Loss of Sequences 3' to the Testis-Determining Gene, SRY, Including the Y Pseudoautosomal Boundary Associated with Partial Testicular Determination K

Proc. Natl. Acad. Sci. USA Vol. 93, pp. 8590-8594, August 1996 Medical Sciences

Loss of sequences 3' to the testis-determining gene, SRY, including the Y pseudoautosomal boundary associated with partial testicular determination K. MCELREAVEY*t, E. VILAIN*, S. BARBAUX*, J. S. FUQUAt, P. Y. FECHNERt, N. SOULEYREAU*, M. Doco-FENZY§, R. GABRIEL§, C. QUEREUX§, M. FELLOUS*, AND G. D. BERKOVITZt *Immunogenetique Humaine, Institut Pasteur, 75724 Paris, Cedex 15, France; tDivision of Pediatric Endocrinology, The Johns Hopkins University School of Medicine, 600 North Wolf Street, Baltimore, MD 21205-3311; and §H6pital Maison Blanche, 45 Rue Cognacq-Jay, 51092 Reims, France Communicated by Jean Dausset, Human Polymorphism Study Center, Paris, France, May 1, 1996 (received for review February 8, 1996)

ABSTRACT The condition termed 46,XY complete go- In the first 5 weeks of gestation, the human fetus develops nadal dysgenesis is characterized by a completely female various bipotential and neutral sex structures, such as the phenotype and streak gonads. In contrast, subjects with 46,XY bipotential gonads, neutral external genitalia, and paired partial gonadal dysgenesis and those with embryonic testic- internal sex ducts. In the presence of SRY the bipotential ular regression sequence usually present ambiguous genitalia gonads become testes and male sex differentiation occurs. In and a mix of Mullerian and Wolffian structures. In 46,XY 46,XX individuals, in the absence of SRY, the fetal gonads partial gonadal dysgenesis gonadal histology shows evidence develop as ovaries. In rare individuals with a 46,XY karyotype, of incomplete testis determination. In 46,XY embryonic tes- there may be an abnormality in testis determination or in the ticular regression sequence there is lack of gonadal tissue on early steps of testis differentiation. The conditions that result both sides. Various lines of evidence suggest that embryonic are referred to as 46,XY gonadal dysgenesis and are further testicular regression sequence is a variant form of 46,XY classified as 46,XY complete (or pure) gonadal dysgenesis, gonadal dysgenesis. The sex-determining region Y chromo- 46,XY partial gonadal dysgenesis, and embryonic testicular some gene (SRY) encodes sequences for the testis-determining regression sequence (6-8). factor. To date germ-line mutations in SRYhave been reported The 46,XY complete gonadal dysgenesis is characterized by in "20%v of subjects with 46,XY complete gonadal dysgenesis. female external genitalia and well-developed Mullerian struc- However no germ-line mutations ofSRY have tures. The gonad consists of fibrous ovarian-like stroma with been reported in no evidence of testicular differentiation. The 46,XY partial subjects with the partial forms. We studied 20 subjects who gonadal dysgenesis is characterized by partial testis determi- presented either 46,XY partial gonadal dysgenesis or 46,XY nation in an individual with a normal XY karyotype. Partially embryonic testicular regression sequence. We examined the developed internal ducts usually consist of a mixture of Wolf- SRY gene and the minimum region of Y-specific DNA known fian (epididymus, vas deferens, and seminal vesicle) and to confer a male phenotype. The SRY-open reading frame Mullerian ducts (fallopian tube, uterus, and upper third of the (ORF) was normal in all subjects. However a de novo inter- vagina). Affected individuals exhibit varying degrees of mas- stitial deletion 3' to the SRY-ORF was found in one subject. culinization of the external genitalia. Embryonic testicular Although it is possible that the deletion was unrelated to the regression sequence can also be regarded as part of the clinical subject's phenotype, we propose that the deletion was respon- spectrum of 46,XY gonadal dysgenesis. Gonad tissue is absent sible for the abnormal gonadal development by diminishing on one or both sides. Affected individuals have a 46,XY expression ofSRY. We suggest that the deletion resulted either karyotype and usually present a mix of Wolffian and Mullerian in the loss of sequences necessary for normal SRY expression tissue and ambiguous genitalia. Various evidence supports the or in a position effect that altered SRY expression. This case claim that the embryonic gonads were functionally abnormal provides further evidence that deletions of the Y chromosome before their loss (8). outside the SRY-ORF can result in either complete or incom- Mutations in the SRY-ORF have been reported in -20% of plete sex reversal. subjects with 46,XY complete gonadal dysgenesis (9-14). The mutations are clustered in sequences encoding the HMG Sex determination in mammals is controlled by the presence or domain of the molecule. By contrast no germ-line mutations absence of a testis-determining factor encoded by a gene in the SRY-ORF have been reported among subjects with termed sex determining region Y (SRY) (1). In humans the partial forms of 46,XY gonadal dysgenesis. As SRY is respon- SRY gene resides in a 35-kb region on the short arm of the Y sible for the primary step in testis determination, mutations in chromosome, referred to as the testis-determining region. This the SRY-ORF could be expected to completely block testis is the smallest region of Y-specific DNA known to induce formation. However, it is conceivable that some cases of46,XY masculinization in XX males partial gonadal dysgenesis might result from mutations in the (2). The SRYgene itself has been SRY-ORF that modified SRY protein function in a subtle mapped to a region 5 kb proximal to the pseudoautosomal fashion. Similarly, a mutation in a putative regulatory element boundary. SRYconsists of a single exon of -700 bp (3, 4). The might result in reduced expression of SRY or an alteration in central one third of the open reading frame (ORF) encodes a the timing of SRY gene expression. To examine these possi- motif that has sequence homology to a conserved region of the bilities we studied 20 subjects who had either 46,XY partial high mobility group (HMG) proteins (5). This motif, termed gonadal dysgenesis or 46,XY embryonic testicular regression the HMG-box, has the capacity to bind to DNA, which is syndrome. We determined the presence of genetic abnormal- consistent with a cell-autonomous signal in the sex- ities in the testis-determining locus on the Y chromosome, determining pathway. including the SRY gene. In all cases the sequence of the SRY

The publication costs of this article were defrayed in part by page charge Abbreviations: HMG, high mobility group; PABY, Y pseudoautoso- payment. This article must therefore be hereby marked "advertisement" in mal boundary; PABX, X pseudoautosomal boundary. accordance with 18 U.S.C. §1734 solely to indicate this fact. tTo whom reprint requests should be addressed.

8590 Downloaded by guest on September 26, 2021 Medical Sciences: McElreavey et aL Proc. Natl. Acad. Sci. USA 93 (1996) 8591

gene was found to be identical to that of a normal male. asymetrically amplified using the primers XES2 and XES7 (12) However one subject with 46,XY partial gonadal dysgenesis and sequenced directly using Sequenase (United States Bio- had a small de novo interstitial deletion 3' to the SRYgene. The chemical) using conditions described by the manufacturer. The results suggest that (i) human sex determination is sensitive to X and Y pseudoautosomal boundaries (PABX and PABY) variations in the activity of the testis-determining gene SRY were amplified using oligonucleotides A and C for the Y and (ii) small interstitial deletions in the Y chromosome may boundary and the oligonucleotides B and C for the X chro- be more common than previously supposed. mosomal boundary, as described (18). Amplification of Y- specific sequences 2 kb proximal to the pseudoautosomal boundary was performed using the primers Y2A, GCATTA- MATERIALS AND METHODS GTGAAGAATTAACT; and Y2B, TCTCATGAAGATTT- Subjects. Table 1 summarizes the clinical description of 20 TTACTC. These primers amplify a 343-bp Y-specific fragment subjects with a 46,XY karyotype and abnormalities of testis under standard conditions. Expression of SRY in peripheral determination. Subjects had 46,XY partial gonadal dysgenesis blood lymphocytes was determined as described elsewhere on the basis of (i) ambiguous external genitalia, (ii) mixture of (13). Paternity was determined by Southern analysis using both Wolffian and Mullerian ducts, and (iii) dysgenetic testis. minisatellite probes (19). Patients who have been described elsewhere are indicated. Blood karyotype analysis excluded mosaicism in all cases, and RESULTS none of the patients presented with Turner stigmata. DNA Analysis. Genomic DNA was prepared from periph- The SRY-ORF was sequenced in each case by using an eral blood lymphocytes. In Southern blot analysis, 15-,ug asymetrically amplified PCR product as a template. In all 20 samples were digested with restriction endonucleases accord- subjects the SRY-ORF sequence was identical to that of a ing to the manufacturer's recommended conditions. Agarose normal male control. To determine if mutations were present gel electrophoresis, transfer to nylon membranes (Hybond N; in the testis-determining region of the Y short arm, Southern Amersham), prehybridization, hybridization to 32P-labeled analysis was performed by using the probes, pY53.3 (SRY), probes, and autoradiography were performed essentially as pO.9, pDP1226, and HfO.2. Southern analysis using the probes described (13, 15). Blots were hybridized with the Y-DNA- pDP1226 and pO.9 failed to detect in all patients any change specific probes pY53.3 (SRY), pO.9, pDP1226, and with the in fragment size from that of a normal male control (data not pseudoautosomal probe HFO.2 (1, 16-18). Hybridization was shown). Southern analysis was performed on StuI digested also performed using probes from 10 kb and 4 kb distal to the DNA using the probe pY53.3 which contains the SRY gene. pseudoautosomal boundary. Primer pairs KPR1OA (GAGT- Hybridization of StuI digested DNA from a normal male CTGAGACTTTTAGAGAG) and KPR1OB (GGGCGGG- control with the probe pY53.3 results in two Y-specific frag- GATATGCCTGTCCTAAGC) amplify a 738-bp fragment ments of 9 and 6 kb (Fig. 1); however, one subject (SC) was using standard cycling conditions, 10 kb distal to the X and Y observed to have a change in fragment size from 6 to 11 kb pseudoautosomal boundaries. This fragment KPR10 was used (Fig. 1C, lane 3). Her father had a hybridization pattern as a probe on BamHI digested DNA. Primer pairs KPR41 identical to that of a normal male, indicating that the change (CCTCTCTGTGAAGGTAGCCTCATC) and KPR42 (GTT- in restriction site was de novo. Family relatedness was checked GGAGAGTGATGATAGCAT) amplify a 264-bp fragment by using minisatellite DNA probes which showed results (KPR4) under standard conditions, located 4 kb distal to the compatible with parental relationships (data not shown). To pseudoautosomal boundary. To check for the presence of determine if the altered StuI restriction site was due to a simple mutations in the SRY-ORF, genomic DNA samples were polymorphism, further hybridization and PCR amplifications Table 1. Clinical features of subjects with 46,XY partial gonadal dysgenesis included in this study Age at Mullerian Wolffian presentation, External ducts ducts Gonads Subject year genitalia* R L R L R L Other 214 (#8)t 0.3 A No Yes Yes Yes Dysgenetic testis Dysgenetic testis 215 (#11)t 1.3 A Yes No Yes No Streak Dysgenetic testis 216 (#10)t 2.0 A Yes Yes No No Dysgenetic testis Dysgenetic testis 221 Birth A Yes Yes Yes Yes Dysgenetic testis Dysgenetic testis Bilateral vesicoureteral reflux 229 4.0 A No Yes Yes Yes Testis Dysgenetic testis 243 Birth A Yes Yes Yes Yes Dysgenetic testis Dysgenetic testis 244 Birth A Yes Yes No No Streak Streak Hydrocephalus/developmental delay 247 2.8 A ? Yes ? No ? Streak 248 Birth A Yes ? Yes ? Streak ? 249 Birth A Yes Yes Yes Yes Dysgenetic testis Dysgenetic testis BK1029 5 A ?? ? ? Streak Testis CH1045 15 A Yes Yes Yes Yes Streak Dysgenetic testis SC 17 F Yes Yes Yes Yes Dysgenetic testis Dysgenetic testis Hydronephrosis CB1007 18 F Yes Yes Yes Yes Streak Dysgenetic testis 237 (#3)f 1.5 A No No No No None None Ectopic thyroid 225 (#4)t 3.7 A Yes Yes No No None None 242 (#7)t 0.3 A No Yes No No Testis None AS1040 0.1 A No Yes Yes No None Dysgenetic testis SL1028 17 A Yes Yes No No None Dysgenetic testis *External genitalia were noted as ambiguous (A) or female (F). tPreviously described by Berkovitz et al. (7). tDescribed by Marcantonio et al. (8). Downloaded by guest on September 26, 2021 8592 Medical Sciences: McElreavey et al. Proc. Natl. Acad. Sci. USA 93 (1996)

12 34 5 1 2 3 4 5 12 3 4 5

6.6 kb- 6 kb- 11 kb- 9 kb - _.: 3.7 kb - 6 kb-wf 2.5 kb-

1.6 kb

0.75 kb-4- _ A

A B C FIG. 1. Southern hybridization of pY53.3 (SRY) to XbaI (A), PstI (B), and StuI (C) digested DNA of subject SC (lane 3), her father (lane 1), her mother (lane 2), a normal female (lane 4), and a normal male (lane 5). The size of the fragments is indicated in kilobases. No change in fragment size was observed in XbaI digested DNA after hybridization with pY53.3, indicating that sequences 2 kb 3' to SRY were intact. Digestion with PstI showed a change in fragment size from 5 kb to 3.5 kb in subject SC but not in her father, indicating that the change was de novo. Similarly, hybridization of StuI digested DNA with probe pY53.3 revealed a de novo change in fragment size from 6 kb to 11 kb in subject SC (C, lane 3). were performed using Y-specific sequences 3' to the SRYgene. fragment was amplified in samples from a normal male control Hybridization of pY53.3 to membranes containing PstI di- and from the father of the subject. Sequences recognized by gested DNA, revealed two Y-specific fragments of 6 kb and 2.5 these primers could not be detected in DNA prepared from kb in a normal male control and in the father of the patient. subject SC. This defines the proximal breakpoint position to However the size of the PstI fragment 3' to the SRY gene was between 2 and 3 kb 3' to the SRY polyadenylylation site. changed from 6 kb to 2.5 kb (Fig. 1B), which suggested the The distal breakpoint was mapped by using pseudoautoso- presence of a deletion 3' to SRY. Digestion with the enzyme mal probes HfO.2, KPR10, and KPR4. Hybridization with the XbaI followed by hybridization with pY53.3 generated three probe HfO.2, which maps to about 500 bp into the pseudoau- fragments of 6.6, 1.6, and 0.75 kb in a normal male (Fig. 1A, tosomal region, failed to detect a 2-kb Y-specific TaqI frag- lane 5). The Xbal restriction site 3' to the SRY gene is -2 kb ment in DNA from subject SC. This fragment and a 2.4-kb 3' to the polyadenylylation site and corresponds to the 1.6-kb X-specific band were present in the normal male control. The fragment. This site was conserved in XY female SC. probe KPR10 located 10 kb distal to the pseudoautosomal Amplification of the Y- and X-specific autosomal bound- boundary detects a BamHI polymorphism. As shown in Fig. aries was performed by using primers A and C and B and C, 3A, XY female SC inherited X and Y chromosome alleles from respectively. The Y-specific pseudoautosomal boundary was her mother and her father indicating that sequences 10 kb not detected in subject SC (Fig. 2, lane 3); however, the distal to the PABY were not deleted. The most proximal probe X-specific pseudoautosomal boundary was amplified. This used in the pseudoautosomal region, located 4 kb distal to the indicated that the patient harbored a de novo deletion 3' to boundary, failed to detect the breakpoint. This conclusion was SRY coding sequences. To further define the extent of the based on the intensity of the hybridization signal compared deletion, amplification of Y-specific sequences 2 kb proximal with samples from her parents and normal female and male to the pseudoautosomal boundary (3 kb 3' to the SRY gene) controls. Digestion with a number of enzymes followed by was performed by using the primers Y2A and Y2B. A 343-bp hybridization with this probe failed to detect any polymorphic 1 2 restriction site. In summary, the deletion begins between 2 and 3 4 5 6 3 kb 3' to the SRYpolyadenylylation site and extends to at least 500 bp into the pseudoautosomal region (see Fig. 4). PABY- To determine if the deletion gave rise to ectopic SRY PABX- expression, reverse transcriptase-PCR (RT-PCR) was performed on RNA prepared from a lymphoblastoid cell line of Y2- subject SC. SRY expression was not detected in this cell line (data not shown).

DISCUSSION We describe an individual with 46,XY partial gonadal dysgen- FIG. 2. PCR amplification of PABX and PABY and Y-specific esis associated with a de novo deletion 3' to the SRY gene in sequences (Y2) located 2 kb proximal to the Y pseudoautosomal the testis-determining region. The SRY gene itself was intact boundary. Amplification of DNA from the father of subject SC (lane 1) indicated the presence of PABY (950-bp fragment), PABX (770-bp in this subject, and the sequence of the SRY-ORF was normal. fragment), and Y2 sequences (343-bp fragment). Only sequences Mutations in both the SRY-ORF and in the testis-determining corresponding to the PABX were present in subject SC (lane 2) and region 5' to the SRY gene have been reported in subjects with her mother (lane 3). Lanes 4 and 5 are normal female and normal male 46,XY complete gonadal dysgenesis (9-14). Studies by Braun controls, respectively. et al. (20) and Hiort et al. (21) suggested a role for somatic cell Downloaded by guest on September 26, 2021 Medical Sciences: McElreavey et al. Proc. Natl. Acad. Sci. USA 93 (1996) 8593

1 2 3 4 5 1 2 3 4 5 _: :_:_

5 kb- _r ......

: w.. 3.2 kb- ._. . 2.4 kb- *w 2.0 kb- 2.7 kb- .ffi.. 2.2 kb- 1o4kb- 4 :. |;.. .l

*w A B C FIG. 3. Southern blot analysis of subject SC and her parents with pseudoautosomal probes. Hybridization of pseudoautosomal probes KPR10 (A), KPR4 (B), and HfO.2 (C) was performed on DNA digested with BamHI, EcoRV, and TaqI, respectively. The order of DNA samples is identical to that described in the legend of Fig. 1, with the exception of the autoradiogram shown in C, which contains subject SC (lane 1), her mother (lane 2), and her father (lane 3). The size of the fragments is indicated in kilobases. Probe KPR10 detects a BamHI polymorphism (A). XY female SC harbored alleles inherited from her mother (5-kb fragment) and father (3.2-, 2.7-, and 2.2-kb fragments) respectively. The intensity of hybridization signal of KPR4 to EcoRV digested DNA was similar between SC and her parents indicating the presence of this region. Probing with HfO.2 located -500 bp distal to the pseudoautosomal boundary failed to detect a 2-kb TaqI Y-specific fragment, indicating that the distal breakpoint of the deletion lies between HfO.2 and KPR4.

mutations in the SRY gene in the etiology of 46,XY true Sequences 3' to many genes are important for regulation of hermaphroditism. However no germ-line mutations involving gene expression. For example, an enhancer motif 3' to the the testis-determining region have been previously associated Wilms' tumor gene WT1 appears to increase basal transcrip- with 46,XY partial gonadal dysgenesis. It is possible that the tion levels and confer tissue specificity (22). The possible role deletion in the testis-determining region in the subject in our of a position effect in the abnormal gonadal development of study is unrelated to the abnormality of testis determination. the subject of this report is also supported by studies in the However, its presence in the region close to the SRY gene mouse. Deletions of the Y chromosome Sxl repeat sequences makes it quite plausible that it plays a significant role. Two located outside the minimal testis determining region resulted possible mechanisms could explain how such a deletion could in XY sex reversal, even though the Sry gene itself was intact influence SRYgene expression. First, the deletion may remove (23). Murine Sry is expressed in the fetal genital ridge of the regulatory elements required for the proper expression ofSRY. developing embryo during a limited critical period from days This could result in reduced expression of SRY or a change in 10.5 to 12.5 post coitum, and various studies show that normal the timing or tissue specificity of SRY expression. Alternatively, testis determination depends on the activity of Sry at a critical SRY expression could be diminished by a simple position effect. moment during fetal development. Earlier studies by Eicher

SRY RPS4Y ZFY Vn Pseudoautosomal region - T , I I I_ _ 20 10 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 kb I I I I I

KPR22 KPR10 KPR4 HfO.2 Y2A/B SRY

I I I I I IIII I11I1I I I 22 20 18 16 14 12 10 8 6 4 2 2 4 6 10 PABY

Female SC - 3- FIG. 4. Schematic representation of the short arm of the human Y chromosome. The position of the genes SRY, RPS4Y, and ZFY is indicated by the solid boxes. Direction of transcription is indicated by the arrows. Distances from PABY are given in kilobases. The position of each of the probes used in the study is indicated. The amount of Y chromosomal material present in XY female SC is illustrated by a black line. Downloaded by guest on September 26, 2021 8594 Medical Sciences: McElreavey et al. Proc. Natl. Acad. Sci. USA 93 (1996) and Washburn (24) showed that the introduction of the Y 5. Kelly, M., Burke, J., Smith, M., Klar, A. & Beach, D. (1988) chromosome from the mouse POS-A strain into the autosomal EMBO J. 7, 1537-1547. background of the C5713L/6J strain resulted in sex reversal in 6. Berkovitz, G. D. (1992) Semin. Perinatol. 16, 289-298. many of the XY offspring. Palmer and Burgoyne (25) showed 7. Berkovitz, G. D., Fechner, P. Y., Zacur, H. W., Rock, J. A., Snyder, H. M., III, Migeon, C. J. & Perlman, E. J. (1991) Med- that abnormality of testis determination resulted from a delay icine (Baltimore) 70, 375-383. in Tdy activity in the POS-A strain. 8. Marcantonio, S. M., Fechner, P. Y., Migeon, C. J., Perlman, E. J. Nineteen of the 20 subjects in this study appeared to have an & Berkovitz, G. D. (1994) Am. J. Med. Genet. 49, 1-5. intact testis-determining region 3' to the SRY gene, indicating 9. Berta, P., Hawkins, J. R., Sinclair, A. H., Taylor, A., Griffiths, B., that large deletions of this type are an unusual cause of partial Goodfellow, P. N. & Fellous, M. (1990) Nature (London) 348, gonadal dysgenesis. In addition all of the subjects in this study 448-450. had a normal SRY gene sequence. This is consistent with 10. Jager, R. J., Anvret, M., Hall, K. & Scherer G. (1990) Nature previous findings in subjects with 46,XY partial gonadal (London) 348, 452-454. the of the vast of 11. Hawkins, J. R., Taylor, A., Goodfellow, P. N., Migeon, C. J., dysgenesis. Although etiology majority Smith, K. D. & Berkovitz, G. D. (1992) Am. J. Hum. Genet. 51, subjects with 46,XY partial gonadal dysgenesis remains un- 979-984. known, some appear to have autosomal abnormalities. In these 12. Hawkins, J. R., Taylor, A., Berta, P., Levilliers, J., Van der cases subjects often have a combination of multiple congenital Auwera, B. & Goodfellow, P. N. (1992) Hum. Genet. 88,471-474. abnormalities. For example, individuals with Denys-Drash 13. McElreavey, K., Vilain, E., Abbas, N., Costa, J.-M., Souleyreau, syndrome harbor mutations in the Wilms' tumor gene WT1. N., Kucheria, K., Boucekkine, C., Thibaud, E., Brauner, R., These patients exhibit both complete and partial forms of Flamant, F. & Fellous M. (1992) Proc. Natl. Acad. Sci. USA 89, 46,XY gonadal dysgenesis in association with nephropathy and 11016-11020. Wilms' tumor (26). Similarly XY patients with mutations of the 14. Affara. N., Chalmers, I. J. & Ferguson-Smith, M. (1993) Hum. Mol. Genet. 2, 785-789. SOX9 gene on chromosome 17 at position q24 present with 15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular multiple congenital abnormalities including campomelic dys- Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, plasia and XY gonadal dysgenesis (27, 28). Duplications of the Plainview, NY). distal region of the short arm of the X chromosome can result 16. Affara, N. A., Ferguson-Smith, M. A., Tolmie, J., Kwok, K., in 46,XY complete gonadal dysgenesis but no cases of 46,XY Mitchell, M., Jamieson, D., Cooke, A. & Florentin, L. (1986) partial gonadal dysgenesis have been reported (29). Nucleic Acids Res. 14, 5375-5387. In a previous publication we described a subject with 46,XY 17. Page, D. C., Mosher, R., Simpson, E. M., Fisher, E. M. C., complete gonadal dysgenesis who had a de novo interstitial Mardon, G., Pollack, J., de la Chapelle, A. & Brown, L. G. (1987) deletion of 30-50 kb in 5' to the SRY Cell 51, 1091-1104. size, gene (13). The 18. Ellis, N., Taylor, A., Bengtsson, B. O., Kidd, J., Rogers, J. & gonadal tissue of that subject was totally devoid of seminifer- Goodfellow, P. (1989) Nature (London) 344, 663-665. ous tubules, indicating the complete failure of testis develop- 19. Jeffreys, A. J., Wilson, V. & Thein, S. L. (1985) Nature (London) ment. Here we describe a small interstitial deletion 3' to SRY, 316, 76-79. associated with partial testicular determination. Other cyto- 20. Braun, A., Krammere, S., Cleve, H., Lohrs, U., Schwarz, H.-P. & genetically undetectable interstitial deletions in this region Kuhnle, U. (1993) Am. J. Hum. Genet. 52, 578-581. have been described including the deletion in a subject with 21. Hiort, O., Gramss, B. & Klauber, G. T. (1995) J. Pediatr. 126, 46,XY complete gonadal dysgenesis (patient WT1013) de- 1022. scribed Page et al. This suggests that microdeletions in 22. Fraizer, G. C., Wu, Y.-J., Hewitt, S. M., Maity, T., Ton, C. T., by (17). Huff, V. & Saunders, G. F. (1994) J. Biol. Chem. 269, 8892-8900. the testis-determining region may be more prevalent that 23. Capel, B., Rasberry, C., Dyson, J., Bishop, C. E., Simpson, E., previously supposed. Vivian, N., Lovell-Badge, R., Rastan, S. & Cattanach, B. M. The Y chromosome is rich in highly repetitive DNA (30) (1993) Nat. Genet. 5, 301-307. including tandem clustered repea.-, short interspersed repet- 24. Eicher, E. M. & Washburn, L. L. (1983) J. Exp. Zool. 228, itive elements among which Alu repeats are particularly fre- 297-304. quent (31), and long interspersed repetitive elements (32). 25. Palmer, S. J. & Burgoyne, P. S. (1991) Development (Cambridge, Simple illegitimate recombination events involving repetitive UK) 113, 709-714. elements are most likely to be the mechanism responsible for 26. Pelletier, J., Bruening, W., Kashtan, C. E., Mauer, S. M., these deletions. into the of Manivel, J. C., Striegel, J. E., Houghton, D. C., Junien, C., Habib, Insights origins these rearrangements R., Fouser, L., Fine, R. N., Silverman, B. L., Haber, D. A. & must await detailed molecular analysis of their novel junctions. Housman, D. (1991) Cell 67, 437-447. 27. Tommerup, N., Schempp, W., Meinecke, P., Pedersen, S., Bol- The authors wish to thank Simon Whitfield and Peter N. Goodfellow und, L., Brandt, C., Goodpasture, C., Guldberg, P., Held, K. R., for providing sequence information in the pseudoautosomal region for Reinwein, H., Saugstad, 0. D., Scherer, G., Skjeldal, O., Toder, use in this study. This work is supported by Institut National de la Sante R., Westvik, J., van der Hagen, C. B. & Wolf U. (1993) Nat. et de la Recherche Medicale reseau Nord-Sud, the Association Genet. 4, 144-148. Fran,aise contre les Myopathies (ACC 61568, contract de recherche 28. Foster, J. W., Dominguez-Steglich, M. A., Guioli, S., Kwok, C., MESR), Universite Paris VII, and Fondation pour la Recherche Weller, P. A., Stevanovic, M., Weissenbach, J., Mansour, S., Medicale. Young, I. D., Goodfellow, P. N., Brook, J. D. & Schafer, A. J. (1994) Nature (London) 372, 525-530. 1. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, 29. Bardoni, B., Zanaria, E., Guioli, S., Floridia, G., Worley, K. C., B. L., Smith, M. J., Foster, J. M., Frischauf, A. M., Lovell-Badge, Tonini, G., Ferrante, E., Chiumello, G., McCabe, E. R. B., R. & Goodfellow, P. N. (1990) Nature (London) 346, 240-244. FraccarQ, M., Zuffardi, 0. & Camerino G. (1994) Nat. Genet. 7, 2. Palmer, M. S., Sinclair, A. H., Berta, P., Ellis, N. A., Goodfellow, 497-501. P. N., Abbas, N. E. & Fellous, M. (1989) Nature (London) 342, 30. Cooke, H. J., Fantes, J. & Green, D. (1983) Differentiation 23, 937-939. S48-S55. 3. Vilain, E., Fellous, M. & McElreavey, K. (1992) Methods Mol. 31. Burk, R. D., Szabo, P., O'Brien, S., Nash, W. G., Yu, L. & Smith, Cell. Biol. 3, 128-134. K. D. (1985) Chromosoma 92, 225-233. 4. Behlke, M. A., Bogan, J. S., Beer-Romero, P. & Page, D. C. 32. Smith, K. D., Young, K. E., Talbot, C. C., Jr., & Schmeckpeper, (1993) Genomics 17, 736-739. B. J. (1987) Development (Cambridge, UK) 100 (Suppl.), 77-92. Downloaded by guest on September 26, 2021