Genome-Wide DNA Methylation and Gene Expression Profiles in Cows
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. -
Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L. -
The Role of Dlx3 in Gene Regulation in the Mouse Placenta
The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding. -
DNA Methylation Analysis Identifies Patterns in Progressive Glioma Grades to Predict Patient Survival
International Journal of Molecular Sciences Article DNA Methylation Analysis Identifies Patterns in Progressive Glioma Grades to Predict Patient Survival Jingyin Weng and Nicole Salazar * Department of Biology, San Francisco State University, San Francisco, CA 94132, USA; [email protected] * Correspondence: [email protected] Abstract: DNA methylation is an epigenetic change to the genome that impacts gene activities with- out modification to the DNA sequence. Alteration in the methylation pattern is a naturally occurring event throughout the human life cycle which may result in the development of diseases such as cancer. In this study, we analyzed methylation data from The Cancer Genome Atlas, under the Lower-Grade Glioma (LGG) and Glioblastoma Multiforme (GBM) projects, to identify methylation markers that exhibit unique changes in DNA methylation pattern along with tumor grade progression, to predict patient survival. We found ten glioma grade-associated Cytosine-phosphate-Guanine (CpG) sites that targeted four genes (SMOC1, KCNA4, SLC25A21, and UPP1) and the methylation pattern is strongly associated with glioma specific molecular alterations, primarily isocitrate dehydrogenase (IDH) mutation and chromosome 1p/19q codeletion. The ten CpG sites collectively distinguished a cohort of diffuse glioma patients with remarkably poor survival probability. Our study highlights genes (KCNA4 and SLC25A21) that were not previously associated with gliomas to have contributed to the poorer patient outcome. These CpG sites can aid glioma tumor progression monitoring and serve as prognostic markers to identify patients diagnosed with less aggressive and malignant gliomas that exhibit similar survival probability to GBM patients. Keywords: glioma; glioblastoma; DNA methylation; progression; TCGA; WGCNA; prognosis Citation: Weng, J.; Salazar, N. -
CD29 Identifies IFN-Γ–Producing Human CD8+ T Cells With
+ CD29 identifies IFN-γ–producing human CD8 T cells with an increased cytotoxic potential Benoît P. Nicoleta,b, Aurélie Guislaina,b, Floris P. J. van Alphenc, Raquel Gomez-Eerlandd, Ton N. M. Schumacherd, Maartje van den Biggelaarc,e, and Monika C. Wolkersa,b,1 aDepartment of Hematopoiesis, Sanquin Research, 1066 CX Amsterdam, The Netherlands; bLandsteiner Laboratory, Oncode Institute, Amsterdam University Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; cDepartment of Research Facilities, Sanquin Research, 1066 CX Amsterdam, The Netherlands; dDivision of Molecular Oncology and Immunology, Oncode Institute, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands; and eDepartment of Molecular and Cellular Haemostasis, Sanquin Research, 1066 CX Amsterdam, The Netherlands Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved February 12, 2020 (received for review August 12, 2019) Cytotoxic CD8+ T cells can effectively kill target cells by producing therefore developed a protocol that allowed for efficient iso- cytokines, chemokines, and granzymes. Expression of these effector lation of RNA and protein from fluorescence-activated cell molecules is however highly divergent, and tools that identify and sorting (FACS)-sorted fixed T cells after intracellular cytokine + preselect CD8 T cells with a cytotoxic expression profile are lacking. staining. With this top-down approach, we performed an un- + Human CD8 T cells can be divided into IFN-γ– and IL-2–producing biased RNA-sequencing (RNA-seq) and mass spectrometry cells. Unbiased transcriptomics and proteomics analysis on cytokine- γ– – + + (MS) analyses on IFN- and IL-2 producing primary human producing fixed CD8 T cells revealed that IL-2 cells produce helper + + + CD8 Tcells. -
20874 SYNGR1 Antibody
Revision 1 C 0 2 - t SYNGR1 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] 4 Support: 877-678-TECH (8324) 7 8 Web: [email protected] 0 www.cellsignal.com 2 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H M R Endogenous 28 Rabbit O43759 9145 Product Usage Information Application Dilution Western Blotting 1:1000 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity SYNGR1 Antibody recognizes endogenous levels of total synaptogyrin-1 protein. Species Reactivity: Human, Mouse, Rat Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Tyr214 of human synaptogyrin-1 protein. Antibodies are purified by peptide affinity chromatography. Background Synaptogyrin, or SYNGR, are a family of tyrosine-phosphorylated proteins, including neuronal SYNGR1 and SYNGR3 that are found in synaptic vesicles and contribute to the proper synapse function. Synaptogyrin-2 (SYNGR2) expresses ubiquitously and it is not only associated with synaptic vesicles, but also plays an important role in exocytosis processes (1,3). In addition, it has been shown that SYNGRs modulate calcium currents in excitable cells during potassium chloride-dependent exocytosis (3). SYNGR3 and SYNGR1 specifically localize in synaptic vesicles. SYNGR1 modulates synaptic vesicle function similar to SYNGR3 (2,3). SYNGR1 and SYNGR3 contribute to the neurotransmitter release in neurons by interactions with the GABA and VGLUT transporters in primary neurons and in C. -
Protein Interactions in the Cancer Proteome† Cite This: Mol
Molecular BioSystems View Article Online PAPER View Journal | View Issue Small-molecule binding sites to explore protein– protein interactions in the cancer proteome† Cite this: Mol. BioSyst., 2016, 12,3067 David Xu,ab Shadia I. Jalal,c George W. Sledge Jr.d and Samy O. Meroueh*aef The Cancer Genome Atlas (TCGA) offers an unprecedented opportunity to identify small-molecule binding sites on proteins with overexpressed mRNA levels that correlate with poor survival. Here, we analyze RNA-seq and clinical data for 10 tumor types to identify genes that are both overexpressed and correlate with patient survival. Protein products of these genes were scanned for binding sites that possess shape and physicochemical properties that can accommodate small-molecule probes or therapeutic agents (druggable). These binding sites were classified as enzyme active sites (ENZ), protein–protein interaction sites (PPI), or other sites whose function is unknown (OTH). Interestingly, the overwhelming majority of binding sites were classified as OTH. We find that ENZ, PPI, and OTH binding sites often occurred on the same structure suggesting that many of these OTH cavities can be used for allosteric modulation of Creative Commons Attribution 3.0 Unported Licence. enzyme activity or protein–protein interactions with small molecules. We discovered several ENZ (PYCR1, QPRT,andHSPA6)andPPI(CASC5, ZBTB32,andCSAD) binding sites on proteins that have been seldom explored in cancer. We also found proteins that have been extensively studied in cancer that have not been previously explored with small molecules that harbor ENZ (PKMYT1, STEAP3,andNNMT) and PPI (HNF4A, MEF2B,andCBX2) binding sites. All binding sites were classified by the signaling pathways to Received 29th March 2016, which the protein that harbors them belongs using KEGG. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
A Novel Resveratrol Analog: Its Cell Cycle Inhibitory, Pro-Apoptotic and Anti-Inflammatory Activities on Human Tumor Cells
A NOVEL RESVERATROL ANALOG : ITS CELL CYCLE INHIBITORY, PRO-APOPTOTIC AND ANTI-INFLAMMATORY ACTIVITIES ON HUMAN TUMOR CELLS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Boren Lin May 2006 Dissertation written by Boren Lin B.S., Tunghai University, 1996 M.S., Kent State University, 2003 Ph. D., Kent State University, 2006 Approved by Dr. Chun-che Tsai , Chair, Doctoral Dissertation Committee Dr. Bryan R. G. Williams , Co-chair, Doctoral Dissertation Committee Dr. Johnnie W. Baker , Members, Doctoral Dissertation Committee Dr. James L. Blank , Dr. Bansidhar Datta , Dr. Gail C. Fraizer , Accepted by Dr. Robert V. Dorman , Director, School of Biomedical Sciences Dr. John R. Stalvey , Dean, College of Arts and Sciences ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………….………v LIST OF TABLES……………………………………………………………………….vii ACKNOWLEDGEMENTS….………………………………………………………….viii I INTRODUCTION….………………………………………………….1 Background and Significance……………………………………………………..1 Specific Aims………………………………………………………………………12 II MATERIALS AND METHODS.…………………………………………….16 Cell Culture and Compounds…….……………….…………………………….….16 MTT Cell Viability Assay………………………………………………………….16 Trypan Blue Exclusive Assay……………………………………………………...18 Flow Cytometry for Cell Cycle Analysis……………..……………....……………19 DNA Fragmentation Assay……………………………………………...…………23 Caspase-3 Activity Assay………………………………...……….….…….………24 Annexin V-FITC Staining Assay…………………………………..…...….………28 NF-kappa B p65 Activity Assay……………………………………..………….…29 -
Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened. -
Genetics of Gene Expression in Primary Immune Cells Identifies Cell
ARTICLES Genetics of gene expression in primary immune cells identifies cell type–specific master regulators and roles of HLA alleles Benjamin P Fairfax1, Seiko Makino1, Jayachandran Radhakrishnan1, Katharine Plant1, Stephen Leslie2, Alexander Dilthey3, Peter Ellis4, Cordelia Langford4, Fredrik O Vannberg1,5 & Julian C Knight1 Trans-acting genetic variants have a substantial, albeit poorly characterized, role in the heritable determination of gene expression. Using paired purified primary monocytes and B cells, we identify new predominantly cell type–specific cis and trans expression quantitative trait loci (eQTLs), including multi-locus trans associations to LYZ and KLF4 in monocytes and B cells, respectively. Additionally, we observe a B cell–specific trans association of rs11171739 at 12q13.2, a known autoimmune disease locus, with IP6K2 (P = 5.8 × 10−15), PRIC285 (P = 3.0 × 10−10) and an upstream region of CDKN1A (P = 2 × 10−52), suggesting roles for cell cycle regulation and peroxisome proliferator-activated receptor γ (PPARγ) signaling in autoimmune pathogenesis. We also find that specific human leukocyte antigen (HLA) alleles form trans associations with the expression of AOAH and ARHGAP24 in monocytes but not in B cells. In summary, we show that mapping gene expression in defined primary cell populations identifies new cell type–specific trans-regulated networks and provides insights into the genetic basis of disease susceptibility. Defining the genetic determinants of gene expression is crucial to especially pertinent in the elucidation of trans-acting eQTLs, where understanding the biological and medical significance of genetic var- context specificity may be of greater relevance12. iation. This is particularly relevant in the drive to identify functional Here we sought to determine cell type–specific eQTLs relevant to variants underlying observed disease associations from genome- immunity and inflammation in paired samples of primary monocytes wide association studies (GWAS)1. -
Open Data for Differential Network Analysis in Glioma
International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.