20.60548934
731.2756907 1.365080253 25.74 13.69411045 Page 103 of 603 Diabetes
814.370055 1.383519425 61.67 43.44753708
686.9787577 0.499776162 28.1 33.71036904
600.27551 0.526866987 28.68 40.88392291
1028.931149 0.228073861 25.89 17.18856655
734.9561107 0.904281533 38.26 17.86199421
516.723325 0.360311712 36.55 39.91270389
799.6463577 0.826475751 30.04 20.41907798
468.5320107 0.799383584 23.1 14.68618567
524.28253 0.093550925 34.04 13.97940009
604.313475 0.205362669 20.08 27.68094734 Diabetes Page 104 of 603
618.81573 0.532093749 27.47 27.60422483
876.89575 0.820409025 94.75 97.52191314
773.32025 0.725916071 89.84 38.16970038
568.761715 0.21293142 25.32 100
964.3670007 1.332371085 51.78 100
1033.418941 0.241427214 21 16.34807418
1371.573848 1.254404946 47.36 46.03392095
921.7462737 0.048132177 23.9 28.13595755
710.86224 1.927195634 26.25 9.120448296
910.45428 1.273695456 45.75 57.22701588 Page 105 of 603 Diabetes
910.45471 1.746247733 55.91 20.09597766
597.6098607 0.534951952 28.58 8.368586662
526.9200407 0.558671399 20.5 33.43996719
673.3151807 0.377614498 27.99 13.09984838
647.9358477 0.08291306 25.51 18.35551185
647.9360937 0.297147935 23.85 14.23968294
427.5588337 0.103852542 20.79 100
866.0656707 0.696407137 50.66 24.33188829
866.0648777 0.219938518 25.46 3.521825181
623.9936485 0.825527069 27.68 13.00153518 Diabetes Page 106 of 603
1279.012815 1.806009717 63.45 63.34850278
684.9956637 0.397959554 24.68 17.65338202
706.3527807 1.127988 22.08 6.575773192
607.781005 0.429787134 23.4 100
999.949155 0.07103939 43.5 18.22821645
766.32342 0.477919228 45.84 13.4324443
766.32324 0.712961639 40.54 6.766936096
348.693785 0.103391782 20.1 100
640.9522677 1.276002748 28.01 19.7008109
884.3989207 0.006789424 26.2 10.92545208 Page 107 of 603 Diabetes
855.0097607 1.374162992 37.67 19.06660739
794.80383 0.372655077 83.67 19.08485019
794.85638 0.592935574 58.68 42.42791361
621.5176355 1.294376533 23.23 30.59621724
1045.9624 0.477302422 26.5
973.848445 0.689375434 58.15 100
738.778255 0.827605317 46.83 100
1040.51501 0.874028903 43.39 103.093026
1001.159238 0.119608331 25.99 6.777807053
616.9929177 1.259624166 33.99 100 Diabetes Page 108 of 603
793.3828707 0.568512944 33.91 39.24026127
635.2666 0.99407186 65.82 25.42179704
874.0402807 0.35189412 23.21 10.18885344
871.3687707 0.475480998 22.49 4.58637849
726.778685 0.249216877 62.96 100
1036.089231 0.831226522 31.15 53.55126562
1374.045775 0.137600438 72.5 100 Page 109 of 603 Diabetes
spectral score charge state delta cn drosophila CG timepoints timepoints timepoints accession number 0.839308022 2 0
0.163441795 3 0
0.82904404 3 0
0.170265301 2 0
0.886232417 2 0
0.036569372 2 0
0.885815982 2 0
0.408155294 3 0
0.873407817 4 0 Diabetes Page 110 of 603
0.131338908 2 0
0.671118855 3 0
0.279916258 2 0
0.529475962 2 0
0.96230606 2 0
0.893170789 2 0
0.692095648 3 0
0.489963992 2 0
0.892814274 2 0
0.789363175 2 0 Page 111 of 603 Diabetes
0.509021253 2 0
0.710332007 3 0
0.524301405 3 0
0.585660678 3 0
0.676538399 3 0
0.737585232 2 0
0.858185602 3 0
0.833952626 3 0
0.837612638 2 0
0.716008431 2 0 Diabetes Page 112 of 603
0.859201215 2 0
0.784245014 2 0
0.769222797 4 0
0.631844025 3 0
0.78148677 3 0
0.394064622 3 0
0.145689352 3 0
0.761039435 2 0
0.85760058 3 0
0.854169817 2 0 Page 113 of 603 Diabetes
0.731066548 2 0
0.707875755 2 0
0.93169221 2 0
0.173989194 3 0
0.924968819 3 0
0.868256374 2 0
0.766994268 3 0
0.921666608 2 0
0.867700402 3 0
0.941869077 3 0 Diabetes Page 114 of 603
0.887926545 2 0
0.593481211 3 0
0.713377661 2 0
0.59111672 4 0
0.696867785 3 0
0.957346403 2 0
0.963441941 3 0
0.862405608 3 0
0.77350172 2 0
0.687963568 2 0 Page 115 of 603 Diabetes
0.753416787 2 0
0.982451095 2 0
0.982023417 2 0
0.841218318 2 0
0.932193724 3 0
0.862111087 3 0
0.756407978 3 0
0.681503539 3 0
0.686659829 2 0
0.790521826 2 0 Diabetes Page 116 of 603
0.790141074 2 0
0.442444301 3 0
0.645254227 3 0
0.343257923 3 0
0.837781341 3 0
0.786978284 3 0
0.271835029 3 0
0.630009758 3 0
0.548409959 3 0
0.912716885 4 0 Page 117 of 603 Diabetes
0.899739225 2 0
0.431952483 3 0
0.922613475 3 0
0.588226645 2 0
0.82523021 2 0
0.65470437 2 0
0.815744978 2 0
0.16628827 2 0
0.752950205 3 0
0.774886498 3 0 Diabetes Page 118 of 603
0.667957335 3 0
0.945276372 2 0
0.944162175 2 0
0.751444042 4 0
0.369874908 2 0
0.399102685 2 0
0.933150201 2 0
0.64783811 2 0
0.54556238 3 0
0.624499688 3 0 Page 119 of 603 Diabetes
0.550880576 3 0
0.949929746 2 0
0.769680547 3 0
0.285209129 3 0
0.977002589 2 0
0.950363538 3 0
0.94757577 2 0 Diabetes Page 120 of 603
gi name species IPI accession swissprot gi species adjust adjust number accession 50403784 Vinculin Q64727 VINC_MOUSE (Metavinculin) [MASS=116717]
81865757 Serologically Q80UF4 SDCG8_MOUSE defined colon cancer antigen 8 homolog 94717658 Myosin(Centrosomal light chain colon B1B1A8 B1B1A8_MOUSE kinase, smooth muscle (MLCK) (Telokin) (Kinase- 74190979 unnamedrelated protein) protein Q3UGF0 Q3UGF0_MOUSE product [Mus musculus] 341942107 RecName: A2AQD5 A2AQD6_MOUSE Full=Sperm-specific antigen 2 homolog; AltName: Full=Ki- 83305641 U1ras-induced small nuclear actin- Q99LY5 Q99LY5_MOUSE ribonucleoprotein 70 kDa (U1 SNRNP 70 kDa) (snRNP70) 34098397 SAM and SH3 P59808 SASH1_MOUSE domains containing protein 1
187957400 Ppfia1 protein [Mus B2RXW8 B8QI33_MOUSE musculus] [MASS=140134]
2498444 Histone D3YYI8 HDAC1_MOUSE deacetylase 1 (HD1) Page 121 of 603 Diabetes
41688745 Treacle protein O08784 TCOF_MOUSE (Treacher Collins syndrome protein homolog) 46577497 Regulatory Q8K4Q0 A2ACM0_MOUSE associated protein of mTOR (Raptor) (P150 target of 81883938 Programmedrapamycin (TOR)- cell Q61823 PDCD4_MOUSE death protein 4 (Topoisomerase- inhibitor 81883938 Programmedsuppressed cell Q61823 PDCD4_MOUSE death protein 4 (Topoisomerase- inhibitor 547739 INSULINsuppressed P35569 Q543V3_MOUSE RECEPTOR SUBSTRATE-1
13124192 Elongation factor 1- Q91VK2 Q91VK2_MOUSE delta (EF-1-delta)
341942283 RecName: Q64213 SF01_MOUSE Full=Splicing factor 1; AltName: Full=CW17; 73921754 PlasmalemmaAltName: G3X924 PLVAP_MOUSE vesicle-associated protein (Plasmalemma 81883604 Splicingvesicle protein factor, 1) Q5U4C3 SFR19_MOUSE arginine/serine-rich 19
464506 Pyruvate Q05920 Q3T9S7_MOUSE carboxylase, mitochondrial precursor (Pyruvic carboxylase) (PCB) Diabetes Page 122 of 603
464506 Pyruvate Q05920 Q3T9S7_MOUSE carboxylase, mitochondrial precursor (Pyruvic 156633606 Rabcarboxylase) GTPase- (PCB) A2AWA9 A2AWA7_MOUSE activating protein 1 (Rab6 GTPase- activating protein 123779669 PhosphatidylinositolGAPCenA) (GAP Q2TBE6 P4K2A_MOUSE 4-kinase type 2- alpha (Phosphatidylinosit 77416393 CLIP-associatingol 4-kinase type II- B9EJA4 Q08EB6_MOUSE protein 2 (Cytoplasmic linker- associated protein 81906074 Uncharacterized2) Q9DB90 SMG9_MOUSE protein C19orf61 homolog
347595715 RecName: A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: 81884028 SerumFull=Plenty-of- deprivation- Q63918 SDPR_MOUSE response protein (Phosphatidylserine- binding protein) 61248556 THUMP domain Q99J36 THUM1_MOUSE containing protein 1
2498751 Astrocytic Q62048 PEA15_MOUSE phosphoprotein PEA-15
81862571 Acetyl-CoA Q5SWU9 ACACA_MOUSE carboxylase 1 (ACC-alpha) (Acetyl-CoA carboxylase 265) Page 123 of 603 Diabetes
38372553 Trans-Golgi Q62313 TGON1_MOUSE network integral membrane protein 1 precursor 38372553 Trans-Golgi(TGN38A) Q62313 TGON1_MOUSE network integral membrane protein 1 precursor 71153232 Cleavage(TGN38A) Q99LI7 CSTF3_MOUSE stimulation factor 77 kDa subunit (CSTF 77 kDa 123447 Hemesubunit) oxygenase (CstF-77) 1 P14901 HMOX1_MOUSE (HO-1) (P32 protein)
14916570 Ras-GTPase- P97379 G3BP2_MOUSE activating protein binding protein 2 (GAP SH3-domain 81902126 Paxillinbinding protein 2) Q8VI36 PAXI_MOUSE
81902126 Paxillin Q8VI36 PAXI_MOUSE
38372554 Trans-Golgi Q62314 TGON2_MOUSE network integral membrane protein 2 precursor 81881579 Pre-mRNA(TGN38B) 3'-end- Q9D824 D3Z619_MOUSE processing factor FIP1 (FIP1-like 1)
14194972 Nuclear factor 1 A- B1AUB9 NFIA_MOUSE type (Nuclear factor 1/A) (NF1-A) (NFI- A) (NF-I/A) (CCAAT- box binding Diabetes Page 124 of 603
341942061 RecName: O89032 SPD2A_MOUSE Full=SH3 and PX domain-containing protein 2A; 81896337 Patatin-likeAltName: Full=Five Q8BJ56 PLPL2_MOUSE phospholipase domain-containing protein 2 (Adipose 6685240 [3-methyl-2-triglyceride lipase) O55028 D3Z7R0_MOUSE oxobutanoate dehydrogenase [lipoamide]] kinase, 81896427 Proteinmitochondrial FAM73B Q8BK03 FA73B_MOUSE
341940275 RecName: Q9JLV1 BAG3_MOUSE Full=BAG family molecular chaperone 81896337 Patatin-likeregulator 3; Q8BJ56 PLPL2_MOUSE phospholipase domain-containing protein 2 (Adipose 205829307 RecName:triglyceride lipase) E9QPD4 E9QPD4_MOUSE Full=Oxysterol- binding protein 1 [MASS=84689] 14193672 ATP citrate lyase Q3TS02 Q3V117_MOUSE [Mus musculus]
81862464 Cisplatin resistance- Q5SUF2 LC7L3_MOUSE associated overexpressed protein 81862464 Cisplatin resistance- Q5SUF2 LC7L3_MOUSE associated overexpressed protein Page 125 of 603 Diabetes
46396418 Oxysterol binding Q8CI95 OSR11_MOUSE protein-related protein 11 (OSBP- related protein 11) 50401639 Translocation(ORP-11) Q91V04 TRAM1_MOUSE associated membrane protein 1 19909186 translocated Q7M739 Q7M739_MOUSE promoter region protein [Mus musculus] 56749456 Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] 543921 Calnexin precursor P35564 CALX_MOUSE
81881209 Proline-rich AKT1 Q9D1F4 AKTS1_MOUSE substrate 1 (Proline- rich AKT substrate)
57015348 High mobility group P17095 HMGIY_MOUSE protein HMG- I/HMG-Y (HMG- I(Y)) (High mobility 110816418 SRAgroup stem-loop- AT-hook 1) Q9D8T7 SLIRP_MOUSE interacting RNA- binding protein, mitochondrial 341941975 RecName:precursor Q6QI06 RICTR_MOUSE Full=Rapamycin- insensitive companion of 47605501 Bcl-2-associatedmTOR; AltName: Q8K019 Q3UR37_MOUSE transcription factor 1 (Btf) [MASS=106001] Diabetes Page 126 of 603
125987710 Ankyrin repeat Q8C0J6 ANR57_MOUSE domain-containing protein 57 [MASS=54938] 148704095 mCG2476 [Mus IPI00761751.2 Q6A029_MOUSE musculus] [MASS=212836]
6093508 BCL2/adenovirus O55003 BNIP3_MOUSE E1B 19-kDa protein- interacting protein 3
73621447 RNA-binding Q8C2Q3 RBM14_MOUSE protein 14 (RNA- binding motif protein 14) 81875212 Translocation Q8BU14 SEC62_MOUSE protein SEC62 (Translocation protein 1) (TP-1) 56749456 Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] 56749456 Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] 1709091 Cation-independent Q07113 MPRI_MOUSE mannose-6- phosphate receptor precursor (CI Man- 81896427 Protein6-P receptor) FAM73B (CI- Q8BK03 FA73B_MOUSE
148704095 mCG2476 [Mus IPI00761751.2 Q6A029_MOUSE musculus] [MASS=212836] Page 127 of 603 Diabetes
148704095 mCG2476 [Mus IPI00761751.2 Q6A029_MOUSE musculus] [MASS=212836]
218512063 RecName: Q9Z1E4 GYS3_MOUSE Full=Glycogen [starch] synthase, muscle 123231522 ATP citrate lyase Q3TS02 Q3V117_MOUSE [Mus musculus] [MASS=53705]
341941109 RecName: Q60902 Q3UIS9_MOUSE Full=Epidermal growth factor receptor substrate 91208163 RNA15-like polymerase- 1; AltName: Q62018 CTR9_MOUSE associated protein CTR9 homolog (SH2 domain- 91208163 RNAbinding polymerase- protein 1) Q62018 CTR9_MOUSE associated protein CTR9 homolog (SH2 domain- 37675525 AHNAKbinding protein[Mus 1) IPI00553798.2 musculus] [MASS=224129]
14194972 Nuclear factor 1 A- B1AUB9 NFIA_MOUSE type (Nuclear factor 1/A) (NF1-A) (NFI- A) (NF-I/A) (CCAAT- 14194972 Nuclearbox binding factor 1 A- B1AUB9 NFIA_MOUSE type (Nuclear factor 1/A) (NF1-A) (NFI- A) (NF-I/A) (CCAAT- 54041237 cAMP-dependentbox binding P31324 KAP3_MOUSE protein kinase type II-beta regulatory subunit Diabetes Page 128 of 603
81913131 EH domain- Q8R2X0 EHD2_MOUSE containing protein 2
51316833 Sec1 family domain Q8BRF7 SCFD1_MOUSE containing protein 1 (Syntaxin binding protein 1-like 2) 13878552 Probable kinesin Q9DBS5 KLC8_MOUSE light chain 3 (KLC 3)
34921544 Eukaryotic Q60876 4EBP1_MOUSE translation initiation factor 4E binding protein 1 (4E-BP1) 46577497 Regulatory(eIF4E-binding Q8K4Q0 A2ACM0_MOUSE associated protein of mTOR (Raptor) (P150 target of 126752 Myristoylatedrapamycin (TOR)- P26645 MARCS_MOUSE alanine-rich C- kinase substrate (MARCKS) 126752 Myristoylated P26645 MARCS_MOUSE alanine-rich C- kinase substrate (MARCKS)
81880234 SH3 domain- Q99LH9 Q80TA2_MOUSE binding protein 5- like
122065842 Membrane- Q80UU9 PGRC2_MOUSE associated progesterone receptor component 2 Page 129 of 603 Diabetes
543921 Calnexin precursor P35564 CALX_MOUSE
114152851 Protein Njmu-R1 Q9CYI0 NJMU_MOUSE
2493259 Protein tyrosine Q62130 PTN14_MOUSE phosphatase, non- receptor type 14 (Protein-tyrosine 543921 Calnexinphosphatase precursor P35564 CALX_MOUSE
38372554 Trans-Golgi Q62313 TGON2_MOUSE network integral membrane protein 2 precursor 119362 Endoplasmin(TGN38B) P08113 Q3TUD6_MOUSE precursor (Endoplasmic reticulum protein 50400986 Nuclear99) (94 kDaubiquitous Q80XU3 NUCKS_MOUSE casein and cyclin- dependent kinases substrate (JC7) 85690846 Hormone-sensitive P54310 Q8CDI9_MOUSE lipase (HSL)
145566774 Enhancer of mRNA- Q3UJB9 EDC4_MOUSE decapping protein 4 [MASS=152483]
146345481 Phosphoglycerate P09411 PGK1_MOUSE kinase 1 Diabetes Page 130 of 603
160017861 Ankyrin repeat Q99NH0 ANR17_MOUSE domain-containing protein 17 (Gene trap ankyrin repeat 30580337 Ankyrinprotein) repeat(Ankyrin and Q3UHP6 Q3UHP6_MOUSE SAM domain containing protein 1 [MASS=125241] 81895299 Ubiquitin- Q80X50 UBP2L_MOUSE associated protein 2-like
81895299 Ubiquitin- Q80X50 UBP2L_MOUSE associated protein 2-like
81884028 Serum deprivation- Q63918 SDPR_MOUSE response protein (Phosphatidylserine- binding protein) 56749456 Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] 56417892 ATP-binding Q6P542 Q5RL55_MOUSE cassette, sub- family F, member 1 [MASS=94945] Page 131 of 603 Diabetes
mass error minimum across reversed databse hprd accession string accession timepoints direction 372509 0.303590126 F
374312 0.333775769 F
372961 0.956348295 F
1.500754468 F
374553 0.11218745 F
0.456252543 F
06408_1 371036 1.510671379 F
380301 0.423990705 F
388438 0.246940268 F Diabetes Page 132 of 603
388032 1.484035873 F
373935 0.554185727 F
373669 0.133914776 F
373669 0.492961462 F
384184 0.213922378 F
00560_2 386762 0.278789799 F
03306_4 387518 1.048813336 F
369928 0.5025916 F
390221 0.213288184 F
384196 0.361145697 F Page 133 of 603 Diabetes
384196 1.388650713 F
377490 0.224125129 F
373759 0.732135325 F
12054_1 389923 0.104491532 F
369913 0.189332863 F
10441_1 375402 0.434453532 F
382219 0.221008551 F
376371 0.746445156 F
04579_1 370921 0.41474376 F
01938_7 371924 0.3801927 F Diabetes Page 134 of 603
385289 0.585806908 F
385289 0.744670811 F
02651_1 374602 0.25647673 F
370331 0.391693364 F
375703 0.500026322 F
390839 0.944661842 F
390839 1.99181125 F
0.537747047 F
09646_1 388692 0.678721755 F
09007_1 387260 0.190525598 F Page 135 of 603 Diabetes
10228_1 389158 0.277075951 F
373907 0.830847231 F
385760 0.335663125 F
388009 1.0610593 F
376328 0.150684428 F
373907 0.816313151 F
391674 0.935415115 F
00155_2 370550 0.661566461 F
16759_2 0.612278182 F
16759_2 1.365080253 F Diabetes Page 136 of 603
378244 0.339121636 F
374054 0.499776162 F
370415 0.526866987 F
382871 0.128869072 F
371849 0.904281533 F
12441_3 380756 0.011622954 F
02829_7 383821 0.826475751 F
387847 0.799383584 F
10682_1 381260 0.093550925 F
379214 0.205362669 F Page 137 of 603 Diabetes
394572 0.532093749 F
377998 0.32976123 F
376404 0.218680392 F
11485_1 370479 0.21293142 F
374856 0.447236316 F
382871 0.241427214 F
382871 0.009239668 F
373169 0.048132177 F
12965_1 388009 1.927195634 F
377998 0.19891218 F Diabetes Page 138 of 603
377998 1.746247733 F
00721_1 370159 0.534951952 F
00155_1 0.558671399 F
09445_1 370451 0.377614498 F
370357 0.08291306 F
370357 0.297147935 F
391797 0.103852542 F
387260 0.696407137 F
387260 0.219938518 F
01486_1 370027 0.825527069 F Page 139 of 603 Diabetes
0.102463285 F
372116 0.397959554 F
370111 1.127988 F
376603 0.171256073 F
373935 0.07103939 F
394614 0.158000569 F
394614 0.712961639 F
0.103391782 F
386565 1.276002748 F
382466 0.006789424 F Diabetes Page 140 of 603
371849 1.374162992 F
11392_1 386755 0.139745621 F
04402_1 374357 0.284508277 F
371849 1.294376533 F
385289 0.477302422 F
01860_1 371684 0.689375434 F
383895 0.827605317 F
370042 0.874028903 F
06911_1 378130 0.119608331 F
02412_1 390412 1.259624166 F Page 141 of 603 Diabetes
391130 0.125308239 F
10610_1 373326 0.033083184 F
384755 0.35189412 F
384755 0.475480998 F
382219 0.166603534 F
382871 0.347041493 F
377554 0.131776116 F Diabetes Page 142 of 603
xcorr max across Go location Go bio process Go mol process timepoints unique index unqiue index unique index 50.23 membrane cell adhesion protein binding
20.91 centrosome Ras protein signal protein binding transduction
24.45 cytoplasm protein amino acid ATP binding intracellular phosphorylation
25.91
63.8 cytoplasm oxidation reduction oxidoreductase activity
23.48 nucleus nuclear mRNA protein binding splicing, via spliceosome regulation of RNA 33.37 centrosome cellsplicing cycle protein binding
23.71 Golgi cisterna transmembrane protein binding membrane transport nucleus regulation of transcription, DNA- 23.06 nucleus regulationdependent of protein binding transcription Page 143 of 603 Diabetes
30.35 nucleus transport cobalt ion binding transcription of zinc ion binding nuclear rRNA large RNA polymerase I 22.02 TORC1 complex regulationtranscript of cell protein binding size
22.82 nucleus apoptosis protein binding cell aging
31.96 nucleus apoptosis protein binding cell aging
46.08 nucleus signal transduction protein binding response to peptide hormone stimulus
37.64 eukaryotic translation protein binding translation translation elongation factor 1 elongation factor complex activity 21.21 nucleus regulation of protein binding clathrin coat transcription zinc ion binding mitochondrion male sex determination 28.67 nucleus mRNA processing nucleotide binding integral to transport protein membrane actin filament homodimerization organization activity 30.04 nucleus mRNA processing RNA binding
29.42 cytoplasm metabolic process ATP binding Diabetes Page 144 of 603
24.18 cytoplasm metabolic process ATP binding
24.93 cytoplasm cell cycle GTPase activator activity
36.93 membrane phosphatidylinositol ATP binding biosynthetic process
34.6 cytoplasm cell cycle protein binding intracellular translational binding Golgi apparatus termination modification- 25.31 intracellular nuclear-transcribeddependent protein protein binding mRNA catabolic process, nonsense- mediated decay 26.44 nucleus mRNA processing DNA binding spliceosomal protein binding complex lysophospholipase activity 51.18 membrane cell adhesion proteinzinc ion binding binding
44.16
25.32 cytoplasm transport protein binding mitochondrion regulation of apoptosis
25.5 cytoplasm metabolic process protein binding Page 145 of 603 Diabetes
58.39 integral to peptide cross- protein binding membrane linking
52.84 integral to peptide cross- protein binding membrane linking
21.4 nucleus mRNA processing protein binding
26.7 nucleus oxidation reduction metal ion binding
29.66 intracellular transport protein binding
44.9 cytoplasm cell adhesion protein binding
27.09 cytoplasm cell adhesion protein binding
49.11 integral to peptide cross- protein binding membrane linking
28.73 nucleus mRNA processing RNA binding
52.51 nucleus regulation of protein binding transcription, DNA- DNA binding dependent Diabetes Page 146 of 603
23.81 cytoplasm cell communication protein binding integral to membrane dynein complex 27.29 integral to metabolic process hydrolase activity membrane
62.12 mitochondrion signal transduction protein binding
20.67 integral to oxidation reduction protein binding membrane
29.7 cytosol apoptosis protein binding
52.69 integral to metabolic process hydrolase activity membrane
28.86 membrane transport protein binding
36.34 cytoplasm metabolic process ATP binding intracellular acetyl-CoA protein binding integral to biosynthetic binding membrane process 29.68 nucleusintrinsic to apoptosis protein binding
25.74 nucleus apoptosis protein binding Page 147 of 603 Diabetes
61.67 endoplasmic transport protein binding reticulum lumen GTP binding nucleus
28.1 integral to transport protein binding membrane
28.68 cytoplasm translation protein binding nuclear pore mitotic cell cycle spindle assembly checkpoint 25.89 nucleus regulation of protein binding transcription
38.26 integral to protein folding protein binding membrane
36.55 cytoplasm negative regulation protein binding of protein kinase activity
30.04 nucleus regulation of protein binding transcription, DNA- DNA binding dependent
23.1 nucleus regulation of nucleotide binding transcription
34.04 intracellular multicellular binding organismal protein binding development
20.08 nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription Diabetes Page 148 of 603
27.47
94.75 cytoplasm steroid metabolic protein binding process
89.84 integral to apoptosis protein membrane response to homodimerization hypoxia activity
25.32 nucleus regulation of nucleotide binding intracellular transcription transcription factor oxidation reduction complex positive regulation 51.78 integral to transportof transcription protein transporter membrane activity
21 nucleus regulation of protein binding transcription
47.36 nucleus regulation of protein binding transcription
23.9 integral to transport protein binding membrane
26.25 integral to multicellular protein binding membrane organismal development oxidation reduction 45.75 cytoplasm steroid metabolic protein binding process Page 149 of 603 Diabetes
55.91 cytoplasm steroid metabolic protein binding process
28.58 cytoplasm heart development protein binding ribonucleoprotein glycogen glycogen (starch) complex biosynthetic synthase activity process 20.5 cytoplasm metabolic process ATP binding intracellular acetyl-CoA protein binding biosynthetic process 27.99 nucleus endocytosis protein binding integral to proteasomal calcium ion binding membrane ubiquitin-dependent receptor activity myofibril protein catabolic 25.51 nucleustranscription factor histoneprocess H2B protein binding ubiquitination
23.85 nucleus histone H2B protein binding ubiquitination
20.79 nucleus nervous system protein binding development
50.66 nucleus regulation of protein binding transcription, DNA- dependent
25.46 nucleus regulation of protein binding transcription, DNA- dependent
27.68 cytoplasm signal transduction nucleotide binding cytosol protein amino acid cAMP-dependent phosphorylation protein kinase complex Diabetes Page 150 of 603
63.45 membrane endocytosis protein binding
24.68 membrane transport protein binding
22.08 microtubule intraflagellar protein binding transport
23.4 nucleus regulation of protein binding translation
43.5 TORC1 complex regulation of cell protein binding size
45.84 membrane protein amino acid actin binding phosphorylation
40.54 membrane protein amino acid actin binding phosphorylation
20.1
28.01
26.2 integral to axon guidance protein binding membrane metabolic process Page 151 of 603 Diabetes
37.67 integral to protein folding protein binding membrane
83.67 cellular_component spermatogenesis molecular_function
58.68 cytoplasm protein amino acid binding dephosphorylation
23.23 integral to protein folding protein binding membrane
26.5 integral to peptide cross- protein binding membrane linking
58.15 endoplasmic protein folding ATP binding reticulum protein transport protein binding peroxisome
46.83 nucleus in utero embryonic metal ion binding development double-stranded regulation of cell DNA binding cycle 43.39 nucleus metabolic process protein binding cytosol
25.99 nucleus immune response protein binding biological_process transport
33.99 cytoplasm glycolysis ATP binding integral to carbohydrate transferase activity membrane metabolic process Diabetes Page 152 of 603
33.91 nucleus mismatch repair ATP binding
65.82 cytoplasm cell cycle protein binding synapse biological_process embryo implantation 23.21 cellular_component modification- protein binding nucleus dependent protein endosome catabolic process blood coagulation 22.49 cellular_component modification- protein binding nucleus dependent protein endosome catabolic process blood coagulation 62.96 membrane cell adhesion protein binding
31.15 nucleus regulation of protein binding transcription
72.5 ribosome transport ATP binding metabolic process Page 153 of 603 Diabetes
Kegg unique index Regulation of actin cytoskeleton Focal adhesion Leukocyte transendothelial
Calcium signaling pathway Regulation of actin cytoskeleton Vascular smooth
Spliceosome
Pathways in cancer Huntington's disease Chronic myeloid leukemia Diabetes Page 154 of 603
Insulin signaling pathway mTOR signaling pathway
Aldosterone- regulated sodium reabsorption Insulin signaling pathway
Spliceosome
Pyruvate metabolism Citrate cycle (TCA cycle) Page 155 of 603 Diabetes
Pyruvate metabolism Citrate cycle (TCA cycle)
Pyruvate metabolism Propanoate metabolism Fatty acid Diabetes Page 156 of 603
Porphyrin and chlorophyll metabolism
Regulation of actin cytoskeleton Focal adhesion Chemokine Regulationsignaling pathway of actin cytoskeleton Focal adhesion Chemokine signaling pathway Page 157 of 603 Diabetes
Citrate cycle (TCA cycle) Reductive carboxylate cycle (CO2 fixation) Diabetes Page 158 of 603
Pathways in cancer MAPK signaling pathway - yeast Thyroid cancer
Antigen processing and presentation
mTOR signaling pathway Page 159 of 603 Diabetes
Protein export
Lysosome Diabetes Page 160 of 603
Starch and sucrose metabolism Insulin signaling pathway Citrate cycle (TCA cycle) Reductive carboxylate cycle (CO2 fixation)
Insulin signaling pathway Apoptosis Page 161 of 603 Diabetes
Endocytosis
Insulin signaling pathway ErbB signaling pathway InsulinmTOR signaling pathway mTOR signaling pathway Fc gamma R- mediated phagocytosis
Fc gamma R- mediated phagocytosis
Glycolysis / Gluconeogenesis Glycerolipid metabolism Glycerophospholipi Diabetes Page 162 of 603
Antigen processing and presentation
Antigen processing and presentation
Pathways in cancer Plant-pathogen interaction Prostate cancer NOD-like receptor
Insulin signaling pathway
RNA degradation
Glycolysis / Gluconeogenesis Carbon fixation in photosynthetic organisms Page 163 of 603 Diabetes Diabetes Page 164 of 603
timecourse manual naming::protein name counter manual all protein name index 1960025 Likely ortholog of H. sapiens chromosome 9 Manual Assigned open reading frame 138 (C9orf138) Name:Likely ortholog of H. sapiens chromosome 9 open reading frame 138 (C9orf138) 1959390 Card6 caspase recruitment domain family, ManualSwissPROT>B1AXP3_MOUS Assigned member 6 Name:Card6 caspase recruitment domain family, member 6 1960315 AP2-associated protein kinase 1 ManualSwissPROT>Q8BWE0_MOU Assigned Name:AP2- associated protein kinase 1 HPRD>10620_1>T620S623> AP2 associated kinase 1 1960292 Serine/threonine-protein kinase SIK2 ManualSwissPROT>AAK1_MOUSE> Assigned Name:Serine/threonine- protein kinase SIK2 HPRD>12348_1>S358>Salt 1959732 Interferon-induced helicase C domain- Manualinducible Assigned kinase 2 containing protein 1 Name:Interferon-induced helicase C domain-containing protein 1 1960434 Z-DNA-binding protein 1 ManualSwissPROT>IFIH1_MOUSE> Assigned Name:Z- DNA-binding protein 1 SwissPROT>A2APF7_MOUS E>Z-DNA binding protein 1 1960406 Phosphatidylinositol 4-kinase beta ManualOS=Mus Assigned musculus GN=Zbp1 Name:Phosphatidylinositol 4- kinase beta HPRD>11805_1>S523>Phos 1960193 RNA binding motif protein 15 Manualphatidylinositol Assigned 4 kinaseName:RNA binding motif protein 15 SwissPROT>Q0VBL3_MOUS E>S655>RNA binding motif 1959318 182 kDa tankyrase-1-binding protein Manualprotein 15Assigned OS=Mus Name:182 musculus kDa tankyrase-1-binding protein SwissPROT>TB182_MOUSE >S429>182 kDa tankyrase-1- Page 165 of 603 Diabetes
1959993 Transmembrane and coiled-coil domains Manual Assigned protein 2 Name:Transmembrane and coiled-coil domains protein 2 HPRD>11040_1>S438>Cere 1960336 Testis expressed gene 2 Manualbral protein Assigned 11 Name:Testis expressed gene 2 HPRD>13716_1>S196>HT00 1959476 Protein PML Manual8 protein Assigned Name:Protein PML SwissPROT>D3YXR5_MOUS E>S515>Uncharacterized 1959737 Protein PML Manualprotein OS=MusAssigned musculus Name:Protein PML SwissPROT>D3YXR5_MOUS E>T527>Uncharacterized 1960353 Protein PML Manualprotein OS=MusAssigned musculus Name:Protein PML SwissPROT>D3YXR5_MOUS E>S528>Uncharacterized 1960213 Interferon-induced, double-stranded RNA- Manualprotein OS=MusAssigned musculus activated protein kinase Name:Interferon-induced, double-stranded RNA- activated protein kinase 1960068 Protein PML ManualSwissPROT>E2AK2_MOUSE Assigned Name:Protein PML SwissPROT>D3YXR5_MOUS E>S514S515>Uncharacterize 1960312 Akap13 A kinase (PRKA) anchor protein 13 Manuald protein Assigned OS=Mus musculus Name:Akap13 A kinase (PRKA) anchor protein 13 HPRD>05253_1>S1933>A 1959855 Receptor-interacting serine/threonine-protein Manualkinase anchoring Assigned protein 13 kinase 2 Name:Receptor-interacting serine/threonine-protein kinase 2 1959998 Mitogen-activated protein kinase kinase ManualSwissPROT>RIPK2_MOUSE Assigned kinase kinase 5 Name:Mitogen-activated protein kinase kinase kinase kinase 5 SwissPROT>M4K5_MOUSE> Diabetes Page 166 of 603
1960018 Transcription intermediary factor 1-beta Manual Assigned Name:Transcription intermediary factor 1-beta SwissPROT>TIF1B_MOUSE 1959872 Microtubule-associated protein Manual>S473>Isoform Assigned 2 of Name:Microtubule-associated protein HPRD>01141_1>S941>Micro 1960235 Hepatoma-derived growth factor Manualtubule associated Assigned protein 4 Name:Hepatoma-derived growth factor IPI>P51859>Hepatoma- 1958938 CLIP-associating protein 1 Manualderived Assignedgrowth factor Name:CLIP- associating protein 1 HPRD>09322_1>S600>CLIP associated protein 1 1960156 Rho guanine nucleotide exchange factor 17 ManualSwissPROT>CLAP1_MOUSE Assigned Name:Rho guanine nucleotide exchange factor 17 HPRD>10658_1>S463>Rho 1958660 MCG5400 Manualguanine Assigned nucleotide exchange Name:MCG5400 HPRD>10095_1>T19S20>My osin regulatory light chain 1959396 Perilipin-1 ManualMRLC2 Assigned Name:Perilipin-1 HPRD>01364_1>S81>Perilipi n 1959339 Eukaryotic translation initiation factor 4 ManualSwissPROT>PLIN_MOUSE> Assigned gamma 3 Name:Eukaryotic translation initiation factor 4 gamma 3 SwissPROT>A2AMI2_MOUS 1959692 Dclk1 protein ManualE>S267>"Eukaryotic Assigned Name:Dclk1 protein HPRD>09202_1>S332T336> Doublecortin and CaM kinase 1959954 Dclk1 protein Manuallike 1 Assigned Name:Dclk1 protein HPRD>09202_1>S330T336> Doublecortin and CaM kinase like 1 Page 167 of 603 Diabetes
1960247 Tjp1 protein Manual Assigned Name:Tjp1 protein HPRD>03002_1>S617>Tight junction protein 1 1959407 Septin-2 ManualHPRD>03002_2>S617>Tight Assigned Name:Septin-2 HPRD>03297_1>S218>Septi n 2 1959537 Actin, cytoplasmic 1 ManualHPRD>03297_2>S218>Septi Assigned Name:Actin, cytoplasmic 1 HPRD>00015_1>S241>Actin alpha, cardiac muscle 1960324 Protein PML ManualHPRD>00016_1>S240>Actin Assigned Name:Protein PML SwissPROT>D3YXR5_MOUS E>T535>Uncharacterized 1959097 Eukaryotic translation initiation factor 4 Manualprotein OS=MusAssigned musculus gamma 1 Name:Eukaryotic translation initiation factor 4 gamma 1 HPRD>06774_1>S1187>eIF 1959090 RNA-binding protein 8A Manual4G1 Assigned Name:RNA- binding protein 8A HPRD>05609_1>S56>RNA binding motif protein 8A 1958781 Cytosolic phospholipase A2 ManualSwissPROT>RBM8A_MOUS Assigned Name:Cytosolic phospholipase A2 SwissPROT>PA24A_MOUSE 1959485 SAM domain and HD domain-containing Manual>S437>Cytosolic Assigned Name:SAM protein 1 domain and HD domain- containing protein 1 SwissPROT>E0CXZ5_MOUS 1959843 SAM domain and HD domain-containing ManualE>T21T29>Uncharacterized Assigned Name:SAM protein 1 domain and HD domain- containing protein 1 SwissPROT>E0CXZ5_MOUS 1958626 MCG10050 ManualE>T21S24>Uncharacterized Assigned Name:MCG10050 HPRD>01611_1>S104>Ribos omal protein, large, P1 HPRD>01611_2>S79>Riboso Diabetes Page 168 of 603
1960000 Catenin beta-1 Manual Assigned Name:Catenin beta-1 HPRD>00286_1>T556>Cate nin beta 1960005 Interferon-activable protein 204 ManualHPRD>00286_2>T556>Cate Assigned Name:Interferon-activable protein 204 SwissPROT>IFI4_MOUSE>Is 1958844 Integrator complex subunit 1 Manualoform 2 Assignedof Interferon-activable Name:Integrator complex subunit 1 SwissPROT>INT1_MOUSE> 1959621 Integrator complex subunit 1 ManualT1321S1328>Integrator Assigned Name:Integrator complex subunit 1 SwissPROT>INT1_MOUSE> 1959623 Integrator complex subunit 1 ManualS1320S1328>Integrator Assigned Name:Integrator complex subunit 1 SwissPROT>INT1_MOUSE> 1958776 Serine/arginine repetitive matrix 1 ManualT1321S1329>Integrator Assigned Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>S605S607> 1960051 H-2 class I histocompatibility antigen, L-D ManualSerine arginine Assigned repetitive Name:H-2 alpha chain class I histocompatibility antigen, L-D alpha chain SwissPROT>HA11_MOUSE> 1959777 Protein PAT1 homolog 1 Manual"H-2 class Assigned I histocompatibility Name:Protein PAT1 homolog 1 HPRD>08214_1>S36>FLJ36 1959415 MARCKS-related protein Manual874 protein Assigned Name:MARCKS-related protein HPRD>04247_1>S104>MAR 1959845 SAM domain and HD domain-containing ManualCKS like Assigned protein Name:SAM protein 1 domain and HD domain- containing protein 1 SwissPROT>E0CXZ5_MOUS E>S24T25>Uncharacterized Page 169 of 603 Diabetes
1959246 Nucleolar protein 58 Manual Assigned Name:Nucleolar protein 58 SwissPROT>NOP58_MOUS E>S509S521>Nucleolar 1959129 AP-3 complex subunit delta-1 Manualprotein 58Assigned OS=Mus Name:AP-3 musculus complex subunit delta-1 SwissPROT>AP3D1_MOUSE >T758S760>AP-3 complex 1959727 AP-3 complex subunit delta-1 Manualsubunit delta-1Assigned OS=Mus Name:AP-3 complex subunit delta-1 SwissPROT>AP3D1_MOUSE >S755S760>AP-3 complex 1960334 Nuclear factor 1 B-type Manualsubunit delta-1Assigned OS=Mus Name:Nuclear factor 1 B-type SwissPROT>NFIB_MOUSE> S328>Isoform 3 of Nuclear 1958916 Drebrin-like protein Manualfactor 1 AssignedB-type OS=Mus Name:Drebrin-like protein SwissPROT>DBNL_MOUSE> S273>Isoform 3 of Drebrin- 1959230 Tight junction-associated protein 1 Manuallike protein Assigned OS=Mus Name:Tight junction-associated protein 1 SwissPROT>TJAP1_MOUSE >S527>Tight junction- 1960224 Microtubule-associated protein Manualassociated Assigned protein 1 OS=Mus Name:Microtubule-associated protein IPI>E9PWC0>S609>Microtub 1959109 Cap-specific mRNA (nucleoside-2'-O-)- Manualule-associated Assigned protein Name:Cap- methyltransferase 1 specific mRNA (nucleoside-2'- O-)-methyltransferase 1 SwissPROT>D3Z491_MOUS 1958984 Cobl-like 1 ManualE>S28>Uncharacterized Assigned Name:Cobl- like 1 SwissPROT>B1AZ14_MOUS E>S864>Cobl-like 1 OS=Mus 1958932 Na(+)/H(+) exchange regulatory cofactor NHE-Manualmusculus Assigned GN=Cobll1 RF1 Name:Na(+)/H(+) exchange regulatory cofactor NHE-RF1 SwissPROT>NHERF_MOUS E>T287>Ezrin-radixin-moesin Diabetes Page 170 of 603
1958934 Na(+)/H(+) exchange regulatory cofactor NHE-Manual Assigned RF1 Name:Na(+)/H(+) exchange regulatory cofactor NHE-RF1 SwissPROT>NHERF_MOUS 1960142 Autophagy-related protein 16-1 ManualE>S282>Ezrin-radixin-moesin Assigned Name:Autophagy-related protein 16-1 HPRD>16498_2>S269>APG 1960209 Cobl-like 1 Manual16L Assigned Name:Cobl- like 1 SwissPROT>B1AZ14_MOUS E>S281>Cobl-like 1 OS=Mus 1958685 Protein PRRC2C Manualmusculus Assigned GN=Cobll1 Name:Protein PRRC2C SwissPROT>BA2L2_MOUSE >S902>Isoform 5 of Protein 1959567 Protein PRRC2C ManualBAT2-like Assigned 2 OS=Mus Name:Protein PRRC2C SwissPROT>BA2L2_MOUSE >S897>Isoform 5 of Protein 1958850 DNA-binding protein A ManualBAT2-like Assigned 2 OS=Mus Name:DNA- binding protein A SwissPROT>DBPA_MOUSE >S259>Isoform 2 of DNA- 1960470 ADP-ribosylation factor GTPase-activating Manualbinding proteinAssigned A OS=MusName:ADP- protein 2 ribosylation factor GTPase- activating protein 2 HPRD>06069_1>Zinc finger 1959418 Tumor necrosis factor receptor superfamily Manualprotein 289,Assigned ID1 regulated member 6 Name:Tumor necrosis factor receptor superfamily member 6 1959306 Isoform 2 of ATP-dependent RNA helicase A ManualSwissPROT>D3Z6E5_MOUS Assigned Name:Isoform 2 of ATP- dependent RNA helicase A IPI>O70133-2>Isoform 2 of 1959115 Serine/threonine-protein kinase TAO3 ManualATP-dependent Assigned RNA helicase Name:Serine/threonine- protein kinase TAO3 SwissPROT>TAOK3_MOUS E>S324>Serine/threonine- Page 171 of 603 Diabetes
1960337 Bcl-2-associated transcription factor 1 Manual Assigned Name:Bcl-2- associated transcription factor 1 HPRD>16544_1>S285S290> 1960396 Thrap3 protein ManualBCL2 associated Assigned transcription Name:Thrap3 protein HPRD>07543_1>S928>TRA P150 1959218 A230067G21Rik protein ManualSwissPROT>Q80VM0_MOU Assigned Name:A230067G21Rik protein HPRD>11135_2>S375S376> 1959991 A230067G21Rik protein ManualChromosome Assigned 20 open Name:A230067G21Rik protein HPRD>11135_2>S373S375> 1959545 Dclk1 protein ManualChromosome Assigned 20 open Name:Dclk1 protein SwissPROT>A8IP62_MOUS E>S45>Activity and 1959130 Ahnak AHNAK nucleoprotein isoform 1 Manualneurotransmitter-induced Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 SwissPROT>Q8BRB8_MOU 1960066 Hematological and neurological expressed 1 ManualSE>Putative Assigned uncharacterized protein Name:Hematological and neurological expressed 1 protein 1958671 Pinin ManualSwissPROT>HN1_MOUSE>S Assigned Name:Pinin SwissPROT>PININ_MOUSE> S380>Pinin OS=Mus musculus GN=Pnn 1959215 Synaptosomal-associated protein ManualSwissPROT>Q3TUQ5_MOU Assigned Name:Synaptosomal- associated protein SwissPROT>B0R030_MOUS 1959277 Acetyl-coenzyme A synthetase, cytoplasmic ManualE>S110>Synaptosomal- Assigned Name:Acetyl-coenzyme A synthetase, cytoplasmic SwissPROT>A2AQN4_MOU SE>S263S267>Acyl-CoA Diabetes Page 172 of 603
1959005 Pericentriolar material 1 protein Manual Assigned Name:Pericentriolar material 1 protein SwissPROT>PCM1_MOUSE 1960225 Ankyrin repeat and IBR domain-containing Manual>S1805S1808>Isoform Assigned 2 of protein 1 Name:Ankyrin repeat and IBR domain-containing protein 1 SwissPROT>AKIB1_MOUSE 1958927 La-related protein 1 Manual>S740>Ankyrin Assigned repeat Name:La- and related protein 1 IPI>Q6ZQ58>S81>La-related protein 1 1960063 Vesicle-trafficking protein SEC22b ManualIPI>IPI00344088.6>S81>Larp Assigned Name:Vesicle-trafficking protein SEC22b HPRD>04939_1>S137>SEC2 1958667 Receptor-interacting serine/threonine-protein Manual2B Assigned kinase 3 Name:Receptor-interacting serine/threonine-protein kinase 3 1959504 E3 ubiquitin-protein ligase NEDD4-like ManualSwissPROT>Q3U3Z9_MOUS Assigned Name:E3 ubiquitin-protein ligase NEDD4-like HPRD>05903_1>S428>Ubiqu 1960300 Drebrin-like protein Manualitin protein Assigned ligase NEDD4 like Name:Drebrin-like protein SwissPROT>DBNL_MOUSE> T295>Isoform 3 of Drebrin- 1959284 Nuclear autoantigen Sp-100 Manuallike protein Assigned OS=Mus Name:Nuclear autoantigen Sp- 100 SwissPROT>Q3UKD8_MOU 1960097 60S acidic ribosomal protein P1 ManualSE>T313>Putative Assigned Name:60S acidic ribosomal protein P1 SwissPROT>RLA1_MOUSE> S101S104>60S acidic 1959210 Microtubule-associated protein Manualribosomal Assigned protein P1 OS=Mus Name:Microtubule-associated protein IPI>E9QPW8>S517>Microtub ule-associated protein Page 173 of 603 Diabetes
1958632 E3 ubiquitin-protein ligase Mdm2 Manual Assigned Name:E3 ubiquitin-protein ligase Mdm2 SwissPROT>MDM2_MOUSE >S134>Isoform Mdm2-p76 of 1958668 Receptor-interacting serine/threonine-protein ManualE3 ubiquitin-protein Assigned ligase kinase 3 Name:Receptor-interacting serine/threonine-protein kinase 3 1959009 MCG126099, isoform CRA_b ManualSwissPROT>Q3U3Z9_MOUS Assigned Name:MCG126099, isoform CRA_b SwissPROT>D3Z3A0_MOUS 1958971 E3 ubiquitin-protein ligase NEDD4 ManualE>S122S123>"MCG126099, Assigned Name:E3 ubiquitin-protein ligase NEDD4 SwissPROT>NEDD4_MOUS 1959133 Myeloid leukemia factor 2 ManualE>S309>E3 Assigned ubiquitin-protein Name:Myeloid leukemia factor 2 HPRD>03238_1>S238>MLF2 1959730 Myeloid leukemia factor 2 ManualSwissPROT>MLF2_MOUSE> Assigned Name:Myeloid leukemia factor 2 HPRD>03238_1>S240>MLF2 1960123 Vimentin ManualSwissPROT>MLF2_MOUSE> Assigned Name:Vimentin SwissPROT>VIME_MOUSE> Vimentin OS=Mus musculus 1960345 Ahnak AHNAK nucleoprotein isoform 1 ManualGN=Vim Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 SwissPROT>Q8BRB8_MOU 1959716 Nucleoporin 98 ManualSE>Putative Assigned uncharacterized Name:Nucleoporin 98 SwissPROT>Q68G59_MOUS E>S281>Nup98 protein 1959387 Tyrosine-protein kinase JAK2 Manual(Fragment) Assigned OS=Mus Name:Tyrosine-protein kinase JAK2 SwissPROT>JAK2_MOUSE> S523>Tyrosine-protein kinase Diabetes Page 174 of 603
1958831 PHD and RING finger domain-containing Manual Assigned Name:PHD protein 1 and RING finger domain- containing protein 1 SwissPROT>PHRF1_MOUS 1959069 Polymerase I and transcript release factor ManualE>S884S886>Isoform Assigned 2 of Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1959079 Polymerase I and transcript release factor ManualS171>Polymerase Assigned I and Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1959032 Tripartite motif-containing protein 47 ManualS169>Polymerase Assigned I and Name:Tripartite motif- containing protein 47 SwissPROT>Q7TMQ8_MOU 1958852 Serine/arginine repetitive matrix 1 ManualSE>S164>Trim47 Assigned protein Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>S389S391S 1960059 6-phosphofructokinase, liver type Manual393>Serine Assigned arginine Name:6- repetitive phosphofructokinase, liver type SwissPROT>K6PL_MOUSE> 1958966 Isoform 3 of Peripheral plasma membrane ManualS775>"6- Assigned protein CASK Name:Isoform 3 of Peripheral plasma membrane protein CASK 1959670 Isoform 3 of Peripheral plasma membrane ManualIPI>O70589-3>S571>Isoform Assigned protein CASK Name:Isoform 3 of Peripheral plasma membrane protein CASK 1960098 Cyclin-dependent kinase 11 ManualIPI>O70589-3>S570>Isoform Assigned Name:Cyclin-dependent kinase 11 HPRD>00308_1>S271>Cell 1959464 Glycogen [starch] synthase, muscle Manualdivision Assignedcycle 2 like 2 Name:Glycogen [starch] synthase, muscle SwissPROT>D3Z0Q6_MOUS E>S645>Uncharacterized Page 175 of 603 Diabetes
1960446 Glycogen [starch] synthase, muscle Manual Assigned Name:Glycogen [starch] synthase, muscle SwissPROT>D3Z0Q6_MOUS 1959769 Zinc finger Ran-binding domain-containing ManualE>S647>Uncharacterized Assigned Name:Zinc protein 2 finger Ran-binding domain- containing protein 2 HPRD>09185_1>Zinc finger 1959999 Paralemmin-1 Manualprotein 265Assigned Name:Paralemmin-1 SwissPROT>PALM_MOUSE >T141T145>Isoform 2 of 1958603 Ahnak AHNAK nucleoprotein isoform 1 ManualParalemmin Assigned OS=Mus Name:Ahnak AHNAK nucleoprotein isoform 1 IPI>IPI00553798.2>Ahnak 1960147 Dual specificity protein phosphatase ManualAHNAK Assignednucleoprotein Name:Dual isoform specificity protein phosphatase HPRD>02136_1>S325>Dual 1959472 SH2B adapter protein 2 Manualspecificity Assigned phosphatase 9 Name:SH2B adapter protein 2 SwissPROT>APS_MOUSE>S 588>SH2 and PH domain- 1960122 Vimentin Manualcontaining Assigned adapter protein Name:Vimentin SwissPROT>VIME_MOUSE> Vimentin OS=Mus musculus 1958748 Protein DEK ManualGN=Vim Assigned Name:Protein DEK SwissPROT>DEK_MOUSE> S247S248S255>Protein DEK 1959077 Thyroid hormone receptor-associated protein ManualOS=Mus Assigned musculus GN=Dek 3 Name:Thyroid hormone receptor-associated protein 3 SwissPROT>Q8BZN7_MOUS 1960148 Dual specificity protein phosphatase ManualE>S379>Putative Assigned Name:Dual specificity protein phosphatase HPRD>02136_1>S328>Dual specificity phosphatase 9 Diabetes Page 176 of 603
1959446 Patatin-like phospholipase domain-containing Manual Assigned protein 2 Name:Patatin-like phospholipase domain- containing protein 2 1959920 Guanine nucleotide-binding protein ManualHPRD>11443_1>S428>Patati Assigned G(I)/G(S)/G(O) subunit gamma-12 Name:Guanine nucleotide- binding protein G(I)/G(S)/G(O) subunit 1959224 Perilipin-1 Manualgamma-12 Assigned Name:Perilipin-1 HPRD>01364_1>S382>Perili pin 1958974 Protein phosphatase 1 regulatory subunit ManualSwissPROT>PLIN_MOUSE> Assigned 12A Name:Protein phosphatase 1 regulatory subunit 12A HPRD>03606_1>S507>Myosi 1959936 Protein phosphatase 1 regulatory subunit Manualn phosphatase Assigned target subunit 12A Name:Protein phosphatase 1 regulatory subunit 12A HPRD>03606_1>S509>Myosi 1960103 Isoform PLEC-1A of Plectin Manualn phosphatase Assigned target subunit Name:Isoform PLEC-1A of Plectin HPRD>03180_4>S20>Plectin 1959254 Protein phosphatase 1 regulatory subunit Manual1 Assigned 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS 1959007 Eukaryotic translation initiation factor 4B ManualE>S299>Isoform Assigned 2 of Protein Name:Eukaryotic translation initiation factor 4B HPRD>04892_1>S445>Eukar 1959292 Microtubule-associated protein Manualyotic translation Assigned initiation Name:Microtubule-associated protein SwissPROT>MAP4_MOUSE 1959060 Vasodilator-stimulated phosphoprotein Manual>S748>Isoform Assigned 4 of Name:Vasodilator-stimulated phosphoprotein SwissPROT>VASP_MOUSE> Vasodilator-stimulated Page 177 of 603 Diabetes
1959695 Vasodilator-stimulated phosphoprotein Manual Assigned Name:Vasodilator-stimulated phosphoprotein SwissPROT>VASP_MOUSE> 1959478 Tyrosine-protein phosphatase non-receptor ManualVasodilator-stimulated Assigned type 12 Name:Tyrosine-protein phosphatase non-receptor type 12 1960163 Serine/arginine repetitive matrix 1 ManualHPRD>02513_1>S435>Protei Assigned Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1959245 Perilipin-1 ManualE>S577T579>Serine/arginine Assigned Name:Perilipin-1 SwissPROT>PLIN_MOUSE> S460>Perilipin (PERI) (Lipid 1959767 Perilipin-1 Manualdroplet-associated Assigned protein) Name:Perilipin-1 SwissPROT>PLIN_MOUSE> S463>Perilipin (PERI) (Lipid 1959660 Calcium/calmodulin-dependent protein kinase Manualdroplet-associated Assigned protein) type II subunit delta Name:Calcium/calmodulin- dependent protein kinase type II subunit delta 1959702 Dclk1 protein ManualHPRD>09653_1>T337>CaM Assigned Name:Dclk1 protein HPRD>09202_1>T336>Doubl ecortin and CaM kinase like 1 1960317 Dclk1 protein ManualSwissPROT>A8IP62_MOUS Assigned Name:Dclk1 protein HPRD>09202_1>S337>Doubl ecortin and CaM kinase like 1 1959650 Na(+)/H(+) exchange regulatory cofactor NHE-ManualSwissPROT>A8IP62_MOUS Assigned RF1 Name:Na(+)/H(+) exchange regulatory cofactor NHE-RF1 SwissPROT>NHERF_MOUS 1959960 Charged multivesicular body protein 2b ManualE>S284>Ezrin-radixin-moesin Assigned Name:Charged multivesicular body protein 2b HPRD>13174_1>S199>DKFZ P564O123 protein Diabetes Page 178 of 603
1958837 Palladin Manual Assigned Name:Palladin HPRD>09731_1>S892S894S 897>Palladin 1958866 5'-3' exoribonuclease 2 ManualSwissPROT>PALLD_MOUSE Assigned Name:5'-3' exoribonuclease 2 HPRD>10309_1>S499S501> 5`-3` exoribonuclease 2 1960367 Cobl-like 1 ManualSwissPROT>XRN2_MOUSE> Assigned Name:Cobl- like 1 SwissPROT>B1AZ14_MOUS E>S1183>Cobl-like 1 1958848 PC4 and SFRS1-interacting protein ManualOS=Mus Assigned musculus Name:PC4 and SFRS1-interacting protein HPRD>04688_1>S106>PC4 1959895 PC4 and SFRS1-interacting protein Manualand SFRS1 Assigned interacting Name:PC4 protein and SFRS1-interacting protein HPRD>04688_1>S105>PC4 1959384 FACT complex subunit SSRP1 Manualand SFRS1 Assigned interacting protein Name:FACT complex subunit SSRP1 SwissPROT>A2AW05_MOU 1960179 Acin1 protein ManualSE>S444>Structure Assigned Name:Acin1 specific protein HPRD>05191_1>S898>ACIN US 1959026 Ahnak AHNAK nucleoprotein isoform 1 ManualSwissPROT>B8JJ87_MOUS Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 HPRD>14684_2>S5731>AH 1958629 DnaJ homolog subfamily C member 5 ManualNAK nucleoprotein Assigned Name:DnaJ homolog subfamily C member 5 HPRD>08539_1>S10>Cystei 1960107 DnaJ homolog subfamily C member 5 Manualne string Assigned protein Name:DnaJ homolog subfamily C member 5 HPRD>08539_1>S8>Cystein e string protein Page 179 of 603 Diabetes
1960228 Ras GTPase-activating protein 3 Manual Assigned Name:Ras GTPase-activating protein 3 HPRD>05537_1>S809>Ras p21 protein activator 3 1959672 NEDD9-interacting protein with calponin ManualSwissPROT>Q3UGJ5_MOUS Assigned homology and LIM domains Name:NEDD9-interacting protein with calponin homology and LIM domains 1959570 Serine/arginine repetitive matrix 1 ManualSwissPROT>MICA1_MOUSE Assigned Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1959571 Serine/arginine repetitive matrix 1 ManualE>S401T404>Serine/arginine Assigned Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1958957 PC4 and SFRS1-interacting protein ManualE>S400T404>Serine/arginine Assigned Name:PC4 and SFRS1-interacting protein SwissPROT>A2BI12_MOUS 1959666 PC4 and SFRS1-interacting protein ManualE>S272S274>PC4 Assigned Name:PC4 and and SFRS1-interacting protein SwissPROT>A2BI12_MOUS 1959922 PC4 and SFRS1-interacting protein ManualE>T271S274>PC4 Assigned Name:PC4 and and SFRS1-interacting protein SwissPROT>A2BI12_MOUS 1959923 PC4 and SFRS1-interacting protein ManualE>T269S274>PC4 Assigned Name:PC4 and and SFRS1-interacting protein SwissPROT>A2BI12_MOUS 1960441 Oxysterol-binding protein-related protein 11 ManualE>S270T271>PC4 Assigned and Name:Oxysterol-binding protein-related protein 11 SwissPROT>OSB11_MOUSE 1960405 Dclk1 protein Manual>S194>Oxysterol-binding Assigned Name:Dclk1 protein HPRD>09202_1>S32T34>Do ublecortin and CaM kinase like 1 Diabetes Page 180 of 603
1959707 Serine/arginine repetitive matrix 1 Manual Assigned Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1959368 1-phosphatidylinositol-3-phosphate 5-kinase ManualE>S558S560>Serine/arginine Assigned Name:1- phosphatidylinositol-3- phosphate 5-kinase HPRD>17852_1>S307>Phos 1958742 Hmga2 protein Manualphatidylinositol-3- Assigned Name:Hmga2 protein SwissPROT>HMGA2_MOUS E>S44>High mobility group 1959463 Thyroid hormone receptor-associated protein Manualprotein HMGI-CAssigned OS=Mus 3 Name:Thyroid hormone receptor-associated protein 3 HPRD>07543_1>S682>TRA 1960214 RNA-binding protein 25 ManualP150 Assigned Name:RNA- binding protein 25 HPRD>15229_1>S677>RNA binding motif protein 25 1958892 Caspase-8 ManualIPI>B2RY56>S675>RNA- Assigned Name:Caspase-8 SwissPROT>CASP8_MOUS E>S188>Caspase-8 OS=Mus 1959385 Serine/arginine repetitive matrix protein 2 Manualmusculus Assigned GN=Casp8 Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1959558 Prelamin-A/C ManualE>S1305>Isoform Assigned 3 of Name:Prelamin-A/C SwissPROT>LAMA_MOUSE >S403>Lamin A 1960141 Prelamin-A/C ManualSwissPROT>LAMC_MOUSE Assigned Name:Prelamin-A/C SwissPROT>LAMA_MOUSE >S404>Lamin A 1958723 Serine/threonine-protein kinase PRP4 ManualSwissPROT>LAMC_MOUSE Assigned homolog Name:Serine/threonine- protein kinase PRP4 homolog SwissPROT>B2RUN6_MOU SE>S278>PRP4 pre-mRNA Page 181 of 603 Diabetes
1960275 Sister chromatid cohesion protein PDS5 Manual Assigned homolog B Name:Sister chromatid cohesion protein PDS5 homolog B 1960138 Vimentin ManualSwissPROT>PDS5B_MOUS Assigned Name:Vimentin SwissPROT>VIME_MOUSE> Vimentin OS=Mus musculus 1959687 Rab GTPase-binding effector protein 1 ManualGN=Vim Assigned Name:Rab GTPase-binding effector protein 1 SwissPROT>Q5QNU3_MOU 1959460 Perilipin-1 ManualSE>S407>"Rabaptin, Assigned RAB Name:Perilipin-1 HPRD>01364_1>S408>Perili pin 1960461 Perilipin-1 ManualSwissPROT>PLIN_MOUSE> Assigned Name:Perilipin-1 HPRD>01364_1>S408>Perili pin 1958975 Kif13b kinesin family member 13B ManualSwissPROT>PLIN_MOUSE> Assigned Name:Kif13b kinesin family member 13B SwissPROT>Q6A029_MOUS 1958921 Kif13b kinesin family member 13B ManualE>MKIAA0639 Assigned protein Name:Kif13b kinesin family member 13B SwissPROT>Q6A029_MOUS 1959466 Rab-3A-interacting protein ManualE>MKIAA0639 Assigned protein Name:Rab- 3A-interacting protein SwissPROT>RAB3I_MOUSE >S240>Rab-3A-interacting 1960173 DNA-(apurinic or apyrimidinic site) lyase Manualprotein OS=MusAssigned musculus Name:DNA- (apurinic or apyrimidinic site) lyase SwissPROT>APEX1_MOUSE 1959502 Pleckstrin homology domain-containing family Manual>S18>DNA-(apurinic Assigned or O member 2 Name:Pleckstrin homology domain-containing family O member 2 SwissPROT>PKHO2_MOUS Diabetes Page 182 of 603
1959503 Pleckstrin homology domain-containing family Manual Assigned O member 2 Name:Pleckstrin homology domain-containing family O member 2 1959635 Rho guanine nucleotide exchange factor 2 ManualSwissPROT>PKHO2_MOUS Assigned Name:Rho guanine nucleotide exchange factor 2 HPRD>10458_1>S955S959> 1959340 WASH complex subunit FAM21 ManualRho guanine Assigned nucleotide Name:WASH complex subunit FAM21 SwissPROT>FAM21_MOUSE 1960319 Guanine nucleotide-binding protein-like 3 Manual>Isoform Assigned 2 of WASH complex Name:Guanine nucleotide- binding protein-like 3 SwissPROT>GNL3_MOUSE> 1960007 Protein phosphatase 1 regulatory subunit ManualS472>Isoform Assigned 2 of Guanine 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS 1959724 Ubiquitin-conjugating enzyme E2 J1 ManualE>S909>Isoform Assigned 2 of Protein Name:Ubiquitin-conjugating enzyme E2 J1 SwissPROT>A3KG52_MOUS 1959116 mRNA cap guanine-N7 methyltransferase ManualE>S209>Ubiquitin- Assigned Name:mRNA cap guanine-N7 methyltransferase SwissPROT>D3YYS7_MOUS 1958935 MCG14935, isoform CRA_a ManualE>S100>Uncharacterized Assigned Name:MCG14935, isoform CRA_a SwissPROT>Q3UWE6_MOU 1959499 Glucosamine--fructose-6-phosphate ManualSE>"MCG14935, Assigned isoform aminotransferase [isomerizing] 1 Name:Glucosamine--fructose- 6-phosphate aminotransferase 1959618 Nardilysin Manual[isomerizing] Assigned 1 Name:Nardilysin HPRD>04036_1>S86>Nardily sin SwissPROT>A2A9Q2_MOUS Page 183 of 603 Diabetes
1959363 Sipa1l1 protein Manual Assigned Name:Sipa1l1 protein HPRD>11559_1>S1549>E6 targeted protein 1 1959262 Heterogeneous nuclear ribonucleoprotein L- ManualSwissPROT>SI1L1_MOUSE> Assigned like Name:Heterogeneous nuclear ribonucleoprotein L-like SwissPROT>Q3UXJ3_MOUS 1960359 Bin1 protein ManualE>S129>Putative Assigned Name:Bin1 protein SwissPROT>BIN1_MOUSE> S265>Isoform 2 of Myc box- 1959108 Bin1 protein Manualdependent-interacting Assigned Name:Bin1 protein protein SwissPROT>BIN1_MOUSE> S265S267>Isoform 2 of Myc 1959061 Dclk1 protein Manualbox-dependent-interacting Assigned Name:Dclk1 protein HPRD>09202_1>S307>Doubl ecortin and CaM kinase like 1 1959694 Dclk1 protein ManualSwissPROT>DCAK1_MOUS Assigned Name:Dclk1 protein HPRD>09202_1>S312>Doubl ecortin and CaM kinase like 1 1959951 Dclk1 protein ManualSwissPROT>DCAK1_MOUS Assigned Name:Dclk1 protein HPRD>09202_1>S310>Doubl ecortin and CaM kinase like 1 1959968 RNA-binding protein Raly ManualSwissPROT>DCAK1_MOUS Assigned Name:RNA- binding protein Raly SwissPROT>A2AU62_MOUS E>T268>HnRNP-associated 1960347 RNA-binding protein Raly Manualwith lethal Assigned yellow (Fragment)Name:RNA- binding protein Raly SwissPROT>A2AU62_MOUS E>S270>HnRNP-associated 1960376 SAFB-like transcription modulator Manualwith lethal Assigned yellow (Fragment) Name:SAFB-like transcription modulator SwissPROT>SLTM_MOUSE> S534>Isoform 2 of SAFB-like Diabetes Page 184 of 603
1959995 Calmodulin-regulated spectrin-associated Manual Assigned protein 2 Name:Calmodulin-regulated spectrin-associated protein 2 SwissPROT>B2RRE3_MOUS 1959160 Vigilin ManualE>S1131>Camsap1l1 Assigned protein Name:Vigilin SwissPROT>Q8BX68_MOUS E>Putative uncharacterized 1959668 Zinc finger Ran-binding domain-containing Manualprotein OS=MusAssigned musculus Name:Zinc protein 2 finger Ran-binding domain- containing protein 2 HPRD>09185_1>Zinc finger 1959294 Ahnak AHNAK nucleoprotein isoform 1 Manualprotein 265Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 SwissPROT>Q8BRB8_MOU 1960017 Ahnak AHNAK nucleoprotein isoform 1 ManualSE>Putative Assigned uncharacterized Name:Ahnak AHNAK nucleoprotein isoform 1 SwissPROT>Q8BRB8_MOU 1959740 Ubiquinone biosynthesis protein COQ9, ManualSE>Putative Assigned uncharacterized mitochondrial Name:Ubiquinone biosynthesis protein COQ9, mitochondrial 1960170 Heterogeneous nuclear ribonucleoprotein G ManualSwissPROT>COQ9_MOUSE Assigned Name:Heterogeneous nuclear ribonucleoprotein G SwissPROT>D3Z613_MOUS 1959483 Small acidic protein ManualE>T163>Uncharacterized Assigned Name:Small acidic protein HPRD>18069_1>S15>SMAP SwissPROT>D6RI64_MOUS 1959789 Eukaryotic translation initiation factor 3 ManualE>S15>Uncharacterized Assigned subunit C Name:Eukaryotic translation initiation factor 3 subunit C HPRD>04889_1>S39>EIF3S 1958825 Small glutamine-rich tetratricopeptide repeat- Manual8 Assigned Name:Small containing protein alpha glutamine-rich tetratricopeptide repeat- containing protein alpha SwissPROT>SGTA_MOUSE Page 185 of 603 Diabetes
1958677 Yorkie homolog Manual Assigned Name:Yorkie homolog HPRD>09424_1>Yes associated protein 1959788 Nucleolar protein 58 ManualSwissPROT>Q3U046_MOUS Assigned Name:Nucleolar protein 58 SwissPROT>NOP58_MOUS E>S509>Nucleolar protein 58 1959389 Cyclin-dependent kinase 11 ManualOS=Mus Assigned musculus Name:Cyclin-dependent kinase 11 HPRD>00308_1>T736S737> 1960424 Cyclin-dependent kinase 11 ManualCell division Assigned cycle 2 like 2 Name:Cyclin-dependent kinase 11 HPRD>00308_1>T736S737> 1959648 Microtubule-associated protein 1A ManualCell division Assigned cycle 2 like 2 Name:Microtubule-associated protein 1A HPRD>02549_1>S986>Micro 1958666 Vimentin Manualtubule associated Assigned protein 1A Name:Vimentin SwissPROT>VIME_MOUSE> Vimentin OS=Mus musculus 1958904 Cyclin-dependent kinase 12 ManualGN=Vim Assigned Name:Cyclin-dependent kinase 12 SwissPROT>B1AQH7_MOU 1958997 E3 ubiquitin-protein ligase UBR4 ManualSE>S807>"Cdc2-related Assigned Name:E3 ubiquitin-protein ligase UBR4 HPRD>10184_1>S2719>Reti noblastoma associated factor 1959673 E3 ubiquitin-protein ligase UBR4 Manual600 Assigned Name:E3 ubiquitin-protein ligase UBR4 HPRD>10184_1>S2718>Reti noblastoma associated factor 1960168 Heterogeneous nuclear ribonucleoprotein D0 Manual600 Assigned Name:Heterogeneous nuclear ribonucleoprotein D0 HPRD>03206_1>S83>Hetero geneous nuclear Diabetes Page 186 of 603
1959297 Ahnak AHNAK nucleoprotein isoform 1 Manual Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 SwissPROT>Q8BRB8_MOU 1960342 KN motif and ankyrin repeat domain- ManualSE>Putative Assigned uncharacterized Name:KN containing protein 2 motif and ankyrin repeat domain-containing protein 2 HPRD>13865_1>S137>Immu 1959179 SEC16 homolog A (S. cerevisiae) Manualnoglobulin Assigned superfamily Name:SEC16 homolog A (S. cerevisiae) SwissPROT>A2AIX1_MOUS 1959072 Prelamin-A/C ManualE>S1028>SEC16 Assigned homolog A Name:Prelamin-A/C HPRD>01035_1>S390S392> Lamin A/C 1959091 Prelamin-A/C ManualHPRD>01035_2>S390S392> Assigned Name:Prelamin-A/C HPRD>01035_1>S390S395> Lamin A/C 1959685 Archvillin ManualHPRD>01035_2>S390S395> Assigned Name:Archvillin SwissPROT>Q8K4L2_MOUS E>S857>Archvillin OS=Mus 1958754 Transcription elongation factor A protein 1 Manualmusculus Assigned GN=Svil Name:Transcription elongation factor A protein 1 SwissPROT>TCEA1_MOUSE 1960145 Zc3h13 Zinc finger CCCH type containing 13 Manual>S65>Isoform Assigned 1 of Name:Zc3h13 Zinc finger CCCH type containing 13 SwissPROT>B9EHN9_MOUS 1959807 Ubiquitin carboxyl-terminal hydrolase ManualE>Zinc fingerAssigned CCCH type Name:Ubiquitin carboxyl- terminal hydrolase HPRD>03950_1>Ubiquitin 1959252 Protein phosphatase 1 regulatory subunit Manualspecific Assignedprotease 7 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS E>S299>Isoform 2 of Protein Page 187 of 603 Diabetes
1959276 N(2),N(2)-dimethylguanosine tRNA Manual Assigned methyltransferase Name:N(2),N(2)- dimethylguanosine tRNA methyltransferase 1959756 Cobl-like 1 ManualSwissPROT>D3Z1P5_MOUS Assigned Name:Cobl- like 1 SwissPROT>B1AZ14_MOUS E>S1183>Cobl-like 1 1959425 Apoptotic chromatin condensation inducer 1 ManualOS=Mus Assigned musculus (Fragment) Name:Apoptotic chromatin condensation inducer 1 (Fragment) 1960045 Hormone-sensitive lipase ManualSwissPROT>ACINU_MOUSE Assigned Name:Hormone-sensitive lipase SwissPROT>LIPS_MOUSE> 1958869 RNA-binding protein 10 ManualS650>Hormone-sensitive Assigned Name:RNA- binding protein 10 HPRD>02095_1>S723>RNA binding motif protein 10 1959977 Serine/arginine repetitive matrix 1 ManualHPRD>02095_2>S645>RNA Assigned Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1959065 Prelamin-A/C ManualE>S220>Serine/arginine Assigned Name:Prelamin-A/C HPRD>01035_1>S390>Lami n A/C 1959370 Insulin-like growth factor 2 mRNA-binding ManualHPRD>01035_2>S390>Lami Assigned protein 3 Name:Insulin-like growth factor 2 mRNA-binding protein 3 1960166 RNA-binding protein 26 ManualSwissPROT>IF2B3_MOUSE> Assigned Name:RNA- binding protein 26 HPRD>12611_1>S127>Cuta neous T cell lymphoma tumor 1959897 D(1B) dopamine receptor Manualantigen Assignedse70-2 Name:D(1B) dopamine receptor HPRD>00542_1>S261>Dopa mine receptor, D5 Diabetes Page 188 of 603
1958818 Eukaryotic translation initiation factor 3 Manual Assigned subunit B Name:Eukaryotic translation initiation factor 3 subunit B SwissPROT>Q8CIJ3_MOUS 1958862 Apolipoprotein A-I-binding protein ManualE>Eif3b Assignedprotein OS=Mus Name:Apolipoprotein A-I- binding protein SwissPROT>AIBP_MOUSE> 1958999 Swi5-dependent recombination DNA repair ManualS43>Apolipoprotein Assigned Name:Swi5- A-I- protein 1 homolog dependent recombination DNA repair protein 1 homolog SwissPROT>CJ078_MOUSE 1959674 Swi5-dependent recombination DNA repair Manual>S67T70>Uncharacterized Assigned Name:Swi5- protein 1 homolog dependent recombination DNA repair protein 1 homolog SwissPROT>CJ078_MOUSE 1958925 Formin-like protein 2 Manual>S67S71>Uncharacterized Assigned Name:Formin-like protein 2 HPRD>13545_1>S171>Formi n like 2 1958716 High mobility group protein HMGI-C ManualHPRD>13545_2>S171>Formi Assigned Name:High mobility group protein HMGI- C SwissPROT>HMGA2_MOUS 1958769 Prelamin-A/C ManualE>S104>High Assigned mobility group Name:Prelamin-A/C HPRD>01035_1>S390>Lami n A/C 1959871 Prelamin-A/C ManualHPRD>01035_2>S390>Lami Assigned Name:Prelamin-A/C HPRD>01035_1>S392>Lami n A/C 1958840 Transformer-2 protein homolog beta ManualHPRD>01035_2>S392>Lami Assigned Name:Transformer-2 protein homolog beta HPRD>04096_1>S260S262> 1960177 Serine/arginine repetitive matrix protein 2 ManualTRA2A Assigned Name:Serine/arginine repetitive matrix protein 2 IPI>Q8BTI8>Serine/arginine repetitive matrix protein 2 Page 189 of 603 Diabetes
1958834 Glycylpeptide N-tetradecanoyltransferase 1 Manual Assigned Name:Glycylpeptide N- tetradecanoyltransferase 1 SwissPROT>NMT1_MOUSE 1959082 Zinc finger CCCH domain-containing protein Manual>S47>Glycylpeptide Assigned Name:Zinc N- 18 finger CCCH domain- containing protein 18 HPRD>11232_1>S534>Cons 1959591 Acin1 protein Manualerved nuclear Assigned protein Name:Acin1 NHN1 protein SwissPROT>ACINU_MOUSE >S798>Isoform 4 of Apoptotic 1959705 Polymerase I and transcript release factor Manualchromatin Assigned condensation Name:Polymerase I and transcript release factor SwissPROT>PTRF_MOUSE> 1959471 Glycogen [starch] synthase, muscle ManualS171>Polymerase Assigned I and Name:Glycogen [starch] synthase, muscle SwissPROT>D3Z0Q6_MOUS 1960447 Glycogen [starch] synthase, muscle ManualE>T650>Uncharacterized Assigned Name:Glycogen [starch] synthase, muscle SwissPROT>D3Z0Q6_MOUS 1959289 Novel protein (1200015F23Rik) (Fragment) ManualE>S655>Uncharacterized Assigned Name:Novel protein (1200015F23Rik) (Fragment) SwissPROT>A3KGH5_MOU 1958612 Eukaryotic translation initiation factor 3 ManualSE>S46>Novel Assigned protein subunit G Name:Eukaryotic translation initiation factor 3 subunit G SwissPROT>EIF3G_MOUSE 1960102 Eukaryotic translation initiation factor 3 Manual>T41>Eukaryotic Assigned translation subunit G Name:Eukaryotic translation initiation factor 3 subunit G SwissPROT>EIF3G_MOUSE 1960012 Disintegrin and metalloproteinase domain- Manual>S42>Eukaryotic Assigned translation containing protein 17 Name:Disintegrin and metalloproteinase domain- containing protein 17 HPRD>04703_1>S791>ADA Diabetes Page 190 of 603
1959719 Bcl-2-associated transcription factor 1 Manual Assigned Name:Bcl-2- associated transcription factor 1 HPRD>16544_1>Y284S297> 1959335 Serine/arginine repetitive matrix protein 2 ManualBCL2 associated Assigned transcription Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1959627 Tyrosine-protein kinase BAZ1B ManualE>T955>Isoform Assigned 3 of Name:Tyrosine-protein kinase BAZ1B HPRD>10416_1>S283>Brom 1958692 Bcl-2-like protein 13 Manualodomain Assigned adjacent Name:Bcl-2-to zinc like protein 13 SwissPROT>B2L13_MOUSE >S387>Bcl-2-like protein 13 1958823 MCG123425, isoform CRA_e ManualOS=Mus Assigned musculus Name:MCG123425, isoform CRA_e HPRD>10139_1>S1834>Pec 1958969 MCG127409 Manualanex homolog Assigned Name:MCG127409 SwissPROT>D3YXK2_MOUS E>S345>Uncharacterized 1959433 Bcl-2-associated transcription factor 1 Manualprotein OS=MusAssigned musculus Name:Bcl-2- associated transcription factor 1 SwissPROT>BCLF1_MOUSE 1958725 Serine/arginine repetitive matrix 1 Manual>S654>Isoform Assigned 3 of Bcl-2- Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>S616>Serin 1958846 Heat shock protein 84b Manuale arginine Assigned repetitive Name:Heat matrix shock protein 84b HPRD>06763_1>S255>HSP9 0B 1959778 Perilipin-1 ManualHPRD>11811_1>S218>Heat Assigned Name:Perilipin-1 SwissPROT>PLIN_MOUSE> S222>Perilipin (PERI) (Lipid droplet-associated protein) Page 191 of 603 Diabetes
1958889 Sntb2 protein Manual Assigned Name:Sntb2 protein SwissPROT>B7ZNU9_MOUS E>S90>Sntb2 protein 1959508 Elongation factor 1-beta ManualOS=Mus Assigned musculus GN=Sntb2 Name:Elongation factor 1- beta HPRD>02804_1>S106>Eukar 1959319 Aladin Manualyotic translation Assigned elongation Name:Aladin HPRD>05646_1>S495>Aladi n 1958807 Transformer-2 protein homolog beta ManualSwissPROT>AAAS_MOUSE> Assigned Name:Transformer-2 protein homolog beta HPRD>04096_1>S260Y264> 1959772 Kinesin light chain 2 ManualTRA2A Assigned Name:Kinesin light chain 2 HPRD>13917_1>S610>FLJ1 2387 1958620 ATP-binding cassette sub-family F member 1 ManualSwissPROT>D3YXZ3_MOUS Assigned Name:ATP- binding cassette sub-family F member 1 SwissPROT>ABCF1_MOUSE 1959637 Nuclease-sensitive element-binding protein 1 Manual>S138>ATP-binding Assigned cassette Name:Nuclease-sensitive element-binding protein 1 HPRD>01095_1>YB-1 1959580 High mobility group protein HMGI-C ManualSwissPROT>A2BGG7_MOU Assigned Name:High mobility group protein HMGI- C SwissPROT>HMGA2_MOUS 1959864 High mobility group protein HMGI-C ManualE>S101S104>High Assigned Name:High mobility mobility group protein HMGI- C SwissPROT>HMGA2_MOUS 1960188 Serrate RNA effector molecule homolog ManualE>S100S104>High Assigned mobility Name:Serrate RNA effector molecule homolog HPRD>10665_1>S74>Arsenit e resistance protein 2 Diabetes Page 192 of 603
1958910 Pinin Manual Assigned Name:Pinin SwissPROT>PININ_MOUSE> S346>Pinin OS=Mus musculus GN=Pnn 1958791 Heat shock protein 84b ManualSwissPROT>Q3TUQ5_MOU Assigned Name:Heat shock protein 84b HPRD>06763_1>S226>HSP9 0B 1959188 SAM and SH3 domain-containing protein 1 ManualSwissPROT>HS90B_MOUSE Assigned Name:SAM and SH3 domain-containing protein 1 SwissPROT>SASH1_MOUS 1959747 SAM and SH3 domain-containing protein 1 ManualE>S831>SAM Assigned and Name:SAM SH3 and SH3 domain-containing protein 1 SwissPROT>SASH1_MOUS 1959234 Serine/arginine repetitive matrix protein 2 ManualE>S829>SAM Assigned and SH3 Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1959831 ATP-binding cassette sub-family F member 1 ManualE>S1360>Isoform Assigned Name:ATP- 3 of binding cassette sub-family F member 1 SwissPROT>ABCF1_MOUSE 1959861 Serine/arginine-rich splicing factor 2 Manual>S107>ATP-binding Assigned cassette Name:Serine/arginine-rich splicing factor 2 HPRD>02888_1>S189S191> 1958688 Serine/arginine repetitive matrix 1 ManualSplicing Assignedfactor, arginine/serine Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>S450>Serin 1960184 Pinin Manuale arginine Assigned repetitive Name:Pinin matrix HPRD>04401_1>S99>Pinin HPRD>04401_2>S100>Pinin SwissPROT>PININ_MOUSE> 1960011 Nuclear ubiquitous casein and cyclin- ManualS100>Pinin Assigned OS=Mus dependent kinases substrate Name:Nuclear ubiquitous casein and cyclin-dependent kinases substrate HPRD>11406_1>S19>Nuclea Page 193 of 603 Diabetes
1959362 Heterogeneous nuclear ribonucleoproteins Manual Assigned C1/C2 Name:Heterogeneous nuclear ribonucleoproteins C1/C2 SwissPROT>HNRPC_MOUS 1959799 Heterogeneous nuclear ribonucleoproteins ManualE>S261>Isoform Assigned 5 of C1/C2 Name:Heterogeneous nuclear ribonucleoproteins C1/C2 SwissPROT>HNRPC_MOUS 1958883 Melanoma inhibitory activity protein 3 ManualE>S254>Isoform Assigned 5 of Name:Melanoma inhibitory activity protein 3 SwissPROT>MIA3_MOUSE> 1959905 Melanoma inhibitory activity protein 3 ManualS617>Isoform Assigned 3 of Melanoma Name:Melanoma inhibitory activity protein 3 SwissPROT>MIA3_MOUSE> 1960246 Melanoma inhibitory activity protein 3 ManualS616>Isoform Assigned 3 of Melanoma Name:Melanoma inhibitory activity protein 3 SwissPROT>MIA3_MOUSE> 1959488 A3 subunit of vacuolar-adenosine ManualS615>Isoform Assigned 3 of Name:A3 Melanoma triphosphatase subunit of vacuolar-adenosine triphosphatase SwissPROT>Q91W06_MOU 1960266 EH domain-binding protein 1-like protein 1 ManualSE>S693>"T-cell, Assigned Name:EHimmune domain-binding protein 1-like protein 1 SwissPROT>EH1L1_MOUSE 1959119 Cobl-like 1 Manual>S499>Isoform Assigned 5 Name:Cobl-of EH like 1 SwissPROT>B1AZ14_MOUS E>S268>Cobl-like 1 OS=Mus 1959123 Cobl-like 1 Manualmusculus Assigned GN=Cobll1 Name:Cobl- like 1 SwissPROT>B1AZ14_MOUS E>S268>Cobl-like 1 OS=Mus 1959639 Serine/arginine-rich splicing factor 7 Manualmusculus Assigned GN=Cobll1 Name:Serine/arginine-rich splicing factor 7 SwissPROT>SFRS7_MOUSE >S208S210S212>Splicing Diabetes Page 194 of 603
1958812 Eukaryotic translation initiation factor 3 Manual Assigned subunit B Name:Eukaryotic translation initiation factor 3 subunit B SwissPROT>Q8CIJ3_MOUS 1960176 Bcl-2-associated transcription factor 1 ManualE>Eif3b Assignedprotein OS=Mus Name:Bcl-2- associated transcription factor 1 SwissPROT>BCLF1_MOUSE 1958918 Tensin-like C1 domain-containing Manual>S492>Isoform Assigned 3 of Bcl-2- phosphatase Name:Tensin-like C1 domain- containing phosphatase SwissPROT>TENC1_MOUS 1958697 Myosin-9 ManualE>S1087>Isoform Assigned 4 of Tensin- Name:Myosin-9 SwissPROT>MYH9_MOUSE >S1943>Myosin-9 OS=Mus 1958847 Ahnak AHNAK nucleoprotein isoform 1 Manualmusculus Assigned GN=Myh9 Name:Ahnak AHNAK nucleoprotein isoform 1 IPI>IPI00553798.2>Ahnak 1959192 Pre-mRNA 3'-end-processing factor FIP1 ManualAHNAK Assignednucleoprotein Name:Pre- isoform mRNA 3'-end-processing factor FIP1 HPRD>09646_1>S492>FIP1 1959748 Pre-mRNA 3'-end-processing factor FIP1 Manuallike 1 Assigned Name:Pre- mRNA 3'-end-processing factor FIP1 HPRD>09646_1>S496>FIP1 1959984 Pre-mRNA 3'-end-processing factor FIP1 Manuallike 1 Assigned Name:Pre- mRNA 3'-end-processing factor FIP1 HPRD>09646_1>T494>FIP1 1959560 Heterogeneous nuclear ribonucleoprotein D0 Manuallike 1 Assigned Name:Heterogeneous nuclear ribonucleoprotein D0 HPRD>03206_1>S82>Hetero 1959671 Isoform 3 of Peripheral plasma membrane Manualgeneous Assigned nuclear protein CASK Name:Isoform 3 of Peripheral plasma membrane protein CASK IPI>O70589-3>S569>Isoform Page 195 of 603 Diabetes
1959217 Ankyrin repeat domain-containing protein 57 Manual Assigned Name:Ankyrin repeat domain- containing protein 57 SwissPROT>ANR57_MOUSE 1959411 Importin subunit alpha-3 Manual>S82>Ankyrin Assigned repeat domain- Name:Importin subunit alpha- 3 HPRD>03536_1>S60>Karyop 1958842 Protein KRI1 homolog Manualherin alpha3 Assigned Name:Protein KRI1 homolog SwissPROT>KRI1_MOUSE> S148>Protein KRI1 homolog 1959427 Kinesin light chain 2 ManualOS=Mus Assigned musculus GN=Kri1 Name:Kinesin light chain 2 HPRD>13917_1>S582>FLJ1 2387 1958615 Eukaryotic translation initiation factor 3 ManualSwissPROT>D3YXZ3_MOUS Assigned subunit G Name:Eukaryotic translation initiation factor 3 subunit G SwissPROT>EIF3G_MOUSE 1958710 Serine/arginine repetitive matrix protein 2 Manual>T41>Eukaryotic Assigned translation Name:Serine/arginine repetitive matrix protein 2 HPRD>06913_1>S1925T192 1960062 Ras-related GTP-binding protein C Manual7>SRRM2 Assigned Name:Ras- related GTP-binding protein C HPRD>12198_1>S95>Ras related GTP binding C 1959632 Bcl-2-associated transcription factor 1 ManualHPRD>12199_1>S96>Ras Assigned Name:Bcl-2- associated transcription factor 1 HPRD>16544_1>S177>BCL2 1958902 Tln2 talin-2 Manualassociated Assigned transcription Name:Tln2 factor talin-2 HPRD>09555_1>T1843>Tali n 2 1958729 Serine/arginine-rich splicing factor 2 ManualSwissPROT>B2RY15_MOUS Assigned Name:Serine/arginine-rich splicing factor 2 HPRD>02888_1>S206S208S 212S220>Splicing factor, Diabetes Page 196 of 603
1958655 40S ribosomal protein S17 Manual Assigned Name:40S ribosomal protein S17 HPRD>01600_1>S113>Ribos omal protein S17 1959365 Acetyl-coenzyme A synthetase, cytoplasmic ManualHPRD>18936_1>S113>Simil Assigned Name:Acetyl-coenzyme A synthetase, cytoplasmic SwissPROT>A2AQN4_MOU 1960180 Ahnak AHNAK nucleoprotein isoform 1 ManualSE>S30>Acyl-CoA Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 IPI>IPI00553798.2>Ahnak 1959380 Prelamin-A/C ManualAHNAK Assignednucleoprotein isoform Name:Prelamin-A/C HPRD>01035_2>S628>Lami n A/C 1959381 Prelamin-A/C ManualHPRD>01035_3>S598>Lami Assigned Name:Prelamin-A/C HPRD>01035_2>S632>Lami n A/C 1959568 Bcl-2-associated transcription factor 1 ManualHPRD>01035_3>S602>Lami Assigned Name:Bcl-2- associated transcription factor 1 HPRD>16544_1>S648>BCL2 1958998 Swi5-dependent recombination DNA repair Manualassociated Assigned transcription Name:Swi5- factor protein 1 homolog dependent recombination DNA repair protein 1 homolog SwissPROT>CJ078_MOUSE 1960262 Serine/arginine repetitive matrix protein 2 Manual>S67T70>Uncharacterized Assigned Name:Serine/arginine repetitive matrix protein 2 IPI>Q8BTI8>Serine/arginine 1959435 Protein phosphatase 1 regulatory subunit Manualrepetitive Assigned matrix protein 2 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS 1959441 Protein phosphatase 1 regulatory subunit ManualE>T443>Isoform Assigned 2 of Protein 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS E>S445>Isoform 2 of Protein Page 197 of 603 Diabetes
1959099 Protein FAM54B Manual Assigned Name:Protein FAM54B HPRD>14248_1>S103>Famil y with sequence similarity 54, 1959034 E3 ubiquitin-protein ligase UBR4 Manualmember Assigned B Name:E3 ubiquitin-protein ligase UBR4 HPRD>10184_1>T2715S271 9>Retinoblastoma associated 1960174 Serine/arginine repetitive matrix 1 Manualfactor 600 Assigned Name:Serine/arginine repetitive matrix 1 HPRD>10441_1>T581S583> 1959751 Sodium/hydrogen exchanger ManualSerine arginine Assigned repetitive Name:Sodium/hydrogen exchanger SwissPROT>Q7TSV2_MOUS 1958700 High mobility group protein HMGI-C ManualE>S790>Sodium/hydrogen Assigned Name:High mobility group protein HMGI- C SwissPROT>HMGA2_MOUS 1958634 Protein FAM54B ManualE>S100S104>High Assigned mobility Name:Protein FAM54B HPRD>14248_1>S238>Famil y with sequence similarity 54, 1958720 Heat shock protein HSP 90-alpha Manualmember Assigned B Name:Heat shock protein HSP 90-alpha SwissPROT>HS90A_MOUSE >S231>Heat shock protein 1960149 Tuberin ManualHSP 90-alpha Assigned OS=Mus Name:Tuberin SwissPROT>Q3TCQ7_MOU SE>S1323>Putative 1959585 Vacuolar protein sorting-associated protein Manualuncharacterized Assigned protein 4B Name:Vacuolar protein sorting-associated protein 4B SwissPROT>VPS4B_MOUSE 1959664 Serine/arginine repetitive matrix protein 2 Manual>Vacuolar Assigned protein sorting- Name:Serine/arginine repetitive matrix protein 2 IPI>Q8BTI8>Serine/arginine repetitive matrix protein 2 Diabetes Page 198 of 603
1960420 Transcription intermediary factor 1-beta Manual Assigned Name:Transcription intermediary factor 1-beta SwissPROT>TIF1B_MOUSE 1959178 Eukaryotic translation initiation factor 5B Manual>S51>Isoform Assigned 2 of Name:Eukaryotic translation initiation factor 5B SwissPROT>IF2P_MOUSE> 1959083 Heterogeneous nuclear ribonucleoprotein H ManualS215>Eukaryotic Assigned translation Name:Heterogeneous nuclear ribonucleoprotein H HPRD>03021_1>T107>Heter 1959713 Heterogeneous nuclear ribonucleoprotein H Manualogeneous Assigned nuclear Name:Heterogeneous nuclear ribonucleoprotein H HPRD>03021_1>S104>Heter 1958728 Heterogeneous nuclear ribonucleoprotein U- Manualogeneous Assigned nuclear like protein 2 Name:Heterogeneous nuclear ribonucleoprotein U-like protein 2 1959309 Serine/arginine repetitive matrix protein 2 ManualSwissPROT>HNRL2_MOUS Assigned Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1959074 Brain-specific angiogenesis inhibitor 1- ManualE>S2351>Isoform Assigned Name:Brain- 3 of associated protein 2 specific angiogenesis inhibitor 1-associated protein 2 HPRD>05686_1>S366>BAI1 1959075 Brain-specific angiogenesis inhibitor 1- Manualassociated Assigned protein Name:Brain- 2 associated protein 2 specific angiogenesis inhibitor 1-associated protein 2 HPRD>05686_1>S365>BAI1 1959149 Papillary renal cell carcinoma (Translocation- Manualassociated Assigned protein 2 associated) Name:Papillary renal cell carcinoma (Translocation- associated) 1959588 Microtubule-associated protein 1A ManualSwissPROT>Q05CA9_MOUS Assigned Name:Microtubule-associated protein 1A SwissPROT>A2ARP8_MOUS E>S2841T2843>Microtubule- Page 199 of 603 Diabetes
1958676 Yorkie homolog Manual Assigned Name:Yorkie homolog HPRD>09424_1>Yes associated protein 1958806 Exocyst complex component 1 ManualSwissPROT>Q3U046_MOUS Assigned Name:Exocyst complex component 1 HPRD>07615_1>S470>Exoc 1960394 Serine/arginine repetitive matrix 1 Manualyst complex Assigned component 1 Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1958950 Rho GTPase activating protein 1 ManualE>S878>Serine/arginine Assigned Name:Rho GTPase activating protein 1 SwissPROT>A2AGT9_MOUS E>S91>Rho GTPase 1958653 CLIP-associating protein 1 Manualactivating Assigned protein 1Name:CLIP- OS=Mus associating protein 1 HPRD>09322_1>T796>CLIP associated protein 1 1959236 Serine/arginine repetitive matrix protein 2 ManualIPI>Q80TV8>T793>CLIP- Assigned Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1958985 28 kDa heat- and acid-stable phosphoprotein ManualE>S1360>Isoform Assigned Name:28 3 of kDa heat- and acid-stable phosphoprotein SwissPROT>HAP28_MOUSE 1959675 28 kDa heat- and acid-stable phosphoprotein Manual>S57S63>28 Assigned kDa Name:28heat- and kDa heat- and acid-stable phosphoprotein SwissPROT>HAP28_MOUSE 1959165 Glycogen synthase kinase-3 beta Manual>S60S63>28 Assigned kDa heat- and Name:Glycogen synthase kinase-3 beta HPRD>05418_1>Y216>Glyco 1958917 Pleckstrin homology-like domain family B Manualgen synthase Assigned kinase 3 beta member 1 Name:Pleckstrin homology- like domain family B member 1 HPRD>15128_1>S563>Pleck Diabetes Page 200 of 603
1958875 Transcriptional regulator ATRX Manual Assigned Name:Transcriptional regulator ATRX SwissPROT>A2ADH4_MOUS 1959731 182 kDa tankyrase-1-binding protein ManualE>Alpha Assigned thalassemia/mental Name:182 kDa tankyrase-1-binding protein HPRD>06164_1>S1620S162 1960065 Serine/threonine-protein kinase PRP4 Manual1>Tankyrase Assigned 1 binding homolog Name:Serine/threonine- protein kinase PRP4 homolog HPRD>09087_1>T847>PRP4 1959491 Ras-related GTP-binding protein C Manualpre-mRNA Assigned processing Name:Ras- factor related GTP-binding protein C HPRD>12198_1>T96>Ras related GTP binding C 1958867 Serine/arginine repetitive matrix protein 2 ManualHPRD>12199_1>T97>Ras Assigned Name:Serine/arginine repetitive matrix protein 2 SwissPROT>SRRM2_MOUS 1959027 Choline-phosphate cytidylyltransferase A ManualE>S1972T1974>Isoform Assigned 3 of Name:Choline-phosphate cytidylyltransferase A HPRD>00438_1>S315>Phos 1959302 Hepatoma-derived growth factor Manualphate cytidylyltransferase Assigned 1 Name:Hepatoma-derived growth factor SwissPROT>E0CXA0_MOUS 1959305 Hepatoma-derived growth factor ManualE>S96S101>Uncharacterized Assigned Name:Hepatoma-derived growth factor SwissPROT>E0CXA0_MOUS 1960013 Hepatoma-derived growth factor ManualE>S100S101>Uncharacterize Assigned Name:Hepatoma-derived growth factor SwissPROT>E0CXA0_MOUS 1959820 Protein transport protein Sec31A ManualE>S96S100>Uncharacterized Assigned Name:Protein transport protein Sec31A IPI>Q3UPL0>S526>Protein transport protein Sec31A Page 201 of 603 Diabetes
1960054 Protein transport protein Sec31A Manual Assigned Name:Protein transport protein Sec31A IPI>Q3UPL0>S531>Protein 1959801 Ragulator complex protein LAMTOR1 Manualtransport Assigned protein Sec31A Name:Ragulator complex protein LAMTOR1 SwissPROT>CK059_MOUSE 1960035 Ragulator complex protein LAMTOR1 Manual>S26>RhoA Assigned activator Name:Ragulator complex protein LAMTOR1 SwissPROT>CK059_MOUSE 1960411 Ragulator complex protein LAMTOR1 Manual>S27>RhoA Assigned activator Name:Ragulator complex protein LAMTOR1 SwissPROT>CK059_MOUSE 1959352 Intersectin-1 Manual>T28>RhoA Assigned activator Name:Intersectin-1 HPRD>03898_1>S904>Inters ectin 1 1959798 Intersectin-1 ManualHPRD>03898_2>S904>Inters Assigned Name:Intersectin-1 HPRD>03898_1>S901>Inters ectin 1 1959132 Heat shock protein HSP 90-alpha ManualHPRD>03898_2>S901>Inters Assigned Name:Heat shock protein HSP 90-alpha SwissPROT>HS90A_MOUSE >S263>Heat shock protein 1960454 Serine/threonine-protein kinase PRP4 ManualHSP 90-alpha Assigned OS=Mus homolog Name:Serine/threonine- protein kinase PRP4 homolog HPRD>09087_1>Y849>PRP4 1958991 mRNA cap guanine-N7 methyltransferase Manualpre-mRNA Assigned processing factor Name:mRNA cap guanine-N7 methyltransferase SwissPROT>D3YYS7_MOUS 1958607 Utrn utrophin ManualE>S15>Uncharacterized Assigned Name:Utrn utrophin SwissPROT>O08614_MOUS E>Cytoskeletal protein OS=Mus musculus GN=Utrn Diabetes Page 202 of 603
1958815 Nolc1 nucleolar and coiled-body Manual Assigned phosphoprotein 1 isoform D Name:Nolc1 nucleolar and coiled-body phosphoprotein 1 isoform D 1959261 Sntb2 protein ManualSwissPROT>Q3TKZ9_MOUS Assigned Name:Sntb2 protein HPRD>02491_1>S95>Syntro phin beta 2 1959282 Protein bicaudal D homolog 2 ManualHPRD>02491_2>S95>Syntro Assigned Name:Protein bicaudal D homolog 2 SwissPROT>D3Z390_MOUS 1959283 Serine/arginine-rich splicing factor 10 ManualE>S503>Uncharacterized Assigned Name:Serine/arginine-rich splicing factor 10 HPRD>05562_1>S133>FUS 1958951 Itsn1 protein Manualinteracting Assigned protein Name:Itsn1 1 protein SwissPROT>D3Z6P4_MOUS E>S274>Uncharacterized 1959661 Itsn1 protein Manualprotein OS=MusAssigned musculus Name:Itsn1 protein SwissPROT>D3Z6P4_MOUS E>S273>Uncharacterized 1958956 Thyroid hormone receptor-associated protein Manualprotein OS=MusAssigned musculus 3 Name:Thyroid hormone receptor-associated protein 3 SwissPROT>Q8BZN7_MOUS 1959379 Rho guanine nucleotide exchange factor 7 ManualE>S243>Putative Assigned Name:Rho guanine nucleotide exchange factor 7 HPRD>02226_1>S488>Rho 1958771 Ahnak AHNAK nucleoprotein isoform 1 Manualguanine Assigned nucleotide exchange Name:Ahnak AHNAK nucleoprotein isoform 1 HPRD>14684_2>S5782>AH 1959452 Ahnak AHNAK nucleoprotein isoform 1 ManualNAK nucleoprotein Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 HPRD>14684_2>T5824>AHN AK nucleoprotein Page 203 of 603 Diabetes
1959825 Ahnak AHNAK nucleoprotein isoform 1 Manual Assigned Name:Ahnak AHNAK nucleoprotein isoform 1 HPRD>14684_2>S5830>AH 1959128 HIV Tat-specific factor 1 homolog ManualNAK nucleoprotein Assigned Name:HIV Tat-specific factor 1 homolog HPRD>02282_1>S721>TATS F1 1959723 Synapse-associated protein 1 ManualIPI>Q8BGC0>S724>HIV Assigned Tat- Name:Synapse-associated protein 1 HPRD>06733_1>T248>Syna 1958828 Serine/threonine-protein kinase B-raf Manualpse associated Assigned protein 1 Name:Serine/threonine- protein kinase B-raf HPRD>01264_1>S729>B-Raf 1959701 Cad protein ManualSwissPROT>BRAF_MOUSE> Assigned Name:Cad protein HPRD>06437_1>S1859>Glut amine dependent carbamoyl 1959015 Serine/arginine repetitive matrix 1 Manualphosphate Assigned synthase Name:Serine/arginine repetitive matrix 1 SwissPROT>A2A8V8_MOUS 1959166 Activating signal cointegrator 1 complex ManualE>S558S560>Serine/arginine Assigned subunit 3-like 1 Name:Activating signal cointegrator 1 complex subunit 3-like 1 1959038 Rab GTPase-binding effector protein 1 ManualHPRD>03391_1>S225>U5 Assigned Name:Rab GTPase-binding effector protein 1 SwissPROT>Q5QNU3_MOU 1959445 Protein phosphatase 1 regulatory subunit ManualSE>S407S410>"Rabaptin, Assigned 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS 1959341 General vesicular transport factor p115 ManualE>Y446>Isoform Assigned 2 of Protein Name:General vesicular transport factor p115 SwissPROT>USO1_MOUSE >Isoform 4 of General Diabetes Page 204 of 603
1959290 Protein SON Manual Assigned Name:Protein SON SwissPROT>Q811G3_MOUS E>S1723>Son protein 1959084 Yorkie homolog Manual(Fragment) Assigned OS=Mus Name:Yorkie homolog HPRD>09424_1>Yes associated protein 1960322 Yorkie homolog ManualSwissPROT>Q3U046_MOUS Assigned Name:Yorkie homolog HPRD>09424_1>Yes associated protein 1959351 Acetyl-coenzyme A synthetase, cytoplasmic ManualSwissPROT>Q3U046_MOUS Assigned Name:Acetyl-coenzyme A synthetase, cytoplasmic SwissPROT>A2AQN4_MOU 1958928 Secreted frizzled-related protein 2 ManualSE>S30>Acyl-CoA Assigned Name:Secreted frizzled- related protein 2 HPRD>16041_1>S289>Secre 1959912 DNA polymerase eta Manualted frizzled Assigned related Name:DNA protein 2 polymerase eta HPRD>01592_1>S235>Ribos omal protein S6 1960264 DNA polymerase eta ManualHPRD>04913_1>S379>DNA Assigned Name:DNA polymerase eta HPRD>01592_1>S236>Ribos omal protein S6 1958650 Ubiquitin carboxyl-terminal hydrolase ManualHPRD>04913_1>S380>DNA Assigned Name:Ubiquitin carboxyl- terminal hydrolase HPRD>11664_1>Ubiquitin 1958651 Ubiquitin carboxyl-terminal hydrolase Manualspecific Assignedprotease 24 Name:Ubiquitin carboxyl- terminal hydrolase HPRD>11664_1>Ubiquitin 1959256 RNA-binding protein 39 Manualspecific Assignedprotease 24Name:RNA- binding protein 39 HPRD>09201_2>S136>Splici ng factor HCC1 HPRD>09201_3>S136>Splici Page 205 of 603 Diabetes
1960240 Itsn1 protein Manual Assigned Name:Itsn1 protein SwissPROT>D3Z6P4_MOUS E>S273>Uncharacterized 1959453 Prostaglandin E synthase 3 Manualprotein OS=MusAssigned musculus Name:Prostaglandin E synthase 3 HPRD>06138_1>Unactive 1960125 Microtubule-associated protein 1A Manualprogesterone Assigned receptor 23KD Name:Microtubule-associated protein 1A SwissPROT>A2ARP8_MOUS 1960217 40S ribosomal protein S6 ManualE>S764S765>Microtubule- Assigned Name:40S ribosomal protein S6 HPRD>01592_1>S236S240> Ribosomal protein S6 1959711 Heat shock protein HSP 90-alpha ManualSwissPROT>D3YX41_MOUS Assigned Name:Heat shock protein HSP 90-alpha SwissPROT>HS90A_MOUSE >S263>Heat shock protein 1960301 Ubiquitin carboxyl-terminal hydrolase ManualHSP 90-alpha Assigned OS=Mus Name:Ubiquitin carboxyl- terminal hydrolase HPRD>11664_2>Ubiquitin 1959553 Proline-rich AKT1 substrate 1 Manualspecific Assignedprotease 24 Name:Proline-rich AKT1 substrate 1 SwissPROT>AKTS1_MOUSE 1959947 Histone deacetylase Manual>Proline-rich Assigned AKT1 substrate Name:Histone deacetylase SwissPROT>D3YYI8_MOUS E>S421S423>MCG128529 1959214 Ras GTPase-activating protein-binding ManualOS=Mus Assigned musculus Name:Ras protein 1 GTPase-activating protein- binding protein 1 SwissPROT>G3BP_MOUSE> 1958901 Protein SET ManualS231>Ras-GTPase-activating Assigned Name:Protein SET SwissPROT>A2BE92_MOUS E>S30>SET translocation (Fragment) OS=Mus Diabetes Page 206 of 603
1959874 Proteasome subunit alpha type-3 Manual Assigned Name:Proteasome subunit alpha type-3 HPRD>01463_1>S243>Prote 1960189 Proteasome subunit alpha type-3 Manualasome subunit,Assigned alpha type 3 Name:Proteasome subunit alpha type-3 HPRD>01463_1>S250>Prote 1959815 Apoptotic chromatin condensation inducer 1 Manualasome subunit,Assigned alpha type 3 (Fragment) Name:Apoptotic chromatin condensation inducer 1 (Fragment) 1960398 Novel protein (1200015F23Rik) (Fragment) ManualSwissPROT>ACINU_MOUSE Assigned Name:Novel protein (1200015F23Rik) (Fragment) SwissPROT>A3KGH5_MOU 1958930 Torsin-1A-interacting protein 1 ManualSE>S44>Novel Assigned protein Name:Torsin-1A-interacting protein 1 SwissPROT>Q1EQW1_MOU 1959646 Retrotransposon-derived protein PEG10 ManualSE>S140>Lamina-associated Assigned Name:Retrotransposon- derived protein PEG10 SwissPROT>PEG10_MOUSE 1959171 A-kinase anchor protein 1, mitochondrial Manual>S30>Isoform Assigned RF1 Name:A- of kinase anchor protein 1, mitochondrial SwissPROT>AKAP1_MOUSE 1959120 Superkiller viralicidic activity 2-like (S. Manual>S101>"Isoform Assigned 6 of A-kinase cerevisiae) Name:Superkiller viralicidic activity 2-like (S. cerevisiae) SwissPROT>Q3TW36_MOU 1959041 Pyruvate dehydrogenase E1 component ManualSE>S240>Putative Assigned subunit alpha, somatic form, mitochondrial Name:Pyruvate dehydrogenase E1 component subunit alpha, 1958905 Uncharacterized protein Manualsomatic Assignedform, mitochondrial Name:Uncharacterized protein SwissPROT>CF203_MOUSE >S106>Uncharacterized Page 207 of 603 Diabetes
1960295 Pyruvate dehydrogenase E1 component Manual Assigned subunit alpha, somatic form, mitochondrial Name:Pyruvate dehydrogenase E1 component subunit alpha, 1960030 Protein phosphatase 1 regulatory subunit Manualsomatic Assignedform, mitochondrial 12A Name:Protein phosphatase 1 regulatory subunit 12A SwissPROT>MYPT1_MOUS 1958731 Heterogeneous nuclear ribonucleoproteins ManualE>S445>Isoform Assigned 2 of Protein C1/C2 Name:Heterogeneous nuclear ribonucleoproteins C1/C2 SwissPROT>HNRPC_MOUS 1958601 Microfibrillar-associated protein 1 ManualE>S299>Isoform Assigned 5 of Name:Microfibrillar- associated protein 1 HPRD>02569_1>S52S53>Mi 1959222 Translation initiation factor eIF-2B subunit Manualcrofibrillar Assigned associated protein epsilon Name:Translation initiation factor eIF-2B subunit epsilon SwissPROT>EI2BE_MOUSE 1958826 La-related protein 7 Manual>S540>Translation Assigned Name:La- initiation related protein 7 IPI>Q05CL8>S253S256>La- related protein 7 1959681 STIP1 homology and U box-containing ManualIPI>IPI00340860.5>S253S25 Assigned protein 1 Name:STIP1 homology and U box-containing protein 1 SwissPROT>CHIP_MOUSE> 1959270 Calcium-regulated heat stable protein 1 ManualS20>STIP1 Assigned homology and U Name:Calcium-regulated heat stable protein 1 HPRD>08515_1>S41>Calciu 1959265 Protein kinase, cAMP dependent regulatory, Manualm regulated Assigned heat stable type I, alpha Name:Protein kinase, cAMP dependent regulatory, type I, alpha 1959067 Programmed cell death protein 5 ManualHPRD>01786_1>S83>Protein Assigned Name:Programmed cell death protein 5 SwissPROT>D3YVV5_MOUS E>S121>Uncharacterized Diabetes Page 208 of 603
accession assigned phosphosite number for sequence annotated psite shSNRK/shGFP qvalues for SILAC K.MDLLTTVQ T311 UNI:B1AXP3 1030.367211 0.006527052 T*HYK.Y
K.S*IRT*LPHI S870T873 UNI:IPI00351 687.5857302 0.006527052 K.Y 041.1
K.VGSLT*PP T618S621* UNI:Q3UHJ0 80.62611954 0.006527052 S*SPK.T
R.RPS*TIAEQ S358 UNI:Q8CFH6 16.17843572 0.009488101 TVAK.A
R.DSGTMGS* S289 UNI:Q8R5F7 11.21476787 0.039652747 DSDESVIQTK .R
R.AMALGDS S384 UNI:Q9QY24 7.510311874 0.033424285 S*PQTTEPVL R.E
R.RLS*EQLA S511* UNI:Q8BKC8 7.186401515 0.023035228 HTPTAFK.R
R.HLDRS*PE S655 UNI:Q0VBL3 6.791986233 0.04972369 SERPR.K
R.RFS*EGVL S429* UNI:P58871 5.516680661 0.038676564 QPPSQDQEK .L Page 209 of 603 Diabetes
R.NKFGS*AD S435 UNI:Q80W04 5.494552692 0.036609927 NIAHLK.D
K.SLS*TEVEP S195 UNI:B1ATR2 5.461699349 0.027575892 K.E
R.LATSS*PE S515 UNI:Q60953 4.868743253 0.026974997 QSWPSTFK. A
K.AT*SPPHL T527 UNI:Q60953 4.833140109 0.028508578 DGTSNPEST VPEK.K
K.ATS*PPHL S528 UNI:Q60953 4.833140109 0.028508578 DGTSNPEST VPEK.K
K.ELSTS*GP S32 UNI:Q03963 4.737904532 0.026441449 PHDR.R
R.LATS*S*PE S514S515 UNI:Q60953 4.486470131 0.044088092 QSWPSTFK. A
K.FLSHS*TD S1910* UNI:IPI00126 4.146197509 0.033977346 SLNK.I 181.9
R.ASSCS*LA S414 UNI:P58801 3.723166758 0.037260875 VISPFLVEK.G
R.RQS*SPSC S433 UNI:Q8BPM 3.527083918 0.032065908 VPVAETSSSI 2 GNGDGISK.L Diabetes Page 210 of 603
R.SRS*GEGE S473* UNI:Q62318 3.507745161 0.030830229 VSGLLR.K
R.SKVGS*TE S761* UNI:E9PWC 3.482284266 0.028919489 NIK.H 0
R.RAGDVLED S165 UNI:P51859 3.458883758 0.033163515 S*PKRPK.E
R.SRS*DIDVN S600* UNI:Q80TV8 3.457942251 0.02461838 AAASAK.S
K.SLS*NPDIA S458 UNI:Q80U35 3.167637163 0.037972079 SETLTLLSFL R.S
R.AT*S*NVFA T19S20 UNI:Q6ZWQ 3.044362225 0.034250636 MFDQSQIQE 9 FK.E
R.RLS*TQFT S81* UNI:Q8CGN 3.023249444 0.036609927 AANELACR.G 5
R.TSS*PTSLP S267 UNI:Q80XI3 2.904965445 0.009488101 PLAR.S
K.SPS*PSPT* S332T336 UNI:Q80VB6 2.895648188 0.02461838 SPGSLR.K
K.S*PSPSPT* S330T336 UNI:Q80VB6 2.895648188 0.02461838 SPGSLR.K Page 211 of 603 Diabetes
K.S*REDLSA S617* UNI:B9EHJ3 2.862407711 0.048092894 QPVQTK.F
K.IYHLPDAE S218* UNI:P42208 2.84493259 0.030830229 S*DEDEDFK. E
K.S*YELPDG S239 UNI:P60710 2.79460464 0.044088092 QVITIGNER.F
K.ATSPPHLD T535 UNI:Q60953 2.715230621 0.032869467 GT*SNPESTV PEKK.I
R.SFS*KEVE S1189* UNI:Q6NZJ6 2.692839154 0.043412508 ER.S
R.MREDYDS* S56 UNI:Q9CWZ 2.680331377 0.031719238 VEQDGDEPG 3 PQR.S
K.HIVSNDSS S437* UNI:P47713 2.590381322 0.023035228 DS*DDEAQG PK.G
R.T*PPSTPP T21T29 UNI:Q60710 2.58444013 0.022143962 AT*ANLSADD DFQNTDLR.T
R.T*PPS*TPP T21S24 UNI:Q60710 2.58444013 0.022143962 ATANLSADD DFQNTDLR.T
K.KEESEES* S105 UNI:G3UW6 2.462061548 0.02461838 DDDMGFGLF 9 D.- Diabetes Page 212 of 603
R.RTSMGGT* T556* UNI:Q02248 2.432719976 0.044088092 QQQFVEGVR .M
K.NGQEAGP T106 UNI:P15092 2.346603429 0.033163515 AT*PTSTTSH MLASER.G
R.RDST*EAP T1321S1328 UNI:Q6P4S8 2.346094034 0.02461838 KPES*SPEPP PGQGR.T
R.RDS*TEAP S1320S1328 UNI:Q6P4S8 2.346094034 0.02461838 KPES*SPEPP PGQGR.T
R.RDST*EAP T1321S1329 UNI:Q6P4S8 2.346094034 0.02461838 KPESS*PEPP PGQGR.T
R.RYS*PS*PP S610S612* UNI:A2A8V8 2.279917374 0.031260141 PK.R
K.GGDYALAP S353S356 UNI:P01897 2.259740506 0.02925192 GSQSS*EMS* LR.D
R.STS*PIIGS S179* UNI:Q3TC46 2.248154776 0.012029028 PPVR.A
K.LSGLS*FK. S104* UNI:P28667 2.243378641 0.049236616 R
R.TPPS*T*PP S24T25 UNI:Q60710 2.22358103 0.039740525 ATANLSADD DFQNTDLR.T Page 213 of 603 Diabetes
K.HIKEEPLS* S509S521* UNI:Q6DFW 2.17332402 0.036609927 EEEPCTSTA 4 VPS*PEK.K
R.RHSSLPT* T758S760* UNI:O54774 2.092782528 0.023035228 ES*DEDIAPA QR.V
R.RHSS*LPT S755S760* UNI:O54774 2.092782528 0.023035228 ES*DEDIAPA QR.V
K.KPEKPLFS S328 UNI:P97863 2.034584622 0.046134291 STS*PQDSSP R.L
R.AMS*TTSV S277 UNI:Q62418 1.983585439 0.023035228 TSSQPGK.L
R.KDS*LTQA S527 UNI:Q9DCD 1.981460652 0.023035228 QEQGTVLS.- 5
K.RTSPS*KP S609 UNI:E9PWC 1.972946035 0.044382609 SSAPALKPG 0 PK.T
R.HLSS*TSD S28 UNI:Q9DBC3 1.946710849 0.034250636 DEPLSSVNH AAK.A
R.TLS*SPTG S864 UNI:B1AZ14 1.916074199 0.023035228 TETNPPK.A
R.SASSDT*S T288* UNI:P70441 1.913017392 0.020146265 EELNSQDSP K.R Diabetes Page 214 of 603
R.S*ASSDTS S283* UNI:P70441 1.913017392 0.020146265 EELNSQDSP K.R
K.RLS*QPAG S269 UNI:Q8C0J2 1.912680833 0.034250636 GLLDSITNIF GR.R
K.HRPS*FTR. S281 UNI:B1AZ14 1.885574555 0.038735827 S
R.SVSHGS*N S902* UNI:Q3TLH4 1.869229993 0.028508578 HAQNAEEQR .N
R.S*VSHGSN S897* UNI:Q3TLH4 1.869229993 0.028508578 HAQNAEEQR .N
R.S*RPLNAV S328 UNI:Q9JKB3 1.867937489 0.034250636 SQDGK.E
K.AIS*SDMFF S431 UNI:Q99K28 1.867812251 0.036609927 GR.E
R.ETIPMNAS S220 UNI:P25446 1.860315338 0.018494698 NLS*LSK.Y
K.AEAENNSG S137 UNI:O70133- 1.858217199 0.026441449 VESSGYGS* 2 PGPTWDR.G
R.NGPLNES* S324* UNI:Q8BYC6 1.857986821 0.027903064 QEEEEDGEQ GSNLNR.E Page 215 of 603 Diabetes
R.YS*PSQNS S284S289* UNI:Q8K019 1.850863069 0.044088092 *PIHHIPSR.R
K.WAHDKFS* S34* UNI:Q80VM0 1.846695764 0.037972079 GEEGEIEDD ESGTENR.E
R.RLSNS*S*L S375S376 UNI:B2RX86 1.837821631 0.02461838 CSIEEEHR.T
R.RLS*NS*SL S373S375 UNI:B2RX86 1.837821631 0.02461838 CSIEEEHR.T
R.DLYRPLS* S352 UNI:Q80VB6 1.831289336 0.047923383 SDDLDSVGD SV.-
R.LRS*EDGV S136 UNI:IPI00553 1.827206088 0.02461838 EGDLGETQS 798.2 R.T
R.SNS*SEAS S87* UNI:P97825 1.826814176 0.02461838 SGDFLDLK.G
K.QQDS*QPE S380* UNI:O35691 1.809456489 0.023035228 EVMDVLEMV ESVK.H
K.ATWGDGG S121 UNI:Q9D3L3 1.807430692 0.02461838 DNS*PSNVV SK.Q
R.AELGMND S263S267* UNI:Q9QXG 1.805175222 0.026441449 S*PSQS*PPV 4 K.R Diabetes Page 216 of 603
K.NVRS*DVS S1766S1769* UNI:Q9R0L6 1.800967205 0.023035228 *DQEEDEES ER.C
R.GVAPADS* S738* UNI:Q6ZPS6 1.793389489 0.034339712 PDAPR.R
R.ESPRPPAA S81 UNI:Q6ZQ58 1.787033178 0.02461838 AEAPAGS*D GEDGGR.R
R.NLGS*INTE S137 UNI:O08547 1.784445139 0.042445681 LQDVQR.I
R.DS*GGTLA S184 UNI:Q9QZL0 1.782303538 0.028508578 YLDPELLFK. V
R.SLS*SPTVT S477* UNI:Q8CFI0 1.778058028 0.032869467 LSAPLEGAK. D
K.QLT*QPET T299* UNI:Q62418 1.777704319 0.018653912 SYGR.E
R.DRGGDT*S T313 UNI:O35892 1.766445226 0.034458466 DTESSIIIR.R
K.KEES*EES* S101S104 UNI:P47955 1.748758643 0.032333852 EDDMGFGLF D.-
K.DMS*PSAE S517 UNI:E9QPW 1.746091572 0.010595587 TEAPLAK.N 8 Page 217 of 603 Diabetes
R.S*LSFDPSL S183* UNI:P23804 1.739577844 0.022067974 GLCELR.E
R.DSGGT*LA T187 UNI:Q9QZL0 1.738093379 0.022173871 YLDPELLFK. V
R.EQES*S*G S122S123* UNI:D3Z3A0 1.732356121 0.033345923 EEDNDLSPE ER.E
R.QIS*EDVD S309 UNI:P46935 1.721334508 0.031181888 GPDNR.E
R.LAIQGPED S237* UNI:Q99KX1 1.703508357 0.023035228 S*PSR.Q
R.LAIQGPED S239* UNI:Q99KX1 1.703508357 0.023035228 SPS*R.Q
R.ISLPLPTFS S420* UNI:P20152 1.69542697 0.033977346 S*LNLR.E
R.LRS*EDGV S136 UNI:IPI00553 1.694508221 0.018138037 EGDLGETQS 798.2 R.T
K.YGLQDS*D S888* UNI:Q6PFD9 1.694181488 0.031441733 EEEEEHPPK. T
R.TNGISDVQI S523 UNI:Q62120 1.673153393 0.043529901 S*PTLQR.H Diabetes Page 218 of 603
R.S*VS*PVAE S1043S1045 UNI:A6H619 1.672232254 0.028508578 EHTR.R
K.LPAKLSVS* S171* UNI:O54724 1.665277371 0.02461838 K.S
K.LPAKLS*VS S169* UNI:O54724 1.665277371 0.02461838 K.S
R.GLGS*NED S393 UNI:Q8C0E3 1.662188757 0.02461838 GLQK.L
R.RLS*PS*AS S387S389S391* UNI:A2A8V8 1.66118578 0.025258451 *PPR.R
R.TLS*IDKGF S775 UNI:P12382 1.66108809 0.02461838 .-
R.TQSSS*CE S571 UNI:O70589- 1.658730791 0.036609927 DLPSTTQPK. 3 G
R.TQSS*SCE S570 UNI:O70589- 1.658730791 0.036609927 DLPSTTQPK. 3 G
R.DLLSDLQD S270* UNI:P24788 1.658476204 0.031260141 IS*DSER.K
R.S*NSVDTG S709* UNI:Q9Z1E4 1.652170775 0.035949602 PSSSLSTPTE PLSPTSSLGE ER.N Page 219 of 603 Diabetes
R.SNS*VDTG S711* UNI:Q9Z1E4 1.652170775 0.035949602 PSSSLSTPTE PLSPTSSLGE ER.N R.EES*DGEY S120* UNI:Q9R020 1.648868901 0.046001469 DEFGR.K
K.SETLVNAQ T141T145 UNI:Q9Z0P4 1.648171607 0.02461838 QT*PLGT*PK. E
K.ASLGS*LE S5525 UNI:IPI00553 1.64730001 0.023035228 GEVEAEASS 798.2 PK.G
K.S*NISPNFN S328 UNI:E9Q3P6 1.64474176 0.043586433 FMGQLLDFE R.T
R.SNS*TEHL S588 UNI:Q9JID9 1.642516967 0.028508578 LDAASGATE EPTEATLGR. A R.ISLPLPTFS S420* UNI:P20152 1.640260405 0.020146265 S*LNLR.E
K.NKEES*S*E S247S248S255* UNI:Q7TNV0 1.639143449 0.023035228 DEEKES*EEE QPPK.K
K.GGFS*DAD S379 UNI:Q569Z6 1.638930717 0.02461838 VK.M
K.SNIS*PNFN S331 UNI:E9Q3P6 1.625048815 0.043529901 FMGQLLDFE R.T Diabetes Page 220 of 603
R.NNLS*LGD S430 UNI:Q8BJ56 1.624564203 0.010595587 ALAK.W
R.LEAS*IER.I S26* UNI:Q9DAS9 1.616372588 0.028508578
R.AMS*LSDA S384 UNI:Q8CGN 1.611886008 0.026441449 LK.G 5
R.LAS*TSDIE S507 UNI:Q9DBR7 1.608325752 0.02461838 EK.E
R.LASTS*DIE S509 UNI:Q9DBR7 1.608325752 0.02461838 EK.E
R.TS*SEDNL S20 UNI:Q9QXS1- 1.607599616 0.02461838 YLAVLR.A 3
K.S*PLIESTA S299 UNI:Q9DBR7 1.603331838 0.03577241 NMENNQPQK .A
K.S*LENETLN S445* UNI:Q8BGD 1.600652371 0.034548735 K.E 9
R.LATTVS*AP S748* UNI:E9PWC 1.590243507 0.006527052 DLK.S 0
K.S*SSSVTT S317 UNI:P70460 1.581743576 0.043529901 SEAHPSTPC SSDDSDLER. V Page 221 of 603 Diabetes
K.SSS*SVTT S319 UNI:P70460 1.581743576 0.043529901 SEAHPSTPC SSDDSDLER. V R.NLS*FEIK.K S434* UNI:P35831 1.577085947 0.023035228
R.RRS*PT*PP S577T579 UNI:A2A8V8 1.569251883 0.023035228 PR.R
R.GLS*APSC S460 UNI:Q8CGN 1.557414097 0.0388827 PGLDDK.T 5
R.GLSAPS*C S463 UNI:Q8CGN 1.557414097 0.0388827 PGLDDK.T 5
K.ESTESSNT T337* UNI:Q6PHZ2 1.550852103 0.031132282 T*IEDEDVK.A
K.SPSPSPT* T336 UNI:Q80VB6 1.547173489 0.028508578 SPGSLR.K
K.SPSPSPTS S337 UNI:Q80VB6 1.547173489 0.028508578 *PGSLR.K
R.SAS*SDTS S285* UNI:P70441 1.546559055 0.026974997 EELNSQDSP K.R
K.ATIS*DEEI S199* UNI:Q8BJF9 1.539216882 0.027575892 ER.Q Diabetes Page 222 of 603
R.S*RS*RDS* S1141S1143S114 UNI:Q9ET54 1.539006346 0.026730019 GDENEPIQE 6* R.F
R.KAEDS*DS S499S501* UNI:Q9DBR1 1.538960225 0.031441733 *EPEPEDNV R.L
R.QSS*LTFQ S1183 UNI:B1AZ14 1.537458494 0.033543599 SSDPEHVR. Q
K.QSNASS*D S106* UNI:Q99JF8 1.532255554 0.018653912 VEVEEK.E
K.QSNAS*SD S105* UNI:Q99JF8 1.532255554 0.018653912 VEVEEK.E
K.EGINPGYD S444* UNI:Q08943 1.526535721 0.025258451 DYADS*DED QHDAYLER. M R.IS*EDETER S112 UNI:Q52KR6 1.521532722 0.035499969 .N
K.GGVTGS*P S5504 UNI:IPI00553 1.514696472 0.011048245 EASISGSK.G 798.2
R.SLS*TSGE S10* UNI:P60904 1.514310896 0.047305429 SLYHVLGLD K.N
R.S*LSTSGE S8* UNI:P60904 1.514310896 0.047305429 SLYHVLGLD K.N Page 223 of 603 Diabetes
R.YGS*QEHP S809 UNI:Q60790 1.513040337 0.02461838 IGDK.S
R.VS*PVPSP S777 UNI:Q8VDP3 1.508647518 0.02461838 SQPAR.R
R.HRPSS*PA S401T404* UNI:A2A8V8 1.508416289 0.027575892 T*PPPK.T
R.HRPS*SPA S400T404* UNI:A2A8V8 1.508416289 0.027575892 T*PPPK.T
K.NLAKPGVT S272S274* UNI:Q99JF8 1.505903125 0.010406962 STS*DS*EDE DDQEGEK.K
K.NLAKPGVT T271S274* UNI:Q99JF8 1.505903125 0.010406962 ST*SDS*EDE DDQEGEK.K
K.NLAKPGVT T269S274* UNI:Q99JF8 1.505903125 0.010406962 *STSDS*EDE DDQEGEK.K
K.NLAKPGVT S270T271* UNI:Q99JF8 1.505903125 0.010406962 S*T*SDSEDE DDQEGEK.K
R.RPS*QNAM S194* UNI:Q8CI95 1.502099031 0.037972079 SFFNVGHSK. L
R.VNGLPS*P S32T34 UNI:Q80VB6 1.496783223 0.034250636 T*HSAHCSFY R.T Diabetes Page 224 of 603
R.S*PS*PAPP S558S560* UNI:A2A8V8 1.495818924 0.046134291 PPPPPPPPR. R
R.SAS*ITNLS S307 UNI:Q9Z1T6 1.493433679 0.02461838 LDR.S
K.QQQEPTC S44* UNI:Q6NSP9 1.492803929 0.023035228 EPS*PK.R
R.IDIS*PSTF S679* UNI:Q569Z6 1.48857383 0.005885893 R.K
K.LGASNS*P S675* UNI:B2RY56 1.487448678 0.02721905 GQPNSVK.R
R.RMS*LEGR S188 UNI:O89110 1.485715271 0.026441449 .E
K.NSGPVSEV S1305 UNI:Q8BTI8 1.48158489 0.012029028 NTGFS*PEVK .E
R.AS*SHSSQ S403* UNI:P48678 1.478609713 0.032869467 SQGGGSVTK .K
R.ASS*HSSQ S404* UNI:P48678 1.478609713 0.032869467 SQGGGSVTK .K
R.KKS*PIVNE S278* UNI:Q61136 1.473136457 0.02461838 R.S Page 225 of 603 Diabetes
R.AES*PETS S1356* UNI:Q4VA53 1.466310875 0.027575892 AVESTQSTP QK.G
R.ISLPLPTFS S419* UNI:P20152 1.461662503 0.02461838 *SLNLR.E
R.AQS*TDSL S407* UNI:O35551 1.458931272 0.03461207 GTSSSLQSK. A
R.LS*LMEPE S410 UNI:Q8CGN 1.458232843 0.039652747 SEFR.D 5
R.LS*LMEPE S410 UNI:Q8CGN 1.458232843 0.039652747 SEFR.D 5
R.RRS*S*GL S1794S1795 UNI:IPI00761 1.456566669 0.030536122 QPQGAPEVR 751.2 .R
R.SIS*SPSM S1380 UNI:IPI00761 1.455309865 0.044769447 NR.L 751.2
K.S*TSSAMG S240 UNI:Q68EF0 1.453791107 0.012029028 GSHQDLSVI QPIVK.D
K.AAADDGEE S18 UNI:P28352 1.449665035 0.049439966 PKS*EPETK. K
R.SS*SLGDL S394 UNI:Q8K124 1.446931743 0.039652747 LR.E Diabetes Page 226 of 603
R.SSS*LGDL S395 UNI:Q8K124 1.446931743 0.039652747 LR.E
R.LS*PPHS*P S955S959 UNI:Q60875 1.444512803 0.011650196 R.D
R.VS*PEVGS S747 UNI:Q6PGL7 1.43736064 0.023035228 ADVASIAQK. E
R.ELS*PEQS S505 UNI:Q8CI11 1.433364785 0.041596747 TAGKPSDGS SALDR.A
R.SAS*YSYL S909* UNI:Q9DBR7 1.431451475 0.042013979 EDR.K
R.RPS*TSPD S266 UNI:Q9JJZ4 1.42604215 0.024170293 VLQGQPPR. A
R.GDVS*EDE S100 UNI:Q9D0L8 1.422807805 0.048711205 PSLGR.L
R.SNS*LPHS S434 UNI:Q3UWE 1.422009044 0.032333852 AVSNAASK.G 6
R.VDS*TTCL S259* UNI:P47856 1.419646368 0.039652747 FPVEEK.A
R.LGADES*E S85 UNI:Q8BHG 1.419130072 0.03461207 EEGR.S 1 Page 227 of 603 Diabetes
K.LIDLES*PT S1528* UNI:Q4VBF8 1.408639338 0.023035228 PESQK.N
R.LKTEEGEI S37 UNI:Q921F4 1.403853594 0.033345923 VYS*AEESEN R.Q
K.S*PSPPPD S265* UNI:Q6P1B9 1.398066809 0.010406962 GSPAATPEIR .V
K.GNKS*PS* S265S267* UNI:Q6P1B9 1.391840445 0.03854909 PPPDGSPAA TPEIR.V
R.SKS*PAST S307 UNI:Q80VB6 1.387821942 0.039652747 SSVNGTPGS QLSTPR.S
R.SKSPASTS S312 UNI:Q80VB6 1.387821942 0.039652747 *SVNGTPGS QLSTPR.S
R.SKSPAS*T S310 UNI:Q80VB6 1.387821942 0.039652747 SSVNGTPGS QLSTPR.S
R.LPAPQEDT T268 UNI:Q64012 1.386587308 0.040625492 *ASEAGTPQ GEVQTR.D
R.LPAPQEDT S270 UNI:Q64012 1.386587308 0.040625492 AS*EAGTPQ GEVQTR.D
K.S*PGHMVIL S552* UNI:Q8CH25 1.383510534 0.032869467 NQTK.G Diabetes Page 228 of 603
K.ADVSVEKL S1120 UNI:Q8C1B1 1.381093408 0.024913634 DGES*DKEQ FDDDQK.V
K.VATLNS*E S31* UNI:Q8VDJ3 1.38029287 0.043865778 EENDPPTYK. D
K.YNLDAS*E S188* UNI:Q9R020 1.375744805 0.030901956 EEDSNKK.K
R.LPSGS*GP S213S217 UNI:IPI00553 1.375631671 0.039652747 AS*PTTGSAV 798.2 DIR.A
R.LPS*GSGP S211S217 UNI:IPI00553 1.375631671 0.039652747 AS*PTTGSAV 798.2 DIR.A
R.YTDQS*GE S81 UNI:Q8K1Z0 1.374809674 0.02461838 EEEDYESEE QLQHR.I
K.RST*PSGP T163 UNI:O35479 1.373219393 0.046655501 VR.S
R.S*ASPDDD S15* UNI:Q9R0P4 1.369739358 0.046134291 LGSSNWEAA DLGNEER.K
K.QPLLLS*ED S39* UNI:Q8R1B4 1.360180049 0.03854909 EEDTKR.V
R.APDRT*PP T82* UNI:Q8BJU0 1.359439024 0.02461838 SEEDSAEAE R.L Page 229 of 603 Diabetes
R.GDS*ETDL S46 UNI:P46938 1.357241222 0.035949602 EALFNAVMN PK.T
K.EEPLS*EE S509* UNI:Q6DFW 1.357123392 0.036238122 EPCTSTAVP 4 SPEK.K
K.RGT*S*PR T740S741* UNI:P24788 1.357089895 0.04069897 PPEGGLGYS QLGDDDLK.E
K.RGT*S*PR T740S741* UNI:P24788 1.357089895 0.04069897 PPEGGLGYS QLGDDDLK.E
R.CLS*PDDS S981 UNI:Q9QYR 1.354478809 0.044382609 TVK.M 6
R.ISLPLPT*F T417* UNI:P20152 1.354359101 0.030901956 SSLNLR.E
K.NNS*PAPP S1079* UNI:Q14AX6 1.353928784 0.02461838 QPAPVK.A
R.HVTLPSS* S2716* UNI:A2AN08 1.353619484 0.02461838 PR.S
R.HVTLPS*S S2715* UNI:A2AN08 1.353619484 0.02461838 PR.S
K.IDASKNEE S83* UNI:Q60668 1.352892569 0.046134291 DEGHSNSS* PR.H Diabetes Page 230 of 603
R.LPSGS*GP S213S217 UNI:IPI00553 1.351894538 0.031747009 AS*PTTGSAV 798.2 DIR.A
R.LGS*LPR.D S72 UNI:Q8BX02 1.349009679 0.039652747
R.MYS*PSPS S1028 UNI:A2AIX1 1.345686476 0.03461207 DGPASQQPL PNHPR.Q
R.LRLS*PS*P S390S392* UNI:P48678 1.344837222 0.036609927 TSQR.S
R.LRLS*PSPT S390S395* UNI:P48678 1.344837222 0.036609927 S*QR.S
R.KLS*VDNN S857 UNI:Q8K4L2 1.343305074 0.044088092 TSATDYK.S
K.KKEPAISS S100* UNI:P10711 1.34274994 0.031381487 QNS*PEAR.E
R.T*PS*PPPP T263S265 UNI:IPI00515 1.342318767 0.028964788 ILEDIILGK.K 528.3
K.AGEQQLS* S19* UNI:E9QLK0 1.335951337 0.0490369 EPEDMEMEA GDTDDPPR.I
K.S*PLIESTA S299 UNI:Q9DBR7 1.333626849 0.028508578 NMENNQPQK .A Page 231 of 603 Diabetes
K.IAVDLS*DQ S121 UNI:Q3TX08 1.333363929 0.02435676 EEETAGK.N
R.QSS*LTFQ S1183 UNI:B1AZ14 1.332451842 0.039652747 SSDPEHVR. Q
K.SQS*PS*PP S243S245 UNI:B8JJ89 1.331690458 0.039652747 PLPEDLEK.A
R.RS*SQGVL S650* UNI:P54310 1.3313273 0.028508578 HMPLYTSPIV K.N
K.LASDDRPS S723* UNI:Q99KG3 1.328817873 0.028312977 *PPR.G
K.EKS*PELP S220* UNI:A2A8V8 1.328741142 0.010595587 EPSVR.M
R.LRLS*PSPT S390* UNI:P48678 1.328305987 0.038676564 SQR.S
K.VAYIPDET S165 UNI:Q9CPN8 1.327894113 0.018441724 AAQQNPS*P QLR.G
R.LNHS*PPQ S127* UNI:Q6NZN0 1.327583003 0.037940786 SSSR.Y
R.ISS*LER.S S255 UNI:Q8BLD9 1.32556176 0.040485407 Diabetes Page 232 of 603
R.GHPSAGA S120S123 UNI:Q8JZQ9 1.323809946 0.02461838 EEEGGS*DG S*AAEAEPR. A R.RGS*ETMA S43 UNI:Q8K4Z3 1.323215203 0.023035228 GAAVK.Y
R.ENPPS*PP S67T70 UNI:Q8BP27 1.321531455 0.02461838 T*SPAAPQPR .E
R.ENPPS*PP S67S71 UNI:Q8BP27 1.321531455 0.02461838 TS*PAAPQPR .E
R.S*IEDLHR. S171* UNI:A2APV2 1.320922284 0.0388827 G
K.KPAQETEE S104 UNI:P52927 1.318347756 0.03292067 TSSQES*AEE D.-
R.LS*PSPTS S390* UNI:P48678 1.315671756 0.026974997 QR.S
R.LSPS*PTS S392* UNI:P48678 1.315671756 0.026974997 QR.S
R.RS*PS*PYY S264S266* UNI:P62996 1.313439533 0.026441449 SR.Y
R.S*RT*PPSA S2360T2362 UNI:Q8BTI8 1.312567771 0.026441449 PSQSR.M Page 233 of 603 Diabetes
R.SGLS*PAN S47* UNI:O70310 1.309997347 0.035936682 DTGAK.K
K.LGVSVS*P S530* UNI:Q0P678 1.309312234 0.034250636 SR.A
K.GVQAGNS* S64 UNI:Q52KR6 1.308024285 0.040485407 DTEGGQPGR .K
K.LPAKLSVS* S171* UNI:O54724 1.307988791 0.041736861 K.S
R.SNSVDT*G T714* UNI:Q9Z1E4 1.30755911 0.031260141 PSSSLSTPTE PLSPTSSLGE ER.N R.SNSVDTGP S719* UNI:Q9Z1E4 1.30755911 0.031260141 SSS*LSTPTE PLSPTSSLGE ER.N R.SHS*LPNS S46 UNI:A3KGH5 1.307200209 0.043529901 LDYAQASER. G
K.GIPLPTGD T41* UNI:Q9Z1D1 1.30639995 0.02461838 T*SPEPELLP GDPLPPPK.E
K.GIPLPTGD S42* UNI:Q9Z1D1 1.30639995 0.02461838 TS*PEPELLP GDPLPPPK.E
K.S*FEDLTD S794* UNI:Q9Z0F8 1.304380939 0.043412508 HPVTR.S Diabetes Page 234 of 603
R.Y*SPSQNS Y283S296* UNI:Q8K019 1.304046112 0.026974997 PIHHIPS*R.R
K.MELGT*PL T955 UNI:Q8BTI8 1.303599997 0.02461838 R.H
K.YS*LPSK.F S283 UNI:Q9Z277 1.303298404 0.01143977
K.S*HTGEAA S387 UNI:P59017 1.302910906 0.039652747 AVR.G
R.ISS*IR.E S134 UNI:A6H6N9 1.300038734 0.006402985
R.APTAALS* S366 UNI:D3YXK2 1.299251705 0.029772069 PEPQDSK.E
R.IDIS*PSAL S656* UNI:Q8K019 1.298281706 0.034250636 R.K
R.TAS*PPPP S621* UNI:A2A8V8 1.297065955 0.028508578 PKR.R
K.IEDVGS*DE S255* UNI:Q71LX8 1.294530206 0.032656278 EDDSGK.D
R.RVS*TLAN S222 UNI:Q8CGN 1.294481779 0.045399155 TLSR.H 5 Page 235 of 603 Diabetes
R.GPAGEAS S90* UNI:B7ZNU9 1.290342975 0.03854909 AS*PPVR.R
K.DDDDIDLF S106* UNI:O70251 1.288460557 0.02461838 GS*DDEEES EEAK.K
R.FS*PVLGR. S495 UNI:P58742 1.288458848 0.02461838 A
R.RRS*PSPY* S264Y268* UNI:P62996 1.288331108 0.030344453 YSR.Y
R.TLSSS*SM S607* UNI:Q91YS4 1.284158337 0.042411267 DLSR.R
K.GGNVFEAL S138* UNI:Q6P542 1.283815988 0.039652747 IQDDS*EEEE EEEENR.V
R.NYQQNYQ S163* UNI:P62960 1.282931326 0.043168007 NS*ESGEKN EGSESAPEG QAQQR.R K.KPAQETEE S101S104 UNI:P52927 1.280342022 0.02461838 TSS*QES*AE ED.-
K.KPAQETEE S100S104 UNI:P52927 1.280342022 0.02461838 TS*SQES*AE ED.-
R.HELS*PPQ S74* UNI:Q99MR6 1.276686796 0.04497445 KR.M Diabetes Page 236 of 603
K.EAGIVHS*D S346* UNI:O35691 1.275339779 0.02461838 AEKEQEEEE QK.Q
R.EKEIS*DDE S226* UNI:Q71LX8 1.274954909 0.020146265 AEEEK.G
R.SHS*LDDL S831 UNI:P59808 1.274155533 0.043529901 QGDADVGK. N
R.S*HSLDDL S829 UNI:P59808 1.274155533 0.043529901 QGDADVGK. N
K.VSS*PVLET S1360 UNI:Q8BTI8 1.273571832 0.02461838 VQQR.T
K.QLSVPAS* S107* UNI:Q6P542 1.272821049 0.036609927 DEEDEVPAPI PR.G
R.S*RS*PPPV S189S191* UNI:Q62093 1.268468469 0.029723372 SK.R
K.RES*PSPA S448 UNI:A2A8V8 1.267824984 0.044088092 PKPR.K
R.QES*DPED S100* UNI:O35691 1.26740847 0.047447802 DDVK.K
R.KVVDYSQF S19* UNI:Q80XU3 1.267402056 0.023035228 QES*DDADE DYGR.D Page 237 of 603 Diabetes
K.MESEAGA S268* UNI:Q9Z204 1.266165059 0.010595587 DDS*AEEGD LLDDDDNED R.G K.MES*EAGA S261* UNI:Q9Z204 1.266165059 0.010595587 DDSAEEGDL LDDDDNEDR. G K.HSASDPGP S1766 UNI:Q8BI84 1.265678006 0.034250636 APVVNSSS*R .S
K.HSASDPGP S1765 UNI:Q8BI84 1.265678006 0.034250636 APVVNSS*SR .S
K.HSASDPGP S1764 UNI:Q8BI84 1.265678006 0.034250636 APVVNS*SSR .S
K.LLASPDAS S693 UNI:Q9JHF5 1.264686596 0.039740525 TLENS*WSP DEEK.A
R.RSS*VNGE S1444* UNI:Q99MS7 1.264224025 0.047767606 AGPVPPPR.A
R.EQTAS*AP S268 UNI:B1AZ14 1.263559329 0.039652747 ATPLVSK.H
R.EQTAS*AP S268 UNI:B1AZ14 1.263559329 0.039652747 ATPLVSK.H
R.S*RS*GS*II S208S210S212 UNI:Q8BL97 1.26147089 0.042928021 GSR.Y Diabetes Page 238 of 603
R.GHPSAGA S120S123 UNI:Q8JZQ9 1.260020213 0.032333852 EEEGGS*DG S*AAEAEPR. A K.KEVQS*PE S494* UNI:Q8K019 1.259834185 0.032869467 QVK.S
R.HLPGSGQ S1087 UNI:Q8CGB 1.258542724 0.026441449 QPS*PPAR.S 6
R.KGTGDCS* S1943* UNI:Q8VDD5 1.258383136 0.048092894 DEEVDGK.A
K.GHYEVTGS S5607 UNI:IPI00553 1.257344397 0.016086 *DDEAGK.L 798.2
R.DHS*PTPS S479* UNI:Q9D824 1.25535656 0.0490369 VFNSDEER.Y
R.DHSPTPS* S483* UNI:Q9D824 1.25535656 0.0490369 VFNSDEER.Y
R.DHSPT*PS T481* UNI:Q9D824 1.25535656 0.0490369 VFNSDEER.Y
K.NEEDEGH S82* UNI:Q60668 1.252431128 0.02461838 SNS*SPR.H
R.TQS*SSCE S569 UNI:O70589- 1.251752259 0.030830229 DLPSTTQPK. 3 G Page 239 of 603 Diabetes
R.FCTGDS*P S82 UNI:Q8C0J6 1.25105153 0.043529901 PLEAK.L
R.NVPQEESL S60* UNI:O35344 1.249710999 0.02461838 EDS*DVDADF K.A
K.YVDEDNS* S148* UNI:Q8VDQ 1.249671799 0.021014369 DGETVDHR.L 9
R.ASS*LNFL S575* UNI:O88448 1.249201467 0.028508578 NK.S
K.GIPLPTGD T41* UNI:Q9Z1D1 1.24861558 0.027926853 T*SPEPELLP GDPLPPPK.E
R.S*RT*PPVT S1878T1880 UNI:Q8BTI8 1.248014626 0.028508578 R.R
K.MSPNETLF S94* UNI:Q99K70 1.247766568 0.04692638 LES*TNK.I
K.KAEGEPQE S177* UNI:Q8K019 1.24533987 0.02461838 ES*PLK.S
K.LDEGT*PP T1844* UNI:IPI00229 1.244064683 0.031441733 EPK.G 647.5
R.S*KS*PPKS S206S208S212S2 UNI:Q62093 1.243982285 0.023035228 *PEEEGAVS* 20 S.- Diabetes Page 240 of 603
K.LLDFGS*LS S113* UNI:P63276 1.2426966 0.037100195 NLQVTQPTV GMNFK.T
R.GWS*PPPE S30* UNI:Q9QXG 1.241969833 0.023035228 VR.R 4
R.HRS*NS*FS S5553S5555 UNI:IPI00553 1.239927976 0.025540115 DER.E 798.2
R.S*VGGSGG S629 UNI:P48678 1.239367373 0.029723372 GSFGDNLVT R.S
R.SVGGS*GG S633 UNI:P48678 1.239367373 0.029723372 GSFGDNLVT R.S
R.QKS*PEIH S646* UNI:Q8K019 1.237761463 0.02461838 R.R
R.ENPPS*PP S67T70 UNI:Q8BP27 1.235598567 0.044088092 T*SPAAPQPR .E
K.RVPS*PTP S2535 UNI:Q8BTI8 1.233710269 0.043586433 VPK.E
K.T*GSYGAL T443* UNI:Q9DBR7 1.232507411 0.032869467 AEISASK.E
K.TGS*YGAL S445* UNI:Q9DBR7 1.232507411 0.032869467 AEISASK.E Page 241 of 603 Diabetes
R.NAS*VPNL S100 UNI:Q9CWE 1.231305977 0.009488101 R.G 0
R.HVT*LPSS* T2712S2716* UNI:A2AN08 1.22837412 0.039652747 PR.S
R.RRT*PS*PP T586S588 UNI:A2A8V8 1.228129997 0.041312983 PR.R
R.SKEPSSPG S790* UNI:Q7TSV2 1.22777835 0.039652747 TDDVFTPGS SDS*PSSQR.I
K.KPAQETEE S100S104 UNI:P52927 1.2265018 0.019815842 TS*SQES*AE ED.-
K.ASS*FADM S235 UNI:Q9CWE 1.225748465 0.020758727 MGILK.D 0
R.DKEVS*DD S231* UNI:P07901 1.223617148 0.031713029 EAEEKEEK.E
K.SSS*SPEL S1388* UNI:Q61037 1.221515309 0.03461207 QTLQDILGDL GDK.I
K.GNDS*DGE S102 UNI:P46467 1.220182339 0.035154749 AESDDPEK.K
R.S*RS*RT*P S1832S1834T183 UNI:Q8BTI8 1.219281444 0.041596747 LISR.R 6 Diabetes Page 242 of 603
K.RPAASSAA S51* UNI:Q62318 1.218892839 0.036609927 AASAAASS*P AGGGGEAQ ELLEHCGVC K.SVPTVDS*R.E S215* UNI:Q05D44 1.216586845 0.043586433 GNEDDDSSF K.I
K.HTGPNSPD T107* UNI:O35737 1.215205043 0.037869211 T*ANDGFVR. L
K.HTGPNS*P S104* UNI:O35737 1.215205043 0.037869211 DTANDGFVR. L
R.S*GDETPG S159 UNI:Q00PI9 1.21517713 0.034548735 SEAPGDK.A
R.TS*PLMLD S2351 UNI:Q8BTI8 1.214119195 0.029272654 R.A
R.SSS*MAAG S367 UNI:B1AZ46 1.214017769 0.02461838 LER.N
R.SS*SMAAG S366 UNI:B1AZ46 1.214017769 0.02461838 LER.N
R.IAAPELQK S157S159 UNI:Q9EQC 1.213572283 0.026441449 GDS*DS*EED 8 EPAK.K
K.RS*PT*PGK S2603T2605 UNI:Q9QYR 1.212917246 0.026883818 GPVDR.T 6 Page 243 of 603 Diabetes
R.GDSET*DL T48 UNI:P46938 1.211260524 0.02461838 EALFNAVMN PK.T
K.LTGS*TSSL S455 UNI:Q5PPR2 1.20909741 0.038676564 NK.L
R.KETES*EA S878 UNI:A2A8V8 1.208630523 0.04653522 EDDNLDDLE R.H
K.SSS*PEPV S91 UNI:A2AH25 1.20699461 0.011398117 THLK.W
R.VLST*STDL T793* UNI:Q80TV8 1.206357744 0.028508578 EAAVADALK. K
K.VSS*PVLET S1360 UNI:Q8BTI8 1.20517565 0.035154749 VQQR.T
K.S*LDSDES* S57S63* UNI:Q3UHX2 1.204827819 0.026441449 EDEDDDYQQ K.R
K.SLDS*DES* S60S63* UNI:Q3UHX2 1.204827819 0.026441449 EDEDDDYQQ K.R
R.GEPNVSY*I Y216* UNI:Q9WV6 1.204673176 0.033163515 CSR.Y 0
R.KLS*SGDL S565 UNI:Q6PDH0 1.204039741 0.02461838 R.V Diabetes Page 244 of 603
K.YVES*DDE S92* UNI:Q61687 1.202881238 0.031181888 KPTDENVNE K.A
R.VPS*S*DEE S1611S1612* UNI:P58871 1.202853148 0.043412508 VVEEPQSR.R
K.LCDFGSAS T847* UNI:Q61136 1.202195727 0.028508578 HVADNDIT*P YLVSR.F
K.MSPNETLF T95* UNI:Q99K70 1.200861328 0.042061773 LEST*NK.I
R.S*RT*PPAI S1972T1974 UNI:Q8BTI8 1.199887164 0.043381208 R.R
R.MLQAIS*PK S315* UNI:P49586 1.199397296 0.040625492 .Q
K.GS*AEGSS S128S133* UNI:P51859 1.19910738 0.043529901 *DEEGKLVID EPAK.E
K.GSAEGS*S S132S133* UNI:P51859 1.19910738 0.043529901 *DEEGKLVID EPAK.E
K.GS*AEGS* S128S132* UNI:P51859 1.19910738 0.043529901 SDEEGKLVID EPAK.E
K.DSDQVAQ S526 UNI:Q3UPL0 1.198015626 0.039652747 S*DGEESPA AEEQLLGER. I Page 245 of 603 Diabetes
K.DSDQVAQ S531 UNI:Q3UPL0 1.198015626 0.039652747 SDGEES*PA AEEQLLGER. I K.LLLDPS*ST S26 UNI:Q9CQ22 1.197794473 0.012029028 PTK.A
K.LLLDPSS*T S27 UNI:Q9CQ22 1.197794473 0.012029028 PTK.A
K.LLLDPSST* T28 UNI:Q9CQ22 1.197794473 0.012029028 PTK.A
R.SAFTPATA S897* UNI:Q9Z0R4 1.197259362 0.027003469 TGSSPS*PVL GQGEK.V
R.SAFTPATA S894* UNI:Q9Z0R4 1.197259362 0.027003469 TGS*SPSPVL GQGEK.V
K.ESDDKPEI S263* UNI:P07901 1.196409362 0.010406962 EDVGS*DEE EEEK.K
K.LCDFGSAS Y849* UNI:Q61136 1.185885196 0.026730019 HVADNDITPY *LVSR.F
K.ASVASDPE S15 UNI:Q9D0L8 1.18566609 0.039740525 S*PPGGNEP AAASGQR.L
K.AAQAS*LN S933 UNI:IPI00353 1.18508029 0.010406962 ALNDPIAVEQ 420.7 ALQEK.K Diabetes Page 246 of 603
K.AAKES*EE S562 UNI:IPI00719 1.183397384 0.039652747 EEEEEETEE 871.1 K.K
R.GLGPPS*P S75* UNI:B7ZNU9 1.183039063 0.034339712 PAPPR.G
R.S*PVLLPK. S578 UNI:Q921C5 1.181715079 0.02461838 G
R.S*FDYNYR. S133* UNI:Q9R0U0 1.179481336 0.043412508 R
R.LPEEPSS* S335 UNI:Q6NZJ5 1.179155531 0.044088092 EDEQQPEK. K
R.LPEEPS*S S334 UNI:Q6NZJ5 1.179155531 0.044088092 EDEQQPEK. K
R.ASVSDLS* S243 UNI:Q569Z6 1.177281142 0.038676564 PR.E
R.MS*GFIYQ S497* UNI:Q9ES28 1.175684801 0.035154749 GK.L
R.SNS*FSDE S5555 UNI:IPI00553 1.171046126 0.029723372 R.E 798.2
K.FGT*FGGL T5590 UNI:IPI00553 1.168496252 0.03292067 GSK.S 798.2 Page 247 of 603 Diabetes
K.FGTFGGLG S5596 UNI:IPI00553 1.168496252 0.03292067 S*K.S 798.2
K.LFDDS*DE S724* UNI:Q8BGC 1.167576478 0.035154749 R.G 0
K.T*PPVVIK.S T262* UNI:Q9D5V6 1.16691471 0.02461838
R.SAS*EPSL S766* UNI:P28028 1.166801608 0.026441449 NR.A
R.AS*DPGLP S1859* UNI:B7ZN27 1.166660411 0.033345923 AEEPK.E
R.RRS*PS*P S558S560* UNI:A2A8V8 1.163053437 0.049439966 APPPPPPPP PPR.R
R.EEAS*DDD S225* UNI:Q6P4T2 1.160817815 0.04042083 MEGDEAVVR .C
R.AQS*TDS*L S407S410* UNI:O35551 1.159713296 0.043412508 GTSSSLQSK. A
K.TGSY*GAL Y446* UNI:Q9DBR7 1.158597227 0.033345923 AEISASK.E
K.DLGHPVEE S940* UNI:Q9Z1Z0 1.157898905 0.028508578 EDES*GDQE DDDDEIDDG DKDQDI.- Diabetes Page 248 of 603
K.ESAQAVAV S1723 UNI:Q9QX47 1.153430139 0.033345923 ALS*PK.E
R.QAST*DAG T95* UNI:P46938 1.15007245 0.036609927 TAGALTPQH VR.A
R.QAS*TDAG S94* UNI:P46938 1.15007245 0.036609927 TAGALTPQH VR.A
R.GWS*PPPE S30* UNI:Q9QXG 1.149999218 0.028508578 VR.R 4
R.ISRS*IR.K S289* UNI:P97299 1.147237448 0.028508578
R.RLS*SLR.R S378* UNI:Q9JJN0 1.147237448 0.028508578
R.RLSS*LR.R S379* UNI:Q9JJN0 1.147237448 0.028508578
R.TIS*AQDTL S2559* UNI:E9PV45 1.146141355 0.026974997 AYATALLNEK .E
R.TISAQDT*L T2563* UNI:E9PV45 1.146141355 0.026974997 AYATALLNEK .E
K.DKS*PVRE S136 UNI:Q8VH51 1.145063025 0.040625492 PIDNLTPEER .D Page 249 of 603 Diabetes
R.LPEEPS*S S334 UNI:Q6NZJ5 1.143202411 0.031381487 EDEQQPEKK .L
K.DWEDDS*D S113* UNI:Q9R0Q7 1.141728543 0.04195003 EDMSNFDR.F
R.ELALS*S*P S526S527* UNI:Q9QYR 1.135887329 0.049463094 EDLTQDFEE 6 LK.R
R.LSS*LRAS* S236S240* UNI:D3Z6N6 1.135728973 0.025258451 TSK.S
K.ESDDKPEI S263* UNI:P07901 1.135575714 0.044382609 EDVGS*DEE EEEKK.D
R.VSDQNS*P S2045 UNI:E9PV45 1.130055681 0.047260617 VLPK.K
K.S*LPVSVP S184 UNI:Q9D1F4 1.129673555 0.026974997 VWAFK.E
R.IACEEEFS* S421S423* UNI:D3YYI8 1.126321992 0.035409265 DS*DEEGEG GRK.N
K.STS*PAPA S231* UNI:P97855 1.123545951 0.04497445 DVAPAQEDL R.T
K.SAS*PGLP S30 UNI:Q9EQU 1.120443063 0.035440905 K.G 5 Diabetes Page 250 of 603
K.ES*LKEED S243 UNI:O70435 1.118533554 0.038735827 ESDDDNM.-
K.ESLKEEDE S250 UNI:O70435 1.118533554 0.038735827 S*DDDNM.-
K.SQS*PSPP S243 UNI:B8JJ89 1.115959354 0.041661807 PLPEDLEK.A
R.S*HSLPNS S44 UNI:A3KGH5 1.110580276 0.043412508 LDYAQASER. G
R.LEQHSQQ S140 UNI:Q921T2 1.109930849 0.044950659 PQLS*PATSG R.G
K.S*PGVPDA S30 UNI:Q7TN75 1.106030911 0.034548735 EDDDER.R
R.S*ESSGNL S101 UNI:O08715 1.102747106 0.044088092 PSVADTR.S
R.GDNAS*PS S240 UNI:Q6NZR5 1.101229304 0.03461207 PSGTPLVR.A
R.YGMGTS*V S232* UNI:P35486 1.099674541 0.039740525 ER.A
K.EADEEDS* S106 UNI:D3Z316 1.096919394 0.023035228 DEETSYPER. S Page 251 of 603 Diabetes
R.YHGHS*MS S293* UNI:P35486 1.096512771 0.040362963 DPGVSYR.T
R.KTGS*YGA S445* UNI:Q9DBR7 1.087833141 0.038676564 LAEISASK.E
K.DDEKEPEE S306 UNI:Q9Z204 1.087739104 0.04972369 GEDDRDS*A NGEDDS.-
K.RPDYAPME S52S53* UNI:Q9CQU 1.087613553 0.047449869 S*S*DEEDEE 1 FQFIK.K
R.AGS*PQLD S540 UNI:Q8CHW 1.080193162 0.046134291 DIR.V 4
R.TAS*EGS*E S253S256 UNI:Q05CL8 1.071901333 0.029723372 AETPEAPK.Q
R.LGTGGGG S20* UNI:Q9WUD 1.062188797 0.03461207 S*PDKSPSA 1 QELK.E
R.GNVVPS*P S42* UNI:Q9CR86 1.061943602 0.044382609 LPTR.R
R.EDEIS*PPP S83* UNI:A2AI69 1.053446788 0.044934857 PNPVVK.G
R.KVMDS*DE S119 UNI:P56812 1.023464661 0.049236616 DDADY.- Diabetes Page 252 of 603
heatmap peakarea Final peakarea manual peakarea manual for display peakarea 1 rep1 1 rep2 labelfree 1 manual 1 thresholded thresholded 289859848.2 289859848.2 243892804 498016880
1049435234 1049435234 1015010399 1126781142
120317511.6 120317511.6 141745804 192812603
11051143.81 11051143.81 10305944 18716187
1114466.127 1114466.127 1181467 1101803
2593983.483 2593983.483 2197013 4662251
14887816.18 14887816.18 16303667 22447476
1370083.17 1370083.17 1531852 1774108
3478887.722 3478887.722 4011311 4544870 Page 253 of 603 Diabetes
6113590.847 6113590.847 3903753 6915290
4115193.58 4115193.58 2318204 5277822
15160126.57 15160126.57 10868517 23264464
5455683.629 5455683.629 6901179 6068119
5455683.629 5455683.629 6901179 6068119
217734.7715 217734.7715 316043 131111
5335353.547 5335353.547 4013329 10044318
3404070.419 3404070.419 3356733 4368590
3409376.756 3409376.756 3070665 6962780
2212231.311 2212231.311 1551837 2748960 Diabetes Page 254 of 603
3175558.217 3175558.217 2755261 3101653
1268784.74 1268784.74 1131913 777879
4129830.185 4129830.185 4775155 2860509
3807041.59 3807041.59 4631570 3868140
144005.072 144005.072 259975 80153
10092496.77 10092496.77 11182617 14443182
44533500.42 44533500.42 74842188 48084140
25421143.45 25421143.45 18338842 31842539
3947535.42 3947535.42 2198707 6022668
3947535.42 3947535.42 2198707 6022668 Page 255 of 603 Diabetes
2878441.224 2878441.224 1557968 3129107
78192308.12 78192308.12 56031835 130548465
3116151.505 3116151.505 3011288 4506804
2924353.527 2924353.527 3448402 2663577
4674927.943 4674927.943 3397278 3784656
446307.6507 446307.6507 60073 1119404
3025962.559 3025962.559 2108018 3242324
12966627.21 12966627.21 11069901 23415558
12966627.21 12966627.21 11069901 23415558
22453488.41 22453488.41 9418996 33624985 Diabetes Page 256 of 603
4024724.097 4024724.097 1164658 3903198
7911922.833 7911922.833 4988855 9671203
491369.9006 491369.9006 340279 500027
491369.9006 491369.9006 340279 500027
491369.9006 491369.9006 340279 500027
4394454.428 4394454.428 2300471 5616287
19700211.71 19700211.71 9190062 20961980
6920461.621 6920461.621 9038838 7468001
7950650.846 7950650.846 5316787 15432400
24362290.78 24362290.78 17833321 45918703 Page 257 of 603 Diabetes
4715460.152 4715460.152 1596218 7053234
3549310.74 3549310.74 4445294 4044870
3549310.74 3549310.74 4445294 4044870
4849564.788 4849564.788 2326854 6742957
1874126.791 1874126.791 1630632 2563175
4622919.799 4622919.799 4892850 4087481
563506.7826 563506.7826 325288 769465
5021407.151 5021407.151 4390155 6392511
1221107.69 1221107.69 720306 1547809
1602146.99 1602146.99 855318 2527626 Diabetes Page 258 of 603
1602146.99 1602146.99 855318 2527626
714017.3403 714017.3403 1160125 689908
226745.8182 226745.8182 688556 62992
1339021.79 1339021.79 937378 1399753
1339021.79 1339021.79 937378 1399753
7626161.77 7626161.77 7690829 8780947
3411488.96 3411488.96 3351233 4040600
4393987.061 4393987.061 3889168 6649263
11246925.47 11246925.47 6023976 13411027
2561987.791 2561987.791 1917108 3532783 Page 259 of 603 Diabetes
3366286.367 3366286.367 3249696 4624393
2759633.155 2759633.155 1697013 3846703
7696647.727 7696647.727 6226578 8954427
7696647.727 7696647.727 6226578 8954427
8837064.925 8837064.925 5518409 9728436
11438326.58 11438326.58 11293820 16812210
3968048.921 3968048.921 4318167 5079460
6176122.254 6176122.254 4084440 8525604
2989026.794 2989026.794 2221534 3876722
5965039.269 5965039.269 4017483 6786801 Diabetes Page 260 of 603
1368659.032 1368659.032 929718 1502281
426842.5765 426842.5765 533306 362273
1701600.346 1701600.346 1580486 2339295
6729812.276 6729812.276 4520809 13189350
2375300.382 2375300.382 2056180 2988693
11182617.91 11182617.91 9637565 15027919
4436607.972 4436607.972 3909851 4871407
8730290.467 8730290.467 6700150 7535526
2144874.191 2144874.191 921157 2705128
9674167.003 9674167.003 9070041 11491417 Page 261 of 603 Diabetes
6282327.244 6282327.244 7190867 11259875
2136389.412 2136389.412 2056180 2988693
2815651.902 2815651.902 1191904 3989853
1542104.912 1542104.912 959226 1816467
37223101.11 37223101.11 39352720 48984105
37223101.11 37223101.11 39352720 48984105
6481907.152 6481907.152 7650739 7946712
1764082.648 1764082.648 2478145 2215531
4851112.873 4851112.873 3251211 7336641
3040761.775 3040761.775 1674751 4486076 Diabetes Page 262 of 603
378909.6808 378909.6808 256410 436645
21038731.82 21038731.82 33677907 22448040
21038731.82 21038731.82 33677907 22448040
7924799.264 7924799.264 5368462 9188268
7175355.392 7175355.392 2996023 7859804
12536335 12536335 10419981 15728719
1864216.188 1864216.188 787363 2414234
1864216.188 1864216.188 787363 2414234
6482003.356 6482003.356 5193032 7046173
17420579.73 17420579.73 12441062 23264154 Page 263 of 603 Diabetes
17420579.73 17420579.73 12441062 23264154
2665877.098 2665877.098 1498724 3275266
6546801.809 6546801.809 4593214 6378393
5257491.748 5257491.748 5869313 7888772
2108596.288 2108596.288 1154081 3042151
9414323.2 9414323.2 5638307 11564559
9448763.705 9448763.705 10504438 12032705
311747.7833 311747.7833 81616 444405
1467850.19 1467850.19 1348946 1907064
511083.6904 511083.6904 216097 746351 Diabetes Page 264 of 603
5297620.66 5297620.66 5271767 8336466
2133114.558 2133114.558 1916941 1829290
350087875.6 350087875.6 450947242 519569342
3946607.812 3946607.812 2600510 3695520
3946607.812 3946607.812 2600510 3695520
3951564.726 3951564.726 2484972 5233367
5403900.705 5403900.705 5161528 6637739
5066991.113 5066991.113 3514882 7092566
5935283.425 5935283.425 5105306 7248058
1031996.789 1031996.789 1166022 1263996 Page 265 of 603 Diabetes
1031996.789 1031996.789 1166022 1263996
16089521.12 16089521.12 8629143 23539427
3146901.079 3146901.079 1822583 3892595
24927109.91 24927109.91 28044519 27279325
24927109.91 24927109.91 28044519 27279325
1108353.786 1108353.786 875173 1388285
3395407.028 3395407.028 2784132 4508241
3395407.028 3395407.028 2784132 4508241
1854521.105 1854521.105 1111319 2816910
2589491.155 2589491.155 2827201 2921997 Diabetes Page 266 of 603
1058849.004 1058849.004 665842 912869
1349398.016 1349398.016 764983 1835087
3457696.611 3457696.611 5035504 3518921
3195236.789 3195236.789 3207483 3118416
3195236.789 3195236.789 3207483 3118416
4664939.615 4664939.615 1160413 6539810
642047.9571 642047.9571 500049 844181
16072331.08 16072331.08 10806454 17739730
18302953.34 18302953.34 14042017 25514733
18302953.34 18302953.34 14042017 25514733 Page 267 of 603 Diabetes
1255999.05 1255999.05 1157009 1501039
2315111.141 2315111.141 2109268 3170770
445282.9156 445282.9156 257299 536711
445282.9156 445282.9156 257299 536711
6843434.254 6843434.254 3230219 9829727
6843434.254 6843434.254 3230219 9829727
6843434.254 6843434.254 3230219 9829727
6843434.254 6843434.254 3230219 9829727
5669938.664 5669938.664 6604814 7585597
29910696.04 29910696.04 12506755 42171504 Diabetes Page 268 of 603
18971807.89 18971807.89 15368123 24935955
25738049.29 25738049.29 20654475 34789353
937390.374 937390.374 805368 1178495
93061487.11 93061487.11 89705771 120135776
1206743.093 1206743.093 879435 1192787
4966971.264 4966971.264 4532145 4665782
45330099.32 45330099.32 32820345 61808190
203602.3255 203602.3255 131289 364885
203602.3255 203602.3255 131289 364885
863925.6893 863925.6893 1092096 786302 Page 269 of 603 Diabetes
2307013.494 2307013.494 1537307 2675272
10950708.82 10950708.82 14196129 12486358
1525345.048 1525345.048 952878 1827453
197829155.5 197829155.5 325624083 289112234
197829155.5 197829155.5 325624083 289112234
3357739.267 3357739.267 2782497 3435180
6982430.653 6982430.653 3918559 11920359
45785230.36 45785230.36 38108284 58349104
675029.8147 675029.8147 817430 489460
6659424.08 6659424.08 6617776 9570281 Diabetes Page 270 of 603
6659424.08 6659424.08 6617776 9570281
1763139.434 1763139.434 1275213 2317367
5531078.205 5531078.205 4860034 7653899
4277491.948 4277491.948 4363943 4705594
3564009.036 3564009.036 1730077 3832924
12412351.33 12412351.33 10868342 11308038
3337480.574 3337480.574 3018629 4731177
1221669.682 1221669.682 1212862 1546953
36614567.56 36614567.56 52848386 42800075
627629.7948 627629.7948 639321 813355 Page 271 of 603 Diabetes
6333925.305 6333925.305 5533872 8764307
8332887.281 8332887.281 5024071 9280967
6543379.06 6543379.06 6861955 6683398
3963266.547 3963266.547 2854996 5472670
3028765.661 3028765.661 2044698 3576035
3028765.661 3028765.661 2044698 3576035
3028765.661 3028765.661 2044698 3576035
6507678.47 6507678.47 6591485 6927948
6507678.47 6507678.47 6591485 6927948
4884749.861 4884749.861 4240630 6519561 Diabetes Page 272 of 603
637748.6852 637748.6852 226891 436965
2601293.176 2601293.176 2291168 3314258
553391.9798 553391.9798 458756 734030
43242197.41 43242197.41 30879209 51789994
43242197.41 43242197.41 30879209 51789994
1981460.53 1981460.53 586975 2567718
557454.3941 557454.3941 465386 467179
11429045.07 11429045.07 5364286 20344535
11711438.12 11711438.12 17892326 9986829
1699305.987 1699305.987 1410348 1460792 Page 273 of 603 Diabetes
3987912.749 3987912.749 3532248 4930034
5822580.572 5822580.572 5589827 6573086
4977019.962 4977019.962 2300518 6548262
4977019.962 4977019.962 2300518 6548262
2111079.979 2111079.979 3686759 1791564
10735401.57 10735401.57 14196129 12486358
1716326.427 1716326.427 1133383 2025069
18538086.24 18538086.24 23584851 17450813
18538086.24 18538086.24 23584851 17450813
3505511.639 3505511.639 979249 1157082 Diabetes Page 274 of 603
36908132.49 36908132.49 21749992 42225155
2453574.303 2453574.303 3608116 2686875
5712856.99 5712856.99 4174811 6805133
41765698.01 41765698.01 40565475 57939967
41765698.01 41765698.01 40565475 57939967
792629.8352 792629.8352 597126 957471
4841724.223 4841724.223 2990483 3994959
4284162.261 4284162.261 2963194 5634089
7796723.215 7796723.215 4192635 10165789
8779137.557 8779137.557 5502468 10503647 Page 275 of 603 Diabetes
5560337.417 5560337.417 7468862 6077095
24769816.8 24769816.8 31266706 28781299
17677886.01 17677886.01 11584120 29944341
4675745.976 4675745.976 5363664 4113839
3868673.453 3868673.453 4203076 3633370
15116335.39 15116335.39 20883077 15034531
31694276.09 31694276.09 53474375 34443759
30221868.46 30221868.46 20013900 36763326
1493870.16 1493870.16 1017362 1825846
1589965.655 1589965.655 1290965 1849783 Diabetes Page 276 of 603
617256.9632 617256.9632 496642 681146
8171501.173 8171501.173 8265249 9115044
2734074.557 2734074.557 2201380 3139031
2734074.557 2734074.557 2201380 3139031
1859466.774 1859466.774 1589496 2427721
1413509.436 1413509.436 711679 1437026
6634531.601 6634531.601 4244049 7958375
6634531.601 6634531.601 4244049 7958375
1996914.723 1996914.723 1339971 2566297
2175330.165 2175330.165 1126851 2600453 Page 277 of 603 Diabetes
2020355.882 2020355.882 1840478 2131605
11164482.56 11164482.56 11692780 13887784
502581.4446 502581.4446 320803 608795
9556450.291 9556450.291 16649857 11251748
4515368.416 4515368.416 3427539 6114927
4515368.416 4515368.416 3427539 6114927
13450681.1 13450681.1 6310656 14557726
7662797.435 7662797.435 6963433 7882781
7662797.435 7662797.435 6963433 7882781
2727383.269 2727383.269 1425629 3337693 Diabetes Page 278 of 603
19803054.67 19803054.67 12585799 31923361
6328942.611 6328942.611 9542737 8315417
886803.7213 886803.7213 869644 1160191
702541.3361 702541.3361 384889 1061042
5346866.248 5346866.248 5189758 7334881
20013386.86 20013386.86 17125714 21809794
56690423.04 56690423.04 67234539 89795348
1120122.692 1120122.692 764371 1139716
88298681.39 88298681.39 66755204 101721113
6265474.011 6265474.011 6596925 6899381 Page 279 of 603 Diabetes
9010173.515 9010173.515 7577751 10679812
54843559.58 54843559.58 41663212 89444377
9379134.031 9379134.031 10490388 9995953
1865322.611 1865322.611 1758869 2030947
5333109.853 5333109.853 3265832 5847969
18700430.17 18700430.17 10722457 34187366
6564464.152 6564464.152 2144306 9137091
5208816.664 5208816.664 1755114 6444212
5208816.664 5208816.664 1755114 6444212
6648738.171 6648738.171 11546813 5480513 Diabetes Page 280 of 603
2195212.843 2195212.843 1655350 2350127
1523395.491 1523395.491 1234018 2015902
9110294.899 9110294.899 7510153 10321068
9110294.899 9110294.899 7510153 10321068
51608625.52 51608625.52 59451799 58241697
26551564.27 26551564.27 24976313 30420894
4820454.372 4820454.372 2134788 6293489
1163947.588 1163947.588 1328830 991447
307365.6568 307365.6568 325999 333467
34983940.12 34983940.12 11329079 34160272 Page 281 of 603 Diabetes
17260975.67 17260975.67 7871894 24904158
17260975.67 17260975.67 7871894 24904158
4870879.425 4870879.425 3687555 4313449
4870879.425 4870879.425 3687555 4313449
4870879.425 4870879.425 3687555 4313449
15787768.07 15787768.07 12980093 27529987
2865780.451 2865780.451 3541134 3597025
6364845.945 6364845.945 5812711 7914459
6364845.945 6364845.945 5812711 7914459
3219905.306 3219905.306 1304604 3508119 Diabetes Page 282 of 603
6224627.361 6224627.361 3220913 7017015
939294.9733 939294.9733 673103 1000569
4288401.677 4288401.677 3258196 4365897
11771858.95 11771858.95 6923048 14809875
2603319.951 2603319.951 2058203 3679662
7288653.204 7288653.204 5761673 8358047
7288653.204 7288653.204 5761673 8358047
7288653.204 7288653.204 5761673 8358047
120530.0698 120530.0698 89508 168942
1800620.889 1800620.889 657896 2455086 Page 283 of 603 Diabetes
8898816.468 8898816.468 10464774 11183932
17272598.24 17272598.24 15839568 25946539
685412.2606 685412.2606 499868 738481
16959159.27 16959159.27 13910935 24425749
7465247.501 7465247.501 6963433 7882781
2355869.505 2355869.505 1261537 2358590
19370554.09 19370554.09 13289283 35909202
2427104.14 2427104.14 2470780 3037846
5344113.574 5344113.574 4354400 5472940
1484928.17 1484928.17 885680 2110869 Diabetes Page 284 of 603
1318221.729 1318221.729 1661788 1508592
6013826.291 6013826.291 5873112 7157518
742926.0567 742926.0567 472771 853842
17281972.2 17281972.2 11475526 22654727
17281972.2 17281972.2 11475526 22654727
892595.8246 892595.8246 1240558 852868
4777054.237 4777054.237 3712453 5338149
2953745.704 2953745.704 5156247 3131108
34195214.53 34195214.53 27542568 61694761
34195214.53 34195214.53 27542568 61694761 Page 285 of 603 Diabetes
43517996.82 43517996.82 38615911 52679108
4359022.415 4359022.415 3400718 5532127
11560011.83 11560011.83 7788057 11626290
3066229.115 3066229.115 1192610 3001009
3646150.909 3646150.909 1390346 4323349
20724081.38 20724081.38 22866337 24144413
3615484.33 3615484.33 1894941 4453662
5452210.957 5452210.957 1869499 8063037
579361.3203 579361.3203 433254 503443
20077493.74 20077493.74 12090356 27654745 Diabetes Page 286 of 603
16484016.91 16484016.91 11735572 20734787
27069578.17 27069578.17 16558692 32380510
2054850.087 2054850.087 3060584 2303768
2054850.087 2054850.087 3060584 2303768
5378620.972 5378620.972 3675445 5928145
21135387.26 21135387.26 20635917 23409045
4548002.144 4548002.144 3536740 6328736
4548002.144 4548002.144 3536740 6328736
10432516.65 10432516.65 7357068 14493662
546796.8073 546796.8073 437896 652341 Page 287 of 603 Diabetes
13395225.66 13395225.66 13500417 15259104
327639.9432 327639.9432 333469 343877
2121945.562 2121945.562 2028009 2405598
3009364.694 3009364.694 2630098 3576454
3361689.46 3361689.46 3768016 4405169
42048981.89 42048981.89 45640890 49770260
3616703.334 3616703.334 1122892 3853889
3616703.334 3616703.334 1122892 3853889
58075362.4 58075362.4 45944564 68230940
2269440.395 2269440.395 2423530 2236866 Diabetes Page 288 of 603
3203280.235 3203280.235 1826006 4103843
4269801.263 4269801.263 2899617 5885541
11697270.72 11697270.72 11716398 14098288
62657134.79 62657134.79 48933383 103924705
7658542.641 7658542.641 4566987 9270703
39909562.93 39909562.93 44223578 49025409
11745534.51 11745534.51 7832786 16804901
11745534.51 11745534.51 7832786 16804901
11745534.51 11745534.51 7832786 16804901
40516843.1 40516843.1 31126209 60466222 Page 289 of 603 Diabetes
40516843.1 40516843.1 31126209 60466222
13839299.32 13839299.32 11606375 19364213
13839299.32 13839299.32 11606375 19364213
13839299.32 13839299.32 11606375 19364213
7056475.155 7056475.155 5166513 9639737
7056475.155 7056475.155 5166513 9639737
3120616.897 3120616.897 2215749 4587865
10715734.9 10715734.9 11716398 14098288
3657661.479 3657661.479 2233194 3828033
9264221.494 9264221.494 8497419 10012904 Diabetes Page 290 of 603
1372797.853 1372797.853 599282 1502833
25673491.4 25673491.4 26811194 29679311
7978840.213 7978840.213 6640472 9501582
6900321.646 6900321.646 4695949 8332202
2736961.285 2736961.285 2807567 2951596
2736961.285 2736961.285 2807567 2951596
20049186.68 20049186.68 17700225 25732357
18045835.45 18045835.45 17322690 20203672
3371803.174 3371803.174 2019693 3925052
7625259.082 7625259.082 6730877 11321885 Page 291 of 603 Diabetes
7625259.082 7625259.082 6730877 11321885
4178759.344 4178759.344 3799497 5261054
27249888.45 27249888.45 27551646 36980683
1011684.847 1011684.847 761122 1164760
2944906.129 2944906.129 3306688 4142482
22347828.15 22347828.15 14254586 26290582
9202084.479 9202084.479 7264861 11414751
1992264.911 1992264.911 1311432 2312159
5454500.709 5454500.709 4384242 10239298
37133397.63 37133397.63 5721600 39441834 Diabetes Page 292 of 603
26901943.45 26901943.45 24290290 32996700
13048619.73 13048619.73 19366038 13097111
13048619.73 13048619.73 19366038 13097111
62717043.96 62717043.96 67332657 67189181
7256977.305 7256977.305 7804986 5425249
7256977.305 7256977.305 7804986 5425249
7256977.305 7256977.305 7804986 5425249
1524719.163 1524719.163 1462137 2520873
1524719.163 1524719.163 1462137 2520873
32700361.08 32700361.08 28043556 36570624 Page 293 of 603 Diabetes
5331293.411 5331293.411 3694556 5807528
91985762.14 91985762.14 24893194 139904273
4179356.676 4179356.676 3548327 5404462
8530703.537 8530703.537 5024857 8502982
33700389.21 33700389.21 21367406 47577204
4094958.488 4094958.488 3146265 4632106
29976025.98 29976025.98 26990025 43186056
3460035.166 3460035.166 1459864 3989679
51876995.48 51876995.48 66905134 52403709
2382522.282 2382522.282 1439299 2295638 Diabetes Page 294 of 603
2946622.627 2946622.627 2209962 2856479
2946622.627 2946622.627 2209962 2856479
11698071.08 11698071.08 10623599 16561007
46885858.74 46885858.74 16688841 47727344
1813419.014 1813419.014 1109822 2202215
8168898.458 8168898.458 6557975 9758296
11240882.91 11240882.91 7778580 13955003
4179227.218 4179227.218 3611453 5702587
123252836.6 123252836.6 103657983 129482827
4186455.462 4186455.462 1552652 4933518 Page 295 of 603 Diabetes
1952990.873 1952990.873 2321234 1915516
9023853.21 9023853.21 6696010 7641935
27005186.92 27005186.92 11019207 31923150
3699413.859 3699413.859 1345727 4458651
31387304.46 31387304.46 37646235 35034500
447269.4386 447269.4386 265768 602239
6571274.576 6571274.576 5216784 7583003
206091597.9 206091597.9 185733491 277085120
72377943.36 72377943.36 92399812 78798297
6265585.877 6265585.877 3084175 8315392 Diabetes Page 296 of 603
peakarea manual peakarea manual peakarea manual 1 rep3 1 rep4 peakarea manual 2 rep1 thresholded thresholded 2 thresholded 251044869 166484840 281317.0343 385152
901461134 1154488260 1526260.927 1018216
130431149 16280491 1492289.5 1482301
10288712 4893732 683078.6361 973900
1715991 458604 99374.87247 60180
2226568 1290102 345389.5826 63112
12113111 8687010 2071664.957 1462895
137401 2036971 201720.5458 441871
3859590 1499780 630612.4888 378160 Page 297 of 603 Diabetes
7556443 6078878 1112663.976 507937
3716173 5148575 753463.9528 525202
15796762 10710763 3113765.87 1385962
6600379 2253058 1128807.257 899893
6600379 2253058 1128807.257 899893
252934 170851 45955.92207 58783
3891601 3392167 1189209.644 52937
3134603 2756355 821010.1935 346673
3595399 8663 915719.5951 1294569
2553323 1994807 627212.5536 245718 Diabetes Page 298 of 603
3049895 3795425 905299.0085 538313
1252967 1912380 364354.1545 95573
3424527 5459129 1193977.732 1662161
3388025 3340431 1100955.804 1199614
91888 45461.35323 98557
4651692 3315143.214 5162829
34892243 20315431 14730342.71 31563826
27598331 23904862 8750928 7587049
5265060 2303707 1363264.859 478678
5265060 2303707 1363264.859 478678 Page 299 of 603 Diabetes
3364011 3462678 1005601.408 465079
93005575 33183357 27484766.56 17310410
4477976 468538 1115059.876 1623664
1606131 3979305 1077018.469 475941
8562302 2955475 1736059.109 1513622
352579 253174 166512.1166 14561
3695150 3058359 1168153.327 1067400
13136421 4244629 5017190.012 4469126
13136421 4244629 5017190.012 4469126
46758514 11459 9119791.677 5682149 Diabetes Page 300 of 603
3691600 7339440 1654413.224 813728
9891354 7096279 3371648.883 1485373
663445 461728 209441.6905 148815
663445 461728 209441.6905 148815
663445 461728 209441.6905 148815
6680044 2981016 1927462.143 1123207
19026156 29622649 8717908.831 1903933
6379700 4795307 3078285.221 3394088
8136411 2917005 3544052.127 2728211
25667516 8029624 10956331.45 7256060 Page 301 of 603 Diabetes
7499307 2713081 2169699.552 737192
3278765 2428314 1695976.86 2119063
3278765 2428314 1695976.86 2119063
7821938 2506510 2383565.046 1965445
1741451 1561249 944817.7801 711790
3004877 6506472 2333086.854 2771724
528776 630498 285616.9265 316708
5629453 3673510 2579431.431 1828373
1889293 727023 637296.6615 478043
1917689 1107955 837497.3469 338108 Diabetes Page 302 of 603
1917689 1107955 837497.3469 338108
292019 373307.1028 622820
33629 121806 120252.9052 356705
1648993 1369963 716349.4036 330037
1648993 1369963 716349.4036 330037
8244746 5788124 4082664.338 2650089
2842634 1826462.461 1296316
3885943 3151574 2361958.197 1836334
11521450 14031249 6052535.452 4223645
2738019 2060041 1378905.255 1005509 Page 303 of 603 Diabetes
4914943 676113 1818765.755 1905050
2220397 3274420 1494362.639 1209153
10672726 4932859 4187918.782 3207603
10672726 4932859 4187918.782 3207603
12658395 7443020 4825597.326 2262465
13966371 3680904 6260009.014 6113429
2511270 3963299 2172114.15 1836216
5918323 3413247.178 1992189
3718098 2139753 1653743.519 1187671
5810810 7245062 3304410.119 1699363 Diabetes Page 304 of 603
1000510 2042127 759957.7764 444738
530265 281526 238008.8537 199659
2626129 260492 952192.9235 937441
6085467 3123624 3771375.274 1047614
2081029 1332713.722 1383418
6550526 13514462 6289231.134 3636028
5005545 3959629 2495695.108 1815561
6491972 14193515 4942293.334 2914333
2808337 1226512.418 417094
12885242 5249968 5540469.444 5049704 Page 305 of 603 Diabetes
6670046 8520 3611409.092 4258001
2081029 1419657 1229156.867 1383418
4747449 1333401 1625330.882 582423
2884434 508293 895877.5328 617322
45632327 14923252 21850847.38 26592361
45632327 14923252 21850847.38 26592361
3848271 3823170.957 4964808
1858533 504122 1041058.772 1512023
7139319 1677281 2863396.223 1349170
4047870 1954351 1817383.742 681399 Diabetes Page 306 of 603
661126 161458 226589.1475 185950
13735306 14293673 12633770.32 21220757
13735306 14293673 12633770.32 21220757
9004644 8137824 4767689.128 2710788
10467577 7378017 4319417.779 1801265
12061741 11934898 7547062.121 4854473
2708171 1547097 1123881.101 481599
2708171 1547097 1123881.101 481599
7206806 3908409.02 3759420
26127681 7849423 10544055.13 4294682 Page 307 of 603 Diabetes
26127681 7849423 10544055.13 4294682
5514588 374931 1616791.424 577274
6749281 8466319 3972160.291 2731428
7158119 113763 3191581.203 3605515
2129557 1282022.71 872504
9739488 10714939 5731644.415 3798432
5809149 5760526.607 6417623
505390 215581 190189.4453 58849
1526184 1089206 895614.5462 1054237
570803 314503.5926 83271 Diabetes Page 308 of 603
4467614 3114636 3260948.783 3469781
1547654 3238573 1319692.362 985060
325540912 104294006 217191460.1 223232133
6608755 2881646 2453860.983 1199711
6608755 2881646 2453860.983 1199711
4136355 2458052.792 1711063
8090411 1725924 3370419.384 3550215
9024946 635571 3165578.738 2435573
6516578 4871191 3732311.058 3021231
1368581 329389 652442.5356 384516 Page 309 of 603 Diabetes
1368581 329389 652442.5356 384516
17226685 14962829 10202057.25 5146139
3631334 3241093 2005351.156 1060921
36011018 8373578 16005447.71 12659349
36011018 8373578 16005447.71 12659349
1175031 994927 714674.071 627239
3831761 2457494 2194587.131 1682496
3831761 2457494 2194587.131 1682496
2327864 1161991 1199127.249 591664
2757491 1851275 1682343.265 1382461 Diabetes Page 310 of 603
1440847 1215839 688008.2118 405230
1807082 990441 876824.4907 444484
4043791 1232570 2248969.077 3402717
3495021 2960028 2085315.847 1976255
3495021 2960028 2085315.847 1976255
4600180 6359356 3055899.413 935955
1032673 191289 421974.4655 300929
21423475 14319666 10610925.27 7006927
15352110 12086654.98 12501324
15352110 12086654.98 12501324 Page 311 of 603 Diabetes
1299381 1066568 830116.0382 613011
2694292 1286113 1534560.667 1462331
541363 445759 295198.9572 153468
541363 445759 295198.9572 153468
8336761 5977029 4544405.375 1999474
8336761 5977029 4544405.375 1999474
8336761 5977029 4544405.375 1999474
8336761 5977029 4544405.375 1999474
3655623 4833720 3774677.001 3548517
33074719 31889806 19983318.62 7919623 Diabetes Page 312 of 603
20965940 14617213 12683224.94 12129687
26196923 21311446 17234142.81 11576710
1299831 465869 627939.3802 571024
100930791 61473611 62517212.96 60507901
845275 1909475 811283.8516 747773
5174372 5495587 3343151.518 2647084
54814070 31877792 30595681.44 21696439
201768 116466 137698.4905 99680
201768 116466 137698.4905 99680
812129 765176 586453.2678 774549 Page 313 of 603 Diabetes
2287642 2727834 1573345.416 1155635
6169640 7491954.402 9080799
1919801 1401249 1045522.21 708276
117215440 59364865 135663626.3 176601179
117215440 59364865 135663626.3 176601179
4696729 2516551 2305242.415 1547213
10101661 1989143 4797899.622 3273231
62263214 24420319 31493678.93 28302576
993906 399324 465645.3721 586636
3759914 6689726 4602445.216 4822815 Diabetes Page 314 of 603
3759914 6689726 4602445.216 4822815
2440789 1019188 1220577.229 868940
6979727 2630654 3848079.634 3257863
3262034 4778397 2984231.224 2586055
3819066 4873969 2489786.833 651098
9098850 18374175 8704056.42 6514474
3805655 1794462 2345700.216 1939420
911284 1215579 859115.2693 637117
28523347 22286462 25791329.72 32284901
783172 274672 442263.7551 394240 Page 315 of 603 Diabetes
6285552 4751971 4496484.752 3476138
6060459 12966052 5935723.865 2873470
7031903 5596260 4680304.988 4741229
4490232 3035168 2847500.632 2479909
3155167 3339163 2182387.791 1224319
3155167 3339163 2182387.791 1224319
3155167 3339163 2182387.791 1224319
9534904 2976377 4693305.957 4422137
9534904 2976377 4693305.957 4422137
6137927 2640882 3530692.207 2675082 Diabetes Page 316 of 603
160793 1726346 461770.856 170558
2916419 1883328 1884595.097 1419876
775933 244848 402249.0057 262600
53406184 36893403 31434429.96 21532871
53406184 36893403 31434429.96 21532871
2248250 2522900 1441261.701 378480
520956 776297 405947.0735 295406
12371893 7635466 8343956.099 4329720
11604308 7362289 8610211.664 13440047
2196696 1729388 1250005.302 1208238 Page 317 of 603 Diabetes
3501456 2938249.062 2831493
10388263 739146 4290384.064 4135427
5897138 5162163 3667420.987 1973707
5897138 5162163 3667420.987 1973707
2387437 578560 1558592.105 2758635
6169640 10089480 7926554.752 9080799
2792972 913882 1267663.741 688726
18747242 14369439 13695197.55 16815221
18747242 14369439 13695197.55 16815221
922411 10963304 2591123.433 688931 Diabetes Page 318 of 603
44941446 38715937 27301044.16 14884596
2267134 1252172 1818796.663 2117580
7265800 4605685 4245310.547 3580417
35242861 33314489 31056322.15 28137295
35242861 33314489 31056322.15 28137295
1071993 543929 590059.4367 335475
4403452 7978002 3605827.175 1850563
4255203 3191613.175 1964783
9802883 7025586 5836083.247 2771166
13679388 5431048 6582904.028 4327233 Page 319 of 603 Diabetes
5632584 3062809 4170157.372 5452178
28210853 10820410 18589652.56 21052275
21336233 7846850 13274771.1 8574969
2293192 6932288 3512093.514 3300137
4269811 3368437 2911364.704 3477800
13713510 10834224 11376433.61 15207797
19306659 19552311 23860673.97 40754053
37770285 26339962 22759245.77 15012703
1520019 1612253 1125255.564 761940
1660191 1558923 1199465.542 875204 Diabetes Page 320 of 603
801491 489749 466273.0969 339282
8895354 6410357 6175489.184 5870936
3110101 2485786 2068868.317 1599057
3110101 2485786 2068868.317 1599057
2286600 1134050 1407703.387 1309801
2071892 1433441 1072182.533 664301
8130812 6204890 5042695.164 3135156
8130812 6204890 5042695.164 3135156
2862047 1219344 1520370.503 957619
3030886 1943132 1657308.836 840232 Page 321 of 603 Diabetes
2527859 1581482 1542259.522 1188531
10397657 8679709 8526982.537 8697556
700987 379740 384229.4447 224433
4811415 5512781 7306217.265 11050302
6892374 1626633 3453280.531 1986603
6892374 1626633 3453280.531 1986603
13731710 19202633 10289687.07 4299701
8142178 5865583.076 5190311
8142178 5865583.076 5190311
2654476 3491735 2090940.758 731773 Diabetes Page 322 of 603
26973561 7729499 15185854.62 10175186
4974750 2482867 4854972.864 7363218
1148233 369148 680430.2978 661050
786698 577535 539209.038 227877
6449797 2413029 4112851.491 4030315
26359205 14758834 15403779.56 12365251
52627799 17104007 43665733.54 51161867
1231255 1345148 863581.9073 668087
127692703 57025706 68209054.53 48635297
7094892 4470698 4840140.753 3913340 Page 323 of 603 Diabetes
12350328 5432802 6982774.109 5624795
78204870 10061780 42565183.14 31174539
7630658 9399538 7279343.108 8022796
1617886 2053589 1447859.638 1233119
6205257 6013381 4153000.218 2255889
29847075 44823 14566285.46 8281110
7148669 7827790 5116769.714 1540230
6128404 6507537 4068300.951 1306393
6128404 6507537 4068300.951 1306393
4881441 4686186 5207806.796 8627269 Diabetes Page 324 of 603
3683882 1091492 1721276.854 1185328
2755860 87802 1194862.25 891286
10526374 8083584 7150065.016 5428125
10526374 8083584 7150065.016 5428125
51178807 37562199 40522744.16 45149073
27107317 23701733 20860406.33 17550395
6701252 4152289 3800216.158 1648576
674766 1660748 918066.4539 897661
481822 88175 242515.0724 177106
26634667 67811742 27602874.68 9387055 Page 325 of 603 Diabetes
30593878 5673973 13632484.61 6394651
30593878 5673973 13632484.61 6394651
4240040 7242474 3848434.911 2601571
4240040 7242474 3848434.911 2601571
4240040 7242474 3848434.911 2601571
13182925 9458068 12483541.86 9380354
2283253 2041709 2266829.608 2271355
7434870 4297344 5037235.527 4222555
7434870 4297344 5037235.527 4222555
4765465 3301433 2552500.682 814375 Diabetes Page 326 of 603
7933088 6727493 4940101.198 2456146
1067644 1015864 745570.3176 533781
5674229 3855285 3407434.324 2633645
13265755 12088758 9354749.452 4840358
4011159 664256 2070490.756 1604807
9159485 5875408 5806042.234 4027365
9159485 5875408 5806042.234 4027365
9159485 5875408 5806042.234 4027365
191379 32291 96236.88451 72606
1927445 2162057 1438480.24 523907 Page 327 of 603 Diabetes
8312859 5633701 7113069.492 8536038
16964379 10339907 13821274.08 12226093
951764 551536 548473.8164 382229
19455469 10044485 13576000.13 10428564
8142178 6872598 5978819.757 5190311
3133320 2670032 1887693.826 1015671
15713979 12569752 15524181.03 8650814
2760223 1439567 1948949.197 1817214
6301337 5247778 4295687.874 3452208
2472847 470316 1193689.161 645017 Diabetes Page 328 of 603
784285 1060775.196 1386420
5347973 5676703 4842167.764 5075593
807687 837404 599168.7187 419528
19993367 15004269 13944188.45 7828172
19993367 15004269 13944188.45 7828172
826815 650142 721137.1913 908034
4553113 5504502 3866186.288 2342341
1934059 1593569 2394197.226 3730133
33642543 13900987 27744429.13 20294584
33642543 13900987 27744429.13 20294584 Page 329 of 603 Diabetes
42878074 39898895 35342959.12 30213955
6271166 2232079 3548611.409 2734551
13541822 13283878 9412693.979 5454011
4040964 4030334 2497380.015 1023011
4677795 4193115 2972805.185 1168436
15161494 16907287.23 18297507
7117527 995808 2954751.277 1508728
6424097 4463481.479 1565570
869415 511333 474815.3631 304301
23321397 17243477 16466660.62 9328470 Diabetes Page 330 of 603
16993845 16471863 13523762.21 10378697
32815063 26524048 22250428.14 12244271
1473311 1381737 1690949.276 2565952
1473311 1381737 1690949.276 2565952
6448173 5462721 4426203.257 2910878
20509901 19986687 17408000.26 15916336
4144260 4182274 3746240.178 2815539
4144260 4182274 3746240.178 2815539
9573003 10306334 8596535.038 5532794
786816 310135 450811.3057 324632 Page 331 of 603 Diabetes
11426156 11058913.74 11517600
279647 353567 270978.9472 296563
1585588 2468588 1755661.074 1363435
3321587 2509319 2493271.03 2255396
1911883 2786643.909 2964581
40919797 31864980 34890334.76 34760095
5099181 4390851 3001842.484 808204
5099181 4390851 3001842.484 808204
61443792 56682155 48208396.74 36822488
2176093 2241273 1884855.057 1842069 Diabetes Page 332 of 603
3630531 3252741 2663006.233 1382054
5628137 2665910 3549727.805 1893685
8242550 12731848 9729922.05 9276809
56976503 40793949 52176827.85 37494917
8898175 7898306 6382719.036 3698882
37480248 28909016 33274681.43 32752407
13567132 8777319 9795231.607 6511736
13567132 8777319 9795231.607 6511736
13567132 8777319 9795231.607 6511736
43719519 26755423 33819962.11 25673962 Page 333 of 603 Diabetes
43719519 26755423 33819962.11 25673962
14258203 10128407 11553984.95 9341868
14258203 10128407 11553984.95 9341868
14258203 10128407 11553984.95 9341868
9702287 3717364 5893856.736 3950350
9702287 3717364 5893856.736 3950350
5329467 349386 2608318.689 1786952
4316407 12731848 9036064.317 9276809
4287720 4281699 3084900.134 1873596
9310139 9236424 7817378.765 7238553 Diabetes Page 334 of 603
1743192 1645885 1160048.071 397295
19796885 26406576 21701304.88 21718135
7565106 8208200 6751915.377 5491864
7839410 6733726 5850301.682 3508016
3223651 1965031 2321119.829 2105615
3223651 1965031 2321119.829 2105615
21857131 14907034 17030075.46 14668271
17044778 17612202 15349212.17 13520468
3951195 3591273 2879308.593 1531635
6675998 5772277 6525702.642 6144244 Page 335 of 603 Diabetes
6675998 5772277 6525702.642 6144244
4731030 2923457 3579002.68 3213330
41452317 3014908 23352082.39 22893606
1283479 837378 867058.1535 652131
3336217 994237 2524218.789 2561118
28524632 20321513 19214790.51 10410658
10593202 7535523 7927242.638 6206112
2821708 1523760 1717894.344 988265
4986145 2208318 4707848.924 3449168
64770294 38599863 32069637.04 5361580 Diabetes Page 336 of 603
28093855 22226928 23323426.82 20645371
9909529 9821801 11345911.06 15781987
9909529 9821801 11345911.06 15781987
59199984 57146355 54536597.04 55150674
2428861 13368813 6325610.552 6345005
2428861 13368813 6325610.552 6345005
2428861 13368813 6325610.552 6345005
897959 1217907 1330306.385 1361787
897959 1217907 1330306.385 1361787
21701449 44485816 28557695.4 24086776 Page 337 of 603 Diabetes
6078557 5744533 4663472.853 2969869
117635551 85510031 80567103.87 19882319
3585281 3679376.089 2907579
8499640 12095335 7511214.151 4318804
48073008 17783939 29676919.64 18075643
4735589 3865874 3623678.511 2474956
19751997 26535122.33 23025038
3810774 4579824 3071976.921 1317168
49606628 38592511 46172562.34 57816867
2894022 2901130 2126410.847 1141715 Diabetes Page 338 of 603
3719834 3000216 2634362.302 2026974
3719834 3000216 2634362.302 2026974
15731124 3876555 10482524.33 8510961
39822740 83304510 42217442.31 15372883
1312869 2628770 1633812.608 936265
12481470 3877853 7385777.721 5992226
13382764 9847185 10193527.46 6706092
5191454 2211416 3795056.309 3375934
146026719 113843817 112081194.9 100025607
6182387 4077265 3816557.062 1368923 Page 339 of 603 Diabetes
2139696 1435518 1781092.683 2010015
4248130 17509339 8295254.919 6191958
35647436 29430956 24826897.2 9759551
6752687 2240591 3401404.707 1072039
29240471 23628012 29057121.98 33256480
699753 221318 417267.3594 237550
7049821 6435490 6186541.035 5134786
233009787 128537993 194070191.2 174936124
83232701 35080964 68705837.05 86023501
5549873 8112904 6121936.709 2957631 Diabetes Page 340 of 603
peakarea manual peakarea manual peakarea manual 2 rep2 2 rep3 2 rep4 isolated mass thresholded thresholded thresholded timepoints 203172 335808 201136 510.5743677
1719680 573275 2793873 612.7984
1807683 2346602 332573 615.264705
851695 626241 280479 466.9083837
90605 147340 918.86413
450534 112980 754932 926.929685
2578937 1552278 2692550 560.2819777
245691 92308 27012 530.2498737
528989 242109 1373192 962.945185 Page 341 of 603 Diabetes
124669 231588 3586462 498.9082007
781142 158532 1548979 535.24432
3329700 1850915 5888487 873.393065
1035201 1156565 1423570 715.3225677
1035201 1156565 1423570 715.3233007
9242 45799 69999 638.271115
1361148 262999 3079755 917.384825
388616 625336 1923417 443.5345407
852809 599780 894.43774
355180 476374 1431578 867.3931237 Diabetes Page 342 of 603
1081143 260098 1741643 476.2276577
136818 152201 1072825 571.775265
844170 228128 2041453 549.9454307
972565 544387 1687258 495.5633207
25743 12084 1079.045895
5214812 2871776 11156 750.9775977
4149523 20435243 2772779 606.6172437
10637481 8540927 8238255 653.82501
1870723 1826950 1276709 715.291135
1870723 1826950 1276709 715.291625 Page 343 of 603 Diabetes
165607 97656 3294064 513.5783637
54284833 35111081 3232742 670.9419507
1605260 1214704 16611 935.933165
674008 290466 2867660 568.7676355
1670211 1362215 2398188 595.75848
342104 109433 199950 768.3018777
1232272 983931 1389010 660.9321237
7910366 5230508 2458759 1352.56262
7910366 5230508 2458759 1352.562985
16997843 13794147 5028 1015.36755 Diabetes Page 344 of 603
1352326 419595 4032004 627.6256077
3199419 2818506 5983298 775.0062837
125324 325196 238432 793.6715677
125324 325196 238432 793.6714437
125324 325196 238432 803.0153177
2046829 2189792 2350021 594.745845
6130848 6061890 20774964 998.39184
3920234 2702494 2296324 645.827145
5314356 2822439 3311202 416.20428
17115562 11317808 8135895 902.0452837 Page 345 of 603 Diabetes
2416848 3007341 2517417 924.0690877
2360188 1506865 797792 730.3112137
2360188 1506865 797792 730.3101177
3120460 2476392 1971964 689.9969437
1165383 826777 1075322 731.31811
2338792 1664219 2557613 842.89276
295018 330153 200589 472.2524985
3237439 2049723 3202191 692.3068207
738166 1016318 316659 755.34521
1369343 1118472 524067 621.2495077 Diabetes Page 346 of 603
1369343 1118472 524067 623.9205907
394203 102898 699.0289877
33547 33123 57637 334.1591777
655620 820123 1059618 614.2578077
655620 820123 1059618 610.9210777
4125360 4843621 4711587 451.2170077
2548349 1634722 605.75244
3711673 1885516 2014309 792.87054
8215536 6272347 5498613 1223.99267
1505080 1351814 1653219 842.3400237 Page 347 of 603 Diabetes
2599049 2075680 695283 945.40112
1937510 1722704 1108084 906.3591277
4712211 5005919 3825942 659.6030837
4712211 5005919 3825942 659.6022907
4178794 4273821 8587309 1021.94598
7340506 8968264 2617837 649.9569037
2634478 1331184 2886579 818.84106
4899180 3348372 803.3557707
2823681 1661122 942500 889.87591
3284530 2645076 5588672 908.866635 Diabetes Page 348 of 603
718978 470635 1405480 734.9371307
308018 310285 134074 616.768855
1287592 1381880 201858 731.9813807
8466993 3320191 2250703 556.2648877
1514297 1100426 909.932185
6798015 3033314 11689567 869.437255
2742853 2894663 2529704 680.30023
2185479 3672779 10996582 601.2705037
1385010 1877433 1062.357175
6597389 7929471 2585314 763.826415 Page 349 of 603 Diabetes
5940378 4243456 3801 842.3869
1514297 1100426 918486 913.939635
2174776 2529765 1214361 707.2465177
991574 1529625 444989 717.791135
27646897 22925084 10239047 680.31256
27646897 22925084 10239047 675.307795
4801001 1703704 549.9639237
1249853 1162548 239812 964.422785
4425265 4328385 1350765 661.2614107
2720699 1885072 1982366 854.916315 Diabetes Page 350 of 603
282554 316394 121459 686.2702
12513679 6595284 10205361 519.80023
12513679 6595284 10205361 511.7868
4967357 4958974 6433638 603.268245
3725415 6052486 5698505 654.250975
9019873 8146504 8167399 484.73251
1382168 1205242 1426515 923.38214
1382168 1205242 1426515 923.38214
4031821 3933986 562.5811107
13971237 18191344 5718957 1000.449278 Page 351 of 603 Diabetes
13971237 18191344 5718957 1000.450314
2295658 3238641 355592 756.760985
3612114 3206379 6338720 926.422605
4586001 4526013 48796 920.91473
1985267 988297 736.9985937
7653976 6859574 4614595 883.0618877
7082566 3781391 819.43664
258495 328989 114425 872.9761307
1030277 806166 691778 488.194365
488770 371470 1109.997555 Diabetes Page 352 of 603
5244747 2457496 1871771 598.289545
1061420 654751 2577538 454.211695
337780670 229547722 78205316 508.23016
2295721 4411803 1908209 590.76446
2295721 4411803 1908209 586.757505
3137997 2525099 520.9150337
4305451 4064098 1561914 990.93884
4436609 5197189 592945 564.25256
4652081 4233502 3022430 598.30267
1159745 913869 151641 907.0278277 Page 353 of 603 Diabetes
1159745 913869 151641 910.3623007
13162586 10964014 11535491 465.72006
2614955 2615707 1729822 418.5280737
17628001 26480832 7253609 698.79388
17628001 26480832 7253609 702.801265
693802 715323 822332 932.372005
2603924 2325486 2166443 680.3114
2603924 2325486 2166443 675.308955
1728960 1509051 966834 931.369505
2295012 1806480 1245420 621.76672 Diabetes Page 354 of 603
762291 788179 796333 715.5986907
1080918 1080146 901750 988.86035
2228129 2235409 1129622 899.39361
1881173 2263378 2220457 751.305785
1881173 2263378 2220457 751.306635
4734708 2647186 3905747 956.3712107
565427 756652 64890 529.704525
11018169 13997673 10420932 707.316525
21215453 14573671 56171 943.45135
21215453 14573671 56171 947.45819 Page 355 of 603 Diabetes
1089391 824680 793382 437.5185507
2028452 1592958 1054502 651.31628
300819 343593 382915 716.311705
300819 343593 382915 725.323725
6858491 5223408 4096248 871.0034737
6858491 5223408 4096248 876.3455177
6858491 5223408 4096248 871.0032307
6858491 5223408 4096248 876.3458207
4355372 2881102 4313718 629.6172437
23636935 18688149 29688567 697.2827707 Diabetes Page 356 of 603
16624852 8963391 13014969 585.6029637
21703875 18601122 17054865 628.798335
673090 964290 303354 758.81451
80221285 66677852 42661813 563.26483
800284 596878 1100200 479.2240277
2755152 3309531 4660839 464.706995
42806960 34335129 23544198 914.41107
224470 122438 104205 528.8934907
224470 122438 104205 528.8929407
467845 493922 609498 384.2042507 Page 357 of 603 Diabetes
1914472 1760030 1463244 652.9525107
8947072 4447992 824.4411
1370727 1451070 652015 842.878965
215540919 111297552 39214855 717.30383
215540919 111297552 39214855 714.31207
2301252 3159825 2212679 599.9433537
7446383 6519921 1952063 534.72424
39099683 40609489 17962969 744.0266677
377769 506350 391827 585.2438307
4972557 2275563 6338847 514.244625 Diabetes Page 358 of 603
4972557 2275563 6338847 519.24963
1512114 1834204 667051 525.71197
5493718 4489122 2151616 819.394285
2880033 1642960 4827877 737.9962107
2690486 2715295 3902269 635.752865
8802469 5971727 13527556 578.9529377
2904909 2612241 1926231 670.77154
1230007 722108 847230 517.2377907
29285549 19542902 22051967 806.855895
468415 684018 222383 636.24322 Page 359 of 603 Diabetes
6231839 5095319 3182643 768.86444
6193409 3095202 11580815 727.6627177
4978707 5210061 3791223 878.400815
3063132 3351425 2495536 712.3110307
2129427 2033362 3342443 748.6917077
2129427 2033362 3342443 742.6844437
2129427 2033362 3342443 742.6846277
4623395 6714155 3013537 788.0231907
4623395 6714155 3013537 788.0239837
4602617 4388082 2456988 702.83856 Diabetes Page 360 of 603
274841 135063 1266621 867.7144737
2657868 1636819 1823818 943.906795
581619 562490 202286 861.348385
32378959 34927315 36898575 970.425475
32378959 34927315 36898575 965.42004
1614842 1781153 1990572 894.3432577
254902 248311 825169 518.75024
12748130 8587824 7710149 1257.995845
7287066 6792150 6921585 876.90631
1046301 1512459 1233023 646.2695277 Page 361 of 603 Diabetes
3757195 2226059 1015.9411
4506062 7801308 718739 1148.48205
4214643 3688503 4792831 868.3899507
4214643 3688503 4792831 859.0457107
1230337 1646871 598525 601.244075
8947072 4447992 9230356 824.441035
1446960 2233456 701513 698.834345
11723162 14091876 12150531 537.260985
11723162 14091876 12150531 542.26489
957729 349590 8368243 690.6215177 Diabetes Page 362 of 603
28138693 30017097 36163790 643.9505577
2461501 1659631 1036475 361.68365
5229770 4349950 3821106 785.0150107
40023087 23474679 32590229 701.31793
40023087 23474679 32590229 711.32617
640673 852962 531128 826.38055
2693763 2625312 7253671 574.6110807
4321220 3288836 923.954585
5995849 7174236 7403082 909.6870707
6987263 10143121 4874000 660.9625807 Page 363 of 603 Diabetes
4582205 4645230 2001017 842.86859
21396024 21195420 10714890 603.2675737
21271239 15394229 7858648 890.87646
3049044 1690141 6009052 709.6976277
2862811 3251743 2053105 430.8659337
11001554 10812680 8483704 724.34442
22972486 12658618 19057540 661.33502
29908644 26340103 19775533 726.6793177
1094750 1121698 1522635 430.5261807
1269234 1076411 1577013 392.68359 Diabetes Page 364 of 603
508248 594170 423393 1169.42993
6521311 6924188 5385522 638.298155
2101018 2515011 2060387 901.87811
2101018 2515011 2060387 901.877805
1981212 1353986 985815 475.2102
1112919 1402602 1108907 1037.90161
5695985 5711294 5628346 526.74182
5695985 5711294 5628346 531.746395
1803218 2239011 1081634 636.74432
1868402 2165836 1754766 477.5320107 Page 365 of 603 Diabetes
1519252 1957541 1503715 603.268
10737566 6628535 8044273 491.24182
419049 509944 383492 810.338315
8820590 4043994 5309983 346.8686807
4955938 5710183 1160398 1500.171015
4955938 5710183 1160398 1500.171015
12710388 7275722 16872937 932.907775
5843030 6563408 1307.65649
5843030 6563408 1311.663325
2331461 2017890 3282640 748.825315 Diabetes Page 366 of 603
24544677 19079662 6943894 470.7026935
6007993 3867486 2181194 498.73318
933337 835448 291886 387.67532
1030657 471423 426879 539.73767
5565550 5031823 1823718 333.166285
16634843 18866818 13748206 746.33935
67148312 39779286 16573470 526.262875
854061 819685 1112494 382.5322837
73932317 95999070 54269534 791.79797
6384411 5079215 3983597 649.334775 Page 367 of 603 Diabetes
7667633 9251197 5387472 638.289915
68316380 61826144 8943669 1180.93054
7014356 5789297 8290923 433.21371
1516868 1134579 1906872 714.79431
3963409 4234351 6158351 632.26843
25183088 24779464 21480 916.3671837
6092373 4820692 8013783 839.6016815
4615004 5445113 4906694 721.5972237
4615004 5445113 4906694 721.5963107
3997674 3346497 4859787 397.1994277 Diabetes Page 368 of 603
1652044 3263512 784223 760.9982277
1617056 2209180 61927 815.82202
7589943 7282021 8300172 546.2333337
7589943 7282021 8300172 546.2337007
42881526 40319517 33740861 716.857175
22931515 19718487 23241229 1064.99377
4687777 4966129 3898382 566.74914
620094 603936 1550574 434.5505037
296038 444767 52150 678.74487
24522876 20274888 56226680 815.9970037 Page 369 of 603 Diabetes
19462964 24453485 4218838 1401.998045
19462964 24453485 4218838 1396.995115
4129236 3301912 5361021 585.5963707
4129236 3301912 5361021 585.5957007
4129236 3301912 5361021 582.2595177
23179650 8425405 8948758 1139.00598
2789636 2151151 1855176 540.5983837
7361931 6013792 2550664 740.357785
7361931 6013792 2550664 744.365415
2741860 3382367 3271400 640.240535 Diabetes Page 370 of 603
5059338 5856620 6388300 779.9562937
727376 762268 958856 626.302305
3904082 4051640 3040370 506.9076507
10169877 9594983 12813780 526.1989707
2775274 3389899 511983 772.79852
6374055 6630023 6192726 599.5755577
6374055 6630023 6192726 599.5758007
6374055 6630023 6192726 602.9107637
144411 145011 22919 774.285335
1908754 1333325 1987935 615.9241307 Page 371 of 603 Diabetes
7525325 6907089 5483826 701.29217
20570599 13121889 9366515 1058.933835
560917 779833 470916 614.2346777
18552731 16038491 9284214 541.261655
5843030 6563408 6318530 1311.66479
1756837 2309323 2468945 365.1614637
27782583 13172261 12491066 566.9231537
2364529 2351977 1262076 761.345515
4087916 4673942 4968686 585.76196
1739596 1991571 398573 968.32611 Diabetes Page 372 of 603
1246448 549458 1245.11047
5873633 4148644 4270801 368.8337077
626165 680212 670770 472.1730007
20122804 15222895 12602883 823.862055
20122804 15222895 12602883 828.866635
719561 702560 554394 358.8413677
3958307 4225744 4938353 604.9245577
2574365 1726055 1546236 588.31872
47427643 31236533 12018957 717.828425
47427643 31236533 12018957 721.8363 Page 373 of 603 Diabetes
43423774 35008862 32725246 475.726405
4423665 4811011 2225219 582.24774
9033303 9803717 13359745 418.5278277
2711280 2735329 3519900 878.0397307
3727467 3737928 3257390 1077.88464
20169997 12254358 679.80255
3879565 5494365 936347 620.5852637
6178335 5646540 731.0144607
356025 790907 448029 822.781185
21219107 17850317 17468749 471.5331677 Diabetes Page 374 of 603
15460389 12720317 15535646 856.8869585
23548082 26184648 27024712 943.87463
1709247 1140778 1347820 882.87115
1709247 1140778 1347820 882.870905
4572945 4907501 5313489 713.77154
18252753 16599586 18863326 511.73532
5612515 3448226 3108680 549.73022
5612515 3448226 3108680 544.72613
11621665 7792359 9439323 763.6439177
506255 715939 256420 476.2132537 Page 375 of 603 Diabetes
12529345 9129797 680.3010207
312431 231463 243458 544.255795
1883910 1264213 2511086 1044.41772
2901316 2683643 2132729 421.1989407
3842802 1552549 597.9666707
40599947 33142224 31059072 474.9045377
3114699 4172677 3911789 1089.35107
3114699 4172677 3911789 1089.35156
54298909 47052806 54659383 686.285945
1998267 1822501 1876583 478.233915 Diabetes Page 376 of 603
3179071 3027780 3063119 702.9619707
4891849 4978117 2435260 616.2420607
11750308 6118789 11773783 843.0454077
83563470 46469236 41179689 845.872675
7028472 6791744 8011778 353.1576507
39289836 32821128 28235354 484.23776
13667612 10152517 8849061 1089.447995
13667612 10152517 8849061 1089.447995
13667612 10152517 8849061 1089.447995
49220153 33740288 26645447 884.0400337 Page 377 of 603 Diabetes
49220153 33740288 26645447 880.7027537
16383565 11698372 8792136 626.31567
16383565 11698372 8792136 626.316465
16383565 11698372 8792136 626.315915
8042677 8151371 3431029 1085.50842
8042677 8151371 3431029 1089.5133
3917638 4436433 292252 1202.475095
11750308 3343358 11773783 839.7086137
2676089 3839547 3950369 747.9918177
8701353 7673214 7656395 792.0609107 Diabetes Page 378 of 603
1338199 1417844 1486855 707.6125437
23623943 15707937 25755205 611.80206
7517113 6576273 7422411 421.23724
6878179 6219786 6795227 522.69488
2249605 3135683 1793576 915.381405
2249605 3135683 1793576 911.374385
20892544 17711068 14848419 511.232845
16952154 13727211 17197016 559.74499
3212030 3477809 3295761 516.18878
9403212 5203364 5351991 525.73614 Page 379 of 603 Diabetes
9403212 5203364 5351991 525.73712
4311131 3916266 2875284 538.700435
30126644 37712540 2675540 421.237635
968891 1059837 787373 520.723995
3988176 2712585 834996 645.783565
21642920 24044844 20760740 696.3425877
9349457 8601645 7551757 923.838435
2279676 2473778 1129858 878.85571
8722960 4805378 1853890 481.5600237
36051636 53478060 33387273 1190.106564 Diabetes Page 380 of 603
27520814 23422701 21704822 679.84454
11432495 8521659 9647503 620.9580637
11432495 8521659 9647503 620.9578807
64147944 49803514 49044257 552.74829
4875607 2271013 11810817 406.212645
4875607 2271013 11810817 406.21298
4875607 2271013 11810817 416.22122
2095498 822692 1041249 1005.99829
2095498 822692 1041249 1001.99011
29782943 16371103 43989960 701.6749837 Page 381 of 603 Diabetes
4997679 5181600 5504743 655.9596507
119935712 96524760 85925626 983.32104
4715610 3414939 1116.478025
7360317 8058771 10306965 614.2785
40244395 42339218 18048423 839.3399007
3813818 4363401 3842539 632.30218
39151070 17429258 709.372555
3290233 3225925 4454581 774.6142537
45307397 42247338 39318647 902.90808
2127499 2512835 2723594 422.706265 Diabetes Page 382 of 603
2617603 3025308 2867564 587.2040977
2617603 3025308 2867564 587.2045877
16455179 13538415 3425542 850.89178
45826214 31638978 76031695 618.9389007
1794304 1126628 2678053 648.6367777
9272385 11132374 3146126 741.275935
14162970 11296832 8608216 755.326045
5490307 4414332 1899652 767.848505
119990733 122091175 106217264 540.21533
4591652 5711814 3593839 990.845945 Page 383 of 603 Diabetes
1693778 2000435 1420143 841.835325
6544022 4140532 16304507 781.87689
28137383 31258198 30152457 850.9658177
4394396 6083246 2055938 908.0155607
32698338 26478249 23795422 581.26318
547990 683567 199962 832.30987
7151614 6385278 6074487 627.9688677
265852391 225378079 110114171 613.812495
77445667 76718145 34636036 799.37933
8342588 5269767 7917761 741.75256 Diabetes Page 384 of 603
mass error spectral score timepoints xcorr timepoints ascorr timepoints timepoints 1.051834345 20.19 10.92545208 0.637972451
0.475261291 22.63 100 0.147070759
0.559566988 35.76 33.76433346 0.791518451
0.080788692 34.31 12.31446515 0.718944499
0.265690871 51.63 22.41149709 0.725370066
0.571011578 31.9 22.46769817 0.667321909
0.100665261 20.9 74.92094871 0.591014699
1.18521963 29.19 28.84721822 0.677521724
1.593863026 71.45 131.2637225 0.919685742 Page 385 of 603 Diabetes
0.01873273 26.79 100 0.259272481
0.0916332 26.34 13.89166084 0.726798438
0.382637238 35.04 16.94605199 0.846280352
0.546187306 34.71 6.777807053 0.861328967
0.479487596 29.76 11.00731117 0.816126079
1.216744387 22.62 9.777236053 0.346027623
1.994805894 31.38 21.19358778 0.884140928
0.653324654 23.01 7.781512504 0.929670076
1.855841491 31.61 0.638871241
0.374207046 25.93 7.535014192 0.666513435 Diabetes Page 386 of 603
0.105840991 24.13 6.641110557 0.479836601
1.760983653 24.2 13.89166084 0.271319029
0.223325126 22.4 100 0.141982288
0.928148997 34.85 0.556180585
0.305041362 21.19 0.695840146
0.195031517 25.98 28.79979759 0.872618022
0.443934146 51 11.26142116 0.946154487
1.91942289 21.55 13.93575203 0.657031092
0.700907613 43.41 14.44998709 0.723171399
0.015389179 21.64 14.81300602 0.521960897 Page 387 of 603 Diabetes
0.294400436 29.05 31.92690521 0.674402232
0.874273977 43.63 71.75200994 0.981501074
0.442577433 58.88 137.2251242 0.918881538
0.243832799 26.77 2.266476325 0.518830174
0.678700903 30.41 18.85959805 0.782959516
0.308742347 27.22 15.72142928 0.520827991
0.006563065 70.03 49.1568628 0.976806491
0.165673246 34.05 7.007002704 0.691300202
0.435631765 37.89 25.48477163 0.612882792
1.082903811 42.16 34.38320794 0.965159734 Diabetes Page 388 of 603
1.860316962 36.37 3.055304969 0.743211633
0.988805743 23.97 36.75746927 0.774394477
0.496427037 23.59 15.1932836 0.695515124
0.652795351 26.21 17.32320056 0.45244012
0.282921111 25.62 3.160704101 0.700988098
0.472871155 20.57 35.74975202 0.609904649
1.499165933 27.96 17.35398254 0.886699304
1.300123098 35.45 7.596678447 0.810236877
0.12990117 31.87 58.02145665 0.795724744
1.400454924 21.61 0.336198363 Page 389 of 603 Diabetes
0.959861017 31.51 27.43807012 0.862976868
0.761563094 23.08 13.36411944 0.847589447
0.740549268 31.42 24.34964395 0.775267404
0.79159515 24.5 13.4324443 0.62255883
0.103993562 71.78 27.60422483 0.899629012
0.404801048 54.82 13.93575203 0.912810085
0.700958795 25.75 0.147859743
0.858834121 24.72 7.793559515 0.929339222
0.06093994 79.72 15.1851394 0.936681304
0.273401037 48.39 3.624824748 0.914602454 Diabetes Page 390 of 603
0.241743907 30.78 8.239087409 0.866109909
1.364630632 28.72 10.22901467 0.555526725
0.268875514 21.1 25.44112358 0.569333659
0.462309328 41.89 5.265201957 0.885178362
1.513588411 30.3 35.14149134 0.910576204
0.052528917 24.79 46.0316384 0.712900411
1.138374823 59.41 39.91270389 0.974609134
0.026502874 26.51 14.68618567 0.728741308
0.094810821 71.05 35.38573734 0.853729609
0.159603611 59.07 91.10113085 0.968901871 Page 391 of 603 Diabetes
1.096415238 29.85 12.71089852 0.82851293
0.232236072 56.83 76.25052531 0.86539357
0.742110445 28.04 0.870629567 0.850277391
0.46135347 24.62 11.57196979 0.902813925
0.845862721 32.84 8.223549129 0.66629847
0.173010721 46.14 126.022142 0.95181822
0.652542563 78.3 0.92647856
1.639498956 43.83 109.8985958 0.977464233
1.524670871 56.87 29.82869818 0.763327043
1.985990185 53.36 24.17240968 0.90160216 Diabetes Page 392 of 603
0.26874925 38.93 58.78689652 0.886870802
0.212570815 28.93 100 0.672164061
0.684616316 47.26 50.84838024 0.596406289
0.323377987 21.23 9.408785479 0.713171497
0.548696212 64.55 14.03692338 0.88223384
0.136949472 75.78 11.95392218 0.741537645
0.611947756 38.58 51.52868182 0.947216391
0.331335889 30.87 5.213249172 0.391768804
0.241087862 26.36 100 0.446048384
0.778176699 74.68 35.38573734 0.907729643 Page 393 of 603 Diabetes
1.289965066 91.04 19.39704098 0.956257084
0.923983728 57.47 0.876495322
0.066518062 26.11 67.80206745 0.913588405
1.534949377 39.2 100 0.943106199
0.060311065 41.2 16.11801956 0.901791775
0.994362573 33.14 19.82271233 0.613917361
1.66699312 37.39 13.93575203 0.917285028
0.514565978 49.83 124.5951029 0.90942659
0.08174512 27.32 30.48241509 0.933894636
0.697555192 55.57 32.13119139 0.950232411 Diabetes Page 394 of 603
0.730569302 23.23 68.92745647 0.924008259
0.229156134 39.79 32.13119139 0.354367233
1.748541832 29.9 19.82271233 0.459171947
0.255489453 42.09 100 0.859054481
0.090248933 22.59 100 0.765819577
0.249881836 41.98 45.15723173 0.949306048
0.109440191 63.86 27.60422483 0.892505947
0.109440191 44.32 27.60422483 0.94896113
1.33354785 24.9 1.017088959 0.855752677
1.063903105 27.63 12.2184875 0.448307553 Page 395 of 603 Diabetes
0.027672788 32.32 4.559319556 0.571235233
1.006271213 47.2 33.22400213 0.890001787
0.055080414 49.42 130.3820195 0.94969231
0.563878471 80.49 15.57507202 0.844599297
1.302410338 26.59 14.55931956 0.976199874
1.772080379 47.67 0.911612565
0.123331212 41.83 8.223549129 0.860565424
0.447855783 25.03 100 0.302988721
0.473660839 52.27 100 0.942818871
0.544392348 80.47 11.95392218 0.975967848 Diabetes Page 396 of 603
0.015055557 44.93 100 0.907744142
0.174120778 24.97 100 0.51073697
0.106356468 59.34 44.68528249 0.941277283
0.645477363 67.73 27.60422483 0.93744706
0.39402725 21.43 27.60422483 0.684998852
0.036521358 57.71 0.926723581
1.409481402 76.21 86.94018449 0.959312699
0.108204198 45.4 67.48911848 0.954385747
0.910004816 48.44 44.68528249 0.937212465
0.613813051 37.31 13.89166084 0.971000991 Page 397 of 603 Diabetes
1.165963955 21.81 0.719684714
0.367570858 32.61 100 0.940324999
0.236923408 26.93 100 0.69006424
0.66734428 54.99 48.62510659 0.820799687
0.257725489 24.71 11.11710471 0.464607266
0.623478615 46.52 12.08620484 0.912495571
1.781385951 43.15 10.92545208 0.736849665
0.709834357 29.53 9.777236053 0.238555568
0.930316632 110.75 16.94605199 0.935842054
1.012453526 37.08 32.13119139 0.904749041 Diabetes Page 398 of 603
0.439205573 55.05 100 0.955136233
1.184794906 36.96 100 0.247480708
0.212484292 22.57 0.813615401
0.70724358 61.21 19.08485019 0.933190417
0.424878431 32.52 48.38773292 0.802287255
1.370025897 25.37 9.164539485 0.869654971
1.853738382 22.71 42.38717557 0.856991902
0.033955238 73.73 60.38601918 0.687589044
0.608729404 49.35 16.94605199 0.889761421
0.326309218 75.58 7.447274949 0.961545389 Page 399 of 603 Diabetes
0.115982627 20.87 7.604224834 0.741197854
0.267358051 21.17 58.00064371 0.632366037
1.391434441 36.34 16.43196153 0.67682783
0.291106722 37.35 14.86748654 0.814153341
0.34584505 44.61 30.11713929 0.261372195
1.210876798 46.16 11.07441655 0.555480244
0.625049036 29.39 16.13749948 0.394342732
0.86485732 34.98 2.297297993 0.24904148
0.242204258 36.62 44.82747375 0.793755799
0.632586199 21.79 10.44158504 0.92321217 Diabetes Page 400 of 603
0.0837705 31.96 100 0.841540691
0.961332319 60.11 13.8039216 0.968524458
0.752989334 30.34 32.69916364 0.93971372
0.762312691 58.69 26.0224091 0.906213017
0.098212837 22.86 9.427951751 0.580978819
0.292975045 36.92 100 0.83800351
0.646673807 56.25 51.96731766 0.871774578
0.604543824 22.42 7.958800173 0.261570967
0.436685555 27.7 5.276776282 0.822023578
0.215540054 22.34 100 0.469042941 Page 401 of 603 Diabetes
0.19010212 20.01 1.681223294 0.816759683
0.271865293 47.15 10.79181246 0.907093872
0.594746763 70.81 13.89166084 0.908197555
0.977957325 38.99 112.576599 0.96429411
1.210408786 27.96 77.68041496 0.923343577
0.07397867 41.63 100 0.672609713
0.628953652 40.43 33.8039216 0.877854897
0.457834094 39.03 9.340470197 0.43813171
0.340990033 23.53 11.5930136 0.590636375
0.036983617 63.55 0.928438565 Diabetes Page 402 of 603
1.704109545 63.53 39.91270389 0.959749888
0.230384768 22.73 100 0.811611983
1.897689273 80.7 67.62127051 0.934880947
1.090428687 23.68 23.31174137 0.664561139
0.190476422 45.53 13.89166084 0.954175389
0.293398093 24.93 0.809565844
0.568429426 31.04 44.38565025 0.868708083
1.136995117 33.45 45.15723173 0.719733237
0.658521129 40.38 22.46769817 0.884341057
0.375940096 38.17 100 0.914347438 Page 403 of 603 Diabetes
1.527928018 49.58 26.0224091 0.957324586
1.049531269 47.29 22.41149709 0.906708461
0.308692187 49.33 8.239087409 0.788575802
0.947108733 23.81 21.40533614 0.372980927
0.75354472 46.21 15.14149134 0.799500318
0.450576156 46.01 2.918866162 0.43893203
0.20260199 32.23 0.051805125 0.633300125
0.33953485 30.68 10.92545208 0.848568186
0.667638304 27.81 7.87106093 0.565062097
0.464166011 33.3 92.71630721 0.9165691 Diabetes Page 404 of 603
0.508625317 34.04 11.74163522 0.607848964
0.428236853 56.45 39.38923145 0.924855944
0.361273041 31.17 33.61652038 0.844671329
0.037116393 84.07 27.60422483 0.660188696
1.384575902 41.75 8.930440061 0.291057923
0.224168812 26.48 27.80763412 0.982536119
0.310662914 25.25 23.89953206 0.293412867
1.917308102 69.92 42.71871767 0.877452084
0.135782333 50.51 76.68828175 0.260956892
1.068260206 59.86 34.95042823 0.868298647 Page 405 of 603 Diabetes
1.335385041 81.97 13.97940009 0.911478594
0.244778122 40.4 47.80440376 0.790530435
0.779054555 21.46 37.94700751 0.073402153
0.018639889 20.41 49.80048941 0.340108001
0.189765817 33.08 86.94018449 0.874621565
0.192975826 20.32 12.17483944 0.589620272
0.438187804 43.62 100 0.891644445
0.715407066 37.63 19.08485019 0.876499384
0.284258054 33.57 37.69558244 0.943816493
1.266275328 30.51 0.837974799 Diabetes Page 406 of 603
0.854476254 22.6 5.313050269 0.268114262
0.537128281 31.91 100 0.787693863
0.056097871 21.22 18.62727528 0.865814018
0.072772488 36.4 26.75236625 0.841095432
0.113952493 32.44 16.84093839 0.74461485
0.443165312 41.5 27.92795109 0.836010553
1.766736535 42.07 37.68997541 0.539711358
0.876061691 48.87 100 0.925506473
1.224034792 21.85 41.05673539 0.831159872
0.001009656 32.78 22.55627176 0.914211804 Page 407 of 603 Diabetes
0.820309531 92.31 100.1442674 0.951918134
0.233987591 31.33 12.13074825 0.87321626
0.829989393 48.93 10.79657402 0.872308923
0.169716363 27.43 16.14520114 0.85076093
0.405243131 25.05 16.26883575 0.373186907
0.857923474 30.61 54.15727927 0.78066562
0.308702046 43.82 32.13119139 0.769660786
0.343889784 33.53 78.61858947 0.951637228
0.479231741 32.2 25.0673204 0.512336745
0.155540841 20.42 30.19300959 0.328321349 Diabetes Page 408 of 603
0.244668977 71.82 63.17038525 0.547666164
0.688309458 54.18 26.0224091 0.745175798
1.13271457 47.96 32.69916364 0.898858388
1.471087197 24.07 18.54562869 0.766357299
0.77100261 29.32 100 0.844102047
0.593793332 64.71 61.22904958 0.709560639
0.790516562 20.45 53.84845592 0.780452161
0.045177086 24.28 22.46769817 0.832734508
0.32849204 39.24 46.75280939 0.906147327
0.686434159 35.16 19.43260443 0.810341712 Page 409 of 603 Diabetes
0.150971102 44.97 22.47843695 0.613220905
0.114113802 76.8 22.41149709 0.956971733
0.529737749 65.52 35.38573734 0.859345978
1.398047262 26.56 19.42008053 0.555443605
0.574127311 21.43 0.168658112
0.574127311 100.82 0.431660723
0.934144287 82.89 16.90240394 0.957591213
0.205790776 28.76 21.03771809 0.514367031
0.000762684 22.5 7.596678447 0.201686244
1.094449116 44.52 57.4824232 0.964179677 Diabetes Page 410 of 603
0.100011227 20.03 7.999607567 0.866494014
0.720551409 32.02 100 0.966730372
0.061988004 23.39 16.94605199 0.820924486
0.350497165 28.74 32.17483944 0.724538725
0.619245956 30.19 39.91270389 0.590812806
0.819215262 74.35 110.4168993 0.877325346
0.150258891 56.49 22.60667537 0.830244144
0.90172482 33.14 45.02494907 0.881507032
0.20725537 65.11 71.75504509 0.920183523
0.063190555 40.19 16.94605199 0.717474061 Page 411 of 603 Diabetes
0.260275276 43.35 19.82271233 0.625690594
0.106741044 63.71 83.47084735 0.957477932
0.637840477 27.24 100 0.767810602
0.498396539 25.05 23.98673391 0.499350825
0.750279225 24.84 10.79181246 0.918427627
1.131016234 29.28 100 0.889202444
0.008940852 24.1 0.829555612
0.269560831 33.92 19.15817084 0.908177968
1.535990077 23.13 16.29931271 0.916471268
0.547250251 28.95 100 0.898258862 Diabetes Page 412 of 603
1.609395863 37.03 100 0.24430128
0.053966648 74.94 100 0.894915645
0.254783226 53.74 1.496347276 0.904827651
0.927483636 25.3 15.00135618 0.793523091
0.015355546 50.04 13.62482475 0.968901725
0.224520634 50.1 19.33234129 0.739174224
0.717003485 20.87 82.75552719 0.212089616
0.643036439 27.25 8.311288372 0.665748009
1.033555562 33.68 100 0.932139934
1.895766399 50.66 42.90396045 0.98574573 Page 413 of 603 Diabetes
1.095972977 94.1 20.40625017 0.912672447
0.23702257 28.93 7.535014192 0.061866015
0.733997417 29.61 13.97940009 0.776411339
0.411449334 35.01 0.793084848
0.573716557 28.97 10.88136089 0.826335666
0.110671709 24.97 33.22400213 0.832060267
0.115447734 34.46 25.35230807 0.780248926
0.501450185 67.93 44.93539634 0.851716662
0.207027709 54.72 28.9425275 0.85537676
0.728424452 24.5 62.21509449 0.730495036 Diabetes Page 414 of 603
0.503453094 44.83 50.05085056 0.928568729
0.552893474 24.57 100 0.348759552
0.277867692 20.79 42.6053664 0.82525621
0.578466446 49.38 24.03802919 0.912708394
0.195521171 60.1 55.20844967 0.925848944
0.100739566 54 3.979400087 0.949753236
0.305001435 32.63 9.427951751 0.90567761
1.568036847 22.19 0.875862929
0.050401812 25.36 12.31446515 0.239738485
0.345657477 25.91 9.20818754 0.743069497 Page 415 of 603 Diabetes
1.047391566 32.53 68.06449519 0.844392722
0.462004958 25.46 40.19195532 0.852875368
0.103765465 29.55 27.86575173 0.966082723
0.769290487 39.16 39.91270389 0.95011109
1.116567552 32.55 13.89166084 0.500647069
0.67034313 31.24 75.43427502 0.927799427
0.804707016 22.57 7.781512504 0.713312149
0.373270725 48.69 100 0.892754547
0.258005728 29.17 100 0.85838927
0.667477784 33.21 135.4666644 0.76294906 Diabetes Page 416 of 603
0.374415428 61.11 29.82869818 0.935793178
0.725223842 41.37 100 0.95814435
0.460938809 25.35 22.28100751 0.859088971
0.122668327 86.82 17.1030993 0.825685452
0.415276878 106.89 28.10814325 0.845457689
0.380638773 22.99 100 0.921771207
0.07226553 20.75 19.12089143 0.606099396
0.120786284 31.16 10.88136089 0.804765493
1.116648988 44.3 15.22878745 0.873383143
0.04297601 65.76 10.61452479 0.944385359 Page 417 of 603 Diabetes
0.050502631 28.93 100 0.865074162
0.268159142 22.66 27.83139773 0.895871516
0.35179557 23.44 100 0.631197656
0.004559089 41.27 12.87935579 0.791801533
0.692419856 49.52 32.18985834 0.821853016
0.234064852 59.67 0.958317114
0.915718788 38.9 100 0.863274254
1.427639813 21.38 6.197887583 0.621169141
0.39402754 59.91 52.87935579 0.895237018
0.133797262 20.15 27.65327048 0.458370622 Diabetes Page 418 of 603
0.353917591 37.05 8.939466076 0.74602929
0.041341106 89.67 46.85875588 0.900534713
0.735521186 22.47 11.11710471 0.822831394
0.457859232 70.6 34.03235762 0.80272149
0.814560696 60.4 61.58362492 0.834966673
1.768278509 46.16 10.91867857 0.981840172
0.671853859 61.15 30.19300959 0.875334695
0.760718281 56.25 0.896234499
1.507699792 35.68 100 0.380497561
0.881100365 24.83 100 0.283536726 Page 419 of 603 Diabetes
1.629319097 26.91 12.13119139 0.786816575
1.138386285 40.29 16.94605199 0.842152997
0.30749657 100.36 25.57507202 0.972597934
0.088777404 29.02 27.42693716 0.890559093
0.676382515 29.83 15.14149134 0.787235499
0.167990551 40.31 25.57507202 0.953683805
0.294807142 68.36 75.09974723 0.936832302
0.155209921 43.64 9.510919048 0.787648576
0.603690114 28.16 27.60422483 0.931674739
0.263747151 20.18 10.79181246 0.511535365 Diabetes Page 420 of 603
0.37591284 30.45 28.8106408 0.869035789
1.463141264 23.09 66.24046876 0.848425903
0.723748292 26.13 0.777545306
0.746419576 82.54 16.94605199 0.954801892
0.65439926 22.61 100 0.568430845
0.049614031 53.04 100 0.732064786
0.031222899 22.28 7.568676829 0.035401174
0.031222899 49.03 6.411778824 0.607876126
0.031222899 26.41 5.528419687 0.409253818
1.078070265 34.25 28.6378447 0.94802511 Page 421 of 603 Diabetes
0.270066171 24.35 4.024876364 0.783724671
0.693498968 20.88 9.075904882 0.627226443
1.963845967 36.58 8.223549129 0.706729417
1.084989897 25.7 5.213249172 0.545001525
1.473726221 59.43 19.82271233 0.571354601
0.574834201 23.36 9.120448296 0.191767146
0.490028274 72.94 86.15115723 0.8258965
0.112430468 22.98 7.515892914 0.758076803
1.690930464 22.9 37.23546301 0.817171283
1.372270093 20.54 100 0.853891362 Diabetes Page 422 of 603
0.840711331 37.56 102.6169583 0.967718951
0.93407733 30.45 100 0.755850239
0.251940893 40.05 100 0.915065822
0.247035931 23.93 48.75738925 0.917138301
0.673313989 57.36 30.19300959 0.956082079
0.58295867 48.68 0.972734448
0.491454171 69.43 82.8126745 0.967679685
0.395178215 33.36 58.00064371 0.868687904
0.195855943 41.25 28.94496981 0.986052626
0.563559943 48.79 55.52255219 0.857982382 Page 423 of 603 Diabetes
1.302277979 21.26 22.04119983 0.084369914
0.369753221 28.67 100 0.978033852
0.675010816 23.71 100 0.674906724
0.069201444 51.13 25.28951439 0.927118174
1.117344532 44.44 100 0.790311945
0.128892332 29.1 100 0.468176392
0.627074817 75.73 100 0.489201756
0.209483196 54.71 46.60906731 0.884701448
0.094963106 34.48 11.95392218 0.740302709
0.357872981 33.79 100 0.785722744 Diabetes Page 424 of 603
0.859656759 74.46 156.9257678 0.900063891
0.178949552 35.22 0.616140136
0.473974629 22.1 5.528419687 0.373790606
1.745603136 28.92 100 0.887910698
0.643318226 22.28 13.93575203 0.43905038
0.182396588 30.09 10.79181246 0.743116742
0.093813689 31.66 16.94605199 0.672063155
0.928896038 22.17 16.94605199 0.138817522
0.140790718 32.1 6.509085589 0.680968706
0.377078495 42.76 75.59209119 0.811502517 Page 425 of 603 Diabetes
0.774214129 22.29 6.766936096 0.927508428
0.392748438 96.88 114.2190118 0.987301629
0.01702548 56.25 56.19541382 0.955343087
0.254164856 20.8 8.914750666 0.291825179
1.240855962 58.9 38.60084507 0.81311595
0.761318627 41.49 51.52868182 0.861599355
0.54170805 35.71 44.42837539 0.830982742
0.463858606 31.46 100 0.502060224
1.325348083 66.62 0.904110955
0.333962866 39.74 59.82540778 0.746840775 Diabetes Page 426 of 603
0.085815068 23.11 0.640715625
0.749602515 25.22 5.915068189 0.913769279
0.912524481 41.62 16.90240394 0.801371745
0.219969552 34.94 10.6694679 0.915939736
0.664130252 38.43 29.13527486 0.926992229
1.227097721 49.24 100 0.915073869
0.524626714 67.44 16.44274426 0.9497554
0.011728755 49.45 26.0224091 0.754834337
0.609584717 60.72 30.19300959 0.929255124
0.980469067 49.35 61.37442738 0.976434335 Page 427 of 603 Diabetes
1.344297398 40.57 19.82271233 0.901224396
0.235482849 93.11 16.94605199 0.868631439
1.462630835 28.15 81.53078279 0.935614429
0.675230823 38.45 16.92285552 0.94957646
1.367175121 55.1 100 0.89618705
0.64438084 51.05 24.19997279 0.883607696
0.218397223 26.03 13.80807391 0.370343024
0.723941932 34.98 42.38717557 0.674232559
0.299170449 73.35 100 0.935025314
0.032377787 37.07 101.7626802 0.371846899 Diabetes Page 428 of 603
charge state delta cn drosophila CG timepoints timepoints accession number gi species adjust 3 0 148699061
2 0 253314487
2 0 115503759
3 0 59798961
2 0 62510931
2 0 25453361
3 0 229462734
3 0 223459828
2 0 150387848 Page 429 of 603 Diabetes
3 0 158518639
2 0 109895137
2 0 9313029
3 0 9313029
3 0 9313029
2 0 2507204
2 0 9313029
3 0 189181672
2 0 20455219
3 0 30315995 Diabetes Page 430 of 603
3 0 3183181
2 0 148887397
3 0
3 0 124007127
2 0 147742931
3 0 38605043
3 0 261260072
2 0 48428375
2 0 20137987
2 0 20137987 Page 431 of 603 Diabetes
3 0 342187308
3 0 1346679
2 0 6425087
4 0 9313029
2 0 67461015
3 0 251757447
3 0 1352708
2 0 22261823
2 0 22261823
2 0 46397855 Diabetes Page 432 of 603
3 0 399310
3 0 166214952
3 0 166214944
3 0 166214944
3 0 166214944
2 0 347595715
2 0 122183
2 0 187608835
2 0 114930
3 0 22261823 Page 433 of 603 Diabetes
3 0 49901389
3 0 81882150
3 0 81882150
3 0 14195676
2 0 51315842
2 0 78099268
4 0
3 0 81906080
2 0 118568015
3 0 41688568 Diabetes Page 434 of 603
3 0 41688568
3 0 62510494
3 0 118568015
3 0 205688689
3 0 205688689
3 0 61212920
2 0 81880083
2 0 342187056
2 0 116283679
3 0 78098987 Page 435 of 603 Diabetes
2 0 47605501
3 0 81882407
3 0 147742933
3 0 147742933
2 0 158148935
3 0 61743961
2 0 81882232
3 0 73921751
2 0 41017844
2 0 6691151 Diabetes Page 436 of 603
3 0 341941235
2 0 158518599
3 0 147744571
3 0 48474741
2 0 20455238
2 0 73921205
2 0 51315842
3 0 341942058
2 0 1350781
2 0 148887397 Page 437 of 603 Diabetes
2 0 341940995
2 0 20455238
3 0 51316524
2 0 32172436
2 0 17368615
2 0 17368615
3 0 138536
2 0 61743961
3 0 51258091
2 0 189047109 Diabetes Page 438 of 603
2 0 215275613
2 0 56749456
2 0 56749456
2 0 55976729
2 0 347595715
2 0 341941131
2 0 123213541
2 0 123213541
3 0 57015295
3 0 218512063 Page 439 of 603 Diabetes
3 0 218512063
2 0 146291107
2 0 22653923
2 0 34766351
3 0 338817907
3 0 341942026
2 0 138536
3 0 73620776
2 0 81882407
2 0 338817907 Diabetes Page 440 of 603
2 0 81896337
2 0 20138335
2 0 261260072
2 0 281185473
2 0 281185473
3 0 6578739
2 0 281185473
2 0 55976513
2 0 148887397
3 0 90110086 Page 441 of 603 Diabetes
3 0 90110086
2 0 1346902
3 0 347595715
2 0 261260072
2 0 261260072
2 0 81911483
2 0 20137987
2 0 20137987
2 0 41688568
2 0 73917747 Diabetes Page 442 of 603
3 0 158564030
2 0 30173483
2 0 118568015
2 0 68565928
2 0 68565928
3 0 110283006
2 0 341940614
2 0 34766351
2 0 46397410
2 0 46397410 Page 443 of 603 Diabetes
3 0 13959565
2 0 46396473
2 0 347595715
2 0 347595715
3 0 68565928
3 0 68565928
3 0 68565928
3 0 68565928
3 0 46396418
3 0 20137987 Diabetes Page 444 of 603
3 0 347595715
2 0 341941090
2 0 1708264
2 0 81882407
3 0 226736666
2 0 25090576
2 0 341942108
3 0 85700428
3 0 85700428
3 0 341942183 Page 445 of 603 Diabetes
3 0 81908799
2 0 138536
2 0 47605961
2 0 261260072
2 0 261260072
3 0 148704095
2 0 148704095
3 0 71152026
3 0 113985
2 0 81900897 Diabetes Page 446 of 603
2 0 81900897
2 0 341940631
2 0 81885787
3 0 62510642
2 0 281185473
3 0 52000879
2 0 81881162
3 0 28380207
2 0 30923239
2 0 29839513 Page 447 of 603 Diabetes
2 0 50401562
3 0 62286942
2 0 14916536
3 0 14916536
3 0 20137987
3 0 20137987
3 0 20137987
3 0 341942168
3 0 341942168
2 0 81914411 Diabetes Page 448 of 603
3 0 166991454
2 0 46396970
2 0 146291107
2 0 61743961
2 0 61743961
3 0 81900953
2 0 3914804
2 0 81907185
2 0 81878875
3 0 41018011 Page 449 of 603 Diabetes
2 0 294862480
2 0 49901389
3 0 57015295
3 0 57015295
2 0 122065442
2 0 138536
2 0 166234056
2 0 147742910
2 0 147742910
3 0 33516945 Diabetes Page 450 of 603
3 0 61743961
2 0 81897880
3 0 123228045
2 0 85700428
2 0 85700428
2 0 57013084
3 0 28380825
2 0 223461012
3 0 81891295
3 0 281185473 Page 451 of 603 Diabetes
2 0 84029593
3 0 118568015
2 0 9622185
3 0 85690846
3 0 81880120
2 0 347595715
2 0 85700428
3 0 81916748
3 0 124021003
2 0 47115791 Diabetes Page 452 of 603
2 0 81914516
2 0 81878684
2 0 19353460
2 0 19353460
2 0 148886616
2 0 1708264
2 0 85700428
2 0 85700428
2 0 51703331
3 0 341942108 Page 453 of 603 Diabetes
2 0 6225769
2 0 123785957
2 0 9622185
3 0 56749456
2 0 218512063
2 0 218512063
2 0 147643261
2 0 23503073
2 0 23503073
2 0 341940611 Diabetes Page 454 of 603
4 0 47605501
2 0 341942108
2 0 239938603
2 0 23396700
2 0 122066548
2 0 38372440
2 0 47605501
3 0 347595715
2 0 123681
2 0 261260072 Page 455 of 603 Diabetes
2 0 23822163
2 0 46397804
2 0 20137304
2 0 51703331
2 0 148701159
3 0 56417892
4 0 51704189
3 0 1708264
3 0 1708264
3 0 20137436 Diabetes Page 456 of 603
3 0 73921751
2 0 123681
3 0 34098397
3 0 34098397
2 0 341942108
2 0 56417892
2 0 18280933
3 0 347595715
2 0 73921751
3 0 50400986 Page 457 of 603 Diabetes
2 0 20455216
2 0 20455216
3 0 152040391
3 0 152040391
3 0 152040391
2 0 7329158
3 0 81903237
2 0 118568015
2 0 118568015
2 0 71162370 Diabetes Page 458 of 603
3 0 81914516
2 0 47605501
3 0 81878080
3 0 205371802
2 0 34766351
3 0 81881579
3 0 81881579
3 0 81881579
2 0 33516945
3 0 123213541 Page 459 of 603 Diabetes
2 0 125987710
2 0 3122277
3 0 156630946
2 0 13878547
2 0 23503073
3 0 341942108
3 0 81880094
2 0 47605501
2 0 51261360
2 0 18280933 Diabetes Page 460 of 603
2 0 54039390
3 0 6691151
3 0 34766351
2 0 85700428
2 0 85700428
3 0 47605501
3 0 19353460
2 0 341942108
2 0 281185473
2 0 281185473 Page 461 of 603 Diabetes
2 0 81904209
2 0 147742910
3 0 347595715
3 0 2498048
2 0 1708264
2 0 81904209
3 0 1170384
3 0 9297076
2 0 41019534
3 0 341942108 Diabetes Page 462 of 603
4 0 3183181
2 0 215275645
2 0 46577330
2 0 46577330
2 0 123778087
2 0 341942108
2 0 73917637
2 0 73917637
3 0 11527239
3 0 122065442 Page 463 of 603 Diabetes
3 0 294862480
2 0 24418669
2 0 347595715
3 0 81882902
3 0 124007127
3 0 341942108
2 0 84029300
2 0 84029300
2 0 11133187
2 0 81892500 Diabetes Page 464 of 603
3 0 341940583
3 0 150387848
3 0 341942183
2 0 81880094
3 0 341942108
2 0 1345856
2 0 22261803
2 0 22261803
2 0 22261803
3 0 152112288 Page 465 of 603 Diabetes
3 0 152112288
2 0 81903514
2 0 81903514
2 0 81903514
2 0 20138800
2 0 20138800
2 0 1170384
3 0 341942183
3 0 81881162
3 0 1934963 Diabetes Page 466 of 603
3 0 148710033
2 0 23822163
2 0 34098661
2 0 47605750
2 0 20138800
2 0 20138800
2 0 81882407
2 0 125987791
2 0 34766351
2 0 34766351 Page 467 of 603 Diabetes
2 0 34766351
2 0 81913100
2 0 30580527
2 0 122065141
2 0 219518475
3 0 347595715
2 0 123232173
2 0 47605961
3 0 281185473
3 0 85681904 Diabetes Page 468 of 603
2 0 338817942
3 0 294862480
3 0 294862480
2 0 6691151
2 0 61216765
2 0 51338633
2 0 51338633
2 0 212288549
2 0 212288549
3 0 28201882 Page 469 of 603 Diabetes
3 0 20138800
2 0 8928249
2 0 122065442
2 0 51338633
3 0 1170384
2 0 212288549
2 0 81881209
3 0 2498444
2 0 14916571
2 0 46396655 Diabetes Page 470 of 603
3 0 3914438
3 0 3914438
2 0 9622185
3 0 147643261
3 0 342187057
2 0 172045711
2 0 14194433
2 0 148694805
2 0 548409
2 0 71152389 Page 471 of 603 Diabetes
2 0 548409
2 0 281185473
3 0 20455216
3 0 59798469
2 0 81878145
2 0 134034152
3 0 78099174
2 0 41016923
2 0 54036156
2 0 6686019 Diabetes Page 472 of 603
gi name species IPI accession swissprot adjust number accession hprd accession mCG1697, isoform B1AXP3 B1AXP3_MOUSE CRA_a [Mus musculus] [MASS=54784] caspase IPI00351041.1 Q8BWE0_MOUSE recruitment domain family, member 6 [Mus musculus] [MASS=131468]AP2-associated Q3UHJ0 AAK1_MOUSE 10620_1 protein kinase 1 (Adaptor- associated kinase 1)Serine/threonine- [MASS=103345] Q8CFH6 SN1L2_MOUSE 12348_1 protein kinase SNF1-like kinase 2 (Salt inducible kinaseInterferon 2) induced Q8R5F7 IFIH1_MOUSE with helicase C domain protein 1 (Helicase with 2 CARDZ-DNA domains)binding Q9QY24 ZBP1_MOUSE protein 1 (Tumor stroma and activated macrophageRecName: Q8BKC8 PI4KB_MOUSE 11805_1 Full=Phosphatidylin ositol 4-kinase beta; Short=PtdIns 4-kinaseRNA binding beta; motif Q0VBL3 Q0VBL3_MOUSE protein 15 [Mus musculus] [MASS=105721] 182 kDa tankyrase P58871 TB182_MOUSE 1-binding protein [MASS=181824] Page 473 of 603 Diabetes
Transmembrane Q80W04 TMCC3_MOUSE 15519_1 and coiled-coil domains protein 3
Testis-expressed B1ATR2 TEX2_MOUSE 13716_1 sequence 2 protein
PML isoform 1 Q60953 PML_MOUSE [Mus musculus]
PML isoform 1 Q60953 PML_MOUSE [Mus musculus]
PML isoform 1 Q60953 PML_MOUSE [Mus musculus]
Interferon-induced, Q03963 E2AK2_MOUSE double-stranded RNA-activated protein kinase (Interferon-PML isoform 1 Q60953 PML_MOUSE [Mus musculus]
A kinase (PRKA) IPI00126181.9 Q3UZK5_MOUSE 05253_3 anchor protein 13 [Mus musculus] [MASS=303974] Receptor- P58801 RIPK2_MOUSE interacting serine/threonine protein kinase 2 Mitogen-activated Q8BPM2 M4K5_MOUSE protein kinase kinase kinase kinase 5 (MAPK/ERK kinase Diabetes Page 474 of 603
Transcription Q62318 TIF1B_MOUSE intermediary factor 1-beta (TIF1-beta) (Tripartite motif proteinMicrotubule- 28) (KRAB- E9PWC0 MAP4_MOUSE 01141_3 associated protein 4 (MAP 4)
P51859 HDGF_MOUSE
CLIP-associating Q80TV8 CLAP1_MOUSE 09322_1 protein 1 (Cytoplasmic linker- associated protein 1)Rho [MASS=169226] guanine Q80U35 ARHGH_MOUSE 10658_1 nucleotide exchange factor 17 [MASS=221670] Myosin regulatory Q6ZWQ9 Q9D6E6_MOUSE 17619_2 light chain 2, smooth muscle isoform (Myosin RLC)RecName: Q8CGN5 PLIN1_MOUSE 01364_1 Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein;Eukaryotic AltName: Q80XI3 IF4G3_MOUSE translation initiation factor 4 gamma 3 (eIF-4-gamma 3) (eIF-4GSerine/threonine- 3) (eIF4G Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andSerine/threonine- CAM kinase- Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like and CAM kinase- Page 475 of 603 Diabetes
RecName: B9EHJ3 ZO1_MOUSE 03002_2 Full=Tight junction protein ZO-1; AltName: Full=Tight junctionSeptin 2 protein(NEDD5 1; P42208 SEPT2_MOUSE 03297_4 protein)
gamma actin-like P60710 Q9QZ83_MOUSE 18642_1 protein [Mus musculus]
PML isoform 1 Q60953 PML_MOUSE [Mus musculus]
Eukaryotic Q6NZJ6 Q8K0J8_MOUSE 06774_5 translation initiation factor 4 gamma 1 (eIF-4-gamma 1) (eIF-4GRecName: 1) (eIF- Q9CWZ3 RBM8A_MOUSE 05609_1 Full=RNA-binding protein 8A; AltName: Full=RNA- bindingCytosolic motif P47713 Q9DBX5_MOUSE phospholipase A2 (CPLA2) [Includes: Phospholipase A2 (PhosphatidylcholinSAM domain and Q60710 SAMH1_MOUSE HD domain- containing protein 1 (Interferon-gamma inducibleSAM domain protein and Q60710 SAMH1_MOUSE HD domain- containing protein 1 (Interferon-gamma inducible60S acidic protein G3UW69 RLA2_MOUSE 01612_1 ribosomal protein P2 Diabetes Page 476 of 603
Beta-catenin Q02248 CTNB1_MOUSE 00286_3
Interferon-activable P15092 IFI4_MOUSE protein 205-B (Interferon- inducible protein p205-B)Integrator (Ifi-205-B) complex Q6P4S8 INT1_MOUSE subunit 1 (Int1) [MASS=245166]
Integrator complex Q6P4S8 INT1_MOUSE subunit 1 (Int1) [MASS=245166]
Integrator complex Q6P4S8 INT1_MOUSE subunit 1 (Int1) [MASS=245166]
RecName: A2A8V8 SRRM1_MOUSE 10441_1 Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-H-2 CLASS I P01897 HA1L_MOUSE HISTOCOMPATIBI LITY ANTIGEN, ALPHA CHAIN (CLONEProtein PAT1 PH-2D-2) Q3TC46 PATL1_MOUSE 08214_1 homolog 1 (PAT1- like protein 1)
MARCKS-related P28667 MRP_MOUSE 04247_1 protein (Macrophage myristoylated alanine-richSAM domain C and Q60710 SAMH1_MOUSE HD domain- containing protein 1 (Interferon-gamma inducible protein Page 477 of 603 Diabetes
Nol5 protein [Mus Q6DFW4 NOP58_MOUSE musculus] [MASS=60343]
AP-3 complex O54774 AP3D1_MOUSE subunit delta-1 (Adapter-related protein complex 3 subunitAP-3 complex delta-1) O54774 AP3D1_MOUSE subunit delta-1 (Adapter-related protein complex 3 subunitNuclear delta-1)factor 1 B- P97863 Q8BN68_MOUSE type (Nuclear factor 1/B) (NF1-B) (NFI- B) (NF-I/B) (CCAAT- boxDrebrin-like binding protein Q62418 DBNL_MOUSE (SH3 domain- containing protein 7) (Actin-binding proteinTight junction- 1) Q9DCD5 TJAP1_MOUSE associated protein 1 (Tight junction protein 4) (Protein incorporated later E9PWC0 E9PWC0_MOUSE
Uncharacterized Q9DBC3 MTR1_MOUSE protein KIAA0082
Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] Ezrin-radixin- P70441 NHERF_MOUSE moesin binding phosphoprotein 50 (EBP50) (Na(+)/H(+) Diabetes Page 478 of 603
Ezrin-radixin- P70441 NHERF_MOUSE moesin binding phosphoprotein 50 (EBP50) (Na(+)/H(+)Autophagy protein Q8C0J2 APG16_MOUSE 16498_2 16-like (APG16- like)
Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] RecName: Q3TLH4 D3Z3U3_MOUSE Full=BAT2 domain- containing protein 1 [MASS=308902] RecName: Q3TLH4 D3Z3U3_MOUSE Full=BAT2 domain- containing protein 1 [MASS=308902] DNA-binding Q9JKB3 Q68G78_MOUSE protein A (Cold shock domain protein A) (Y-box proteinADP-ribosylation 3) Q99K28 ARFG2_MOUSE 6069 factor GTPase- activating protein 2 (ARF GAP 2) (GTPase-activatingRecName: P25446 TNR6_MOUSE Full=Tumor necrosis factor receptor superfamilyDhx9 protein [Mus O70133-2 DHX9_MOUSE musculus] [MASS=21770]
Serine/threonine- Q8BYC6 TAOK3_MOUSE protein kinase TAO3 (Thousand and one amino acid protein 3) Page 479 of 603 Diabetes
Bcl-2-associated Q8K019 Q3UR37_MOUSE 16544_3 transcription factor 1 (Btf) [MASS=106001] Thyroid hormone Q80VM0 TR150_MOUSE 07543_1 receptor-associated protein 3 (Thyroid hormone receptor- associated250 kDa substrate protein B2RX86 RGPA2_MOUSE 11135_2 of Akt (AS250) [MASS=210287]
250 kDa substrate B2RX86 RGPA2_MOUSE 11135_2 of Akt (AS250) [MASS=210287]
activity and Q80VB6 DCLK1_MOUSE neurotransmitter- induced early gene protein 4 [Mus musculus]AHNAK IPI00553798.2 Q8BRB8_MOUSE nucleoprotein isoform 1 [Mus musculus] [MASS=604249]Hematological and P97825 HN1_MOUSE neurological expressed 1 protein
Pinin O35691 Q3TUQ5_MOUSE [MASS=82435]
Synaptosomal- Q9D3L3 SNP23_MOUSE associated protein 23 (SNAP-23) (Vesicle-membrane fusionacetyl-CoA protein Q9QXG4 Q8BK97_MOUSE synthetase [Mus musculus] Diabetes Page 480 of 603
RecName: Q9R0L6 PCM1_MOUSE Full=Pericentriolar material 1 protein; Short=PCM-1; Short=mPCM-1Ankyrin repeat and Q6ZPS6 B2RX15_MOUSE IBR domain- containing protein 1 [MASS=121875] La-related protein 1 Q6ZQ58 LARP1_MOUSE (La ribonucleoprotein domain family memberVesicle trafficking 1) O08547 SC22B_MOUSE 04939_1 protein SEC22b (SEC22 vesicle trafficking protein- likeReceptor- 1) Q9QZL0 RIPK3_MOUSE interacting serine/threonine protein kinase 3 (RIP-likeE3 ubiquitin-protein protein Q8CFI0 NED4L_MOUSE 05903_1 ligase NEDD4-like protein (Nedd4-2) (NEDD4.2) [MASS=115418]Drebrin-like protein Q62418 DBNL_MOUSE (SH3 domain- containing protein 7) (Actin-binding proteinRecName: 1) O35892 SP100_MOUSE Full=Nuclear autoantigen Sp- 100; AltName: Full=Nuclear60S acidic dot- P47955 RLA1_MOUSE ribosomal protein P1
Microtubule- E9QPW8 E9QPW8_MOUSE associated protein 4 (MAP 4) Page 481 of 603 Diabetes
RecName: Full=E3 P23804 Q3TVL4_MOUSE ubiquitin-protein ligase Mdm2; AltName: Full=DoubleReceptor- minute Q9QZL0 RIPK3_MOUSE interacting serine/threonine protein kinase 3 (RIP-likeProtein protein D3Z3A0 IPP2_MOUSE phosphatase inhibitor 2 (IPP-2)
E3 ubiquitin-protein P46935 NEDD4_MOUSE ligase Nedd-4
Myeloid leukemia Q99KX1 MLF2_MOUSE 03238_1 factor 2 (Myelodysplasia- myeloid leukemia factorMyeloid 2) leukemia Q99KX1 MLF2_MOUSE 03238_1 factor 2 (Myelodysplasia- myeloid leukemia factorVimentin 2) P20152 VIME_MOUSE
AHNAK IPI00553798.2 Q8BRB8_MOUSE nucleoprotein isoform 1 [Mus musculus] [MASS=604249]AI849286 protein Q6PFD9 Q6PFD9_MOUSE [Mus musculus] [MASS=136359]
Tyrosine-protein Q62120 JAK2_MOUSE kinase JAK2 (Janus kinase 2) (JAK-2) [MASS=130234] Diabetes Page 482 of 603
RecName: A6H619 Q3TPE7_MOUSE Full=PHD and RING finger domain-containing proteinPolymerase 1 I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] Tripartite motif Q8C0E3 TRI47_MOUSE protein 47 [MASS=69912]
RecName: A2A8V8 SRRM1_MOUSE 10441_1 Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-RecName: Full=6- P12382 Q8VDX7_MOUSE phosphofructokinas e, liver type; AltName: Full=Phosphofructo-calcium/calmodulin- O70589-3 CSKP_MOUSE dependent serine protein kinase (MAGUK family) [Muscalcium/calmodulin- musculus] O70589-3 CSKP_MOUSE dependent serine protein kinase (MAGUK family) [MusPITSLRE musculus] P24788 CD2L1_MOUSE 08909_8 serine/threonine- protein kinase CDC2L1 (GalactosyltransferRecName: Q9Z1E4 GYS3_MOUSE Full=Glycogen [starch] synthase, muscle Page 483 of 603 Diabetes
RecName: Q9Z1E4 GYS3_MOUSE Full=Glycogen [starch] synthase, muscle Zinc finger Ran- Q9R020 ZRAB2_MOUSE 9185 binding domain- containing protein 2 (Zinc finger protein 265)Paralemmin (Zinc finger, Q9Z0P4 PALM_MOUSE
AHNAK [Mus IPI00553798.2 musculus] [MASS=68761]
RecName: E9Q3P6 Q7TNL7_MOUSE 04125_1 Full=Dual specificity protein phosphatase 7 RecName: Q9JID9 SH2B2_MOUSE Full=SH2B adapter protein 2; AltName: Full=Adapter proteinVimentin with P20152 VIME_MOUSE
Protein DEK Q7TNV0 Q3UR53_MOUSE
Thyroid hormone Q569Z6 TR150_MOUSE receptor-associated protein 3 (Thyroid hormone receptor- associatedRecName: protein E9Q3P6 Q7TNL7_MOUSE 04125_1 Full=Dual specificity protein phosphatase 7 Diabetes Page 484 of 603
Patatin-like Q8BJ56 PLPL2_MOUSE 11443_1 phospholipase domain-containing protein 2 (Adipose Guaninetriglyceride nucleotide- lipase) Q9DAS9 GBG12_MOUSE 13592_1 binding protein G(I)/G(S)/G(O) gamma-12 subunit RecName: Q8CGN5 PLIN_MOUSE 01364_1 Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein;RecName: AltName: Q9DBR7 MYPT1_MOUSE 03606_1 Full=Protein phosphatase 1 regulatory subunit 12A;RecName: AltName: Q9DBR7 MYPT1_MOUSE 03606_1 Full=Protein phosphatase 1 regulatory subunit 12A;plectin AltName: isoform plec Q9QXS1-3 PLEC_MOUSE 03180_4 1a [Mus musculus]
RecName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A;Eukaryotic AltName: Q8BGD9 IF4B_MOUSE 04892_1 translation initiation factor 4B (eIF-4B)
Microtubule- E9PWC0 MAP4_MOUSE associated protein 4 (MAP 4)
Vasodilator- P70460 VASP_MOUSE stimulated phosphoprotein (VASP) Page 485 of 603 Diabetes
Vasodilator- P70460 VASP_MOUSE stimulated phosphoprotein (VASP) Protein-tyrosine P35831 Q80UM4_MOUSE 02513_1 phosphatase, non- receptor type 12 (Protein-tyrosine phosphataseRecName: P19) A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-RecName: Q8CGN5 PLIN_MOUSE Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein;RecName: AltName: Q8CGN5 PLIN_MOUSE Full=Perilipin-1; AltName: Full=Lipid droplet-associated Calcium/calmodulin-protein; AltName: Q6PHZ2 Q8CCM0_MOUSE 09653_4 dependent protein kinase type II delta chain (CaM-kinase IISerine/threonine- delta chain) (CaM Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andSerine/threonine- CAM kinase- Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andEzrin-radixin- CAM kinase- P70441 NHERF_MOUSE moesin binding phosphoprotein 50 (EBP50) (Na(+)/H(+)Charged Q8BJF9 CHM2B_MOUSE 13174_1 multivesicular body protein 2b (Chromatin- modifying protein Diabetes Page 486 of 603
Palladin Q9ET54 Q8C306_MOUSE 09731_1 [MASS=152130]
5'-3' Q9DBR1 XRN2_MOUSE 10309_1 exoribonuclease 2 (Dhm1 protein)
Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] PC4 and SFRS1- Q99JF8 PSIP1_MOUSE 04688_2 interacting protein (Lens epithelium- derived growth factor)PC4 and (mLEDGF) SFRS1- Q99JF8 PSIP1_MOUSE 04688_2 interacting protein (Lens epithelium- derived growth factor)FACT complex(mLEDGF) Q08943 SSRP1_MOUSE subunit SSRP1 (Facilitates chromatin transcriptionRecName: Q52KR6 Q52KR6_MOUSE 05191_1 Full=Apoptotic chromatin condensation inducerAHNAK in[Mus the IPI00553798.2 14684_2 musculus] [MASS=68761]
DnaJ homolog P60904 DNJC5_MOUSE 08539_1 subfamily C member 5 (Cysteine string protein)DnaJ homolog (CSP) P60904 DNJC5_MOUSE 08539_1 subfamily C member 5 (Cysteine string protein) (CSP) Page 487 of 603 Diabetes
Ras GTPase- Q60790 RASA3_MOUSE 05537_1 activating protein 3 (GAP1(IP4BP)) (Ins P4-binding protein) (GapIII)NEDD9 interacting Q8VDP3 Q3TX89_MOUSE protein with calponin homology and LIM domains (MoleculeRecName: A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-RecName: A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-PC4 and SFRS1- Q99JF8 PSIP1_MOUSE interacting protein (Lens epithelium- derived growth factor)PC4 and (mLEDGF) SFRS1- Q99JF8 PSIP1_MOUSE interacting protein (Lens epithelium- derived growth factor)PC4 and (mLEDGF) SFRS1- Q99JF8 PSIP1_MOUSE interacting protein (Lens epithelium- derived growth factor)PC4 and (mLEDGF) SFRS1- Q99JF8 PSIP1_MOUSE interacting protein (Lens epithelium- derived growth factor)Oxysterol (mLEDGF) binding Q8CI95 OSR11_MOUSE protein-related protein 11 (OSBP- related protein 11) (ORP-11)Serine/threonine- Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like and CAM kinase- Diabetes Page 488 of 603
RecName: A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-RecName: Full=1- Q9Z1T6 FYV1_MOUSE 17852_3 phosphatidylinositol- 3-phosphate 5- kinase; Short=PhosphatidylHigh mobility group Q6NSP9 Q6NSP9_MOUSE protein HMGI-C (High mobility group AT-hook 2) Thyroid hormone Q569Z6 TR150_MOUSE 07543_1 receptor-associated protein 3 (Thyroid hormone receptor- associatedRecName: protein B2RY56 RBM25_MOUSE 15229_1 Full=RNA-binding protein 25; AltName: Full=RNA- bindingCaspase-8 motif O89110 CASP8_MOUSE precursor
RecName: Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 Lamin-A/C P48678 LMNA_MOUSE
Lamin-A/C P48678 LMNA_MOUSE
RecName: Q61136 PRP4B_MOUSE Full=Serine/threoni ne-protein kinase PRP4 homolog; AltName: Page 489 of 603 Diabetes
Sister chromatid Q4VA53 PDS5B_MOUSE cohesion protein PDS5 homolog B (Androgen-induced proliferationVimentin P20152 VIME_MOUSE
Rab GTPase O35551 RABE1_MOUSE binding effector protein 1 (Rabaptin- 5) (Rabaptin- 5alpha)RecName: Q8CGN5 PLIN_MOUSE 01364_1 Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein;RecName: AltName: Q8CGN5 PLIN_MOUSE 01364_1 Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein;mCG2476 AltName: [Mus IPI00761751.2 Q6A029_MOUSE musculus] [MASS=212836]
mCG2476 [Mus IPI00761751.2 Q6A029_MOUSE musculus] [MASS=212836]
RAB3A-interacting Q68EF0 RAB3I_MOUSE protein (Rabin-3) (SSX2-interacting protein) DNA-(apurinic or P28352 D3Z6R9_MOUSE apyrimidinic site) lyase (AP endonuclease 1) (APEXPleckstrin nuclease) Q8K124 PKHO2_MOUSE homology domain- containing family O member 2 (Pleckstrin Diabetes Page 490 of 603
Pleckstrin Q8K124 PKHO2_MOUSE homology domain- containing family O member 2 (PleckstrinRecName: Q60875 ARHG2_MOUSE 10458_2 Full=Rho guanine nucleotide exchange factor 2; AltName:Protein FAM21 Q6PGL7 FAM21_MOUSE
Guanine nucleotide Q8CI11 GNL3_MOUSE binding protein-like 3 (Nucleolar GTP- binding protein 3) (Nucleostemin)RecName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A;Ubiquitin- AltName: Q9JJZ4 UB2J1_MOUSE conjugating enzyme E2 J1 (Non- canonical ubiquitin mRNAconjugating cap guanine- Q9D0L8 MCES_MOUSE N7 methyltransferase (mRNA (guanine- N(7)-)-WD-repeat protein Q3UWE6 Q3UWE6_MOUSE 20
Glucosamine-- P47856 GFPT1_MOUSE 00702_1 fructose-6- phosphate aminotransferase [isomerizing]Nardilysin 1 Q8BHG1 NRDC_MOUSE 04036_1 precursor (N- arginine dibasic convertase) (NRD convertase) (NRD- Page 491 of 603 Diabetes
Signal-induced Q4VBF8 SI1L1_MOUSE 11559_1 proliferation- associated 1 like protein 1 [MASS=197030]Heterogeneous Q921F4 Q3UXJ3_MOUSE nuclear ribonucleoprotein L- like [MASS=64124] Myc box dependent Q6P1B9 Q6P1B9_MOUSE interacting protein 1 (Bridging integrator 1) (Amphiphysin- Myclike protein) box dependent Q6P1B9 Q6P1B9_MOUSE interacting protein 1 (Bridging integrator 1) (Amphiphysin- likeSerine/threonine- protein) Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andSerine/threonine- CAM kinase- Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andSerine/threonine- CAM kinase- Q80VB6 Q9JLM7_MOUSE 09202_1 protein kinase DCAMKL1 (Doublecortin-like andRecName: CAM kinase- Q64012 RALY_MOUSE Full=RNA-binding protein Raly; AltName: Full=Maternally-RecName: Q64012 RALY_MOUSE Full=RNA-binding protein Raly; AltName: Full=Maternally-SAFB-like Q8CH25 SLTM_MOUSE transcription modulator (SAF-like transcription modulator) Diabetes Page 492 of 603
Calmodulin- Q8C1B1 CAMP2_MOUSE regulated spectrin- associated protein 1-like protein 1 Vigilin[MASS=164331] (High density Q8VDJ3 VIGLN_MOUSE lipoprotein-binding protein) (HDL- binding protein) [MASS=141742]Zinc finger Ran- Q9R020 ZRAB2_MOUSE 9185 binding domain- containing protein 2 (Zinc finger protein 265)AHNAK (Zinc finger, IPI00553798.2 Q8BRB8_MOUSE nucleoprotein isoform 1 [Mus musculus] [MASS=604249]AHNAK IPI00553798.2 Q8BRB8_MOUSE nucleoprotein isoform 1 [Mus musculus] [MASS=604249]Ubiquinone Q8K1Z0 COQ9_MOUSE biosynthesis protein COQ9, mitochondrial precursorHeterogeneous O35479 Q91VM5_MOUSE nuclear ribonucleoprotein G (hnRNP G) (RNA bindingSmall acidic motif protein Q9R0P4 SMAP_MOUSE 18069_1 (Sid 2057)
Eukaryotic Q8R1B4 EIF3C_MOUSE 04889_2 translation initiation factor 3 subunit C (eIF3c) (Eukaryotic translationSmall glutamine- initiation Q8BJU0 SGTA_MOUSE rich tetratricopeptide repeat-containing protein A Page 493 of 603 Diabetes
RecName: P46938 YAP1_MOUSE 9424 Full=Yorkie homolog; AltName: Full=65 kDa Yes- associatedNol5 protein protein; [Mus Q6DFW4 NOP58_MOUSE musculus] [MASS=60343]
PITSLRE P24788 CDK11_MOUSE 08909_8 serine/threonine- protein kinase CDC2L1 (GalactosyltransferPITSLRE P24788 CDK11_MOUSE 08909_8 serine/threonine- protein kinase CDC2L1 (GalactosyltransferMicrotubule- Q9QYR6 MAP1A_MOUSE 02549_1 associated protein 1A (MAP 1A)
Vimentin P20152 VIME_MOUSE
Cell division cycle 2- Q14AX6 CDK12_MOUSE related protein kinase 7 (CDC2- related protein kinaseE3 ubiquitin-protein 7) (Cdc2- A2AN08 UBR4_MOUSE 10184_1 ligase UBR4 (N- recognin-4) (Zinc finger UBR1-type proteinE3 ubiquitin-protein 1) (p600) A2AN08 UBR4_MOUSE 10184_1 ligase UBR4 (N- recognin-4) (Zinc finger UBR1-type proteinHeterogeneous 1) (p600) Q60668 HNRPD_MOUSE 03206_3 nuclear ribonucleoprotein D0 (hnRNP D0) (AU-rich element Diabetes Page 494 of 603
AHNAK IPI00553798.2 Q8BRB8_MOUSE nucleoprotein isoform 1 [Mus musculus] [MASS=604249]KN motif and Q8BX02 KANK2_MOUSE 13865_1 ankyrin repeat domain-containing protein 2 (Ankyrin repeatSEC16 domain- homolog A A2AIX1 A2AIX1_MOUSE (S. cerevisiae) [Mus musculus] [MASS=256471] Lamin-A/C P48678 LMNA_MOUSE 01035_4
Lamin-A/C P48678 LMNA_MOUSE 01035_4
Supervillin Q8K4L2 SVIL_MOUSE (Archvillin) (p205/p250) [MASS=243160] Transcription P10711 TCEA1_MOUSE elongation factor A protein 1 (Transcription elongationZinc finger factorCCCH S- IPI00515528.3 B9EHN9_MOUSE type containing 13 [Mus musculus] [MASS=203825] Ubiquitin carboxyl- E9QLK0 E9QLK0_MOUSE 3950 terminal hydrolase 7 (Ubiquitin thioesterase 7) (Ubiquitin-specific-RecName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A; AltName: Page 495 of 603 Diabetes
N(2),N(2)- Q3TX08 TRM1_MOUSE dimethylguanosine tRNA methyltransferase (tRNA(guanine-Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] acinusL protein B8JJ89 B8JJ89_MOUSE [Mus musculus]
Hormone-sensitive P54310 Q8CDI9_MOUSE lipase (HSL)
RecName: Q99KG3 RBM10_MOUSE 02095_2 Full=RNA-binding protein 10; AltName: Full=RNA- bindingRecName: motif A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-Lamin-A/C P48678 LMNA_MOUSE 01035_4
Insulin-like growth Q9CPN8 IF2B3_MOUSE factor 2 mRNA- binding protein 3 (IGF2 mRNA- bindingRNA-binding protein 3) Q6NZN0 RBM26_MOUSE 12611_1 protein 26 (RNA- binding motif protein 26) [MASS=114142]D(1B) dopamine Q8BLD9 DRD5_MOUSE 00542_1 receptor (D(5) dopamine receptor) Diabetes Page 496 of 603
Eukaryotic Q8JZQ9 EIF3B_MOUSE translation initiation factor 3 subunit B (Eukaryotic translationApolipoprotein initiation A-I- Q8K4Z3 AIBP_MOUSE binding protein precursor (AI-BP)
6330577E15Rik Q8BP27 Q3TH62_MOUSE protein [Mus musculus]
6330577E15Rik Q8BP27 Q3TH62_MOUSE protein [Mus musculus]
Formin-like protein A2APV2 FMNL2_MOUSE 13545_4 2 (Protein Man) [MASS=123100]
High mobility group P52927 HMGIC_MOUSE protein HMGI-C (High mobility group AT-hook 2) Lamin-A/C P48678 LMNA_MOUSE 01035_4
Lamin-A/C P48678 LMNA_MOUSE 01035_4
Arginine/serine-rich P62996 TRA2A_MOUSE 04097_1 splicing factor 10 (Transformer-2- beta) (HTRA2-beta) (TransformerRecName: 2 Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 Page 497 of 603 Diabetes
Glycylpeptide N- O70310 NMT1_MOUSE tetradecanoyltransf erase 1 (Peptide N- myristoyltransferas eZinc 1) (Myristoyl-finger CCCH Q0P678 ZCH18_MOUSE 11232_1 domain-containing protein 18 (Nuclear protein NHN1) acinusL protein Q52KR6 Q52KR6_MOUSE [Mus musculus]
Polymerase I and O54724 PTRF_MOUSE transcript release factor [MASS=43953] RecName: Q9Z1E4 GYS3_MOUSE Full=Glycogen [starch] synthase, muscle RecName: Q9Z1E4 GYS3_MOUSE Full=Glycogen [starch] synthase, muscle Protein FAM82C A3KGH5 RMD3_MOUSE
Eukaryotic Q9Z1D1 IF34_MOUSE translation initiation factor 3 subunit 4 (eIF-3 delta) (eIF3 p44)Eukaryotic (eIF-3 RNA- Q9Z1D1 IF34_MOUSE translation initiation factor 3 subunit 4 (eIF-3 delta) (eIF3 p44)RecName: (eIF-3 RNA- Q9Z0F8 Q3UNK7_MOUSE 04703_1 Full=Disintegrin and metalloproteinase domain-containing Diabetes Page 498 of 603
Bcl-2-associated Q8K019 Q3UR37_MOUSE 16544_3 transcription factor 1 (Btf) [MASS=106001] RecName: Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 RecName: Q9Z277 BAZ1B_MOUSE 10416_3 Full=Tyrosine- protein kinase BAZ1B; AltName: Full=BromodomainBCL2-like protein P59017 Q3TNR7_MOUSE 13 (Mil1 protein) (Bcl-rambo)
Tetratricopeptide A6H6N9 TTC14_MOUSE 15579_2 repeat protein 14 (TPR repeat protein 14) [MASS=86792] Scaffold D3YXK2 SAFB2_MOUSE attachment factor B2 [MASS=111838]
Bcl-2-associated Q8K019 Q3UR37_MOUSE transcription factor 1 (Btf) [MASS=106001] RecName: A2A8V8 SRRM1_MOUSE 10441_1 Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-Heat shock protein Q71LX8 Q71LX8_MOUSE 11811_1 HSP 90-beta (HSP 84) (Tumor specific transplantation 84 kDaRecName: antigen) Q8CGN5 PLIN_MOUSE Full=Perilipin-1; AltName: Full=Lipid droplet-associated protein; AltName: Page 499 of 603 Diabetes
Beta-2-syntrophin B7ZNU9 SNTB2_MOUSE (59 kDa dystrophin- associated protein A1, basic componentElongation factor2) 1- O70251 EF1B_MOUSE 19235_1 beta (EF-1-beta)
Aladin (Adracalin) P58742 AAAS_MOUSE 05646_1
Arginine/serine-rich P62996 TRA2A_MOUSE 04097_1 splicing factor 10 (Transformer-2- beta) (HTRA2-beta) kinesin(Transformer light chain 2 2 Q91YS4 Q91YS4_MOUSE 13917_1 [Mus musculus] [MASS=68419]
ATP-binding Q6P542 Q5RL55_MOUSE cassette, sub- family F, member 1 [MASS=94945] Nuclease sensitive P62960 YBOX1_MOUSE 1095 element binding protein 1 (Y box binding protein-1) (Y-boxHigh mobility transcription group P52927 HMGIC_MOUSE protein HMGI-C (High mobility group AT-hook 2) High mobility group P52927 HMGIC_MOUSE protein HMGI-C (High mobility group AT-hook 2) Arsenite-resistance Q99MR6 SRRT_MOUSE 10665_1 protein 2 Diabetes Page 500 of 603
Pinin O35691 Q3TUQ5_MOUSE [MASS=82435]
Heat shock protein Q71LX8 Q71LX8_MOUSE 06763_1 HSP 90-beta (HSP 84) (Tumor specific transplantation 84 kDaSAM antigen) and SH3 P59808 SASH1_MOUSE domains containing protein 1
SAM and SH3 P59808 SASH1_MOUSE domains containing protein 1
RecName: Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 ATP-binding Q6P542 Q5RL55_MOUSE cassette, sub- family F, member 1 [MASS=94945] Splicing factor, Q62093 SRSF2_MOUSE 02888_1 arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (SplicingRecName: A2A8V8 SRRM1_MOUSE 10441_1 Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-Pinin O35691 Q3TUQ5_MOUSE 04401_2 [MASS=82435]
Nuclear ubiquitous Q80XU3 NUCKS_MOUSE 11406_1 casein and cyclin- dependent kinases substrate (JC7) Page 501 of 603 Diabetes
Heterogeneous Q9Z204 Q3U6P5_MOUSE nuclear ribonucleoproteins C1/C2 (hnRNP C1 / hnRNPHeterogeneous C2) Q9Z204 Q3U6P5_MOUSE nuclear ribonucleoproteins C1/C2 (hnRNP C1 / hnRNPMelanoma C2) Q8BI84 MIA3_MOUSE inhibitory activity protein 3 precursor (Protein TANGO) [MASS=213673]Melanoma Q8BI84 MIA3_MOUSE inhibitory activity protein 3 precursor (Protein TANGO) [MASS=213673]Melanoma Q8BI84 MIA3_MOUSE inhibitory activity protein 3 precursor (Protein TANGO) [MASS=213673]vacuolar proton- Q9JHF5 Q91W06_MOUSE translocating ATPase 100 kDa subunit isoform a3 [MusEH domain-binding musculus] Q99MS7 EH1L1_MOUSE protein 1-like protein 1 (Tangerin)
Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] Cordon-bleu B1AZ14 COBL1_MOUSE protein-like 1 (Cobl- related protein 1) [MASS=137381] Splicing factor, Q8BL97 SRSF7_MOUSE arginine/serine-rich 7 Diabetes Page 502 of 603
Eukaryotic Q8JZQ9 EIF3B_MOUSE translation initiation factor 3 subunit B (Eukaryotic translationBcl-2-associated initiation Q8K019 Q3UR37_MOUSE transcription factor 1 (Btf) [MASS=106001] Tensin-like C1 Q8CGB6 TENC1_MOUSE domain-containing phosphatase (C1 domain-containing phosphataseRecName: and Q8VDD5 MYH9_MOUSE Full=Myosin-9; AltName: Full=Myosin heavy chainAHNAK 9; [MusAltName: IPI00553798.2 musculus] [MASS=68761]
Pre-mRNA 3'-end- Q9D824 D3Z619_MOUSE 09646_1 processing factor FIP1 (FIP1-like 1)
Pre-mRNA 3'-end- Q9D824 D3Z619_MOUSE 09646_1 processing factor FIP1 (FIP1-like 1)
Pre-mRNA 3'-end- Q9D824 D3Z619_MOUSE 09646_1 processing factor FIP1 (FIP1-like 1)
Heterogeneous Q60668 HNRPD_MOUSE 03206_3 nuclear ribonucleoprotein D0 (hnRNP D0) (AU-richcalcium/calmodulin- element O70589-3 CSKP_MOUSE dependent serine protein kinase (MAGUK family) [Mus musculus] Page 503 of 603 Diabetes
Ankyrin repeat Q8C0J6 ANR57_MOUSE domain-containing protein 57 [MASS=54938] Importin alpha-3 O35344 Q9CT07_MOUSE 03536_1 subunit (Karyopherin alpha- 3 subunit) (Importin alphaProtein Q2) KRI1 Q8VDQ9 KRI1_MOUSE homolog [MASS=82601]
Kinesin light chain O88448 Q91YS4_MOUSE 13917_1 2 (KLC 2)
Eukaryotic Q9Z1D1 IF34_MOUSE translation initiation factor 3 subunit 4 (eIF-3 delta) (eIF3 p44)RecName: (eIF-3 RNA- Q8BTI8 SRRM2_MOUSE 06913_1 Full=Serine/arginin e repetitive matrix protein 2 Ras-related GTP- Q99K70 RRAGC_MOUSE 12199_1 binding protein C (Rag C) (GTPase- interacting protein 2)Bcl-2-associated (TIB929) Q8K019 Q3UR37_MOUSE 16544_3 transcription factor 1 (Btf) [MASS=106001] Tln2 protein [Mus IPI00229647.5 Q8CHG4_MOUSE 09555_1 musculus] [MASS=186688]
Splicing factor, Q62093 SRSF2_MOUSE 02888_1 arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing Diabetes Page 504 of 603
40S ribosomal P63276 RS17_MOUSE 18936_1 protein S17 acetyl-CoA Q9QXG4 Q8BK97_MOUSE synthetase [Mus musculus]
AHNAK [Mus IPI00553798.2 musculus] [MASS=68761]
Lamin-A/C P48678 LAMA_MOUSE 01035_3
Lamin-A/C P48678 LAMA_MOUSE 01035_3
Bcl-2-associated Q8K019 Q3UR37_MOUSE 16544_3 transcription factor 1 (Btf) [MASS=106001] 6330577E15Rik Q8BP27 Q3TH62_MOUSE protein [Mus musculus]
RecName: Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 RecName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A;RecName: AltName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A; AltName: Page 505 of 603 Diabetes
Protein FAM54B Q9CWE0 D6RCX5_MOUSE 14248_1
E3 ubiquitin-protein A2AN08 UBR4_MOUSE 10184_1 ligase UBR4 (N- recognin-4) (Zinc finger UBR1-type proteinRecName: 1) (p600) A2A8V8 SRRM1_MOUSE 10441_1 Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-Sodium/hydrogen Q7TSV2 SL9A1_MOUSE exchanger 1 (Na(+)/H(+) exchanger 1) (NHE- 1)High mobility group P52927 HMGIC_MOUSE protein HMGI-C (High mobility group AT-hook 2) Protein FAM54B Q9CWE0 FA54B_MOUSE 14248_1
Heat shock protein P07901 HS90A_MOUSE HSP 90-alpha (HSP 86) (Tumor specific transplantationTuberin (Tuberous 86 Q61037 TSC2_MOUSE sclerosis 2 homolog protein)
SKD1 protein P46467 VPS4B_MOUSE (Vacuolar sorting protein 4b)
RecName: Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 Diabetes Page 506 of 603
Transcription Q62318 TIF1B_MOUSE intermediary factor 1-beta (TIF1-beta) (Tripartite motif proteinRecName: 28) (KRAB- Q05D44 IF2P_MOUSE Full=Eukaryotic translation initiation factor 5B; Short=eIF-5B;Heterogeneous O35737 Q8C2Q7_MOUSE 03022_2 nuclear ribonucleoprotein H' (hnRNP H') Heterogeneous O35737 Q8C2Q7_MOUSE 03022_2 nuclear ribonucleoprotein H' (hnRNP H') Heterogeneous Q00PI9 HNRL2_MOUSE nuclear ribonucleoprotein U- like protein 2 (MLF1- associatedRecName: nuclear Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 Brain-specific B1AZ46 BAIP2_MOUSE 05686_3 angiogenesis inhibitor 1- associated protein 2Brain-specific (BAI1-associated B1AZ46 BAIP2_MOUSE 05686_3 angiogenesis inhibitor 1- associated protein 2papillary (BAI1-associated renal cell Q9EQC8 Q9EQC8_MOUSE carcinoma- associated protein [Mus musculus] Microtubule- Q9QYR6 MAP1A_MOUSE associated protein 1A (MAP 1A) Page 507 of 603 Diabetes
RecName: P46938 YAP1_MOUSE 9424 Full=Yorkie homolog; AltName: Full=65 kDa Yes- associatedExocyst complex protein; Q5PPR2 SEC3_MOUSE 07615_3 component Sec3
RecName: A2A8V8 A2A8V9_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-Rho GTPase- A2AH25 RHG01_MOUSE activating protein 1 (Rho-type GTPase- activating protein 1) CLIP-associating Q80TV8 CLAP1_MOUSE 09322_1 protein 1 (Cytoplasmic linker- associated protein 1)RecName: [MASS=169226] Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 28 kDa heat- and Q3UHX2 HAP28_MOUSE acid-stable phosphoprotein (PDGF-associated protein)28 kDa heat-(PAP) and Q3UHX2 HAP28_MOUSE acid-stable phosphoprotein (PDGF-associated protein)Glycogen (PAP) synthase Q9WV60 GSK3B_MOUSE 06002_1 kinase-3 beta (GSK- 3 beta)
Pleckstrin Q6PDH0 PHLB1_MOUSE 15128_1 homology-like domain family B member 1 (Protein LL5-alpha) Diabetes Page 508 of 603
RecName: Q61687 ATRX_MOUSE Full=Transcriptional regulator ATRX; AltName: Full=ATP- dependent182 kDa tankyrase helicase P58871 TB182_MOUSE 06164_1 1-binding protein [MASS=181824]
RecName: Q61136 PRP4B_MOUSE 09087_2 Full=Serine/threoni ne-protein kinase PRP4 homolog; AltName:Ras-related GTP- Q99K70 RRAGC_MOUSE 12199_1 binding protein C (Rag C) (GTPase- interacting protein 2)RecName: (TIB929) Q8BTI8 SRRM2_MOUSE Full=Serine/arginin e repetitive matrix protein 2 Cholinephosphate P49586 PCY1A_MOUSE 00438_1 cytidylyltransferase A (Phosphorylcholine transferaseHepatoma-derived A) P51859 HDGF_MOUSE growth factor (HDGF)
Hepatoma-derived P51859 HDGF_MOUSE growth factor (HDGF)
Hepatoma-derived P51859 HDGF_MOUSE growth factor (HDGF)
Protein transport Q3UPL0 SC31A_MOUSE protein Sec31A (SEC31-related protein A) (SEC31- like 1) Page 509 of 603 Diabetes
Protein transport Q3UPL0 SC31A_MOUSE protein Sec31A (SEC31-related protein A) (SEC31- likeUPF0404 1) protein Q9CQ22 CK059_MOUSE C11orf59 homolog
UPF0404 protein Q9CQ22 CK059_MOUSE C11orf59 homolog
UPF0404 protein Q9CQ22 CK059_MOUSE C11orf59 homolog
Intersectin 1 (EH Q9Z0R4 Q3TUF4_MOUSE 03898_2 and SH3 domains protein 1)
Intersectin 1 (EH Q9Z0R4 Q3TUF4_MOUSE 03898_2 and SH3 domains protein 1)
Heat shock protein P07901 HS90A_MOUSE HSP 90-alpha (HSP 86) (Tumor specific transplantationRecName: 86 Q61136 PRP4B_MOUSE 09087_2 Full=Serine/threoni ne-protein kinase PRP4 homolog; mRNAAltName: cap guanine- Q9D0L8 MCES_MOUSE N7 methyltransferase (mRNA (guanine- N(7)-)-cytoskeletal protein IPI00353420.7 O08614_MOUSE [Mus musculus] Diabetes Page 510 of 603
nucleolar and IPI00719871.1 Q3TKZ9_MOUSE coiled-body phosphoprotein 1, isoform CRA_c [MusBeta-2-syntrophin musculus] B7ZNU9 SNTB2_MOUSE 02491_2 (59 kDa dystrophin- associated protein A1, basic componentCytoskeleton-like 2) Q921C5 D3Z390_MOUSE bicaudal D protein homolog 2
FUS interacting Q9R0U0 SRS10_MOUSE 05562_2 serine-arginine rich protein 1 (TLS- associated protein withIntersectin Ser-Arg 1 (EH Q6NZJ5 Q6NZJ5_MOUSE and SH3 domains protein 1)
Intersectin 1 (EH Q6NZJ5 Q6NZJ5_MOUSE and SH3 domains protein 1)
Thyroid hormone Q569Z6 TR150_MOUSE receptor-associated protein 3 (Thyroid hormone receptor- associatedRho guanine protein Q9ES28 ARHG7_MOUSE 05688_2 nucleotide exchange factor 7 (PAK-interacting exchangeAHNAK [Mus factor IPI00553798.2 14684_2 musculus] [MASS=68761]
AHNAK [Mus IPI00553798.2 14684_2 musculus] [MASS=68761] Page 511 of 603 Diabetes
AHNAK [Mus IPI00553798.2 14684_2 musculus] [MASS=68761]
HIV Tat-specific Q8BGC0 HTSF1_MOUSE 02282_1 factor 1 homolog
Synapse Q9D5V6 SYAP1_MOUSE 06733_1 associated protein 1
B-Raf proto- P28028 BRAF1_MOUSE 01264_1 oncogene serine/threonine- protein kinase Cad protein [Mus B7ZN27 Q80VF8_MOUSE 06437_1 musculus] [MASS=235849]
RecName: A2A8V8 SRRM1_MOUSE Full=Serine/arginin e repetitive matrix protein 1; AltName: Full=Plenty-of-activating signal Q6P4T2 Q8BYH6_MOUSE 03391_1 cointegrator 1 complex subunit 3- like 1 [Mus musculus]Rab GTPase O35551 RABE1_MOUSE binding effector protein 1 (Rabaptin- 5) (Rabaptin- 5alpha)RecName: Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A;General AltName: vesicular Q9Z1Z0 USO1_MOUSE transport factor p115 (Protein USO1 homolog) (Transcytosis- Diabetes Page 512 of 603
RecName: Q9QX47 SON_MOUSE Full=Protein SON; AltName: Full=Negative regulatoryRecName: element- P46938 YAP1_MOUSE 9424 Full=Yorkie homolog; AltName: Full=65 kDa Yes- associatedRecName: protein; P46938 YAP1_MOUSE 9424 Full=Yorkie homolog; AltName: Full=65 kDa Yes- associatedacetyl-CoA protein; Q9QXG4 Q8BK97_MOUSE synthetase [Mus musculus]
Secreted frizzled- P97299 SFRP2_MOUSE 16041_1 related protein 2 precursor (sFRP-2) (Secreted apoptosis40S ribosomal related Q9JJN0 RS6_MOUSE 04913_1 protein S6 (Phosphoprotein NP33) 40S ribosomal Q9JJN0 RS6_MOUSE 04913_1 protein S6 (Phosphoprotein NP33) RecName: E9PV45 E9PV45_MOUSE 11664 Full=Ubiquitin carboxyl-terminal hydrolase 24 RecName: E9PV45 E9PV45_MOUSE 11664 Full=Ubiquitin carboxyl-terminal hydrolase 24 RNA-binding region Q8VH51 RNPC2_MOUSE 09201_3 containing protein 2 (Coactivator of activating protein-1 and estrogen Page 513 of 603 Diabetes
Intersectin 1 (EH Q6NZJ5 Q6NZJ5_MOUSE and SH3 domains protein 1)
Telomerase- Q9R0Q7 TEBP_MOUSE 6138 binding protein p23 (Hsp90 co- chaperone) (ProgesteroneMicrotubule- Q9QYR6 MAP1A_MOUSE associated protein 1A (MAP 1A)
40S ribosomal D3Z6N6 RS6_MOUSE 01592_1 protein S6 (Phosphoprotein NP33) Heat shock protein P07901 HS90A_MOUSE HSP 90-alpha (HSP 86) (Tumor specific transplantationRecName: 86 E9PV45 E9PV45_MOUSE 11664 Full=Ubiquitin carboxyl-terminal hydrolase 24 Proline-rich AKT1 Q9D1F4 AKTS1_MOUSE substrate 1 (Proline- rich AKT substrate)
Histone D3YYI8 HDAC1_MOUSE deacetylase 1 (HD1)
Ras-GTPase- P97855 Q3UR88_MOUSE activating protein binding protein 1 (GAP SH3-domain bindingSET protein protein 1) Q9EQU5 SET_MOUSE (Phosphatase 2A inhibitor I2PP2A) (I- 2PP2A) (Template activating factor I) Diabetes Page 514 of 603
Proteasome O70435 PSA3_MOUSE 01463_2 subunit alpha type 3 (Proteasome component C8) (MacropainProteasome subunit O70435 PSA3_MOUSE 01463_2 subunit alpha type 3 (Proteasome component C8) (MacropainacinusL protein subunit B8JJ89 B8JJ89_MOUSE [Mus musculus]
Protein FAM82C A3KGH5 RMD3_MOUSE
RecName: Q921T2 TOIP1_MOUSE Full=Torsin-1A- interacting protein 1; AltName: Full=Lamina-Retrotransposon- Q7TN75 PEG10_MOUSE derived protein PEG10 (Paternally expressed gene 10 protein)A kinase anchor O08715 B1AR25_MOUSE protein 1, mitochondrial precursor (Protein kinasemCG15924, A anchoring Q6NZR5 Q3TW36_MOUSE isoform CRA_a [Mus musculus] [MASS=136654] Pyruvate P35486 ODPA_MOUSE 02420_1 dehydrogenase E1 component alpha subunit, somatic form,Uncharacterized mitochondrial D3Z316 CF203_MOUSE protein C6orf203 homolog Page 515 of 603 Diabetes
Pyruvate P35486 ODPA_MOUSE 02420_1 dehydrogenase E1 component alpha subunit, somatic form,RecName: mitochondrial Q9DBR7 MYPT1_MOUSE Full=Protein phosphatase 1 regulatory subunit 12A;Heterogeneous AltName: Q9Z204 HNRPC_MOUSE nuclear ribonucleoproteins C1/C2 (hnRNP C1 / hnRNPMicrofibrillar- C2) Q9CQU1 MFAP1_MOUSE 02569_1 associated protein 1
Translation Q8CHW4 EI2BE_MOUSE initiation factor eIF- 2B subunit epsilon (eIF-2B GDP-GTP La-relatedexchange factorprotein 7 Q05CL8 LARP7_MOUSE (La ribonucleoprotein domain family memberSTIP1 homology 7) Q9WUD1 STUB1_MOUSE and U box- containing protein 1 (STIP1 homology andCalcium-regulated U-box- Q9CR86 CHSP1_MOUSE 08515_2 heat stable protein 1 (Calcium- regulated heat- stablecAMP-dependent protein of 24 A2AI69 Q8C3Z4_MOUSE 01786_3 protein kinase type I-alpha regulatory subunit Programmed cell P56812 PDCD5_MOUSE death protein 5 (TFAR19 protein) (TF-1 cell apoptosis related gene-19 Diabetes Page 516 of 603
mass error minimum across reversed databse xcorr max across string accession timepoints direction timepoints 375246 1.051834345 F 20.19
383411 0.475261291 F 22.63
370122 0.559566988 F 35.76
378034 0.080788692 F 34.31
374495 0.265690871 F 51.63
374775 0.571011578 F 31.9
386312 0.100665261 F 20.9
381915 1.18521963 F 29.19
379763 1.128383285 F 71.45 Page 517 of 603 Diabetes
377932 0.01873273 F 26.79
378855 0.0916332 F 26.34
379470 0.382637238 F 35.04
379470 0.546187306 F 34.71
379470 0.479487596 F 29.76
373265 1.216744387 F 22.62
379470 1.994805894 F 31.38
0.653324654 F 23.01
378046 0.258408855 F 31.61
380271 0.374207046 F 25.93 Diabetes Page 518 of 603
370352 0.105840991 F 24.13
377095 1.760983653 F 24.2
370274 0.223325126 F 22.4
374249 0.928148997 F 34.85
0.305041362 F 21.19
392092 0.195031517 F 25.98
390074 0.443934146 F 51
389515 1.91942289 F 21.55
380814 0.700907613 F 43.41
380814 0.015389179 F 21.64 Page 519 of 603 Diabetes
376170 0.294400436 F 29.05
374203 0.21483889 F 43.63
375785 0.442577433 F 58.88
379470 0.243832799 F 26.77
380235 0.267112594 F 30.41
379451 0.308742347 F 27.22
385887 0.006563065 F 70.03
383230 0.165673246 F 34.05
383230 0.435631765 F 37.89
389649 0.481838291 F 42.16 Diabetes Page 520 of 603
370549 1.860316962 F 36.37
370703 0.988805743 F 23.97
386405 0.496427037 F 23.59
386405 0.652795351 F 26.21
386405 0.282921111 F 25.62
375402 0.472871155 F 20.57
386217 1.499165933 F 27.96
383395 1.300123098 F 35.45
382208 0.12990117 F 31.87
383230 1.400454924 F 21.61 Page 521 of 603 Diabetes
374089 0.959861017 F 31.51
371766 0.346289781 F 23.08
371766 0.740549268 F 31.42
387336 0.79159515 F 24.5
371900 0.103993562 F 71.78
391148 0.17094228 F 54.82
377095 0.700958795 F 25.75
373236 0.858834121 F 24.72
386496 0.06093994 F 79.72
372022 0.119780855 F 48.39 Diabetes Page 522 of 603
372022 0.049204503 F 30.78
1.364630632 F 28.72
386496 0.268875514 F 21.1
0.462309328 F 41.89
0.214119771 F 30.3
376036 0.052528917 F 24.79
374639 1.138374823 F 59.41
373569 0.026502874 F 26.51
0.094810821 F 71.05
0.017029663 F 59.07 Page 523 of 603 Diabetes
379214 1.096415238 F 29.85
0.232236072 F 56.83
379158 0.742110445 F 28.04
379158 0.183630771 F 24.62
0.845862721 F 32.84
0.173010721 F 46.14
372026 0.652542563 F 78.3
372133 0.416104694 F 43.83
393033 0.563318121 F 56.87
385364 0.439252389 F 53.36 Diabetes Page 524 of 603
378270 0.26874925 F 38.93
378581 0.212570815 F 28.93
0.264821513 F 47.26
374938 0.323377987 F 21.23
0.548696212 F 64.55
0.136949472 F 75.78
371900 0.611947756 F 38.58
384814 0.278055916 F 30.87
387885 0.010359242 F 26.36
377095 0.778176699 F 74.68 Page 525 of 603 Diabetes
371763 0.450180395 F 91.04
0.923983728 F 57.47
383332 0.066518062 F 26.11
376955 1.534949377 F 39.2
376003 0.060311065 F 41.2
376003 0.994362573 F 33.14
374414 1.66699312 F 37.39
0.514565978 F 49.83
385648 0.08174512 F 27.32
384319 0.697555192 F 55.57 Diabetes Page 526 of 603
389655 0.730569302 F 23.23
382871 0.229156134 F 39.79
382871 1.748541832 F 29.9
372038 0.056406773 F 42.09
375402 0.090248933 F 22.59
371806 0.064019301 F 41.98
0.109440191 F 63.86
0.109440191 F 44.32
389776 1.33354785 F 24.9
370159 1.063903105 F 27.63 Page 527 of 603 Diabetes
370159 0.027672788 F 32.32
392976 1.006271213 F 47.2
378507 0.055080414 F 49.42
0.563878471 F 80.49
371649 1.302410338 F 26.59
370295 0.11408386 F 47.67
374414 0.123331212 F 41.83
372292 0.447855783 F 25.03
388931 0.459307052 F 52.27
371649 0.544392348 F 80.47 Diabetes Page 528 of 603
373907 0.015055557 F 44.93
379958 0.174120778 F 24.97
390074 0.056231632 F 59.34
385473 0.599734126 F 67.73
385473 0.39402725 F 21.43
0.036521358 F 57.71
385473 0.425065248 F 76.21
388213 0.108204198 F 45.4
377095 0.419874104 F 48.44
376133 0.613813051 F 37.31 Page 529 of 603 Diabetes
376133 1.165963955 F 21.81
375381 0.109626368 F 32.61
375402 0.236923408 F 26.93
390074 0.488335534 F 54.99
390074 0.257725489 F 24.71
384960 0.623478615 F 46.52
380814 1.781385951 F 43.15
380814 0.709834357 F 29.53
372022 0.2105565 F 110.75
370263 1.012453526 F 37.08 Diabetes Page 530 of 603
376686 0.099310781 F 55.05
374733 0.941967369 F 36.96
386496 0.212484292 F 22.57
375244 0.141182254 F 61.21
375244 0.424878431 F 32.52
374565 1.370025897 F 25.37
372668 1.853738382 F 22.71
0.033955238 F 73.73
391386 0.608729404 F 49.35
391386 0.326309218 F 75.58 Page 531 of 603 Diabetes
376587 0.115982627 F 20.87
371588 0.267358051 F 21.17
375402 1.391434441 F 36.34
375402 0.291106722 F 37.35
375244 0.217158398 F 44.61
375244 1.210876798 F 46.16
375244 0.625049036 F 29.39
375244 0.86485732 F 34.98
378244 0.242204258 F 36.62
380814 0.632586199 F 21.79 Diabetes Page 532 of 603
375402 0.0837705 F 31.96
391348 0.085947004 F 60.11
394387 0.58814919 F 30.34
388931 0.001776954 F 58.69
370803 0.098212837 F 22.86
374092 0.040930324 F 36.92
392144 0.646673807 F 56.25
375038 0.604543824 F 22.42
375038 0.436685555 F 27.7
372307 0.215540054 F 22.34 Page 533 of 603 Diabetes
371162 0.19010212 F 20.01
374414 0.271865293 F 47.15
381442 0.594746763 F 70.81
390074 0.131138212 F 38.99
390074 1.210408786 F 27.96
377998 0.07397867 F 41.63
377998 0.16659771 F 40.43
371750 0.457834094 F 39.03
378986 0.340990033 F 23.53
384160 0.036983617 F 63.55 Diabetes Page 534 of 603
384160 0.643861076 F 63.53
375035 0.230384768 F 22.73
378088 1.073404276 F 80.7
380083 1.090428687 F 23.68
385473 0.190476422 F 45.53
375146 0.024786094 F 24.93
370726 0.202903868 F 31.04
377503 0.754338693 F 33.45
375935 0.658521129 F 40.38
385255 0.103816143 F 38.17 Page 535 of 603 Diabetes
383532 0.222552085 F 49.58
382867 1.049531269 F 47.29
373396 0.308692187 F 49.33
373396 0.947108733 F 23.81
380814 0.75354472 F 46.21
380814 0.450576156 F 46.01
380814 0.20260199 F 32.23
374809 0.33953485 F 30.68
374809 0.667638304 F 27.81
380593 0.464166011 F 33.3 Diabetes Page 536 of 603
378837 0.508625317 F 34.04
385689 0.104939263 F 56.45
392976 0.361273041 F 31.17
0.037116393 F 84.07
1.384575902 F 41.75
376750 0.224168812 F 26.48
380361 0.310662914 F 25.25
376233 0.702984621 F 69.92
376272 0.075307865 F 50.51
370281 0.030462744 F 59.86 Page 537 of 603 Diabetes
385548 0.466793045 F 81.97
374089 0.244778122 F 40.4
389776 0.779054555 F 21.46
389776 0.018639889 F 20.41
0.189765817 F 33.08
374414 0.192975826 F 20.32
370041 0.438187804 F 43.62
379987 0.147180183 F 37.63
379987 0.057220797 F 33.57
386449 1.266275328 F 30.51 Diabetes Page 538 of 603
0.854476254 F 22.6
376947 0.537128281 F 31.91
0.056097871 F 21.22
375038 0.072772488 F 36.4
375038 0.113952493 F 32.44
373337 0.443165312 F 41.5
379751 0.064466608 F 42.07
372585 0.876061691 F 48.87
1.224034792 F 21.85
385473 0.001009656 F 32.78 Page 539 of 603 Diabetes
369868 0.749081443 F 92.31
386496 0.233987591 F 31.33
372668 0.352661426 F 48.93
370042 0.169716363 F 27.43
385223 0.405243131 F 25.05
375402 0.857923474 F 30.61
375038 0.308702046 F 43.82
375883 0.343889784 F 33.53
372643 0.479231741 F 32.2
378265 0.155540841 F 20.42 Diabetes Page 540 of 603
387347 0.244668977 F 71.82
375041 0.014111137 F 54.18
373715 1.13271457 F 47.96
373715 1.471087197 F 24.07
0.128500352 F 29.32
0.241951419 F 64.71
375038 0.790516562 F 20.45
375038 0.045177086 F 24.28
375886 0.150886368 F 39.24
392144 0.686434159 F 35.16 Page 541 of 603 Diabetes
394602 0.150971102 F 44.97
394886 0.069283367 F 76.8
372668 0.529737749 F 65.52
382871 1.398047262 F 26.56
370159 0.574127311 F 21.43
370159 0.574127311 F 100.82
379058 0.151221861 F 82.89
0.205790776 F 28.76
0.000762684 F 22.5
385169 1.094449116 F 44.52 Diabetes Page 542 of 603
379214 0.100011227 F 20.03
392144 0.720551409 F 32.02
369983 0.061988004 F 23.39
370698 0.350497165 F 28.74
374850 0.117235799 F 30.19
377552 0.410277852 F 74.35
379214 0.150258891 F 56.49
375402 0.744599372 F 33.14
373204 0.026538804 F 65.11
390074 0.063190555 F 40.19 Page 543 of 603 Diabetes
377669 0.123865897 F 43.35
374066 0.005082906 F 63.71
379467 0.494556911 F 27.24
375886 0.498396539 F 25.05
373614 0.750279225 F 24.84
377554 0.000364022 F 29.28
388522 0.008940852 F 24.1
0.239506757 F 33.92
1.535990077 F 23.13
379108 0.010087557 F 28.95 Diabetes Page 544 of 603
372133 1.609395863 F 37.03
373204 0.053966648 F 74.94
371036 0.254783226 F 53.74
371036 0.927483636 F 25.3
392144 0.015355546 F 50.04
377554 0.224520634 F 50.1
0.717003485 F 20.87
375402 0.643036439 F 27.25
372133 1.033555562 F 33.68
383895 1.895766399 F 50.66 Page 545 of 603 Diabetes
387360 0.209775804 F 94.1
387360 0.23702257 F 28.93
385819 0.733997417 F 29.61
385819 0.411449334 F 35.01
385819 0.573716557 F 28.97
369843 0.100131525 F 24.97
377765 0.115447734 F 34.46
386496 0.089206735 F 67.93
386496 0.122334596 F 54.72
390866 0.056273096 F 24.5 Diabetes Page 546 of 603
387347 0.197189498 F 44.83
379214 0.552893474 F 24.57
378617 0.277867692 F 20.79
392678 0.234050379 F 49.38
0.11783063 F 60.1
388692 0.100739566 F 54
388692 0.305001435 F 32.63
388692 1.568036847 F 22.19
386449 0.050401812 F 25.36
0.345657477 F 25.91 Page 547 of 603 Diabetes
394572 0.429516794 F 32.53
372546 0.459170995 F 25.46
378263 0.103765465 F 29.55
373614 0.769290487 F 39.16
1.116567552 F 32.55
392144 0.247834804 F 31.24
375320 0.804707016 F 22.57
379214 0.057830694 F 48.69
378739 0.258005728 F 29.17
0.667477784 F 33.21 Diabetes Page 548 of 603
388896 0.374415428 F 61.11
385364 0.643737964 F 41.37
0.460938809 F 25.35
375038 0.043723361 F 86.82
375038 0.415276878 F 106.89
379214 0.380638773 F 22.99
373715 0.07226553 F 20.75
392144 0.120786284 F 31.16
385473 0.092008437 F 44.3
385473 0.04297601 F 65.76 Page 549 of 603 Diabetes
375410 0.050502631 F 28.93
379987 0.268159142 F 22.66
375402 0.35179557 F 23.44
389531 0.004559089 F 41.27
0.692419856 F 49.52
375410 0.234064852 F 59.67
372250 0.130125527 F 38.9
392004 1.427639813 F 21.38
385650 0.39402754 F 59.91
392144 0.133797262 F 20.15 Diabetes Page 550 of 603
370352 0.353917591 F 37.05
385908 0.041341106 F 89.67
387964 0.735521186 F 22.47
387964 0.457859232 F 70.6
386142 0.127581708 F 60.4
392144 0.442070604 F 46.16
373840 0.225772129 F 61.15
373840 0.540220348 F 56.25
370272 1.507699792 F 35.68
0.881100365 F 24.83 Page 551 of 603 Diabetes
385548 0.010790175 F 26.91
379998 1.138386285 F 40.29
0.30749657 F 100.36
385026 0.088777404 F 29.02
374249 0.550815778 F 29.83
392144 0.167990551 F 40.31
375809 0.06979856 F 68.36
375809 0.155209921 F 43.64
372943 0.158942637 F 28.16
378735 0.263747151 F 20.18 Diabetes Page 552 of 603
376488 0.37591284 F 30.45
379763 1.463141264 F 23.09
372307 0.723748292 F 26.13
375320 0.162884147 F 82.54
392144 0.050120144 F 22.61
388568 0.049614031 F 53.04
370274 0.031222899 F 22.28
370274 0.031222899 F 49.03
370274 0.031222899 F 26.41
0.251688296 F 34.25 Page 553 of 603 Diabetes
0.270066171 F 24.35
376325 0.693498968 F 20.88
376325 1.963845967 F 36.58
376325 1.084989897 F 25.7
373009 0.123501926 F 59.43
373009 0.574834201 F 23.36
372250 0.490028274 F 72.94
372307 0.112430468 F 22.98
370726 1.690930464 F 22.9
387656 1.372270093 F 20.54 Diabetes Page 554 of 603
371023 0.062711453 F 37.56
377669 0.132504734 F 30.45
378193 0.251940893 F 40.05
375335 0.247035931 F 23.93
373009 0.059024235 F 57.36
373009 0.355703261 F 48.68
388931 0.491454171 F 69.43
376615 0.266432195 F 33.36
0.195855943 F 41.25
0.563559943 F 48.79 Page 555 of 603 Diabetes
1.302277979 F 21.26
392170 0.035303083 F 28.67
376540 0.675010816 F 23.71
369950 0.069201444 F 51.13
370917 1.117344532 F 44.44
375402 0.036894834 F 29.1
370129 0.432129362 F 75.73
381442 0.209483196 F 54.71
385473 0.094963106 F 34.48
375704 0.357872981 F 33.79 Diabetes Page 556 of 603
373011 0.13836951 F 74.46
385548 0.178949552 F 35.22
385548 0.473974629 F 22.1
385364 0.689913293 F 28.92
374996 0.108452033 F 22.28
375247 0.182396588 F 30.09
375247 0.093813689 F 31.66
375250 0.928896038 F 22.17
375250 0.140790718 F 32.1
374823 0.377078495 F 42.76 Page 557 of 603 Diabetes
373009 0.774214129 F 22.29
377662 0.166867119 F 96.88
384635 0.01702548 F 56.25
375247 0.254164856 F 20.8
372250 1.240855962 F 58.9
0.761318627 F 41.49
380756 0.54170805 F 35.71
388438 0.463858606 F 31.46
371392 0.045434115 F 66.62
386126 0.333962866 F 39.74 Diabetes Page 558 of 603
385508 0.085815068 F 23.11
385508 0.749602515 F 25.22
372668 0.163454596 F 41.62
379058 0.219969552 F 34.94
374288 0.381707597 F 38.43
383052 0.484629713 F 49.24
371358 0.279535883 F 67.44
377408 0.011728755 F 49.45
376517 0.066702324 F 60.72
371575 0.798713585 F 49.35 Page 559 of 603 Diabetes
376517 1.344297398 F 40.57
385473 0.235482849 F 93.11
387360 1.392066934 F 28.15
380687 0.675230823 F 38.45
393041 0.001721885 F 55.1
374985 0.64438084 F 51.05
378465 0.218397223 F 26.03
370652 0.128809564 F 34.98
371954 0.067595013 F 73.35
376141 0.032377787 F 37.07 Diabetes Page 560 of 603
Go location Go bio process Go mol process Kegg unique unique index unqiue index unique index index
intracellular regulation of protein binding NOD-like receptor apoptosis signaling pathway membrane protein amino acid ATP binding phosphorylation nucleus protein amino acid protein binding phosphorylation nucleus immune response protein binding RIG-I-like receptor signaling pathway intracellular multicellular DNA binding integral to organismal RNA binding membrane development protein amino acid membrane signaldephosphorylation transduction protein binding Inositol phosphate phosphatidylinositol metabolism metabolic process Phosphatidylinositol signaling system nucleus regulation of protein binding transcription nucleus regulation of Rab GTPase activator GTPase activity activity Page 561 of 603 Diabetes
integral to sensory perception protein binding membrane of sound binding carbohydrate zinc ion binding metabolic process integral to protein amino acid ATP binding membrane phosphorylation molecular_function signal transduction
nucleus regulation of protein binding Pathways in cancer transcription Acute myeloid leukemia Ubiquitin mediated nucleus regulation of protein binding Pathwaysproteolysis in cancer transcription Acute myeloid leukemia Ubiquitin mediated nucleus regulation of protein binding Pathwaysproteolysis in cancer transcription Acute myeloid leukemia Ubiquitin mediated intracellular protein amino acid protein binding proteolysis phosphorylation
nucleus regulation of protein binding Pathways in cancer transcription Acute myeloid leukemia Ubiquitin mediated nucleus apoptosis protein binding proteolysis intracellular intracellular zinc ion binding signaling cascade
cytoplasm protein amino acid protein binding Neurotrophin phosphorylation signaling pathway NOD-like receptor signaling pathway cytoplasm protein amino acid protein binding phosphorylation Diabetes Page 562 of 603
nucleus protein amino acid protein binding phosphorylation microtubule negative regulation protein binding of microtubule binding depolymerization metal ion binding
cytoplasm cell cycle protein binding integral to G-protein coupled binding membrane receptor protein signaling pathway intracellular actin cytoskeleton guanyl-nucleotide organization exchange factor apoptosis activity myosin complex signal transduction protein binding Cardiac muscle protein complex multicellular calcium ion binding contraction integral to organismal Regulation of actin membrane development cytoskeleton lipidmembrane particle lipidregulation metabolic of protein binding PPARVascular signaling smooth process pathway cytoplasm translation protein binding Viral myocarditis integral to RNA metabolic membrane process nucleus protein amino acid ATP binding integral to plasma phosphorylation protein binding membrane brain development guanyl-nucleotide integral to transport exchange factor nucleusmembrane proteinintracellular amino acid ATPactivity binding integral to plasma phosphorylation protein binding membrane brain development guanyl-nucleotide integral to transport exchange factor membrane intracellular activity Page 563 of 603 Diabetes
nucleus blastocyst protein binding Tight junction membrane formation Epithelial cell cytoplasm cell-cell junction signaling in assembly Helicobacter pylori nucleus cellregulation cycle of protein binding infection
cytoplasm DNA repair protein binding Cardiac muscle membrane muscle contraction contraction cytoskeleton response to Regulation of actin actin cytoskeleton mechanical cytoskeleton nucleuscytosol regulationstimulus of protein binding PathwaysVascular smooth in cancer transcription Acute myeloid leukemia Ubiquitin mediated cytoplasm translation protein binding Viralproteolysis myocarditis RNA metabolic process
nucleus transport nucleotide binding Spliceosome protein binding
nucleus metabolic process calcium ion binding Glycerophospholipi phospholipase A2 d metabolism activity Arachidonic acid phospholipase metabolism nucleus immune response catalyticactivity activity Linoleic acid extracellular space carbohydrate metabolic process
nucleus immune response catalytic activity extracellular space carbohydrate metabolic process
cytoplasm translation protein binding Ribosome intracellular translational structural elongation constituent of ribosome RNA binding Diabetes Page 564 of 603
nucleus regulation of protein binding Wnt signaling transcription, DNA- binding pathway dependent Melanogenesis intracellular Pathways in cancer nucleus regulationsignaling cascade of protein binding Basal cell transcription integral to negative regulation protein binding membrane of apoptosis integral to negative regulation protein binding membrane of apoptosis integral to negative regulation protein binding membrane of apoptosis nucleus mRNA processing DNA binding spliceosomal protein binding complex lysophospholipase activity integral to immune response proteinzinc ion binding binding Autoimmune membrane peptide antigen thyroid disease binding Endocytosis calcium ion binding Natural killer cell cytoplasm response to calciumreceptor ion activity binding RNAmediated degradation membrane wounding protein binding multicellular isomerase activity organismal plasma membrane vesicle-mediateddevelopment calmodulin binding Fc gamma R- transport mediated phagocytosis Leishmania nucleus immune response catalytic activity infection extracellular space carbohydrate metabolic process Page 565 of 603 Diabetes
nucleus ribosome protein binding biogenesis
membrane transport protein binding Lysosome Golgi apparatus protein transport
membrane transport protein binding Lysosome Golgi apparatus protein transport
nucleus regulation of DNA binding transcription, DNA- dependent
cytoplasm immune response protein binding
Golgi apparatus protein amino acid protein binding Tight junction phosphorylation
nucleus methylation protein binding
membrane Wnt receptor protein binding signaling pathway Diabetes Page 566 of 603
membrane Wnt receptor protein binding signaling pathway membrane transport protein binding
nucleus regulation of protein binding Tight junction integral to transcription, DNA- DNA binding membrane dependent membrane transport zinc ion binding Endocytosis cytoplasm regulation of ARF integral to GTPase activity membrane integral to signal transduction protein binding membrane
cytoplasm protein amino acid ATP binding MAPK signaling phosphorylation pathway Page 567 of 603 Diabetes
nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription nucleus regulation of protein binding transcription ATP binding positive regulation of transcription cytoplasm regulationfrom RNA of small GTPase activator intracellular GTPase mediated activity signal transduction binding
cytoplasm regulation of small GTPase activator intracellular GTPase mediated activity signal transduction binding
integral to brain development guanyl-nucleotide membrane intracellular exchange factor integral to plasma signaling cascade activity membrane kinase activity mitochondrion protein amino acid protein binding phosphorylation
nucleus regulation of DNA binding transcription, DNA- metal ion binding dependent immune response nucleus regulation of protein binding cytoplasm transcription neurotransmitter secretion membrane transport protein binding SNARE interactions nucleus apoptosis in vesicular transport
cytoplasm metabolic process ATP binding Glycolysis / nucleus catalytic activity Gluconeogenesis Pyruvate metabolism Propanoate Diabetes Page 568 of 603
cytoplasm centrosome protein binding centriolar satellite organization membrane porphyrin protein binding biosynthetic process
integral to transport hydrolase activity SNARE interactions membrane protein binding in vesicular transport cytoplasm protein amino acid protein binding intracellular phosphorylation ATP binding cytoplasm modification- protein binding Aldosterone- intracellular dependent protein regulated sodium catabolic process reabsorption Endocytosis cytoplasm immune response protein binding Ubiquitin mediated
nucleus oxidation reduction metal ion binding regulation of DNA binding apoptosis positive regulation intracellular translationalof transcription structural Ribosome cytoplasm elongation constituent of ribosome protein binding microtubule negative regulation protein binding of microtubule depolymerization Page 569 of 603 Diabetes
nucleus modification- protein binding Pathways in cancer dependent protein Bladder cancer catabolic process Endocytosis negative regulation Glioma cytoplasm proteinof transcription amino acid protein binding Prostate cancer intracellular phosphorylation ATP binding
nucleus carbohydrate protein binding metabolic process
cytoplasm modification- protein binding Endocytosis dependent protein Ubiquitin mediated catabolic process proteolysis
nucleus defense response protein binding
nucleus defense response protein binding
cytoplasm intermediate protein binding filament-based process
mitochondrion protein amino acid protein binding phosphorylation
nucleus transport peptide binding protein binding microtubule binding
nucleus protein amino acid protein binding Jak-STAT signaling phosphorylation pathway Chemokine signaling pathway Adipocytokine Diabetes Page 570 of 603
nucleus intracellular protein binding signaling cascade protein domain mRNA processing specific binding nucleus regulation of protein binding transcription nucleus regulation of protein binding transcription nucleus acrosome reaction protein binding
nucleus mRNA processing DNA binding spliceosomal protein binding complex lysophospholipase activity cytoplasm carbohydrate ATPzinc ionbinding binding Glycolysis / metabolic process Gluconeogenesis Fructose and mannose integral to protein amino acid protein binding Tightmetabolism junction membrane phosphorylation integral to protein amino acid protein binding Tight junction membrane phosphorylation nucleus protein amino acid protein binding intracellular phosphorylation ATP binding mitochondrion cell division structural constituent of cytoplasm heart development proteinribosome binding Starch and sucrose metabolism Insulin signaling pathway Page 571 of 603 Diabetes
cytoplasm heart development protein binding Starch and sucrose metabolism Insulin signaling pathway nucleus mRNA processing zinc ion binding protein binding
membrane cytoskeleton D3 dopamine organization receptor binding
cytoplasm cell differentiation protein binding MAPK signaling nucleus protein amino acid hydrolase activity pathway endoplasmic dephosphorylation protein tyrosine reticulum phosphatase membrane intracellular proteinactivity binding Insulin signaling cytoplasm signaling cascade pathway Neurotrophin signaling pathway cytoplasm intermediate protein binding filament-based process
nucleus response to protein DNA binding intracellular stimulus histone binding
nucleus regulation of protein binding mediator complex transcription ATP binding transcription from receptor activity RNA polymerase II cytoplasm cellpromoter differentiation protein binding MAPK signaling nucleus protein amino acid hydrolase activity pathway endoplasmic dephosphorylation protein tyrosine reticulum phosphatase activity Diabetes Page 572 of 603
integral to metabolic process hydrolase activity membrane membrane G-protein coupled signal transducer Regulation of actin receptor protein activity cytoskeleton signaling pathway Chemokine signaling pathway lipid particle lipid metabolic protein binding PPARMAPK signalingsignaling process pathway cytoplasm integrin-mediated protein binding Regulation of actin intracellular signaling pathway cytoskeleton membrane- protein amino acid Vascular smooth bounded organelle dephosphorylation muscle contraction cytoplasm integrin-mediated protein binding RegulationFocal adhesion of actin intracellular signaling pathway cytoskeleton membrane- protein amino acid Vascular smooth bounded organelle dephosphorylation muscle contraction perinuclear region response to actin binding Focal adhesion of cytoplasm nutrient cytoplasm integrin-mediated protein binding Regulation of actin intracellular signaling pathway cytoskeleton membrane- protein amino acid Vascular smooth bounded organelle dephosphorylation muscle contraction nucleus translation nucleotide binding mTORFocal adhesion signaling integral to transport translation initiation pathway membrane phagocytosis factor activity cytoskeleton oxidation reduction microtubulecytoplasm negativenucleosome regulation protein binding of microtubule depolymerization membrane actin cytoskeleton protein binding Fc gamma R- organization mediated phagocytosis Focal adhesion Leukocyte Page 573 of 603 Diabetes
membrane actin cytoskeleton protein binding Fc gamma R- organization mediated phagocytosis Focal adhesion cytoplasm protein amino acid protein binding Leukocyte cytosol dephosphorylation
nucleus mRNA processing DNA binding zinc ion binding
lipid particle lipid metabolic protein binding PPAR signaling process pathway
lipid particle lipid metabolic protein binding PPAR signaling process pathway
nucleus protein amino acid protein binding Wnt signaling membrane phosphorylation ATP binding pathway intracellular Melanogenesis Calcium signaling nucleus protein amino acid ATP binding pathway integral to plasma phosphorylation protein binding membrane brain development guanyl-nucleotide integral to transport exchange factor nucleusmembrane proteinintracellular amino acid ATPactivity binding integral to plasma phosphorylation protein binding membrane brain development guanyl-nucleotide integral to transport exchange factor membrane Wntintracellular receptor proteinactivity binding signaling pathway
membrane transport protein domain Endocytosis microsome protein transport specific binding protein binding metal ion binding Diabetes Page 574 of 603
cytoplasm protein amino acid actin binding nucleus phosphorylation protein binding cytoskeleton organization nucleus regulation of protein binding RNA degradation transcription
nucleus regulation of DNA binding transcription nucleus regulation of DNA binding transcription nucleus regulation of DNA binding transcription protein binding transport nucleus apoptosis nucleotide binding Spliceosome nucleolus erythrocyte nucleic acid binding intracellular differentiation response to protein nucleus nervousstimulus system protein binding development membrane protein folding unfolded protein plasma membrane binding membrane protein folding unfolded protein plasma membrane binding Page 575 of 603 Diabetes
membrane signal transduction zinc ion binding MAPK signaling intracellular GTPase activator pathway - fly activity
cytoplasm oxidation reduction protein binding extracellular region proteolysis zinc ion binding
nucleus mRNA processing DNA binding zinc ion binding
nucleus mRNA processing DNA binding zinc ion binding
nucleus regulation of DNA binding transcription
nucleus regulation of DNA binding transcription
nucleus regulation of DNA binding transcription
nucleus regulation of DNA binding transcription
endoplasmic transport protein binding reticulum lumen
integral to plasma protein amino acid protein binding membrane phosphorylation ATP binding nucleus intracellular kinase activity intracellular signaling cascade transferase activity Diabetes Page 576 of 603
nucleus mRNA processing DNA binding zinc ion binding membrane intracellular protein binding Inositol phosphate plasma membrane signaling cascade prenylcysteine metabolism integral to oxidase activity Phosphatidylinositol membrane zinc ion binding signaling system nucleus regulation of proteinkinase activitybinding Endocytosis transcription, DNA- DNA binding dependent nucleus regulation of protein binding mediator complex transcription ATP binding transcription from receptor activity RNA polymerase II nucleus mRNApromoter processing nucleotide binding Spliceosome
nucleus proteolysis protein binding Alzheimer's disease Pathways in cancer Huntington's nucleus mRNA processing protein binding disease
nucleus spermatogenesis protein binding Hypertrophic structural molecule cardiomyopathy activity (HCM) Arrhythmogenic nucleus spermatogenesis protein binding Hypertrophicright ventricular structural molecule cardiomyopathy activity (HCM) Arrhythmogenic nucleus protein amino acid protein binding right ventricular chromosome phosphorylation Page 577 of 603 Diabetes
nucleus cell cycle DNA binding
cytoplasm intermediate protein binding filament-based process
cytoplasm transport protein binding Endocytosis endosome growth factor activity
lipid particle lipid metabolic protein binding PPAR signaling process pathway
lipid particle lipid metabolic protein binding PPAR signaling process pathway
cytoplasm steroid metabolic protein binding process
cytoplasm steroid metabolic protein binding microtubule process ATP binding microtubule-based movement nucleus transport protein binding
nucleus DNA repair protein binding Base excision repair Diabetes Page 578 of 603
cytoplasm cell cycle protein binding Pathogenic intracellular apoptosis zinc ion binding Escherichia coli intracellular infection signaling cascade
nucleus regulation of cell protein binding proliferation cytoplasm protein amino acid protein binding Regulation of actin intracellular dephosphorylation cytoskeleton membrane- Vascular smooth bounded organelle muscle contraction integral to modification- ATP binding Parkinson'sFocal adhesion membrane dependent protein small conjugating disease catabolic process protein ligase Ubiquitin mediated regulation of activity proteolysis nucleus mRNAprotein processingmetabolic transferase activity
cytoplasm metabolic process transferase activity Amino sugar and nucleotide sugar metabolism Alanine, aspartate cytosol proteolysis protein binding and glutamate integral to zinc ion binding membrane mitochondrion intracellular Page 579 of 603 Diabetes
intracellular regulation of small protein binding GTPase mediated signal transduction biological_process nucleus mRNA processing protein binding
nucleus multicellular protein binding cytoplasm organismal development regulation of nucleus multicellularendocytosis protein binding cytoplasm organismal development regulation of integral to plasma proteinendocytosis amino acid protein binding membrane phosphorylation ATP binding nucleus intracellular kinase activity intracellular signaling cascade transferase activity integral to plasma protein amino acid protein binding membrane phosphorylation ATP binding nucleus intracellular kinase activity intracellular signaling cascade transferase activity integral to plasma protein amino acid protein binding membrane phosphorylation ATP binding nucleus intracellular kinase activity intracellular signaling cascade transferase activity nucleus mRNA processing nucleotide binding
nucleus mRNA processing nucleotide binding
nucleus regulation of nucleotide binding transcription Diabetes Page 580 of 603
microtubule epidermal growth protein binding factor receptor signaling pathway nucleus transport protein binding cytosol fructose 2,6- bisphosphate metabolic process nucleus mRNA processing zinc ion binding protein binding mitochondrion protein amino acid protein binding phosphorylation mitochondrion protein amino acid protein binding phosphorylation mitochondrion ubiquinone metal ion binding biosynthetic process nucleus mRNA processing nucleotide binding regulation of transcription, DNA- dependent cellular_component biological_process molecular_function
cytoplasm translation translation initiation factor activity protein binding cytoplasm regulation of binding transcription Page 581 of 603 Diabetes
nucleus regulation of protein binding transcription factor transcription complex positive regulation of transcription nucleus ribosomefrom RNA protein binding biogenesis
nucleus protein amino acid protein binding intracellular phosphorylation ATP binding mitochondrion
nucleus protein amino acid protein binding intracellular phosphorylation ATP binding mitochondrion
microtubule negative regulation protein binding cytosol of microtubule microtubule depolymerization associated complex oxidation reduction cytoplasm intermediatesensory perception protein binding filament-based process
nucleus protein amino acid ATP binding mediator complex phosphorylation
integral to modification- zinc ion binding membrane dependent protein protein binding catabolic process
integral to modification- zinc ion binding membrane dependent protein protein binding catabolic process
nucleus regulation of protein binding transcription, DNA- dependent regulation of transcription Diabetes Page 582 of 603
mitochondrion protein amino acid protein binding phosphorylation integral to regulation of protein binding Phenylalanine membrane transcription, DNA- metabolism intracellular dependent Ubiquinone and signal transduction other terpenoid- quinone
nucleus spermatogenesis protein binding Hypertrophic intermediate DNA repair structural molecule cardiomyopathy filament DNA metabolic activity (HCM) process Arrhythmogenic nucleus spermatogenesisG-protein coupled protein binding Hypertrophicright ventricular intermediate DNA repair structural molecule cardiomyopathy filament DNA metabolic activity (HCM) process Arrhythmogenic nucleus cytoskeletonG-protein coupled calcium ion binding right ventricular organization actin binding skeletal muscle tissue development nucleus regulation of protein binding transcription, DNA- dependent nucleus regulation of ARF zinc ion binding integral to GTPase activity membrane transport nucleus modification- hydrolase activity dependent protein protein binding catabolic process cytoplasm integrin-mediated protein binding Regulation of actin intracellular signaling pathway cytoskeleton membrane- protein amino acid Vascular smooth bounded organelle dephosphorylation muscle contraction Focal adhesion Page 583 of 603 Diabetes
intracellular tRNA processing zinc ion binding integral to membrane
nucleus apoptosis nucleotide binding erythrocyte differentiation
nucleus metabolic process protein binding Insulin signaling cytosol pathway
nucleus regulation of zinc ion binding intracellular transcription mRNA processing translation nucleus mRNA processing DNA binding zinc ion binding
nucleus spermatogenesis protein binding Hypertrophic intermediate DNA repair structural molecule cardiomyopathy filament DNA metabolic activity (HCM) process Arrhythmogenic nucleus regulationG-protein coupledof protein binding right ventricular translation
nucleus mRNA processing protein binding zinc ion binding
nucleus cell cycle calmodulin binding Calcium signaling integral to G-protein coupled receptor activity pathway membrane receptor protein protein binding Neuroactive ligand- nuclear pore signaling pathway DNA binding receptor interaction spindle pole proteolysis peptidase activity Gap junction Diabetes Page 584 of 603
cytoplasm translation nucleotide binding
extracellular region protein folding protein binding
cytoplasm actin cytoskeleton actin binding Pyrimidine organization metabolism nucleus regulation of protein binding transcription, DNA- dependent nucleus spermatogenesis protein binding Hypertrophic intermediate DNA repair structural molecule cardiomyopathy filament DNA metabolic activity (HCM) process Arrhythmogenic nucleus spermatogenesisG-protein coupled protein binding Hypertrophicright ventricular intermediate DNA repair structural molecule cardiomyopathy filament DNA metabolic activity (HCM) process Arrhythmogenic nucleus mRNAG-protein processing coupled nucleotide binding Spliceosomeright ventricular plasma membrane angiogenesis protein binding soluble fraction protein amino acid dephosphorylation nucleus mRNAnuclear processing mRNA protein binding membrane ER-associated protein catabolic process Page 585 of 603 Diabetes
cytoplasm in utero embryonic transferase activity development
nucleus cell communication zinc ion binding regulation of transcription
nucleus apoptosis nucleotide binding Spliceosome nucleolus erythrocyte nucleic acid binding differentiation response to protein nucleus regulationstimulus of protein binding transcription
cytoplasm heart development protein binding Starch and sucrose metabolism Insulin signaling pathway cytoplasm heart development protein binding Starch and sucrose metabolism Insulin signaling pathway integral to apoptosis protein binding membrane protein folding Golgi apparatus
cytoplasm translation protein binding
cytoplasm translation protein binding
integral to proteolysis protein binding Alzheimer's membrane zinc ion binding disease cytoplasm Epithelial cell signaling in Helicobacter pylori Diabetes Page 586 of 603
nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription nucleus mRNA processing protein binding
nucleus regulation of protein binding Nucleotide excision transcription repair integral to apoptosis protein binding membrane prolactin receptor activity integral to protein amino acid protein binding Glycerolipid membrane phosphorylation binding metabolism cytoplasm immune response RNA binding Glycine, serine and membrane regulation of threonine nucleus regulationtranscription, of DNA- DNA binding metabolism transcription nucleotide binding inflammatory response nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription nucleus mRNA processing DNA binding spliceosomal protein binding complex lysophospholipase activity cytoplasm protein folding proteinzinc ion binding binding Pathways in cancer ATP binding Plant-pathogen interaction Progesterone- lipid particle lipid metabolic protein binding PPARmediated signaling oocyte process pathway Page 587 of 603 Diabetes
membrane neuromuscular protein binding synapse junction development fatty acid metabolic eukaryotic translationprocess protein binding translation elongation factor 1 complex cytosolnuclear pore learning hydrolase activity Nitrogen molecular_function metabolism
nucleus mRNA processing nucleotide binding Spliceosome plasma membrane angiogenesis protein binding soluble fraction protein amino acid dephosphorylation cytoplasm axonnuclear cargo mRNA protein binding kinesin complex transport binding regulation of ARF GTPase activity ribosome transport ATP binding metabolic process
nucleus regulation of protein binding proteasome core transcription, DNA- DNA binding complex dependent
nucleus regulation of protein binding transcription, DNA- dependent
nucleus regulation of protein binding transcription, DNA- dependent
cytoplasm cell proliferation protein binding Diabetes Page 588 of 603
nucleus regulation of protein binding cytoplasm transcription neurotransmitter secretion cytoplasm protein folding protein binding Pathways in cancer Plant-pathogen interaction Progesterone- centrosome cell cycle protein binding mediated oocyte
centrosome cell cycle protein binding
nucleus mRNA processing protein binding
ribosome transport ATP binding metabolic process nucleus mRNA processing protein binding Spliceosome cytoplasm translation nucleotide binding mitochondrion signal transduction skeletal muscle nucleus mRNAfiber development processing DNA binding spliceosomal protein binding complex lysophospholipase activity nucleus regulation of proteinzinc ion binding binding cytoplasm transcription neurotransmitter secretion nucleus in utero embryonic metal ion binding integral to development double-stranded membrane regulation of cell DNA binding cycle kinase activity protein folding Page 589 of 603 Diabetes
nucleus mRNA processing protein binding Spliceosome ribonucleoprotein metabolic process nucleotide binding complex female pregnancy
nucleus mRNA processing protein binding Spliceosome ribonucleoprotein metabolic process nucleotide binding complex female pregnancy
integral to transport protein binding membrane
integral to transport protein binding membrane
integral to transport protein binding membrane
plasma membrane ATP synthesis hydrogen ion Oxidative coupled proton transmembrane phosphorylation transport transporter activity Lysosome Epithelial cell signaling in
nucleus mRNA processing protein binding Spliceosome Diabetes Page 590 of 603
cytoplasm translation nucleotide binding
nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription membrane intracellular protein binding signaling cascade nucleus cell adhesion protein binding Tight junction Viral myocarditis
nucleus mRNA processing RNA binding
nucleus mRNA processing RNA binding
nucleus mRNA processing RNA binding
nucleus regulation of protein binding transcription, DNA- dependent regulation of integral to proteintranscription amino acid protein binding Tight junction membrane phosphorylation Page 591 of 603 Diabetes
nucleus transport protein binding intracellular protein binding transport
cytoplasm microtubule-based protein binding kinesin complex movement binding axon cargo transport cytoplasm translationregulation of ARF protein binding
nucleus mRNA processing protein binding
nucleus apoptosis protein binding transcription immune response
nucleus regulation of protein binding membrane transcription integral to negative regulation membrane of transcription membrane cell adhesion protein binding Focal adhesion cytoskeleton cytoskeletal actin binding synapse anchoring at plasma membrane nucleus mRNAvisual perception processing protein binding Spliceosome cytoplasm translation nucleotide binding mitochondrion signal transduction Diabetes Page 592 of 603
intracellular translation structural Ribosome constituent of ribosome cytoplasm metabolic process ATP binding Glycolysis / membrane catalytic activity Gluconeogenesis nucleus Pyruvate metabolism nucleus nervous system protein binding Propanoate development nucleus spermatogenesis protein binding Hypertrophic intermediate DNA repair structural molecule cardiomyopathy filament activity (HCM) Arrhythmogenic nucleus spermatogenesis protein binding Hypertrophicright ventricular intermediate DNA repair structural molecule cardiomyopathy filament activity (HCM) Arrhythmogenic nucleus regulation of protein binding right ventricular membrane transcription integral to negative regulation membrane of transcription
nucleus mRNA processing protein binding membrane ER-associated protein catabolic process cytoplasm protein amino acid protein binding Regulation of actin intracellular dephosphorylation cytoskeleton membrane- Vascular smooth bounded organelle muscle contraction cytoplasm protein amino acid protein binding RegulationFocal adhesion of actin intracellular dephosphorylation cytoskeleton membrane- Vascular smooth bounded organelle muscle contraction Focal adhesion Page 593 of 603 Diabetes
cytoplasm protein folding isomerase activity
integral to modification- zinc ion binding membrane dependent protein protein binding catabolic process
nucleus mRNA processing DNA binding spliceosomal protein binding complex lysophospholipase activity integral to transport sodiumzinc ion ionbinding binding Cardiac muscle membrane transcription factor contraction binding Regulation of actin cytoskeleton nucleus regulation of protein binding transcription, DNA- dependent
cytoplasm protein folding isomerase activity
cytoplasm protein folding protein binding Pathways in cancer Plant-pathogen interaction Progesterone- nucleus signal transduction protein binding Insulinmediated signaling oocyte cytoplasm negative regulation pathway of cell proliferation mTOR signaling pathway nucleus transport protein binding Endocytosisp53 signaling potassium ion transport
nucleus mRNA processing protein binding Diabetes Page 594 of 603
nucleus protein amino acid protein binding phosphorylation cytoplasm translation protein binding
nucleus mRNA processing protein binding ribonucleoprotein nuclear mRNA nucleotide binding complex splicing, via spliceosome nucleus mRNAregulation processing of protein binding ribonucleoprotein nuclear mRNA nucleotide binding complex splicing, via spliceosome nucleus biological_processregulation of protein binding intracellular signal transduction nucleic acid binding nucleus mRNA processing protein binding
membrane signal transduction protein binding Regulation of actin nuclear pore SH3 domain cytoskeleton cytoskeleton binding Adherens junction nucleus membraneintegral to signal transduction protein binding Regulation of actin nuclear pore SH3 domain cytoskeleton cytoskeleton binding Adherens junction nucleus integral to
microtubule negative regulation protein binding cytosol of microtubule depolymerization sensory perception of sound Page 595 of 603 Diabetes
nucleus regulation of protein binding transcription factor transcription complex positive regulation of transcription secretory granule transportfrom RNA protein binding exocyst molecular_function
nucleus mRNA processing DNA binding zinc ion binding
cytoplasm signal transduction protein binding intracellular zinc ion binding
cytoplasm cell cycle protein binding
nucleus mRNA processing protein binding
cytosol protein amino acid protein binding Alzheimer's cytoplasm phosphorylation ATP binding disease nucleus Wnt signaling intracellular pathway Hedgehog signaling Diabetes Page 596 of 603
nucleus DNA repair protein binding oligosaccharyltransf transmembrane erase complex transport nucleolus proteolysis nucleus regulationforebrain of Rab GTPase activator GTPase activity activity telomere protein binding maintenance via nucleus proteintelomerase amino acid protein binding chromosome phosphorylation nucleus apoptosis protein binding transcription immune response nucleus mRNA processing protein binding
membrane biosynthetic catalytic activity Glycerophospholipi membrane fraction process d metabolism cytoskeleton Phosphonate and phosphinate nucleus regulation of DNA binding metabolism transcription nucleus regulation of DNA binding transcription nucleus regulation of DNA binding transcription membrane transport protein binding Page 597 of 603 Diabetes
membrane transport protein binding
plasma membrane biological_process protein binding
plasma membrane biological_process protein binding
plasma membrane biological_process protein binding
membrane apoptosis protein binding intracellular endocytosis calcium ion binding lamellipodium small GTPase mediated signal membrane apoptosistransduction protein binding intracellular endocytosis calcium ion binding lamellipodium small GTPase mediated signal cytoplasm proteintransduction folding protein binding Pathways in cancer Plant-pathogen interaction Progesterone- nucleus protein amino acid protein binding mediated oocyte chromosome phosphorylation
nucleus mRNA processing transferase activity
plasma membrane neuromuscular protein binding junction development Diabetes Page 598 of 603
nucleolus nucleolus protein binding organization lipid transport membrane muscle contraction protein binding synapse neuromuscular junction development cytoplasm transportfatty acid metabolic protein binding Golgi apparatus nucleus regulation of protein binding Spliceosome mitochondrion transcription nucleotide binding intracellular Ras protein signal nucleoplasm transduction membranecytoplasm smallregulation GTPase of Rab protein binding lamellipodium mediated signal transduction membrane small GTPase protein binding lamellipodium mediated signal transduction nucleus regulation of protein binding mediator complex transcription ATP binding transcription from receptor activity RNA polymerase II intracellular apoptosispromoter guanyl-nucleotide Regulation of actin cytoplasm small GTPase exchange factor cytoskeleton mediated signal activity Pancreatic cancer transduction protein binding nucleus nervoussignal transduction system proteinRho guanyl- binding development nucleus nervous system protein binding development Page 599 of 603 Diabetes
nucleus nervous system protein binding development
nucleus regulation of protein binding integral to transcription nucleotide binding membrane cell growth
nucleus translation ATP binding carbohydrate calcium ion binding phosphorylation kinase activity female pregnancy nucleus protein amino acid protein binding Pathways in cancer membrane phosphorylation ATP binding Insulin signaling pathway Bladder cancer nucleus metabolic process ATP binding Alanine,Regulation aspartate of actin cellular amino acid hydrolase activity and glutamate metabolic process metabolism Pyrimidine nucleus mRNA processing DNA binding metabolism zinc ion binding
nucleus mRNA processing protein binding Spliceosome ribonucleoprotein RNA splicing ATP binding complex G-protein coupled integral to receptor protein cytoplasmmembrane transportsignaling pathway protein binding Endocytosis endosome growth factor activity
cytoplasm protein amino acid protein binding Regulation of actin intracellular dephosphorylation cytoskeleton membrane- Vascular smooth bounded organelle muscle contraction membrane transport protein binding Focal adhesion Diabetes Page 600 of 603
nucleus signal transduction protein binding myosin complex anti-apoptosis nucleus regulation of protein binding transcription factor transcription complex positive regulation of transcription nucleus regulationfrom RNA of protein binding transcription factor transcription complex positive regulation of transcription cytoplasm metabolicfrom RNA process ATP binding Glycolysis / membrane catalytic activity Gluconeogenesis nucleus Pyruvate metabolism extracellular region multicellular protein binding WntPropanoate signaling cytoplasm organismal pathway development Nucleotide excision repair nucleus DNA repair DNA binding Lysine degradation cytoplasm translation protein binding Folate biosynthesis intracellular intracellular structural Insulin signaling integral to signaling cascade constituent of pathway nucleusmembrane DNAproteolysis repair DNAribosome binding LysinemTOR degradationsignaling cytoplasm translation protein binding Folate biosynthesis intracellular intracellular structural Insulin signaling integral to signaling cascade constituent of pathway nucleusmembrane modification-proteolysis hydrolaseribosome activity mTOR signaling intracellular dependent protein catabolic process nucleus modification- hydrolase activity intracellular dependent protein catabolic process nucleus regulation of protein binding transcription nucleotide binding mRNA processing transcription Page 601 of 603 Diabetes
membrane small GTPase protein binding lamellipodium mediated signal transduction
cytoplasm lipid biosynthetic unfolded protein process binding signal transduction protein binding cell proliferation microtubule negative regulation protein binding cytosol of microtubule microtubule depolymerization associated complex sensory perception nucleus translationof sound protein binding Insulin signaling cytoplasm structural pathway intracellular constituent of mTOR signaling ribosome pathway cytoplasm protein folding protein binding PathwaysRibosome in cancer Plant-pathogen interaction Progesterone- nucleus modification- hydrolase activity mediated oocyte intracellular dependent protein catabolic process
cytoplasm negative regulation protein binding of protein kinase activity
nucleus regulation of protein binding Pathways in cancer transcription Huntington's disease Chronic myeloid nucleus transport protein binding leukemia intracellular histone binding
cytoplasm transport protein binding nucleus nucleosome zinc ion binding assembly ATP binding lipid binding Diabetes Page 602 of 603
nucleus ubiquitin-dependent protein binding Proteasome protein catabolic hydrolase activity process nucleus ubiquitin-dependent protein binding Proteasome protein catabolic hydrolase activity process nucleus apoptosis nucleotide binding erythrocyte differentiation integral to apoptosis protein binding membrane protein folding Golgi apparatus integral to regulation of gene protein binding membrane expression nuclear envelope negative regulation of transcription nucleus proteolysisfrom RNA zinc ion binding
integral to signal transduction protein binding membrane regulation of cytoplasm transcription nucleus negative regulation ATP binding RNA degradation of transcription mitochondrion oxidation reduction oxidoreductase Glycolysis / intracellular activity Gluconeogenesis membrane- oxidoreductase Butanoate bounded organelle activity, acting on metabolism mitochondrion cell communication proteinthe aldehyde binding or oxo Pyruvate Page 603 of 603 Diabetes
mitochondrion oxidation reduction oxidoreductase Glycolysis / intracellular activity Gluconeogenesis membrane- oxidoreductase Butanoate bounded organelle activity, acting on metabolism cytoplasm protein amino acid proteinthe aldehyde binding or oxo RegulationPyruvate of actin intracellular dephosphorylation cytoskeleton membrane- Vascular smooth bounded organelle muscle contraction nucleus mRNA processing protein binding SpliceosomeFocal adhesion ribonucleoprotein female pregnancy nucleotide binding complex
extracellular region biological_process molecular_function protein amino acid protein binding phosphorylation
nucleus translation protein binding
nucleus RNA processing nucleotide binding
cytoplasm modification- protein binding Ubiquitin mediated dependent protein proteolysis catabolic process
cytoplasm regulation of protein binding transcription, DNA- dependent
cytoplasm signal transduction protein binding Insulin signaling cytosol protein amino acid kinase activity pathway integral to phosphorylation cAMP-dependent Apoptosis membrane protein kinase nucleuscAMP-dependent apoptosis DNAregulator binding activity