DOCSLIB.ORG

USH1G with Unique Retinal Findings Caused by a Novel Truncating Mutation Identified by Genome-Wide Linkage Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
USH1G with Unique Retinal Findings Caused by a Novel Truncating Mutation Identified by Genome-Wide Linkage Analysis Molecular Vision 2012; 18:1885-1894 <http://www.molvis.org/molvis/v18/a196> © 2012 Molecular Vision Received 20 August 2011 | Accepted 9 July 2012 | Published 12 July 2012 USH1G with unique retinal findings caused by a novel truncating mutation identified by genome-wide linkage analysis Faiqa Imtiaz,1 Khalid Taibah,2 Ghada Bin-Khamis,3 Shelley Kennedy,4 Amal Hemidan,5 Faisal Al-Qahtani,5 Khalid Tabbara,5 Bashayer Al Mubarak,1 Khushnooda Ramzan,1 Brian F. Meyer,1 Mohammed Al-Owain6,7 1Department of Genetics, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 2ENT Medical Centre, Riyadh, Saudi Arabia; 3Department of Otolaryngology, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 4Ontario Newborn Screening Program, Children's Hospital of Eastern Ontario, Ottawa, Ontario, Canada; 5Department of Ophthalmology, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 6Department of Medical Genetics, King Faisal Specialist Hospital & Research Centre, Riyadh, Saudi Arabia; 7College of Medicine, Al-Faisal University, Riyadh, Saudi Arabia Purpose: Usher syndrome (USH) is an autosomal recessive disorder divided into three distinct clinical subtypes based on the severity of the hearing loss, manifestation of vestibular dysfunction, and the age of onset of retinitis pigmentosa and visual symptoms. To date, mutations in seven different genes have been reported to cause USH type 1 (USH1), the most severe form. Patients diagnosed with USH1 are known to be ideal candidates to benefit from cochlear implantation. Methods: Genome-wide linkage analysis using Affymetrix GeneChip Human Mapping 10K arrays were performed in three cochlear implanted Saudi siblings born from a consanguineous marriage, clinically diagnosed with USH1 by comprehensive clinical, audiological, and ophthalmological examinations. From the linkage results, the USH1G gene was screened for mutations by direct sequencing of the coding exons. Results: We report the identification of a novel p.S243X truncating mutation in USH1G that segregated with the disease phenotype and was not present in 300 ethnically matched normal controls. We also report on the novel retinal findings and the outcome of cochlear implantation in the affected individuals. Conclusions: In addition to reporting a novel truncating mutation, this report expands the retinal phenotype in USH1G and presents the first report of successful cochlear implants in this disease. Usher syndrome (USH) is an autosomal recessive was cloned, which is the human ortholog of the Sans gene disorder that is clinically and genetically heterogeneous defective in Jackson shaker mutant mice [3,4]. USH1G associated with sensorineural hearing impairment and contains three exons, spans 7.2 kb, and encodes a progressive visual loss attributable to retinitis pigmentosa scaffolding protein (SANS) with 460 amino acids. The (RP). USH is the most common cause of hereditary deaf- SANS protein contains three ankyrin domains at the N- blindness, reported in 1 in 6,000 children [1]. terminal end (amino acids 31–129) and a PDZ-binding Usher type 1 (USH1) is the most severe of three known motif at the C-terminal end. In-between lies a central region clinical subtypes as patients affected have severe to (amino acids 130–385) and a sterile alpha motif (SAM) profound congenital hearing loss combined with prepubertal domain (amino acids 384–446) [3]. Since then, only a small onset of visual symptoms. In addition, individuals with number of patients with USH1G mutations have been USH1 often walk later than usual due to vestibular reported in the literature with prelingual hearing loss, dysfunction, and older children with USH1 may appear vestibular dysfunction, and variable RP [3,5-7]. clumsy and have difficulty with gross motor activities that In this report, we describe three siblings from a require a level of balance. To date, seven loci have been consanguineous family of Saudi Arabian origin with mapped that cause USH1, USH1B–USH1H (Hereditary USH1G and distinct retinopathy, who also had a good Hearing Loss Homepage). outcome after cochlear implantation. The locus for USH1G was mapped to 17q24–25 [2], METHODS and in 2003 the gene USH1G (previously named scaffold protein containing ankyrin repeats and sam domain [SANS]) Patient information and clinical evaluation: All of the individuals who participated in this study provided an Correspondence to: Faiqa Imtiaz, Department of Genetics, King approved informed consent form, which adhered to Faisal Specialist Hospital & Research Centre, PO Box 3354, institutional (King Faisal Specialist Hospital; RAC# Riyadh 11211, Saudi Arabia; Phone: +966-1464-7272; FAX: 2040039) guidelines and to the tenets of the Declaration of +966-1205-5171; email: [email protected] Helsinki. Three siblings affected with hearing loss and RP 1885 Molecular Vision 2012; 18:1885-1894 <http://www.molvis.org/molvis/v18/a196> © 2012 Molecular Vision Figure 1. The pedigree of the Usher family with three affected siblings and an autosomal recessive pattern of inheritance. from a consanguineous family (Figure 1) of Saudi Arabian single nucleotide polymorphisms (SNPs) were called using origin were recruited for this study. Detailed clinical and Affymetrix GCOS 1.4 software, which generated an overall developmental histories were obtained for all the members average SNP call rate of 97%. The Allegro module of the of this family. Easy Linkage software package was used to calculate Hearing was assessed both pre- and post-cochlear multipoint logarithm of the odds (LOD) scores, with the implantation for all three patients by pure tone visual parameters that assume a disease model with an autosomal- reinforcement audiometry; air conduction and bone recessive mode of inheritance with 100% penetrance and a conduction thresholds were measured at frequencies 250, disease allele frequency of 0.0001. 500, 1,000, 2,000, 4,000, and 8,000 Hz in a sound booth Mutation screening in USH1G: Genomic DNA of all with a Grason-Stadler Diagnostic Clinical Audiometer individuals was amplified by PCR using intronic primers (Grason-Stadler, Eden Prairie, MN). In addition, that were designed to flank each of the three coding exons diagnostic brainstem evoked response audiometry was of USH1G (Table 1). PCR was performed in a final volume performed using click stimulation. Dilated funduscopy and of 20 µl containing approximately 20 ng of genomic DNA, electroretinography (ERG) and visual field were performed 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, for ophthalmological examinations. Vestibular function was 200 µM deoxyribonucleotide triphosphates (dNTPs), 1 unit evaluated by testing tandem gait ability and by using the of Qiagen (Valencia, CA) HotStar Taq polymerase, and Romberg test. 10 µM of each primer. Thermocycling (Applied Biosystems Sample collection and DNA extraction: Whole venous Inc., Foster City, CA) consisted of an initial denaturation at blood samples (10 ml) were collected and immediately 95 °C for 15 min followed by 35 cycles of PCR. Each cycle processed for genomic DNA extraction from peripheral of PCR consisted of denaturation at 94 °C for 60 s, blood leucocytes, using the standard protocols. These annealing at 62 °C for 60 s and extension at 72 °C for 60 s. were obtained from the three patients described above, A final extension step of 10 min at 72 °C was added. their parents, and two unaffected siblings. Genomic Automated sequencing: Purified PCR products covering the extraction of DNA was performed using the standard entire coding region of USH1G as identified on the UCSC salting-out method [8]. and Ensembl websites, were directly sequenced with the Linkage analysis: SNP-based genotyping was performed dideoxy chain-termination method using an ABI Prism Big using the Affymetrix GeneChip Human Mapping 10K Dye Terminator v3.1 Cycle Sequencing Kit following the arrays (Affymetrix, Santa Clara, CA). The genotypes of manufacturer’s instructions, and processed on a MegaBACE 1886 Molecular Vision 2012; 18:1885-1894 <http://www.molvis.org/molvis/v18/a196> © 2012 Molecular Vision TABLE 1. PCR PRIMERS FOR THE THREE CODING EXONS OF THE USH1G GENE. Primers Forward Reverse Exon 1 CATGCCTCAGCCCTAATACC AGCTCAGAGGAGTGGTGGAC Exon 2a TGCTGTGACAGTGGGGAAG CGTGGCCTGAGAGTACGG Exon 2b ACACCCTCAGCTTCTCCAG AGGCTGTCATCGTCCAGG Exon 2c ACGACTCCCTGTTTACCCG CCTGAATAGGCAGATCTGTACC Exon 3 ATGGGGAGGCTAAGTTGTCC CAACTGTGAGGACCTCGAGAC 1000 DNA Analysis System (Molecular Dynamics; developmental assessment at 3 1/2 years showed normal Sunnyvale, CA). Sequence analysis was performed using cognition with moderate speech delay. The most severely the SeqMan 6.1 module of the Lasergene (DNA Star Inc.; affected of three affected siblings, he was a late walker and Madison, WI) software package, and then compared to the has a clumsy ataxic gait with frequent falls, especially in reference sequence (GenBank NG_007882). Numbering unfamiliar areas. As a result, his family was afraid that he commenced with the A of the ATG initiation codon as +1. might cause injury to himself. He had a positive Romberg test, and cannot perform tandem gait. Patient 2 is currently RESULTS in the fourth grade in a normal school and is doing well. Clinical description: At the time of study, the father of the Patient 3—The proband’s sister was reported to have proband was 41 years old, and the mother was 36 years old. the mildest phenotype and was 6 years of age at the time of Both were reported to be in good health. The parents were enrollment. She was born vaginally after an uncomplicated first cousins, related through their fathers who were half- pregnancy. Her hearing loss was detected 2 weeks after brothers. They had six children in total, three of whom had birth by brainstem auditory evoked potential. She had a hearing loss. There was no family history of recognizable cochlear implant at 2 years of age. She sat at 9 months and genetic conditions, birth defects, or mental retardation. A walked at 18 months of age. At 2 1/2 years, her comprehensive review of the extended family pedigree did developmental assessment noted she was clumsy and prone not reveal any other individuals with hearing loss.
Load more

Recommended publications
  • Comprehensive Sequence Analysis of Nine Usher Syndrome Genes in The
    Genotype-phenotype correlations J Med Genet: first published as 10.1136/jmedgenet-2011-100468 on 1 December 2011. Downloaded from ORIGINAL ARTICLE Comprehensive sequence analysis of nine Usher syndrome genes in the UK National Collaborative Usher Study Polona Le Quesne Stabej,1 Zubin Saihan,2,3 Nell Rangesh,4 Heather B Steele-Stallard,1 John Ambrose,5 Alison Coffey,5 Jenny Emmerson,5 Elene Haralambous,1 Yasmin Hughes,1 Karen P Steel,5 Linda M Luxon,4,6 Andrew R Webster,2,3 Maria Bitner-Glindzicz1,6 < Additional materials are ABSTRACT characterised by congenital, moderate to severe published online only. To view Background Usher syndrome (USH) is an autosomal hearing loss, with normal vestibular function and these files please visit the recessive disorder comprising retinitis pigmentosa, onset of RP around or after puberty; and type III journal online (http://jmg.bmj. fi com/content/49/1.toc). hearing loss and, in some cases, vestibular dysfunction. (USH3), de ned by postlingual progressive hearing 1 It is clinically and genetically heterogeneous with three loss and variable vestibular response together with Clinical and Molecular e 1 2 Genetics, Institute of Child distinctive clinical types (I III) and nine Usher genes RP. In addition there remain patients whose Health, UCL, London, UK identified. This study is a comprehensive clinical and disease does not fit into any of these three 2Institute of Ophthalmology, genetic analysis of 172 Usher patients and evaluates the subtypes, because of atypical audiovestibular or UCL, London, UK fi ‘ 3 contribution of digenic inheritance. retinal ndings, who are said to have atypical Moorfields Eye Hospital, Methods The genes MYO7A, USH1C, CDH23, PCDH15, ’ London, UK Usher syndrome .
    [Show full text]
  • Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome
    RESEARCH ARTICLE Diversity of the Genes Implicated in Algerian Patients Affected by Usher Syndrome Samia Abdi1,2,3, Amel Bahloul4, Asma Behlouli1,5, Jean-Pierre Hardelin4, Mohamed Makrelouf1, Kamel Boudjelida3,6, Malek Louha7, Ahmed Cheknene3,8, Rachid Belouni2,3, Yahia Rous3,8, Zahida Merad3,6, Djamel Selmane9, Mokhtar Hasbelaoui10, Crystel Bonnet11, Akila Zenati1, Christine Petit4,11,12* 1 Laboratoire de biochimie génétique, Service de biologie - CHU de Bab El Oued, Université d'Alger 1, 16 Alger, Algérie, 2 Laboratoire central de biologie, CHU Frantz Fanon, 09 Blida, Algérie, 3 Faculté de médecine, Université Saad Dahleb, 09 Blida, Algérie, 4 Unité de génétique et physiologie de l’audition, INSERM UMRS1120, Institut Pasteur, 75015, Paris, France, 5 Faculté des sciences biologiques, Université des sciences et de la technologie Houari Boumédiène, 16 Alger, Algérie, 6 Service d’ophtalmologie, CHU Frantz Fanon, 09 Blida, Algérie, 7 Service de biochimie et de biologie moléculaire, Hôpital Armand Trousseau, APHP, 75012, Paris, France, 8 Service d’ORL, CHU Frantz Fanon, 09 Blida, Algérie, 9 Service a11111 d’ORL, CHU Bab el Oued, 16 Alger, Algérie, 10 Service d’ORL, CHU Tizi Ouzou, 15 Tizi-Ouzou, Algérie, 11 INSERM UMRS 1120, Institut de la vision, Université Pierre et Marie Curie, 75005, Paris, France, 12 Collège de France, 75005, Paris, France * [email protected] OPEN ACCESS Abstract Citation: Abdi S, Bahloul A, Behlouli A, Hardelin J-P, Usher syndrome (USH) is an autosomal recessive disorder characterized by a dual sensory Makrelouf M, Boudjelida K, et al. (2016) Diversity of the Genes Implicated in Algerian Patients Affected by impairment affecting hearing and vision.
    [Show full text]
  • Impact of a Diet and Activity Health Promotion Intervention on Regional
    Hibler et al. Clinical Epigenetics (2019) 11:133 https://doi.org/10.1186/s13148-019-0707-0 RESEARCH Open Access Impact of a diet and activity health promotion intervention on regional patterns of DNA methylation Elizabeth Hibler1* , Lei Huang2, Jorge Andrade2,3 and Bonnie Spring1 Abstract Background: Studies demonstrate the impact of diet and physical activity on epigenetic biomarkers, specifically DNA methylation. However, no intervention studies have examined the combined impact of dietary and activity changes on the blood epigenome. The objective of this study was to examine the impact of the Make Better Choices 2 (MBC2) healthy diet and activity intervention on patterns of epigenome-wide DNA methylation. The MBC2 study was a 9-month randomized controlled trial among adults aged 18–65 with non-optimal levels of health behaviors. The study compared three 12-week interventions to (1) simultaneously increase exercise and fruit/ vegetable intake, while decreasing sedentary leisure screen time; (2) sequentially increase fruit/vegetable intake and decrease leisure screen time first, then increase exercise; (3) increase sleep and decrease stress (control). We collected blood samples at baseline, 3 and 9 months, and measured DNA methylation using the Illumina EPIC (850 k) BeadChip. We examined region-based differential methylation patterns using linear regression models with the false discovery rate of 0.05. We also conducted pathway analysis using gene ontology (GO), KEGG, and IPA canonical pathway databases. Results: We found no differences between the MBC2 population (n = 340) and the subsample with DNA methylation measured (n = 68) on baseline characteristics or the impact of the intervention on behavior change.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Homology Modeling and Global Computational Mutagenesis of Human Myosin Viia
    Journal of Analytical & Pharmaceutical Research Research Article Open Access Homology modeling and global computational mutagenesis of human myosin VIIa Abstract Volume 10 Issue 1 - 2021 Usher syndrome type 1B (USH1B) is a genetic disorder caused by mutations in the Annapurna Kuppa, Yuri V Sergeev unconventional Myosin VIIa (MYO7A) protein. USH1B is characterized by hearing loss Ophthalmic Genetics and Visual Function Branch, National Eye due to abnormalities in the inner ear and vision loss due to retinitis pigmentosa. Here, Institute, National Institutes of Health, Bethesda, United States we present the model of human MYO7A homodimer, built using homology modeling, and refined using 5 ns molecular dynamics in water. Global computational mutagenesis Correspondence: Yuri V. Sergeev, Ophthalmic Genetics was applied to evaluate the effect of missense mutations that are critical for maintaining and Visual Function Branch, National Eye Institute, National protein structure and stability of MYO7A in inherited eye disease. We found that 43.26% Institutes of Health, Bethesda, MD, United States, (77 out of 178 in HGMD) and 41.9% (221 out of 528 in ClinVar) of the disease-related Email missense mutations were associated with higher protein structure destabilizing effects. Overall, most mutations destabilizing the MYO7A protein were found to associate with Received: February 20, 2021 | Published: March 04, 2021 USH1 and USH1B. Particularly, motor domain and MyTH4 domains were found to be most susceptible to mutations causing the USH1B phenotype. Our work contributes to the understanding of inherited disease from the atomic level of protein structure and analysis of the impact of genetic mutations on protein stability and genotype-to-phenotype relationships in human disease.
    [Show full text]
  • Foraging Shifts and Visual Pre Adaptation in Ecologically Diverse Bats
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/340654059 Foraging shifts and visual preadaptation in ecologically diverse bats Article in Molecular Ecology · April 2020 DOI: 10.1111/mec.15445 CITATIONS READS 0 153 9 authors, including: Kalina T. J. Davies Laurel R Yohe Queen Mary, University of London Yale University 40 PUBLICATIONS 254 CITATIONS 24 PUBLICATIONS 93 CITATIONS SEE PROFILE SEE PROFILE Edgardo M. Rengifo Elizabeth R Dumont University of São Paulo University of California, Merced 13 PUBLICATIONS 28 CITATIONS 115 PUBLICATIONS 3,143 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Ecology of the Greater horseshoe bat View project BAT 1K View project All content following this page was uploaded by Liliana M. Davalos on 14 May 2020. The user has requested enhancement of the downloaded file. Received: 17 October 2019 | Revised: 28 February 2020 | Accepted: 31 March 2020 DOI: 10.1111/mec.15445 ORIGINAL ARTICLE Foraging shifts and visual pre adaptation in ecologically diverse bats Kalina T. J. Davies1 | Laurel R. Yohe2,3 | Jesus Almonte4 | Miluska K. R. Sánchez5 | Edgardo M. Rengifo6,7 | Elizabeth R. Dumont8 | Karen E. Sears9 | Liliana M. Dávalos2,10 | Stephen J. Rossiter1 1School of Biological and Chemical Sciences, Queen Mary University of London, London, UK 2Department of Ecology and Evolution, State University of New York at Stony Brook, Stony Brook, USA 3Department of Geology & Geophysics, Yale University,
    [Show full text]
  • A Locus on Distal Chromosome 11 (Ahl8) and Its Interaction with Cdh23ahl Underlie the Early Onset, Age-Related Hearing Loss of DBA/2J Mice
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 92 (2008) 219–225 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno A locus on distal chromosome 11 (ahl8) and its interaction with Cdh23ahl underlie the early onset, age-related hearing loss of DBA/2J mice Kenneth R. Johnson a,⁎, Chantal Longo-Guess a, Leona H. Gagnon a, Heping Yu b, Qing Yin Zheng b a The Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609, USA b Department of Otolaryngology-Head and Neck Surgery, Case Western Reserve University, University Hospitals-Case Medical Center, 11100 Euclid Avenue, Cleveland, OH 44106, USA article info abstract Article history: The DBA/2J inbred strain of mice is used extensively in hearing research, yet little is known about the genetic Received 7 April 2008 basis for its early onset, progressive hearing loss. To map underlying genetic factors we analyzed recombinant Accepted 23 June 2008 inbred strains and linkage backcrosses. Analysis of 213 mice from 31 BXD recombinant inbred strains Available online 15 August 2008 detected linkage of auditory brain-stem response thresholds with a locus on distal chromosome 11, which we designate ahl8. Analysis of 225 N2 mice from a backcross of (C57BL/6J×DBA/2J) F1 hybrids to DBA/2J mice Keywords: confirmed this linkage (LODN50) and refined the ahl8 candidate gene interval. Analysis of 214 mice from a Presbycusis Ahl+ Age-related hearing loss backcross of (B6.CAST-Cdh23 ×DBA/2J) F1 hybrids to DBA/2J mice demonstrated a genetic interaction of Progressive hearing loss Cdh23 with ahl8.
    [Show full text]
  • Analysis and Functional Evaluation of the Hair-Cell Transcriptome
    Analysis and functional evaluation of the hair-cell transcriptome Brian M. McDermott, Jr.*, Jessica M. Baucom, and A. J. Hudspeth† Howard Hughes Medical Institute and Laboratory of Sensory Neuroscience, The Rockefeller University, 1230 York Avenue, New York, NY 10021-6399 Contributed by A. J. Hudspeth, May 17, 2007 (sent for review March 31, 2007) An understanding of the molecular bases of the morphogenesis, ciated from the lagena, a receptor organ of the zebrafish’s ear. organization, and functioning of hair cells requires that the genes Linear amplification of the RNA from 200 hair cells yielded Ϸ40 expressed in these cells be identified and their functions ascer- ␮g of aRNA, an enhancement of Ϸ1 millionfold. The resultant tained. After purifying zebrafish hair cells and detecting mRNAs labeled aRNA was hybridized to an Affymetrix microarray with oligonucleotide microarrays, we developed a subtractive (Affymetrix, Santa Clara, CA) containing Ϸ15,000 oligonucle- strategy that identified 1,037 hair cell-expressed genes whose otide probe sets. Averaging the outcomes of three experiments cognate proteins subserve functions including membrane trans- (SI Data Set 1) resulted in the identification of 6,472 transcripts port, synaptic transmission, transcriptional control, cellular adhe- scored as ‘‘present’’ (SI Data Set 2). sion and signal transduction, and cytoskeletal organization. To In the second step, we defined the transcriptome from cells of assess the validity of the subtracted hair-cell data set, we verified a nonsensory organ, the liver (SI Data Set 1). Hepatocytes were the presence of 11 transcripts in inner-ear tissue. Functional eval- selected for the subtraction process for three reasons: they are uation of two genes from the subtracted data set revealed their nonneuronal and thus unlikely to express synaptic factors; they importance in hair bundles: zebrafish larvae bearing the seahorse lack cilia (http://members.global2000.net/bowser/cilialist.html) and ift 172 mutations display specific kinociliary defects.
    [Show full text]
  • Usher Syndrome Research Update to Families
    Usher Syndrome Research Update to Families Gwenaëlle Géléoc, PhD Assistant Professor Talk outline I- What is Usher Syndrome? II- Advances in understanding the patho-physiology of Usher Syndrome III- Treatment: Strategies for restoring function I- What is Usher Syndrome? Charles Howard Usher 1865-1942 1914 Study on “the inheritance of retinitis pigmentosa” Usher syndrome causes hearing loss and retinitis pigmentosa (RP) which is responsible for night-blindness and progressive a loss of peripheral vision Many people with Usher also suffer from balance problems Usher Syndrome is the most common condition that affect hearing and vision 16-40,000 people with Usher syndrome in the US. Clinically and genetically heterogeneous Three clinical USH types: Type 1, Type 2 and Type 3 distinguished by their severity and age when signs and symptoms appear. I- What is Usher Syndrome? Locus Location Gene/protein Function USH1B 11q13.5 MYO7A/myosin VIIA IE and R: transport USH1C 11p15.1 USH1C/harmonin IE and R: scaffolding IE: tip link formation; R: periciliary USH1D 10q22.1 CDH23/cadherin 23 maintenance USH1E 21q21 −/− Unknown IE: tip link formation; R: periciliary USH1F 10q21.1 PCDH15/protocadherin 15 maintenance IE and R: scaffolding and protein USH1G 17q25.1 USH1G/SANS trafficking USH1H 15q22-23 −/− Unknown USH1J CIB2/ Calcium And Integrin 15q24 Calcium and Integrin-binding protein Binding Family Member 2 IE: ankle links formation and cochlear USH2A 1q41 USH2A/usherin development; R: periciliary maintenance IE: ankle links formation Cochlear USH2C 5q14.3 GPR98/VLGR1 development; R: periciliary maintenance IE: scaffolding and cochlear development; 11 different genes (15 USH2D 9q32-34 DFNB31/whirlin R: scaffolding0 genetic loci) have USH2 been linked to USH.
    [Show full text]
  • Novel Digenic Inheritance of PCDH15 and USH1G Underlies Profound
    Schrauwen et al. BMC Medical Genetics (2018) 19:122 https://doi.org/10.1186/s12881-018-0618-5 RESEARCHARTICLE Open Access Novel digenic inheritance of PCDH15 and USH1G underlies profound non-syndromic hearing impairment Isabelle Schrauwen1, Imen Chakchouk1, Anushree Acharya1, Khurram Liaqat2, Irfanullah3, University of Washington Center for Mendelian Genomics, Deborah A. Nickerson4, Michael J. Bamshad4,5, Khadim Shah3, Wasim Ahmad3 and Suzanne M. Leal1* Abstract Background: Digenic inheritance is the simplest model of oligenic disease. It can be observed when there is a strong epistatic interaction between two loci. For both syndromic and non-syndromic hearing impairment, several forms of digenic inheritance have been reported. Methods: We performed exome sequencing in a Pakistani family with profound non-syndromic hereditary hearing impairment to identify the genetic cause of disease. Results: We found that this family displays digenic inheritance for two trans heterozygous missense mutations, one in PCDH15 [p.(Arg1034His)] and another in USH1G [p.(Asp365Asn)]. Both of these genes are known to cause autosomal recessive non-syndromic hearing impairment and Usher syndrome. The protein products of PCDH15 and USH1G function together at the stereocilia tips in the hair cells and are necessary for proper mechanotransduction. Epistasis between Pcdh15 and Ush1G has been previously reported in digenic heterozygous mice. The digenic mice displayed a significant decrease in hearing compared to age-matched heterozygous animals. Until now no human examples have been reported. Conclusions: The discovery of novel digenic inheritance mechanisms in hereditary hearing impairment will aid in understanding the interaction between defective proteins and further define inner ear function and its interactome.
    [Show full text]
  • PDZD7-MYO7A Complex Identified in Enriched Stereocilia Membranes
    RESEARCH ARTICLE PDZD7-MYO7A complex identified in enriched stereocilia membranes Clive P Morgan1†, Jocelyn F Krey1†, M’hamed Grati2, Bo Zhao3, Shannon Fallen1, Abhiraami Kannan-Sundhari2, Xue Zhong Liu2, Dongseok Choi4,5, Ulrich Mu¨ ller3, Peter G Barr-Gillespie1* 1Oregon Hearing Research Center and Vollum Institute, Oregon Health and Science University, Portland, United States; 2Department of Otolaryngology, Miller School of Medicine, University of Miami, Miami, United States; 3Dorris Neuroscience Center, The Scripps Research Institute, La Jolla, United States; 4OHSU-PSU School of Public Health, Oregon Health and Science University, Portland, United States; 5Graduate School of Dentistry, Kyung Hee University, Seoul, Korea Abstract While more than 70 genes have been linked to deafness, most of which are expressed in mechanosensory hair cells of the inner ear, a challenge has been to link these genes into molecular pathways. One example is Myo7a (myosin VIIA), in which deafness mutations affect the development and function of the mechanically sensitive stereocilia of hair cells. We describe here a procedure for the isolation of low-abundance protein complexes from stereocilia membrane fractions. Using this procedure, combined with identification and quantitation of proteins with mass spectrometry, we demonstrate that MYO7A forms a complex with PDZD7, a paralog of USH1C and DFNB31. MYO7A and PDZD7 interact in tissue-culture cells, and co-localize to the ankle-link region of stereocilia in wild-type but not Myo7a mutant mice. Our data thus describe a new paradigm for *For correspondence: gillespp@ the interrogation of low-abundance protein complexes in hair cell stereocilia and establish an ohsu.edu unanticipated link between MYO7A and PDZD7.
    [Show full text]
  • Determining the Causes of Recessive Retinal Dystrophy
    Determining the causes of recessive retinal dystrophy By Mohammed El-Sayed Mohammed El-Asrag BSc (hons), MSc (hons) Genetics and Molecular Biology Submitted in accordance with the requirements for the degree of Doctor of Philosophy The University of Leeds School of Medicine September 2016 The candidate confirms that the work submitted is his own, except where work which has formed part of jointly- authored publications has been included. The contribution of the candidate and the other authors to this work has been explicitly indicated overleaf. The candidate confirms that appropriate credit has been given within the thesis where reference has been made to the work of others. This copy has been supplied on the understanding that it is copyright material and that no quotation from the thesis may be published without proper acknowledgement. The right of Mohammed El-Sayed Mohammed El-Asrag to be identified as author of this work has been asserted by his in accordance with the Copyright, Designs and Patents Act 1988. © 2016 The University of Leeds and Mohammed El-Sayed Mohammed El-Asrag Jointly authored publications statement Chapter 3 (first results chapter) of this thesis is entirely the work of the author and appears in: Watson CM*, El-Asrag ME*, Parry DA, Morgan JE, Logan CV, Carr IM, Sheridan E, Charlton R, Johnson CA, Taylor G, Toomes C, McKibbin M, Inglehearn CF and Ali M (2014). Mutation screening of retinal dystrophy patients by targeted capture from tagged pooled DNAs and next generation sequencing. PLoS One 9(8): e104281. *Equal first- authors. Shevach E, Ali M, Mizrahi-Meissonnier L, McKibbin M, El-Asrag ME, Watson CM, Inglehearn CF, Ben-Yosef T, Blumenfeld A, Jalas C, Banin E and Sharon D (2015).
    [Show full text]