Conserved in Schizosaccharomyces Pombe and Viral Capping Enzymes

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Proc. Nati. Acad. Sci. USA Vol. 91, pp. 12046-12050, December 1994 Biochemistry Covalent catalysis in nucleotidyl transfer reactions: Essential motifs in Saccharomyces cerevisiae RNA capping enzyme are conserved in Schizosaccharomyces pombe and viral capping enzymes and among polynucleotide ligases STEWART SHUMAN*, YIZHI Liut, AND BEATE SCHWERt *Molecular Biology Program, Sloan-Kettering Institute, New York, NY 10021; and tDepartment of Biochemistry, Robert Wood Johnson Medical School, Piscataway, NJ 08854 Communicated by Bernard Moss, August 1, 1994 ABSTRACT Formation of the 5' cap structure of eukary- based comparisons of the yeast and viral proteins uncovered otic mRNAs occurs via transfer of GMP from GTP to the 5' no conservation of primary sequence. However, mapping of terminus of the primary transcript. RNA guanylyltansferase, the yeast guanylyltransferase active site to Lys-70 within the the enzyme that catalyzes this reaction, has been isolated from motifKTDG (11, 12), which is identical to the KTDG element many viral and cellular sources. Though differing in molecular at the vaccinia active site (7, 8), argues that the cellular and weight and subunit structure, the various guanylyltranferases DNA virus-encoded enzymes might have a common evolu- employ a common catalytic mechanism involving a covalent tionary origin. enzyme-(Lys-GMP) intermediate. Saccharomyces cerevisiae Covalent catalysis during nucleotidyl transfer is not unique CEGI is the sole example ofa cellular capping enzyme gene. In to the RNA capping reaction. DNA and RNA ligation reac- this report, we describe the Identification and characterization tions were the first examples of nucleotidyltransferases that of the PCEI gene encoding the capping enzyme from Schizo- employ an enzyme-adenylate intermediate (13). The AMP saccharomycespombe. PCEI was isolated from a cDNA library moiety is linked covalently via a phosphoamide bond to a Lys by functional complementation in Sa. cerevisiae. Induced ex- residue of the ligase polypeptide (14). The bound AMP is pression of PCEI in bacteria and in yeast confirmed that the transferred to the 5' monophosphate end of a polynucleotide 47-kDa Sc. pombe protein was enzymatically active. The amino toformanactivatednucleicacidintermediate-A(5')pp(5')N- acid sequence ofPCE1 is 38% identical (152 of 402 residues) to that is reminiscent ofthe G(5')ppp(5')N RNA cap. Mapping of the 52-kDa capping enzyme from Sa. cerevisiae. Comparison of the active sites of DNA and RNA ligases to Lys residues the two cellular capping enzymes with guanylyltranferases within KXDG motifs (15, 16) suggests that capping enzymes encoded by DNA viruses revealed local sequence similarity at and polynucleotide ligases may be related structurally and the enzyme's active site and at four additional collinear motifs. functionally. Mutational analysis of yeast CEGI demonstrated that four of To gain further insight into the mechanism and molecular the five conserved motifs are essential for capping enzyme evolution of nucleotidyltransferases, we have identified and function in vivo. Remarkably, the same motifs are conserved in characterized a cDNA encoding the mRNA capping enzyme the polynucleotide ligase family of enzymes that employ an from the fission yeast Schizosaccharomyces pombe.t The enzyme-(Lys-AMP) intermediate. These findings illuminate a Sc. pombe PCE1 gene encodes a 402-aa polypeptide with shared structural basis for covalent catalysis in nucleotidyl extensive sequence identity to the guanylyltransferase from transfer and suggest a common evolutionary origin for capping Sa. cerevisiae. The cellular enzymes and the DNA virus enzymes and ligases. guanylyltransferases display local sequence similarity at the active site and at four additional collinear motifs not appre- RNA guanylyltransferase (capping enzyme) catalyzes transfer ciated previously. Remarkably, the same five motifs are ofGMPfrom GTP to the 5' end ofmRNA. The hallmark ofthe conserved in the polynucleotide ligase family of enzymes. RNA capping reaction is the formation of an enzyme- Mutational analysis demonstrates that the conserved motifs guanylate intermediate in which GMP is linked covalently to are essential for capping enzyme function. a Lys residue of the protein via a phosphoamide bond (1). Analysis ofvirus-encoded RNA guanylyltransferases points to at least two families of capping enzymes, based on overall MATERIALS AND METHODS sequence conservation and on the nature of the enzyme's cDNA Encoding Sc. pombe Capping Enzyme-Cloning by active site (2-8). The capping enzymes encoded by double- Genetic Complementation. The galactose-dependent yeast strand DNA viruses (vaccinia, Shope fibroma, and African strain YBS3 [MATa, leu2, lys2, trpl, ura3, cegl::hisG, swine fever) display local sequence similarities that suggest a pGAL-CEG1 (CEN, TRPI, GALIO-CEGI)] was used to common evolutionary origin-this includes a conserved screen a Sc. pombe cDNA library in the vector pDB20 (2 ,nm, KXDG motif at the site of covalent guanylylation (5, 6). URA3) (17). Ura+ transformants were selected at 300C on Guanylyltransferase encoded by reovirus, a double-strand medium containing glucose. Plasmids with cDNA inserts RNA virus, displays no obvious sequence similarity to the were recovered from viable yeast colonies, amplified by vaccinia protein despite their essentially identical enzymatic transformation in Escherichia coli, and then retested for functions (7, 8). Although guanylyltransferases have been complementation of YBS3 growth on glucose. All secondary isolated from numerous cellular sources (9), a cellular gene transformants were incapable of growth on glucose in the (CEGI) encoding an RNA capping enzyme has only been presence of 5-fluoroorotic acid (5-FOA), indicating that the identified in Saccharomyces cerevisiae (10). Initial computer- growth on glucose required the library plasmid. DNA pre- The publication costs ofthis article were defrayed in part by page charge Abbreviation: 5-FOA, 5-fluoroorotic acid. payment. This article must therefore be hereby marked "advertisement" *The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. U16143). 12046 Downloaded by guest on September 28, 2021 Biochemistry: Shuman et al. Proc. Nadl. Acad. Sci. USA 91 (1994) 12047 pared from five secondary colonies was amplified in bacteria CTCTAAAGAAGCCCTCTCTTAGCAAAGAAACGAGTGTATTATTAAAAGGA ATG GCA CCC TCA GAG AAA GAC ATT GAA GAG GTA TCA GTC CCT GGA GTT TTA GCA CCG CGC GAC GAT and screened by restriction digestion with EcoRI, HindIII, MA P S E K D I E E V S V P G V L A P R D D andBamHI. All five plasmids contained inserts with identical GTG AGG GTT TTA AAG ACA CGA ATT GCC AAA TTA TTA GGA ACA AGT CCT GAT ACA TTT CCT GGA TCA restriction patterns. HindIll and EcoRI fragments from one V RV L K T R I A K L L G TS PDT F P G S CAG CCA GTT TCT TTT TCA AAG AAA CAT TTA CAA GCA TTA AAA GAA AAG AAC TAT TTC GTA TGT GAA cDNA clone were inserted into pBS-KS+ (Stratagene). The Q P V S F S K K H L Q A L K E K NYF V C E AAA AGT GAT GGA ATT CGT TGT TTA CTT TAT ATG ACC GAG CAT CCT CGG TAC GAA AAT CGA CCC AGT nucleotide sequence of the inserts was determined by dide- K S D G I R C L L Y M T E H P R Y E N R P S oxynucleotide sequencing. Sequencing of overlapping re- GTA TAT TTA TTT GAT CGT AAA ATG AAT TTT TAT CAT GTT GAG AAA ATT TTT TAT CCA GTT GMA AAT striction fragments and of the intact cDNA clone made clear V Y L FD R K M NF Y H V e K I F Y P V E N GAC AAA TCT GGA AAA AAA TAT CAT GTT GAT ACA CTT TTG GAC GGT GAG TTG GTT TTA GAT ATC TAT the order of the fragments and the 5' and 3' margins of the DK S G K KY H V D T L L D G E L V L D I Y cDNA insert. The cloned Sc. pombe gene was designated CCA GGT GGT AAG AAG CAA CTG AGA TAT TTA GTC TTT GAT TGT TTG GCA TGT GAT GGA ATT GTT TAT PCEI. P GG KK Q L R Y L V F D C L A C D G I V Y ATG AGT CGA TTG CTT GAC AAA CGC TTG GGA ATT TTT GCT AAA AGC ATT CAA AAG CCC TTA GAT GAA Vectors for Expression of Sc. pombe Capping Enzyme. The N S R LL D K R L G I F A K S I Q K P L D E PCEI coding sequence was isolated from the cDNA insert TAT ACA AAG ACT CAT ATG CGC GAA ACT GCC ATA TTT CCT TTT CTC ACA TCG TTA AAA AAA ATG GAG by Y T K T H H R E T A I F P F L T SL K K M E PCR amplification using oligonucleotides corresponding to CTG GGT CAT GGT ATC CTA AAG TTA TTT AAT GAA GTG ATC CCC CGA CTT CGT CAT GGT AAT GAT GGA the 5' end of the open reading frame and the 3' untranslated L G H G I L K L F N E V I P R L R H G N DG CTT ATC TTT ACA TGT ACG GAA ACT CCT TAT GTA TCT GGC ACT GAC CAG TCG CTT TTG MG TGG AAA region. The 5' oligonucleotide introduced an Nco I restriction L I F TCT E T P Y V S G TD Q S L L K H K site at the start codon and the 3' oligonucleotide included a CCA AM GAA ATG AAT ACA ATA GAC TTT ATG CTA AAG CTG GAA TTT GCA CAG CCT GM GAA GGG GAC BamHI site. The amplified DNA fragment was digested with P K E M NT I D F M L K L E F A Q P E E G D ATT GAT TAT TCA GCC ATG CCA GAA TTT CAA CTT GGT GTA TGG GAG GGT AGG AAC ATG TAC TCT TTT Nco I and Bgl II (which cuts at a single site in the cDNA I D Y S A N P E F Q L G V W E G R N M Y S F the and Tm GCC TTC ATG TAT GTT GAT GAA AAA GAA TGG GAA AAA TTG AAA AGC TTT AAT GT? CCT TTA TCG immediately downstream of translation stop codon) FAFM Y V D E K E WE K L K S F N V P L S then ligated into the bacterial expression vector pET14b.
Recommended publications
  • Active Site of the Mrna-Capping Enzyme Guanylyltransferase from Saccharomyces Cerevisiae

    Active Site of the Mrna-Capping Enzyme Guanylyltransferase from Saccharomyces Cerevisiae

    Proc. Nati. Acad. Sci. USA Vol. 91, pp. 6624-6628, July 1994 Biochemistry Active site of the mRNA-capping enzyme guanylyltransferase from Saccharomyces cerevisiae: Similarity to the nucleotidyl attachment motif of DNA and RNA ligases (nucleoidyl trnsfer/covalent catalysis) LUCILLE D. FRESCO* AND STEPHEN BURATOWSKI*t The Whitehead Institute for Biomedical Research, Nine Cambridge Center, Cambridge, MA 02142 Communicated by Phillip A. Sharp, March 8, 1994 ABSTRACT Nasent mRNAchains are capped atthe 5' end The covalent E-GMP intermediate (EnpG) can be conve- by the addiion ofa guanylyl residue to forma G(5')ppp(5')N... niently identified by radioactive labeling of the protein with structure. During the capping reaction, the guanylyltrnerase [a-32P]GTP. (GTP:mRNA guanylyltransferase, EC 2.7.7.50) is reversibly Interest in the mechanism ofcapping has focused attention and covalently guanylylated. In this enzyme-GMP (E-GMP) on the E-GMP complex. Cellular mRNA guanylyltrans- termediate, GMP Is linked to the E-amino group of a lysine ferases from human, rat liver, calf thymus, Artemia salina, residue via a phosphoamide bond. Lys-70 was Identid as the wheat germ, and Saccharomyces cerevisiae all form E-GMP GMP attachment ste of the Saccharomyces cerevisiae guanylyl- covalent complexes (reviewed in ref. 3). In addition, cyto- transferase (encoded by the CEGI gene) by guanyylpeptide plasmic viruses encode their own capping enzymes. The sequencing. CEGI genes with substitutions at Lys-70 were guanylyltransferases of vaccinia virus (12, 13), reovirus (11, unable to support viability in yeast and produced proteins that 14, 15), African swine fever virus (16), rotavirus (17), blue- were not guanylylated in vitro.
  • RNA Capping Gene Expression in General Eukaryote Gene Expression Is Regulated at Seven Levels

    RNA Capping Gene Expression in General Eukaryote Gene Expression Is Regulated at Seven Levels

    Modification and processing of eukaryotic pre-mRNAs RNA Capping Gene Expression in General Eukaryote gene expression is regulated at seven levels: 1. Transcription 2. RNA processing 3. mRNA transport 4. mRNA translation 5. mRNA degradation 6. Protein targeting 7. Protein degradation Each of these levels contains multiple steps, which are also subject of control and regulation Control vs. regulation The Long and Winding Road….. Processing of eukaryotic RNA polymerase II transcripts Steps in pre-mRNA processing i). Capping ii). Splicing iii). Cleavage and polyadenylation I. Capping II. Splicing a). Chemistry of mRNA splicing b). Donor and acceptor splice sites c). Spliceosome assembly and splice site recognition d). Small nuclear RNAs and RNPs e). Role of SR proteins in splicing f). Splicing regulation g). Alternative splicing h).Mutations that disrupt splicing i). AT-AC introns j). Trans splicing III. 3’ End Processing: Cleavage and Polyadenylation of Primary Transcripts Steps in mRNA processing (hnRNA is the precursor of mRNA) • capping (occurs co-transcriptionally) • cleavage and polyadenylation (forms the 3’ end) • splicing (occurs in the nucleus prior to transport) exon 1 intron 1 exon 2 Transcription of pre-mRNA and capping at the 5’ end cap Cleavage of the 3’ end and polyadenylation cap cap poly(A) Splicing to remove intron sequences cap poly(A) Transport of mature mRNA to the cytoplasm RNA capping 5’ cap 6 Most eukaryotic mRNAs contain a 5' cap of 7-methylguanosine 1 5 7 2 9 8 linked to the 5'-end of the mRNA in a novel 5', 5'-triphosphate linkage 3 4 This base is not encoded in the DNA template The cap may also have some additional modifications including: 1.Methyl groups at 2'-O position of the 1st and 2nd template encoded nucleotides No methyl at either 1st or 2nd template encoded nucleotides = Cap 0 Methyl at only 1st template encoded nucleotide = Cap 1 Methyl at both 1st and 2nd template encoded nucleotides = Cap 2 2.In some cases, if the 1st nucleotide is an adenine it may be methylated at N6 RNA capping Addition of the cap involves several step: 1.
  • 5'-Terminal Capping of RNA by Guanylyltransferase

    5'-Terminal Capping of RNA by Guanylyltransferase

    Proc. Nati. Acad. Sci. USA Vol. 74, No. 9, pp. 3758-3761, September 1977 Biochemistry 5'-Terminal capping of RNA by guanylyltransferase from HeLa cell nuclei (mRNA/7-methylguanosine/RNA processing) CHA-MER WEI AND BERNARD MOSS Laboratory of Biology of Viruses, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20014 Communicated by Robert P. Perry, June 24, 1977 ABSTRACT A soluble extract prepared from HeLa cell MATERIALS AND METHODS nuclei has been shown to catalyze the 5'-terminal modification Preparation of Guanylyltransferase from of RNA and synthetic polyribonucleotides to form m7G(5')pppA- HeLa Cells. and m7G(5')pppG- structures referred to as caps. The reaction HeLa S3 cells were harvested from suspension culture at 3 X involves the transfer of a GMP moiety from GTP to the 5' end 105 cells per ml and washed three times with 20mM Tris-HCl of an RNA molecule containing at Teast two terminal phos- (pH 7.6)/146 mM NaCl/11 mM glucose at 4°. The cells were phates. Significantly, neither the P nor the 'y phosphates of GTP then swollen in three volumes of 20mM Tris-HC1 (pH 7.9)/10 are transferred and polynucleotides with no 5'-terminal phos- mM MgCI2/10 mM KCI/0.25 mM spermidine at 00 and dis- phate or only one are not acceptors. In the absence of methyl rupted by Dounce homogenization. An equal volume of cold donor, G(5')pppA- and G(5')pppG- structures were synthesized, indicating that methylation is not required for guanylylation. 20mM Tris.HCI (pH 7.6)/50% glycerol was immediately added Cap formation was considered to occur by the following to the lysate.
  • Phosphorylation and Functions of the RNA Polymerase II CTD

    Phosphorylation and Functions of the RNA Polymerase II CTD

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Phosphorylation and functions of the RNA polymerase II CTD Hemali P. Phatnani1 and Arno L. Greenleaf2 Department of Biochemistry, Duke University Medical Center, Durham, North Carolina 27710, USA The C-terminal repeat domain (CTD), an unusual exten- important that the heptads be in tandem: Insertion of an sion appended to the C terminus of the largest subunit of Ala residue between heptads is lethal in yeast, whereas RNA polymerase II, serves as a flexible binding scaffold insertion of an Ala between heptad pairs can be tolerated for numerous nuclear factors; which factors bind is de- (Stiller and Cook 2004). While the CTD is indispensable termined by the phosphorylation patterns on the CTD in vivo, it is frequently not required for general transcrip- repeats. Changes in phosphorylation patterns, as poly- tion factor (GTF)-mediated initiation and RNA synthesis merase transcribes a gene, are thought to orchestrate the in vitro (Zehring et al. 1988; Kim and Dahmus 1989; association of different sets of factors with the transcrip- Buratowski and Sharp 1990; Kang and Dahmus 1993; tase and strongly influence functional organization of Akoulitchev et al. 1995). Thus, the CTD does not form the nucleus. In this review we appraise what is known, part of the catalytic essence of RNAPII; rather, it must and what is not known, about patterns of phosphoryla- perform other functions. The nature and variety of these tion on the CTD of RNA polymerases II at the begin- functions are currently being elucidated and are a main ning, the middle, and the end of genes; the proposal that topic of this review.
  • Conventional and Unconventional Mechanisms for Capping Viral Mrna

    Conventional and Unconventional Mechanisms for Capping Viral Mrna

    REVIEWS Conventional and unconventional mechanisms for capping viral mRNA Etienne Decroly1, François Ferron1, Julien Lescar1,2 and Bruno Canard1 Abstract | In the eukaryotic cell, capping of mRNA 5′ ends is an essential structural modification that allows efficient mRNA translation, directs pre-mRNA splicing and mRNA export from the nucleus, limits mRNA degradation by cellular 5′–3′ exonucleases and allows recognition of foreign RNAs (including viral transcripts) as ‘non-self’. However, viruses have evolved mechanisms to protect their RNA 5′ ends with either a covalently attached peptide or a cap moiety (7‑methyl-Gppp, in which p is a phosphate group) that is indistinguishable from cellular mRNA cap structures. Viral RNA caps can be stolen from cellular mRNAs or synthesized using either a host- or virus-encoded capping apparatus, and these capping assemblies exhibit a wide diversity in organization, structure and mechanism. Here, we review the strategies used by viruses of eukaryotic cells to produce functional mRNA 5′-caps and escape innate immunity. Pre-mRNA splicing The cap structure found at the 5′ end of eukaryotic reactions involved in the viral RNA-capping process, A post-transcriptional mRNAs consists of a 7‑methylguanosine (m7G) moi‑ and the specific cellular factors that trigger a response modification of pre-mRNA, in ety linked to the first nucleotide of the transcript via a from the innate immune system. which introns are excised and 5′–5′ triphosphate bridge1 (FIG. 1a). The cap has several exons are joined in order to form a translationally important biological roles, such as protecting mRNA Capping, decapping and turnover of host RNA functional, mature mRNA.
  • Reaction Mechanism of Mrna Guanylyltransferase from Rat Liver

    Reaction Mechanism of Mrna Guanylyltransferase from Rat Liver

    Proc. Nati Acad. Sci. USA Vol. 79, pp. 1693-1697, March 1982 Biochemistry Reaction mechanism of mRNA guanylyltransferase from rat liver: Isolation and characterization of a guanylyl-enzyme intermediate (capping mechanism/GTP-PP; exchange/covalent catalysis/phosphoamide linkage) KIYOHISA MIZUMOTOt, YOSHITo KAZIROt, AND FRITZ LIPMANNt tInstitute of Medical Science, University ofTokyo, Minatoku, Tokyo 108, Japan; and lThe Rockefeller University, New York, New York 10021 Contributed by Fritz Lipmann, October 27, 1981 ABSTRACT Rat liver RNA guanylyltransferase catalyzes a By studying the mechanism ofthe first reaction catalyzed by GTP-PP, exchange reaction in the absence of acceptor RNA [Mi- guanylyltransferase in detail, we found that a GTP-PPj exchange zumoto, K. & Lipmann, F. (1979) Proc. NatL Acai Sci USA 76, reaction occurred in the absence ofacceptor RNA and suggested 4961-4965] suggesting that the reaction proceeds through the for- that the guanylylation reaction may involve an enzyme-GMP mation of a covalent guanylylated intermediate. We now present complex as an intermediate (13). A similarfinding was also made more direct evidence for the existence of the enzyme-GMP in- by Shuman et al. (10) with the capping enzyme from vaccinia termediate: (i) the enzyme-[32P]GMP intermediate was formed virus. Furthermore, Shuman and Hurwitz (14) have recently on incubation of rat liver guanylyltransferase with [a-32P]GTP siicceed'ed' in isorating a covalent enzyme-GMP intermediate and migrated as a single radioactive band with Mr 69,000 on in which GMP is NaDodSO4polyacrylamide gel electrophoresis, and (ii) the in- linked to the Mr 95,000 subunit ofthe enzyme termediate isolated on gel filtration can transfer its GMP moiety complex.
  • Different Phosphorylated Forms of RNA Polymerase II and Associated Mrna Processing Factors During Transcription

    Different Phosphorylated Forms of RNA Polymerase II and Associated Mrna Processing Factors During Transcription

    Different phosphorylated forms of RNA polymerase II and associated mRNA processing factors during transcription Philip Komarnitsky,1 Eun-Jung Cho,1 and Stephen Buratowski2 Harvard Medical School, Department of Biological Chemistry and Molecular Pharmacology, Boston, Massachusetts 02115, USA The activities of several mRNA processing factors are coupled to transcription through binding to RNA polymerase II (Pol II). The largest subunit of Pol II contains a repetitive carboxy-terminal domain (CTD) that becomes highly phosphorylated during transcription. mRNA-capping enzyme binds only to phosphorylated CTD, whereas other processing factors may bind to both phosphorylated and unphosphorylated forms. Capping occurs soon after transcription initiation and before other processing events, raising the question of whether capping components remain associated with the transcription complex after they have modified the 5؅ end of the mRNA. Chromatin immunoprecipitation in Saccharomyces cerevisiae shows that capping enzyme cross-links to promoters but not coding regions. In contrast, the mRNA cap methyltransferase and the Hrp1/CFIB polyadenylation factor cross-link to both promoter and coding regions. Remarkably, the phosphorylation pattern of the CTD changes during transcription. Ser 5 phosphorylation is detected primarily at promoter regions dependent on TFIIH. In contrast, Ser 2 phosphorylation is seen only in coding regions. These results suggest a dynamic association of mRNA processing factors with differently modified forms of the polymerase throughout the transcription cycle. [Key Words: RNA polymerase II; TFIIH; capping enzyme; Kin 28] Received June 6, 2000; revised version accepted July 31, 2000. Eukaryotic mRNAs undergo 5Ј end capping, splicing of ase. In contrast, the mRNA cap methyltransferase Abd1 introns, and polyadenylation.
  • 5 -Capping Enzymes Are Targeted to Pre-Mrna by Binding to The

    5 -Capping Enzymes Are Targeted to Pre-Mrna by Binding to The

    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press 5*-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II Susan McCracken, Nova Fong, Emanuel Rosonina,1 Krassimir Yankulov, Greg Brothers, David Siderovski, Andrew Hessel, Stephen Foster,2 Amgen EST Program,2 Stewart Shuman,3 and David L. Bentley1,4 Amgen Institute and Ontario Cancer Institute, Toronto, Ontario M5G 2C1, Canada; 1Department of Medical Biophysics, University of Toronto, Toronto, Canada; 2 Amgen, Inc., Thousand Oaks, California 91320 USA; 3Memorial Sloan-Kettering Cancer Center, New York, New York 10021 USA We have investigated the role of the RNA Polymerase II (Pol II) carboxy-terminal domain (CTD) in mRNA 5* capping. Transcripts made in vivo by Pol II with a truncated CTD had a lower proportion of capped 5* ends than those made by Pol II with a full-length CTD. In addition, the enzymes responsible for cap synthesis, RNA guanylyltransferase, and RNA (guanine-7)-methyltransferase bound directly to the phosphorylated, but not to the nonphosphorylated, form of the CTD in vitro. These results suggest that: (1) Pol II-specific capping of nascent transcripts in vivo is enhanced by recruitment of the capping enzymes to the CTD and (2) capping is co-ordinated with CTD phosphorylation. [Key Words: RNA Pol II; CTD; mRNA cap; RNA guanylyltransferase; RNA 7-methyltransferase] Received September 22, 1997; accepted in revised form October 14, 1997. Transcripts made by RNA Polymerase II (Pol II) are dis- subunits copurify as a stable complex distinct from the tinguished from Pol I and Pol III transcripts by a m7G(58)- monomeric methyltransferase (Itoh et al.
  • Origins of Mrna Identity: Capping Enzymes Bind to The

    Origins of Mrna Identity: Capping Enzymes Bind to The

    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12758–12760, November 1997 Commentary Origins of mRNA identity: Capping enzymes bind to the phosphorylated C-terminal domain of RNA polymerase II Stewart Shuman Molecular Biology Program, Sloan-Kettering Institute, New York, NY 10021 Cellular enzymes that cap, splice, and polyadenylate eukary- Cap formation entails a series of three reactions catalyzed by otic pre-mRNAs are targeted in vivo to the nascent chains RNA triphosphatase, RNA guanylyltransferase, and RNA synthesized by RNA polymerase II (pol II). Placing a mam- (guanine-7-) methyltransferase. The triphosphatase hydro- malian pol II transcription unit under the control of a pol III lyzes the 59 triphosphate end of the primary transcript to a promoter results in a failure to cap, splice, or polyadenylate the diphosphate. Guanylyltransferase adds GMP from GTP to the transcript (1, 2). How is pre-mRNA ‘‘identity’’ established? Do diphosphate RNA end to form a blocked G(59)ppp(59)N the various mRNA processing enzymes recognize protein structure. The methyltransferase adds a methyl group from components of the pol II transcription elongation complex or S-adenosylmethionine to the cap guanosine to form is identity conferred through an initial pol II-specific modifi- m7GpppN. This pathway was elucidated more than 20 years cation that directs subsequent mRNA fate? We know that ago by the Moss and Shatkin laboratories through studies of acquisition of the m7GpppN cap is the first modification event the capping enzymes encoded by vaccinia virus and reovirus in mRNA biogenesis and that capping facilitates downstream (reviewed in ref. 14). Only in the past few years have cellular transactions such as splicing, polyadenylation, transport, and genes encoding the capping enzymes been cloned (15–19).
  • High Resolution Crystal Structure of a Key Editosome Enzyme from Trypanosoma Brucei: RNA Editing Ligase 1

    High Resolution Crystal Structure of a Key Editosome Enzyme from Trypanosoma Brucei: RNA Editing Ligase 1

    doi:10.1016/j.jmb.2004.08.041 J. Mol. Biol. (2004) 343, 601–613 High Resolution Crystal Structure of a Key Editosome Enzyme from Trypanosoma brucei: RNA Editing Ligase 1 Junpeng Deng1,2, Achim Schnaufer3,4, Reza Salavati3,4 Kenneth D. Stuart3,4 and Wim G. J. Hol1,2* 1Howard Hughes Medical Trypanosomatids are causative agents of several devastating tropical diseases Institute, University of such as African sleeping sickness, Chagas’ disease and leishmaniasis. There Washington, Seattle WA 98195 are no effective vaccines available to date for treatment of these protozoan USA diseases, while current drugs have limited efficacy, significant toxicity and suffer from increasing resistance. Trypanosomatids have several remarkable 2Department of Biochemistry and unique metabolic and structural features that are of great interest for and Biological Structure developing new anti-protozoan therapeutics. One such feature is “RNA Biomolecular Structure Center editing”, an essential process in these pathogenic protozoa. Transcripts for key University of Washington trypanosomatid mitochondrial proteins undergo extensive post-transcrip- P.O. Box 357742, Seattle WA tional RNA editing by specifically inserting or deleting uridylates from pre- 98195, USA mature mRNA in order to create mature mRNAs that encode functional 3Seattle Biomedical Research proteins. The RNA editing process is carried out in a w1.6 MDa multi-protein Institute, 307 Westlake Avenue complex, the editosome. In Trypanosoma brucei, one of the editosome’s core N, Suite 500, Seattle, WA 98109 enzymes, the RNA editing ligase 1 (TbREL1), has been shown to be essential USA for survival of both insect and bloodstream forms of the parasite. We report ˚ 4 here the crystal structure of the catalytic domain of TbREL1 at 1.2 A Department of Pathobiology resolution, in complex with ATP and magnesium.
  • Curriculum Vitae Stewart Shuman, MD, Ph.D. Address

    Curriculum Vitae Stewart Shuman, M.D., Ph.D. Address: Molecular Biology Program Sloan-Kettering Institute 1275 York Ave. New York, NY 10065 [email protected] Education: B.A. Biology (1976) summa cum laude Wesleyan University Middletown, Connecticut Ph.D. Molecular Biology (1983) Albert Einstein College of Medicine, New York M.D. (1983) Albert Einstein College of Medicine Postgraduate Positions Held: 1983-86 Medical House Officer, Medical Services Massachusetts General Hospital 1986-88 Medical Staff Fellow, Laboratory of Viral Diseases National Institute of Allergy and Infectious Diseases National Institutes of Health 1988-92 Assistant Member, Molecular Biology Program, Sloan-Kettering Institute, and Assistant Member, Dept. of Medicine, Memorial Sloan-Kettering Cancer Center 1992-95 Associate Member, Molecular Biology Program, Sloan-Kettering Institute, and Associate Member, Dept. of Medicine, Memorial Sloan-Kettering Cancer Center 1995- Member, Molecular Biology Program, Sloan-Kettering Institute, and Member, Dept. of Medicine, Memorial Sloan-Kettering Cancer Center Certification: American Board of Internal Medicine (1986) Honors: Member of the American Academy of Arts and Sciences (2015) Fellow of the American Academy of Microbiology (2013) NIH MERIT Award (2007-2017) American Cancer Society Research Professor (2005 - ) American Society for Virology, Wolfgang Joklik Lectureship (2004) Burroughs Wellcome Fund Award - New Initiatives in Malaria Research (2001-03) Simon H. Rifkind Chair (1999 - ) American Cancer Society Faculty Research
  • Highly Efficient 5' Capping of Mitochondrial RNA with NAD+ and NADH by Yeast and Human Mitochondrial RNA Polymerase

    Thomas Jefferson University Jefferson Digital Commons Department of Biochemistry and Molecular Department of Biochemistry and Molecular Biology Faculty Papers Biology 12-12-2018 Highly efficient 5' capping of mitochondrial RNA with NAD+ and NADH by yeast and human mitochondrial RNA polymerase Jeremy G Bird Rutgers University Urmimala Basu Rutgers University David Kuster Rutgers University; Heidelberg University Aparna Ramachandran FRutgersollow this Univ andersity additional works at: https://jdc.jefferson.edu/bmpfp Ewa P arGrudzien-Nogalskat of the Medical Biochemistr y Commons LetRutgers us Univ knowersity how access to this document benefits ouy SeeRecommended next page for Citation additional authors Bird, Jeremy G; Basu, Urmimala; Kuster, David; Ramachandran, Aparna; Grudzien-Nogalska, Ewa; Towheed, Atif; Wallace, Douglas C.; Kiledjian, Megerditch; Temiakov, Dmitry; Patel, Smita S.; Ebright, Richard H.; and Nickels, Bryce E., "Highly efficient 5' capping of mitochondrial RNA with NAD+ and NADH by yeast and human mitochondrial RNA polymerase" (2018). Department of Biochemistry and Molecular Biology Faculty Papers. Paper 144. https://jdc.jefferson.edu/bmpfp/144 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Biochemistry and Molecular Biology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.