And R-Dependent Expression of the Maize Bzi Gene Requires Sequences with Homology to Mammalian Myb and Myc Binding Sites

The Plant Cell, Vol. 3, 317-325, March 1991 O 1991 American Society of Plant Physiologists

CI- and R-Dependent Expression of the Maize BzI Gene Requires Sequences with Homology to Mammalian myb and myc Binding Sites

Bradley A. Roth,’ Stephen A. Goff,* Theodore M. Klein,3 and Michael E. Fromm4 Plant Gene Expression Center, United States Department of Agriculture/University of California, Berkeley, 800 Buchanan Street, Albany, California 9471 O

Tissue-specific expression of the maize anthocyanin Bronze-7 (627) gene is controlled by the products of several regulatory genes. These include C7 or PI and R or B that share homology to the myb proto-oncogenes and myc-like genes, respectively. 621 expression in embryo tissues is dependent on C7 and an R-sc allele of R. Transient expression from mutated and deleted versions of the 627 promoter fused to a luciferase reporter gene was measured in C7, Rscm2 embryos after gene transfer by microprojectiles. This analysis revealed that the sequences between -76 base pairs (bp) and -45 bp and a 9-bp AT-rich block between -88 bp and -80 bp were critical for 627 expression. The -76 bp to -45 bp region includes two short sequences that are homologous to the consensus binding sites of the myb- and myc-like proteins. Site-specific mutations of these “myb” and “myc” sequences reduced k7expression to 10% and 1% of normal, respectively. Additionally, a trimer of a 38-bp oligonucleotide containing these myb and myc sites increased the expression of a cauliflower mosaic virus 35s minimal promoter by 26-fold. This enhancement was dependent on both C1 and R. Because the sites critical for 627 expression are homologous to the myb and myc consensus binding sequences and the C1 and R proteins share homology with the myb and myc products, respectively, we propose that C7 and R interact with the 627 promoter at these sites.

INTRODUCTION

The extensive genetics of the maize anthocyanin biosyn- The predicted PI-encoded and C7-encoded proteins are thetic pathway and the isolation of many of its structural homologous to each other (K. Cone, unpublished results) and regulatory genes have provided an ideal system to and to proteins of the animal myb proto-oncogene family study the regulation of gene expression in plants. The (Paz-Ares et al., 1987). The myb protein has been shown enzymes of the pathway are encoded by a set of genes, to bind DNA specifically (Biedenkapp et al., 1988; Howe including A7, Bronze-7 (Bzl), and C2. These structural et al., 1990; Oehler et al., 1990). Also, myb proteins contain genes are coordinately regulated by several regulatory loci, acidic regions that have been found to function as tran- which condition the tissue-specific production of anthocy- scriptional activators (Klempnauer et al., 1989; Weston anin pigment (Coe et al., 1988). In general, anthocyanin and Bishop, 1989). Similarly, the C7 carboxyl terminus pigment formation requires the expression of at least two contains an acidic region (Paz-Ares et al., 1987) that has classes of regulatory genes: a PI or C7 gene and a member been shown to function to activate transcription in plants from the R or B gene families (Coe et al., 1988). Light can when fused to the yeast Ga14 DNA binding domain (Goff partially substitute for the requirement for P1 (expressed et al., 1991). primarily in the plant body) and in some instances for C7 The R and B gene families both show extensive diversity (expressed in the aleurone and embryo). among alleles, each of which directs a different tissue- specific pattern of pigment formation (Coe et al., 1988). The R and B genes have been shown to encode very ’ To whom correspondence should be addressed. Current Ad- similar proteins (Dellaporta et al., 1988; Chandler et al., dress: Pioneer Hi-Bred International, Inc., P.O. Box 38, Johnston, 1989; Ludwig et al., 1989; Perrot and Cone, 1989) and IA 50131. * Current Address: Department of Biology, lnstitute of Molecular contain regions that are homologous to myc-like proteins Biology, University of Oregon, Eugene, OR 97403. (Ludwig et al., 1989). The myc-related, helix-loop-helix Current Address: E.I. DuPont, Agricultura1 Products, Experimen- proteins have been shown to bind specifically to DNA and tal Station, 402/4250, Wilmington, DE 19880. to function as transcriptional activators (Murre et al., Current Address: Monsanto Company, Plant Sciences, 700 1989a; Beckmann et al., 1990; Davis et al., 1990; Henthorn Chesterfield Village Parkway, St. Louis, MO 63198. et al., 1990). 318 The Plant Cell

The BZl structural gene encodes UDPg1ucose:flavonol than in nonpermissive tissues (c7, r; Cl,r; c7, R aleurones 3-0-gIucosyltransferase, which catalyzes one of the last or embryos). Therefore, if the sites in the Bzl promoter steps in the synthesis of anthocyanin pigment (Dooner and that respond to C7 and R are removed by deletion or Nelson, 1977). Both C7 and R were shown to be necessary mutagenesis, a similar large drop in relative activity would for the production of the Bz7 enzyme and mRNA in the be expected in permissive tissues. Because deletion of aleurone of the kernel (Dooner and Nelson, 1979; Cone et essential core promoter elements might also cause similar al., 1986). In embryos, both C7 and certain alleles of R, decreases in promoter activity, further experiments would such as Rscm2, are required for Bzl expression (Dooner be required to distinguish between these possibilities. and Nelson, 1977,1979). Bzl mRNA also has been shown to be regulated by 6 and PI in the husks of mature plants (Gerats et al., 1984; Chandler et al., 1989; Sullivan et al., Luciferase Expression from Bzí 5’-Deleted Promoters 1989). Recently, we showed that the C7,R genotype of maize aleurone and embryo tissues regulated the expres- To locate the critical regions for Bz7 promoter activity, a sion of a Bzl promoter that was attached to a firefly series of 5‘ deletions of the Bzl promoter were con- luciferase reporter gene after DNA transfer by micropro- structed. Each chimeric gene included a Bzl 5’-deleted jectiles (Klein et al., 1989). Luciferase expression from the promoter (with end points from -407 bp to +2 bp), the Bzl promoter in Cl,R aleurone tissue was 100-foldhigher Bzl first intron, the firefly luciferase coding region, and the than the luciferase expression in aleurones mutant for c7 Bzl 3‘ region, as shown in Figure 1A. Fifteen Bzl 5‘- or r. Luciferase expression in C7, Rscm2 embryos was deleted promoters were introduced into bz7, C7 , Rscm2 100-fold higher than in C7,R embryos or those mutant for embryos, which are permissive for the expression of c7. or r. pBzl L. Additionally, pBzl L and pLBz3’, a promoterless In the present study, we utilize DNA transfer by micro- derivative of pBzl L (Klein et al., 1989), were introduced projectiles into intact C7,Rscm2 embryos to measure the as positive and negative controls, respectively. In all bom- levels of expression from various mutated and deleted Bzl bardments, the plasmid pBzl CAT (see Methods) was promoters. Our results indicate that at least two short coprecipitated onto the microprojectiles with each experi- regions upstream of the TATA box are necessary for the mental plasmid. The chloramphenicol acetyltransferase expression of Bz7. One of these regions contains sites (CAT) enzyme activity directed by this plasmid was used similar to the consensus sites for DNA binding by the myb- as a control to verify delivery of DNA and to standardize like and myc-like proteins (Sen and Baltimore, 1986; Bie- the luciferase activity. denkapp et al., 1988), which share homology with the Cl Figure IAshows the average luciferase-to-CAT ratio for and R products, respectively. Fusions of the Bzl promoter each 5’-deleted promoter construct, as well as the relative upstream of an Adh7 core promoter indicate that these activity compared with pBzl L. Relative activities from regions are necessary for an 18-fold increase in expression 102% to 34% were observed in the 12 constructs with of the Adhl core promoter. Additionally, a trimer of an deletion end points between -407 bp and -1 14 bp. The oligonucleotide containing the Bz7 “myb” and “myc” sites relatively small decreases in expression with these con- fused to a minimal promoter increased gene expression structs indicate that Cl and/or R most likely do not interact 26-fold when cobombarded into embryogenic maize callus with these regions of the Bz7 promoter. The relative activ- (c7,r) with B-peru and C7 expressed from the cauliflower ities observed for the -80 bp, -60 bp, and +2 bp deleted mosaic virus (CaMV) 35s promoter. This enhancement of promoter constructs were all 2% or less. These results the minimal promoter expression is dependent on C7 and suggest that the important cis-acting regions required for B (homologous to R). Thus, these experiments define the expression of the Bz7 promoter are located within 114 bp cis-acting sites in the BZl promoter that respond to regu- of the mRNA start site. lation by Cl and R.

Analysis of Expression of Bzí Promoters Containing Interna1 Deletions and Mutations RESULTS

A set of Bz7 3’-deleted promoters was constructed (see Experimental Rationale Methods) to help define in more detail the important regions of the Bzl promoter. These 3’-deleted promoters A chimeric Bz7 promoter-luciferase plasmid, pBzl L, was were combined with the 527 5’-deleted promoter series shown previously to be regulated in a manner similar to to create a set of promoters with internal deletions (Figure that of the endogenous Bz7 gene after transfer by micro- 1B). Each of these internal deletion constructs was copre- projectiles to intact aleurone and embryo tissues (Klein et cipitated with pBzl CAT onto microprojectiles and bom- al., 1989). Luciferase expression in permissive tissues (Cl, barded into bz7, C7,Rscm2 embryos. The resulting Iuci- R aleurones; C?, Rscm2 embryos) was 100-fold higher ferase-to-CAT ratios and relative activities (compared with Functional Analysis of Maize Bzl Promoter 31 9 pBzl L pBzl L) are shown in Figure 1B. Relative activities of about 3% were observed for each of the constructs containing - 2.3 kb Bzl Promoter BzlI Luciferase Bzl 3‘ promoters with internal deletions extending from -60 bp +n+l to -68 bp, -76 bp, and -90 bp. Thus, these deletions removed a critical promoter element. Another set of con- /33\ structs with internal deletions from -80 bp extending to A -90 bp, -1 1O bp, and -1 27 bp resulted in relative activi- LuciferaselCAT Relative ties of 11O/O, 14%, and 4%, respectively. Each of these (Ave se.) Activity (%) deletions removed an AT-rich block of 9 bp from -80 bp - 2.3 kb to -88 bp of the Bz-McC promoter (of pBzl L) shown in -// 15.02 f7.18 100 Figure 2. - 407 15.34 f2.30 102 lnspection of the Bzl promoter sequences between -90 bp and -45 bp (Figure 2) revealed the presence of a 6-bp - 303 15.03&2.16 100 site (TAACTG) at -71 bp to -66 bp homologous to the - 261 9.80* 1.82 65 myb proto-oncogene consensus recognition site C/T AAC

- 248 14.46 f 4.48 96 G/T G (Biedenkapp et al., 1988). Another sequence in this region, GGCAGGTGC (-60 bp to -52 bp), is a myc - 200 14.89 f6.14 99 consensus binding site, NCANNTGN, and is closely related - 182 15.26 f 1.09 102 to the KE~immunoglobulin enhancer GGCAGGTGG (Sen and Baltimore, 1986). The KE~site is the consensus rec- ~ 167 10.80 f 1.71 72 ognition sequence for binding by E 72 and €47 in the myc - 151 6.13f3.43 41 family of proteins (Murre et al., 1989a). To test the importance of these sequences for Bzl - 142 11.91 f3.60 79 expression, two plasmids analogous to pBzl L were con- - 134 6.44 f 2.83 43 structed, each with a multisite-directed mutation in one of these regions. Each mutation replaced 6 bp between either - 119 6.22f 2.73 41 -71 bp to -66 bp or -58 bp to -53 bp with an NHel - 114 5.06 * 2.90 34 restriction site (GCTAGC), thus mutating the myb-homol- - 80 - 0.26f 0.06 2 ogous or myc-homologous sites noted above (Figure 2). After bombardment into bZl, Cl,Rscm2 embryos, the - 60 - 0.05 fO.02 <1 relative activities of the myb- and myc- promoters were 10% and 1%, respectively, when compared with pBzl L +2 - 0.16f0.08 1 (Figure 2). Similarly, a Bzl promoter with an internal dele- No Bz1 F’romoter 0.12 0.02 1 * tion between -68 bp and -60 bp resulted in a relative B activity of 3%. In this promoter, an 8-bp Sstl linker was substituted for 7 bp of the Bzl sequence; this deleted 2 +I - 90 -80 1.62f0.60 11 bp of the myb consensus binding site and added 1 bp between the myb and myc sites. -// - -80 110 2.06+_0.37 14 When the myb- and myc- vectors were introduced into -/a- 127 -80 0.67f0.16 4 bzl, Cl,Rscm2 aleurones, the relative activities of the myb- and myc- constructs were 126% and 2% of pBzl L, -/I - 68 0.46 f 0.32 3 respectively (data not shown). The possible significance of +/ -76 -60 0.4220.32 3 the difference in expression of the myb- promoter observed between tissues will be discussed. Nevertheless, -// -90 -60 0.43f0.08 3 these results show that both the myb and myc sites and the region between these sites (-68 bp to -60 bp) are Figure 1. Expression of Chimeric Genes Containing a De- Bz7 important for Bzl expression. leted or Mutated Promoter Region. Chimeric Bz7 promoter-luciferase constructs were delivered to bzl, C7,Rscm2 embryos by microprojectile bombardment. The Expression from Bzl-Adhl Promoter Fusions relative activity versus pBzlL was determined from at least six independent bombardments. A schematic drawing of pBzl L (Klein et al., 1989) is shown at the top. The above experiments define an essential region of the (A) Expression from Bzl 5’-deleted promoter constructs and BZl promoter between -90 bp and -45 bp, with critical controls. The 5’ deletion end points are indicated. regions between -80 bp to -90 bp and -68 bp to -53 (E)Expression from Bzl promoter internal deletion constructs. bp. Although this -90 bp to -45 bp region is essential for Break points are indicated where an Sstl linker is inserted. Bzl expression, it may or may not contain sequences that 320 The Plant Cell

P romot er AT-Block mYb myc ( 1 TATA Relat ive Activity (%) -100 (C/T AAC G/T G) (GGCAGGTGG) -28 l?BzlL GCCGGCTCACCTAAAAATTTCGGCACGTC~CGACT~T~,GCACGCGTGTTCGCGCGGAATAAA100

mYb- GCCGGCTCACCTAAAAAT’CGGCACGTC-CGACTGGCAGGTGCGCACGCGTGTTCGCGCGGAATAAA 10 (myb-) myc- GCCGGCTCACC~~~~~~~~~CGGCACGTCTAACTGCGACTGCGACT~~GCACGCGTGTTCGCGCGG~1 (myc-) -68I-60 GCCGGCTCACCTAAAAAT~~CGGCACGTC~~TC~~~GCAGGTG€GCACGCGTGTTCGCGCGG~3 (SStI)

Figure 2. Expression from Bz7 Promoters Mutated in the -71 bp to -53 bp Region. The sequences of the pBzlL promoter (Bz-McC allele, Furtek et al., 1988; Ralston et al., 1988) and mutant Bz7 promoters from -100 bp to -28 bp are shown. The AT-rich block, myb consensus site, myc consensus site, and Bz7 TATA box (at -33 bp upstream of the transcription start site) are underlined. The mutated bases are larger and shown in boldface. Each promoter construct was bombarded into bz7, C7, Rscm2 embryos, and the luciferase-to-CATratios relative to pBzl L are shown.

are directly regulated by C7 and R. To determine which containing the myb-homologous and myc-homologous sequences were responsive to C7 and R regulation, BZ7 mnsensus sites, was ligated to form a trimer and fused 3’deleted promoters were fused upstream of the core upstream of a CaMV 35s minimal promoter (-73 bp; Ow promoter of the maizeAdh7 gene. It was shown previously et al., 1987) and a luciferase coding region. When this that a deleted Adh7 promoter (5’ end at nucleotide -99) plasmid, pC1R-15, was cobombarded into c7, r embry- fused to CAT resulted in low levels of CAT expression ogenic callus cells with either CaMV 35S-driven B-peru or (Walker et al., 1987). A fragment that contained 89 bp C7 constructs (Goff et al., 1990), luciferase/CAT expres- upstream of the Adhl transcription start site was attached sion was only 1.6-fold higher than pC1 R-I5 alone, as to the luciferase gene. shown in Figure 4. However, introduction of pC1 R-15 with The fusions made between the Bz7 3’-deleted pro- both p35SB-peru and p35SC7 effector plasmids resulted moters and the Adh7 core promoter were introduced into in a 26-fold higher transactivation (Figure 4). Thus, the bzl, C7, RscmP embryo tissues with pBzlCAT. Expres- oligonucleotide of the -78 bp to -47 bp region of the Bzl sion was monitored using luciferase as a reporter gene promoter conferred C7- and R-dependent expression on and CAT as an internal standard. Figure 3 shows that the the minimal CaMV 35s promoter. These results are con- addition of the Bz7 promoter fragment starting at -45 bp sistent with the Bz7 promoter deletion data except that (which lacks the TATA box; Ralston et al., 1988) results in the trimer eliminates the need for the AT-rich block at -88 an 18-fold increase in luciferase expression relative to the bp to -80 bp. Adh7 core promoter. The expression of the pBz-76/Adhl- 89L was only threefold higher than pAdh-89L, indicating that a critical enhancing region is between -45 bp and DISCUSSION -76 bp, in good agreement with the results from the promoters containing internal deletions presented in Figure 1B. Bzl promoters with deletion end points at -90 bp, In this paper, we describe the functional analysis of the -1 50 bp, and -222 bp do not increase expression above promoter sequences of the Bz7 gene of the maize antho- that of pAdhl-89L (Figure 3). These data confirm that two cyanin biosynthetic pathway. We have identified the critical critical regions of the Bzl promoter are present between region of the Bz7 promoter to be between -45 bp and -45 bp and -76 bp and -76 bp and -90 bp. These -90 bp, relative to the start of transcription. Deleted and regions can function as enhancer sequences. mutated Bz7 promoter constructs revealed that the sequences in the regions -90 bp to -80 bp, -71 bp to -66 bp, -68 bp to -60 bp, and -58 bp to -53 bp were Trimers of a myb and myc Oligonucleotide lncrease essential for €327 expression. An oligonucleotide trimer of Promoter Expression the -78 bp to -47 bp region of the Bz7 promoter was sufficient for C7- and R-dependent expression when fused To determine whether the enhancement of expression to a CaMV 35s minimal promoter. Thus, these experi- from this Bzl promoter region is dependent on C7 and R, ments define the cis-acting sequences of Bz7 that respond an oligonucleotide from -78 bp to -47 bp (see Methods), to C7 and R regulation. Functional Analysis of Maize Bzl Promoter 321

t Rzl Promoter Sequences .e, +G Luciferase/ CAT Fold Increase $03 (ave s.e.) of pAdh-89L ATmyb myc 0 4 Luciferase wt 20.70 k 3.64 18 - 45 3.22 & 1.83 3 - 76

1.25 & 0.32 1 - 90

0.64 0.17

0.83 & 0.20 c1 - 222

pAdh-89L 1.17 * 0.06 1

Figure 3. Expression from Chimeric Bz7-Adhl Promoter Fusions The end points of the 3’ deletions of the Bz7 promoter that were attached to the Adhl core promoter are shown. pAdh-89L is the Adhl core promoter without upstream Bz7 sequences. Luciferase/CAT expression ratios in bombarded bz7, C7, RscmP embryos and the relative increase in activity over pAdh-89L are shown.

These results are consistent with transposable element Kf2 enhancer GGCAGGTGG from the immunoglobulin K and insertion mutations of the endogenous Bzl gene. A chain promoter (Sen and Baltimore, 1986). This Kf2 se- 406-bp Ds insertion at -63 bp of the Bz-wm allele reduced quence is recognized by the E72 and E47 proteins, helix- Bzl expression 20-fold to 100-fold (Sullivan et al., 1989), loop-helix proteins that contain a myc homologous region whereas a 437-bp insertion at -216 bp did not reduce (Murre et al., 1989a). Bzl expression (Ralston et al., 1988). A 6-bp insertion AT-rich DNA sequences have been implicated previously “footprint” left behind in the Bz’ (wm)-7 allele when Ds in the tissue-specific regulation of several plant genes was excised from the -63 bp position reduced Bzl (Jofuku et al., 1987; Jensen et al., 1988; Jacobsen et al., expression 1O-fold to 15-fold (Sullivan et al., 1989). Sur- 1990). It is unlikely, however, that the AT-rich sequence in prisingly, an 8-bp insertion footprint at this location in the the Bzl promoter represents a specific site regulated by Bz’ (wm)-2 and Bz’ (wm)-3 alleles virtually restored Bzl Cl and R, given the data from the Bzl-Adhl promoter expression. A possible explanation for the large difference fusions and oligonucleotide trimer experiments. It is per- in expression between these similar insertions was that haps more likely that the presence of these AT-rich se- the 6-bp insertion was more disruptive to the spacing of quences may represent a more general promoter element. cis-regulatory regions than the 8-bp insertion, which is Struhl (1985) showed that in three yeast genes, pet56, almost a full turn of the DNA helix (Sullivan et al., 1989). his3, and dedl, AT-rich regions were required for consti- Additionally, a Bz isoallele, Bz-W22, contains a 6-bp dupli- tutive expression. It was hypothesized that AT-rich tracts cation at -74 bp (Ralston et al., 1988). This allele exhibited exert their effects by causing local perturbations in the transcription and enzyme activity levels at least threefold nucleosome arrangement or structure that influences the lower than Bz-McC (Ralston et al., 1988), which is the assembly of the transcription complex of a promoter source of the Bzl promoter described in this study. The (Struhl, 1985; Chen et al., 1987). location of these mutations is in good agreement with the The myb gene products have been shown to bind DNA sequences we identified as critical for Bzl expression. and activate transcription (Biedenkapp et al., 1988; Klemp- lnspection of the Bzl sequence in the essential areas nauer et al., 1989; Weston and Bishop, 1989; Howe et al., revealed several interesting features (Figure 2): (1) a 9-bp 1990; Oehler et al., 1990). The Cl acidic domain fused to AT-rich sequence, TAAAAATTT, from -88 bp to -80 bp; the Ga14 DNA binding domain transactivates a minimal (2) a sequence from -71 bp to -66 bp, TAACTG, which CaMV 35s promoter with upstream Ga14 DNA binding is homologous to the consensus site for binding of the v- sites (Goff et al., 1991). Additionally, the Cl amino-terminal myb protein (C/T AAC G/T G; Biedenkapp et al., 1988); domain, which shares homology with myb, fused to the and (3) the sequence GGCAGGTGC (-60 bp to -52 bp), Ga14 acidic domain, transactivates the Bzl promoter (Goff a myc-like consensus site which is virtually identical to the et al., 1991). These studies, and the homology of C7 with 322 The Plant Cell

pC1 R-I5 determine the molecular basis of the differences in the expression from this promoter mutation in aleurone and I embryo tissues. myc-Like proteins have been shown to bind DNA at the Trimer consensus sequence NCANNTGN. Furthermore, the KE2 consensus sequence has been shown to be important for (GATCTGCACGTCTAACTGCGACTGGCAGGTGCGCACGG) the transcription of the immunoglobulin light chain gene (myb) (myc) 3 (Henthorn et al., 1990). Our results show that the myc binding consensus site in the Bz7 promoter is essential for expression in the presence of C7 and R. The myc-, mu- Effector Transactivation of tated Bz7 promoter also has been found to interfere with Plasmid(s) pC1R-15 (Fold pBzl L transactivation when cotransformed with 6 and C7 Induction, ave +. s.e.) expressing plasmids in plant cells (Goff et al., 1990). The products of the R and B genes have homology to the helix- p35SB-peru 25.8 12.5 loop-helix family of proteins, which include the myc family, + p35SCI €72, €47,MyoD, and several regulatory genes of Droso- phila (Murre et ai., 1989a). These proteins are capable of p35SB-peru 1.6 f 0.6 binding to the Kf2 Site as homodimers or heterodimers (Murre et al., 1989b). Therefore, it is likely that the R and p35SCI 1.6 k 0.6 B gene products interact directly with the myc-like consensus sequence in the Bz7 promoter. This hypothesis, how- Figure 4. Expression from Bz7 Oligonucleotide Trimer-CaMV ever, must be confirmed by in vitro DNA-protein binding 35s Fusions. and footprinting experiments. One implication of our identification of sequences that The structure of pC1 R-15 is shown at the top of the figure and are regulated by C7 and R is that similar sequences should below it is the sequence of the monomer oligonucleotide. pC1R- be present in other anthocyanin structural gene promoters 15 and either p35SB-peru or p35SC7 or both effector plasmid that also are regulated by and R. The maize A7 gene DNAs were delivered to embryogenic callus cells with pAlCN C7 encodes an NADPH-dependent reductase in the anthocy- (CAT interna1 control, Callis et al., 1987). Transactivation is expressed as the -fold induction over the luciferase-to-CAT ratio of anin biosynthetic pathway (Coe et al., 1988) and has been pC1 R-15 delivered without p35SB-peru or p35SC7. shown to be regulated by C7 and R (Cone et al., 1986; Chandler et al., 1989; Ludwig et al., 1989). Transient gene expression analysis of deleted promoters has shown that the region of A1 regulated by C7 and R is within 150 nucleotides of the start of transcription (J. Tuerck, unpub- the myb DNA binding domain, strongly suggest that C7 is lished results). Within this region, there are several imper- a transcription factor that can bind DNA. This hypothesis fect myb consensus sites and a sequence, GGtAGtTGC, is strengthened by our finding that the cis-acting DNA between nucleotides -122 bp and -114 bp (Schwarz- region of the Bz7 promoter that responds to C7 contains Sommer et al., 1987) that is homologous to 7 of the 9 a myb DNA binding consensus site. nucleotides in the Bz7 myc-like consensus sequence However, this model is somewhat complicated by the GGCAGGTGC. Additionally, the promoter of the barley observation that a Bz7 promoter that lacks the myb con- Bz7-homologous gene contains the sequence sensus recognition site at position -71 bp to -66 bp is GGCAGGTGa (nucleotides 419 to 427 of the published expressed at Iow levels (1 0% of pBzl L) in embryos but at sequence; Wise et al., 1990), which shows almost perfect levels comparable with pBzlL in aleurone tissue. One homology to the Bz,7 myc-like consensus sequence. Fur- explanation for this finding is that there may be alternative ther experiments will be required to establish the functional sites recognized by C7 in the Bz7 promoter. Analysis of importance of this sequence. the Bzl sequence (Ralston et al., 1988) revealed a myb myc-Homologous consensus sequences also have been consensus sequence at -189 bp upstream of the Bz7 found to be functionally important in other plant genes. mRNA start. It is possible that the expression of the C7 Two light-responsive sequences in the promoter regions protein could be significantly higher in aleurone cells com- of the small subunit of ribuIose-l,5bisphosphate carbox- pared with embryo cells, in part because of the extra copy ylase from several plants (Giuliano et al., 1988) and chal- of the C7 gene in aleurone tissue. In aleurones, therefore, cone synthase of Antirrhinum majus (Staiger et ai., 1989) there may be sufficient C7 protein available to bind to the contain myc consensus sites. The occurrence of myc -189 bp myb site or other cryptic sites to overcome the consensus sequences in a number of plant genes and the effect of the myb site mutation in the critical -76 bp to demonstration that they bind trans-acting factors indicate -45 bp region. Further experiments will be required to that they represent a general DNA sequence motif bound Functional Analysis of Maize Bzl Promoter 323

by regulatory proteins, most likely, helix-loop-helix Bzl 3‘ and lnternal Deletion Promoter Constructs proteins. The latter findings of light-responsive myc consensus An opposing set of deletions was produced by Ba131 digestion sites are intriguing. In the maize plant body, €327 is ex- from the BamHl site of the Bzl promoter fragment. Sstl linkers pressed in the presence of B and PI (products homologous were added and the deletion products were cloned as EcoRI-Sstl to R and respectively) or at lower levels in the presence fragments into pUCl8N, a derivative of pUCl8 with a unique Notl C7, site (nucleotide 460) added adjacent to the Hindlll site (nucleotide of light in a B and pl genotype. One possible explanation 448). Deletion end points were determined by dideoxy sequenc- for this is the presence of a light-dependent, helix-loop- ing. lnternal deletions of the Bzl promoter were constructed by helix protein that can form a heterodimer with B (or R). combining a 5‘ deletion and a 3’ deletion at their unique Sstl This heterodimer would bind the Bz7 myc consensus site sites. and activate the expression of Bz7 in the absence of C7 or PI. Our findings indicate that the critical region of the Bz7 Mutagenesis of the Bz 1 Promoter promoter that responds to C7 (myb-like) and R (myc-like) control contains myb and myc DNA consensus binding Single-stranded DNA produced from a plasrnid containing an sites. This supports the hypothesis that C7 and R encode EcoRI-Hindlll fragment (6.2 kb) of the Bzl genomic DNA in transcription factors that interact directly at these sites. pBluescript SK+ (Stratagene) was subjected to multisite-directed mutagenesis (Su and El-Gewely, 1988). The mutagenesis re- This model requires direct confirmation by in vitro DNA placed the nucleotides at -71 bp to -6E bp (TAACTG, myb site) binding studies. Once confirmed, these results would pro- or -58 bp to -53 bp (CAGGTG, myc site) with an Nhel restriction vide another example of the conservation of the protein site (GCTAGC), resulting in myb- and myc- Bzl promoters. These binding domain structure and DNA consensus binding sites rnutated promoter fragments were cloned into pLBz3‘, and the for the regulation of genes in completely divergent path- resulting plasmids, except for the mutagenized sites, were the ways in plants, animals, and insects (Kouzarides and Ziff, same as pBzl L. 1988; Murre et al., 1989a, 1989b).

Bzl-Adhl Promoter Fusions

METHODS BZl 3’-deleted promoters were gel purified after digestion with Pstl and Sinal, which cut at -569 bp in the Bzl promoter and in the pUCl8N polylinker, respectively. A 259-bp Haelll-Hindlll fragment containing a truncated Adhl promoter (-89 bp upstream of Plasmid Constructions the transcription start) and a portion of the Adhl first intron was gel purified from pAllLN (Callis et al., 1987). These fragments were cloned into Pstl-Hindlll-digested pBluescript KS+ plasmid Bzl 5‘-Deleted Promoter Constructs (Stratagene). A Hindlll fragment (2591 bp) containing the remain- der of the Adhl first intron, the luciferase coding region, and the Nos 3’ end from pAll LN then was cloned into the Hindlll site of 5’ deletions of a 2.3-kb EcoRI-BamHI Bzl promoter fragment the Bzl-Adhl core promoter fusion plasmids. The resulting plas- (Klein et al., 1989) in pUC18 were produced by digestion of the mids contained fusions of the Adhl core promoter to Bzl 3’- EcoRI-restrictedDNA with Ba131 exonuclease (Fromm and Berg, deleted promoters with end points of -45 bp, -76 bp, -90 bp, 1982). Sstl linkers (GCTCGAGC) were ligated to the deletion -150 bp, and -222 bp. A control plasmid, pAdh-89L, lacks products after treatment with T4 DNA polymerase. The resulting upstream 627 sequences. 5’-deleted promoters were cloned as Sstl-BamHI fragments into the luciferase reporter vector pLBz3’ (Klein et al., 1989). Deletion myb/myc Trimer-CaMV Fusions end points were determine by dideoxy sequencing using Sequen- 35s ase (U.S. Biochemicals). Nine deletions of the Bzl promoter were isolated with the following end points: -407 bp, -303 bp, A 38-mer oligonucleotide, GATCTGCACGTCTAACTGCGACT- -261 bp, -248 bp, -200 bp, -1 14 bp, -80 bp, -60 bp, and +2 GGCAGGTGCGCACGG, was trimerized and inserted upstream bp relative to the Bzl start of transcription. Additional deleted Bzl of a -73 bp CaMV 35s promoter (pJ044d, Ow et al., 1987) fused promoters were produced by the polymerasechain reaction (PCR) to a €327 intron, luciferase coding region, and Nos 3‘ end. CaMV utilizing single-stranded DNA template produced from the Bzl 35s-driven 8-peru and C1 constructs have been described else- -407 bp promoter (Sstl-BamHI fragment) cloned into the where (Goff et al., 1990). pBluescript SK+ plasmid (Stratagene). Oligonucloetide primers (25-mers) containing a 5’ Sstl site and with the 5’ end points of complementarysequences at -182 bp, -167 bp, -151 bp, -142 lnternal Control Plasmids bp, -134 bp, and -119 bp in the Bzl promoter and a reverse sequencing primer were utilized for PCR reactions (30 cycles). An interna1 control plasmid, pBzl CAT, was cointroduced with Amplified DNAs were digested with Sstl and BamHl and cloned deletion vectors into bzl, Cl, Rscm2 embryos as a control to into pLBz3’. verify that DNA was being delivered in each bombardment and to 324 The Plant Cell

standardize the luciferase activities. pBzl CAT is similar to pBzl L REFERENCES (Klein et al., 1989) except that the luciferase reporter gene is replaced by a CAT coding region (Callis et al., 1987). pAlCN (Callis et al., 1987) was used as the CAT internal control in the experi- Beckmann, H., Su, L.-K, and Kadesch, T. (1990). TFE3: A helix- ments with the oligonucleotide trimer-35s fusions. loop-helix protein that activates transcription through the immunoglobulin enhancer pE3 motif. Genes Dev. 4, 167-179. Biedenkapp, H., Borgmeyer, U., Sippel, A.E., and Klempnauer, Plant Material K.-H. (1988). Vira1 myb oncogene encodes a sequence-specific DNA-binding activity. Nature 335, 835-837. Callis, J., Fromm, M., and Walbot, V. (1987). lntrons increase lmmature embryos of the homozygous genotypes bz7, Cl, gene expression in cultured maize cells. Genes Dev. 1, Rscm2 or bzl, cl, Rscm2 were excised from kernels of sibfing 1183-1 200. crossed ears 18 days after pollination. Aleurones (bzl, C7, Rscm2) were harvested and dissected as previously described Chandler, V.L., Radicella, J.P., Robbins, T.P., Chen, J., and (Klein et al., 1989). Twelve embryos (embryo axis facing down) or Turks, D. (1989). Two regulatory genes of the maize anthocy- aleurones were placed on Petri dishes containing agarose-solidi- anin pathway are homologous: lsolation of 8 utilizing R genomic fied N6 media lacking 2,4-dichlorophenoxyaceticacid 1 day before sequences. Plant Cell 1, 1175-1 183. bombardment (Klein et al., 1989). Chen, W., Tabor, S., and Struhl, K. (1987). Distinguishing be- Embryogenic callus cultures derived from B73 x A188 were tween mechanisms of eukaryotic transcriptional activation with utilized in the 627 oligonucleotide trimer-35s fusion experiments bacteriophage T7 RNA polymerase. Cell 50, 1047-1 055. and described elsewhere (Goff et al., 1990). Coe, E.H., Jr., Hoisington, D.A., and Neuffer, M.G. (1988). The genetics of corn. In Corn and Corn Improvements, G.F. Sprague and J. Dudley, eds (Madison, WI: American Agronomy Society), pp. 81-258. Microprojectile Bombardment and Assays of Gene Expression Cone, K., Burr, F., and Burr, B. (1986). Molecular analysis of the maize anthocyanin regulatory locus C7. Proc. Natl. Acad. Sci. USA 83,9631-9635. Bombardment conditions and transient assays for luciferase and Davis, R.L., Cheng, P.-F., Lassar, A.B., and Weintraub, H. CAT activities were performed as previously described (Klein et (1990). The MyoD DNA binding domain contains a recognition al., 1989). For each microprojectilepreparation, 5 pg of an exper- code for muscle-specific gene activation. Cell 60, 733-746. imental plasmid or control (pBzl L, pLBz3', or pAdh-89L) plasmid Dellaporta, S.L., Greenblatt, I., Kermicle, J.L., Hicks, J.B., and was coprecipitated with 2 pg of pBzl CAT onto tungsten particles Wessler, S. (1988). Molecular cloning of the maize R-nj allele in a 50-pL volume. A 2.5-pL aliquot was used for each independent by transposon-tagging with Ac. In Chromosome Structure and bombardment. Bombardment conditions for embryogenic callus Function: lmpact of New Concepts, 18th Stadler Genetics cultures were described previously (Goff et al., 1990). Symposium, J.P. Gustafson and R. Appels, eds (New York: The luciferase-to-CAT ratio is the number of light units recorded Plenum Press), pp. 263-282. in 1O sec from 1O0 pL of extract divided by the CAT activity (from the CAT internal control) observed from 25 pL of extract. Relative Dooner, H.K., and Nelson, O.E. (1977). Genetic control of UDP- activity was calculated by dividing the average luciferase-to-CAT g1ucose:flavonol 3-O-glucosyl transferase in the endosperm of ratio of a Bzl deleted promoter construct by the average lucifer- maize. Biochem. Genet. 15, 509-519. ase-to-CAT ratio of pBzlL in each experiment. Each deletion Dooner, H.K., and Nelson, O.E. (1979). lnteraction among C, R construct was tested at least twice with three replications per and Vp in the control of the Bz glucosyltransferase during experiment. endosperm development in maize. Genetics 91,309-31 5. Fromm, M., and Berg, P. (1982). Deletion mapping of DNA regions required for SV40 early region promoter function in vivo. J. MOI. Appl. Genet. 1, 457-481. ACKNOWLEDGMENTS Furtek, D., Schiefelbein, J., Johnston, F., and Nelson, O.E. (1988). Sequence comparisons of three wild-type Bronze-7 alleles from Zea mays. Plant MOI. Biol. 11, 473-481. We wish to thank E. I. Du Pont Medical Products Division for the Gerats, A.G.M., Bussard, J., Coe, E.H., and Larson, R. (1984). use of the microprojectile particle delivery apparatus. This re- lnfluence of 6 and PI on UDPG:flavonoid-3-O-glucosyltransfer- search was supported by United States Department of Agricul- ase in Zea mays L. Biochem. Genet. 22,1161 -1 169. ture, Competitive Research Grants Office Grant 89-37280-4898 Giuliano, G., Pichersky, E., Malik, V. S., Timko, M.P., Scolnik, to M.E.F. P.A., and Cashmore, A.R. (1988). An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc. Natl. Acad. Sci. USA 85, 7089-7093. Goff, S.A., Klein, T.M., Roth, B.A., Fromm, M.E., Cone, K.C., Radicella, J.P., and Chandler, V. (1 990). Transactivation of anthocyanin biosynthetic genes following transfer of B regula- Received December 7, 1990; accepted January 25, 1991. tory genes into maize tissues. EM60 J. 9, 2517-2522. Functional Analysis of Maize 6z7 Promoter 325

Goff, S.A., Cone, K.C., and Fromm, M.E. (1991).ldentification of Nucl. Acids Res. 18, 1703-1 71 O. functional domains in the maize transcriptional activator C1: Ow, D.W., Jacobs, J.D., and Howell, S.H. (1987). Functional Comparison of wildtype and dominant inhibitor proteins. Genes regions of the cauliflower mosaic virus promoter determined by Dev. 5,298-309. use of the firefly luciferase gene as a reporter of promoter Henthorn, P., Kiledjian, M., and Kadesch, T. (1 990). Two distinct activity. Proc. Natl. Acad. Sci. USA 84, 4870-4874. transcription factors that bind the immunoglobulin enhancer Paz-Ares, J., Ghoal, D., Wienand, U., Peterson, P.A., and pE5/~E2motif. Science 247, 467-470. Saedler, H. (1987). The regulatory c7 locus of Zea mays Howe, K.M., Reakes, C.F.L., and Watson, R.J. (1990). Charac- encodes a protein with homology to myb proto-oncogene prod- terization of the sequence-specific interaction of mouse c-myb ucts and with structural similarities to transcriptional activators. protein with DNA. EMBO J. 9, 161 -1 69. EMBO J. 6,3553-3558. Jacobsen, K., Laursen, N.B., Jensen, E.0., Marcker, A., Poul- Perrot, G.H., and Cone, K.C. (1989). Nucleotide sequence of the sen, C., and Marcker, K.A. (1990). HMG I-like proteins from maize R-S gene. Nucl. Acids Res. 17, 8003. leaf and nodule nuclei interact with different AT motifs in soy- Ralston, E., English, J.J., and Dooner, H.K. (1988).Sequence of bean nodulin promoters. Plant Cell 2, 85-94. three bronze alleles of maize and correlation with the genetic Jensen, E.O., Marcker, K.A., Shell, J., and de Bruijn, F.J. (1988). fine structure. Genetics 119, 185-1 97. lnteraction of a nodule specific, trans-acting factor with distinct Schwarz-Sommer, Z., Shepherd, N., Tacke, E., Gierl, A., DNA elements in the soybean leghaemoglobin lbc3 upstream Rohde, W., Leclercq, L., Mattes, M., Berndtgen, R., Petersen, region. EMBO J. 7, 1265-1271. P., and Saedler, H. (1987). lnfluence of transposable elements Jofuku, K.D., Okamuro, J.K., and Goldberg, R.B. (1987). Inter- on the structure and function of the A7 gene of Zea mays. action of an embryo DNA binding protein with a soybean lectin EMBO J. 6,287-294. gene upstream region. Nature 328, 734-737. Sen, R., and Baltimore, D. (1986). Multiple nuclear factors inter- Klein, T.M., Roth, B.A., and Fromm, M.E. (1989). Regulation of act with the immunoglobulin enhancer sequences. Cell 46, anthocyanin biosynthetic genes introduced into intact maize 705-71 6. tissues by microprojectiles. Proc. Natl. Acad. Sci. USA 86, Staiger, D., Kaulen, H., and Schell, J. (1989). A CACGTG motif 6681-6685. of the Antirrhinum majus chalcone synthase promoter is rec- Klempnauer, K.-H., Arnold, H., and Beidenkapp, H. (1989). ognized by an evolutionarily conserved nuclear protein. Proc. Activation of transcription by v-myb: Evidence for two different Natl. Acad. Sci. USA 86, 6930-6934. mechanisms. Genes Dev. 3,1582-1589. Struhl, K. (1 985). Naturally occurring poly(dA-dT) sequences are Kouzarides, T., and Ziff, E. (1988).The role of the leucine zipper upstream promoter elements for constitutive transcription in in the fos-jun interaction. Nature 336, 646-651. yeast. Proc. Natl. Acad. Sci. USA 82, 8419-8423. Ludwig, S.R., Habera, L.F., Dellaporta, S.L., and Wessler, S.R. Su, T.-Z., and El-Gewely, M.R. (1 988). A multisite-directed mu- (1989). Lc, a member of the maize R gene family responsible tagenesis using T7 DNA polymerase: Application for recon- for tissue-specific anthocyanin production, encodes a protein structing a mammalian gene. Gene 69, 81-89. similar to transcriptional activators and contains the myc-ho- Sullivan, T.D., Schiefelbein, J.W., Jr., and Nelson, O.E. (1989). mology region. Proc. Natl. Acad. Sci. USA 86, 7092-7096. Tissue-specific effects of maize Bronze gene promoter muta- Murre, C., McCaw, P.S., and Baltimore, D. (1989a).A new DNA tions induced by Ds7 insertion and excision. Dev. Genet. 10, binding and dimerization motif in immunoglobulinenhancer bind- 412-424. ing, daughterless, MyoD, and myc proteins. Cell 56, 777-783. Walker, J.C., Howard, E.A., Dennis, E.S., and Peacock, W.J. Murre, C., McCaw, P.S., Vaessin, H., Caudy, M., Jan, L.Y., Jan, (1 987). DNA sequences required for anaerobic expression of Y.N., Cabrera, C., Buskin, J.N., Hauschka, S.D., Lassar, A.B., the maize alcohol dehydrogenase 1 gene. EMBO J. 6,ll-16. Weintraub, H., and Baltimore, D. (1 989b). lnteractions be- Weston, K., and Bishop, J.M. (1 989). Transcriptional activation tween heterologous helix-loop-helix proteins generate com- by the v-myb oncogene and its cellular progenitor, c-myb. Cell plexes that bind specifically to a common DNA sequence. Cell 58,85-93. 58,537-544. Wise, R.P., Rohde, W., and Salamini, F. (1990). Nucleotide Oehler, T., Arnold, H., Biedenkapp, H., and Klempnauer, K.-H. sequence of the Bronze- 7 homologous gene from Hordeum (1990). Characterization of the v-myb DNA binding domain. vulgare. Plant MOI. Biol. 14, 277-279. The Pulvinus: Motor Organ for Leaf Movement

Edited by Ruth L. Satter, Holly L. Gorton, and Thomas C. Vogelmann

Sponsored by The University of Connecticut, Storrs

Volume 3, Current Topics in Plant Physiology: An American Society of Plant Physiologists Series

~ ~ ~~ ~ Leaf Movements: An Overview of the Field Nyctinastic Legumes Ruth L. Satter Youngsook Lee

1. Types of Leaf Movement The Role of lon Channels in Osmotic Volume Changes in Samanea Motor Cells by Patch-Clamp Methods Light-Modulated Circadian Rhythmic Leaf Movements in Nava Moran Nyctinastic Legumes Ruth L. Satter and Ma/y Jane Morse Walls as Potassium Storage Resevoirs in Phaseolus Pulvini Seismonastic Movements in Mimosa pudica and Other W. -E. Mayer Nyctinastic Legumes Gabriel Roblin Phototransduction in the Samanea Pulvinus: Role of Accelerated lnositol Phospholipid Turnover Movement in Grass Shoots Richard C. Crain Thomas G. Brock and Peter 6. Kaufman Mechanism of Light Perception in Leaves of Sun- Leaf Movements in Plants Without Pulvini Tracking Plants Donald F. Wetherell Raymon A. Donohue and Thomas C. Vogelmann

Leaf Movements in Nyctinastic Plants as Hands of thé Role of Turgorins in Leaf Movement Biological Clock Hermann Schildknecht and Wolfram Meier-Augenstein Anders Johnsson, Wolfgang Engelmann, and Bernd Antko wiak Pulvinar Water Relations in Nyctinastic Plants Holly L. Gorton 1. Mechanisms and Function Stomates and Pulvini: A Comparison of Two Rhythmic, Structure and Ultrastructure of the Pulvinus in Nyctinastic Turgor-Mediated Movement Systems Legumes Holly L. Gorton Pierrette Fleurat-Lessard Function of Leaf Movements lon Movements That Control Pulvinar Curvature in lrwin N. Forseth

The Pulvinus: Motor Organ for Leaf Movement

VOLUME 3, CURRENT TOPICS IN PLANT PHYSIOLOGY AN AMERICAN SOCIETY OF PLANT PHYSIOLOGISTSSERIES Payment must be in U.S. currency orbe drawn on a U.S. bank. Return this form (ora copy ) with payment or purchase order to American Society of Plant Physiologists, 15501 Monona Drive, Rockville, MD 20855 USA

NAME ASPP MEMBER NUMBER CHIRGE CARD NO./EXPIFtATION DATE (AMERICAN EXPRESS, VISA, MASTERCARD, DINER'S CLUB)