Russian Entomol. J. 20(3): 273286 © RUSSIAN ENTOMOLOGICAL JOURNAL, 2011 Molecular data support the existence of four main lineages in the phylogeny of the family Eulophidae (Hymenoptera) Ìîëåêóëÿðíûå äàííûå ïîäòâåðæäàþò ñóùåñòâîâàíèå ÷åòûðåõ îñíîâíûõ âåòâåé â ôèëîãåíåçå ñåìåéñòâà Eulophidae (Hymenoptera) A.V. Gumovsky À.Â. Ãóìîâñêèé I.I. Schmalhausen Institute of Zoology, National Academy of Sciences of Ukraine, 15 Bogdan Khmelnitsky St., Kiev-30 01601, Ukraine. E-mail: [email protected], [email protected] Èíñòèòóò çîîëîãèè èì. È.È. Øìàëüãàóçåíà ÍÀÍ Óêðàèíû, óë. Á. Õìåëüíèöêîãî, 15, Êèåâ, 01601, Óêðàèíà. KEY WORDS: Hymenoptera, Eulophidae, Tetracampidae, Trichogrammatidae, nuclear genes, mitochondrial genes, phylogeny, morphology. ÊËÞ×ÅÂÛÅ ÑËÎÂÀ: Hymenoptera, Eulophidae, Tetracampidae, Trichogrammatidae, ÿäåðíûå ãåíû, ìèòîõîíäðèàëüíûå ãåíû, ôèëîãåíèÿ, ìîðôîëîãèÿ. ABSTRACT. This study is an attempt to infer the phinae, Tetrastichinae, Entedoninae è Entiinae (= Eude- relationships between Eulophidae and putatively relat- rinae).  ñòàòüå òàêæå îáñóæäàþòñÿ ìîðôîëîãè÷åñ- ed families, as well as major groups within eulophids, êèå îñîáåííîñòè ïîäñåìåéñòâ ýâëîôèä, âêëþ÷àÿ with the combined analysis of nuclear (28S D2 rDNA) ïðåäïîëàãàåìûå ñèíàïîìîðôèè. and two mitochondrial sequences (cytochrome oxidase Introduction subunit I, COI, and cytochrome b, Cyt b). There is no signal of close relationships between the families Eu- The family Eulophidae is the most speciose in the lophidae, Tetracampidae and Trichogrammatidae, but family Chalcidoidea and it has an extremely wide host at least Eulophidae and Trichogrammatidae are sup- range [Noyes, 2004]. Eulophids are one of the most ported as monophyletic. The Eulophidae lineage con- successful groups of insects involved in biocontrol sists of four internal lineages corresponding to the rec- worldwide (e.g. [Murphy, La Salle, 1999; Waterhouse, ognized subfamilies: Eulophinae, Tetrastichinae, Ente- Norris, 1987]). Therefore taxonomy and phylogeny of doninae and Entiinae (= Euderinae). Morphology of those parasitoids attract attention of numerous research- the subfamilies (including putative synapomorphies) is ers. The first signal of monophyly of Eulophidae was also discussed. obtained by Campbell et al. [2000] on the basis of 28S D2 rDNA gene of chalcidoids. Also, Elasmus West- ÐÅÇÞÌÅ. Äàííîå èññëåäîâàíèå ïðåäñòàâëÿåò wood, 1833, the only genus of the former family Elas- ñîáîé ïîïûòêó âûÿñíèòü ôèëîãåíåòè÷åñêèå ñâÿçè midae, appeared to be a derived taxon within Eu- ìåæäó ñåìåéñòâîì Eulophidae è ïðåäïîëîæèòåëüíî lophidae. Then Gauthier et al. [2000] used the same ðîäñòâåííûìè åìó ñåìåéñòâàìè, à òàêæå ìåæäó îñ- gene on broader sampling to clarify the phylogeny of íîâíûìè ãðóïïàìè âíóòðè ñîáñòâåííî ýâëîôèä, èñ- Eulophidae. Those authors supported the idea that Elas- õîäÿ èç àíàëèçà ÿäåðíîé (28S D2 rDNA) è äâóõ midae are derived eulophids, demonstrated that the ìèòîõîíäðèàëüíûõ [ñóáúåäèíèöà I îêñèäàçû öèòîõ- subfamilies Eulophinae and Tetrastichinae are closely ðîìà (COI) è öèòîõðîì b (Cyt b)] ïîñëåäîâàòåëüíî- related and provided some new characters to support ñòåé ÄÍÊ. Íå óäàëîñü îáíàðóæèòü ñâèäåòåëüñòâ monophyly of some groups of Eulophidae. Gumovsky òåñíîãî ðîäñòâà ñåìåéñòâ Eulophidae, Tetracampidae [2002] also used the same gene for studying the sub- è Trichogrammatidae, îäíàêî ïî êðàéíåé ìåðå Eulo- family Entedoninae and discussed distribution of some phidae è Trichogrammatidae ÿâëÿþòñÿ ìîíîôèëåòè- morphological characters within eulophids*. ÷åñêèìè. Ñîáñòâåííî âåòâü Eulophidae ñîñòîèò èç The families Eulophidae, Tetracampidae, Tricho- ÷åòûðåõ âíóòðåííèõ âåòâåé, ñîîòâåòñòâóþùèõ òðà- grammatidae and also Aphelinidae are sometimes con- äèöèîííî ðàññìàòðèâàåìûì ïîäñåìåéñòâàì: Eulo- sidered as the eulophid lineage [Gibson et al., 1997]. * Note added in proof. When the present paper had already been in press, another paper on Eulophidae phylogeny [Burks et al., 2011] was published online (doi: 10.1111/j.1096-0031.2011.00358.x). The results presented in the latter work are in general agreement with the phylogenetic pattern demonstrated in the present paper. However, more detailed discussion could not be included in this paper due to technical reasons. 274 A.V. Gumovsky This group is characterized by the reduced number of ogy Department of the Natural History Museum antennal (generally 47, but occasionally more) and (BMNH, London, UK). Single specimen of each spe- tarsal segments (34). However, there are many over- cies was used for DNA extraction and further sequenc- laps in distribution of these character states within the ing. Genomic DNA was extracted from the ethanol- eulophid lineage, as well as with certain outgroups. preserved individuals using a protocol largely based on For instance, only the males of some Tetracampidae those described in the DNeasy Tissue Handbook pro- have 4-segmented tarsi, whereas the females have 5- vided by Qiagen (Hilden, Germany). We amplified segmented tarsi likewise most other Chalcidoidea. Gla- partial sequences of the nuclear 28S D2 rDNA, mito- dun and Gumovsky [2006] demonstrated that the rep- chondrial cytochrome oxidase subunit I (COI) and mi- resentatives of the eulophid lineage share similar tochondrial cytochrome b (Cyt b) genes for all studied morphology of pretarsus (e.g. number of proximal set- samples, using the following primers: ae on manubrium reduced to 23 setae). However, (a) 28S D1 and D2 rDNA (nuclear): D1F (ACCC there were some overlaps with other families (My- GCTGAATT TAAGCATAT) [Harry et al., 1996] and maridae, Pteromalidae) and high probability of conver- D2R (TTGG TCCGTGTTTCAAGACGG) [Campbell gence of this character in unrelated groups. Gokhman et al., 1993]. [2004, 2009] and then Gokhman and Gumovsky [2009] (b) Cytochrome oxidase I mtDNA (mitochondrial, suggested that Eulophidae belong to the so-called «low- COI): COI-Jerry (CAACATTTATTTTGATTTTTT numbered» chalcidoid families with the modal haploid GG) and COI-2613 (ATTGCAAATACTGCACCTAT) number of chromosomes n = 6 (but with occasional [Simon et al., 1994]. modifications to 5 or 8), whereas n = 912 in many (c) Cytochrome b mtDNA (mitochondrial, Cytb): other families. However, karyotypes of that kind also CB3 (GAGGAGCAACTGTAATTACTAA) and CB4 occur outside Eulophidae [Gokhman, 2009]. On the (AAAAGAAA(AG)TATCATTCAGGTTGAAT) other hand, the chromosome numbers reduced inde- [Pons, 2006]. pendently in various groups of Chalcidoidea [Gokh- Standard polymerase chain reactions (PCR) were man, Gumovsky, 2009]. carried out in 25 mL reaction mixtures consisting of The monophyly of Eulophidae and the relation- 2.5 mL BioTaq 4xNH4 Buffer, 2.625 mL 25 mM ships of this family with other groups of the eulophid MgCl , 0.7 mL dNTP, 0.35 mL primers, 0.084 mL 2 lineage therefore requires further studies and verifica- BioTaq Taq polymerase and 1 to 4 mL DNA. The total tion based on additional data. volume was increased up to 25 mL by adding of the The main purposes of the present study are: necessary volume of distilled water. DNA fragments (1) Independent reconstructions of phylogeny of were sequenced in one direction (with a reverse primer). Eulophidae and presumably related groups based on original data matrix of nuclear (28S D2 rDNA, used by Sequence alignment and matrix composition Gauthier et al. [2000]) and mitochondrial gene se- Only original sequences of the all three genes were quences (cytochrome b gene and cytochrome oxidase used for the analysis. The sequences were obtained for subunit 1 gene). 45 taxa (32 of Eulophidae, 13 of other families, Ap- (2) A review of morphological features of the mono- pendix 1). The obtained sequences were aligned using phyletic taxa within Eulophidae. the ClustalW algorithm [Thompson et al., 1994] in BioEdit software version 5.0.0 [Hall, 1999] with de- Materials and methods fault settings and corrected manually if certain ambigu- ities were found. The obtained sequences were depos- Materials ited in the GenBank with corresponding accession num- Eulophidae are traditionally considered as con- bers (JF816057-JF816191). sisting of four subfamilies, Eulophinae, Entedoninae, The matrices were prepared for each gene separate- Tetrastichinae and Entiinae (= Euderinae [Hansson, ly in BioEdit. 28S D2 matrix was represented by 648 Straka, 2009]). Some other groups, namely, Ophelimi- positions after alignment, Cyt b matrix was represented ni, Anselemellini, Keryini and Platytetracampini have by 341 positions and COI matrix was represented by been regarded eulophids (e.g., Bouèek [1988]), but 397 positions. These three alignments were combined then were treated as unplaced groups or even non- into a single matrix of total 1386 positions, which was eulophids by Gauthier et al. [2000]. In this study we eventually used for the analyses. focused only on the representatives of the four tradi- tionally recognized subfamilies (Table 1), keeping in Phylogeny reconstructions mind that their relationships with the unplaced Phylogenies were reconstructed with three different groups require a separate study based on excessive approaches: sampling of those taxa. (1) The maximum parsimony analysis. This analy- sis was executed with PAUP* version 4.0b10 [Swof- DNA studies ford, 1998], using default options for heuristic search DNA extraction and sequencing were conducted in and treating gaps as missing data, unweighted and un- the Molecular Systematics Laboratory of the Entomol- ordered characters. Of total 1386 characters in the Molecular data and phylogeny of Eulophidae 275 Table.