Characterizing Inhibitor of Growth (ING) Family Evolution and ING1 Structure and Function

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2020-07-29 Characterizing Inhibitor of Growth (ING) family evolution and ING1 structure and function

Bertschmann, Jessica

Bertschmann, J. (2020). Characterizing Inhibitor of Growth (ING) family evolution and ING1 structure and function (Unpublished master's thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/112355 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Characterizing Inhibitor of Growth (ING) family evolution and ING1 structure and function

Jessica Bertschmann

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

GRADUATE PROGRAM IN BIOCHEMISTRY AND MOLECULAR BIOLOGY

CALGARY, ALBERTA

JULY, 2020

Abstract

The INhibitior of Growth (ING) family of tumor suppressors have emerged as a versatile family of phospholipid effectors, histone mark sensors, and growth regulators. An updated phylogenetic analysis of this protein family using sequences from 42 eukaryotic species reveals that ING4 is likely most similar to the ancestral ING protein, not ING3 as previously reported.

Previous studies have shown that the major ING1 isoforms, ING1a and ING1b serve distinct cellular functions by differentially regulating apoptosis and senescence in primary cells. The

ING1a isoform encodes a sequence unique in the human proteome. To identify ING1a homologs in other species we searched all available databases and found that sequences corresponding to

ING1a were only found in great apes and old-world monkeys. However, only select primates had start codons capable of encoding full-length ING1a. Moreover, when we expressed ING1a with and without it’s unique N-terminal sequence, the unique sequence promoted localization to the mitochondria. Given the natural induction of this isoform as cells age in culture, expression of

ING1a may serve to help limit the replicative lifespan of cells from long-lived primates, in part through its activity in the mitochondria.

Acknowledgements

I would like to first express my gratitude for my supervisor, Dr. Karl Riabowol, for allowing me to join his lab. He has been incredibly supportive of both my academic and professional development. He has always encouraged me to ask questions and to pursue my curiosities, and I am a much better scientist for it. I would also like to thank the current and former members of the Riabowol lab: Arthur Dantas, Nancy Adam, Buthaina Shueili, Yang

Yang, Karen Blote, Hari Thoppil, Whitney Alpaugh, Charles Ricordel, and Subhash Thalappilly for their help with experiments and for making my time in the lab much more enjoyable. I would like to extend a special thank you to Dr. Hamed Hojjat for his invaluable support and guidance.

He offered many helpful ideas and patiently helped me troubleshoot many experiments. I would like to thank my supervisory committee members, Dr. Jennifer Cobb and Dr. Jason de Koning, for their valuable suggestions throughout my project. I would also like to thank all my friends within the Charbonneau research group and the BMB department. I wouldn’t have made through this degree without all the scientific discussion and laughs over coffee.

Table of Contents

Abstract ...... 1 Acknowledgements ...... 2 Table of Contents ...... 3 List of Tables ...... 4 List of Figures and Illustrations ...... 5 List of Symbols, Abbreviations and Nomenclature ...... 6

Chapter 1 Introduction ...... 10 1.1 The ING1 family of tumor suppressor genes ...... 10 1.1.1 Structural features of ING proteins ...... 11 1.1.2 Biological roles of ING proteins ...... 16 1.1.2.1 Chromatin modification ...... 16 1.1.2.2 Cellular senescence ...... 18 1.1.2.3 DNA damage response ...... 19 1.1.2.4 rRNA transcriptional regulation ...... 21 1.1.2.5 Cell stress response ...... 22 1.1.2.6 Cell migration, metastasis, and angiogenesis suppression ...... 22 1.1.2.7 Cell differentiation and stem cell maintenance ...... 23 1.1.3 ING proteins in model organisms ...... 24 1.1.4 Evolution of ING proteins ...... 28 1.2 Cellular Senescence ...... 29 1.2.1 Aging and cellular senescence ...... 29 1.2.2 The senescent phenotype ...... 31 1.2.3 Senescence signalling pathways ...... 33 1.2.4 ING1a induces senescence ...... 34 1.3 Mitochondria Biology ...... 37 1.3.1 Mitochondrial structure ...... 38 1.3.2 Energy production ...... 39 1.3.3 Apoptosis ...... 40 1.3.4 Mitochondria-associated senescence ...... 41 1.4 Hypothesis and objectives ...... 42

Chapter 2 ING Family Evolution ...... 44 2.1 Introduction ...... 44 2.2 Methods ...... 44 2.2.1 Selection of organisms for analysis ...... 44 2.2.2 Protein sequence retrieval ...... 46 2.2.3 Protein sequence alignments and phylogenetic analysis ...... 48 2.2.5 Protein sequence alignments ...... 48 2.2.5 Genomic DNA sequence retrieval ...... 49 2.2.6 Genomic DNA sequence alignments ...... 50 2.3 Results ...... 51 2.3.1 Distribution of ING proteins in eukaryotes ...... 51

2.3.4 Analyses of plant and fungi ING sequences ...... 59 2.3.4 Emergence of the novel ING1a isoform ...... 62 2.4 Discussion ...... 64

Chapter 3 ING1 Structure and Function ...... 66 3.1 Introduction ...... 66 3.2 Methods ...... 66 3.2.1 Cells and cell culture ...... 66 3.2.2 Freezing and thawing cells ...... 67 3.2.3 Sub-culturing of cells ...... 68 3.2.4 Cell nucleofection ...... 68 3.2.5 DNA constructs and mutagenesis ...... 69 3.3.6 Plasmid preparation ...... 70 3.2.7 Immunofluorescence sample preparation and imaging...... 71 3.2.8 Viability assay ...... 71 3.3 Results ...... 72 3.3.1 Biophysical properties of ING1 isoforms ...... 72 3.3.2 Effect of ING1a expression of cell growth and metabolism ...... 73 3.3.3 Cellular localization of ING1a domains ...... 75 3.4 Discussion ...... 79

Chapter 4. Conclusions and Future Work ...... 82 4.1 Summary of findings ...... 82 4.2 Future directions ...... 83 4.2.1 Understand mechanism by which ING1a affects growth ...... 83 4.2.2 Minimal mitochondrial targeting sequence ...... 83 4.2.3 Role of ING1a in the mitochondria ...... 83 4.2.4 Identify binding partners of ING1 isoforms ...... 84

References ...... 85

List of Tables

Table 1. List of organisms and fully sequenced genomes used for phylogenetic analysis ...... 46

Table 2. Sensitivity analysis used to set the optimum PSI-BLAST parameters...... 47

Table 3. List of organisms and proteins used for phylogenetic trees ...... 50

Table 4. List of primers and their sequences ...... 70

List of Figures and Illustrations

Figure 1. The roles of ING family proteins in tumour suppression...... 11

Figure 2. Domains of the ING family proteins...... 15

Figure 3. A model for ING1a-induced senescence via ITSN2 and disruption of endocytosis ...... Error! Bookmark not defined.

Figure 4. Occurrence of ING proteins in different species ...... 53

Figure 5. Phylogenetic tree constructed for ING1 and ING2 proteins...... 55

Figure 6. Phylogenetic tree constructed for ING3 proteins...... 56

Figure 7. Phylogenetic tree constructed for ING4 and ING5 proteins...... 57

Figure 8. Phylogenetic tree constructed for all five ING family proteins...... 59

Figure 9. Multiple sequence alignment of plant and human ING4/5 proteins ...... 60

Figure 10. Multiple sequence alignments of fungi and human ING4/5 proteins ...... 61

Figure 11. Multiple sequence alignment of ING1a genomic locus in primates...... 63

Figure 12. Multiple sequence alignment of primate ING1a protein sequences...... 64

Figure 13. Diagram of ING1-TagRFP expression constructs ...... 70

Figure 14. Biophysical Properties of ING1 isoforms, ING1a and ING1b...... 73

Figure 15. Effects of ING1 overexpression on cell growth...... 74

Figure 16. Effect of plasmid transfection on cell growth ...... 75

Figure 17. Cellular localization of ING1a and its SAD or C-terminal domains...... 77

Figure 18. Mitochondrial localization of ING1a and its SAD or C-terminal domains...... 78

Figure 19. Cellular localization of ING1b with or without the deletion of the IDR region...... 79

List of Symbols, Abbreviations and Nomenclature

Symbol Definition adenosine triphosphate ATP ataxia telangiectasia mutated ATM basic local alignment search tool BLAST brain tumour initiating cells BTIC cancer stem cells CSC cyclin dependent kinase inhibitor CDKI cyclin-dependent kinase CDK dimethylsulfoxide DMSO

DNA damage response DDR

DNA methyl transferase associated protein1 DMAP1

DNA methyltransferase DNMT1

Dulbecco's modified Eagle's medium DMEM electron transport chain ETC embryonic stem cell ESC epidermal growth factor receptor EGFR fetal bovine serum FBS flavin adenine dinucleotide FADH2

Great Dane GD

7 herpesvirus-associated ubiquitin-specific protease HAUSP heterochromatin protein 1 homologue-γ HP1γ histone acetyl transferase HAT histone deacetylase HDAC

Histone 3 lysine 4 trimethyl H3K4me3

Histone 3 lysine 9 trimethyl H3K9me3

Human diploid fibroblast HDF human double minute HDM hydrogen peroxide H2O2

INhibitior of Growth ING inner mitochondrial membrane IMM insulin-like growth factor 1 IGF1 interleukin Iα (IL-Iα)

Intersectin 2 ITSN2 lamin interaction domain LID leucine zipper-like LZL lipopolysaccharide LPS

Minimum Essential Medium MEM mitochondrial ROS mtROS mouse embryonic fibroblast MEF nicotinamide adenine dinucleotide NAD nicotinamide adenine dinucleotide + H NADH

8 nuclear localization sequence NLS nucleolar targeting signal NTS

5-bromodeoxyuridine BrdU outer mitochondrial membrane OMM partial bromodomain PBD

PCNA-interacting protein PIP phosphatidylinositide phosphates PtdInsPs phosphatidylinositol 5-phosphate PtdIns(5)P phospholipid PI plant homeodomain PHD plasminogen activator inhibitor 1 PAI-1 polybasic region PBR position-specific iterative BLAST PSI-BLAST proliferating cell nuclear antigen PCNA reactive oxygen species ROS red fluorescent protein TagRFP-T retinoblastoma protein pRB senescence- associated secretory phenotype SASP senescence-associated domain SAD senescence-associated heterochromatic foci SAHF senescence-associated β-galactosidase SA-βgal

Src-homology-3A SH3A

9 stress-induced premature senescence SIPS superoxide O2- ribosomal RNA rRNA transferrin TR transforming growth factor-β TGFβ tumor suppressor protein 53 p53 ubiquitin Ub ultraviolet UV

Chapter 1 Introduction

1.1 The ING1 family of tumor suppressor genes

INhibitor of Growth 1, or ING1, is a candidate tumor suppressor gene identified in 1996 by a

PCR-mediated subtractive hybridization assay followed by a functional screen in vivo, to identify differentially expressed factors that affect tumorigenesis1,2. Subsequent studies identified four additional ING family members named ING2 - ING5. ING proteins can be broadly classified as type II tumour suppressors as they are frequently downregulated and/or misslocalized but infrequently mutated in human cancers3. The various roles of the ING proteins in tumour suppression is summarized in Figure 1. Orthologs of ING proteins have now been discovered throughout the animal kingdom and have emerged as a versatile family of phospholipid effectors, histone mark sensors, and growth regulators4.

Figure 1. The roles of ING family proteins in tumour suppression. ING1 & 2 can induce cell cycle arrest through p21 induction, stabilization of p53 and subsequent effects on the Rb/p16 axis. Ectopic expression of ING1 in cells can induce apoptosis via the PCNA, HSP70 induction and the Fas/caspase 8 pathways. ING1b binds to and stabilizes PCNA to maintain genomic integrity during replication stress and the DNA damage response. ING4 can interfere with cell migration and angiogenesis by interacting with linprin-α1, and by inhibiting NFκB and HIF1α functions. ING5 can help to regulate stem cell self-renewal and differentiation through its targeting of the MOZ/MORF HAT complex. This figure was modified from the seminal review, Hallmarks of Cancer: The Next Generation5.

1.1.1 Structural features of ING proteins

The structural domains of proteins dictate their molecular interactions and cellular functions. The structure of all five ING proteins are illustrated in Figure 2. All ING family proteins share a highly conserved C-terminal plant homeodomain (PHD)6. The PHD is one of 14

12 known zinc-binding domains characterized by a Cys4-His-Cys3 zinc- binding motif spanning approximately 50-80 residues. This domain allows ING proteins to act as histone code-readers, binding to histone H3 with highest affinity and specificity to trimethylated lysine 4 (H3K4me3)7.

To date, five crystal structures of ING PHD fingers in complex with H3K4me3 peptide have been solved7. The PHD finger of ING1 consists of three flexible loops: L1 consisting of residues

219-221, L2 of residues 226-234 and L3 consisting of residues 242-253. These loops are stabilized by two zinc-binding clusters in a cross-brace arrangement 7–9. The specificity of ING1-

5 PHD fingers to the H3K4me3 mark was determined by NMR and tryptophan fluorescence spectroscopy. This study demonstrated that these PHD fingers had the highest affinity for

H3K4me3 modification (Kd = 1.5μM) and the removal of each methyl group from Lys4 decreased the binding affinity by 10-fold. The PHD fingers of ING proteins did not detect the unmodified histones or histones methylated at other lysine residues, suggesting high biochemical and functional specificity. This was further established by the observation that PHD fingers of yeast ING proteins also associated with histone H3K4me3 peptides with high affinity 7–10.

The ING proteins also share a conserved lamin interaction domain (LID), whose sequence is unique within the entire human proteome11. The LID domain has a high affinity for lamin A, an alternatively spliced isoform of the LMNA gene and an essential component of the nuclear lamina and inner nuclear membrane. This interaction is thought to help tether INGs in the nucleus, thereby localizing its chromatin modifying activity. This region also possesses the conserved KIQI/KVQL sequence that participates in interactions with histone acetylase (HAT) or histone deacetylase (HDAC) complexes.

All ING proteins also contain bipartite nuclear localization signals (NLS). Karyopherins, specifically Karyopherin α2 and β1, bind the NLS, transporting ING proteins into the nucleus.

Nuclear localization of ING proteins is important for their function as tumor suppressors. They are frequently mislocalized in the cytoplasm of various cancers including gliomas12, lymphoblastic leukemias13, hepatocellular carcinomas14, oral squamous cell carcinomas15, and head and neck squamous carcinomas16. This cytoplasmic localization is generally associated with poor cancer prognosis. Embedded within the NLS of ING1 are nucleolar targeting signals (NTS), which direct ING1 to the nucleolus in the event of DNA damage. Mutations within this motif result in the loss of nucleolar targeting in response to UV damage and subsequent reduced levels of apoptosis17.

ING2-5 proteins, but not ING1, encode leucine zipper-like (LZL) motifs with 4-5 conserved leucine or isoleucine residues that form a hydrophobic region in their N-terminal region. This motif has a coiled-coil secondary structure and is thought to help facilitate interactions with other leucine zipper-containing proteins. The crystal structure of dimeric ING4 in which the two molecules are brought together by their LZL-LZL interaction has recently been solved 18–20. While the function of this motif is not well characterized in other ING proteins, it is thought to be important for UV-induced nucleotide excision repair mediated by ING221.

Both ING1 and ING2 contain a polybasic region (PBR) adjacent to the PHD through which they bind with high affinity to bioactive phosphoinositides such as phosphatidylinositol 5- phosphate (PtdIns(5)P) in the nucleus22. The phospholipids that specifically bind the PBR domain of ING1 and ING2 are stress inducible. It follows that ING1 and ING2 proteins targeting

HDAC complexes to chromatin are strongly induced in response to various forms of cellular

14 stress3. Another recent function attributed to the PBR of ING1 is binding ubiquitin, and hence the additional designation of this motif as a ubiquitin interacting motif (UIM) that binds ubiquitinated proteins. Interaction of the ING1 UIM with mono-ubiquitinated p53 leads to p53 stabilization by inhibiting its polyubiquitination and proteasomal degradation23.

ING1 also has several functional domains that are unique to this family member. The partial bromodomain (PBD) facilitates interaction with SAP30 of the Sin3-HDAC1 and HDAC2 complexes thereby modifying chromatin architecture and regulating gene transcription. The

ING1 isoform, ING1b, harbours an N-terminal proliferating cell nuclear antigen (PCNA)- interacting protein (PIP) motif. The PIP motif mediates interaction of ING1 with PCNA following DNA damage24. ING1 shares this motif with other DNA repair associated proteins such as ligases, DNA repair associated FEN1, XPG exo/endonucleases and DNA methyltransferases. Interaction between ING1 and PCNA is necessary for efficient UV-induced cell apoptosis.

The unique N-terminal domain of ING1a appears to confer the ability to rapidly induce cellular senescence when expressed at levels similar to those seen in aging fibroblasts and so we will refer to it hereafter as the senescence-associated domain (SAD).

Many ING genes encode multiple alternatively spliced isoforms. ING1 has 4 predicted splice variants, of which two have been well studied. p47ING1a, the longest isoform of ING1 is a product of exon 1a and exon 2. p33ING1b, the predominant ING1 isoform, is product of exon

ING1b and exon 2. ING1a and ING1b have distinct expression patterns and in some cases opposing cellular functions. ING2 possess 3 exons, giving rise to two isoforms – ING2a and

ING2b, both sharing a common exon. The promoter of ING2a possess two p53 binding sites, and

15 its expression is repressed by increasing levels of p5325. To date, no regulatory elements for

ING2b expression have been identified. ING3 has two isoforms p47ING3 and p11ING3. ING4 has six splice variants but their expression profiles in different tissues or their functions have not been well characterized. No additional isoforms of ING5 have been reported.

Figure 2. Domains of the ING family proteins.

The plant homeodomain (PHD) allows INGS to bind to the H3K4me3 histone mark. The lamin interacting domain (LID) allows interaction with the nuclear lamina. The nuclear localization sequence (NLS) promotes translocation to the nucleus by binding the karyopherin proteins. Within the NLS are small, basic nucleolar targeting signals (NTS). These direct ING1 to the nucleoli. The NLS can also bind the p53 tumor suppressor. Proliferating cell nuclear antigen protein (PCNA) binds specifically to ING1b via the PCNA-interacting protein (PIP) motif in

16 response to DNA damage. The polybasic region (PBR) is present only in ING1 and ING2. This motif can interact with both bioactive signaling phospholipids (PIs) and ubiquitin (Ub), the latter of which might serve to stabilize multi-monoubiquitination p53. The function of the partial bromodomain (PBD) has not been defined, but like the leucine zipper-like (LZL) region, may promote ING protein multimerization and/or interaction with other members of the HAT and HDAC complexes that ING proteins target to the H3K4Me3 histone mark.

1.1.2 Biological roles of ING proteins

1.1.2.1 Chromatin modification

ING proteins are essential members of multi protein complexes that function to modify chromatin architecture and regulate gene expression. The organization of eukaryotic DNA into chromatin regulates whether proteins that mediate many essential cellular processes can gain access to specific genomic regions. The fundamental unit of chromatin is the nucleosome, which is composed of an octamer of four core histones (H2A, H2B, H3, H4) around which DNA is wrapped. The core histones are globular proteins with unstructured N-terminal tails extending out. Chromatin compaction can be modified via ATP-dependent nucleosome-remodeling factors or by covalent modification of histone protein tails. The N-terminal histone tails possess several residues that can be post-translationally modified, and at least 8 different modifications - acetylation, methylation, phosphorylation, ubiquitination, sumoylation, ADP ribosylation, deamination and proline isomerization - are known to occur on these tails. This complex array of post-translational modifications can either activate gene transcription by creating a more “open” chromatin structure or repress gene transcription by compacting chromatin, depending on the type of chemical modification and its location in the histone octamer. Collectively, these modifications constitute the ‘histone code’, and act as docking sites for numerous enzymes and

17 effector proteins like HATs, HDACs, E3 ligases, kinases etc., which can modify the DNA and other histones in the vicinity26.

The PHD of ING proteins binds specifically to the modification H3K4Me3, a mark that is most often associated with active promoters. By binding this specific histone mark with their C- terminal PHD fingers and associating with HAT and HDAC complexes, ING proteins can mediate chromatin modifications at the vicinity of these marks, and subsequently alter gene expression patterns to regulate cellular functions. The first demonstration of ING proteins interacting with HAT and HDAC components came from studies in Saccharomyces cerevisiae.

Yng1 was shown to be a component of the NuA3 HAT complex which acetylates histone H3 while Yng2 was identified as a member of the NuA4 HAT complex that acetylates H4 and H227.

Pho23, the third ING member of the budding yeast ING family, was found to associate with the

Rpd3 HDAC complex28. All the five human ING proteins have since been identified as members of either HAT or HDAC complexes29.

Both ING1 and ING2 are stoichiometric subunits of the Sin3A HDAC1/2 corepressor, a conserved protein complex which represses the transcription of actively transcribed genes through interaction with their promoter regions and removal of the histone acetylation mark in the neighboring area30. They also interact with the Swi/Snf remodeling complex that alters the arrangement of nucleosomes on DNA30. As there is a high degree of similarity between INGs 1 and 2 and they are capable of occupying the same HDAC complex, it follows that in the event that one gene is depleted, the expression levels of the other gene increases in a presumably compensatory mechanism to keep the Sin3A deacetylation machinery working properly.

Moreover, ING1 has been shown to form a bridge between the Sin3a/HDAC1 complex and

DNA methyltransferase DNMT1 by interacting with DNA methyl transferase associated protein1

(DMAP1)60. DNMT1 is the major enzyme responsible for maintenance of DNA CpG methylation marks in human cells. DNA methylation is involved in transcriptional silencing, cellular differentiation, genomic imprinting, and X-chromosome inactivation. While ING1 and

ING2 primarily interact with HDAC complexes, they have been shown to associate with HATs

PCAF, CBP and p30031. The relative degree of interaction with HAT or HDAC complexes may depend on the cell type and conditions, however the details of such differential associations are unclear.

ING3, ING4, and ING5 associate exclusively with HAT complexes. ING3 is a stoichiometric component of the NuA4-like TIP60 HAT complex. This complex is responsible for the acetylation of histones H2A and H4. ING4 interacts with Jade1 of the HBO1 complex while ING5 associates with both the HBO1 complex and the BRPF1 subunit of the MOZ/MORF

HAT complex. The HBO1 complex is essential for H4 acetylation and association of ING4 with the HBO1 complex is thought to facilitate S-phase progression of cells. The MOZ/MORF/ING5 complex interacts with MCM helicases that have a key role in DNA replication during S phase31.

1.1.2.2 Cellular senescence

The first report that linked ING1 to senescence reported a 10-fold increase in expression of ING1 in senescent diploid fibroblasts compared to young cells. Likewise, antisense RNA- mediated knockdown of ING1 increased the replicative lifespan by seven population doublings32.

Recently, the longest isoform of ING1, ING1a, has been shown to play a causal role in cellular senescence. ING1a is expressed at very low levels in young fibroblasts but, its expression increases 10-fold as cells become senescent. Likewise, overexpression of ING1a in young

19 fibroblasts induced several senescence markers including growth arrest, senescence- associated

β-galactosidase activity, senescence associated heterochromatin foci, long actin filaments and resistance to apoptosis. ING1a induction also results in increased expression of p16INK4a and

Rb, two key players in replicative senescence. Moreover, ectopic expression of ING1a induces senescence makers significantly faster than other senescence-inducing stimuli, including genotoxic stress, oxidative stress, and oncogenic ras33.

The isoform ING1b may also play a role in oncogene-induced cellular senescence in a p53-dependent manner. Endogenous p33ING1b protein was shown to accumulate in chromatin in oncogene‐senescent fibroblasts and its silencing by RNA interference impaired senescence triggered by oncogene expression34. Furthermore, murine cells lacking ING1b show impaired stress-induced senescence due to reduced accumulation of p53. Binding of the H3K4me3 chromatin mark was shown to be essential for the senescence-inducing activity of ING1b as mutations in the PHD finger abolished this form of senescence induction35. ING2 protein levels have also been shown to increase upon entry into replicative senescence. In hTERT- immortalized human fibroblasts, ING2 was shown to activate p53 by enhancing its acetylation by the p300 HAT complex, culminating in senescence36. Together, these observations suggest a positive regulatory role for ING proteins in senescence.

1.1.2.3 DNA damage response

One of the primary roles of ING1b is to aid in the response to DNA damage, in part due to its unique N-terminal PCNA-interacting domain. PCNA is a highly conserved and essential processivity factor of DNA polymerases δ and ε that forms a sliding homotrimeric clamp during

DNA replication and nucleotide excision repair. ING1b also associates with other PCNA-

20 interacting proteins including GADD45 and PAF 24,37. p33ING1b competitively binds PCNA through its PIP domain under conditions of UV induced DNA damage. This interaction is important for orchestrating DNA damage-induced repair and after severe damage, inducing apoptosis in the event that damage cannot be repaired38. Interaction of ING1 with PCNA is required for efficient DNA damage repair during S phase as it is necessary for both histone acetylation-mediated nucleosomal rearrangement during nucleotide excision repair39 and for efficient PCNA monoubiquitination by the E3 ligase Rad-18 during lesion bypass18,40. It follows that ING1b-deficiency results in increased susceptibility to replication stress.

Many ING family proteins have also been shown to interact with the transcription factor, p53. p53 is the most commonly mutated gene in human cancers and is often referred to as the

“guardian of the genome”. In response to various types of genotoxic stresses p53 levels increase and p53 transactivates a number of genes by binding to specific DNA sequences, thereby arresting cell cycle, repairing damaged DNA, or inducing apoptosis. ING1 has been reported to stabilize p53 following DNA damage by blocking its MDM2-mediated polyubitinylation23.

ING1 also physically interacts with herpesvirus-associated ubiquitin-specific protease (HAUSP), which is a deubiquitinase for p5323. These interactions stabilize p53 in either a multimonoubiquinated form or deubiquitinated form, resulting in subsequent p53-mediated apoptosis. ING2 also physically interacts with and regulates p53 in response to various cellular stressors including UV, etoposide and neocarzinostatin41. ING2 is able to enhance the transactivation of p53 by increasing acetylation at residue K382 following DNA damage42. Both

ING1 and ING2 also play a role in the relaxation of chromatin during nucleotide excision repair by altering histone H4 acetylation18. Other ING family proteins have been shown to interact with p53 however their roles during DNA damage remain unclear.

One report has shown that ING1 translocates to mitochondria in response to apoptosis inducing stimuli, independent of the cellular p53 status43. The ability of ING1 to induce apoptosis in various breast cancer cell lines correlates well with its degree of translocation to the mitochondria after UV treatment. Endogenous ING1 protein was observed to specifically interact with the pro-apoptotic BCL2 family member BAX, and colocalized with BAX in a UV-inducible manner43.

1.1.2.4 rRNA transcriptional regulation

The nucleolus is the most distinct and prominent structure within the nucleus of eukaryotic cells and can be easily observed by light microscopy. Its function remained unknown until 1966 when Birnstiel and Wallace discovered that ribosomal RNA (rRNA) coding genes are the major DNA component of nucleoli44. Transcription of rDNA is tightly regulated by growth factor signaling kinases, tumor suppressors, and cell cycle regulators that affect its epigenetic state. While approximately 50 percent of rDNA repeats are actively transcribed, the rest are maintained in a transcriptionally inactive state by regulatory complexes44,45. The NoRC complex consists of the ATP-dependent Snf2h and TIP5 subunits and plays an important role in the epigenetic transcriptional silencing of rDNA. NoRC complex associates with demethylase

DNMT1 and deacetylase HDAC1 to mediate these epigenetic changes46. ING1b has been shown to aid in the recruitment of HDAC1 to rDNA and to promote its interaction with the NoRC complex47. This is required for efficient deacetylation of histones and transcription factors and for enforcing transcriptional repression. Loss of ING1b results in increased H3K9 and H3K27 acetylation and increased the ratio of active rDNA units that are available for transcription.

These observations suggest that ING1b is required for efficient recruitment of HDAC1 for

22 maintaining appropriate silencing of rDNA repeats47. Regulation of rDNA transcription by

ING1b is an important component of its role as a tumor suppressor as deregulation of rRNA transcription and increased protein synthesis are common requirements for aberrant growth of cancer cells.

1.1.2.5 Cell stress response

Phosphatidylinositide phosphates (PtdInsPs) are minor components of biological membranes, but act as key lipid signaling molecules. They are generated transiently in response to different stress stimuli. Although initially characterized as cytoplasmic signaling molecules, they have now been established as essential messengers for several nuclear processes, including

DNA repair, transcriptional regulation and RNA dynamics48,49. ING2 was identified as one of the

12 nuclear PtdIns receptors in a study that screened a library of 100,000 peptides representing the human proteome to identify nuclear receptors of PtdIns50. ING2 was shown to bind PtdIns5P,

PtdIns3P, PtdIns4P and PtdIns(4,5)P2 with decreasing affinity. It was later confirmed that ING1 also bound the monophosphorylated lipid molecules. The polybasic region in the C-terminal region of ING1 and ING2 contain six conserved lysine and arginine residues that are required for interaction with PtdIns5P. The functional significance of interaction between ING1/ING2 with

PtdIns remains unclear, but a model has been proposed in which these proteins potentially function in sensing and responding to cellular stress.

1.1.2.6 Cell migration, metastasis, and angiogenesis suppression

Several reports suggest that ING4 plays a crucial role in the suppression of cell migration. ING4 physically interacts with liprin-α1/PPF1A1, a protein required for focal adhesion formation and axon guidance. ING4/ liprin-α1 colocalize at the lamellipodia,

23 effectively suppressing liprin α1-induced cell spreading and cell motility. ING4 also suppresses migration of melanoma cells by inhibiting expression of stress fibril regulators RhoA GTPase and ROCK and matrix metalloproteinases MMP-2 and MMP-9. ING4 has also been reported to cooperate with the transmembrane 4 superfamily protein KAI1/CD82 in order to negatively regulate cell migration. Gene expression data suggests elevated expression of ING4 is correlated with microvessel density and reduced lymph node metastasis in breast cancer51 and in colon cancers52. Multiple studies have also reported a role for ING4 in inhibiting angiogenesis in glioblastoma53 and in breast cancers54. The role of ING4 in the suppression of metastasis and angiogenesis is in part mediated by the metastasis suppressor protein BRSM1 via the inhibition of NF-κB function55. Coimmunoprecipitation experiments in a glioma cell line indicated a physical interaction to occur between ING4 and RelA, the large subunit of NF-κB42. Consistent with this, deletion of ING4 promoted tumor vascularization in SCID mice and reduced expression of several NF-κB target genes involved in angiogenesis.

1.1.2.7 Cell differentiation and stem cell maintenance

Stem cell differentiation and dedifferentiation are largely mediated by epigenetic regulation. Chromatin remodeling and reorganization are key factors involved in the determination of cell fate56. Multiple reports have demonstrated that the ING family of epigenetic regulators are linked to different stem cell differentiation processes. For instance,

ING4 is important in prostate epithelial cell differentiation, and loss of ING4 results in increased levels of myc-dependent prostate oncogenesis57. ING3 has been identified as an oocyte- reprogramming factor58, while ING2 is connected to myogenic differentiation mediated by the

Sin3A-HDAC1 complex59. The ING2-HDAC1 complex has been implicated in the repression of fetal γ-globulin gene expression in human bone marrow progenitor cells60.

ING5 plays a role in multiple different stem cell differentiation pathways. An siRNA- based screen aimed at identifying epigenetic modifiers that maintain the stemness of epidermal stem cells identified ING5 of the MORF complex, as well as EZH2 of the polycomb complex,

UHRF1, BPTF and SMARCA5 as epigenetic network interactions that inhibited epidermal stem cells from differentiating61. Our group has demonstrated that ING5 levels decrease both in embryonic stem cell lines (ESCs) and in cancer stem cells (CSCs) as these cells undergo differentiation. More recently, it has been suggested that ING5 may play a causal role in the differentiation and self-renewal of brain tumour initiating cells (BTICs) 62. BTICs are primary cultures of cancer stem cells derived from glioblastoma patients. As in ESCs, ING5 levels decrease rapidly as BTICS differentiate. Moreover, if ING5 is overexpressed, these cells form larger spheres and maintain their ability to self-renew, suggesting an increase in their stem-cell- like characteristics, while knockdown of this protein results in a higher percentage of differentiated cells that lose stem cell properties62. Given the avidity of the ING proteins binding to key histone marks and being stoichiometric members of histone modifying complexes, it is not surprising that they have important functions in epigenetic regulation of cell differentiation.

1.1.3 ING proteins in model organisms

Knockout of the ING genes in murine models by various groups has solidified their status as key tumor suppressors. ING1 knockout in mice resulted in the formation of large clear-cell B- lymphomas63 and ING2 knockout led to increased frequency of ameloblastomas, among other phenotypic effects64. ING4 knockout strongly affects innate immunity and angiogenesis65. ING3

25 knockout in mice results in embryonic lethality. Although ING5 knockouts have yet to be published, preliminary reports indicate that ING5 knockout may have postpartum effects on stem cell maintenance.

The murine Ing1 gene encodes two ING1 proteins, p31ING1 and p37ING1. The two isoforms share most of their sequence although p37ING1 has an additional N-terminal domain.

The murine p37Ing1 is functionally homologous to the human p33ING1 isoform66. The first murine ING1 knockout model generated targeted the exon common to both ING1 isoforms63.

These mice exhibited reduced body mass (10 percent in females and 20 percent in males), but presented no other morphological or physiological abnormalities, and had no gross behavioral abnormalities. A deviation from Mendelian distribution of heterozygous animals suggested Ing1 may be important for embryogenesis or the prenatal period. Embryogenesis is characterized by a marked increase in apoptosis observed in brain, limbs and interdigits67. Mouse embryos at day

12.5 showed elevated ING1 staining in the mesenchymal cells between the cartilaginous cells of digits as well as in developing central nervous system, suggesting a role for ING1 in developmental apoptosis68. Ing1 null mice also developed spontaneous follicular B-cell lymphoma and exhibited increased sensitivity to whole body irradiation, confirming its role as an essential tumour suppressor. This is in contrast to p53-deficient mice which are resistant to irradiation-induced death69.

The second ING1 knockout model was designed specifically to study the ING1-p53 interaction70. Only the p37ING1 isoform was targeted at its unique N-terminal region that interacts with p53. Although mouse embryonic fibroblasts (MEFs) that were null for p37ING1 grew faster than their wildtype counterparts, they grew slower than MEFs lacking p53.

Moreover, Ing1 knockdown did not alter immortalization rate or p53- induced senescence.

However, p37ING1-/- mice had reduced numbers of thymocytes and MEFs isolated from the mice showed increased sensitivity to doxorubicin-induced apoptosis. Similar to the first ING1 knockout murine model, both homozygous and heterozygous mice developed spontaneous tumors in spleen or peripheral lymph nodes. This suggested a p53-independent cell protective role for ING1.

ING1 has also been studied in the model organism Xenopus where it is involved in the regulation of thyroid hormone- stimulated tail regression. Inhibitors blocking tail regression inhibited induction of ING proteins in Xenopus tadpoles71. In C.elegans, the ING1 homologue,

ING3 also regulates developmental and stress-induced apoptosis in the worm germline68. ING3 is expressed in a range of tissues including pharynx, vulva, the spermatheca, neuronal system and the intestinal cells where it localized in cell nuclei during all the stages of the cell cycle68,72.

A murine ING2 knockdown model was generated by targeted germline disruption and progeny were viable, with no visible abnormalities64. A heterozygous cross yielded 17% ING2-/- progeny, a decrease from the expected Mendelian ratio of 25% suggesting compromised embryonic or prenatal development in ING2 deficient mice. Moreover, male mice lacking ING2 were infertile and had significantly smaller testes than their wildtype littermates. Further analyses revealed that these mice suffered defects in spermatogenesis, where spermatocytes in the seminiferous tubules of males underwent meiotic arrest, resulting in decreased number and quality of mature spermatozoa. Interestingly, SIRT1 knockout mice display a very similar phenotype. Both SIRT1 and ING2 are involved in regulating HDAC1 activity [53,54], suggesting that the spermatogenesis defects are due to the disruption of stage-specific histone

27 modifications. Interestingly mice with a double knockdown of ING2 and p53 showed less pronounced abnormalities compared to mice deficient in only ING2. The authors attributed this to p53 deficiency being able to partially rescue the pathological changes caused by deletion of

ING2. Mature ING2 knockdown mice also had a higher incidence of soft tissue sarcomas, with more pronounced differences in males although the underlying reasons are still unclear.

In order to study the roles of ING3, knockout mice were generated by insertional mutagenesis, using a UbC-mCherry expression cassette to disrupt expression of the endogenous

ING3 gene. Homozygous ING3 knockout embryos display severe growth retardation which ultimately culminates in early embryonic lethality. A μCT analysis of E10.5 embryos showed developmental defects in the closure of the prosencephalon of homozygous knockouts73.

Preliminary data showed that ectopic expression of ING3 can rescue the homozygous lethal phenotype observed in embryos at the age of 10.5 days, supporting ING3’s crucial role in regulating embryonic development, specifically regarding the growth of the fetal brain. Of all the

ING family members, the ING3 knockout was the only one that was lethal in mice. This may be due to its unique sequence and structural characteristics or its key role in targeting the Tip60

HAT complex to the H3K4Me3 histone mark74. Is a Tip60 KO lethal at the same time? If so, note this.

Although there are four predicted ING4 transcripts in human, mice encode a single ING4 isoform. To create ING4-null mice, a retroviral trap construct was inserted in the ING4 locus.

These mice were phenotypically indistinguishable from their wild-type littermates. A heterozygous cross yielded the expected Mendelian ratios, suggesting that ING4 does not appear to contribute to development in mice. Unlike the other ING knockdown mice, mice deficient in

ING4 did not form spontaneous tumors. However, ING4 deficient mice showed hypersensitivity to lipopolysaccharide (LPS) injection, a known trigger of the NF-κB signaling cascade, which results in an inflammatory cytokine production and lethal shock. Likewise, ING4-/- animals had higher levels of certain cytokines regulated by the NF-κB pathway post-LPS treatment.

Interestingly, despite having increased nuclear p65/RelA protein, ING4 knockdown led to decreased expression of NF-κB target genes. This suggests that RelA-mediated transcription requires ING4 for histone acetylation at target promoters, highlighting a regulatory role for ING4 in innate immunity65.

Currently there are no published murine ING5 knockdown models however our group is working to develop one. Based on what is currently know about ING5 activity in different stem cell populations and the importance of ING5 interacting partners, the MOZ/MORF and HBO1 complexes important for embryonic development and in different stem cells75,76, we expect a knockout model for ING5 to show stem cell dysfunction. The phenotype would likely not be lethal, as ING4 can also interact with the HBO1 complex29 and might be able to partially compensate for ING5 deficiency.

1.1.4 Evolution of ING proteins

Phylogenetic and genomic analyses have shown that the ING gene family is well conserved in different species ranging from vertebrates to plants and fungi. The most recent comprehensive phylogenetic study of ING family proteins was performed in 20056. This study mapped the five human ING genes to five different chromosomes. ING1 through ING5 are located on chromosome bands 13q34, 4q35, 7q31, 12p13.3, and 2q37.3, respectively. ING1,

ING2, ING4, and ING5 are in close proximity to the telomeric/subtelomeric regions.

Interestingly, ING5 is within 440 kbp from the telomere and may be susceptible to the effects of telomere erosion. In contrast to the other ING proteins, ING3 is located in the middle of the long arm of chromosome 7. The amino acid sequence alignment of human ING proteins revealed

ING1 and ING2 share 70% of their sequence and ING4 and ING5 share 67% of their sequence.

Alternatively, ING3 is relatively dissimilar from any of its other family members. Likewise, both

ING1/ ING2 and ING4/ING5 occupy the same HAT or HDAC complex while ING3 interacts with different complexes. Based on its atypical sequence and chromosomal location, as well as its clustering with non-vertebrate species in a phylogenetic tree of ING proteins, the authors of this study suggest that ING3 may represent an ancestral form of ING proteins. However, the advances in genome sequencing technologies and phylogenetic analyses in the past 15 years highlight the need for an updated evolutionary analysis of ING proteins.

1.2 Cellular Senescence

1.2.1 Aging and cellular senescence

Aging can be described as the progressive loss of physiological fitness, leading to impaired function and increased probability of death77, and is a major risk factor for human diseases including cancer, diabetes, cardiovascular disorders, and neurodegenerative diseases78.

It is therefore of interest to study and characterize the mechanisms responsible for initiating and enforcing the cellular aging process and promoting age-related diseases. The most prominent feature of aging is a gradual decline in function that occurs at the molecular, cellular, tissue, and organismal levels. The antagonistic pleiotropy theory of aging suggests that organismal fitness declines with age, at least in part, because natural selection favors genetic programs that have positive effects on reproductive fitness early in life without regard for detrimental impacts on

30 health in post-reproductive years79. Among these antagonistically pleiotropic genetic programs are gene sets responsible for cellular senescence80, a potent anticancer mechanism that prevents the proliferation of cells with potentially oncogenic alterations81 but also has been implicated as a driver of aging and age- related disease82.

As cells age and undergo multiple rounds of cell division, they enter a state of irreversible proliferative arrest termed cellular senescence. This phenomenon was first described by Hayflick and Moorhead to characterize the observation that human diploid fibroblast cells undergo a finite number of divisions in vitro83. They went on to suggest a cell-autonomous theory of aging, where senescence depletes tissues of replication-competent cells required for tissue repair and regeneration. It is now known that replicative senescence is a result of progressive telomere erosion84. Telomeres consist of tandem repeats of a short DNA sequence (5′-TTAGGG-3′n in vertebrates where n ranges from 800-3,500 in humans) and associated proteins at the ends of linear chromosomes, which serve to protect the chromosome ends from degradation and recombination85. The “end replication problem” describes the intrinsic inability of the DNA replication machinery to copy the ends of linear molecules. As a result, telomeres become progressively shorter with each round of replication. When telomeres, or a subset of telomeres in a cell reach a critical length, the uncapped free double-stranded chromosome end becomes exposed. This triggers a permanent p53-mediated DNA damage response, culminating in growth arrest and replicative senescence86,87. Other harmful stimuli such as oxidative damage88, ionizing radiation89, and inappropriate activation of oncogenes90,91 have been shown to initiate growth arrest and induce a senescence-like phenotype referred to as stress-induced premature senescence

(SIPS). This observation suggests that like replicative senescence, SIPS can function as a protective mechanism to inhibit replication of cells harbouring potentially harmful genomic

31 alterations92. Further, there is growing evidence to suggest that programmed cellular senescence may play a role in many normal physiological processes including embryonic development, wound healing, and tissue repair93–95.

Although senescence was initially characterized in cultured cells, there is now clear evidence that senescence is a hallmark of organismal aging96. Cellular senescence and physiological aging share many of the same cell signaling and genetic mechanisms which contribute to the overall process of aging itself82,97. First, senescence causes a loss of tissue- repair capacity because of cell cycle arrest in progenitor cells, despite stem cells showing detectable telomerase activity98. Next, the impaired clearance of senescent cells by the immune system results in the net accumulation of senescent cells in certain human tissues, notably in the skin, liver, lung and spleen99,100. This accumulation of senescent cells appears to cause tissue dysfunction and impairs normal organ function, likely as a result of the secretion of proinflammatory and matrix-degrading molecules in what is known as the senescence- associated secretory phenotype (SASP)101.

1.2.2 The senescent phenotype

Human diploid fibroblast cells (HDF) are a common model for studying the molecular basis for cell aging and senescence because of their distinctive and well-characterized phenotype.

Senescent HDFs have several characteristics which distinguish them from other non-dividing cells, such as quiescent or terminally differentiated cells, including increased cell size, nuclear size, nucleolar size, number of multinucleated cells, prominent Golgi apparati, increased number of vacuoles in the endoplasmic reticulum and cytoplasm, increased numbers of cytoplasmic microfilaments, and large lysosomal bodies102. The most widely used assay for the detection of

32 senescent cells is the histochemical detection of β-galactosidase activity at pH 6.0, termed senescence-associated β-galactosidase (SA-βGAL)96. Increased β-galactosidase activity is due to increased enzymatic activity of the lysosomal hydrolase and lysosomal content of senescent cells. Although young replication-competent cells also express this enzyme at lower levels, its activity can only be detected at its optimal pH of 4.0. Senescent cells show increased enzymatic activity which can be detected even at suboptimal pH 6.0103.

Mediators of senescence, including the CDK inhibitors p16INK4a, p21Cip1/Waf1, p15Ink4b, p27Kip1, p57Kip2 and the human double minute (HDM) inhibitor p14ARF, its target p53 and hypophosphorylated Rb are also used as canonical markers of senescence91,104–106

Senescent cells show a marked absence of proliferative markers such as Ki67 protein, or 5- bromodeoxyuridine (BrdU) incorporation107, downregulation of cyclins and cyclin-dependent kinase (CDK) activity108,109, and an upregulation of prosurvival pathways to resist apoptosis. As cells become senescent, they also undergo profound genetic and epigenetic changes including the formation of senescence-associated heterochromatic foci (SAHF), which contain many hallmarks of heterochromatin, such as trimethylation at lysine 9 of histone 3 (H3K9me3), heterochromatin protein 1 homologue-γ (HP1γ) and macroH2A. SAHF are thought to be involved in the silencing of genes required for cell proliferation109.

Another feature unique to senescent cells is their proinflammatory and matrix-degrading secreteome, termed the SASP101. Among the secreted factors are transforming growth factor-β

(TGFβ), insulin-like growth factor 1 (IGF1) binding proteins, plasminogen activator inhibitor 1

(PAI-1), and inflammatory cytokines and chemokines110. The SASP is largely initiated by NF-κB and p38 MAPK signaling111 and is reinforced and propagated in nearby cells in both paracrine

33 and autocrine fashion by the SASP factor interleukin Iα (IL-Iα)112. Senescent cells may be cleared by immune cells that are recruited due to proinflammatory, chemotactic components of the SASP113,114. However, certain SASP factors also appear to have detrimental effects on their environment such as the destabilization of neighboring cells during aging115. The discovery of the SASP suggested a mechanism by which senescent cells could affect tissue and organ function out of proportion to their numbers116. While none of the biomarkers noted above are completely unique to senescent cells, and all senescent cells typically do not exhibit all markers, senescent cells express many of them, making them useful and informative to identify senescent cells. The use of the above traits in combination is, therefore, the current best practice for identifying senescent cells117.

1.2.3 Senescence signalling pathways

Although diverse stimuli induce senescence, they appear to converge on either or both of two main pathways: the p53 or the p16Ink4a–retinoblastoma protein (pRB) tumour suppressor pathways. During replicative senescence, the newly exposed uncapped free double-stranded chromosome is interpreted as a chronic DNA damage signal. The damage sensing protein ataxia telangiectasia mutated (ATM) is then recruited to the uncapped telomeres, leading to phosphorylation and stabilization of tumor suppressor protein 53 (p53) and the upregulation of the p53 transcriptional target p2186,87. In turn, p21 physically interacts with and inhibits, the activity of cyclin-CDK1, -CDK2, and -CDK4/6 complexes, acting as a negative regulator of cell cycle progression during the G1 and S phases to enforce senescence118. Other DNA-damaging stressors, such as ultraviolet (UV) or gamma irradiation, chemotherapeutics and hyperproliferation caused by oncogenic Ras overexpression also engage the p53 DNA damage

34 response pathway via different upstream factors. The reduction of p53, p21Cip1/Waf1 or DNA damage response (DDR) proteins in vitro can inhibit telomere- or DNA damage-induced senescence118,119, and in certain cells expressing little or no p16Ink4a or RAS it may even delay or temporarily reverse senescence growth arrest120, highlighting the essential role of this pathway.

Other senescence inducing stimuli including oncogenic RAS, CDKN2A locus de- repression, elevated levels of reactive oxygen species (ROS) and expression of ING1a may also exert their effects via the p16Ink4a-Rb pathway33,121,122. p16Ink4a is a cyclin dependent kinase inhibitor (CDKI), which effectively inhibits the activity of cyclin D- and E-associated CDK complexes, thus maintaining pRb in its hypophosphorylated state. Hypophosphorylated pRb remains tightly bound to the E2F family of transcription factors, preventing them from initiating transcription of genes required for cell cycle progression104. Further, the p16Ink4a–pRb pathway is also crucial for generating SAHF, which are thought to silence E2F-target genes required for proliferation.

1.2.4 ING1a induces senescence

Early work aimed at elucidating the function of the ING1 candidate tumor suppressor gene showed that suppression of ING1 expression promotes foci formation and growth in vitro and tumor formation in vivo, whereas ectopic overexpression of this protein blocks cell cycle progression by arresting transfected cells at G1 of the cell cycle1. Later research revealed the two naturally occurring isoforms of ING1, ING1a and ING1b differentially affect senescence and apoptosis in an age-dependent manner123. While the overexpression of the ING1b isoform initially appears to induce features of a stress-induced senescence-like phenotype, including SA-

β-gal activity, increased expression of p16 and growth arrest124, cells subsequently develop pyknotic nuclei and undergo apoptosis.

Alternatively, when the ING1a isoform is ectopically expressed, cell growth is arrested in a state resembling replicative senescence which suggests a role for this protein as a signal transductor in the induction of senescence. Overexpression of this isoform promotes senescent cell morphology, high levels of SA-β-gal activity and induces the formation of structures resembling senescence-associated heterochromatic foci containing heterochromatin protein 1 gamma122. While ING1a is expressed at modest levels in low- passage or “young” fibroblasts, levels of endogenous ING1a mRNA and protein increase as cells undergo senescence, during which time the expression of ING1b is downregulated. Alternative promoter usage within the

ING1 gene in senescent fibroblasts alters the INGla:INGlb ratio by ~30-fold compared to low passage primary fibroblasts122. Compared to other canonical initiators of stress-induced premature senescence including oncogene activation, oxidative stress, and genotoxic stress which take 7-12 days to induce a senescent phenotype, ING1a-induced senescence occurs in 36-

48 hours33. Although the importance of ING1 in cellular senescence is clear, it is only recently that a model for the molecular pathways underlying ING1a-induced senescence has emerged.

Previous research performed by our lab has made significant advances towards elucidating the mechanisms by which ING1a induces senescence. A microarray-based analysis in human diploid fibroblasts transfected with exogenous ING1a identified 242 up- regulated and

172 down-regulated genes121. Many of the genes whose expression was significantly altered by

ING1a overexpression were known to function in endocytosis, vesicular trafficking, or signaling.

Notably, Intersectin 2 (ITSN2), a key component of endocytosis, a direct transcriptional target of

ING1a, showed almost a 30-fold increase. A comparable increase in INST2 expression is also observed in cells undergoing replicative senescence. ITSN2 is a multidomain 180 kDa scaffolding protein that facilitates the formation of clathrin pits during clathrin-mediated endocytosis of growth factor receptors125,126. It exerts its function by interacting with epsin, a clathrin pit component, and with AP2, a clathrin adaptor complex, and binds to both dynamin and synaptojanin, two proteins involved in the pinching off of clathrin vesicles from the membrane surface. Overexpression of ITSN2 independently inhibits clathrin- mediated endocytosis and blocks transferrin (TR) and epidermal growth factor receptor (EGFR) internalization and uptake. It has been proposed that the increased expression of INST2 disrupts endocytosis by causing the formation of constricted clathrin-coated pits, likely through interactions between its Src-homology-3A (SH3A) domain and dynamin127.

Several major endocytotic pathways, including clathrin-mediated and caveolae- dependent endocytosis, are down regulated in cells undergoing replicative senescence and it has been suggested that restoration of receptor-mediated endocytosis may lead to functional recovery of the senescent cells128. Moreover, independently disrupting endocytosis, either pharmacologically by treating with dynamin inhibitor or genetically by manipulating the expression of endocytosis proteins, induces senescence markers121,129. Dysregulation of clathrin- mediated endocytosis results in attenuation of growth factor signaling pathways including EGFR,

Akt and ERK. Both overexpression and endogenous expression of ING1a also affect the Rb-EF2 pathway. ING1a expression blocks phosphorylation of residues S807/811 and S795 and strongly inhibits S780 phosphorylation121. Phosphorylation at these sites inhibit Rb from tightly binding and inhibiting the transcription factor E2F. Increased expression of ING1a also increases overall

Rb levels in an ITSN2-independent manner. Various transcriptional targets of E2F known to

37 promote cell growth, cell cycle progression and proliferation are downregulated in ING1a- expressing cells. Interestingly, ING1a appears to induce senescence in the absence of an activated p53-DNA damage signaling pathway.

Although a clearer model of ING1a-induced rapid cellular senescence is emerging, there are still several questions that remain unanswered. For instance, it is unclear how ING1a and

ING1b are differentially expressed, and what properties of the two isoforms confer their different activity. Further research is also required to understand how the ectopic expression of ING1a induces increased Rb levels and the induction of the p16INK4a and p57KIP2 CDK inhibitors, and to identify other factors involved in signal transduction. Given the increased expression

ING1a during both replicative senescence, and in response to other forms of stress, it is possible that physiological aging, SIPS, and replicative senescence share many of the same components and signaling pathways, despite being initiated by different agents. An improved understanding of the molecular mechanisms governing ING1a induced senescence would therefore provide valuable insight into cellular and organismal aging.

1.3 Mitochondrial Biology

Mitochondria are dynamic membrane-bound organelles that occupy a significant portion of cytosolic volume. While they perform many cellular functions, they are most recognized for their role in energy production130. Mitochondria are essential for the evolution of complex multicellular organisms as cells use mitochondria to access 15 times greater adenosine triphosphate (ATP) production compared to glycolysis alone. Moreover, mitochondria house

38 essential machinery for intrinsic apoptosis. Previous reports have observed ING1 targeting to the mitochondria in response to UV-induced DNA damage43.

1.3.1 Mitochondrial structure

The mitochondria are composed of two separate membranes, the outer mitochondrial membrane (OMM) and the inner mitochondrial membrane (IMM)130. The two membranes create two separate mitochondrial compartments: a narrow intermembrane space and the internal matrix. The OMM is composed of a lipid bilayer and has multiple copies of the transport protein, porin. This membrane allows for the exchange of all molecules of 5,000 Daltons or less, including metabolites, cations, and small proteins between the intermembrane space and the cytosol. Unlike the OMM, the IMM is impermeable to most cytosolic molecules. Thus, while the intermembrane space is biochemically similar to the cytosol with respect to the small molecules it contains, the matrix contains only a highly selected set of these proteins and other molecules.

The IMM is a highly specialized lipid bilayer that is responsible for enveloping the inner matrix where the majority of the working parts of the mitochondrion are found.. This membrane contains transport proteins that make it selectively permeable to small molecules that are required for metabolism of matrix enzymes. The structure of this membrane is highly convoluted, forming a series of invaginations called cristae that significantly increase the surface area of the membrane. Importantly, embedded within the IMM are the essential transmembrane proteins of the electron transport chain (ETC) that facilitate the flow of hydrogen ions across the membrane. Finally, the inner matrix contains mitochondrial DNA, mitochondrial ribosomes, and hundreds of enzymes. Unlike other animal cell organelles, the mitochondria have their own genome with 37 genes encoding 13 proteins. Each of the 13 proteins are subunits of the complexes that make up the electron transport chain131.

1.3.2 Energy production

One of the main roles of the mitochondria is to produce energy in the form of ATP.

Metabolic substrates such as pyruvate and fatty acids are transported across both mitochondrial membranes to the matrix where they are converted to the metabolic intermediate acetyl coenzyme A. The acetyl groups in acetyl CoA are then oxidized in the matrix via the citric acid cycle. This cycle also yields high energy electrons carried by the carrier molecules nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2)130. The electrons are transported to the inner mitochondrial membrane where they enter the ETC. The ETC generates a proton gradient across the inner membrane that drives the conversion of ADP + Pi to ATP via the protein ATP synthase. The final reaction of the ETC is the transfer of electrons to the final electron acceptor, O2, in order to produce H2O.

The mitochondria also plays a role in the production of reactive oxygen species (ROS)132 .

Complexes I and III of the ETC are prone to leaking electrons into the mitochondrial matrix.

These electrons react with oxygen resulting in the partial reduction of oxygen to form superoxide

(O2 -). The superoxide species formed in the mitochondrial matrix may be translocated to the intermembrane space where they are dismutated to hydrogen peroxide (H2O2) by either superoxide dismutase 1 or 2 depending on the location of the superoxide. Both O2 - and H2O2 are considered mitochondrial ROS (mtROS)133. These short-lived and highly reactive compounds were originally thought to only be a hazardous byproduct of mitochondrial respiration due to their damaging effects on proteins, lipids, and DNA. However, research over the last four decades has revealed that mtROS plays an important role in several cell signaling pathways including: metabolism, angiogenesis, growth, survival, and proliferation134.

1.3.3 Apoptosis

Another essential function of the mitochondria is to mediate the intrinsic apoptotic signaling pathway135. Intrinsic apoptosis is triggered in a cell by various stresses, including DNA damage, chemotherapeutic agents, serum starvation, and UV radiation. The mitochondria acts as a cell’s reservoir of pro-apoptotic factors, which reside in the mitochondrial intermembrane space. The role of these mitochondrial proteins is not exclusive to cell death, as they perform various other essential functions for normal cell growth. The spatial separation of mitochondrial proteins from their interacting partners or targets is a safeguard mechanism to prevent unwanted activation of apoptosis in healthy cells.

Intrinsic apoptosis-inducing stimuli cause changes in the inner mitochondrial membrane that result in outer membrane permeabilization (MOMP), loss of the mitochondrial transmembrane potential and release of normally sequestered pro-apoptotic proteins from the intermembrane space into the cytosol136. For instance, in healthy cells, cytochrome C shuttles electrons between complexes III and IV of the electron transport chain. However, once released from mitochondria, cytochrome C adopts a lethal function that is essential for caspase activation. Once in the cytosol, cytochrome C binds the adaptor molecule APAF-1; this leads to extensive conformational changes in APAF-1, causing it to oligomerise and form a heptameric structure called the apoptosome. The apoptosome recruits and activates pro-caspase-9 that in turn cleaves and activates the executioner caspases-3 and -7. Executioner caspase activity effectively kills the cell within minutes through the parallel cleavage of hundreds of different substrates.

As MOMP effectively represents a point-of-no-return for cell death, it is highly regulated, primarily by members of the B-cell lymphoma 2 (BCL-2) protein family137. To date, a total of 25 genes have been identified in the Bcl-2 family. This family can be sub-divided into pro-apoptotic

41 effector proteins (BAX and BAK), pro-apoptotic BH3-only proteins (BID, BIM, PUMA, Noxa,

HRK, BIK, BMF, BAD) and anti-apoptotic BCL-2 proteins (BCL-2, BCL-xL, MCL-1, A1,

BCL-B, BCL-w)138. Activation of either BCL-2-associated X protein (BAX) or BCL-2 antagonist or killer (BAK) is essential for MOMP as cells lacking both proteins fail to undergo

MOMP and apoptosis in response to diverse intrinsic stimuli11. BAX and BAK activity is largely controlled through interactions with other members of the BCL-2 family139.

Previous reports suggest that ING1 is targeted to the mitochondria in response to UV damage. Moreover, overexpression of ING1 enhances expression of the Bax gene and was reported to alter mitochondrial membrane potential in a p53-dependent manner. Endogenous

ING1 protein specifically interacts with the pro-apoptotic BCL2 family member Bax, suggesting a potential role for ING1 in the intrinsic apoptosis signaling pathway.

1.3.4 Mitochondria-associated senescence

Along with cellular senescence, mitochondrial dysfunction is another essential ‘hallmark of aging’77, and the two have been independently identified as important drivers of aging. The mitochondrial theory of aging suggests that mitochondrial ROS cause oxidative damage and the accumulation of this damage is a major driver of physiological aging140. As mitochondria possess their own genome and have only a limited arsenal of DNA repair machinery, they are highly susceptible to ROS-induced DNA damage. This theory is supported by numerous studies showing associations between oxidative stress, mitochondrial dysfunction and ageing-associated processes in humans and a variety of animal models. However, the mitochondrial theory of ageing remains highly contested as other studies using mouse models where antioxidant defence mechanisms were manipulated have generated conflicting results and clinical trials where the

42 role of antioxidant supplements was evaluated in healthy participants showed no prevention of mortality and in some cases increased mortality141.

Although this theory remains controversial, it has been established that senescent cells accumulate dysfunctional mitochondria; oxidative phosphorylation efficiency is decreased, and reactive oxygen species production is increased in senescent cells. Along with the proinflammatory SASP, the senescence-associated pro-oxidant phenotypes have been shown to both stabilize senescence in an autocrine fashion, and also to induce paracrine senescence142. The pro- oxidant phenotype of senescent cells has been associated with mitochondrial dysfunction during senescence143–145, suggesting that mitochondria may play a role in the process.

1.4 Hypothesis and objectives

The ING family of tumor suppressor proteins have emerged as a versatile family of phospholipid effectors, histone mark sensors, and growth regulators. An updated phylogenetic analysis of these proteins is important to identify how many ING variants exist in different species, and to better understand the origin of the human ING genes. Providing an answer to these questions would help in choosing different model organisms to study ING protein function, as well as shed light on the roles the different human ING proteins play in eukaryotic cells.

The ING1 isoforms, ING1a and ING1b differentially regulate apoptosis and senescence in primary cells. Their functional differences may be in part due to differences in structure at their N-terminal domains and targeting of the isoforms to different sub-cellular localizations.

Furthermore, since ING1a is induced during replicative senescence, these insights might help to understand mechanisms that mediate replicative senescence.

The primary objectives of the current study are to:

1. Characterize the distribution of ING proteins across different eukaryotic species and

understand the emergence of the novel ING1a isoform in certain primate species.

2. Understand how differences in structures at the N-terminus of ING1a and ING1b

affect their functions and sub-cellular localization.

Chapter 2 ING Family Evolution

2.1 Introduction

Phylogenetic and genomic analyses have shown that the ING gene family is well conserved in different eukaryotic species ranging from vertebrates to plants and fungi. The most recent comprehensive phylogenetic study of ING family proteins was performed in 2005, using

60 sequences from 15 model organisms6. However, the advances in genome sequences technologies in the past 15 years have dramatically increased the quantity and quality of publicly available genomic data. Likewise, there have been significant improvements in phylogenetic tools available. This highlights the need for an updated evolutionary analysis of ING proteins.

2.2 Methods

2.2.1 Selection of organisms for analysis

To determine the presence or absence of different ING proteins in organisms from different lineages, a common tree of species was generated from the NCBI taxonomy site

(http://www.ncbi.nlm.nih.gov/Taxonomy/CommonTree/), and then selected representative organisms with fully sequenced and annotated genomes were chosen. A total of 42 eukaryotes from the following kingdoms were selected: Animalia Plante, Fungi, Protista, Archaeplastida,

SAR, Chromista, and Excavata (Table 1). Each genome was individually searched using all ING sequences as a query.

Kingdom Phylum Class Organism Assembly Assembly RefSq category level Animalia Chordata Mammalia Homo sapiens (Human) GCA_000001405.21 Chromosome - Animalia Chordata Mammalia Pan paniscus (Chimapnzee) GCA_000001515.4 Chromosome - Animalia Chordata Mammalia Rattus norvegicus (Rat) GCA_000001635.6 Chromosome -

Animalia Chordata Mammalia Mus musculus (Mouse) GCA_000001635.6 Chromosome - Animalia Chordata Mammalia Myotis brandtii (Bat) GCA_000412655.1 Scaffold representative genome Animalia Chordata Mammalia Ornithorhynchus anatinus GCF_000002275.2 Chromosome representative (Platypus) genome Animalia Chordata Aves Gallus gallus (Chicken) GCA_000002315.3 Scaffold representative genome Animalia Chordata Reptilia Alligator sinensis (Chineese GCA_000455745.1 Scaffold representative alligator) genome Animalia Chordata Reptilia Chelonia mydas (Sea turlte) GCA_000344595.1 Scaffold representative genome Animalia Chordata Reptilia Python bivittatus (Snake) GCA_000186305.2 Scaffold representative genome Animalia Chordata Reptilia Gekko japonicus GCA_001447785.1 Scaffold representative genome Animalia Chordata Amphibia Xenopus tropicalis (Frog) GCA_000004195.2 Chromosome - Animalia Chordata Actinopterygii Salmo salar (Salmon) GCA_000233375.4 Chromosome representative genome Animalia Chordata Actinopterygii Danio rerio (Zebrafish) GCA_000002035.3 Scaffold reference genome Animalia Chordata Chondrichthyes Callorhinchus GCA_000165045.2 Scaffold representative milii (Cartilaginous fishes) genome Animalia Chordata Leptocardii Branchiostoma floridae GCA_000003815.1 Scaffold representative (Lancelet) genome Animalia Echinodermata Echinoidea Strongylocentrotus purpuratus GCA_000002235.3 Scaffold representative (Urchin) genome Animalia Arthropoda Insecta Drosophila melanogaster (Fruit GCA_000001215.4 Chromosome reference Fly) genome Animalia Arthropoda Crustacea Lepeophtheirus salmonis (Sea GCA_001005205.1 Contig representative louse) genome Animalia Nematoda Chromadorea Caenorhabditis elegans (Worm) GCA_000002985.3 Complete reference Genome genome Animalia Mollusca Gastropoda Biomphalaria glabrata (Snali) GCA_000457365.1 Scaffold representative genome Animalia Cnidaria Hydrozoa Hydra vulgaris (Hydra) GCA_000004095.1 Scaffold representative genome Animalia Porifera Demospongiae Amphimedon GCA_000090795.1 Scaffold representative queenslandica (Sponge) genome Fungi Zygomycota Zygomycetes Rhizopus microsporus (Rhizopus) GCA_900000135.1 Scaffold representative genome Fungi Zygomycota Zygomycetes Lichtheimia corymbifera GCA_000723665.1 Scaffold representative (Lichtheimia) genome Fungi Mucoromycota Mortierellomyc Mortierella verticillata GCA_000739165.1 Scaffold representative otina (Mortierella) genome Fungi Ascomycota Eurotiomycetes Penicillium chrysogenum GCA_000710275.1 chromosome representative (Penicillium) genome Fungi Ascomycota Saccharomycete Saccharomyces cerevisiae (Yeast) GCA_000146045.2 Complete reference s Genome genome Fungi Chytridiomycot Chytridiomycet Batrachochytrium dendrobatidis GCA_000203795.1 Scaffold representative a es (Frog chytrid fungus) genome Fungi Blastocladiomy Blastocladiomy Allomyces macrogynus (Fungi) GCA_000151295.1 Scaffold representative cetes cetes genome

Plantae Tracheophytes Monocots Oryza sativa Japonica (Rice) GCA_000005425.2 chromosome -

Plantae Tracheophytes Eudicots Arabidopsis thaliana GCA_000001735.1 chromosome representative (Arabidopsis) genome Plantae Tracheophytes Pinopsida Picea sitchensis (Pine) NC_011152.3 chromosome -

Plantae Tracheophytes Lycopodiopsida Selaginella moellendorffii (Fern) GCA_000143415.2 Scaffold representative genome Plantae Bryophyta Bryopsida Physcomitrella patens (Moss) GCA_000002425.1 Scaffold representative genome - Chlorophyta Chlorophyceae Chlamydomonas GCA_000002595.2 Scaffold representative reinhardtii‐ Green algae genome Protista - - Acytostelium subglobosum GCA_000787575.2 chromosome representative (Slime mould) genome - Amoebozoa Discosea Acanthamoeba GCA_000313135.1 Scaffold representative castellanii (Amoeba) genome Archaeplast Rhodophyta Rhodophyta Galdieria sulphuraria (Red algae) GCA_000341285.1 Complete representative ida Genome genome SAR Ciliophora Oligohymenoph Tetrahymena thermophila GCA_000189635.1 Scaffold representative orea (Tetrahymena) genome SAR Heterokonta Coscinodiscoph Thalassiosira pseudonana GCA_000149405.2 chromosome representative yceae (Diatom) genome Chromista Ochrophyta Phaeophyceae Ectocarpus siliculosus (Brown GCA_000310025.1 chromosome representative algae) genome

Table 1. List of organisms and fully sequenced genomes used for phylogenetic analysis Fully sequenced genomes were obtained from: http://www.ncbi.nlm.nih.gov/genome/browse/.

2.2.2 Protein sequence retrieval

The complete protein sequences of human ING1, 2, 3, 4, and 5 were retrieved from the

NCBI database (http://www.ncbi.nlm.nih.gov/protein). These were used as queries in a PSI-

BLAST search to obtain ING homologs from the genomes of the organisms selected for the analysis146. To determine the parameters for the PSI-BLAST searches, I conducted a sensitivity analysis. To this end, all 5 human ING sequences were compared to each other using different

PSI-BLAST parameters to determine the parameter setting where ING1, 2, 3, 4, and 5 were retrieved as mutual blast hits of each other (Table 2). Going forward, I used a PSI-threshold of

0.005 and a cutoff Expected (e) value of 1 x 10-28.

E-value

Query ING1a ING1b ING2 ING3 ING4 ING5

ING1a 0 8.00E-173 4.00E-79 2.00E-26 2.00E-38 5.00E-37

ING1b 1.00E-172 0 2.00E-100 8.00E-29 2.00E-56 3.00E-52

ING2 1.00E-73 3.00E-76 0 1.00E-28 4.00E-31 5.00E-43

ING3 5.00E-26 9.00E-29 1.00E-28 0 4.00E-28 1.00E-27

ING4 9.00E-38 4.00E-56 4.00E-45 3.00E-28 0 5.00E-117

ING5 4.00E-36 4.00E-51 6.00E-46 2.00E-28 2.00E-115 0

Table 2. Sensitivity analysis used to set the optimum PSI-BLAST parameters. All 5 human ING sequences were compared to each other using different PSI-BLAST parameters to determine the most stringent parameter setting where ING1, 2, 3, 4, and 5 were retrieved as mutual blast hits of each other.

Using human ING sequences as queries, PSI-BLAST searches were conducted against the non-redundant (NR) database of completely sequenced genomes. Iterative PSI-BLAST searches were further performed until no new ING homologs were retrieved. The candidate ING sequences were then used as a p-BLAST query against a NR Homo sapien protein database to confirm their identity. Certain isoforms with low conservation (e vale < 1-28) were further examined for the presence of the highly conserved PHD domains using InterProScan. Many organisms had multiple isoform of each ING protein however, they did not correlate with human protein isoforms. Therefore, only one isoform from each species was included in the analysis.

2.2.3 Protein sequence alignments and phylogenetic analysis

Multiple sequence alignments for the ING proteins were performed using MUSCLE with the default settings. For trimming poorly aligned regions, trimAL was employed to generate better quality alignments147. User-defined settings were used such that a minimum of 70 percent of sequences would be conserved. The gap threshold (fraction of positions without gaps in a given column) was set to 0.80 and minimum level of residue similarity within a column was set to 0.2.

PhyML version 3.0 was employed to construct phylogenetic trees using a maximum- likelihood method148. Trees were built for ING1 and ING2, ING3, ING4 and ING5, as well as all five ING protein sequences. For statistical reliability, 100 bootstrap replicates were performed.

Bootstrapping values indicate how many times out of 100 the same branch was observed when repeating the phylogenetic reconstruction on a re-sampled data. To estimate the optimal model of substitution, Smart Model Selection (SMS) was used for each alignment149. SMS indicated the

VT amino acid model150 with gamma distribution shape parameter (VT+ G) as the best fitting model among the 112 examined evolutionary models, based on Akaike information criterion

(AIC) statistics. Trees were visualized and edited using the program FigTree 1.4.0151.

2.2.5 Protein sequence alignments

Protein sequences were obtained from NCBI databases and were aligned using MUSCLE and visualized using Jalview. Blosum62 quality score was calculated using Jalview.

2.2.5 Genomic DNA sequence retrieval

The compete ING1 gene sequences from multiple primate species were retrieved from the NCBI database (https://www.ncbi.nlm.nih.gov/gene) using the most recent reference genomes as of April 2020. The human ING1 gene was used as a query. In organisms that did not encode the ING1a isoform, the equivalent gene loci were identified by searching for sequence conservation in the region between the loci encoding the ING1b exon and the common ING1 exon. The coordinates for the sequences used in subsequent analyses are listed in Table 3.

Species Chr ING1b exon ING1a exon Common Assembly

exon

Homo sapiens 13 110714150- 110715444- 110719229- GRCh38.p12 (human) 110714286 110716009 110719933 (GCF_000001405.38

Pan troglodytes 13 91980241- 91981536- 91985320- Clint_PTRv2 (chimpanzee) 91980377 91982101 91986024 (GCF_002880755.1)

Pan paniscus 13 No seq info 110966199- 110969987- panpan1.1 (bonobo) 110966764 110970691 (GCF_000258655.2)

Gorilla gorilla 13 93725716- 93727025- 93730810- gorGor4 gorilla (western gorilla) 93725852 93727587 93731514 (GCF_000151905.2)

Pongo abelii 13 94944116- 94945407- 94949176- Susie_PABv2 (Sumatran orangutan) 94944252 94945972 94949880 (GCF_002880775.1)

Nomascus 5 139011370- No seq info 139017083- Nleu_3.0 leucogenys (northern white- 139011506 139017786 (GCF_000146795.2) cheeked gibbon)

Papio anubis 17 No seq info 88190819- 88194567- Panu_3.0 (olive baboon) 88191379 88195271 (GCF_000264685.3)

Theropithecus 17 49449418- 49450709- 49454450- Tgel_1.0 gelada 49449554 49451269 49455154 (GCF_003255815.1)

Cercocebus atys Unplaced 3863507- 3864800- 3868562- Caty_1.0 (sooty mangabey) Scaffold 3863643 3865366 3869264 (GCF_000955945.1)

Mandrillus Unplaced 1175540- 1176832- 1180583- Mleu.le_1.0 leucophaeus (drill) Scaffold 1175676 1177392 1181287 (GCF_000951045.1)

Macaca mulatta 17 92400381- 92401673- 92405727- Mmul_8.0.1 (rhesus macaque) 92400517 92402233 92406432 (GCF_000772875.2)

Macaca 17 93100126- 93101417- 93105154- Macaca_fascicularis_5.0 fascicularis (crab-eating 93100262 93101971 93105858 (GCF_000364345.1) macaque) Macaca Unplaced c3372831- C3371641- 3367892- Mnem_1.0 nemestrina (pig-tailed Scaffold 3372795 3371081 3367188 (GCF_000956065.1) macaque) Chlorocebus 3 88937297- 88938584- 88942343- Chlorocebus_sabeus 1.1 sabaeus (green monkey) 88937433 88939144 88943047 (GCF_000409795.2)

Table 3. List of organisms and ING1 genomic loci used for alignments

2.2.6 Genomic DNA sequence alignments

Genomic sequences were aligned with Multiple Alignment using Fast Fourier Transform

(MAFT)152 through the European Bioinformatics Institute (EMBL-EBI). The neighbor-joining tree without distance corrections was also generated by EMBL-EBI.

2.3 Results

2.3.1 Distribution of ING proteins in eukaryotes

To identify homologs of human ING proteins in different organisms from different lineages, I first determined the thresholds for the PSI-BLAST searches to be used in my analysis.

For this purpose, I conducted a sensitivity analysis. Human ING1, ING2, ING3, ING4, and ING5 sequences were compared to each other using different PSI-BLAST parameters and the PSI-

BLAST parameters at which any of these sequences, when used as the query sequence, returned the other two sequences among the BLAST hits were determined (Table 2). Based on this analysis we used an Expect threshold (e-value) of 1 x 10-28 and a PSI-BLAST threshold of 0.05 for our PSI-BLAST searches for the five ING genes in each of the genomes analyzed.

To study the presence or absence of ING protein homologues in organisms from different lineages, I selected 42 organisms with fully sequenced and annotated genomes (Table 2). I tried to include most of the 15 organisms that were used in the previous 2005 analyses as well as organisms from diverse kingdoms including Animalia, Fungi, Planta, SAR, Chromista, Protista, and Archaeplastida, that were not available at the time of previous analyses.

Each genome of the organisms selected was individually subjected to a protein PSI-

BLAST search using each of the five human ING genes as a query, and the presence or absence of each of the different ING homologs was determined and indicated next to the organism name on the species tree (Figure 4). Although many human ING genes encode multiple protein isoforms, with the exception of ING1a and ING1b, the biological roles of the different isoforms are unclear. Therefore, only one isoform was used as a query for ING2-ING5. If an ING protein homolog could not be unambiguously classified as ING4 or ING5 (i.e., its similarity was below a

50% cut-off to each of these proteins), it was annotated as ING4.5. ING homologues in fungi, plants, and algae could not be unambiguously identifies as ING4 or ING5.

Interestingly, ING1a was only found in primates, whereas ING1b is encoded in almost all species within the kingdom animalia. ING1b was also present in select fungi, but absent in plants, algae, and other unicellular eukaryotes. ING2 is exclusively found in organisms belonging to the Chordata phylum. This suggest that ING2 may be the result of a duplication of the highly similar ING1 gene which occurred around the time of the emergence of vertebrates.

Like ING1b, ING3 was also found in all animals, select fungi, but absent in plants, algae and other eukaryotes. ING4 and ING5 are both found in most members of the animal kingdom. A single gene which could not be unambiguously identified as either ING4 or ING5 was found in plants, fungi, algae, and other eukaryotes. Interestingly all five ING proteins were absent in

Lepeophtheirus salmonis (Sea louse) and Thalassiosira pseudonana (Diatom). These findings suggest that although ING proteins are highly conserved in most multicellular organisms, they may not be essential for some eukaryotes.

Figure 4. Occurrence of ING proteins in different species A taxonomy common tree of species was obtained from NCBI (NCBI Taxonomy). The tree was populated with one representative fully sequenced genome on each of its branches. Each genome was then subjected to a PSI-BLAST search with each of the different human ING sequences and the presence or absence of human ING homologs is indicated on right. When a clear distinction could not be made between homologs of ING4 or ING5 with a 50% similarity cutoff to the two different proteins, the homolog was annotated as ING4.5.

To further uncover evolution of the ING family proteins in eukaryotes, I performed multiple sequence alignments and constructed phylogenetic tress for ING1 and ING2, ING3,

ING4 and ING5, and for all ING proteins. As shown in Figure 5, vertebrate ING1 and ING2 form two distinct clades. ING1 and ING2 vertebrates form a third, separate clade. Interestingly, the two fungi ING1 proteins group with the vertebrate ING1 sequences, however they have relatively long branch lengths and low bootstrap values, indicating they may be misplaced. The

ING3 phylogenetic tree has three distinct clades: vertebrates, invertebrates, and fungi (Figure 6).

The ING4 and ING5 tree shows a similar pattern to the ING1/2 tree (Figure 7). Vertebrate ING4 and ING5 form two separate clades. Both ING4 and ING5 invertebrate sequences form another clade, as do fungi and plant ING4/5 sequences.

Finally, I created a phylogenetic tree for all ING family proteins (Figure 8). Vertebrate

ING1 and ING2 formed two distinct clades which were closely related to each other. Likewise, vertebrate ING4 and ING5 formed two closely related clades. The ING1 and ING2, and ING4 and ING 5 clades were grouped together, whereas the vertebrate ING3 clade grouped separately.

All fungi and plant sequences formed a clade separate from any vertebrate ING sequences.

Invertebrate ING sequences were distributed throughout the tree.

ING1 vertebrates

28 5

ING2 vertebrates

30 24 Invertebrates 39

Figure 5. Phylogenetic tree constructed for ING1 and ING2 proteins. All ING1 and ING2 sequence were obtained from the NCBI protein database using the PSI- BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. A maximum-likelihood phylogenetic tree with 100 bootstrap replicates was then created using the PhyML program.

75 41 56 Invertebrates 51 46

Vertebrates

55 Fungi

Figure 6. Phylogenetic tree constructed for ING3 proteins. All ING3 sequence were obtained from the NCBI protein database using the PSI-BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. A maximum-likelihood phylogenetic tree with 100 bootstrap replicates was then created using the PhyML program.

ING5 vertebrates

37 ING4 vertebrates

21 23 22 6 ING4 and ING5 43 22 8 invertebrates

76 4

75 fungi 20 36 37 26 3 94 13 5 58

plants 96

Figure 7. Phylogenetic tree constructed for ING4 and ING5 proteins. All ING4 and ING5 sequence were obtained from the NCBI protein database using the PSI- BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. A maximum-likelihood phylogenetic tree with 100 bootstrap replicates was then created using the PhyML program.

ING5 vertebrates

ING4 vertebrates

ING1 vertebrates

ING2 vertebrates

ING3 vertebrates

ING3 invertebrates

plants

fungi

Figure 8. Phylogenetic tree constructed for all five ING family proteins. All ING4 and ING5 sequence were obtained from the NCBI protein database using the PSI- BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and trimAL was used to delete regions with too many gaps. A maximum-likelihood phylogenetic tree with 100 bootstrap replicates was then created using the PhyML program.

2.3.4 Analyses of plant and fungi ING sequences

In order to better understand the relationship between human ING proteins and their plant and fungi homologues, I did a multiple sequence alignment using human ING4 and ING5 and homologues from a selection of species of each kingdom. The multiple sequence alignment of plant and human ING4/5 sequences revealed moderate conservation throughout the entirety of the sequence with highest homology in the PHD domain, and to a lesser degree in the LID and

LZL (Figure 9). Likewise, the multiple sequence alignment of fungi and human ING4/5 sequences showed lower conservation throughout the body but had similarly high conservation in the functional domains (Figure 10).

Figure 9. Multiple sequence alignment of plant and human ING4/5 proteins All ING4 and ING5 sequences were obtained from the NCBI protein database using the PSI- BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and visualized using Jalview. The colored text reflects percent sequence identity, with dark blue representing higher conservation. The blue box represents the conserved LZL domain, the red box represents the LID, and the green box represents the PHD domain.

Figure 10. Multiple sequence alignments of fungi and human ING4/5 proteins All ING4 and ING5 sequence were obtained from the NCBI protein database using the PSI- BLAST algorithm with PSI threshold. The sequences were then aligned using the software MUSCLE and visualized using Jalview. The colored text reflects percent sequence identity, with dark blue representing higher conservation. The blue box represents the conserved LZL domain, the red box represents the LID, and the green box represents the PHD domain.

2.3.4 Emergence of the novel ING1a isoform

As noted in Figure 4, of the organisms whose genomes were queried, the isoform ING1a was only present in primates. To follow up on this observation, I searched all primate genomes available in the NCBI and Ensemble databases using the ING1a unique N-terminal sequence as a query. Interestingly, ING1a was not present in all primate species. In fact, only five primate species including Homo sapiens, Pan paniscus, Gorilla gorilla, Pongo abeili, and Mandrillus leucophaeus encoded this isoform (Figure 11). To investigate how this novel isoform emerged in only a select few primate species, I identified the genomic loci homologous to that encoding

ING1a in human, in 14 different primates. Multiple sequence alignments revealed that despite sequence similarity in other primate species, these organisms have an ACG in place of the ATG start codon of the ING1a exon (Figure 11). While Pan troglodytes does encode the ATG start codon, a downstream stop codon prevents the full-length sequence from being transcribed. Ing1a genes of Pongo abelii and Mandrillus leucophaeus are encoded by an upstream alternative start codon. While other primate species do share this ATG sequence, they do not have a complete in frame coding sequence for ING1a. This suggests that ING1a expression is the result of a single base pair substitution occurring relatively recently in primate evolution. Multiple sequence alignment of the five primate ING1a protein sequences reveal that the unique N-terminal region is not as well conserved as the body of the protein (Figure 12).

1b exon 1a exon ING1 common exon

HomoHomo sapiens sapiens (Human) ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGCCTAGCGCAATAACTGGTATGGGTCT

PanPan troglodytes troglodytes (Chimpanzee) ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGCCTAGCGCAATAACTGGTATGG…. *

PanPan paniscus paniscus (Bonobo) ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGCCTAGCGCAATAACTGGTATGGGTCT

GorillaGorilla gorilla gorilla gorilla gorilla (Western gorilla) ATGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTTGCTGAGGCGGTTGAAGGCGGGCCTAGCGCAATAACTGGTATGGGTCT

PongoPongo abelii abelii (Sumatran orangutan) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGCCTAGCGCAATAACTGGTATGTGTCT

MacacaMacaca mulatta mulatta (Rhesus macaque) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

MacacaMacaca fascicularisfascicularis (Crab-eating macaque) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGGTCT

MacacaMacaca nemestrinanemestrina (Pig-tailed macaque) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

TheropithecusTheropithecus gelada gelada (Gelada) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

PapioPapio anubis anubis (Olive baboon) ACGTCCTTCGTGGAATGTCCTTATGATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

MandrillusMandrillus sphinx leucophaeus (Drill) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGGTCT

CercocebusCercocebus atys atys (Sooty mangabey) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTGGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

ChlorocebusChlorocebus sabaeus sabaeus (Green monkey) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTGCGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. * PiliocolobusPiliocolobus tephroscelestephrosceles (Ugandan red colobus) ACGTCCTTCGTGGAATGTCCTTATCATTCCCCTACGGAACGATTGGTCGCTGAGGCGGATGAAGGCGGGTGTAGCGCAATAACTGGCATGGG…. *

Figure 11. Multiple sequence alignment of ING1a genomic loci in primates. The ING1 genomic locus is located in the subtelometic region of the long arm of chromosome 13 in humans. Multiple sequence alignment of the genomic locus encoding ING1 show that ING1b is highly conserved throughout eukaryote evolution, whereas ING1a is only encoded in Homo sapiens and closely related primates. Despite sequence similarity in old world monkeys, these primates have an ACG in place of the ATG start codon of the ING1a exon. Several other primates use a downstream alternative start codon to encode a truncated isoform of ING1a. A Neighbour-joining tree without distance corrections was generated by EMBL-EBI Multiple Alignment using Fast Fourier Transform.

Figure 12. Multiple sequence alignment of primate ING1a protein sequences. Multiple alignment for ING1a amino acid sequences was generated by MUSCLE. Blosum62 quality score was calculated in Jalview.

2.4 Discussion

These data show that INGs are a diverse family that evolved through multiple gene duplication events, occurring early on in eukaryotic evolution. This analysis included only eukaryotic organisms. Using ING proteins as a query in a microbial blast search did return two results; one from bacteria and one from an unknown archaeon. However, in both cases, the organism was uncultured, and the sequencing coverage of their genomes were relatively low.

Based on the role of ING proteins as readers of the histone code, its likely they would be absent in bacteria that have neither histones nor a nucleus. While archaeal DNA does associate with histones, these histones lack significant tails and there is currently no evidence that archaeal

65 histones are subject to any post-translational modifications. It is therefore likely that ING proteins evolved early during eukaryote evolution.

This updated phylogenetic analysis supports many of the conclusions from the previous

2005 analyses. For instance, both analyses suggest ING1 and ING2, and ING4 and ING5 are closely related and their chromosomal locations suggest the possibility of duplication of terminal regions of particular chromosome pairs. ING3 on the other hand, is relatively distant from the closely related ING4 and ING5 and the well-related ING 1 and ING2. However, this analysis used 42 organisms, compared to 15 in the previous analyses. By using multiple distantly related organisms, including multiple species of fungi, plants, algae, and other eukaryotes, we are able to gain a better understanding of what ancestral INGs may have resembled. The distribution of ING proteins throughout the phylogenetic tree suggest ING3 is not an ancestral form of ING proteins, as previously suggested. The presence of an ING4/5-like sequence in multiple fungi, plant and algae species suggest it would more closely resemble the ancestral form of the protein. Multiple sequence alignments between human and plant or fungi ING4/5 sequences show significant homology, especially in the functional domains such as the PHD, LZL, and LID. However, further analysis is still required to confirm identify of the ancestral protein.

It has previously been reported that ING1a is not encoded in various model organisms such as mice, fruit flies, and yeast. However, this phylogenetic analysis revealed that ING1a is only encoded in primates. In fact, a recent ACG à ATG mutation resulted in the formation of a start codon relatively recently. The unique N-terminal region is not well conserved compared to the rest of the protein, which is not surprising as it emerged very recently.

Chapter 3 ING1 Structure and Function

3.1 Introduction

The founding member of the ING family has four predicted isoforms, two of which have known biological functions. ING1a and ING1b are nearly identical in sequence although they differ in their N-terminal domains. Despite their similarity in sequence, the two isoforms have distinct expression patterns and opposing cellular functions. While ING1a is expressed at modest levels in low-passage fibroblasts, levels of endogenous ING1a mRNA and protein increase as cells undergo senescence, during which time the expression of ING1b is downregulated122.

Moreover, ectopic expression of ING1a rapidly induces a senescent phenotype. ING1b overexpression results in cell cycle arrest followed by the development of pyknotic nuclei and apoptosis153. Notably, ING1a induces senescence in 36-48 hours, significantly faster than other canonical initiators of stress-induced premature senescence including oncogene activation, oxidative stress, and genotoxic stress, which take 7-12 days to induce a senescent phenotype33. It is therefore interesting to study how these differences in protein structure translate to differences in biological function.

3.2 Methods

3.2.1 Cells and cell culture

Hs68 human diploid foreskin fibroblasts (CRL-1635), and U2OS cells were purchased from the American Type Culture Collection (ATCC). Macaca mulatta skin fibroblasts

(AG06249) were purchased from the Coriell Institute. Primary Great Dane fibroblasts were isolated from skin samples obtained from elective surgeries by Dr. Whitney Alpaugh. The

67 primary human foreskin fibroblasts were a gift from the Rancourt lab at the University of

Calgary.

Hs68 fibroblasts were grown in low glucose Dulbecco's modified Eagle's medium

(DMEM) supplemented with 10% fetal bovine serum (FBS), 4 mM L-glutamine and 1 mM sodium pyruvate. Macaque fibroblasts were grown with Minimum Essential Medium (MEM)

(Eagle) Alpha Modification with nucleosides with 2mM L-glutamine and 10% FBS. Primary human fibroblasts and primary canine fibroblasts were grown in high glucose DMEM and 10%

FBS. All cells were maintained in 1% Pen/Strep and were tested for mycoplasma regularly. All the cells were maintained in a humidified atmosphere with 5% CO2 and 95% air at 37 °C and media was changed every 2-3 days or as required. Culture media and FBS were supplied by

Gibco- BRL or Hyclone. Plastic tissue culture plates and flasks were supplied by Fisher,

Sarstedt, or Corning Canada.

3.2.2 Freezing and thawing cells

Cultured cells were harvested by incubating with trypsin-EDTA for detachment and centrifuged at 1,000 rpm for 5 minutes. They were resuspended in a medium containing 90%

FBS and 10% sterile dimethylsulfoxide (DMSO, Sigma) to yield approximately l-2 X l06 cells/ml. One milliliter aliquots of cell suspension were transferred to cryovials (Nalgene) and vials were placed at -80 °C overnight in a Corning® CoolCell™ Freezer Container. Frozen cells were transferred to liquid nitrogen for long- term storage. To thaw cells, vials of frozen cells were removed from liquid nitrogen and placed in a 37 °C water bath for 3 minutes. The thawed cell suspension was quickly transferred to an Eppendorf tube containing 9 mL fresh culture media and centrifuged at 1000 rpm for 5 minutes. The medium containing DMSO was removed

68 and replaced with fresh complete growth medium. Cells were resuspended by gently pipetting and appropriate aliquots of the cell suspension were added to new culture vessels and incubated at 37 °C incubator with 5% CO2. When the cells had attached to the plate, the medium was replaced with fresh complete growth medium and cells were returned to the incubator.

3.2.3 Sub-culturing of cells

Cells reaching confluence were rinsed with sterile PBS and detached from the plate using trypsin-EDTA (Gibco-BRL) solution at 37°C for 2-5 minutes. Cells were observed under an inverted microscope until cell layer was dispersed. Cells were resuspended in 6.0 to 8.0 mL of the appropriate complete growth medium and centrifuged at 1,000 rpm for 5 minutes. The medium containing trypsin was removed and replaced with fresh complete growth medium.

Cells were resuspended by gently pipetting and appropriate aliquots of the cell suspension were added to new culture vessels. Primary cells including Hs68, Human, Macaque, and Great Dane fibroblasts were split at 1:2-1:4 ratios depending on the experiment. U2OS cells were passaged at

1:2-1:8 ratio depending on the growth rate of the cells and the purpose of the experiment.

3.2.4 Cell nucleofection

Cells were seeded onto tissue culture plates at about 50% confluence and 16-18 hours later, upon reaching about 70% confluence, cells were lifted with accutase and rinsed once with

PBS followed by a rinse with Optimem. Cells were resuspended in Optimem and aliquoted into transfection cuvettes. Cells were nucleofected with the expression constructs using a Lonza 4D-

Nucleofector™ System using CA-137 and EO-100 programs for fibroblasts and U2OS cells respectively. Cells were replated in antibiotic-free media and allowed to recover for 16-24 hours

3.2.5 DNA constructs and mutagenesis

pCIBN-hTRF1-tagRFP-T (Addgene# 103811) was linearized by PCR amplification using

L-primers (Table 4). ING1a and -b were PCR amplified with overlapping regions to linearized vector using ING1a_Fw and ING1bb_Fw and ING1a_Re primers (Table 4) and cloned into the vector using an NEB Gibson assembly kit. The deletion of N- (residues 1-160) and C-Terminal

(residues 161-422) regions of ING1a and the intrinsically disordered region of ING1b (residues

125-200 inclusive) were performed by whole plasmid amplification using ING1aΔN, ING1aΔC and ING1bΔIDR primers, respectively (Table 4) as described before 154. The parent plasmid used as the template and the PCR reaction performed using mutagenesis primers for 15 cycles with

Hot start Q5 polymerase and the products, were digested by DpnI to remove the non-mutated methylated plasmids, for 1h at 37oC. The digested products were then transformed into chemically competent bacteria. The transformed cells were grown on LB-agar plates having 50

µg/ml kanamycin. 5-8 colonies were screened for desired mutations and the results were confirmed by automated sequencing using CMV_f and RFP_Seq_r primers (Table. 4).

Name Sequence

L_Fw GGTGGCGCTAGCGGATC

L_Re GTGCTGTTCCAGGGCCCCAAGCTTATGGTGTCTAAGGGCG

ING1a_Fw GAACCGTCAGATCCGCTAGCGCCACCATGTCCTTCGTGGAATGTCCTTATC

ING1b_Fw GAACCGTCAGATCCGCTAGCGCCACCATGTTGAGTCCTGCCAACG

ING1_Re CATAAGCTTGGGGCCCTGGAACAGCACCTCCAGCCTGTTGTAAGCCCTCTC

ING1aΔN_Fw CTAGCGCCACCATGCCGCGACCCGC

ING1aΔN_Re GCGGGTCGCGGCATGGTGGCGCTAG

ING1aΔC_Fw GTTCGGACCGCCTCCTGGAGGTGCTGTTC

ING1aΔC_Re GAACAGCACCTCCAGGAGGCGGTCCGAAC

ING1bΔIDR_Fw GACACAGCGGGCAACGCCGACCTCCCCAT

ING1bΔIDR_Re ATGGGGAGGTCGGCGTTGCCCGCTGTGTC

CMV_f TGTCGTAACAACTCCGCC

RFP_seq_r CTCGACCACCTTGATTCTC

Table 4. List of primers and their sequences

3C TagRFP TagRFP

3C SAD ING1 CD IDR TagRFP ING1a-TagRFP 3C SAD TagRFP ING1a Δ C terminal-TagRFP

3C ING1 CD IDR TagRFP ING1a Δ N terminal-TagRFP 3C PIP ING1 CD IDR TagRFP ING1b-TagRFP 3C PIP ING1 CD TagRFP ING1b Δ IDR-TagRFP

Figure 13. Diagram of ING1-TagRFP expression constructs Expression constructs were created such that ING1 isoforms were tagged with Red Fluorescent Protein (TagRFP) and contained or lacked the senescence associated domain (SAD), the ING1 common domain (ING1 CD), and the intrinsically disordered region (IDR).

3.3.6 Plasmid preparation

Small scale plasmid preparations were done using the Qiagen Miniprep plasmid preparation kits according to manufacturer’s instructions. Large scale plasmid preparations were

71 done using the Takara Bio NucleoBond Xtra Midi plus kit. They are based on modified alkaline lysis procedure, followed by binding of plasmid DNA to an anion-exchange resin. Plasmid DNA was then eluted with either TE buffer or Optimem (pH 8.0) after washing the column with appropriate buffer.

3.2.7 Immunofluorescence sample preparation and imaging.

Cells that were stained for mitochondria were incubated with MitoTracker diluted at

1/5,000 in fresh media for 20 minutes at 37 degrees. They were rinsed with fresh media then allowed to recover for 30 minutes in the incubator. Cells were fixed in 2% PFA for 10 minutes at room temperature, the aldehyde was quenched by two washes with PBS containing 50 mM glycine. Cells were permeabilized with 0.5% Triton-X100 for 5 minutes and rinsed twice with

PBS containing 50 mM glycine. DNA was stained with Hoechst 33342 dye. Cells were imaged using a Zeiss LSM880 equipped with an Airyscan detector.

3.2.8 Viability assay

Hs68, U2OS, Macaca and Great Dane cells were seeded in black 96 well plates and were grown for 24 h before being transduced with adenoviral vectors expressing GFP, ING1a and

ING1b as previously described 121. Cells were cultured for 48 h after transduction and viability assays were performed using HS Alamar Blue dye. In brief, dye diluted 10 times in growth media was added to the cells, which were incubated for 2-3 h before the amount of reduced dye was measured with a plate fluorimeter using excitation at 560 nm and emission at 590 nm. The fluorescent readout of each cell type was normalized to the readout of the cells transduced with

GFP expressing adenoviral vectors

3.3 Results

3.3.1 Predicted biophysical properties of ING1 isoforms

The two ING1 isoforms share the C-terminal region of the protein, spanning 236 amino acids. This region encodes multiple functional domains including the partial bromodomain, the lamin interacting domain, the nuclear and nucleolar localization signal, the plant homeodomain, and a polybasic region. The isoforms differ in their N-terminal regions. ING1a has a long, N- terminal region spanning 186 amino acids, which we’ve termed the SAD. The N-terminal region of ING1b contains the PCNA-interacting protein motif that is essential to its role in the DNA damage response.

Figure 14a shows the charge distribution across the sequence of both isoforms. The ING1 common region has an isoelectric point (pI) of 8.6. The overall positively charged SAD increases the pI of ING1a to 9.3, whereas the highly negatively charged N-terminal region of ING1b decreases the proteins average pI to 6.7. These differences in pI may reflect the different cellular localizations of the two isoforms. The Kyte and Doolittle hydrophobicity score is plotted across the sequence of ING1a and ING1b in Figure 14b. The ING1 common region is overall hydrophobic, characteristic of globular proteins, as is the N-terminal region of ING1b.

Alternatively, the SAD of ING1a has a significant number of hydrophilic residues contributing to its extended structure. Finally, an intrinsic disorder prediction score was also plotted across the sequence of both isoforms (Figure 14c). Intrinsic disorder refers to a protein’s propensity to adopt multiple different configurations instead of one stable structure. The ING1 common region has an intrinsically disordered that spans the NLS. These biophysical properties influence secondary and tertiary protein structure and likely affect the activity of the two ING1 isoforms.

Figure 14. Biophysical Properties of ING1 isoforms, ING1a and ING1b. (a) Charge distribution is plotted across the protein sequence using EMBOSS, (b) Kyte and Doolittle hydrophobicity score is plotted across the sequence of the protein, (c) Intrinsic disorder prediction score is plotted across the sequence of the protein using IUPred2.

3.3.2 Effect of ING1a expression of cell growth and metabolism

Next, the total metabolic activity was measured using Alamar Blue to estimate the effect of ING1a expression on cells from different species (Figure 15). Alamar blue is a redox indicator that gives fluorescence and visible color changes in response to cellular metabolic activity and is used as a read out for cellular viability. Compared to adeno-GFP infected cells, normal human

Hs68 skin fibroblasts infected with adeno-ING1a-GFP showed a decrease in total metabolic activity, as did Macaca mulatta fibroblasts (AGO6249 cells). However, both murine fibroblasts

74 and fibroblasts derived from Great Danes (GD) were not inhibited by human ING1a and canine cells in fact showed an increase in cell growth compared to GFP expressing cells. Immortalized human U2OS osteosarcoma cells also showed a decrease in total metabolic activity when expressing ING1a.

✱✱✱

y GFP t i s 1.2 ING1a n e t n I

e ✱✱✱ ✱✱✱ ✱✱✱ ns c n e c

s 1.0 e r o u l F

d e z i l a 0.8 m r o N

8 9 F t 6 S 4 s s O 2 E la H 2 6 M b U 0 o G r A ib F D G

Figure 15. Effects of ING1 overexpression on cell growth. The overall metabolic capacity of human (Hs68), rhesus (AG06249) and Great Dane (GD) fibroblasts, and human osteosarcoma (U2OS) cells examined using an Alamar Blue assay.

The ING1a and ING1b proteins only differ in their amino termini. To test the function of the unique ING1a N-terminal domain, I transfected cells with expression constructs containing or lacking this region, tagged with red fluorescent protein (TagRFP-T). I measured and

75 compared the ratios of cells transfected with constructs expressing TagRFP (control), ING1a-

TagRFP and ING1aΔC-TagRFP to total number of cells at 16 and 40 hours (Figure 16). Only cells transfected with ING1a-TagRFP construct showed a significant decrease in the ratios of transfected to total cell number from 16 h to 40 h that is in line with our Alamar Blue assay.

While there is not a statistically significant difference between the ratios of transfected cells in population transfected with ING1aΔC-TagRFP, the decrease in cell growth is evident.

s ✱✱ l l 16h e

c 0.4

l 40h a t o t

o t

d e t c e f s n a r 0.2 T

f o

o i t a R

P P P F F F R R R g g g a a a T -T T a - 1 C Δ G a IN 1 G IN

Figure 16. Effect of plasmid transfection on cell growth Cells were nucleofected by constructs coding the TagRFP, ING1a-TagRFP, and ING1a∆C- TagRFP and after 16 or 40 hours, cells were stained with Hoechst 33342 and imaged on a Zeiss LSM880 confocal microscope.

3.3.3 Cellular localization of ING1a domains

To further examine the localization and mechanism of the action of these protein constructs, cells transfected were studied using Airyscan super-resolution imaging. The TagRFP

76 control protein was distributed evenly throughout the cytoplasm and nucleus, indicating that the

RFP protein has no effect on the tagged protein’s localization. I observed a dual localization of

ING1a-TagRFP with both nuclear and cytosolic distribution whereas the ING1aΔC-TagRFP was entirely cytosolic and strongly reminiscent of mitochondria localized proteins. It is noteworthy that unlike ING1b, the nuclear fraction of ING1a is not mostly partitioned to nucleoli but mainly distributes through the nucleoplasm. In contrast, ING1a lacking the unique region (ING1a∆N-

RFP) localized exclusively to the nucleus, with significant enrichment in the nucleolus and the tagged unique region (ING1a∆C-RFP) localized only to the cytoplasm, most likely since it lacks an NLS (Figure 17).

To follow up on this observation, I decided to investigate the co-localization of the expressed proteins with mitochondria using the MitoTracker far red fluorescent dye. TagRFP control protein was again localized evenly throughout the cytoplasm and nucleus of the fibroblasts, while ING1a-RFP formed foci in the cytoplasm that distinctly co-localized with mitochondria and a fraction of the protein that localized to the nucleus. It is noteworthy that unlike ING1b, the nuclear fraction of ING1a is not mostly partitioned to nucleoli but mainly distributes throughout the nucleoplasm. In contrast, ING1a lacking the unique region (ING1a∆N-

RFP) again localized exclusively to the nucleus, with significant enrichment in the nucleolus. In contrast the tagged unique region (ING1a∆C-RFP) localized only to the mitochondria (Figure

18). Despite an entirely mitochondrial localization of ING1aΔC-TagRFP we could not find any evidence of a putative mitochondrial localization sequence using well-established protein sorting prediction suits (iPSORT, MitoProt II, MitoFates or TargetP). One of our future directions is to further analyze this sequence to identify a minimal mitochondrial targeting domain.

H33342 RFP Merged

TagRFP

ING1a-TagRFP

Δ N terminal ING1a- TagRFP

Δ C terminal ING1a - TagRFP

Figure 17. Cellular localization of ING1a and its SAD or C-terminal domains. U2OS cells were nucleofected with constructs encoding the desired protein fused to TagRFP fluorescent protein and after 24 hours cells were stained with Hoechst 33342 and imaged using an Airyscan Zeiss super-resolution microscope.

H33342 RFP MitoTracker Merged

TagRFP

ING1a-TagRFP

ING1aΔC-TagRFP

ING1aΔN-TagRFP

Figure 18. Mitochondrial localization of ING1a and its SAD or C-terminal domains. Human fibroblast cells were nucleofected with constructs encoding the desired protein fused to TagRFP fluorescent protein and after 24 hours cells were stained with Hoechst 33342 and imaged using an Airyscan Zeiss super-resolution microscope.

In order to study the effect of the intrinsically disordered region on the localization of

ING1b, I transfected U2Os cells with expression constructs containing or lacking this region, tagged with TagRFP (Figure 19). Wild type ING1b co-localized exclusively to the nucleus with foci in the nucleolus. When ING1b is expressed without the IDR, it was still localized to the nucleus, but it was no longer translocated to the nucleolus. This may be due to the disruption of

79 the highly basic nucleolar localization signal, or its impaired ability to phase separate into the nucleolus, characteristic of intrinsically disordered proteins.

H33342 TagRFP Merge

ING1b- TagRFP

Δ IDR ING1b- TagRFP

Figure 19. Cellular localization of ING1b with or without the deletion of the IDR region. U2OS cells were nucleofected with constructs encoding the desired protein fused to TagRFP fluorescent protein and after 24 hours cells were stained with Hoechst 33342 and imaged using an Airyscan Zeiss super-resolution microscope.

3.4 Discussion

To better understand how ING1a affects cell growth in different species, I ectopically expressed ING1a in primary cells from humans, macaca, canine, and mouse, as well as in human cancer cells and measured cellular metabolism. As I previously showed, ING1a is only encoded in humans and closely related primates. Interestingly, while ING1 suppressed metabolic activity in normal and cancer human cells, and primate cells, it had no effect on mouse cells and

80 increased metabolic activity in canines. Further work is required to understand the mechanisms responsible for these observations. It’s possible that ING1a cannot interact with downstream signaling molecules in more distantly related animals.

Although ING1a and ING1b are similar in sequence and structure, they have different localization patterns and at times opposing functions. An analysis of the biochemical properties of the two isoforms reveal interesting differences between the proteins. For instance, ING1a has an 9.3 isoelectric point of whereas ING1b’s is 6.7. ING1b has a relatively hydrophobic index, which could translate into a globular fold. While the common C-terminal region of ING1a is also hydrophobic, its unique N-terminal region is more hydrophilic, suggesting it may adopt a more extended conformation. Finally, both ING1a and ING1b have a predicted intrinsically disordered region. Proteins with these regions have a tendency to phase-separate into different compartments.

Next, to understand how these difference in structure affected the proteins cellular localization, we created expression constructs containing or lacking ING1a’s unique SAD region with TagRFP. Interestingly, both ING1a and the SAD region alone localized to the mitochondria.

A previous study reported ING1 localization to the mitochondria in response to UV stress43.

Immunofluorescence preformed in this study relied on an antibody against the ING1 common region, and therefore it does not distinguish between ING1a and ING1b. They attribute this targeting to short sequence adjacent to the Ser199 residue responsible for 14-3-3 binding that shows a high degree of homology to previously characterized BH3 domains. However, our observations suggest that the SAD region is targeted to the mitochondria even in the absence of the common region, and that deletion of the SAD resulted in exclusively nuclear localization.

Based on microscopy data, we cannot conclusively determine whether ING1a and the SAD domain are tether to the outside of the mitochondria membrane or if they are translocated to the intermembrane space or mitochondrial matrix. While ING1a encodes no canonical mitochondrial targeting sequence, this is not uncommon for mitochondrial proteins.

In silico analysis of yeast interactome studies show that ING homologues interact with 64 mitochondrial proteins with human counterparts. While ING1a does not have a yeast counterpart, it shares many common functional domains, suggesting it may physically interact with mitochondrial proteins in human cells. The role of ING1a in the mitochondria and whether it is related to ING1a’s senescence-inducing activity remains unclear. Preliminary observations suggest it may cause disruption in mitochondrial network and change in the mitochondrial morphology. Upon transfection with both ING1a and the SAD region, the mitochondrial becomes more fragmented. This is consistent with observations from a previous report suggests that senescent cells showed altered mitochondrial morphology, indicative of a more complex mitochondrial network. We also detected increased mitochondrial potential in senescent cells, which can be a result of increased respiratory chain activity155.

Finally, I investigated the role of the IDR in ING1b localization. Despite the classical structure-function paradigm (sometimes termed the “lock-and-key” model), in which a unique biological function of a protein is defined by its specific, highly structured state determined by the amino acid sequence. However, recent work has shown structure-independent functions for intrinsically disordered proteins (IDPs) or protein hybrids that contain both intrinsically disordered protein regions (IDPRs) and ordered domains. The high conformational flexibility of these proteins makes them extremely versatile. Furthermore, IDPs have been shown to play an

82 essential role in the liquid-liquid phase separation-driven formation of various proteinaceous membrane-less organelles (PMLOs), such as the nucleolus. Analyses of the biochemical properties of ING1 reveal a predicted intrinsically disordered region which overlaps with the

NLS and the NTS. When full length ING1b-TagRPF was expressed in U2OS cells, it localized to the nucleus with foci in the nucleolus. ING1 lacking the N-terminal region showed a similar pattern. This supports previous observations that ING1b plays a role in rRNA regulation in the nucleolus. However, when the IDR was deleted, ING1b still localized to the nucleus but was not translocated to the nucleolus. Further work is required to determine if the IDR plays a role in the ability of ING1b to phase separate into the nucleolus.

Chapter 4. Conclusions and Future Work

4.1 Summary of findings

The ING family of tumor suppressors have emerged as a versatile family of phospholipid effectors, histone mark sensors, and growth regulators. An updated phylogenetic analysis of this protein family using sequences from 42 eukaryotic species reveals that ING4 is likely most similar to the ancestral ING protein, not ING3 as previously reported. Previous studies have shown that the ING1 isoforms, ING1a and ING1b differentially regulate apoptosis and senescence in primary cells. To identify ING1a homologs in other species all available databases were searched and sequences corresponding to ING1a were only found in great apes and old- world monkeys. Only select primates had start codons capable of encoding full-length ING1a.

Ectopic ING1a expression resulted in decreased metabolic activity in human and primate cells, not in mouse or canine cells. When ING1a was expressed with and without it’s unique N- terminal sequence, it affected its localization to the mitochondria. Given the natural induction of

83 this isoform as cells age in culture, expression of ING1a may serve to help limit the replicative lifespan of cells from long-lived primates, in part through its activity in the mitochondria.

4.2 Future directions

4.2.1 Understand mechanism by which ING1a affects growth

ING1a is encoded only in human and closely related primates. Interestingly, when ING1a is ectopically expressed in different cell types, it only affects metabolic activity in human and primate cells. The mechanism by which ING1a affects metabolism is still unclear, as is the reason for the different effects in different cell types. Going forward we would like to try to study the differential ING1a effects on mitochondrial function among human and lower mammals.

4.2.2 Minimal mitochondrial targeting sequence

Despite an entirely mitochondrial localization of ING1aΔC-TagRFP we could not find any evidence of a putative mitochondrial localization sequence using the well-established protein sorting prediction suits iPSORT, MitoProt II, MitoFates or TargetP. Going forward, we will perform further in silico and in vivo analyses to identify the minimal targeting domain. For instance, we will search for amphipathic helices, which are characteristic of mitochondrial proteins. By expressing the SAD domain with different short deletions, we should be able to identify which part of the 188 amino acid region is essential for mitochondrial localization.

4.2.3 Role of ING1a in the mitochondria

While our results clearly show that ING1a is targeted to the mitochondria, in part due to the SAD, the role of ING1a in the mitochondria is still unclear. Previous studies have reported

ING1 targeting to the mitochondria in response to UV stress, however these studies did not differentiate between the two isoforms as there are currently no available antibodies to differentiate the two. Our group is in the process of developing an ING1a-specific antibody that will be a valuable tool to determine under which conditions ING1a is expressed and targeted to the mitochondria. To further examine the effects of ING1a in the mitochondria, we intend to measure mitochondria membrane potential, mitochondrial fragmentation, and ATP synthesis in response to ectopic ING1a expression.

4.2.4 Identify binding partners of ING1 isoforms

Identifying proteins that differentially bind ING1a and ING1b will provide us with significant insight into their cellular localization. For instance, identifying nuclear, cytosolic or mitochondrial binding partners will tell us a great deal about where these proteins are active.

Identifying interacting proteins will also provide clues as to which molecular pathways these isoforms are players in. We intend to identify the interactomes of these proteins by affinity purification followed by mass spectrometry. We will pull down the RFP-tagged constructs we’ve created using an RFP-trap system. This system uses and RFP nanobody conjugated to a magnetic agarose bead. Preliminary attempts at the pull down were unsuccessful as plasmid transfection yields very low expression of ING1a compared to other proteins. We therefore plan to package these constructs in adenovirus in order to increase expression levels.

References

1. Garkavtsev I, Grigorian IA, Ossovskaya VS, Chernov M V., Chumakov PM, Gudkov A V. The candidate tumour suppressor p33 ING1 cooperates with p53 in cell growth control. Nature. 1998;391(6664):295-298. doi:10.1038/34675 2. Toyama T, Iwase H, Watson P, et al. Suppression of ING1 expression in sporadic breast cancer. Oncogene. 1999;18(37):5187-5193. doi:10.1038/sj.onc.1202905 3. Tallen G, Riabowol K. Keep-ING balance: Tumor suppression by epigenetic regulation. FEBS Lett. 2014;588(16):2728-2742. doi:10.1016/j.febslet.2014.03.011 4. Soliman MA, Riabowol K. After a decade of study-ING, a PHD for a versatile family of proteins. Trends Biochem Sci. 2007;32(11):509-519. doi:10.1016/j.tibs.2007.08.006 5. Hanahan D, Weinberg RA. Hallmarks of cancer: The next generation. Cell. 2011;144(5):646-674. doi:10.1016/j.cell.2011.02.013 6. He GHY, Helbing CC, Wagner MJ, Sensen CW, Riabowol K. Phylogenetic Analysis of the ING Family of PHD Finger Proteins. Mol Biol Evol. 2005;22(1):104-116. doi:10.1093/molbev/msh256 7. Peña P V., Davrazou F, Shi X, et al. Molecular mechanism of histone H3K4me3 recognition by plant homeodomain of ING2. Nature. 2006;442(7098):100-103. doi:10.1038/nature04814 8. Champagne K, Kutateladze T. Structural Insight Into Histone Recognition by the ING PHD Fingers. Curr Drug Targets. 2009;10(5):432-441. doi:10.2174/138945009788185040 9. Shi X, Hong T, Walter KL, et al. ING2 PHD domain links histone H3 lysine 4 methylation to active gene repression. Nature. 2006;442(7098):96-99. doi:10.1038/nature04835 10. Shi X, Kachirskaia I, Walter KL, et al. Proteome-wide analysis in Saccharomyces cerevisiae identifies several PHD fingers as novel direct and selective binding modules of histone H3 methylated at either lysine 4 or lysine 36. J Biol Chem. 2007;282(4):2450- 2455. doi:10.1074/jbc.C600286200 11. Han X, Feng X, Rattner JB, et al. Tethering by lamin A stabilizes and targets the ING1 tumour suppressor. Nat Cell Biol. 2008;10(11):1333-1340. doi:10.1038/ncb1792

12. Vieyra D, Senger DL, Toyam T, et al. Altered Subcellular Localization and Low Frequency of Mutations of ING1 in Human Brain Tumors. Clin Cancer Res. 2003;9(16):5952-5961. 13. Nouman GS, Anderson JJ, Wood KM, et al. Loss of nuclear expression of the p33ING1b inhibitor of growth protein in childhood acute lymphoblastic leukaemia. J Clin Pathol. 2002;55(8):596-601. doi:10.1136/jcp.55.8.596 14. Sayan B, Emre NCT, Irmak MB, Ozturk M, Cetin-Atalay R. Nuclear exclusion of p33ING1b tumor suppressor protein: Explored in HCC cells using a new highly specific antibody. Hybridoma. 2009;28(1):1-6. doi:10.1089/hyb.2008.0058 15. Zhang JT, Wang DW, Li QX, et al. Nuclear to cytoplasmic shift of p33ING1b protein from normal oral mucosa to oral squamous cell carcinoma in relation to clinicopathological variables. J Cancer Res Clin Oncol. 2008;134(3):421-426. doi:10.1007/s00432-007-0305-y 16. Li XH, Noguchi A, Nishida T, et al. Cytoplasmic expression of ING1b is correlated with tumorigenesis and progression of head and neck squamous cell carcinoma. Histol Histopathol. 2011;26(5):597-607. doi:10.14670/HH-26.597 17. Li XH, Kikuchi K, Zheng Y, et al. Downregulation and translocation of nuclear ING4 is correlated with tumorigenesis and progression of head and neck squamous cell carcinoma. Oral Oncol. 2011;47(3):217-223. doi:10.1016/j.oraloncology.2011.01.004 18. Guérillon C, Larrieu D, Pedeux R. ING1 and ING2: Multifaceted tumor suppressor genes. Cell Mol Life Sci. 2013;70(20):3753-3772. doi:10.1007/s00018-013-1270-z 19. Palacios A, Moreno A, Oliveira BL, et al. The dimeric structure and the bivalent recognition of H3K4me3 by the tumor suppressor ING4 suggests a mechanism for enhanced targeting of the HBO1 complex to chromatin. J Mol Biol. 2010;396(4):1117- 1127. doi:10.1016/j.jmb.2009.12.049 20. Culurgioni S, Muñoz IG, Moreno A, et al. Crystal structure of inhibitor of growth 4 (ING4) dimerization domain reveals functional organization of ING family of chromatin- binding proteins. J Biol Chem. 2012;287(14):10876-10884. doi:10.1074/jbc.M111.330001 21. Wang Y, Wang J, Li G. Leucine zipper-like domain is required for tumor suppressor ING2-mediated nucleotide excision repair and apoptosis. FEBS Lett. 2006;580(16):3787-

3793. doi:10.1016/j.febslet.2006.05.065 22. Kaadige MR, Ayer DE. The polybasic region that follows the plant homeodomain zinc finger 1 of Pf1 is necessary and sufficient for specific phosphoinositide binding. J Biol Chem. 2006;281(39):28831-28836. doi:10.1074/jbc.M605624200 23. Thalappilly S, Feng X, Pastyryeva S, et al. The p53 Tumor Suppressor Is Stabilized by Inhibitor of Growth 1 (ING1) by Blocking Polyubiquitination. Gaetano C, ed. PLoS One. 2011;6(6):e21065. doi:10.1371/journal.pone.0021065 24. Scott M, Bonnefin P, Vieyra D, et al. UV-induced binding of ING1 to PCNA regulates the induction of apoptosis. J Cell Sci. 2001;114(19):3455-3462. 25. Unoki M, Kumamoto K, Robles AI, Shen JC, Zheng ZM, Harris CC. A novel ING2 isoform, ING2b, synergizes with ING2a to prevent cell cycle arrest and apoptosis. FEBS Lett. 2008;582(28):3868-3874. doi:10.1016/j.febslet.2008.10.024 26. Kouzarides T. Chromatin Modifications and Their Function. Cell. 2007;128(4):693-705. doi:10.1016/j.cell.2007.02.005 27. Loewith R, Meijer M, Lees-Miller SP, Riabowol K, Young D. Three yeast proteins related to the human candidate tumor suppressor p33(ING1) are associated with histone acetyltransferase activities. Mol Cell Biol. 2000;20(11):3807-3816. 28. Loewith R, Smith JS, Meijer M, et al. Pho23 Is Associated with the Rpd3 Histone Deacetylase and Is Required for Its Normal Function in Regulation of Gene Expression and Silencing in Saccharomyces cerevisiae. J Biol Chem. 2001;276(26):24068-24074. doi:10.1074/jbc.M102176200 29. Feng X, Hara Y, Riabowol KT. Different HATS of the ING1 gene family. Trends Cell Biol. 2002;12(11):532-538. doi:10.1016/S0962-8924(02)02391-7 30. Kuzmichev A, Zhang Y, Erdjument-Bromage H, Tempst P, Reinberg D. Role of the Sin3- histone deacetylase complex in growth regulation by the candidate tumor suppressor p33(ING1). Mol Cell Biol. 2002;22(3):835-848. 31. Doyon Y, Cayrou C, Ullah M, et al. ING tumor suppressor proteins are critical regulators of chromatin acetylation required for genome expression and perpetuation. Mol Cell. 2006;21(1):51-64. doi:10.1016/j.molcel.2005.12.007 32. Garkavtsev I, Riabowol K. Extension of the replicative life span of human diploid

fibroblasts by inhibition of the p33ING1 candidate tumor suppressor. Mol Cell Biol. 1997;17(4):2014-2019. doi:10.1128/MCB.17.4.2014 33. Rajarajacholan UK, Riabowol K. Aging with ING: a comparative study of different forms of stress induced premature senescence. Oncotarget. 2015;6(33):34118-34127. doi:10.18632/oncotarget.5947 34. Abad M, Menéndez C, Füchtbauer A, Serrano M, Füchtbauer EM, Palmero I. Ing1 mediates p53 accumulation and chromatin modification in response to oncogenic stress. J Biol Chem. 2007;282(42):31060-31067. doi:10.1074/jbc.M701639200 35. Abad M, Moreno A, Palacios A, et al. The tumor suppressor ING1 contributes to epigenetic control of cellular senescence. Aging Cell. 2011;10(1):158-171. doi:10.1111/j.1474-9726.2010.00651.x 36. Pedeux R, Sengupta S, Shen JC, et al. ING2 Regulates the Onset of Replicative Senescence by Induction of p300-Dependent p53 Acetylation. Mol Cell Biol. 2005;25(15):6639-6648. doi:10.1128/mcb.25.15.6639-6648.2005 37. Maga G, Hübscher U. Proliferating cell nuclear antigen (PCNA): A dancer with many partners. J Cell Sci. 2003;116(15):3051-3060. doi:10.1242/jcs.00653 38. Cheung K-J, Mitchell D, Lin P, Li G. The Tumor Suppressor Candidate P33 ING1 Mediates Repair of UV-Damaged DNA 1. Vol 61.; 2001. 39. Kuo WHW, Wang Y, Wong RPC, Campos EI, Li G. The ING1b tumor suppressor facilitates nucleotide excision repair by promoting chromatin accessibility to XPA. Exp Cell Res. 2007;313(8):1628-1638. doi:10.1016/j.yexcr.2007.02.010 40. Ronald P. C. Wong HLSKBPSMJDWCCGL. Tumour suppressor ING1b maintains genomic stability upon replication stress. Nucleic Acids Res. 2013;1(1256879):13-14. doi:10.1093/nar 41. Wang J, Chin MY, Li G. The novel tumor suppressor p33ING2 enhances nucleotide excision repair via inducement of histone H4 acetylation and chromatin relaxation. Cancer Res. 2006;66(4):1906-1911. doi:10.1158/0008-5472.CAN-05-3444 42. Nagashima M, Shiseki M, Miura K, et al. DNA damage-inducible gene p33ING2 negatively regulates cell proliferation through acetylation of p53. Proc Natl Acad Sci U S A. 2001;98(17):9671-9676. doi:10.1073/pnas.161151798

43. Bose P, Thakur S, Thalappilly S, et al. ING1 induces apoptosis through direct effects at the mitochondria. Cell Death Dis. 2013;4(9):e788. doi:10.1038/cddis.2013.321 44. Wallace H, Birnstiel ML. Ribosomal cistrons and the nucleolar organizer. BBA Sect Nucleic Acids Protein Synth. 1966;114(2):296-310. doi:10.1016/0005-2787(66)90311-X 45. Budde A, Grummt I. p53 represses ribosomal gene transcription. Oncogene. 1999;18(4):1119-1124. doi:10.1038/sj.onc.1202402 46. Strohner R NAJPH-RUSRLGGI. NoRC--a novel member of mammalian ISWI-containing chromatin remodeling machines. - Abstract - Europe PMC. EMBO J. 2001;20(17):4892- 4900. 47. Uma Karthika Rajarajacholan STKR. ING1 regulates rRNA levels by altering nucleolar chromatin structure and mTOR localization. Nucleic Acid Res. 2017;45(4):1776-1792. 48. Hammond G, Thomas CL, Schiavo G. Nuclear phosphoinositides and their functions. Curr Top Microbiol Immunol. 2003;282:177-206. doi:10.1007/978-3-642-18805-3_7 49. Barlow CA, Laishram RS, Anderson RA. Nuclear phosphoinositides: a signaling enigma wrapped in a compartmental conundrum. Trends Cell Biol. 2010;20(1):25-35. doi:10.1016/j.tcb.2009.09.009 50. Gozani O, Karuman P, Jones DR, et al. The PHD finger of the chromatin-associated protein ING2 functions as a nuclear phosphoinositide receptor. Cell. 2003;114(1):99-111. doi:10.1016/S0092-8674(03)00480-X 51. Zhang L, Wang Y, Zhang F, Wang Y, Zhang Q. Correlation between tumor suppressor inhibitor of growth family member 4 expression and microvessel density in breast cancer. Hum Pathol. 2012;43(10):1611-1617. doi:10.1016/j.humpath.2011.11.018 52. Shao B, Liu E. Expression of ing4 is negatively correlated with cellular proliferation and microvessel density in human glioma. Oncol Lett. 2017;14(3):3663-3668. doi:10.3892/ol.2017.6618 53. Tallen G, Farhangi S, Tamannai M, et al. The inhibitor of growth 1 (ING1) proteins suppress angiogenesis and differentially regulate angiopoietin expression in glioblastoma cells. Oncol Res. 2009;18(2-3):95-105. doi:10.3727/096504009789954645 54. Thakur S, Singla AK, Chen J, et al. Reduced ING1 levels in breast cancer promotes metastasis. Oncotarget. 2014;5(12):4244-4256. doi:10.18632/oncotarget.1988

55. Li J, Li G. Cell cycle regulator ING4 is a suppressor of melanoma angiogenesis that is regulated by the metastasis suppressor BRMS1. Cancer Res. 2010;70(24):10445-10453. doi:10.1158/0008-5472.CAN-10-3040 56. Nashun B, Hill PW, Hajkova P. Reprogramming of cell fate: epigenetic memory and the erasure of memories past. EMBO J. 2015;34(10):1296-1308. doi:10.15252/embj.201490649 57. Berger PL, Frank SB, Schulz V V., et al. Transient induction of ING4 by Myc drives prostate epithelial cell differentiation and its disruption drives prostate tumorigenesis. Cancer Res. 2014;74(12):3357-3368. doi:10.1158/0008-5472.CAN-13-3076 58. Awe JP, Byrne JA. Identifying candidate oocyte reprogramming factors using cross- species global transcriptional analysis. Cell Reprogram. 2013;15(2):126-133. doi:10.1089/cell.2012.0060 59. Eapen SA, Netherton SJ, Sarker KP, et al. Identification of a novel function for the chromatin remodeling protein ING2 in muscle differentiation. PLoS One. 2012;7(7). doi:10.1371/journal.pone.0040684 60. Xu Z, He Y, Ju J, et al. The role of WDR5 in silencing human fetal globin gene expression. Haematologica. 2012;97(11):1632-1640. doi:10.3324/haematol.2012.061937 61. Mulder KW, Wang X, Escriu C, et al. Diverse epigenetic strategies interact to control epidermal differentiation. Nat Cell Biol. 2012;14(7):753-763. doi:10.1038/ncb2520 62. Wang F, Wang AY, Chesnelong C, et al. ING5 activity in self-renewal of glioblastoma stem cells via calcium and follicle stimulating hormone pathways. Oncogene. 2018;37(3):286-301. doi:10.1038/onc.2017.324 63. Kichina J V., Zeremski M, Aris L, et al. Targeted disruption of the mouse ing1 locus results in reduced body size, hypersensitivity to radiation and elevated incidence of lymphomas. Oncogene. 2006;25(6):857-866. doi:10.1038/sj.onc.1209118 64. Saito M, Kumamoto K, Robles AI, et al. Targeted disruption of ing2 results in defective spermatogenesis and development of soft-tissue sarcomas. Nelson B, ed. PLoS One. 2010;5(11):e15541. doi:10.1371/journal.pone.0015541 65. Coles AH, Gannon H, Cerny A, Kurt-Jones E, Jones SN. Inhibitor of growth-4 promotes IκB promoter activation to suppress NF-κB signaling and innate immunity. Proc Natl

Acad Sci U S A. 2010;107(25):11423-11428. doi:10.1073/pnas.0912116107 66. Zeremski M, Hill JE, Kwek SSS, et al. Structure and regulation of the mouse ing1 gene. Three alternative transcripts encode two PHD finger proteins that have opposite effects on p53 function. J Biol Chem. 1999;274(45):32172-32181. doi:10.1074/jbc.274.45.32172 67. Abud HE. Shaping developing tissues by apoptosis. Cell Death Differ. 2004;11(8):797- 799. doi:10.1038/sj.cdd.4401455 68. Shah S, Smith H, Feng X, Rancourt DE, Riabowol K. ING function in apoptosis in diverse model systems. Biochem Cell Biol. 2009;87(1):117-125. doi:10.1139/O08-107 69. Komarov PG, Komarova EA, Kondratov R V., et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science (80- ). 1999;285(5434):1733-1737. doi:10.1126/science.285.5434.1733 70. Coles AH, Liang H, Zhu Z, et al. Deletion of p37Ing1 in mice reveals a p53-independent role for Ing1 in the suppression of cell proliferation, apoptosis, and tumorigenesis. Cancer Res. 2007;67(5):2054-2061. doi:10.1158/0008-5472.CAN-06-3558 71. Helbing CC, Wagner MJ, Pettem K, et al. Modulation of Thyroid Hormone-Dependent Gene Expression in Xenopus laevis by INhibitor of Growth (ING) Proteins. Laudet V, ed. PLoS One. 2011;6(12):e28658. doi:10.1371/journal.pone.0028658 72. Luo J, Shah S, Riabowol K, Mains PE. The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway. Genetics. 2009;181(2):473-482. doi:10.1534/genetics.107.080515 73. Fink D, Yau T, Nabbi A, et al. Loss of ing3 expression results in growth retardation and embryonic death. Cancers (Basel). 2020;12(1):80. doi:10.3390/cancers12010080 74. Doyon Y, Selleck W, Lane WS, Tan S, Côté J. Structural and Functional Conservation of the NuA4 Histone Acetyltransferase Complex from Yeast to Humans. Mol Cell Biol. 2004;24(5):1884-1896. doi:10.1128/mcb.24.5.1884-1896.2004 75. Kueh AJ, Dixon MP, Voss AK, Thomas T. HBO1 Is Required for H3K14 Acetylation and Normal Transcriptional Activity during Embryonic Development. Mol Cell Biol. 2011;31(4):845-860. doi:10.1128/mcb.00159-10 76. Ormaza G, Rodríguez JA, Ibáñez de Opakua A, et al. The Tumor Suppressor ING5 Is a Dimeric, Bivalent Recognition Molecule of the Histone H3K4me3 Mark. J Mol Biol.

2019;431(12):2298-2319. doi:10.1016/j.jmb.2019.04.018 77. López-Otín C, Blasco MA, Partridge L, Serrano M, Kroemer G. The Hallmarks of Aging. Cell. 2013;153(6):1194-1217. doi:10.1016/J.CELL.2013.05.039 78. Niccoli T, Partridge L. Ageing as a Risk Factor for Disease. Curr Biol. 2012;22(17):R741- R752. doi:10.1016/j.cub.2012.07.024 79. Ungewitter E, Scrable H. Antagonistic pleiotropy and p53. Mech Ageing Dev. 2009;130(1-2):10-17. doi:10.1016/J.MAD.2008.06.002 80. Giaimo S, d’Adda di Fagagna F. Is cellular senescence an example of antagonistic pleiotropy? Aging Cell. 2012;11(3):378-383. doi:10.1111/j.1474-9726.2012.00807.x 81. Sharpless NE, Bardeesy N, Lee K-H, et al. Loss of p16Ink4a with retention of p19Arf predisposes mice to tumorigenesis. Nature. 2001;413(6851):86-91. doi:10.1038/35092592 82. Baker DJ, Wijshake T, Tchkonia T, et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 2011;479(7372):232-236. doi:10.1038/nature10600 83. Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961;25(3):585-621. doi:10.1016/0014-4827(61)90192-6 84. Harley CB, Futcher AB, Greider CW. Telomeres shorten during ageing of human fibroblasts. Nature. 1990;345(6274):458-460. doi:10.1038/345458a0 85. d’Adda di Fagagna F, Teo S-H, Jackson SP. Functional links between telomeres and proteins of the DNA-damage response. Genes Dev. 2004;18(15):1781-1799. doi:10.1101/gad.1214504 86. Atadja P, Wong H, Garkavtsev I, Veillette C, Riabowol K. Increased activity of p53 in senescing fibroblasts. Proc Natl Acad Sci U S A. 1995;92(18):8348-8352. doi:10.1073/PNAS.92.18.8348 87. Vaziri H, West MD, Allsopp RC, et al. ATM-dependent telomere loss in aging human diploid fibroblasts and DNA damage lead to the post-translational activation of p53 protein involving poly(ADP-ribose) polymerase. EMBO J. 1997;16(19):6018-6033. doi:10.1093/emboj/16.19.6018 88. Parrinello S, Samper E, Krtolica A, Goldstein J, Melov S, Campisi J. Oxygen sensitivity severely limits the replicative lifespan of murine fibroblasts. Nat Cell Biol. 2003;5(8):741-

747. doi:10.1038/ncb1024 89. Suzuki K, Mori I, Nakayama Y, Miyakoda M, Kodama S, Watanabe M. Radiation- induced senescence-like growth arrest requires TP53 function but not telomere shortening. Radiat Res. 2001;155(1 Pt 2):248-253. 90. Bartkova J, Rezaei N, Liontos M, et al. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature. 2006;444(7119):633-637. doi:10.1038/nature05268 91. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW. Oncogenic ras Provokes Premature Cell Senescence Associated with Accumulation of p53 and p16INK4a. Cell. 1997;88(5):593-602. doi:10.1016/S0092-8674(00)81902-9 92. Dierick J-F, Eliaers F, Remacle J, et al. Stress-induced premature senescence and replicative senescence are different phenotypes, proteomic evidence. Biochem Pharmacol. 2002;64(5-6):1011-1017. doi:10.1016/S0006-2952(02)01171-1 93. Storer M, Mas A, Robert-Moreno A, et al. Senescence is a developmental mechanism that contributes to embryonic growth and patterning. Cell. 2013;155(5):1119-1130. doi:10.1016/j.cell.2013.10.041 94. Muñoz-Espín D, Cañamero M, Maraver A, et al. Programmed cell senescence during mammalian embryonic development. Cell. 2013;155(5):1104-1118. doi:10.1016/j.cell.2013.10.019 95. Jun J-I, Lau LF. Cellular senescence controls fibrosis in wound healing. Aging (Albany NY). 2010;2(9):627-631. doi:10.18632/aging.100201 96. Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 1995;92(20):9363-9367. doi:10.1073/PNAS.92.20.9363 97. Baker DJ, Perez-Terzic C, Jin F, et al. Erratum: Opposing roles for p16Ink4a and p19Arf in senescence and ageing caused by BubR1 insufficiency. Nat Cell Biol. 2012;14(6):649- 649. doi:10.1038/ncb2519 98. Sousa-Victor P, Gutarra S, García-Prat L, et al. Geriatric muscle stem cells switch reversible quiescence into senescence. Nature. 2014;506(7488):316-321. doi:10.1038/nature13013

99. Herbig U, Ferreira M, Condel L, Carey D, Sedivy JM. Cellular Senescence in Aging Primates. Science (80- ). 2006;311(5765):1257-1257. doi:10.1126/science.1122446 100. Jeyapalan JC, Ferreira M, Sedivy JM, Herbig U. Accumulation of senescent cells in mitotic tissue of aging primates. Mech Ageing Dev. 2007;128(1):36-44. doi:10.1016/J.MAD.2006.11.008 101. Coppé J-P, Patil CK, Rodier F, et al. Senescence-Associated Secretory Phenotypes Reveal Cell-Nonautonomous Functions of Oncogenic RAS and the p53 Tumor Suppressor. Downward J, ed. PLoS Biol. 2008;6(12):e301. doi:10.1371/journal.pbio.0060301 102. Cristofalo VJ, Pignolo RJ. Molecular markers of senescence in fibroblast-like cultures. Exp Gerontol. 31(1-2):111-123. 103. Kurz DJ, Decary S, Hong Y, Erusalimsky JD. Senescence-associated (beta)-galactosidase reflects an increase in lysosomal mass during replicative ageing of human endothelial cells. J Cell Sci. 2000;113 ( Pt 20):3613-3622. 104. Chicas A, Wang X, Zhang C, et al. Dissecting the unique role of the retinoblastoma tumor suppressor during cellular senescence. Cancer Cell. 2010;17(4):376-387. doi:10.1016/j.ccr.2010.01.023 105. Quelle DE, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell. 1995;83(6):993-1000. 106. Stein GH, Drullinger LF, Soulard A, Dulić V. Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human fibroblasts. Mol Cell Biol. 1999;19(3):2109-2117. doi:10.1128/MCB.19.3.2109 107. Sherwood SW, Rush D, Ellsworth JL, Schimke RT. Defining cellular senescence in IMR- 90 cells: a flow cytometric analysis. Proc Natl Acad Sci U S A. 1988;85(23):9086-9090. doi:10.1073/PNAS.85.23.9086 108. Choi BY, Choi HS, Ko K, et al. The tumor suppressor p16INK4a prevents cell transformation through inhibition of c-Jun phosphorylation and AP-1 activity. Nat Struct Mol Biol. 2005;12(8):699-707. doi:10.1038/nsmb960 109. Narita M, Nuñez S, Heard E, et al. Rb-Mediated Heterochromatin Formation and Silencing of E2F Target Genes during Cellular Senescence. Cell. 2003;113(6):703-716.

doi:10.1016/S0092-8674(03)00401-X 110. Özcan S, Alessio N, Acar MB, et al. Unbiased analysis of senescence associated secretory phenotype (SASP) to identify common components following different genotoxic stresses. Aging (Albany NY). 2016;8(7):1316-1329. doi:10.18632/aging.100971 111. Salminen A, Kauppinen A, Kaarniranta K. Emerging role of NF-κB signaling in the induction of senescence-associated secretory phenotype (SASP). Cell Signal. 2012;24(4):835-845. doi:10.1016/J.CELLSIG.2011.12.006 112. Nelson G, Wordsworth J, Wang C, et al. A senescent cell bystander effect: senescence- induced senescence. Aging Cell. 2012;11(2):345-349. doi:10.1111/j.1474- 9726.2012.00795.x 113. Krizhanovsky V, Yon M, Dickins RA, et al. Senescence of activated stellate cells limits liver fibrosis. Cell. 2008;134(4):657-667. doi:10.1016/j.cell.2008.06.049 114. Xue W, Zender L, Miething C, et al. Senescence and tumour clearance is triggered by p53 restoration in murine liver carcinomas. Nature. 2007;445(7128):656-660. doi:10.1038/nature05529 115. Coppé J-P, Desprez P-Y, Krtolica A, Campisi J. The Senescence-Associated Secretory Phenotype: The Dark Side of Tumor Suppression. Annu Rev Pathol Mech Dis. 2010;5(1):99-118. doi:10.1146/annurev-pathol-121808-102144 116. Childs BG, Durik M, Baker DJ, van Deursen JM. Cellular senescence in aging and age- related disease: from mechanisms to therapy. Nat Med. 2015;21(12):1424-1435. doi:10.1038/nm.4000 117. Muñoz-Espín D, Serrano M. Cellular senescence: from physiology to pathology. Nat Rev Mol Cell Biol. 2014;15(7):482-496. doi:10.1038/nrm3823 118. Brown JP, Wei W, Sedivy JM. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science. 1997;277(5327):831-834. 119. Di Micco R, Fumagalli M, Cicalese A, et al. Oncogene-induced senescence is a DNA damage response triggered by DNA hyper-replication. Nature. 2006;444(7119):638-642. doi:10.1038/nature05327 120. Beauséjour CM, Krtolica A, Galimi F, et al. Reversal of human cellular senescence: roles of the p53 and p16 pathways. EMBO J. 2003;22(16):4212-4222.

doi:10.1093/emboj/cdg417 121. Rajarajacholan UK, Thalappilly S, Riabowol K. The ING1a Tumor Suppressor Regulates Endocytosis to Induce Cellular Senescence Via the Rb-E2F Pathway. Campisi J, ed. PLoS Biol. 2013;11(3):e1001502. doi:10.1371/journal.pbio.1001502 122. Soliman MA, Berardi P, Pastyryeva S, et al. ING1a expression increases during replicative senescence and induces a senescent phenotype. Aging Cell. 2008;7(6):783-794. doi:10.1111/j.1474-9726.2008.00427.x 123. Vieyra D, Toyama T, Hara Y, Boland D, Johnston R, Riabowol K. ING1 Isoforms Differentially Affect Apoptosis in a Cell Age-Dependent Manner 1. Vol 62.; 2002. 124. Li N, Li Q, Cao X, Zhao G, Xue L, Tong T. The tumor suppressor p33ING1b upregulates p16INK4a expression and induces cellular senescence. FEBS Lett. 2011;585(19):3106- 3112. doi:10.1016/j.febslet.2011.08.044 125. Yamabhai M, Hoffman NG, Hardison NL, et al. Intersectin, a novel adaptor protein with two Eps15 homology and five Src homology 3 domains. J Biol Chem. 1998;273(47):31401-31407. 126. Tsyba L, Nikolaienko O, Dergai O, et al. Intersectin multidomain adaptor proteins: Regulation of functional diversity. Gene. 2011;473(2):67-75. doi:10.1016/j.gene.2010.11.016 127. McPherson PS, Simpson F, Hussain NK, et al. SH3-domain-containing proteins function at distinct steps in clathrin-coatedvesicle formation. Nat Cell Biol. 1999;1(2):119-124. doi:10.1038/10091 128. Park SC. Functional recovery of senescent cells through restoration of receptor-mediated endocytosis. Mech Ageing Dev. 2002;123(8):917-926. doi:10.1016/S0047- 6374(02)00029-5 129. Olszewski MB, Chandris P, Park B-C, Eisenberg E, Greene LE. Disruption of Clathrin- Mediated Trafficking Causes Centrosome Overduplication and Senescence. Traffic. 2014;15(1):60-77. doi:10.1111/tra.12132 130. Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. The Mitochondrion. 2002. 131. Gustafsson CM, Falkenberg M, Larsson N-G. Maintenance and Expression of Mammalian Mitochondrial DNA. Annu Rev Biochem. 2016;85(1):133-160. doi:10.1146/annurev-

biochem-060815-014402 132. Boveris A, Chance B. The mitochondrial generation of hydrogen peroxide. General properties and effect of hyperbaric oxygen. Biochem J. 1973;134(3):707-716. doi:10.1042/bj1340707 133. Han D, Canali R, Rettori D, Kaplowitz N. Effect of Glutathione Depletion on Sites and Topology of Superoxide and Hydrogen Peroxide Production in Mitochondria. Mol Pharmacol. 2003;64(5):1136-1144. doi:10.1124/mol.64.5.1136 134. Apel K, Hirt H. REACTIVE OXYGEN SPECIES: Metabolism, Oxidative Stress, and Signal Transduction. Annu Rev Plant Biol. 2004;55(1):373-399. doi:10.1146/annurev.arplant.55.031903.141701 135. Tait SWG, Green DR. Mitochondria and cell death: Outer membrane permeabilization and beyond. Nat Rev Mol Cell Biol. 2010;11(9):621-632. doi:10.1038/nrm2952 136. Wang C, Youle RJ. The Role of Mitochondria. Annu Rev Genet. 2009;43(1):95-118. doi:10.1146/annurev-genet-102108-134850 137. Tait SWG, Ichim G, Green DR. Die another way - non-apoptotic mechanisms of cell death. J Cell Sci. 2014;127(10):2135-2144. doi:10.1242/jcs.093575 138. Chipuk JE, Moldoveanu T, Llambi F, Parsons MJ, Green DR. The BCL-2 Family Reunion. Mol Cell. 2010;37(3):299-310. doi:10.1016/j.molcel.2010.01.025 139. Dewson G, Kratina T, Sim HW, et al. To Trigger Apoptosis, Bak Exposes Its BH3 Domain and Homodimerizes via BH3:Groove Interactions. Mol Cell. 2008;30(3):369-380. doi:10.1016/j.molcel.2008.04.005 140. Balaban RS, Nemoto S, Finkel T. Mitochondria, oxidants, and aging. Cell. 2005;120(4):483-495. doi:10.1016/j.cell.2005.02.001 141. Hajhashemi V, Vaseghi G, Pourfarzam M, Abdollahi A. Are antioxidants helpful for disease prevention? Res Pharm Sci. 2010;5(1):5-12. 142. Acosta JC, Banito A, Wuestefeld T, et al. A complex secretory program orchestrated by the inflammasome controls paracrine senescence. Nat Cell Biol. 2013;15(8):978-990. doi:10.1038/ncb2784 143. RG A, M T, BP K, DL D, VJ C. Differences in Electron Transport Potential, Antioxidant Defenses, and Oxidant Generation in Young and Senescent Fetal Lung Fibroblasts (WI-

38). J Cell Physiol. 1999;180(1). doi:10.1002/(SICI)1097-4652(199907)180:1<114::AID- JCP13>3.0.CO;2-0 144. Hutter E, Renner K, Pfister G, Stöckl P, Jansen-Dürr P, Gnaiger E. Senescence-associated changes in respiration and oxidative phosphorylation in primary human fibroblasts. Biochem J. 2004;380(3):919-928. doi:10.1042/BJ20040095 145. Hütter E, Unterluggauer H, Überall F, Schramek H, Jansen-Dürr P. Replicative senescence of human fibroblasts: The role of Ras-dependent signaling and oxidative stress. In: Experimental Gerontology. Vol 37. Exp Gerontol; 2002:1165-1174. doi:10.1016/S0531-5565(02)00136-5 146. Altschul SF, Madden TL, Schäffer AA, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25(17):3389- 3402. doi:10.1016/S0022-2836(05)80360-2 147. Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. TrimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25. doi:10.1093/bioinformatics/btp348 148. Guindon S, Dufayard J-F, Lefort V, Anisimova M, Hordijk W, Gascuel O. New Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the Performance of PhyML 3.0. Syst Biol. 2010;59(3):307-321. doi:10.1080/106351500750049752 149. Lefort V, Longueville J-E, Gascuel O. SMS: Smart Model Selection in PhyML. Mol Biol Evol. 2007;34(9):2422-2424. doi:10.1093/oxfordjournals.molbev.a025808 150. Müller T, Vingron M. Modeling amino acid replacement. J Comput Biol. 2001;7(6):761- 776. doi:10.1089/10665270050514918 151. Rambaut, A. FigTree version 1.4. 0. Available at http://tree.bio.ed.ac.uk/software/figtree (2012). 152. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol Biol Evol. 2013;30(4):772-780. doi:10.1093/molbev/mst010 153. Helbing CC, Veillette C, Riabowol K, Johnston RN, Garkavtsev I. A novel candidate tumor suppressor, ING1, is involved in the regulation of apoptosis. Cancer Res.

1997;57(7):1255-1258. 154. Hojjat H, Jardim A. Identification of leishmania donovaniperoxin 14 residues required for binding the peroxin 5 receptor proteins. Biochem J. 2015;465(2):247-257. doi:10.1042/BJ20141133 155. Hubackova S, Davidova E, Rohlenova K, et al. Selective elimination of senescent cells by mitochondrial targeting is regulated by ANT2. Cell Death Differ. 2019;26(2):276-290. doi:10.1038/s41418-018-0118-3

100