USH1G with Unique Retinal Findings Caused by a Novel Truncating Mutation Identified by Genome-Wide Linkage Analysis

USH1G with unique retinal findings caused by a novel truncating mutation identified by genome-wide linkage analysis

Faiqa Imtiaz,1 Khalid Taibah,2 Ghada Bin-Khamis,3 Shelley Kennedy,4 Amal Hemidan,5 Faisal Al-Qahtani,5 Khalid Tabbara,5 Bashayer Al Mubarak,1 Khushnooda Ramzan,1 Brian F. Meyer,1 Mohammed Al-Owain6,7

1Department of Genetics, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 2ENT Medical Centre, Riyadh, Saudi Arabia; 3Department of Otolaryngology, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 4Ontario Newborn Screening Program, Children's Hospital of Eastern Ontario, Ottawa, Ontario, Canada; 5Department of Ophthalmology, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 6Department of Medical Genetics, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 7College of Medicine, Al-Faisal University, Riyadh, Saudi Arabia

Purpose: Usher syndrome (USH) is an autosomal recessive disorder divided into three distinct clinical subtypes based on the severity of the hearing loss, manifestation of vestibular dysfunction, and the age of onset of retinitis pigmentosa and visual symptoms. To date, mutations in seven different genes have been reported to cause USH type 1 (USH1), the most severe form. Patients diagnosed with USH1 are known to be ideal candidates to benefit from cochlear implantation. Methods: Genome-wide linkage analysis using Affymetrix GeneChip Human Mapping 10K arrays were performed in three cochlear implanted Saudi siblings born from a consanguineous marriage, clinically diagnosed with USH1 by comprehensive clinical, audiological, and ophthalmological examinations. From the linkage results, the USH1G gene was screened for mutations by direct sequencing of the coding exons. Results: We report the identification of a novel p.S243X truncating mutation in USH1G that segregated with the disease phenotype and was not present in 300 ethnically matched normal controls. We also report on the novel retinal findings and the outcome of cochlear implantation in the affected individuals. Conclusions: In addition to reporting a novel truncating mutation, this report expands the retinal phenotype in USH1G and presents the first report of successful cochlear implants in this disease.

Usher syndrome (USH) is an autosomal recessive was cloned, which is the human ortholog of the Sans gene disorder that is clinically and genetically heterogeneous defective in Jackson shaker mutant mice [3,4]. USH1G associated with sensorineural hearing impairment and contains three exons, spans 7.2 kb, and encodes a progressive visual loss attributable to retinitis pigmentosa scaffolding protein (SANS) with 460 amino acids. The (RP). USH is the most common cause of hereditary deaf- SANS protein contains three ankyrin domains at the N- blindness, reported in 1 in 6,000 children [1]. terminal end (amino acids 31–129) and a PDZ-binding Usher type 1 (USH1) is the most severe of three known motif at the C-terminal end. In-between lies a central region clinical subtypes as patients affected have severe to (amino acids 130–385) and a sterile alpha motif (SAM) profound congenital hearing loss combined with prepubertal domain (amino acids 384–446) [3]. Since then, only a small onset of visual symptoms. In addition, individuals with number of patients with USH1G mutations have been USH1 often walk later than usual due to vestibular reported in the literature with prelingual hearing loss, dysfunction, and older children with USH1 may appear vestibular dysfunction, and variable RP [3,5-7]. clumsy and have difficulty with gross motor activities that In this report, we describe three siblings from a require a level of balance. To date, seven loci have been consanguineous family of Saudi Arabian origin with mapped that cause USH1, USH1B–USH1H (Hereditary USH1G and distinct retinopathy, who also had a good Hearing Loss Homepage). outcome after cochlear implantation. The locus for USH1G was mapped to 17q24–25 [2], METHODS and in 2003 the gene USH1G (previously named scaffold protein containing ankyrin repeats and sam domain [SANS]) Patient information and clinical evaluation: All of the individuals who participated in this study provided an Correspondence to: Faiqa Imtiaz, Department of Genetics, King approved informed consent form, which adhered to Faisal Specialist Hospital & Research Centre, PO Box 3354, institutional (King Faisal Specialist Hospital; RAC# Riyadh 11211, Saudi Arabia; Phone: +966-1464-7272; FAX: 2040039) guidelines and to the tenets of the Declaration of +966-1205-5171; email: [email protected] Helsinki. Three siblings affected with hearing loss and RP 1885 Molecular Vision 2012; 18:1885-1894 © 2012 Molecular Vision

Figure 1. The pedigree of the Usher family with three affected siblings and an autosomal recessive pattern of inheritance.

from a consanguineous family (Figure 1) of Saudi Arabian single nucleotide polymorphisms (SNPs) were called using origin were recruited for this study. Detailed clinical and Affymetrix GCOS 1.4 software, which generated an overall developmental histories were obtained for all the members average SNP call rate of 97%. The Allegro module of the of this family. Easy Linkage software package was used to calculate Hearing was assessed both pre- and post-cochlear multipoint logarithm of the odds (LOD) scores, with the implantation for all three patients by pure tone visual parameters that assume a disease model with an autosomal- reinforcement audiometry; air conduction and bone recessive mode of inheritance with 100% penetrance and a conduction thresholds were measured at frequencies 250, disease allele frequency of 0.0001. 500, 1,000, 2,000, 4,000, and 8,000 Hz in a sound booth Mutation screening in USH1G: Genomic DNA of all with a Grason-Stadler Diagnostic Clinical Audiometer individuals was amplified by PCR using intronic primers (Grason-Stadler, Eden Prairie, MN). In addition, that were designed to flank each of the three coding exons diagnostic brainstem evoked response audiometry was of USH1G (Table 1). PCR was performed in a final volume performed using click stimulation. Dilated funduscopy and of 20 µl containing approximately 20 ng of genomic DNA, electroretinography (ERG) and visual field were performed 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, for ophthalmological examinations. Vestibular function was 200 µM deoxyribonucleotide triphosphates (dNTPs), 1 unit evaluated by testing tandem gait ability and by using the of Qiagen (Valencia, CA) HotStar Taq polymerase, and Romberg test. 10 µM of each primer. Thermocycling (Applied Biosystems Sample collection and DNA extraction: Whole venous Inc., Foster City, CA) consisted of an initial denaturation at blood samples (10 ml) were collected and immediately 95 °C for 15 min followed by 35 cycles of PCR. Each cycle processed for genomic DNA extraction from peripheral of PCR consisted of denaturation at 94 °C for 60 s, blood leucocytes, using the standard protocols. These annealing at 62 °C for 60 s and extension at 72 °C for 60 s. were obtained from the three patients described above, A final extension step of 10 min at 72 °C was added. their parents, and two unaffected siblings. Genomic Automated sequencing: Purified PCR products covering the extraction of DNA was performed using the standard entire coding region of USH1G as identified on the UCSC salting-out method [8]. and Ensembl websites, were directly sequenced with the Linkage analysis: SNP-based genotyping was performed dideoxy chain-termination method using an ABI Prism Big using the Affymetrix GeneChip Human Mapping 10K Dye Terminator v3.1 Cycle Sequencing Kit following the arrays (Affymetrix, Santa Clara, CA). The genotypes of manufacturer’s instructions, and processed on a MegaBACE

TABLE 1. PCR PRIMERS FOR THE THREE CODING EXONS OF THE USH1G GENE.

Primers Forward Reverse Exon 1 CATGCCTCAGCCCTAATACC AGCTCAGAGGAGTGGTGGAC Exon 2a TGCTGTGACAGTGGGGAAG CGTGGCCTGAGAGTACGG Exon 2b ACACCCTCAGCTTCTCCAG AGGCTGTCATCGTCCAGG Exon 2c ACGACTCCCTGTTTACCCG CCTGAATAGGCAGATCTGTACC Exon 3 ATGGGGAGGCTAAGTTGTCC CAACTGTGAGGACCTCGAGAC

1000 DNA Analysis System (Molecular Dynamics; developmental assessment at 3 1/2 years showed normal Sunnyvale, CA). Sequence analysis was performed using cognition with moderate speech delay. The most severely the SeqMan 6.1 module of the Lasergene (DNA Star Inc.; affected of three affected siblings, he was a late walker and Madison, WI) software package, and then compared to the has a clumsy ataxic gait with frequent falls, especially in reference sequence (GenBank NG_007882). Numbering unfamiliar areas. As a result, his family was afraid that he commenced with the A of the ATG initiation codon as +1. might cause injury to himself. He had a positive Romberg test, and cannot perform tandem gait. Patient 2 is currently RESULTS in the fourth grade in a normal school and is doing well. Clinical description: At the time of study, the father of the Patient 3—The proband’s sister was reported to have proband was 41 years old, and the mother was 36 years old. the mildest phenotype and was 6 years of age at the time of Both were reported to be in good health. The parents were enrollment. She was born vaginally after an uncomplicated first cousins, related through their fathers who were half- pregnancy. Her hearing loss was detected 2 weeks after brothers. They had six children in total, three of whom had birth by brainstem auditory evoked potential. She had a hearing loss. There was no family history of recognizable cochlear implant at 2 years of age. She sat at 9 months and genetic conditions, birth defects, or mental retardation. A walked at 18 months of age. At 2 1/2 years, her comprehensive review of the extended family pedigree did developmental assessment noted she was clumsy and prone not reveal any other individuals with hearing loss. to falling. Her cognitive development was normal, but she Patient 1—The proband was 18 years of age at the time had severe speech and language delay. This patient is of study. She was born after an uncomplicated pregnancy. currently in elementary school and is reported to be doing Her hearing loss was confirmed at 10 months of age via well. auditory brainstem evoked response testing. She was Audiological evaluation and cochlear implantation: All initially fitted with hearing aids and subsequently had a three affected individuals were diagnosed with bilateral cochlear implant at 6 years of age. She had delayed motor congenital prelingual profound sensorineural hearing loss milestones (she sat and walked at 1 year and 2 1/2 years of and consequently received cochlear implants (Figure 2). age, respectively) and expressive speech delay, but she was cognitively normal. She had a positive Romberg test and The proband received a Cochlear Nucleus 22 cochlear can walk in tandem gait. She had problems in visual implant at the age of 6 years; her final aural rehabilitation fixation, such as in reading during walking and feeling session was in November, 2006 when she was able to insecure when walking in unfamiliar areas like walking on a comprehend open-sent speech, answer Wh-questions from sandy beach. Night-blindness was noted as the first an open set, participate effectively in group conversation, indication of retinal degeneration. She is currently earning and discriminate on the telephone with a familiar person. her bachelor’s degree in business administration. Comprehending and producing Wh-questions are crucial Patient 2—At the time of enrollment, the younger abilities in communication, for example, Wh-questions that brother of the proband was 9 years old. He was delivered begin with which and who and the ability of orally trained after an uncomplicated pregnancy by Cesarean section due deaf children to understand and produce other structures that to fetal distress. His birthweight was 2.75 kg. His hearing involve the same syntactic construction, Wh-movement [9]. loss was detected shortly after birth, and he was fitted with Patient 2 had a Nucleus 24 Contour cochlear implant at the hearing aids at 9 months of age. A computed tomography age o 23 months. At the age of 9 years, the child had met the scan of his temporal bones was normal, as was his long-term goals of the aural rehabilitation program as he toxoplasmosis, rubella, cytomegalovirus, herpes simplex, was able to comprehend from an open set, answer Wh- and HIV (TORCH) screen. He subsequently had a cochlear questions from an open set, participate effectively in group implant at 2 years of age. An ophthalmology examination at conversation, as well as to discriminate on the telephone 14 months was normal with no evidence of retinopathy. His with unfamiliar persons, although he still had some early motor milestones were delayed (sitting and walking at difficulties with gender markers (feminine versus 1 and 3 1/2 years of age, respectively); however, a masculine). Patient 3 received a Nucleus 24 Contour 1887 Molecular Vision 2012; 18:1885-1894 © 2012 Molecular Vision

Figure 2. Audiometry. Audiological evaluation of Patient 1 (A), Patient 2 (B), and Patient 3 (C) shows the hearing thresholds at all tested frequencies pre- and post-cochlear implantation. Pure tone sound field audiograms are represented by unaided (S), Aided (A), and Implanted (I). “O” and “X” symbols correspond to the right and left ear pure tone air conduction audiograms, respectively. Audiometric measurements were obtained at specific ages for each patient as denoted by each hearing assessment. All three affected individuals had bilateral profound sensorineural hearing loss before cochlear implantation. Post-implantation, all affected acquired hearing threshold measurements in the normal range. cochlear implant at age 16 months. At the age of 6 years, the ERG. A focal ERG was not available, and it might have child had met the long-term goals of the program as she was shown normal macular function. able to comprehend from an open set, answers Wh- Disease locus identification: The resulting multipoint questions from an open set, participate effectively in group linkage analysis of the three affected patients, their three conversation, and was able to discriminate on the telephone unaffected siblings, and their parents identified a disease with unfamiliar persons. locus on chromosome 17q24.3-q25.3 (Ensembl cytogenetic Retinal description for the USH1G family: All three siblings band) with a maximum logarithm of odds of 2.5 (Figure 5) had a normal-looking macula surrounded by an abnormal between SNP markers rs718072 and rs2333990, which peripheral atrophic retina that had an abnormal light reflex spanned an 8.3 Mb linkage interval. The USH1G gene with a mottled retinal pigment epithelium without any (NM_173477) was selected as the first choice from within pigment migration. There was a well demarcated line in a this interval as the most likely disease-causing candidate. circular fashion separating the normal-looking macula and Mutation detection in USH1G: Direct sequencing in the the abnormal periphery (Figure 3C). Patient 2 showed more forward and reverse directions identified a homozygous severe changes in the form of a smaller circle of a normal- truncating mutation, c.728C > A (p.S243X), in all three looking macula, mild optic atrophy, and attenuated USH1 affected siblings (Figure 6). The mutation segregated arterioles (Figure 3C). The youngest sibling (Patient 3) had with the disease phenotype (both parents and all three similar severe retinal changes with a left temporal optic unaffected siblings were heterozygous carriers). The nerve pit and mild optic pallor (Figure 3C). The proband p.S243X mutation was not found in 300 ethnically matched had peripheral isolated retinal vascular telangiectasia with normal controls, which signified that this variant was not a local ischemia surrounding a macroaneurysm that had population-based polymorphism. caused a limited retinal hemorrhage (Figure 3D). Her The URLs for the websites used in this manuscript are fluorescein angiogram showed delayed choroidal filling the UCSC Genome Browser, Hereditary Hearing Loss underneath the abnormal retina with normal choroidal filling Homepage, and Ensembl Genome Browser. in the macular area. There was a “starry sky” appearance in the periphery. The macroaneurysm was demonstrated by early point hyperfluorescence through the retinal DISCUSSION hemorrhage with a feeder artery and late leakage. All three USH1G is a rare cause of USH1 with an estimated siblings had normal visual acuity but constricted visual frequency of about 7% [5]. Roux and colleagues [10] fields (Figures 4A,B) as shown by the visual field testing. screened 34 families with deafness and identified no The ERG (LKC Technologies, Inc., Gaithersburg, MD) was mutation in USH1G. To the best of our knowledge, we flat in all three affected individuals. Although the macula describe the first Saudi family with USH1G using SNP- looked normal, the cone function was not seen on a standard based linkage technology. Clearly, the cohort has the typical findings of USH1 with the hearing loss, retinopathy, and

Figure 3. Novel retinal findings. Panels A and B are of fundus photos showing a normal-looking macula and an abnormally mottled retinal pigment epithelium in the periphery. The photo in Panel C shows the demarcation line circular, separating the normal-looking macula from abnormal periphery, mild optic nerve atrophy; optic nerve pit and attenuation of retinal arterioles could be seen (Patient 3). Panel D shows the proband’s local macroaneurysm with limited retinal hemorrhage. vestibular dysfunction. The genome-wide linkage analysis There is clearly a variable severity of the retinopathy in identified a region on chromosome 17q26.3 that contained the patients with USH1G reported in the literature (Table 2). the known USH1-causing gene, USH1G. Direct sequencing In fact, the patients reported by Kalay et al. [6] (ages 13, 18, analysis of USH1G detected the presence of a novel 20, 22 years) had no visual symptoms or night blindness. p.S243X truncating mutation that segregated with the Moreover, the patients’ visual acuity was normal. However, disease phenotype in the family and was not found in 300 the ERG of another 4-year-old child with USH1G showed ethnically matched normal controls. All three siblings have severe retinal degeneration [2]. The retinal findings in the received successful cochlear implants and are living three siblings in this report are a distinct form of RP. The considerably normal lives with good educational normal-appearing macula with a well defined line/junction performance. This is, to our knowledge, the first report in separating the macula from the abnormal peripheral retinal the literature of successful cochlear implants in patients with reflex points to the atypical retinopathy in this family. USH1G. Based on the Human Gene Disease Mutation Interestingly, the two younger patients had more severe Database (HGMD) at the Institute of Medical Genetics in retinopathy than the older proband. The optic nerve pit and Cardiff, UK, seven mutations (Table 2) have been reported the peripheral telangiectasia were isolated findings in two (three missense/nonsense, three small deletions, and one separate patients, which may be an unusual part of the small insertion). phenotype. Compared to the findings of Kalay et al. [6], there was no pigment migration (bony spicules), which may

Figure 4. Figures depicting the results of ERG and visual field testing in the proband. A: Results of ERG testing showed severe attenuation of phobic (A and B) and scotopic (C, D, E) waveforms in the proband. F, G: Visual field testing. Visual field testing using the Octopus screening program showing severe generalized restriction of the peripheral field in the proband. give a hint that the peripheral cells are more preferentially associate with harmonin [14]. Recently, the two proteins affected in this family. were discovered to form a highly stable complex structure, SANS has a highly conserved function in vesicle the formation of which is disrupted in patients with USH1 trafficking among species [3]. It is expressed in lens- mutations of SANS and harmonin [15]. In the mammalian secreting cone cells of the Drosophila adult eye [11]. In eye, the interaction between SANS and whirlin (USH2D) in Jackson shaker mice with defective Sans, harmonin is the apical inner segment collar and the ciliary apparatus of completely absent in the hair cells of the inner ear starting the photoreceptor cells was described [16]. In addition, early at the embryonic stage [3,4]. This indicates an SANS provides a linkage to the microtubule transport important role of SANS in the trafficking of harmonin to the machinery [15]. In 2011, using Ush1g knockout mice stereocilia of the hair cells [12], the essential experiments, Caberlotto and colleagues [17] concluded that mechanosensitive devices for detecting sound [12,13]. In Sans belongs to the USH1 protein network required for the cotransfection experiments, Sans was also shown to cohesion of hair bundles in cochlear hair cells during the

Figure 5. Results of linkage analysis in the Usher family showing a LOD score of 2.5 on chromosome 17. Linkage analysis reveals a LOD score of 2.5 on chromosome 17q26.3, as indicated by an arrow.

Figure 6. Mutation analysis-sequence data Sequence chromatogram of a normal control (NC), an individual heterozygous for the c.728C >A (p.S243X) mutation (CARRIER) and a homozygous p.S243X (indicated by an arrow) mutation in an affected patient (PATIENT).

early stages of their development. These authors [17] also central region along with the ankyrin repeats play an confirmed that Sans localizes to the lower end of tip-links, important role in the cytoplasmic puncta formation of SANS which interconnect the stereocilia of the hair bundle and [14]. MYO7A has been shown to be expressed in the function as controllers of the mechanoelectrical transduction photoreceptor cilium and the adjacent retina pigmented channels in these auditory hair cells [17]. Concurrently in epithelium [22-25], and defects in MYO7A cause USH1B 2011, Grati and Kachar [18-20], using immunofluorescence [26]. intensity techniques, demonstrated MYO7A and Sans in fact The localization of this nonsense mutation may explain cluster at the stereocilia upper tip-link density, which is why the retinal findings in our patients are different from suggested to contain a cluster of various myosin motor the D458V mutation affecting the C-terminal tail of SANS proteins that pull on the tip-link to maintain resting tension. [6]. Moreover, the p.S243X and in fact all of the mutations The p.S243X in this family is located in the central reported to date, apart from D458V, are predicted to result region of SANS, which directly interacts with the tail in premature termination codons (PTCs), causing aberrant domain of myosin VIIa (MYO7A) [21], thereby linking mRNAs that encode truncated proteins. These PTCs are harmonin with the actin-based motor [14]. In addition, the known to be targets for elimination by a regulatory and

1891 Molecular Vision 2012;18:1885-1894

TABLE 2. COMPARISON OF MOLECULAR, AUDIOLOGICAL, OPHTHALMOLOGICAL AND CLINICAL FINDINGS IN ALL REPORTED USH1G PATIENTS TO DATE. Clinical, genetic Weil et al. [3] Ouyang et al. [5] Kalay et al. [6] Mustapha et al. [2] Weil et al. [3] Bashir et al. [7] Present study and patient information Mutation c.142C>T (p.L48P)/186– c.113G>A (p.W38X) c. 1373A>T (p.D458V) c.832–851del20 c.393insG c.163_164+13del15 c. 728C>A (p.S243X) 187delCA Consequences Missense/frameshift Nonsense Missense Frameshift Frameshift Frameshift Nonsense Country Germany USA Turkey Jordan Tunisia Pakistan Saudi Arabia Number of cases 2 (familial) 2(sporadic) 6 (familial) 3 (familial) 8 (familial) 4 (familial) 3 (familial) Hearing loss Profound Profound Prelingual (moderate to Prelingual profound HL Congenital profound Moderate to severe Congenital profound HL profound) HL HL HL Visual acuity ND ND Normal ND ND Mild loss of near- Normal with very constricted sight vision visual fields 1892 Funduscopy ND ND Variable bone spicules and Variable RP Severe RP Pale optic discs, mild Normally looking macula peripheral retinal RP surrounded by an abnormal pigmentary atrophy. No peripheral atrophic retina. No waxy pallor of optic discs, evidence of pigmentary mild RP migration ERG ND ND ND Variably severe retinal Severe RP ND Flat in all members degeneration Vestibular function ND ND Normal Abnormal Abnormal Normal Abnormal Cochlear implant ND ND ND ND ND ND Successful

ND: Not determined. © 2012MolecularVision Molecular Vision 2012; 18:1885-1894 © 2012 Molecular Vision specialized surveillance mechanism, known as nonsense- USH1G, maps to chromosome 17q24–25. Hum Genet 2002; mediated mRNA decay (NMD) [27]. It has previously been 110:348-50. [PMID: 11941484] estimated that approximately one-third of all genetic 3. Weil D, El-Amraoui A, Masmoudi S, Mustapha M, Kikkawa diseases are caused by variations causing PTCs and NMD is Y, Laine S, Delmaghani S, Adato A, Nadifi S, Zina ZB, Hamel C, Gal A, Ayadi H, Yonekawa H, Petit C. Usher in fact a crucial factor in modulating inherited human syndrome type I G (USH1G) is caused by mutations in the disease phenotypes [28-31]. NMD can be of benefit and gene encoding SANS, a protein that associates with the perhaps reduce disease severity, for example, in removing USH1C protein, harmonin. Hum Mol Genet 2003; aberrant transcripts that encode proteins with dominant- 12:463-71. [PMID: 12588794] negative effects. However, NMD may be a disadvantage if 4. Kikkawa Y, Shitara H, Wakana S, Kohara Y, Takada T, truncated proteins sustaining some normal function are Okamoto M, Taya C, Kamiya K, Yoshikawa Y, Tokano H, eliminated [31,32]. Thus, the wide variability in the retinal Kitamura K, Shimizu K, Wakabayashi Y, Shiroishi T, phenotype in all USH1G patients to date may be partly due Kominami R, Yonekawa H. Mutations in a new scaffold to the predicted NMD outcome of each PTC, with respect to protein Sans cause deafness in Jackson shaker mice. Hum Mol Genet 2003; 12:453-61. [PMID: 12588793] its position in the SANS protein. 5. Ouyang XM, Yan D, Du LL, Hejtmancik JF, Jacobson SG, Previously, nonsense mutations resulting in USH1C Nance WE, Li AR, Angeli S, Kaiser M, Newton V, Brown [33] and USH1F [34,35] have been the targets of in vitro SD, Balkany T, Liu XZ. Characterization of Usher and in vivo experiments designed specifically with potential syndrome type I gene mutations in an Usher syndrome therapeutic possibilities using various compounds, including patient population. Hum Genet 2005; 116:292-9. [PMID: aminoglycosides [33], and derivatives of the clinical 15660226] aminoglycoside paromomycin [35,36]. These antibiotics 6. Kalay E, de Brouwer AP, Caylan R, Nabuurs SB, Wollnik B, Karaguzel A, Heister JG, Erdol H, Cremers FP, Cremers have the unique capability to promote translation read- CW, Brunner HG, Kremer H. A novel D458V mutation in through of PTCs but not of normal termination codons, the SANS PDZ binding motif causes atypical Usher resulting in restoration of normally functioning proteins syndrome. J Mol Med 2005; 83:1025-32. [PMID: [36-39]. Such efforts resulted in restoration of protein 16283141] function in both of the Usher genes targeted, and it would be 7. Bashir R, Fatima A, Naz S. A frameshift mutation in SANS of future interest to determine whether the premature results in atypical Usher syndrome. Clin Genet 2010; truncation of SANS caused by USH1G nonsense mutations 78:601-3. [PMID: 21044053] reported to date are restored using similar strategies. 8. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Finally, in addition to the molecular, audiological, and Nucleic Acids Res 1988; 16:1215. [PMID: 3344216] ophthalmological characterization of the siblings described 9. Friedmann N, Szterman R. The comprehension and in this study, the identification of the novel pathogenic production of Wh-questions in deaf and hard-of-hearing mutation described has subsequently proven to be of children. J Deaf Stud Deaf Educ 2011; 16:212-35. [PMID: tremendous use to this family and the extended family, with 21220767] respect to inductive carrier testing and premarital screening. 10. Roux AF, Faugere V, Le Guedard S, Pallares-Ruiz N, Vielle A, Chambert S, Marlin S, Hamel C, Gilbert B, Malcolm S, ACKNOWLEDGMENTS Claustres M. Survey of the frequency of USH1 gene The authors would like to thank the family for participating mutations in a cohort of Usher patients shows the in this study. This work was funded and supported in part by importance of cadherin 23 and protocadherin 15 genes and King Faisal Specialist Hospital (RAC# 2040039), by the establishes a detection rate of above 90%. J Med Genet 2006; 43:763-8. [PMID: 16679490] Prince Salman Centre for Disability Research through a 11. Demontis F, Dahmann C. Characterization of the Drosophila charitable donation from Sheikh Nasser Al-Mutawa ortholog of the human Usher Syndrome type 1G protein (PSCDR #04-IN-0005–04-EP-1) and the Dubai Harvard sans. PLoS ONE 2009; 4:e4753. [PMID: 19270738] Foundation for Medical Research for a Research Fellowship 12. Lefëvre G, Michel V, Weil D, Lepelletier L, Bizard E, for Dr. Faiqa Imtiaz. Wolfrum U, Hardelin JP, Petit C. A core cochlear phenotype in USH1 mouse mutants implicates fibrous links REFERENCES of the hair bundle in its cohesion, orientation and 1. Kimberling WJ, Hildebrand MS, Shearer AE, Jensen ML, differential growth. Development 2008; 135:1427-37. Halder JA, Trzupek K, Cohn ES, Weleber RG, Stone EM, [PMID: 18339676] Smith RJ. Frequency of Usher syndrome in two pediatric 13. Frolenkov GI, Belyantseva IA, Friedman TB, Griffith AJ. populations: Implications for genetic screening of deaf and Genetic insights into the morphogenesis of inner ear hair hard of hearing children. Genet Med 2010; 12:512-6. cells. Nat Rev Genet 2004; 5:489-98. [PMID: 15211351] [PMID: 20613545] 14. Yan J, Pan L, Chen X, Wu L, Zhang M. The structure of the 2. Mustapha M, Chouery E, Torchard-Pagnez D, Nouaille S, harmonin/sans complex reveals an unexpected interaction Khrais A, Sayegh FN, Megarbane A, Loiselet J, Lathrop M, mode of the two Usher syndrome proteins. Proc Natl Acad Petit C, Weil D. A novel locus for Usher syndrome type I, Sci USA 2010; 107:4040-5. [PMID: 20142502] 1893 Molecular Vision 2012; 18:1885-1894 © 2012 Molecular Vision

15. Maerker T, van Wijk E, Overlack N, Kersten FF, McGee J, defects of the myosin-VIIA gene. Nat Genet 1997; Goldmann T, Sehn E, Roepman R, Walsh EJ, Kremer H, 16:191-3. [PMID: 9171833] Wolfrum U. A novel Usher protein network at the 27. Khajavi M, Inoue K, Lupski JR. Nonsense-mediated mRNA periciliary reloading point between molecular transport decay modulates clinical outcome of genetic disease. machineries in vertebrate photoreceptor cells. Hum Mol European journal of human genetics. Eur J Hum Genet Genet 2008; 17:71-86. [PMID: 17906286] 2006; 14:1074-81. [PMID: 16757948] 16. Overlack N, Maerker T, Latz M, Nagel-Wolfrum K, Wolfrum 28. Holbrook JA, Neu-Yilik G, Hentze MW, Kulozik AE. U. SANS (USH1G) expression in developing and mature Nonsense-mediated decay approaches the clinic. Nat Genet mammalian retina. Vision Res 2008; 48:400-12. [PMID: 2004; 36:801-8. [PMID: 15284851] 17923142] 29. Frischmeyer PA, Dietz HC. Nonsense-mediated mRNA decay 17. Caberlotto E, Michel V, Foucher I, Bahloul A, Goodyear RJ, in health and disease. Hum Mol Genet 1999; 8:1893-900. Pepermans E, Michalski N, Perfettini I, Alegria-Prevot O, [PMID: 10469842] Chardenoux S, Do Cruzeiro M, Hardelin JP, Richardson 30. Kuzmiak HA, Maquat LE. Applying nonsense-mediated GP, Avan P, Weil D, Petit C. Usher type 1G protein sans is mRNA decay research to the clinic: progress and a critical component of the tip-link complex, a structure challenges. Trends Mol Med 2006; 12:306-16. [PMID: controlling actin polymerization in stereocilia. Proc Natl 16782405] Acad Sci USA 2011; 108:5825-30. [PMID: 21436032] 31. Bhuvanagiri M, Schlitter AM, Hentze MW, Kulozik AE. 18. Grati M, Kachar B. Myosin VIIa and sans localization at NMD: RNA biology meets human genetic medicine. stereocilia upper tip-link density implicates these Usher Biochem J 2010; 430:365-77. [PMID: 20795950] syndrome proteins in mechanotransduction. Proc Natl Acad 32. Jenkins D, Baynam G, De Catte L, Elcioglu N, Gabbett MT, Sci USA 2011; 108:11476-81. [PMID: 21709241] Hudgins L, Hurst JA, Jehee FS, Oley C, Wilkie AO. 19. Gillespie PG, Muller U. Mechanotransduction by hair cells: Carpenter syndrome: extended RAB23 mutation spectrum models, molecules, and mechanisms. Cell 2009; 139:33-44. and analysis of nonsense-mediated mRNA decay. Hum [PMID: 19804752] Mutat 2011; 32:E2069-78. [PMID: 21412941] 20. Sakaguchi H, Tokita J, Muller U, Kachar B. Tip links in hair 33. Goldmann T, Rebibo-Sabbah A, Overlack N, Nudelman I, cells: molecular composition and role in hearing loss. Curr Belakhov V, Baasov T, Ben-Yosef T, Wolfrum U, Nagel- Opin Otolaryngol Head Neck Surg 2009; 17:388-93. Wolfrum K. Beneficial read-through of a USH1C nonsense [PMID: 19633555] mutation by designed aminoglycoside NB30 in the retina. 21. Adato A, Michel V, Kikkawa Y, Reiners J, Alagramam KN, Invest Ophthalmol Vis Sci 2010; 51:6671-80. [PMID: Weil D, Yonekawa H, Wolfrum U, El-Amraoui A, Petit C. 20671281] Interactions in the network of Usher syndrome type 1 34. Rebibo-Sabbah A, Nudelman I, Ahmed ZM, Baasov T, Ben- proteins. Hum Mol Genet 2005; 14:347-56. [PMID: Yosef T. In vitro and ex vivo suppression by 15590703] aminoglycosides of PCDH15 nonsense mutations 22. Hasson T, Heintzelman MB, Santos-Sacchi J, Corey DP, underlying type 1 Usher syndrome. Hum Genet 2007; Mooseker MS. Expression in cochlea and retina of myosin 122:373-81. [PMID: 17653769] VIIa, the gene product defective in Usher syndrome type 35. Nudelman I, Rebibo-Sabbah A, Cherniavsky M, Belakhov V, 1B. Proc Natl Acad Sci USA 1995; 92:9815-9. [PMID: Hainrichson M, Chen F, Schacht J, Pilch DS, Ben-Yosef T, 7568224] Baasov T. Development of novel aminoglycoside (NB54) 23. Williams DS. Usher syndrome: animal models, retinal with reduced toxicity and enhanced suppression of disease- function of Usher proteins, and prospects for gene therapy. causing premature stop mutations. J Med Chem 2009; Vision Res 2008; 48:433-41. [PMID: 17936325] 52:2836-45. [PMID: 19309154] 24. Liu X, Vansant G, Udovichenko IP, Wolfrum U, Williams 36. Nudelman I, Rebibo-Sabbah A, Shallom-Shezifi D, DS. Myosin VIIa, the product of the Usher 1B syndrome Hainrichson M, Stahl I, Ben-Yosef T, Baasov T. Redesign gene, is concentrated in the connecting cilia of of aminoglycosides for treatment of human genetic diseases photoreceptor cells. Cell Motil Cytoskeleton 1997; caused by premature stop mutations. Bioorg Med Chem 37:240-52. [PMID: 9227854] Lett 2006; 16:6310-5. [PMID: 16997553] 25. Jacobson SG, Cideciyan AV, Aleman TS, Sumaroka A, 37. Kerem E. Pharmacologic therapy for stop mutations: how Roman AJ, Gardner LM, Prosser HM, Mishra M, Bech- much CFTR activity is enough? Curr Opin Pulm Med 2004; Hansen NT, Herrera W, Schwartz SB, Liu XZ, Kimberling 10:547-52. [PMID: 15510065] WJ, Steel KP, Williams DS. Usher syndromes due to 38. Hainrichson M, Nudelman I, Baasov T. Designer MYO7A, PCDH15, USH2A or GPR98 mutations share aminoglycosides: the race to develop improved antibiotics retinal disease mechanism. Hum Mol Genet 2008; and compounds for the treatment of human genetic diseases. 17:2405-15. [PMID: 18463160] Org Biomol Chem 2008; 6:227-39. [PMID: 18174989] 26. Weil D, Kussel P, Blanchard S, Levy G, Levi-Acobas F, Drira 39. Kaufman RJ. Correction of genetic disease by making sense M, Ayadi H, Petit C. The autosomal recessive isolated from nonsense. J Clin Invest 1999; 104:367-8. [PMID: deafness, DFNB2, and the Usher 1B syndrome are allelic 10449426]

Articles are provided courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China. The print version of this article was created on 9 July 2012. This reflects all typographical corrections and errata to the article through that date. Details of any changes may be found in the online version of the article. 1894