DOCSLIB.ORG

Ent20 3 273 286 Gumovsky.P65

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ent20 3 273 286 Gumovsky.P65 Russian Entomol. J. 20(3): 273286 © RUSSIAN ENTOMOLOGICAL JOURNAL, 2011 Molecular data support the existence of four main lineages in the phylogeny of the family Eulophidae (Hymenoptera) Ìîëåêóëÿðíûå äàííûå ïîäòâåðæäàþò ñóùåñòâîâàíèå ÷åòûðåõ îñíîâíûõ âåòâåé â ôèëîãåíåçå ñåìåéñòâà Eulophidae (Hymenoptera) A.V. Gumovsky À.Â. Ãóìîâñêèé I.I. Schmalhausen Institute of Zoology, National Academy of Sciences of Ukraine, 15 Bogdan Khmelnitsky St., Kiev-30 01601, Ukraine. E-mail: [email protected], [email protected] Èíñòèòóò çîîëîãèè èì. È.È. Øìàëüãàóçåíà ÍÀÍ Óêðàèíû, óë. Á. Õìåëüíèöêîãî, 15, Êèåâ, 01601, Óêðàèíà. KEY WORDS: Hymenoptera, Eulophidae, Tetracampidae, Trichogrammatidae, nuclear genes, mitochondrial genes, phylogeny, morphology. ÊËÞ×ÅÂÛÅ ÑËÎÂÀ: Hymenoptera, Eulophidae, Tetracampidae, Trichogrammatidae, ÿäåðíûå ãåíû, ìèòîõîíäðèàëüíûå ãåíû, ôèëîãåíèÿ, ìîðôîëîãèÿ. ABSTRACT. This study is an attempt to infer the phinae, Tetrastichinae, Entedoninae è Entiinae (= Eude- relationships between Eulophidae and putatively relat- rinae).  ñòàòüå òàêæå îáñóæäàþòñÿ ìîðôîëîãè÷åñ- ed families, as well as major groups within eulophids, êèå îñîáåííîñòè ïîäñåìåéñòâ ýâëîôèä, âêëþ÷àÿ with the combined analysis of nuclear (28S D2 rDNA) ïðåäïîëàãàåìûå ñèíàïîìîðôèè. and two mitochondrial sequences (cytochrome oxidase Introduction subunit I, COI, and cytochrome b, Cyt b). There is no signal of close relationships between the families Eu- The family Eulophidae is the most speciose in the lophidae, Tetracampidae and Trichogrammatidae, but family Chalcidoidea and it has an extremely wide host at least Eulophidae and Trichogrammatidae are sup- range [Noyes, 2004]. Eulophids are one of the most ported as monophyletic. The Eulophidae lineage con- successful groups of insects involved in biocontrol sists of four internal lineages corresponding to the rec- worldwide (e.g. [Murphy, La Salle, 1999; Waterhouse, ognized subfamilies: Eulophinae, Tetrastichinae, Ente- Norris, 1987]). Therefore taxonomy and phylogeny of doninae and Entiinae (= Euderinae). Morphology of those parasitoids attract attention of numerous research- the subfamilies (including putative synapomorphies) is ers. The first signal of monophyly of Eulophidae was also discussed. obtained by Campbell et al. [2000] on the basis of 28S D2 rDNA gene of chalcidoids. Also, Elasmus West- ÐÅÇÞÌÅ. Äàííîå èññëåäîâàíèå ïðåäñòàâëÿåò wood, 1833, the only genus of the former family Elas- ñîáîé ïîïûòêó âûÿñíèòü ôèëîãåíåòè÷åñêèå ñâÿçè midae, appeared to be a derived taxon within Eu- ìåæäó ñåìåéñòâîì Eulophidae è ïðåäïîëîæèòåëüíî lophidae. Then Gauthier et al. [2000] used the same ðîäñòâåííûìè åìó ñåìåéñòâàìè, à òàêæå ìåæäó îñ- gene on broader sampling to clarify the phylogeny of íîâíûìè ãðóïïàìè âíóòðè ñîáñòâåííî ýâëîôèä, èñ- Eulophidae. Those authors supported the idea that Elas- õîäÿ èç àíàëèçà ÿäåðíîé (28S D2 rDNA) è äâóõ midae are derived eulophids, demonstrated that the ìèòîõîíäðèàëüíûõ [ñóáúåäèíèöà I îêñèäàçû öèòîõ- subfamilies Eulophinae and Tetrastichinae are closely ðîìà (COI) è öèòîõðîì b (Cyt b)] ïîñëåäîâàòåëüíî- related and provided some new characters to support ñòåé ÄÍÊ. Íå óäàëîñü îáíàðóæèòü ñâèäåòåëüñòâ monophyly of some groups of Eulophidae. Gumovsky òåñíîãî ðîäñòâà ñåìåéñòâ Eulophidae, Tetracampidae [2002] also used the same gene for studying the sub- è Trichogrammatidae, îäíàêî ïî êðàéíåé ìåðå Eulo- family Entedoninae and discussed distribution of some phidae è Trichogrammatidae ÿâëÿþòñÿ ìîíîôèëåòè- morphological characters within eulophids*. ÷åñêèìè. Ñîáñòâåííî âåòâü Eulophidae ñîñòîèò èç The families Eulophidae, Tetracampidae, Tricho- ÷åòûðåõ âíóòðåííèõ âåòâåé, ñîîòâåòñòâóþùèõ òðà- grammatidae and also Aphelinidae are sometimes con- äèöèîííî ðàññìàòðèâàåìûì ïîäñåìåéñòâàì: Eulo- sidered as the eulophid lineage [Gibson et al., 1997]. * Note added in proof. When the present paper had already been in press, another paper on Eulophidae phylogeny [Burks et al., 2011] was published online (doi: 10.1111/j.1096-0031.2011.00358.x). The results presented in the latter work are in general agreement with the phylogenetic pattern demonstrated in the present paper. However, more detailed discussion could not be included in this paper due to technical reasons. 274 A.V. Gumovsky This group is characterized by the reduced number of ogy Department of the Natural History Museum antennal (generally 47, but occasionally more) and (BMNH, London, UK). Single specimen of each spe- tarsal segments (34). However, there are many over- cies was used for DNA extraction and further sequenc- laps in distribution of these character states within the ing. Genomic DNA was extracted from the ethanol- eulophid lineage, as well as with certain outgroups. preserved individuals using a protocol largely based on For instance, only the males of some Tetracampidae those described in the DNeasy Tissue Handbook pro- have 4-segmented tarsi, whereas the females have 5- vided by Qiagen (Hilden, Germany). We amplified segmented tarsi likewise most other Chalcidoidea. Gla- partial sequences of the nuclear 28S D2 rDNA, mito- dun and Gumovsky [2006] demonstrated that the rep- chondrial cytochrome oxidase subunit I (COI) and mi- resentatives of the eulophid lineage share similar tochondrial cytochrome b (Cyt b) genes for all studied morphology of pretarsus (e.g. number of proximal set- samples, using the following primers: ae on manubrium reduced to 23 setae). However, (a) 28S D1 and D2 rDNA (nuclear): D1F (ACCC there were some overlaps with other families (My- GCTGAATT TAAGCATAT) [Harry et al., 1996] and maridae, Pteromalidae) and high probability of conver- D2R (TTGG TCCGTGTTTCAAGACGG) [Campbell gence of this character in unrelated groups. Gokhman et al., 1993]. [2004, 2009] and then Gokhman and Gumovsky [2009] (b) Cytochrome oxidase I mtDNA (mitochondrial, suggested that Eulophidae belong to the so-called «low- COI): COI-Jerry (CAACATTTATTTTGATTTTTT numbered» chalcidoid families with the modal haploid GG) and COI-2613 (ATTGCAAATACTGCACCTAT) number of chromosomes n = 6 (but with occasional [Simon et al., 1994]. modifications to 5 or 8), whereas n = 912 in many (c) Cytochrome b mtDNA (mitochondrial, Cytb): other families. However, karyotypes of that kind also CB3 (GAGGAGCAACTGTAATTACTAA) and CB4 occur outside Eulophidae [Gokhman, 2009]. On the (AAAAGAAA(AG)TATCATTCAGGTTGAAT) other hand, the chromosome numbers reduced inde- [Pons, 2006]. pendently in various groups of Chalcidoidea [Gokh- Standard polymerase chain reactions (PCR) were man, Gumovsky, 2009]. carried out in 25 mL reaction mixtures consisting of The monophyly of Eulophidae and the relation- 2.5 mL BioTaq 4xNH4 Buffer, 2.625 mL 25 mM ships of this family with other groups of the eulophid MgCl , 0.7 mL dNTP, 0.35 mL primers, 0.084 mL 2 lineage therefore requires further studies and verifica- BioTaq Taq polymerase and 1 to 4 mL DNA. The total tion based on additional data. volume was increased up to 25 mL by adding of the The main purposes of the present study are: necessary volume of distilled water. DNA fragments (1) Independent reconstructions of phylogeny of were sequenced in one direction (with a reverse primer). Eulophidae and presumably related groups based on original data matrix of nuclear (28S D2 rDNA, used by Sequence alignment and matrix composition Gauthier et al. [2000]) and mitochondrial gene se- Only original sequences of the all three genes were quences (cytochrome b gene and cytochrome oxidase used for the analysis. The sequences were obtained for subunit 1 gene). 45 taxa (32 of Eulophidae, 13 of other families, Ap- (2) A review of morphological features of the mono- pendix 1). The obtained sequences were aligned using phyletic taxa within Eulophidae. the ClustalW algorithm [Thompson et al., 1994] in BioEdit software version 5.0.0 [Hall, 1999] with de- Materials and methods fault settings and corrected manually if certain ambigu- ities were found. The obtained sequences were depos- Materials ited in the GenBank with corresponding accession num- Eulophidae are traditionally considered as con- bers (JF816057-JF816191). sisting of four subfamilies, Eulophinae, Entedoninae, The matrices were prepared for each gene separate- Tetrastichinae and Entiinae (= Euderinae [Hansson, ly in BioEdit. 28S D2 matrix was represented by 648 Straka, 2009]). Some other groups, namely, Ophelimi- positions after alignment, Cyt b matrix was represented ni, Anselemellini, Keryini and Platytetracampini have by 341 positions and COI matrix was represented by been regarded eulophids (e.g., Bouèek [1988]), but 397 positions. These three alignments were combined then were treated as unplaced groups or even non- into a single matrix of total 1386 positions, which was eulophids by Gauthier et al. [2000]. In this study we eventually used for the analyses. focused only on the representatives of the four tradi- tionally recognized subfamilies (Table 1), keeping in Phylogeny reconstructions mind that their relationships with the unplaced Phylogenies were reconstructed with three different groups require a separate study based on excessive approaches: sampling of those taxa. (1) The maximum parsimony analysis. This analy- sis was executed with PAUP* version 4.0b10 [Swof- DNA studies ford, 1998], using default options for heuristic search DNA extraction and sequencing were conducted in and treating gaps as missing data, unweighted and un- the Molecular Systematics Laboratory of the Entomol- ordered characters. Of total 1386 characters in the Molecular data and phylogeny of Eulophidae 275 Table.
Load more

Recommended publications
  • Dorothy J. Jackson FRES FLS, Scottish Entomologist: a Bibliography Jack R
    The University of Maine DigitalCommons@UMaine Biology and Ecology Faculty Scholarship School of Biology and Ecology 10-2018 Dorothy J. Jackson FRES FLS, Scottish Entomologist: A Bibliography Jack R. McLachlan UMaine, [email protected] Follow this and additional works at: https://digitalcommons.library.umaine.edu/bio_facpub Part of the Entomology Commons, and the History of Science, Technology, and Medicine Commons Repository Citation McLachlan, JR (2018) Dorothy J. Jackson FRES FLS, Scottish entomologist: a bibliography. Latissimus 42: 10-13 This Article is brought to you for free and open access by DigitalCommons@UMaine. It has been accepted for inclusion in Biology and Ecology Faculty Scholarship by an authorized administrator of DigitalCommons@UMaine. For more information, please contact [email protected]. ISSN 0966 2235 LATISSIMUS NEWSLETTER OF THE BALFOUR-BROWNE CLUB Number Forty Two October 2018 October 2018 LATISSIMUS 42 10 DOROTHY J. JACKSON FRES FLS, SCOTTISH ENTOMOLOGIST: A BIBLIOGRAPHY Jack R. McLachlan Dorothy Jean Jackson FRES FLS (1892-1973) should be familiar to anyone interested in water beetles. She published prolifically on the ecology, distribution, flight capacity, and parasites of water beetles, and made especially important contributions to our knowledge of dytiscids. Lees (1974) provided a very brief and somewhat accurate obituary. I am currently preparing a more comprehensive biography of her and would be grateful to receive any notes or anecdotes from those that knew or met her. Foster (1991), at the request of the late Hans Schaeflein, was the first effort in putting together a publication list. Here I provide a more extensive bibliography of her work that is almost certainly incomplete, but I think includes most of her scientific output between 1907 and 1973.
    [Show full text]
  • Comparative Anatomy of the Fig Wall (Ficus, Moraceae)
    Botany Comparative anatomy of the fig wall (Ficus, Moraceae) Journal: Botany Manuscript ID cjb-2018-0192.R2 Manuscript Type: Article Date Submitted by the 12-Mar-2019 Author: Complete List of Authors: Fan, Kang-Yu; National Taiwan University, Institute of Ecology and Evolutionary Biology Bain, Anthony; national Sun yat-sen university, Department of biological sciences; National Taiwan University, Institute of Ecology and Evolutionary Biology Tzeng, Hsy-Yu; National Chung Hsing University, Department of Forestry Chiang, Yun-Peng;Draft National Taiwan University, Institute of Ecology and Evolutionary Biology Chou, Lien-Siang; National Taiwan University, Institute of Ecology and Evolutionary Biology Kuo-Huang, Ling-Long; National Taiwan University, Institute of Ecology and Evolutionary Biology Keyword: Comparative Anatomy, Ficus, Histology, Inflorescence Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? : https://mc06.manuscriptcentral.com/botany-pubs Page 1 of 29 Botany Comparative anatomy of the fig wall (Ficus, Moraceae) Kang-Yu Fana, Anthony Baina,b *, Hsy-Yu Tzengc, Yun-Peng Chianga, Lien-Siang Choua, Ling-Long Kuo-Huanga a Institute of Ecology and Evolutionary Biology, College of Life Sciences, National Taiwan University, 1, Sec. 4, Roosevelt Road, Taipei, 10617, Taiwan b current address: Department of Biological Sciences, National Sun Yat-sen University, 70 Lien-Hai road, Kaohsiung, Taiwan.Draft c Department of Forestry, National Chung Hsing University, 145 Xingda Rd., South Dist., Taichung, 402, Taiwan. * Corresponding author: [email protected]; Tel: +886-75252000-3617; Fax: +886-75253609. 1 https://mc06.manuscriptcentral.com/botany-pubs Botany Page 2 of 29 Abstract The genus Ficus is unique by its closed inflorescence (fig) holding all flowers inside its cavity, which is isolated from the outside world by a fleshy barrier: the fig wall.
    [Show full text]
  • 15-Hansson/A New 121-126
    Rev. Biol. Trop. 50(1): 121-125, 2002 www.ucr.ac.cr www.ots.ac.cr www.ots.duke.edu A new species of Pediobius (Hymenoptera: Eulophidae) from Epilachna (Coleoptera: Coccinellidae) in Costa Rica Christer Hansson1 and Kenji Nishida2 1 Department of Zoology, Lund University, Helgonavägen 3, S-223 62 Lund, Sweden. Fax: 46462224541; [email protected] 2 Escuela de Biología, Universidad de Costa Rica, 2060 San José, Costa Rica; [email protected] Received 03-X-2000. Corrected 16-IV-2001. Accepted 18-VI-2001. Abstract: A new and morphologically very distinct species of Pediobius from Costa Rica is described. The new species (P. nishidai) is unique among New World species of Pediobius in having the propodeum elongated and extended backwards (i.e. with an elongated nucha). The entire type series (15 females, two males) was reared from a single prepupa of Epilachna mexicana and it has been concluded that the new Pediobius species is a gre- garious endoparasitoid that pupates inside its host. The possible use of this new species as a biological control agent against “the Mexican bean beetle” (E. varivestis) should be tested. Key words: Entedoninae, Pediobius nishidai sp. n., taxonomy, parasitoid, Epilachna mexicana. The genus Pediobius Walker is a large and (Waterston) from E. similis (Kerrich 1973) and cosmopolitan group, with the majority of P. foveolatus (Crawford) from several host species occuring in the northern temperate species, e.g. E. varivestis Mulsant (the regions. Relatively few species have been Mexican bean beetle) (Peck 1985). The former recorded from the Neotropical region, where species has an African origin and the latter Pediobius is thought to be largely replaced by originates from Asia and Australia (Kerrich Horismenus Walker (Boucek 1988).
    [Show full text]
  • Hym.: Eulophidae) New Larval Ectoparasitoids of Tuta Absoluta (Meyreck) (Lep.: Gelechidae)
    J. Crop Prot. 2016, 5 (3): 413-418______________________________________________________ Research Article Two species of the genus Elachertus Spinola (Hym.: Eulophidae) new larval ectoparasitoids of Tuta absoluta (Meyreck) (Lep.: Gelechidae) Fatemeh Yarahmadi1*, Zohreh Salehi1 and Hossein Lotfalizadeh2 1. Ramin Agriculture and Natural Resources University, Mollasani, Ahvaz, Iran. 2. East-Azarbaijan Research Center for Agriculture and Natural Resources, Tabriz, Iran. Abstract: This is the first report of two ectoparasitoid wasps, Elachertus inunctus (Nees, 1834) in Iran and Elachertus pulcher (Erdös, 1961) (Hym.: Eulophidae) in the world, that parasitize larvae of the tomato leaf miner, Tuta absoluta (Meyrick, 1917) (Lep.: Gelechiidae). The specimens were collected from tomato fields and greenhouses in Ahwaz, Khouzestan province (south west of Iran). Both species are new records for fauna of Iran. The knowledge about these parasitoids is still scanty. The potential of these parasitoids for biological control of T. absoluta in tomato fields and greenhouses should be investigated. Keywords: tomato leaf miner, parasitoids, identification, biological control Introduction12 holometabolous insects, the overall range of hosts and biologies in eulophid wasps is remarkably The Eulophidae is one of the largest families of diverse (Gauthier et al., 2000). Chalcidoidea. The chalcid parasitoid wasps attack Species of the genus Elachertus Spinola, 1811 insects from many orders and also mites. Many (Hym.: Eulophidae) are primary parasitoids of a eulophid wasps parasitize several pests on variety of lepidopteran larvae. Some species are different crops. They can regulate their host's polyphagous that parasite hosts belonging to populations in natural conditions (Yefremova and different insect families. The larvae of these Myartseva, 2004). Eulophidae are composed of wasps are often gregarious and their pupae can be four subfamilies, Entedoninae (Förster, 1856), observed on the surface of plant leaves or the Euderinae (Lacordaire, 1866), Eulophinae body of their host.
    [Show full text]
  • New Genera and Species of Afrotropical Entedoninae (Hymenoptera, Eulophidae)
    New genera and species of Afrotropical Entedoninae (Hymenoptera, Eulophidae) A. Gumovsky, Z. Boucˇek & G. Delvare Gumovsky, A., Boucˇek, Z. & Delvare, G. New genera and species of Afrotropical Entedoninae (Hy- menoptera, Eulophidae). Zool. Med. Leiden 80-1 (4), 10.iii.2006: 73-85, fi gs 1-26.— ISSN 0024-0672. Gumovsky, A., Schmalhausen Institute of Zoology, 15 Bogdan Khmelnitsky St., 01601 Kiev MSP, Ukraine, (e-mail: [email protected], [email protected]). Boucˇek, Z., The Natural History Museum, Cromwell Road, London SW7 5BD, England, (e-mail: Z. [email protected]). Delvare, G., Cirad TA 40/L, Campus international de Baillarguet-Csiro, Montpellier Cedex 5, France, (e-mail: [email protected]). Key words: Hymenoptera; Eulophidae; Entedoninae; Afrotropical region; propodeum; new genera; new species. Two new genera of Entedoninae are described from Afrotropical region. The genus Janicharis gen. nov. (type species: J. africana spec. nov.) is described from Cameroon, Nigeria and Madagascar. The genus Hakuna gen. nov. (type species: H. matata spec. nov.) is described from Uganda. Both genera have a rather characteristic habitus and a peculiar propodeum bearing large anterolateral strips. A new, but yet unnamed, species of the genus Trisecodes Delvare & LaSalle, 2000, is recorded from Cameroon. This is the fi rst Afrotropical record of this genus, originally described from the Neotropical region. Introduction Afrotropical and Malagasy Entedoninae are probably the least studied group with- in the family Eulophidae. They include only 107 of almost 1200 species known world- wide so far. Compared to this, 603 entedonines are known from the Holarctic region, 239 from the Neotropics and more than 300 from the Indo-Pacifi c area (Noyes, 2001, 2003).
    [Show full text]
  • British Museum (Natural History)
    Bulletin of the British Museum (Natural History) Darwin's Insects Charles Darwin 's Entomological Notes Kenneth G. V. Smith (Editor) Historical series Vol 14 No 1 24 September 1987 The Bulletin of the British Museum (Natural History), instituted in 1949, is issued in four scientific series, Botany, Entomology, Geology (incorporating Mineralogy) and Zoology, and an Historical series. Papers in the Bulletin are primarily the results of research carried out on the unique and ever-growing collections of the Museum, both by the scientific staff of the Museum and by specialists from elsewhere who make use of the Museum's resources. Many of the papers are works of reference that will remain indispensable for years to come. Parts are published at irregular intervals as they become ready, each is complete in itself, available separately, and individually priced. Volumes contain about 300 pages and several volumes may appear within a calendar year. Subscriptions may be placed for one or more of the series on either an Annual or Per Volume basis. Prices vary according to the contents of the individual parts. Orders and enquiries should be sent to: Publications Sales, British Museum (Natural History), Cromwell Road, London SW7 5BD, England. World List abbreviation: Bull. Br. Mus. nat. Hist. (hist. Ser.) © British Museum (Natural History), 1987 '""•-C-'- '.;.,, t •••v.'. ISSN 0068-2306 Historical series 0565 ISBN 09003 8 Vol 14 No. 1 pp 1-141 British Museum (Natural History) Cromwell Road London SW7 5BD Issued 24 September 1987 I Darwin's Insects Charles Darwin's Entomological Notes, with an introduction and comments by Kenneth G.
    [Show full text]
  • Ficus Burkei
    International Scholarly Research Network ISRN Zoology Volume 2012, Article ID 908560, 6 pages doi:10.5402/2012/908560 Research Article Spatial Stratification of Internally and Externally Non-Pollinating Fig Wasps and Their Effects on Pollinator and Seed Abundance in Ficus burkei Sarah Al-Beidh,1 Derek W. Dunn,2 and James M. Cook2 1 Division of Biology, Imperial College London, Ascot, Berkshire SL5 7PY, UK 2 School of Biological Sciences, University of Reading, Reading, Berkshire RG6 6AS, UK Correspondence should be addressed to James M. Cook, [email protected] Received 30 November 2011; Accepted 19 December 2011 Academic Editors: M. Kuntner and S. Van Nouhuys Copyright © 2012 Sarah Al-Beidh et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Fig trees (Ficus spp.) are pollinated by tiny wasps that enter their enclosed inflorescences (syconia). The wasp larvae also consume some fig ovules, which negatively affects seed production. Within syconia, pollinator larvae mature mostly in the inner ovules whereas seeds develop mostly in outer ovules—a stratification pattern that enables mutualism persistence. Pollinators may prefer inner ovules because they provide enemy-free space from externally ovipositing parasitic wasps. In some Australasian Ficus, this results in spatial segregation of pollinator and parasite offspring within syconia, with parasites occurring in shorter ovules than pollinators. Australian figs lack non-pollinating fig wasps (NPFW) that enter syconia to oviposit, but these occur in Africa and Asia, and may affect mutualist reproduction via parasitism or seed predation.
    [Show full text]
  • Hymenoptera: Eulophidae) 321-356 ©Entomofauna Ansfelden/Austria; Download Unter
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Entomofauna Jahr/Year: 2007 Band/Volume: 0028 Autor(en)/Author(s): Yefremova Zoya A., Ebrahimi Ebrahim, Yegorenkova Ekaterina Artikel/Article: The Subfamilies Eulophinae, Entedoninae and Tetrastichinae in Iran, with description of new species (Hymenoptera: Eulophidae) 321-356 ©Entomofauna Ansfelden/Austria; download unter www.biologiezentrum.at Entomofauna ZEITSCHRIFT FÜR ENTOMOLOGIE Band 28, Heft 25: 321-356 ISSN 0250-4413 Ansfelden, 30. November 2007 The Subfamilies Eulophinae, Entedoninae and Tetrastichinae in Iran, with description of new species (Hymenoptera: Eulophidae) Zoya YEFREMOVA, Ebrahim EBRAHIMI & Ekaterina YEGORENKOVA Abstract This paper reflects the current degree of research of Eulophidae and their hosts in Iran. A list of the species from Iran belonging to the subfamilies Eulophinae, Entedoninae and Tetrastichinae is presented. In the present work 47 species from 22 genera are recorded from Iran. Two species (Cirrospilus scapus sp. nov. and Aprostocetus persicus sp. nov.) are described as new. A list of 45 host-parasitoid associations in Iran and keys to Iranian species of three genera (Cirrospilus, Diglyphus and Aprostocetus) are included. Zusammenfassung Dieser Artikel zeigt den derzeitigen Untersuchungsstand an eulophiden Wespen und ihrer Wirte im Iran. Eine Liste der für den Iran festgestellten Arten der Unterfamilien Eu- lophinae, Entedoninae und Tetrastichinae wird präsentiert. Mit vorliegender Arbeit werden 47 Arten in 22 Gattungen aus dem Iran nachgewiesen. Zwei neue Arten (Cirrospilus sca- pus sp. nov. und Aprostocetus persicus sp. nov.) werden beschrieben. Eine Liste von 45 Wirts- und Parasitoid-Beziehungen im Iran und ein Schlüssel für 3 Gattungen (Cirro- spilus, Diglyphus und Aprostocetus) sind in der Arbeit enthalten.
    [Show full text]
  • Plant Diversity Has Contrasting Effects on Herbivore and Parasitoid
    Received: 25 May 2016 | Revised: 1 May 2017 | Accepted: 8 May 2017 DOI: 10.1002/ece3.3142 ORIGINAL RESEARCH Plant diversity has contrasting effects on herbivore and parasitoid abundance in Centaurea jacea flower heads Norma Nitschke1 | Eric Allan2 | Helmut Zwölfer3 | Lysett Wagner1 | Sylvia Creutzburg1 | Hannes Baur4,5 | Stefan Schmidt6 | Wolfgang W. Weisser1 1Institute of Ecology, Friedrich-Schiller- University, Jena, Germany Abstract 2Institute of Plant Sciences, University of High biodiversity is known to increase many ecosystem functions, but studies investi- Bern, Bern, Switzerland gating biodiversity effects have more rarely looked at multi- trophic interactions. We 3Department for Animal Ecology I, University studied a tri- trophic system composed of Centaurea jacea (brown knapweed), its flower of Bayreuth, Bayreuth, Germany 4Abteilung Wirbellose Tiere, Naturhistorisches head- infesting tephritid fruit flies and their hymenopteran parasitoids, in a grassland Museum Bern, Bern, Switzerland biodiversity experiment. We aimed to disentangle the importance of direct effects of 5 Institute of Ecology and Evolution, University plant diversity (through changes in apparency and resource availability) from indirect of Bern, Bern, Switzerland effects (mediated by host plant quality and performance). To do this, we compared 6Bavarian State Collection of Zoology (ZSM), Munich, Germany insect communities in C. jacea transplants, whose growth was influenced by the sur- rounding plant communities (and where direct and indirect effects can occur), with Correspondence Norma Nitschke, Institute of Ecology, potted C. jacea plants, which do not compete with the surrounding plant community Friedrich-Schiller-University, Jena, Germany. (and where only direct effects are possible). Tephritid infestation rate and insect load, Email: [email protected] mainly of the dominant species Chaetorellia jaceae, decreased with increasing plant Present address species and functional group richness.
    [Show full text]
  • Multi-Trophic Level Interactions Between the Invasive Plant
    MULTI-TROPHIC LEVEL INTERACTIONS BETWEEN THE INVASIVE PLANT CENTAUREA STOEBE, INSECTS AND NATIVE PLANTS by Christina Rachel Herron-Sweet A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Land Resources and Environmental Sciences MONTANA STATE UNIVERSITY Bozeman, Montana May 2014 ©COPYRIGHT by Christina Rachel Herron-Sweet 2014 All Rights Reserved ii DEDICATION To my parents and grandparents, who instilled in me the value of education and have been my biggest supporters along the way. iii ACKNOWLEDGEMENTS Special thanks go to my two advisers Drs. Jane Mangold and Erik Lehnhoff for all their tremendous support, advice and feedback during my graduate program. My two other committee members Drs. Laura Burkle and Jeff Littlefield also deserve a huge thank you for the time and effort they put into helping me with various aspects of my project. This research would not have been possible without the dedicated crew of field and lab helpers: Torrin Daniels, Darcy Goodson, Daniel France, James Collins, Ann de Meij, Noelle Orloff, Krista Ehlert, and Hally Berg. The following individuals deserve recognition for their patience in teaching me pollinator identification, and for providing parasitoid identifications: Casey Delphia, Mike Simanonok, Justin Runyon, Charles Hart, Stacy Davis, Mike Ivie, Roger Burks, Jim Woolley, David Wahl, Steve Heydon, and Gary Gibson. Hilary Parkinson and Matt Lavin also offered their expertise in plant identification. Statistical advice and R code was generously offered by Megan Higgs, Sean McKenzie, Pamela Santibanez, Dan Bachen, Michael Lerch, Michael Simanonok, Zach Miller and Dave Roberts. Bryce Christiaens, Lyn Huyser, Gil Gale and Craig Campbell provided instrumental consultation on locating field sites, and the Circle H Ranch, Flying D Ranch and the United States Forest Service graciously allowed this research to take place on their property.
    [Show full text]
  • Journal of Hymenoptera Research
    c 3 Journal of Hymenoptera Research . .IV 6«** Volume 15, Number 2 October 2006 ISSN #1070-9428 CONTENTS BELOKOBYLSKIJ, S. A. and K. MAETO. A new species of the genus Parachremylus Granger (Hymenoptera: Braconidae), a parasitoid of Conopomorpha lychee pests (Lepidoptera: Gracillariidae) in Thailand 181 GIBSON, G. A. P., M. W. GATES, and G. D. BUNTIN. Parasitoids (Hymenoptera: Chalcidoidea) of the cabbage seedpod weevil (Coleoptera: Curculionidae) in Georgia, USA 187 V. Forest GILES, and J. S. ASCHER. A survey of the bees of the Black Rock Preserve, New York (Hymenoptera: Apoidea) 208 GUMOVSKY, A. V. The biology and morphology of Entedon sylvestris (Hymenoptera: Eulophidae), a larval endoparasitoid of Ceutorhynchus sisymbrii (Coleoptera: Curculionidae) 232 of KULA, R. R., G. ZOLNEROWICH, and C. J. FERGUSON. Phylogenetic analysis Chaenusa sensu lato (Hymenoptera: Braconidae) using mitochondrial NADH 1 dehydrogenase gene sequences 251 QUINTERO A., D. and R. A. CAMBRA T The genus Allotilla Schuster (Hymenoptera: Mutilli- dae): phylogenetic analysis of its relationships, first description of the female and new distribution records 270 RIZZO, M. C. and B. MASSA. Parasitism and sex ratio of the bedeguar gall wasp Diplolqjis 277 rosae (L.) (Hymenoptera: Cynipidae) in Sicily (Italy) VILHELMSEN, L. and L. KROGMANN. Skeletal anatomy of the mesosoma of Palaeomymar anomalum (Blood & Kryger, 1922) (Hymenoptera: Mymarommatidae) 290 WHARTON, R. A. The species of Stenmulopius Fischer (Hymenoptera: Braconidae, Opiinae) and the braconid sternaulus 316 (Continued on back cover) INTERNATIONAL SOCIETY OF HYMENOPTERISTS Organized 1982; Incorporated 1991 OFFICERS FOR 2006 Michael E. Schauff, President James Woolley, President-Elect Michael W. Gates, Secretary Justin O. Schmidt, Treasurer Gavin R.
    [Show full text]
  • Hymenoptera: Eulophidae): Application of Integrative Taxonomy for Disentangling a Polyphenism Case in Eucalyptus Globulus Labill Forest in Chile
    Article Ophelimus migdanorum Molina-Mercader sp. nov. (Hymenoptera: Eulophidae): Application of Integrative Taxonomy for Disentangling a Polyphenism Case in Eucalyptus globulus Labill Forest in Chile Gloria Molina-Mercader 1,* , Andrés O. Angulo 2, Tania S. Olivares 2, Eugenio Sanfuentes 3, Miguel Castillo-Salazar 3, Eladio Rojas 4, Oscar Toro-Núñez 5, Hugo A. Benítez 6 and Rodrigo Hasbún 7,* 1 MIPlagas Ltda., Avda. Las Rosas 1973, Huertos Familiares, San Pedro de La Paz, Concepción 4130000, Chile 2 Departamento De Zoología, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Casilla 160-C, Concepción, Concepción 4030000, Chile 3 Facultad de Ciencias Forestales, Universidad de Concepción, Casilla 160-C, Concepción, Concepción 4030000, Chile 4 Laboratorio Regional Servicio Agrícola y Ganadero, Unidad de Entomología., Osorno 5290000, Región de Los Lagos, Chile 5 Departamento de Botánica, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción, Casilla 160-C, Concepción, Concepción 4030000, Chile 6 Departamento de Biología, Facultad de Ciencias, Universidad de Tarapacá, Arica 1000000, Región de Arica y Parinacota, Chile 7 Laboratorio de Epigenética, Departamento de Silvicultura, Facultad de Ciencias Forestales, Universidad de Concepción, Concepción 4030000, Chile * Correspondence: [email protected] (G.M.-M.); [email protected] (R.H.); Fax: + 56-9-56187684 (G.M.-M.) Received: 13 July 2019; Accepted: 16 August 2019; Published: 22 August 2019 Abstract: In 2003, a new gall-inducing wasp of the genus Ophelimus was detected in the Valparaíso Region (Chile), affecting tree plantations of Eucalyptus globulus Labill and Eucalyptus camaldulensis Dehnh. Since then Ophelimus has been frequently detected in different plantations in Chile, covering a widespread area.
    [Show full text]