PDF hosted at the Radboud Repository of the Radboud University Nijmegen
The following full text is a publisher's version.
For additional information about this publication click this link. http://hdl.handle.net/2066/190339
Please be advised that this information was generated on 2021-10-07 and may be subject to change. Arslan Arshad Arslan MICROBIAL ECOLOGY OF OF ECOLOGY MICROBIAL OXIDATION ANAEROBIC OF METHANE
MICROBIAL ECOLOGY OF ANAEROBIC OXIDATION OF METHANE Arslan Arshad Microbial ecology of anaerobic oxidation of methane
Arslan Arshad Arslan Arshad 2018 Microbial ecology of anaerobic oxidation of methane PhD thesis, Radboud University
This PhD project was financially supported by ERC Advanced Grant EcoMoM 339880
ISBN/ EAN: 978-94-6284-137-6 Design layout: Bregje Jaspers | ProefschriftOntwerp.nl Cover: Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor Printed by: 978-94-028-1003-5 Copyright: © Arslan Arshad, 2018 Microbial ecology of anaerobic oxidation of methane
Proefschrift
ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. dr. J.H.J.M. van Krieken, volgens besluit van het college van decanen in het openbaar te verdedigen
op Woensdag 25 April 2018 om 16.30 uur precies
door Arslan Arshad geboren op 8 november 1987 te Gujranwala (Pakistan) Promotoren Prof. dr. ir. M.S.M. Jetten Prof. dr. H. J.M. Op den Camp
Copromotor Dr. C.U. Welte
Manuscriptcommissie Prof. dr. L.P.M. Lamers Prof. dr. K. Wrighton (The Ohio State University, Verenigde Staten) Prof. dr. M. Pester (Leibniz Institute DSMZ Braunschweig, Duitsland) Dedicated to my parents and grandparents
Contents
Summary 9 Samenvatting 13
Chapter 1 General Introduction 17
Chapter 2 Mimicking microbial interactions under nitrate- 35 reducing conditions in an anoxic bioreactor: enrichment of novel Nitrospirae bacteria distantly related to Thermodesulfovibrio
Chapter 3 Dissimilatory nitrate reduction to ammonium (DNRA) in a 77 laboratory scale bioreactor mimicking estuarine conditions
Chapter 4 A metagenomics-based metabolic model of nitrate- 101 dependent anaerobic oxidation of methane by Methanoperedens-like archaea
Chapter 5 Characterization of acetyl-CoA synthetase from the 133 anaerobic methanotrophic archaea clades ANME-2a and ANME-2d
Chapter 6 Integration and Outlook 153
Bibliography 165 Curriculum vitae 187 Publication list 189 8 Summary
Summary
Global warming is a worldwide concern and methane contributes about 20% to planetary temperature increase. Microorganisms are both sources and sinks for methane. Thus, studying methane cycle microorganisms is essential for understanding methane budgets and emissions on earth. For decades efforts have been made towards identification of the underlying factors that modulate microbial responses in methane cycling in various ecosystems. In the absence of oxygen, the availability and abundance of nitrogenous substrates of either natural or anthropogenic origin is an important factor that influences the microbial methane cycle. Moreover, nitrogen is a crucial element of life and is deeply linked to carbon and other elemental cycles across all domains of life. The research presented in this thesis focuses on the microbial interactions of the carbon, nitrogen and sulfur biogeochemical cycles under anoxic conditions. Furthermore, a special emphasis is placed on the elucidation of respiratory mechanisms of nitrate dependent anaerobic oxidation of methane (AOM). The first introductory chapter of this thesis presents an overview of microorganisms capable of performing AOM coupled to various electron acceptors (sulfate, nitrate, nitrite and iron), with a special focus on freshwater microorganisms capable of performing denitrification coupled to AOM. Furthermore, an overview of ecophysiology and microbial cooperation between carbon, nitrogen and sulfur cycles from natural and engineered ecosystems is provided. In Chapter 2 a new enrichment culture containing chemolithoautotrophic microorganisms involved in the methane, nitrogen and sulfur biogeochemical cycles is described and characterized. The enrichment culture was operated for 382 days in a laboratory scale bioreactor mimicking nutrient conditions in anoxic sediments as found in brackish and coastal ecosystems. Next, a combination of analytical, microscopic and next generation sequencing approaches was applied to monitor physiological activity and microbial community composition of the enrichment culture. The successful enrichment of key microbial players along with a novel Nitrospirae, ‘Candidatus Nitrobium versatile’ revealed that competition for substrates and collaboration for intermediates or removal of toxic substances are essential drivers for shaping the microbial community. Chapter 3 illustrates how the outcome of the aforementioned microbial competition was affected when ammonium, the electron donor for anammox, was removed from the medium supply. Based on genomic data (Chapter 2) it was hypothesized that previously enriched members (Ca. Methanoperedens nitroreducens and the novel Nitrospirae sp. Ca. Nitrobium
9 Summary
versatile) might perform dissimilatory nitrate reduction to ammonium (DNRA) and therefore would provide ammonium for anammox spp. A meta-transcriptomic analysis from the bioreactor however showed that the produced ammonium was not sufficient to sustain the anammox population. Furthermore, the newly discovered Ca. Nitrobium versatile disappeared during this 10 week reactor operation. Based on gene expression and mRNA read abundance, nitrate-AOM archaea along with nitrite-AOM bacterial partners became the most dominant members of the microbial community. A putative respiratory mechanism of nitrate reduction coupled to AOM is presented in Chapter 4. This genome based metabolic reconstruction provided important insights into energy conservation and electron transport pathways from reverse methanogenesis located in the cytoplasm to the membrane bound nitrate reductase complex. We predicted that electrons from the core methanotrophic pathway are transferred to the cytoplasmic cofactors F420, coenzyme B and ferredoxin. Next, quinones in the cytoplasmic membrane may transfer electrons to several c-type cytochromes located in the pseudoperiplasm. Furthermore, the question whether anaerobic methanotrophic archaea were capable of methanogenesis was addressed. We could rule out the possibility of hydrogenotrophic or methylotrophic methanogenesis due to absence of specialized hydrogenase and methyltransferase encoding genes, respectively. However, the identification of genes encoding the acetate activating acetyl-CoA synthetase (ACS) similar to those found in aceticlastic methanogens, suggested that acetate might be used by these freshwater methanotrophic archaea. Thus Chapter 5 focuses on the functional characterization of ACS from ANME-2d and ANME-2a archaea. In vitro ACS activity assays indicated that acetate could be utilized by ANME-2 archaea. Furthermore, substrate specific conversion rates for acetate and other long chain organic acids were determined. In the last chapter, an integration of the thesis results and an outlook for future research are presented.
10 11 12 Samenvatting
Samenvatting
De opwarming van de aarde is een wereldomvattend probleem, en het broeikasgas methaan is voor ongeveer 20% verantwoordelijk voor deze opwarming. Micro- organismen kunnen methaan zowel produceren als afbreken. Daarom is het van essentieel belang om beide groepen van micro-organismen te bestuderen om de uitstoot en afbraak van methaan te begrijpen. Dit biedt de mogelijkheid om methaanbudgetten van ecosystemen op te stellen. Al decennia lang probeert men de onderliggende factoren die verantwoordelijk zijn voor de microbiële methaancycli in verschillende ecosystemen te identificeren. Bij afwezigheid van zuurstof is de beschikbaarheid van stikstofbevattende substraten van zowel natuurlijke als menselijke bronnen een belangrijke factor die de microbiële methaancyclus beïnvloedt. Bovendien is stikstof een cruciaal element van het leven, nauw verbonden met koolstof en andere elementaire cycli in alle domeinen van het leven. Het onderzoek dat in dit proefschrift wordt gepresenteerd houdt zich bezig met de microbiële omzettingen en interacties binnen de biochemische cycli van koolstof, stikstof en zwavel onder zuurstofloze omstandigheden. Daarnaast wordt aandacht besteed aan het ademhalingsmechanisme bij nitraat-afhankelijke anaerobe oxidatie van methaan (AOM). Het eerste inleidende hoofdstuk van dit proefschrift geeft een overzicht van micro- organismen in zoetwater ecosystemen die in staat zijn om AOM uit te voeren, gekoppeld aan verschillende elektronenacceptoren (sulfaat, nitraat, nitriet en ijzer). Hierbij ligt de nadruk op zoetwatermicro-organismen die in staat zijn AOM te koppelen aan denitrificatie. Daarnaast wordt een overzicht van ecofysiologie en microbiële samenwerking binnen de koolstof-, stikstof- en zwavelcycli van natuurlijke en kunstmatige ecosystemen gegeven. In Hoofdstuk 2 wordt een nieuwe verrijkingscultuur met chemolithoautotrofe micro-organismen die betrokken zijn bij biochemische cycli van methaan, stikstof en zwavel beschreven en gekarakteriseerd. De verrijkingscultuur werd 382 dagen in stand gehouden in een bioreactor op laboratoriumschaal. Hierbij werden de voedingscondities in zuurstofloze sedimenten nagebootst, zoals deze gevonden worden in brakke- en kustwaterecosystemen. Vervolgens werd een combinatie van analytische, microscopische en Next Generation Sequencing methoden gebruikt om de fysiologische activiteit en samenstelling van de verrijkingscultuur te monitoren. De succesvolle verrijking van essentiële microbiele spelers waaronder de nieuwe Nitrospirae ‘Candidatus Nitrobium versatile’ liet zien dat concurreren om substraten, samenwerken bij het gebruik van intermediairen en/of het verwijderen van giftige
13 Samenvatting
substanties belangijke aandrijvers zijn voor het samenstellen van de microbiële gemeenschap. Hoofdstuk 3 laat zien hoe de uitkomst is van de eerdergenoemde microbiële concurrentie op het moment dat ammonium, de elektronendonor voor anammox, werd verwijderd uit het aangevoerde medium. Gebaseerd op de eerdere genomische data (Hoofdstuk 2) werd verondersteld dat de voorheen verrijkte leden (Ca. Methanoperedens nitroreducens en de nieuwe Nitrospirae sp. Ca. Nitrobium versatile) dissimilatoire nitraatreductie naar ammonium (DNRA) kunnen uitvoeren, en op die wijze ammonium voor de anammox bacterien konden produceren. Een meta-transcriptoom analyse van de bioreactor liet echter zien dat het geproduceerde ammonium niet afdoende was om de anammoxpopulatie in stand te houden. Verder is de nieuw ontdekte Ca. Nitrobium versatile verdwenen gedurende de 10 weken waarin deze reactor onder ammonium-limitatie in stand werd gehouden. Gebaseerd op de genexpressie en abundantie van mRNA reads werden nitraat-AOM archaea samen met nitriet-AOM bacteriën als de meest dominante leden van de microbiële gemeenschap geïdentificeerd. Op basis van een genoom reconstructie kon een hypothetisch ademhalingsmechanisme voor nitraatreductie gekoppeld aan AOM worden opgesteld (Hoofdstuk 4). Deze reconstructie biedt belangrijke inzichten met betrekking tot energieconservering en elektronentransportketens vanuit de omgekeerde methanogenese in het cytoplasma naar het membraangebonden nitraatreductasecomplex. Volgens onzevoorspelling worden elektronen uit de algemene methanotrophe pathway overgedragen naar de cytoplasmatische cofactoren F420, co-enzym B en ferredoxine. Vervolgens kunnen quinonen in het cytoplasmatisch membraan elektronen overdragen naar verschillende c-type cytochromen in het pseudoperiplasma. Bij de reconstructie werd ook getracht de vraag te beantwoorden of anaerobe methanotrofe archaea in staat zijn tot methanogenese. We konden hydrogenotrofe of methylotrofe methanogenese uitsluiten vanwege het ontbreken van de noodzakenlijke genen die respectievelijk speciale hydrogenases en methyltransferases coderen. Echter, genen die het acetaat- activerende acetyl-CoA synthetase (ACS) coderen werden wel geïdentificeerd. Deze genen waren vergelijkbaar met de ACS coderende genen die gevonden wordt in aceticlastische methanogenen. Dit doet vermoeden dat methanotrofe zoetwaterarchaea in staat zijn om acetaat de gebruiken. Dit wordt verder uitgezocht in Hoofdstuk 5 waarin de functionele karakterisatie van het ACS uit ANME-2d en ANME-2a archaea wordt beschreven. In vitro ACS activiteitsassays geven aan dat acetaat inderdaad gebruikt kan worden door ANME-2 archaea. Substraatspecifieke omzettingssnelheden voor acetaat worden vergeleken met die van andere organische
14 Samenvatting
zuren met langere zijketens. In het laatste hoofdstuk worden de resultaten van de proefschrift geintegreerd en in een groter kader geplaatst. Daarnaast worden mogelijkheden voor toekomstig onderzoek gepresenteerd.
15
General Introduction
1 CHAPTER 1
18 General introduction
Background 1
Methane is both an important energy source and greenhouse gas. The atmospheric methane concentration has increased from 0.722 to 1.803 parts per million (ppm) in 260 years and has exhibited a 5 fold higher growth per year since 2009 (Ciasis et al., 2013; Prather and Holmes, 2017; Rigby et al., 2017; Ussiri and Lal, 2017). The methane emissions arise from natural and anthropogenic sources. Termites, wetlands, freshwater bodies, and other geological sources including oceans constitute the natural methane sources and are responsible for about one third of the total methane emissions (Bousquet et al., 2006; EPA, 2010). The remaining two thirds have an anthropogenic origin which include rice cultivation, livestock farming, production and utilization of fossil fuels as well as organic waste deposition in landfills (Fiore et al., 2015). Approximately 70% of the atmospheric methane is of microbial origin (Conrad, 2009). Elevated temperatures along with increased carbon dioxide concentrations in the atmosphere may lead to much higher methane emissions in future. Additionally, factors modulating the microbial responses of the microorganisms involved in the methane cycling indirectly play a crucial role in regulating the global methane fluxes (Conrad, 2009; Murrell and Jetten, 2009; Bodelier and Steenbergh, 2014). Nitrogen input through natural deposition or anthropogenic activity, is one such factors that causes a range of effects on the microbial methane cycle. In general, the use of (surplus) nitrogen fertilizers has substantial negative consequences, including eutrophication of terrestrial and aquatic ecosystems as well as acidification of global ecosystems and nitrous oxide emissions to the atmosphere (Galloway et al., 2003; Rockmannn nature 2008). The impact of human alteration of the nitrogen and methane cycles on climate change has been the subject of many studies (reviewed in Gruber and Galloway, 2008). However, considerably less attention has been paid to microbial interactions that can occur between the major biogeochemical cycles of carbon, nitrogen and sulfur. Furthermore, the co-occurrence of different carbon, nitrogen and sulfur compounds may provide suitable environments for interactions of microorganisms in the biogeochemical cycles. During the past decade, several new links between the nitrogen, sulfur, and methane cycle have been discovered in freshwater and marine ecosystems that warrant further investigations: In 2006, (Raghoebarsing et al., 2006) showed that a novel microbial consortium of Bacteria and Archaea could performed nitrate and nitrite dependent anaerobic oxidation of methane (AOM) (Raghoebarsing et al., 2006). Cryptic sulfur and/or methane cycles coupled to the nitrogen cycle seem to occur in oxygen minimum zones and in some fresh water ecosystems (D
19 CHAPTER 1
E Canfield et al., 2010; Padilla et al., 2016, 2017; Weber et al., 2017)), but the microbial player are not yet well characterized. In the next sections, the relevant microbiology of methane, nitrogen and sulfur cycles will be introduced, and the final section will contain the outline of this thesis.
Modes of microbial methane oxidation The very first observation of microbial consumption of methane dates back to 1905 (Käserer, 1905), while the first aerobic methane-oxidizing bacteria named Bacillus methanicus were isolated in 1906 (Söhngen, 1906). Aerobic methanotrophs have been extensively studied ever since and are members of phyla Proteobacteria and Verrucomicrobia (Op den Camp et al., 2009; Semrau et al., 2010). Furthermore, numerous physiological studies have shown that that biological methane oxidation does occur in a variety of environments that include, among others, soils arctic permafrost, volcanic mud pots and sewage treatments plants (Dedysh et al., 2004; Pol et al., 2007; Liebner et al., 2009; Ho et al., 2013). Methanotrophic bacteria employ two distinct methane monooxygenases (MMOs), the soluble iron containing MMO (sMMO) and the membrane bound copper-iron MMO (pMMO) for the initial methane oxidation step (Hakemian and Rosenzweig, 2007). Although methane is the simplest organic molecule, its microbial consumption requires a very high activation energy of 439 kJ/mol (Thauer and Shima, 2008) to break the C-H bond. Therefore, the belief that methane could only be oxidized by microorganisms in the presence of oxygen persisted for over a century. This assumption was more and more challenged as evidence accumulated in favour of anaerobic mode of methane oxidation. Thermodynamically, nitrate, nitrite, oxidized metals and sulfate are suitable electron acceptors for methane oxidation and would conserve (just) enough energy to sustain growth (Table 1). The very first indications for anaerobic oxidation of methane (AOM) were obtained from marine sediment profiles (Reeburgh, 1976). The identity of the responsible microorganism became more and more apparent when biogeochemical evidence of AOM coupled to sulfate reduction in both fresh water and marine environments was obtained (Zehnder and Brock, 1980; Hoehler et al., 1994; Hinrichs et al., 1999; Boetius et al., 2000a). Later studies established that AOM coupled to sulfate reduction is performed by a consortium of anaerobic methanotrophic (ANME) archaea and their syntrophic sulfate reducing bacterial partners (Knittel and Boetius, 2009; Milucka et al., 2012; Silvan Scheller et al., 2016).
20 General introduction
Table 1: Net reactions of methane oxidation coupled to electron acceptors other than oxygen. 1 Reaction Gibbs free energy
∆Gº (kJ/mol) CH4 - (1) CH4 + 2O2 → CO2 + 2H2O -818
- + (2) 3CH4 + 8NO2 + 8H → 3CO2 + 4N2 + 10H2O -929
- + (3) 5CH4 + 8NO3 + 8H → 5CO2 + 4N2 + 14H2O -765
+ - + (4) 5CH4 + 4MnO2 + 7H → HCO3 + 4Mn2 + 5H2O -528
(5) CH4 + 8Fe(OH)3 + 7 CO2 → 8FeCO3 + 14H2O -344
2- + (6) CH4 + SO4 + 2H → CO2 + H2S + 2H2O -15 - 40
ANME archaea constitute three distinct groups of archaea, ANME-I, ANME-II and ANME-III, all belonging to the phylum Euryarchaeota (Knittel et al., 2005; Nauhaus et al., 2005; Stadnitskaia et al., 2005). The role of ANME archaea in mitigating methane emissions from marine environments has been well documented (Boetius and Wenzhöfer, 2013). Besides marine ecosystems, sulfate-dependent anaerobic methane oxidation has been reported in a limited number of terrestrial and freshwater ecosystems where generally much lower sulfate concentrations prevail (Eller et al., 2005; Timmers et al., 2016a). The free energy change associated with the oxidation of methane under sulfate-reducing conditions (Reaction 6, Table 1) is very low: although variable over a range of environmental conditions, it does not exceed -15 to -40 kJ/mol methane, largely depending on the partial pressure of methane. This is close to the thermodynamic limit -20 kJ/mol needed for translocation of one proton to produce ATP, furthermore this energy also has to be shared between the partners in consortia (Schink and Thauer, 1987; Schink, 1997; Caldwell et al., 2008; Larowe et al., 2008). The electron acceptors further up the redox ladder (Table 1) conserve substantially more energy to support microbial metabolism and are more likely to be found in many more freshwater and terrestrial environments (Strous and Jetten, 2004). However, it was not until 2006 that the first enrichment culture of AOM coupled to denitrification was reported (Raghoebarsing et al., 2006). During follow up studies, the application of stable isotope labelling, microscopy and various omic approaches on the AOM enrichment culture revealed that denitrification coupled to methane oxidation was performed by a consortium of two microorganisms. An archaeal partner belonging to the ANME-2d clade that oxidizes methane coupled to nitrate reduction and was named Candidatus Methanoperedens nitroreducens (Haroon et al., 2013). The methane activation by Ca. M. nitroreducens and other ANME archaea is most likely performed by the similar enzyme that produces
21 CHAPTER 1
methane in methanogens, the methyl-coenzyme M-reductase (MCR) acting in reverse to produce methyl-coenzyme M as the first intermediate (Krüger et al., 2003; Shima and Thauer, 2005; Scheller et al., 2010). In recent years, several meta-omics studies have unravelled the underlying methane-oxidation pathway and energy conservation models of ANME-2d archaea (Wang et al., 2014; Arshad et al., 2015; McGlynn, 2017; Timmers et al., 2017). The nitrite produced during the first step of denitrification coupled to AOM is further reduced by anaerobic methanotrophic bacteria belonging to the NC10 clade tentatively named Candidatus Methylomirabilis oxyfera (Raghoebarsing et al., 2006; Ettwig et al., 2008, 2010). Both Methanoperedens and Methylomirabilis were discovered under nitrate and/ or nitrite reducing conditions. It is believed that nitrate and nitrite are more and more replacing oxygen as the main electron acceptors in many rivers, lakes and wetlands due to leaching of excess fertilizers and their much higher solubility in water (Gruber and Galloway, 2008). Besides the availability of nitrogen oxides as electron acceptors, Methanoperedens and Methylomirabilis require methane as electron donor. Methane is produced by methanogenic archaea known to inhabit an array of anoxic environments that include wetlands, tundra soils, paddy fields, freshwater and saline sediments, intestinal tracts of ruminants, anaerobic reactors and sewage treatment facilities as well as solid waste landfills (Barber and Ferry, 2001; Liu and Whitman, 2008; Conrad, 2009; Kallistova et al., 2014; Sorokin et al., 2015). Due to suitable growth conditions, the aforementioned environments could also act as a sink for methane through the activity of AOM coupled to denitrification. This notion is further supported through extensive biogeochemical surveys where either 16S rRNA genes or functional biomarkers belonging to Methanoperedens and Methylomirabilis have been detected (Figure. 1) (Welte et al., 2016; Vaksmaa et al., 2017). Consequently, detection of these microorganisms in a vast variety of environments emphasizes the importance of interactions between carbon and nitrogen biogeochemical cycles in global sub-oxic and anoxic ecosystems, a topic that will be addressed in the next section.
22 General introduction
1 Clustering of B: Methylomirabilis oxyfera in natural environments
B Candidatus Methanoperedens nitroreducens based on detected habitats. Cultured representatives are marked in bold. Both phylogenies were calculated Candidatus Clustering of NC10 clade into separate subgroups along with the presence 16S rRNA based phylogenetic overview of denitrifying anaerobic methane oxidizing microorganisms to indicate the variety of ecosystems where AOM have been to indicate the variety of ecosystems where based phylogenetic overview of denitrifying anaerobic methane oxidizing microorganisms 16S rRNA A: A 1: Figure detected. ANME-2d related et al., 2016). algorithum using the Jukes cantor correction (Welte through Neighbour-joining
23 CHAPTER 1
Microbial processes of the nitrogen cycle The global nitrogen cycle is crucial for the biogeochemistry of our planet. Due to influx of nitrogen from both natural and anthropogenic sources, the global nitrogen cycle has possibly been altered beyond safe operational boundaries (Rockman, 2008). The bioavailability of nitrogen is essential for sustaining all forms of life. Molecular nitrogen (N2) is the largest pool of atmospheric nitrogen. This un-reactive nitrogen compound can be reduced to ammonium by diazotrophic microorganisms, which fix nitrogen gas into ammonium by a nitrogenase enzyme complex and assimilate ammonium further into a variety of amino acids (Dixon and Kahn, 2004; Galloway et al., 2004). The remaining organisms largely depend on readily available inorganic ammonium or nitrate for assimilation. Besides being a precursor for anabolic processes, ammonium is also used as electron donor during aerobic and anaerobic respiration (Winogradsky, 1890; Mulder et al., 1995). Under aerobic conditions, ammonium is oxidized to nitrate, the most oxidized state of nitrogen, via either a one or two-step nitrification process(Teske et al., 1994; Hovanec et al., 1998; Wuchter et al., 2006; Daims et al., 2015; van Kessel et al., 2015). For long, nitrification process was thought to be carried out by two distinct groups of microorganisms, namely ammonia oxidizing bacteria (AOB) and nitrite oxidizing bacteria (NOB). However in 2005, ammonia oxidizing archaea (AOA) were discovered as the main marine ammonium oxidizers (Könneke et al., 2005; Wuchter et al., 2006). AOB and AOA convert ammonium into nitrite, and the nitrite oxidizing bacteria (NOB) further oxidize nitrite into nitrate. However, the very recent discovery of the complete ammonium-oxidizing (comammox) bacteria has shown that Nitrospira bacteria are capable of converting ammonium into nitrate in one step and the same organism albeit at low ammonium and oxygen concentrations (Daims et al., 2015; van Kessel et al., 2015).
Denitrification Nitrate is the most oxidized nitrogen compound in the nitrogen cycle and in the absence of oxygen it is also the next most favourable electron acceptor. There are a number of different pathways in which nitrate can be metabolized, namely dissimilatory nitrate reduction to ammonium (DNRA), assimilatory nitrate reduction to ammonium, and (partial) denitrification, in which consecutive enzymatic conversions can transform nitrate into nitrite, nitric oxide, nitrous oxide and finally
N2 (Zumft, 1997; Lin and Stewart, 1998; Simon, 2002; Speth et al., 2016; Lycus et al., 2017). The above mentioned processes start with the reduction of nitrate to nitrite by either a membrane bound (nar) or periplasmic (nap) nitrate reductase. The
24 General introduction
produced nitrite is the crucial point where various pathways deviate. In DNRA and 1 nitrogen assimilation, a cytochrome c nitrite reductase or siroheme nitrite reductase converts nitrite into ammonium (Cole and Richardson, 2008). In denitrification, the nitrite is converted by either a copper nitrite reductase (nirK) or a cytochrome cd1 nitrite reductase (nirS) into the gaseous nitric oxide (Tiedje et al., 1983; Ward et al., 2009). Nitric oxide is converted into nitrous oxide a variety of heme-copper NO reductase (Reimann et al., 2007). The final step of denitrification, the oxidation of nitrous oxide into N2 is catalysed by a multicopper nitrous oxide reductase (nosZ) (Einsle and Kroneck, 2004; Philippot and Hallin, 2005). During denitrification, each of the intermediates can also be an end product as microorganisms do not need to carry all genes, or individual enzymatic conversions may have different regulatory mechanism, such as oxygen concentrations, nitrate and nitrite availability and the abundance of organic/inorganic electron donors (Betlach and Tiedje, 1981; Hernandez and Rowe, 1987; Härtig et al., 1999; Lycus et al., 2017). Consequently, - toxic intermediates such as nitrite (NO2 ) and the potent greenhouse gas N2O can escape to the environment. Denitrifying microbes are facultative anaerobes, which only engage the denitrification pathway in the absence of oxygen (Zumft, 1997). Based on the capacity to utilize electron donor and/or carbon source, the denitrification process is classified into two types: the microbes that use organic substrates as carbon source and electron donor to reduce nitrate to N2 are known as heterotrophic denitrifiers, while the ones that use inorganic substrates such as reduced - 2- sulfur compounds (HS , S2O3 , S°) and fix CO2 for biomass production are known as autotrophic denitrifiers (D E Canfield et al., 2010; Lenk et al., 2011; Bruckner et al., 2013). The autotrophic denitrification is mainly performed by the representatives of the Alpha-, Beta-, Gamma- and Epsilonproteobacteria (reviewed in Shao et al., 2010). Furthermore, the sulfide-dependent autotrophic denitrification and/or DNRA establish a direct link between the sulfur and nitrogen biogeochemical cycles. A number of studies have endorsed the importance of this process towards recycling or loss of fixed nitrogen and sulfur compounds in marine ecosystems(Vetriani et al., 2003; Labrenz et al., 2005; Glaubitz et al., 2009; Canfield et al., 2010). In a similar fashion, denitrification and nitrite-dependent AOM couple the elemental cycles of carbon and nitrogen (Raghoebarsing et al., 2006; Ettwig et al., 2012), and as a result fixed nitrogen may be lost from a range of sub-oxic and anoxic environments as N2. The nitrite-dependent AOM pathway by Candidatus M. oxyfera differs from the conventional denitrification pathway at the level of nitric oxide, which is converted to molecular oxygen and nitrogen through a putative nitric oxide dismutase (nod), thus bypassing the potent intermediate nitrous oxide (Ettwig et al., 2010).
25 CHAPTER 1
Anaerobic ammonium oxidation process For long, denitrification has been the only described mechanism through which bound nitrogen species could be converted to molecular nitrogen (N2). Although in theory, under anaerobic conditions nitrate or nitrite reduction coupled to ammonium oxidation was considered possible, as the Gibbs free energy released during this process would be enough to sustain growth (Broda, 1977). However, it was not until 1995 that the very first indication of such microbial mediated process was obtained from a denitrifying fluidized bed bioreactor that showed disappearance of significant amounts of ammonium while treating the anaerobic sulfidic effluent stream of a yeast manufacturing company (Mulder et al., 1995). Later studies focused on the physiology of the enrichment culture. Though initially ammonium oxidation was thought to be nitrate dependent, later it turned out that sulfide or organic compounds served as electron donors in the system to drive nitrate reduction releasing nitrite, which in turn was metabolized by anaerobic ammonium oxidizing (anammox) bacteria (Mulder et al., 1995). Further physiological studies revealed that indeed nitrite was the electron acceptor for the anammox process (van de Graaf et al., 1996). Since its discovery, numerous studies have broadened our understanding of the anaerobic ammonium oxidation (Kuenen, 2008; van Niftrik and Jetten, 2012; Kartal et al., 2013; Lackner et al., 2014). The natural habitats of anammox bacteria expand from deep sea sediments and hydrothermal vents to tropical mangroves and permafrost soils (Meyer et al., 2005; Penton et al., 2006; Byrne et al., 2009; Dale et al., 2009). Furthermore, the presence of anammox in Benguela (Kuypers et al., 2005), Arabian sea (Jensen, Lam, Revsbech, Nagel, Gaye, Mike SM Jetten, et al., 2011), Chilean (Galán et al., 2009) and Peruvian (Lam et al., 2009) oxygen minimum zones is in agreement to the studies that anammox contributes up to 50% in N2 production in marine habitats.
Dissimilatory nitrate reduction to ammonium According to the current understanding of the nitrogen cycle, a clear distinction can be made between N-associated microbial processes that are either conserve or release fixed nitrogen into the environment. Denitrification and anammox both contribute to nitrogen loss while in Dissimilatory Nitrate Reduction to Ammonium (DNRA), ammonium is the end product, and thus nitrogen is retained in the environment. As mentioned above, in both nitrate reducing processes (denitrification and DNRA) the first step of the pathway involves conversion of nitrate to nitrite by either membrane bound (narGH) or periplamsic (napAB) protein complexes. The electron donors for the DNRA reaction can be organic or inorganic such as hydrogen, reduced
26 General introduction
sulfur compounds, or methane (Cole, 1988; Dannenberg et al., 1992; Brunet and 1 Garcia-Gil, 1996; Haroon et al., 2013). During the second step of DNRA, nitrite is reduced to ammonium, without production of any intermediates. This reaction is catalysed by a periplasmic or membrane-bound pentaheme cytochrome c nitrite reductase (Nrf) system. Furthermore, the NrfAB or nrfAH enzyme complex is suggested to play a functional role in cellular detoxification by converting substrates like hydroxylamine, nitric oxide, sulfite and hydrogen peroxide (Simon and Klotz, 2013). Denitrification and DNRA have two electron acceptors in common: nitrate and nitrite, moreover both processes require anoxic or sub-oxic growth conditions (Tiedje et al., 1982; Kraft et al., 2014). The C/N ratio is assumed to be one of the main factors determining which process will prevail. Under nitrate limitation and excess of organic carbon as electron donor DNRA dominates, while at excessive nitrate concentrations denitrification is the preferred pathway (Tiedje et al., 1983; Kraft et al., 2014; van den Berg et al., 2015). DNRA has received relatively less attention compared to denitrification and other processes of the nitrogen cycle. Although the physiology and energy conservation mechanism of DNRA has been well established in pure cultures, the contribution of DNRA in engineered and natural ecosystems remains not well explored (Burgin and Hamilton, 2007; Kraft et al., 2011). Bacteria that can carry out DNRA are diverse: fermentative bacteria, sulfate reducers, some sulfur oxidizers, anammox and the newly discovered nitrate- reducing methanotrophic archaea can all perform nitrate ammonification (Tiedje et al., 1983; Simon, 2002; Kartal et al., 2007; Haroon et al., 2013; Arshad, Speth, De Graaf, et al., 2015). Anammox bacteria generally live under ammonium limiting conditions, and therefore greatly depend on other microbial processes for ammonium supply. Collaboration between DNRA microorganisms and anammox bacteria might therefore benefit both groups. Furthermore, many reports have shown that anammox bacteria can be successfully enriched in a stable co-culture with Ca. M. nitroreducens, where anammox bacteria rely on the archaeal partner for production of nitrite (Zhu et al., 2011; Haroon et al., 2013; Hu et al., 2015). Even though Ca. M. nitroreducens carries genetic potential to perform DNRA, it remains unknown if in a co-culture or natural habitat anammox can obtain both ammonium and nitrite from the physiological activity of Ca. M. nitroreducens. Nevertheless, the presence of nitrate, nitrite and ammonium in the same environment creates optimal conditions for a metabolic cooperation with nitrite and ammonium scavenging organisms.
27 CHAPTER 1
Metabolic cooperation and ecophysiology of the microbial nitrogen cycle The biogeochemical nitrogen cycle is deeply interlinked through microbial activities of generalists and specialists, which constitute significant connections to other elemental cycles, namely carbon and sulfur cycles. According to physiological studies, nitrite is the main product of nitrate reduction by ANME-2d archaea (Haroon et al., 2013; Ettwig et al., 2016a). In high concentrations nitrite is toxic and should be removed immediately. The first described co-culture of ANME-2d archaea contained anammox bacteria which used internally produced nitrite for respiration while ammonium was provided in the mineral medium (Haroon et al., 2013). An overview of both biochemical processes in a co-culture is provided in Figure 2 (Reaction 2 & 4). The initial enrichment culture performing denitrification coupled to AOM contained archaea closely related to ANME-2d (99.2% identical 16S rRNA), and were enriched together with Ca. M. oxyfera bacteria (Figure 2, reaction 3) which reduced nitrite and oxidized methane through a novel intra-aerobic pathway (Raghoebarsing et al., 2006; Ettwig et al., 2010). Therefore, anammox and Ca. M. oxyfera appear to be very suitable metabolic partners of nitrate-AOM performing ANME-2d archaea. The co-occurrence of anammox or Ca. M. oxyfera with ANME-2d archaea leads to a competition of the former two for nitrite utilization. The ANME-2d archaea encode a membrane-bound (nar) nitrate reductase system and lack the capacity to reduce nitrite further to N2 (Arshad et al., 2015; Berger et al., 2017; Vaksmaa et al., 2017). Although ANME-2d archaea encode a nrfAH type nitrite-dependent ammonium production cascade (Haroon et al., 2013; Arshad et al., 2015), only a small part of the available nitrite seems to be converted to ammonium Figure, 2 reaction 4 (Zhu, 2014) and therefore, the ANME-2d archaea probably rely on their microbial partners (anammox or Ca. M. oxyfera) for removal of nitrite. Ca. M. oxyfera competes with Ca. M. nitroreducens for methane utilization while cooperate for nitrite removal (Haroon et al., 2013). Previous studies have shown that anammox bacteria can be co-enriched and form a stable co-culture with Ca. M. oxyfera in a bioreactor system upon gradual increase of ammonium concentrations in the influent medium (Luesken et al., 2011; Zhu et al., 2011; Ding et al., 2014). On the contrary, Hu et al., 2015 reported that anammox bacteria successfully outcompeted Ca. M. oxyfera in a bioreactor system amended with ammonium, methane, nitrate or nitrite. Similarly, environmental studies have shown that anammox and Methylomirabilis sp. coexist in freshwater sub-oxic and anoxic sediments (Shen et al., 2014, 2015; Wang et al., 2014).
28 General introduction
1
Figure 2: Overview of anaerobic nitrogen cycle microbial processes linked to methane and sulfur cycles. 1: Sulfide-dependent autotrophic denitrification (brown arrows) 2: Anaerobic ammonium oxidation (anammox; red arrows) 3: Nitrite-dependent anaerobic oxidation of methane (Nitrite-AOM) performed by Ca. m. oxyfera (blue arrows) 4: Nitrate-dependent anaerobic oxidation of methane (Nitrate-AOM) by Ca. m. nitroreducens (green arrows)
Different substrate affinities of Ca. M. oxyfera and anammox species might be a decisive factor in determining the outcome of this competition. In natural ecosystems, the aforementioned interactions become more complex due to the activity of nitrifying bacteria and archaea. Nevertheless, these nitrifying bacteria are also considered instrumental for providing nitrite or nitrate in natural ecosystems. The ammonium concentrations dictate community composition of nitrifying bacteria, as ammonium oxidizing bacteria (AOB) dominate at higher ammonium concentrations while ammonium oxidizing archaea (AOA) mostly prevail at lower concentrations (Yan et al., 2012).
29 CHAPTER 1
− Figure 3: Branching diagram with a simplified overview of NO3 transformations under different conditions, indicated by the different colours. Depicted in green is CH4 availability, blue is the carbon input, red represents 0 iron (Fe) concentrations, in yellow the free sulfide concentrations H( 2S, S , FeS), finally in differentbrown shades are the C/N ratio under the different Fe or free sulfide concentrations. Courtesy of Kox and Jetten, 2015.
In natural ecosystems success of microbial processes for nitrate or nitrite utilization may be defined by C/N ratio (Figure. 3) (Kox and Jetten, 2015). Besides nitrate- AOM, another source of nitrite could be nitrate reduction to nitrite or partial denitrification. This process requires the availability of a suitable electron donor, which might be organic compounds (heterotrophic denitrification) or reduced sulfur substrates (autotrophic denitrification). In nitrate-rich coastal, brackish or estuarine environments nitrate reduction coupled to sulfide oxidation may release nitrite or reduce nitrate completely to N2 Figure. 3 (Dong et al., 2000; Sorokin et al., 2008). Additionally, autotrophic sulfide-dependent denitrifiers have been known to supply nitrite to anammox bacteria in wastewater treatment plants Figure 2, reaction 1 (Mulder et al., 1995; van de Graaf et al., 1996). The basis of this interaction has been studied directly in natural environments, e.g. marine oxygen minimum zones as well as in laboratory studies mimicking high salinity anoxic conditions (Dalsgaard et al., 2003; D. E. Canfieldet al., 2010; Russ et al., 2014; Rios-Del Toro and Cervantes, 2016). Alternatively, under high electron donor and to nitrate concentrations, nitrate may not be denitrified but instead be reduced to ammonium by DNRA(Kraft et al., 2011; van den Berg et al., 2015). Thus, an expansion of laboratory investigations focusing on interactions between nitrogen, sulfur, and methane utilizing microorganisms, will be relevant not only to understand these biogeochemical cycles in natural ecosystems where denitrification is coupled to sulfide and methane oxidation, but might also
30 General introduction
provide efficient solutions for treating domestic and agricultural sewage as well as 1 industrial wastewater pollution (Luesken et al., 2011; Zhu et al., 2011; Shen et al., 2012; Winkler et al., 2015). The implementation of these important AOM processes may also be improved by better understanding their metabolism and modes of energy conservation which are the topic of the last section in this introductory chapter.
Energy conservation and metabolism in methanotrophic archaea Anaerobic methanotrophs use an external electron acceptor other than oxygen and are found in both prokaryotic domains, Bacteria and Archaea (Boetius et al., 2000b; Ettwig et al., 2010; Haroon et al., 2013). Except the NC10 bacterium Ca. M. oxyfera that oxidizes methane through a putative intra-aerobic pathway (Ettwig et al., 2010, 2012) all other anaerobic methanotrophs have been reported to belong to the domain Archaea. The three ANME constitute of ANME-1 with sub-groups a and b, ANME-2 with subclusters a, b, c and d, and ANME-3. All three clades are related to cultivated members of Methanomicrobiales, Methanosarcinales and Methanococcoides spp. respectively (Hinrichs et al., 1999; Hinrichs and Boetius, 2002; Knittel et al., 2005). The ANME clades do not share a monophyletic relation with each other and only show 75 to 92% 16S rRNA similarity (Knittel and Boetius, 2009). Possibly, this wide phylogenetic distribution is due to the ecological niche adaptation of different ANME clades. Beside the recently discovered ANME-2d archaea all other ANME clades and their sub-group members were mostly observed in marine environments. However, in recent years several studies have reported the existence of sulfate-AOM in freshwater and terrestrial environments (Takeuchi et al., 2011; Amos et al., 2012; Timmers et al., 2016a). According to initial studies, ANME archaea were thought to always occur with SRB partners. However, reports of ANME partnerships with Betaproteobacteria and Verrucomicrobia suggested a metabolically more versatile lifestyle (Pernthaler et al., 2008; Hatzenpichler et al., 2016). Interestingly, ANME- 1 has been shown to occur without a bacterial partner, though the designated electron acceptor for such AOM remains unknown. It was speculated that in such ecosystems ANME-1 archaea could use metal oxides as electron acceptors or perform methanogenesis (Lloyd et al., 2011; Bertram et al., 2013). Although AOM coupled to the reduction of metal (Fe, Mn) oxides is thermodynamically favourable, there has been very little experimental evidence to support this. ANME-2a archaea were shown to be able to transport electrons to extracellular electron carriers making likely interactions with metal oxides (S. Scheller et al., 2016). Only recently, ANME-2d archaea have been shown to perform Fe-AOM (Ettwig et al., 2016a) with readily available iron in the form of iron-citrate. The main obstacle for biochemical
31 CHAPTER 1
characterization studies of ANME archaea has been the lack of defined or pure cultures due to extremely slow and syntrophic growth. Nevertheless, meta-omics approaches have been effectively applied on enrichment cultures to obtain genomic insights of central metabolic pathways of ANME archaea. A draft meta-genome of Ca. M. nitroreducens revealed the presence of a complete (reverse) methanogenesis pathway including all (mcr) subunit genes along with F420-dependent 5, 10-methenyl- tetrahydromethanopterin reductase (mer) genes. Next, genes of nitrate reduction (narGH) could also be identified. Additionally, the presence of a complete reductive acetyl-CoA (carbon fixation) pathway and acetyl-CoA synthetase suggested a possible capacity of acetate production by ANME-2d archaea. Many questions about underlying mechanisms of central energy metabolism remained unanswered. Nitrate-AOM is performed by ANME-2d archaea alone and unlike sulfate-AOM it does not require to transfer redox potentials to an SRB partner via direct inter-species electron transfer (DIET) (McGlynn et al., 2015). The pathway for electron transfer from cytoplasmic reverse methanogenesis reaction to membrane bound nitrate reductase required further investigation. The later part of this thesis (Chapter 4 and 5) extensively addresses these questions and provides some key observations. Over the past few years, an increasing number of metabolic reconstruction and comparative studies have significantly contributed towards current knowledge of the underlying metabolic mechanisms in ANME archaea (Haroon et al., 2013; Wang et al., 2014; Arshad, et al., 2015; Timmers et al., 2017). Consequently, these studies also provide a solid foundation for future research focusing on the functional characterization of key enzyme complexes in ANME archaea.
32 General introduction
Outline of this thesis 1
The biogeochemical cycles are highly interlinked through activities of microorganisms; these microbial activities are suggested to play a crucial role in regulation and release of intermediates in the environment. Therefore, this thesis aimed at further expanding our understanding of microbial interactions of carbon, nitrogen and sulfur cycles in natural ecosystems. In Chapter 2, a physiological study was conducted and an enrichment culture of chemolithoautotrophic microorganisms involved in the methane, nitrogen and sulfur biogeochemical cycles was obtained in an anoxic bioreactor that mimicked estuarine, brackish or coastal sediment nutrient conditions. The successful enrichment of key microbial players along with a novel Nitrospirae sp., Candidatus Nitrobium versatile, revealed that competition for substrates and collaboration for intermediates or removal of toxic substances are essential drivers for shaping a microbial community. Chapter 3 illustrates how the outcome of the aforementioned microbial competition can be influenced when one of the substrates (ammonium) is removed from the medium supply. In Chapter 4, a putative respiratory mechanism of the nitrate reduction coupled to anaerobic methane oxidation is presented. The genome based metabolic reconstruction provided important observations regarding energy conservation pathways and the electron transfer from cytoplasmic electron carriers to membrane bound nitrate reductase. Furthermore, the key question of methanogenic capability of anaerobic methanotrophic archaea (ANME) archaea of clade 2d was investigated. The identification of the acetyl-CoA synthetase (ACS), an enzyme needed for aceticlastic methanogenesis, suggested possible utilization of acetate by these freshwater methanotrophic archaea. Thus Chapter 5, focuses on the functional characterization of ACS in ANME-2d and ANME-2a archaea. This is the very first report of successful heterologous expression of ANME archaeal protein in E. coli. The in vitro activities of both ANME-2a and ANME-2d ACS enzymes revealed that acetate could be utilized by ANME-2 archaea. In Chapter 6, an overall summary of this thesis along with integration and future perspectives of each investigation are presented.
33 Arslan Arshad1, Paula Dalcin Martins2, Jeroen Frank1,3, Mike S. M. Jetten1,3,4, Huub J. M. Op den Camp1 and Cornelia U. Welte1,3*
1 Department of Microbiology, Institute for Water and Wetland Research, Radboud University, Nijmegen, The Netherlands 2 The Ohio State University, Department of Microbiology, USA 3 Soehngen Institute for Anaerobic Microbiology, Radboud University, Nijmegen, The Netherlands 4 Netherlands Earth Systems Science Center, Utrecht University, The Netherlands
* Address correspondence to Cornelia U. Welte, Department of Microbiology, Radboud University, Heyendaalseweg 135, 6525AJ Nijmegen, The Netherlands, [email protected], Telephone: +31 24 3652952
Environmental Microbiology (2017) doi: 10.1111/1462-2920.13977 Mimicking microbial interactions under nitrate-reducing conditions in an anoxic bioreactor: enrichment of novel Nitrospirae bacteria distantly related to Thermodesulfovibrio
2 CHAPTER 2
Originality-Significance Statement
In this study the microbial interactions in the nitrogen, sulfur and carbon cycles were investigated in an anoxic laboratory-scale bioreactor closely mimicking natural conditions. The fluxes of nitrogen, sulfur and methane could be attributed to distinct physiological groups by activity measurements, microscopy and metagenomics. Furthermore, several high quality draft genomes were recovered. Surprisingly, the most dominant member of the microbial community, amounting to 24% of total metagenome reads, represents a novel family within the phylum Nitrospira. It is only distantly related to cultured Thermodesulfovibrio species (87-89% 16S rRNA gene identity). Analysis of this draft genome revealed a versatile metabolic potential as well as broad environmental distribution of its family members.
Summary
Microorganisms are main drivers of the sulfur, nitrogen and carbon biogeochemical cycles. These element cycles are interconnected by the activity of different guilds in e.g. sediments or wastewater treatment systems. Here, we investigated a nitrate- reducing microbial community in a laboratory-scale bioreactor model that closely mimicked estuary or brackish sediment conditions. The bioreactor simultaneously consumed sulfide, methane and ammonium at the expense of nitrate. Ammonium oxidation occurred solely by the activity of anammox bacteria identified asCandidatus Scalindua brodae and Ca. Kuenenia stuttgartiensis. Fifty-three percent of methane oxidation was catalysed by archaea affiliated to Ca. Methanoperedens and 47% by Ca. Methylomirabilis bacteria. Sulfide oxidation was mainly shared between two proteobacterial groups. Interestingly, competition for nitrate did not lead to exclusion of one particular group. Metagenomic analysis showed that the most abundant taxonomic group was distantly related to Thermodesulfovibrio sp. (87-89% 16S rRNA gene identity, 52-54% average amino acid identity) representing a new family within the Nitrospirae phylum. A high quality draft genome of the new species was recovered and analysis showed high metabolic versatility. Related microbial groups are found in diverse environments with sulfur, nitrogen and methane cycling, indicating these novel Nitrospirae bacteria might contribute to biogeochemical cycling in natural habitats.
Keywords: DAMO, DNRA, ammonification, denitrification, methane oxidation, ANME, NC10, sulfide, Nitrospirae
36 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Introduction
The biogeochemical nitrogen, carbon and sulfur cycles are interdependent on each other, particularly through the activity of microorganisms exchanging metabolites belonging to different cycles (Falkowski et al., 2008). In estuary or coastal anoxic 2 sediments, reactive nitrogen compounds such as ammonium and nitrate discharged from agriculture can be present along with sulfide from the marine environment and methane from deeper methanogenic layers (Egger et al., 2015). Therefore, these ecosystems provide substrates for chemolithotrophic microorganisms involved in the nitrogen, carbon and sulfur cycles. Microorganisms that are capable of performing either partial or full denitrification can convert nitrate or nitrite to molecular nitrogen
(N2), thereby contributing to nitrogen loss from the ecosystem. Anammox bacteria + are capable of N2 production by the anaerobic oxidation of ammonium (NH4 ) with - nitrite (NO2 ) (van de Graaf et al., 1996). Nitrite is usually not supplied by agricultural discharge but produced during incomplete denitrification. In an estuary, coastal or brackish anoxic ecosystem, sulfide-dependent denitrification may release nitrite (Dong et al., 2000) or reduce nitrate completely to dinitrogen gas (Sorokin et al., 2008). Autotrophic sulfide-dependent denitrifiers have been found to supply nitrite to anammox bacteria in wastewater treatment plants (Mulder et al., 1995; van de Graaf et al., 1996) and this interaction might also occur in natural environments, e.g. marine oxygen minimum zones (Canfieldet al., 2010). Indeed, when the interaction of anammox bacteria with autotrophic sulfide-dependent denitrifiers was studied in enrichment cultures mimicking marine oxygen minimum zones, it was found that the latter group provided nitrite for the anammox reaction (Russ et al., 2014; Rios- Del Toro et al., 2016). Besides sulfide, methane can also be oxidized during partial denitrification. Such activity has been demonstrated for the recently discovered nitrate-reducing anaerobic methanotrophic archaea tentatively named Candidatus Methanoperedens nitroreducens (Raghoebarsing et al., 2006; Haroon et al., 2013). Furthermore, bacterial anaerobic methanotrophs belonging to the NC10 clade tentatively named Ca. Methylomirabilis oxyfera are capable of nitrite-dependent methane oxidation (Ettwig et al., 2010). They have been shown to co-exist with Ca. M. nitroreducens where they compete for methane but cooperate for nitrite removal (Haroon et al., 2013). On the other hand, Ca. M. oxyfera competes with anammox bacteria for their common substrate nitrite (Luesken et al., 2011; Shi et al., 2013). Under high electron donor to nitrogen ratios, nitrate may not be denitrified but instead be reduced to ammonium by a process termed dissimilatory nitrate reduction to ammonium (DNRA) (Kraft et al., 2011; van den Berg et al., 2015). Investigating
37 CHAPTER 2
such interactions between nitrogen-, sulfur-, and methane-cycling microorganisms is relevant not only to understand natural ecosystems where denitrification is coupled to sulfide and methane oxidation, but also to further develop the treatment of moderately saline wastewater produced by the pickling industry, in landfill leachate or through new technologies using sea water for toilet flushing (Xiao and Roberts, 2010). In this study, we investigated the interactions of chemolithoautotrophic microorganisms involved in the methane, nitrogen and sulfur biogeochemical cycles in an anoxic laboratory-scale bioreactor that mimicked estuary, coastal or brackish sediment nutrient conditions. We monitored the composition of the microbial community as well as their substrate turnover in the bioreactor over a period of 382 days with physiological assays, fluorescence in situ hybridization imaging and metagenome sequencing. We observed that cross-feeding of nitrite and competition for nitrate and methane occurred between anammox bacteria, autotrophic sulfide-dependent denitrifiers, and nitrate- and nitrite-dependent methanotrophs, respectively. Surprisingly, we discovered that the most abundant member of the microbial community, comprising more than 24% of total metagenome reads, was a previously uncultured microorganism distantly related to Thermodesulfovibrio species (87-89% 16S rRNA gene identity), representing a new family within the Nitrospirae phylum. A high quality draft genome was assembled and encoded complete respiratory pathways for oxygen, nitrate (DNRA and denitrification to
N2O), sulfate, dimethylsulfoxide and trimethylamine N-oxide, alongside the putative ability to use a wide range of electron donors, i.e. formate, lactate, sulfur, acetate, pyruvate, hydrogen and carbohydrates. Its environmental distribution indicates that this bacterial group is involved in nutrient turnover in a wide range of nitrogen and sulfur cycling ecosystems.
38 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Results
A denitrifying, methane-oxidizing and sulfide-oxidizing microbial community enriched in a laboratory-scale bioreactor system A laboratory-scale bioreactor system was inoculated with biomass from a marine 2 enrichment culture containing sulfide-dependent autotrophic denitrifiers and anammox bacteria (Russ et al., 2014), and mixed with biomass from a freshwater methane-oxidizing denitrification culture (Ettwig et al., 2016). The reactor received ammonium, nitrate, methane, and sulfide in a 1% NaCl mineral medium and was operated for 382 days. The reactor received 3 mmol nitrate and 1.4 mmol ammonium per day of which 2.3 mmol and 1.2 mmol were consumed, respectively. Further, the daily added 0.29 mmol sulfide was almost completely consumed by the microbial community as the residual amount of sulfide in the bioreactor was less than 0.3 µmol. Methane oxidation rates could not be determined in the continuous bioreactor as the consumption was relatively low compared to the added methane flux. The methane oxidation rates were therefore determined in the bioreactor under batch mode. No nitrite was added to the bioreactor so that nitrite-depending microorganisms had to completely rely on the partial conversion of nitrate to nitrite by other microorganisms in the community. The apparent amount of nitrite in the bioreactor was less than 3 µmol, indicating a near complete conversion of produced nitrite. Ammonium was consumed through the anammox process, which is the only known pathway to anaerobically oxidize ammonium. As a control, samples retrieved from the bioreactor were tested for aerobic ammonium oxidation activity in a respiratory chamber; however, no activity could be observed (data not shown). Therefore, all ammonium was assumed to be converted by anammox bacteria leading to average ammonium and nitrite consumptions rates of 1.2 and 1.5 mmol in 24 h in the 1.5 L working volume of the bioreactor, respectively. Additionally, nitrate is a by-product of the anammox metabolism (Strous et al., 1998) and thus about 0.3 mmol of nitrate would be recycled back into the system. Considering the additional nitrate produced by anammox, the net average nitrate consumption rate was 2.6, and not 2.3 mmol in 24 h. eventually, the remainder of the produced nitrite would be consumed by nitrite- dependent methanotrophs. Methane conversion rates were determined in batch mode of the bioreactor. During this test, no sulfide was added to the bioreactor so nitrate reduction would be exclusively dependent on anaerobic methane oxidizers. Heterotrophic denitrification was not tested as dead biomass would be the only organic carbon source for this process and, therefore, this activity was expected to be negligible. Reactor batch
39 CHAPTER 2
operation was started with 10% methane in the headspace, 10.95 mmol nitrate and 483 μmol ammonium. After 24 h of continuous batch operation, methane in the reactor headspace had decreased to 6.5% and nitrate to 7.65 mmol (Figure 1A, B), equalling a total consumption of 1.16 mmol methane and 2.2 mmol nitrate. Ammonium was already depleted after 12 h (Figure 1C), after which a low amount of nitrite (12 µmol) accumulated in the bioreactor.
Figure 1: Whole reactor batch activity assay. (A) Methane oxidation recorded over a period of 24h. (B) Consumption of nitrate during the batch experiment. (C) Anammox activity established through consumption of ammonium and nitrite. The samples were collected every 4h and measured in triplicates. Error bars represent standard deviation. The error bars in (A) and (B) are masked by the size of the data point.
Fluorescence in situ hybridization and metagenomics analysis of the biomass Molecular characterization of the microbial community in the reactor was performed through fluorescence in situ hybridization (FISH) on day 63 and day 258, and by metagenome sequencing on day 258. After 63 days, FISH analysis showed the presence of the nitrate- and nitrite-dependent anaerobic methane oxidizers Ca. Methanoperedens nitroreducens and Ca. Methylomirabilis oxyfera (Figure 2A). Furthermore, anammox bacteria as well as Sedimenticola sp., a gammaproteobacterial sulfide-dependent denitrifier, were detected (Figure 2B). After 258 days, Ca. M. nitroreducens, Ca. M. oxyfera (Figure 2C) and anammox bacteria could still be
40 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
detected (Figure 2F), whereas Sedimenticola sp. had disappeared (data not shown). Neither Sedimenticola-specific nor gammaproteobacterial probes resulted ina positive FISH signal. Instead, the betaproteobacterium Thiobacillus sp. (Figure 2D) and other betaproteobacteria (Figure 2E) had become abundant in the bioreactor. 2
Figure 2: Fluorescence in situ hybridization micrographs of the reactor biomass after 63 days (A, B) and 258 days (C, D, E, F). (A) Ca. M. nitroreducens visible in red (D-arch641-Cy3) and Ca. M. oxyfera in green (D-bact193-FLUOS). (B) Anammox bacteria visible in blue (Amx0820-Cy5), Sedimenticola sp. in green (GAM781-FLUOS) and Ca. M. oxyfera in red (D-bact193-Cy3). (C) Ca. M. nitroreducens visible in green (D-arch641-FLUOS) and Ca. M. oxyfera in red (D-bact193-Cy3). (D) Thiobacillus spp. visible in green (Betthio1001-FLUOS) and general bacteria visible in blue (Eub338 I-III-Cy5) (E) Betaproteobacteria visible in red (Bet42-Cy3), Ca. M. nitroreducens in green (D-arch641-FLUOS) and most bacteria labelled blue (Eub338 I-III-Cy5). (F) Anammox sp. visible in red (AMX368-Cy3). The scale bar represents 20 µm.
Microbial community composition was examined through 16S rRNA gene analyses, uploading metagenome reads in the SILVA database project tool (Figure 3A) and also by assembly and binning. This yielded 50 bins (Figure 3B), including seven high quality bins to which over 50% of all sequencing data mapped. In line with the FISH results, we were able to assign genome bins to Ca. M. nitroreducens, Ca. M. oxyfera and the anammox bacteria Ca. Kuenenia stuttgartiensis and Ca. Scalindua brodae. These genome bins contained key genes for archaeal anaerobic methanotrophy, bacterial methanotrophy and the anammox reaction (Supplementary Table 2) which have been described in detail elsewhere (Ettwig et al., 2010; van de Vossenberg et al., 2013; Arshad et al., 2015). It is interesting to note that Ca. M.
41 CHAPTER 2
nitroreducens only made up 2% of the microbial community according to 16S rRNA gene analyses (Figure 3A), which contrasts the higher abundances indicated in the FISH micrographs (Figure 2C). This may be due to DNA extraction biases that select against these archaea (Morono et al., 2009; Luo et al., 2014).
Figure 3: Metagenome analysis of the bioreactor after 258 days. (A) Percent of metagenome reads that mapped to 16S rRNA genes. a-d: 16S rRNA gene reads belonging to Phycisphaerae, Ca. M. nitroreducens, Deltaproteobacteria and Brocadiales were 1, 2, 2, and 4%, respectively. e-g: 16S rRNA reads associated with moderately abundant bacteria corresponded to Alphaproteobacteria (6%), Betaproteobacteria (6%), and Gammaproteobacteria (7%). h: 16% of the reads matched the Ca. M. oxyfera 16S rRNA, the second most abundant microorganism. i: 17% of the 16S rRNA reads belonged to the microorganisms related to Bacteroidetes, Acidobacteria, Chloroflexi and Gemmatimonadetes. j: 16S rRNA reads belonging to class Nitrospirae. (B) Microbial abundances based on percent of mapped metagenome reads highlights the enrichment of a new Nitrospirae organism (darker grey in contrast with others in light grey). Percent of metagenome reads (assembled into contigs) that mapped to reconstructed microbial genomes (bins) are shown. While 83.1% of reads mapped to bins, 16.9% of the reads mapped to unbinned contigs. The number of bins (“# bins”) in each category is indicated at the x-axis, while coverage (“x”), combined for each category, is displayed on top of each bar.
Additionally, we identified three genome bins that showed the potential for sulfide-dependent denitrification: two closely related to S. denitrificans and one affiliated within the alphaproteobacterial family Phyllobacteriaceae. The most abundant putative sulfur oxidizer had a 98.53% complete draft genome with 0.87% contamination and a S3 protein (RpsC) 82.6% similar to the one in Sulfuricella denitrificansskB26 (no 16S rRNA gene present). This genome revealed the presence of the complete sulfide oxidation and nitrate reduction pathways (Supplementary
42 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Table 3). In this bin we found the potential for sulfide conversion to elemental sulfur (S0) or sulfite either by sulfide quinone reductase (Sqr) or the dissimilatory sulfite reductase complex (encoded by dsrAB), respectively. Sulfite can be further oxidized to adenosine 5`-phosphate (APS) by APS reductase (Apr) and eventually to sulfate by 5`-triphosphate sulfurylase (Sat). The genome also encoded the Sox enzyme system 2 used for thiosulfate oxidation. Furthermore, genes encoding a complete denitrification pathway were present (Supplementary Table 3). Interestingly, a membrane bound NarGHI nitrate reductase most closely related to Thiohalomonas sp., T. denitrificans and Methylotenera mobilis, respectively, in addition to a periplasmic NapAB related to that from S. denitricans sKB26 and A. oryzae, respectively, were identified. A cytochrome cd1 nitrite reductase (NirS) and nitrous oxide reductase (NosZ), along with the nitric oxide reductase NorBC were also detected. Furthermore, this bin encoded the ammonium-forming nitrite reductase NirBD, which was most closely related to the corresponding subunits in Thiobacillus sp. and Thauera phenylacetica. In addition to that, we recovered a high quality genome bin (98.8% complete with 0.73% contamination) phylogenetically placed within the Xanthomonadaceae family (93% RpsC amino acid sequence similarity to Dyella koreensis). This organism was the third most abundant phylotype in the bioreactor (8.85% of the reads) and was likely involved in nitrogen cycling given the anoxic conditions in the bioreactor. An incomplete denitrification pathway to 2N O was identified based on the presence of a nitrate transporter, narGHI, nirKS, and norBC. We hypothesize that this organism may be involved in sulfide oxidation based on the presence of genes encoding a sulfide quinone oxidoreductase and two rhodanese-related sulfur transferases. No sulfur oxygenase reductase, ferredoxins, soluble HdrABC-type heterodisulfide reductases, or molybdopterin oxidoreductases were encoded so it is unclear what the final product of sulfide oxidation may be. Under oxic condition, this microorganism might use aerobic respiration as the draft genome encoded the aerobic electron transport chain including NADH dehydrogenase (nuoA-N), succinate dehydrogenase
(sdhABCD), cytochrome bc1 complex (ISP, cyt b, and cyt c1), and both aa3- and cbb3-type cytochrome c oxidases (cyoE and coxABCD, and subunits I, II, III, and IV, respectively). All genes in the central carbon metabolism for glycolysis, Entner- Doudoroff pathway, pentose phosphate pathway, citrate cycle, and glyoxylate shunt were identified.
43 CHAPTER 2
The most abundant community member in the bioreactor was a metabolically versatile novel species representing a new family within the Nitrospirae Surprisingly, the most abundant taxonomic group according to the metagenome data was related to previously uncultured microorganisms within the Nitrospirae distantly related to Thermodesulfovibrio sp. A high quality draft genome was obtained for this species through metagenome binning (100% complete, predicted contamination level of 4.98% based on a single-copy maker gene analysis (Parks et al., 2015)). Total genome coverage was 242x, amounting to 24% of total binned reads in the bioreactor metagenome. The genome contained some common features with Thermodesulfovibrio sp. (potential for sulfate reduction, electron donors hydrogen, formate and acetate) but also harboured new metabolic capabilities indicating a more versatile lifestyle than cultured Thermodesulfovibrio sp. and other Nitrospirae (Figure 4, Supplementary Table 4). We found that the genome encoded a full sulfate reduction pathway (Sat, AprAB, reductive DsrAB) as well as an enzyme system catalysing DNRA (NirBD, NrfAH) and a complete aerobic respiratory chain (NADH dehydrogenase, succinate dehydrogenase, cytochrome bc1 complex, cytochrome aa3 oxidase). Partial denitrification was also encoded (nitrate permease, NarGHI, NapAB, NorBC). Divergent NirK/NirS might be present: two ORFs (Node 192, gene 26, and Node 268, gene 29) were ~24-28% identical in amino acid sequence to reference NirK/NirS sequences. It has been suggested previously that divergent NirK proteins sharing only 10% sequence identity with reference proteins might still reduce nitrite to nitric oxide (Helen et al., 2016). However, experimental data are needed to confirm this hypothesis. Furthermore, the genome encoded the anaerobic respiratory enzymes trimethylamine N-oxide (TMAO) and dimethylsulfoxide (DMSO) reductase. As electron donors, the small organic acids acetate (presence of genes encoding acetyl-CoA synthetase), formate (genes encoding formate dehydrogenase FdoG/FdfH), pyruvate (7 copies of pyruvate water dikinase and pyruvate: ferredoxin oxidoreductase) and lactate (lactate dehydrogenase) might be used. We also identified 5 alcohol dehydrogenases and an aldehyde: ferredoxin oxidoreductase. Several hydrogenase gene clusters (hyf and hyb, including maturation system hyp) suggest the possibility of hydrogen uptake or production.
44 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2
Figure 4: Metabolic reconstruction of Nitrospirae phylum related bacteria based on a genome obtained from metagenomics data. The main respiratory and central carbon metabolism pathways are represented with focus on potential electron donors and acceptors. We have identified the electron transport chain for oxygen (SDH: succinate dehydrogenase/fumarate reductase; NuoA-N: NADH dehydrogenase; Q: quinone [quinone biosynthesis pathway];
Cyt bc1: Complex III; C: cytochrome c; Cyt c aa3: aa3-type terminal oxidase), nitrate (Per: nitrate permease; NarGHI: membrane-bound nitrate reductase; NirBD: cytoplasmic ammonium-forming nitrite reductase; NapAB: periplasmic nitrate reductase; NrfAH: membrane-bound ammonium-forming nitrite-reductase; NirKS: nitric oxide-forming nitrite reductase; NorBC: nitric oxide reductase), and for sulfate (Sat: sulfate adenylyltransferase; AprAB: adenosine 5’-phosphosulfate (APS) reductase; DsrAB: dissimilatory sulfite reductase). Candidate electron donors (printed in bold) include hydrogen, formate, acetate, alcohols, lactate, pyruvate, and glucose. AAs: amino acids; ACS: acetyl-coenzyme A synthetase; ADH: alcohol dehydrogenase; AFOR: aldehyde:ferredoxin oxidoreductase; ALDH: aldehyde dehydrogenase; FDH: formate dehydrogenase; LDH: lactate dehydrogenase; M/D/TMA: mono-, di-, and trimethylamines; NiFe Hyd: nickel-iron hydrogenases; PDH: pyruvate dehydrogenase; PEP: phosphoenolpyruvate; PFOR: pyruvate:ferredoxin oxidoreductase; PK: pyruvate phosphate dikinase; PW: pyruvate water dikinase; TCA: tricarboxylic acid cycle.
We did not find any indication for butyrate and propionate oxidation. Furthermore, we detected the genomic potential that these novel Nitrospirae bacteria are able to use simple carbohydrates based on a complete glycolysis pathway with the exception of aldolase, as well as a complete pentose phosphate pathway. Other potential electron donors are methyl groups. We found several subunits of different methyl transferases for methanol, mono-, di- and trimethylamine related to enzymes found in sulfate reducers, acetogens and methanogens. Even though neither methanol or methylamine dehydrogenases nor a complete methyl transferase operon was found, the abundance of individual subunits implicated in a methylotrophic lifestyle indicates that potentially methyl groups may be used as electron donors. The genome also
45 CHAPTER 2
encoded an (incomplete) tricarboxylic acid (TCA) cycle missing only the succinyl- CoA synthetase. No evidence was found for a reductive TCA cycle (no ATP-citrate lyase). Unlike Thermodesulfovibrio sp., the here presented draft genome encoded a complete Wood-Ljungdahl pathway for autotrophic carbon fixation.
Discussion
Competition and collaboration in the bioreactor reveal several major players in substrate turnover Competition for substrates and collaboration for providing intermediates or removal of toxic substances are key drivers for the shaping of microbial communities. We investigated the community dynamics and physiological activity of a microbial community under brackish conditions (1% NaCl) enriched in a laboratory-scale bioreactor supplied with mineral medium and nitrate, sulfide, ammonium, and methane. After one year of operation, a stable microbial community in the bioreactor metabolized all substrates and it was possible to attribute tentative removal rates to different physiological groups (Supplementary Figure 1). Nitrogen loss in the form of N2 was due to the activity of anammox bacteria (Equation 1), sulfide-dependent denitrifiers (Equation 2), and the combined activity of nitrate- and nitrite-dependent anaerobic methanotrophs (Equation 3). + - - Eq. 1 1 NH4 + 1.32 NO2 → 1.02N2 + 0.26 NO3 + 2 H2O - - + 2- Eq. 2 5 HS + 8 NO3 + 3 H → 5 SO4 + 4 N2 + 4 H2O - + Eq. 3 5 CH4 + 8 NO3 + 8 H → 4 N2 + 5 CO2 + 14 H2O Metagenome sequencing indicated that, about 27% from the total anammox-associated reads belonged to Ca. K. stuttgartiensis while remaining 73% could be recovered in the genome bin belonging to Ca. S. brodae. Anammox bacteria produced 1.22 mmol
N2 and the nitrite-dependent methanotrophs 0.86 mmol. For the sulfide-dependent denitrifiers, a maximal amount of 0.23 mmol N2 could be produced if all nitrate was reduced to N2; probably some nitrate was reduced to nitrite (or ammonium) thus diminishing the amount of N2 emitted by this physiological group. In total, this would amount to a maximum total nitrogen loss of 2.31 mmol N2, of which 53% were produced by anammox bacteria. The nitrite-dependent methane oxidizers Ca. M. oxyfera contributed to 37% of the total nitrogen loss, whereas the sulfide- dependent denitrifiers only contributed to about 10% of the nitrogen loss if all nitrate was reduced to N2. A previous study investigating the nitrogen loss in a bioreactor model that did not contain methane concluded that anammox accounted for 65-
46 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
75% and sulfide-dependent denitrifiers for 25-35% of the nitrogen loss (Russ et al., 2014). Our results clearly demonstrate that when methane is included as electron donor, methane-dependent denitrifiers are competitive and will start to contribute substantially to the overall nitrogen loss. Although the sulfide-dependent denitrifiers only cause a maximum of 10% of the N2 loss, they contribute significantly (31%) 2 in providing nitrite for anammox bacteria and nitrite-dependent methanotrophs Ca. M. oxyfera. The remaining 69% of nitrite is produced by the nitrate-dependent methanotrophs Ca. M. nitroreducens. Methane was oxidized to almost equal parts by Ca. M. oxyfera (53%) and Ca. M. nitroreducens (47%) as was evident from the methane oxidation rates under sulfide depletion in the batch reactor assays. Under these conditions, nitrate is reduced to nitrite exclusively by Ca. M. nitroreducens with stoichiometric methane oxidation according to Equation 4. - - Eq. 4 CH4 + 4 NO3 → CO2 + 4 NO2 + 2 H2O Ca. M. oxyfera is responsible for the remainder of the methane oxidation rate and nitrite reduction to N2 according to Equation 5: - + Eq. 5 3 CH4 + 8 NO2 + 8 H → 3 CO2 + 4 N2 + 10 H2O Besides competition and collaboration for substrates, the microbial community in the bioreactor was dependent on the removal of intermediates that could have a toxic effect. It has been noted previously that anammox bacteria are sensitive to sulfide stress (Russ et al., 2014) with a low IC50 of 10 µM. Therefore, anammox bacteria are dependent on the activity of sulfide-oxidizing microorganisms to keep the sulfide concentration below 1 µM. On the other hand, it seemed that sulfide stimulated the growth of Ca. M. nitroreducens, presumably through the maintenance of low redox potential and strictly anoxic conditions, as these methanotrophs rely on enzymes that are readily inactivated by oxygen.
First enrichment of novel Nitrospirae bacteria distantly related to Thermodesulfovibrio that are frequently found in environments with sulfur, nitrogen and methane cycling The most abundant microorganism according to metagenome sequencing in the present study was only distantly related to Thermodesulfovibrio (87-89% 16S rRNA gene identity) as the closest isolated representative and constituted about 24% of the microbial community based on the number of reads mapped to the draft genome. The metabolic reconstruction of this genome revealed the genomic potential for the use of a wide range of electron donors, i.e. hydrogen, pyruvate, lactate, acetate, and formate, as well as a complete pathway for oxygen, nitrate, sulfate, DMSO and TMAO respiration. Also, it harboured a complete Wood-Ljungdahl pathway for
47 CHAPTER 2
autotrophic CO2 fixation or acetate oxidation. This microorganism can therefore be viewed as versatile and probably facultative anaerobic, capable of either an organoheterotrophic or chemolithoautotrophic lifestyle. In the current bioreactor system, only ammonium, sulfide and methane were provided as electron donors. The Nitrospirae related genome encodes neither ammonium nor methane activating enzymes indicating that it probably does not metabolize these substrates. Sulfide might be used by the reverse reaction of the sulfate reduction pathway; however, when we analysed the phylogenetic relationship of the relevant DsrA protein encoded by these organisms, we noted that it falls into the sulfate-reducing and not the sulfide- oxidizing cluster, making it unlikely that these bacteria are able to oxidize sulfide with DsrAB. It has however recently been reported that a reductive-type DsrAB might be able to work in the oxidative direction (Thorup et al., 2017) but this result has not yet been biochemically validated. We did not find a sulfide quinone oxidoreductase that could complement this activity, making it unlikely that sulfide is used as an electron donor. It has recently been observed that sulfur oxidation or disproportionation can be coupled to DNRA (Mardanov et al., 2016; Slobodkina et al., 2017) but the genes involved are not yet clear. Provided that sulfur compounds more oxidized than sulfide are excreted by e.g. the proteobacterial sulfide oxidizers, these might be substrates for the Nitrospirae-related bacteria. Other compounds, e.g. hydrogen or methanol, may be intermediary products of methane oxidation that are potentially released into the medium, alongside electron donors that become available from the turnover of biomass. It is, however, difficult to imagine how leakage products could lead to such a high abundance of this taxonomic group in the bioreactor, even if DNA extraction biases are taken into consideration. When we analysed the nitrogen cycling metabolic potential of these bacteria, it was interesting to note that both redundancies and omissions in well-described pathways occurred. Nitrate could clearly be reduced to nitrite by either NarGHI or NapAB type nitrate reductases. We found NrfA which is the catalytically active subunit of the nitrite: ammonium oxidoreductase enabling DNRA, together with its membrane anchor NrfH (Simon et al., 2003). Interestingly, it was not clear if the genome lacked genes encoding the nitrite reductases NirS and NirK. The genome encoded a nitric oxide reductase (NorBC) for the reduction of NO to N2O. The NO reductase encoded by nosZ was missing in the genome. The presence of millimolar quantities of nitrate in the bioreactor makes it unlikely that sulfate reduction was occurring, as nitrate respiration will thermodynamically outcompete sulfate respiration. However, it has been observed that microorganisms do not always abide to this rule (Canfield et al., 2010; Chen et al., 2017; Dalsgaard and Bak, 1994), and simultaneous nitrate and
48 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
sulfate reduction cannot be excluded. In such a case, a cryptic sulfur cycle might be happening. Cryptic sulfur cycling has been previously found in marine oxygen minimum zones (Canfield et al., 2010) as well as terrestrial peat soils (Hausmann et al., 2016), freshwater sediments (Hansel et al., 2015), and sub-surface coal wells (Glombitza et al., 2016). Another possibility is that the Nitrospirae-related bacteria 2 disproportionate sulfur compounds, eliminating the need for a designated electron donor. Unfortunately, the disproportionation of sulfur compounds is highly complex and not yet fully understood and the involved genes are unknown (Finster et al., 1998; Frederiksen and Finster, 2003; Hardisty et al., 2013). Future research will target the isolation of these interesting microorganisms to study their physiology and possible role in the bioreactor. Additionally, taxonomic groups related to the Nitrospirae bacteria found in this bioreactor occur in a wide range of environments that are implicated in sulfur, nitrogen and methane cycling. Thermodesulfovibrio spp. are the closest cultured representatives of the here presented bacterial group with 87-89% rRNA gene identity (Figure 5). The phylogenetic tree topology was corroborated by a phylogenetic tree of 17 concatenated ribosomal protein sequences (Supplementary Figure 2) and an average amino acid identity (AAI) value of 52-53% (Supplementary Table 5). Taking these values together, this novel Nitrospirae microorganism presumably belongs to a new family within the phylum Nitrospirae. We propose the following naming: Candidatus Nitrobium versatile gen. nov., sp. nov. Ni.tro’bi.um. L. n. nitrogenium nitrogen; Gr. n. bios life. neut. n. Nitrobium a living entity metabolizing nitrogen compounds. Ca. N. versatile sp. nov. (ver.sa’ti.le L. adj. with a versatile metabolism). At the moment, all members of this phylum are classified as genera within the family Nitrospiraceae. Our data show that there are probably several distinct families to be defined within the family Nitrospiraceae. Therefore, the proposal of a new family within the phylum Nitrospirae would require a revision of the complete taxonomy within this order, even though our 16S rRNA gene identities and AAI values support the presence of a new family.
49 CHAPTER 2 from the phylum Nitrospina gracilis Nitrospina The 100 best BLAST hits (nucleotide similarity (nucleotide hits BLAST best 100 The rRNA rRNA gene from the Nitrospirae family bacterium were retrieved. Representative sequences from 40 different studies were selected along with 20 isolate Figure 5: Phylogenetic tree of sequences closely related to the novel Nitrospirae family bacterium enriched in this study. study. this in enriched bacterium family Nitrospirae novel the to related closely sequences of tree Phylogenetic 5: Figure > 90%) to the 16S reference sequences from the NCBI databases. All and sequences SILVA affiliate within the phylum Nitrospirae,in a new family clustering sequences putatively and environmental bacterium gene of the novel Nitrospirae family exceptbetween the 16S rRNA The sequence similarity Nitrospinae. the outgroup ranged from 91 to 95.5%.
50 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
A recent preprint article detected related microorganisms distantly related to Thermodesulfovibrio sp. in rice paddy microcosms that were amended with gypsum
(CaSO4·2H2O) and based on a metagenomics assembled genome tentatively named Ca. Sulfobium mesophilum (Zecchin et al., 2017). As this genome sequence is not yet publically available the exact phylogenetic affiliation needs to be resolved in 2 the future. We suggest to direct future efforts at resolving the taxonomic ambiguity within the phylum Nitrospirae. Physiological characteristics of the closely related and cultured Thermodesulfovibrio spp. are the ability to perform dissimilatory sulfate, sulfite and thiosulfate reduction with a limited set up electron donors, i.e. hydrogen, formate, pyruvate and lactate (Henry et al., 1994; Haouari et al., 2008; Sekiguchi et al., 2008; Frank et al., 2016). All of the current isolated Thermodesulfovibrio sp. are thermophiles whereas the enriched Nitrospirae-related bacteria grew at ambient temperature. Konno and colleagues detected Thermodesulfovibrio-like sequences (91-92% 16S rRNA gene identity) in freshwater aquifers in the terrestrial subsurface which is a very oligotrophic ecosystem (Konno et al., 2013). Lau et al. found Thermodesulfovibrio-like metagenome sequences in the South African continental crust under mesophilic conditions where biogeochemical cycling of nitrogen, sulfur and methane had been shown previously (Lau et al., 2014). Baker et al. investigated the genomic potential of a microbial community in estuary sediments (Baker et al., 2015). They were able to reconstruct environmental genomes harbouring the potential to contribute to the carbon, nitrogen and sulfur cycle. One of their environmental genomes was distantly related to Thermodesulfovibrio. That genome harboured the metabolic potential for some fermentative pathways, hydrogen production or consumption, and dissimilatory sulfate reduction. Interestingly, a recent amplicon sequencing survey of river sediments impacted by freshwater mussels discovered the co-occurrence of anammox bacteria, nitrate- and nitrite-dependent methanotrophs as well as Thermodesulfovibrio-like sequences (Black et al., 2017). Their survey did not target sulfide-dependent denitrifiers, but proteobacteria were abundantly present and could potentially be involved in nitrate-dependent sulfide oxidation. Especially these two studies by Black et al. and Baker et al. (Baker et al., 2015; Black et al., 2017) describe ecosystems that mirror the enrichment conditions in the here presented bioreactor: the interlinkage of sulfur, nitrogen and methane cycling leading to the enrichment of known and new players in these processes. Furthermore, we performed a database survey targeting environmental 16S rRNA gene sequences (Figure 5) related to those found in our novel Nitrospirae family bacterial genome. We found sequences that shared 91-95.5% identity to the one identified here in 40 different studies. Most notably, half of them originated from
51 CHAPTER 2
freshwater sediments (wetlands, rivers, lakes, reservoirs) and soils (peat, fen, paddies). Interestingly, 21% of environmental sequences were recovered from bioreactors or sediment slurries for the degradation of diverse compounds, while 14% of these sequences derived from the deep terrestrial subsurface. The ubiquitous distribution of members in this new Nitrospirae family highlights the potential role of such organisms in the biogeochemical cycles in diverse environments relevant for methane, sulfur, and nitrogen cycling.
Experimental procedures
Enrichment and reactor operation A 2.5 L bioreactor (Applikon, Delft, The Netherlands) with a working volume of 1.5 L was used for cultivation of the enrichment culture for a period of 382 days. It was operated at room temperature. The inoculum consisted of biomass from a marine enrichment culture containing sulfide-dependent autotrophic denitrifiers and anammox bacteria (Russ et al., 2014) and biomass from a freshwater methane- oxidizing denitrification culture (Ettwig et al., 2016). The reactor was operated at 150 rpm with a stirrer that contained two standard six-blade turbines. The flow of methane gas to the reactor was kept at 7.5 ml min-1 using a mass flow controller (Brooks Instrument, Ede, The Netherlands). Additionally, the bioreactor was constantly flushed with Ar/CO2 (95:5) to ensure anoxic conditions. The pH of the reactor liquid was monitored with a pH electrode (Applisens, Applikon, Delft, -1 The Netherlands) and was maintained at 7.1 with 100 g L KHCO3 solution. The pH pump was controlled by an ADI 1010 biocontroller (Applikon, Delft, The Netherlands). The mineral medium per liter contained 10 g coral pro salt (Red Sea),
7 mM NH4Cl, 15 mM NaNO3, 0.6 ml anammox specific trace element solution(van de Graaf et al., 1996) (15 g/L EDTA, 0.43 g/L ZnSO4 x7H2O, 0.24 g/L CoCl2x6H2O,
0.99 g/L MnCl2x4H2O, 0.25 g/L CuSO4x5H2O, 0.22 g/L Na2MoO4x2H2O, 0.2 g/L
NiCl2x6H2O, 0.067 g/L SeO2, 0.014 g/L H3BO3, 0.05 g/L Na2WO4x2H2O), 0.6 mL
FeSO4, 0.5 mL 100 g K2HPO4, 1.25 mL (288 mg/L) MgSO4, 1.25 mL (192 mg/l) CaCl2, and 1 mL trace element solution for DAMO microorganisms (0.5 g/L ZnSO4x7H2O,
0.12 g/L CoCl2x6H2O, 2 g/L CuSO4, 0.2 g/L NiCl2x6H2O, 0.014 g/L H3BO3, 0.3 g/L
MnCl2x4H2O, 0.04 g/L Na2WO4x2H2O, 0.2 g/L Na2MoO4x2H2O, 0.02 g/L SeO2, 0.8 g/L CeCl2). The 6.7 mM sulfide solution was provided as separate anaerobic medium with a flow rate 100 mL day-1. The nitrate and nitrite concentrations in the bioreactor were measured daily with MQuant™ colorimetric test strips (Merck, Darmstadt,
52 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Germany). Sulfide concentration was measured through acidification with 0.5M HCl and injecting the gas samples to a gas chromatograph (7890B GC systems, Agilent Technologies, Santa Clara, USA). The GC was equipped with a Carbopak BHT-100 column (60-80 mesh) and flame photometric detector (FPD). The injection and detection temperature was 200ºC and the oven temperature was 80ºC. 2
Whole culture batch activity assays To measure methane consumption, medium and gas supplies were stopped and headspace methane concentration decreased to ca. 10% by flushing with Ar/CO2 (95:5). The methane concentration was then measured every 4 h for a period of 24 h. At each sampling time, headspace gas samples of 100 µl were withdrawn with a gas tight glass syringe (Hamilton, Switzerland) and immediately measured through a HP 5890 gas chromatograph equipped with a Porapak Q column (80/100 mesh) and flame ionization detector (Hewlett Packard, USA). The injection and detection temperature was 150ºC and the oven temperature was 120ºC. Final methane concentrations were calculated through calibration gas and self-made standards. Additionally, 2 ml liquid sample was centrifuged and supernatant stored at ‑20ºC for determination of nitrogenous compounds. Nitrite was measured colorimetrically at 540 nm after a 15 min-reaction of 1 ml sample (0.05-0.5 mM nitrite) with 1 ml 1% sulfanilic acid in 1 M HCl and 1 ml 0.1% naphtylethylene diaminedihydrochloride (Griess, 1879). Ammonium was measured at 420 nm on a 96 well fluorescence spectrophotometer after reaction with 10% ortho-phthaldialdehyde as described previously (Taylor et al., 1974). Nitrate was measured with a Sievers Nitric Oxide analyzer (NOA280i, GE Power&Water technologies, USA). The sample measurements were carried out in duplicates.
Metagenome sequencing and analysis On day 258, 150 mL biomass for genomic DNA extraction was sampled from the bioreactor, homogenized in a glass homogenizer to disrupt granules, and DNA was extracted with two different extraction methods in triplicate, the FastDNA Spin Kit (MP Biomedicals, Santa Ana California, USA) and the cetyltrimethylammoniumbromide (CTAB) method (Zhou et al., 1996). DNA was quantified with the Qubit Fluorometer (Thermo Fisher Scientific, Waltham, USA). DNA (1 ng) from both extraction methods was used for MiSeq library preparation. The genomic DNA was sheared and adapters were ligated in the same step. The Illumina Nextera® XT Library Prep Kit was used according to the manufacturer’s instructions (Illumina, San Diego, USA). The library was normalized to 4 nM and sequencing was performed with an
53 CHAPTER 2
Illumina MiSeq (Illumina, San Diego, USA) using the 300 paired-end sequencing protocol. Quality-trimming, adapter removal and contaminant-filtering of paired- end sequencing reads was performed using BBDUK (BBTOOLS version 37.17) (Bushnell, 2015). The Fast Spin DNA extraction kit and CTAB method yielded 10.8 and 7.8 million trimmed reads >150 bp, respectively. Reads obtained from both DNA extractions were co-assembled with metaSPAdes v3.10.1 (Nurk et al., 2017) using default settings. MetaSPAdes iteratively assembled the metagenome using kmer sizes 21, 33, 55, 77, 99 and 127. Reads were mapped back to the metagenome for each extraction separately using Burrows-Wheeler Aligner 0.7.15 (Li and Durbin, 2010) (BWA), employing the “mem” algorithm. The generated sequence mapping files were handled and converted as needed using SAMtools 2.1 (Li et al., 2009). Metagenome binning was performed employing five different binning algorithms: BinSanity v0.2.5.9 (Graham et al., 2017), COCACOLA (Lu et al., 2016), CONCOCT (Alneberg et al., 2014), MaxBin 2.0 2.2.3 (Wu et al., 2016) and MetaBAT 2 2.10.2 (Kang et al., 2015). The five resulting bin sets were supplied to DAS Tool 1.0(Sieber, 2017) for consensus binning to obtain the final optimized bins. The quality of the consensus bins was assessed using CheckM 1.0.7 (Parks et al., 2015). From ~18 million trimmed, quality controlled metagenome reads, 93.9% were assembled into contigs, 82.8% mapped to contigs, and 78% mapped to binned contigs. Genes were called and annotated as previously described by (Wrighton et al., 2012) with a pipeline available online (https://github.com/TheWrightonLab/ metagenome_annotation). Briefly, genes were called with Prodigal (Hyatt et al., 2010) and annotated based on forward and reverse blast hits to amino acid sequences in UniRef90 (http://www. uniprot.org/help/uniref) and KEGG (http://www.genome.jp/kegg/). Thresholds for reciprocal best blast matches were a minimum 300 bit score and, for one- way blast matches, a minimum 60 bit score. Motifs were also analysed using InterproScan. Complete or partial 16S rRNA genes in bins were identified with SSU-Align (Nawrocki, 2009). The 16S rRNA gene of the novel Nitrospirae phylum bacterium was completed by two cycles of stringent mapping and elongation of the contigs obtained after assembly of all 16S rRNA gene reads extracted from the metagenome. The metagenome data are available at NCBI under accession number (PRJNA397647). For the biogeography, the complete 16S rRNA gene in the Nitrospirae bin was blasted on NCBI (https://www.ncbi.nlm.nih.gov/). The first 100 best hits were further analysed for similarity, sample type and country of origin. For phylogenetic trees, sequences (nucleotide or amino acid, as indicated in each figure) were aligned with MUSCLE (Edgar, 2004). The biogeography 16S rRNA gene tree
54 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
was built on an alignment containing 1,651 positions using FastTree (Price et al., 2010) with 100 bootstraps. For the concatenated ribosomal protein tree, 17 ribosomal proteins (L1, L2, L3, L4, L5, L6, L14, L15, L16, L19, L20, L24, S3, S8, S11, S13, and S19) were identified using hmmsearch (-E 0.00001) (Johnson et al., 2010) and independently aligned. Alignment columns with 95% gaps were stripped and then 2 concatenated in Geneious v. 9.0.5 (Kearse et al., 2012), generating an alignment with 3,304 positions. This tree was built using RAxML v. 8.2.9 with 100 bootstraps under the LG model of evolution on a pipeline available online at https://github.com/ TheWrightonLab/Protpipeliner as previously described (Solden et al., 2017). Trees were visualized with iToL (Letunic and Bork, 2016). Reference sequences in these trees were retrieved from NCBI or SILVA (https://www.arb-silva.de/). Plots were made in R (Team, 2017), and all figures were edited in Adobe Illustrator version 16.0.0 (Adobe Systems Inc., San Jose, USA). Average Amino Acid Identity (AAI) values were calculated using the Kostas lab tool available at http://enve-omics. ce.gatech.edu/g-matrix/.
Fluorescence in situ hybridization (FISH) Biomass samples were taken after 63 and 258 days and prepared as previously described (Russ et al., 2014). FISH was performed as described by Amann et al. (1990) using a hybridization buffer containing either 30% or 20% (v/v) formamide. Specifications and the details of the probes used in this study are provided in Supplementary Table 1. For image acquisition, a Zeiss Axioplan 2 epifluorescence microscope equipped with a CCD camera was used together with the Axiovision software package (Zeiss, Germany). Vectashield mounting fluid with DAPI (4,6-diamidino-2-phenylindole) was used on all samples to stain all DNA.
Acknowledgements
The authors are thankful to Kelly Wrighton, Michael Wilkins, and Sebastian Lücker for metagenomics and bioinformatics support, as well as Theo van Alen for technical assistance. Furthermore, financial support from the Nederlandse Organisatie voor Wetenschappelijk Onderzoek through the SIAM Gravitation Grant 024.002.002 and the NESSC Gravitation Grant 024.002.001 is thankfully acknowledged. MSMJ and AA were supported by the ERC AG EcoMoM 339880. HOdC was supported by ERC AG Volcano 669371. The funding agencies had no role in study design, data collecti- on and interpretation, or the decision to submit the work for publication.
55 CHAPTER 2
Supplementary materials
Supplementary Figure 1: Schematic overview of the contribution of individual microorganisms to elemental cycling in the bioreactor. Please see the main text for explanation and details.
56 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 The topology was the same as found in 16S Maximum Likelihood phylogenetic tree using 17 concatenated ribosomal protein sequences. Supplementary Figure 2: Supplementary Figure gene tree. rRNA
57 CHAPTER 2 Formamide 30-20 % 30% 30% 30% 20% 20% 35% 35% , 2006) , 2006)
et al. et al. , 2000) , 2001) , 2006) , 1999) , 1992) , 1992) et al. et al. et al. et al. et al. et al. Reference (Daims (Manz (Manz (Haaijer (Schmid (Schmid (Raghoebarsing (Raghoebarsing Label Cy5 Cy3 FLUOS FLUOS Cy3 Cy5 Cy3 FLUOS sp. . K. stuttgartiensis . M. oxyfera . M. nitroreducens Specifity Most bacteria Betaproteobacteria Gammaproteobacteria Thiobacillus Anammox sp. Ca Ca Ca : Overview of the FISH probes used to target specific microbial groups : Overview of the FISH probes used to target Sequence (5’- 3‘) GCTGCCTCCCGTAGGAGT GCCTTCCCACTTCGTTT GCCTTCCCACATCGTTT CTTAGCACGTCATTTGGGACC CCTTTCGGGCATTGCGAA AAAACCCCTCTACTTAGTGCCC CGCTCGCCCCCTTTGGTC GGTCCCAAGCCTACCAGT Name Eub338 I-III Bet42a Gam42a Betthio1001 Amx368 Amx820 D-bact-193 D-arch-641 Supplementary Table 1 Supplementary Table
58 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Supplementary Table 2: Comparison of genome bins obtained from the laboratory-scale bioreactor fed with ammonium, sulfide, nitrate and methane with previously published genome sequences identified by the locus identifier and gene annotation.MO, MN, A1, A3: respective genome bin; NODE: contig number; length: contig length; cov: contig coverage; last underscore followed by digit: gene number. Enzyme Gene Locus identifier Ca. Methylomirabilis sp. Nitrate reductase narG MO_NODE_133_length_85954_cov_104.672_0008 2 narH MO_NODE_133_length_85954_cov_104.672_0010 narJ MO_NODE_133_length_85954_cov_104.672_0011 narI MO_NODE_133_length_85954_cov_104.672_0012
Periplasmic nitrate reductase napA MO_NODE_482_length_33997_cov_97.9171_0041 napB MO_NODE_482_length_33997_cov_97.9171_0040
Nitrite reductase nirS MO_NODE_482_length_33997_cov_97.9171_0044 nirJ MO_NODE_482_length_33997_cov_97.9171_0043 nirF MO_NODE_482_length_33997_cov_97.9171_0042 fused nirD/G & nirH/L MO_NODE_482_length_33997_cov_97.9171_0039
Nitric oxide reductase norZ1 MO_NODE_51_length_155591_cov_105.671_0133 norZ2 MO_NODE_773_length_22646_cov_85.0923_0009 norZ3 MO_NODE_773_length_22646_cov_85.0923_0011
Nitrous oxide reductase nosL MO_NODE_51_length_155591_cov_105.671_0084
Methane monooxygenase pmoA1 MO_NODE_773_length_22646_cov_85.0923_0001 pmoB1 pmoC1 MO_NODE_773_length_22646_cov_85.0923_0002 MO_NODE_374_length_40993_cov_102.336_0036
Ca. Methanoperedens sp. Nitrate reductase narG MN_NODE_72_length_129713_cov_13.8014_0041 narH MN_NODE_72_length_129713_cov_13.8014_0042 narJ MN_NODE_72_length_129713_cov_13.8014_0043 Orf7 MN_NODE_72_length_129713_cov_13.8014_0044 HCO II MN_NODE_72_length_129713_cov_13.8014_0045 NapH MN_NODE_72_length_129713_cov_13.8014_0046 HCO II MN_NODE_72_length_129713_cov_13.8014_0047
Methyl coenzyme-M mcrA MN_NODE_418_length_38049_cov_8.11492_0024 reductase mcrB MN_NODE_418_length_38049_cov_8.11492_0021 mcrG MN_NODE_418_length_38049_cov_8.11492_0023 mcrC MN_NODE_418_length_38049_cov_8.11492_0022
59 CHAPTER 2
Methenyl-H4MPT mch_1 MN_NODE_212_length_61779_cov_8.43783_0016 cyclohydrolase mch_2 MN_NODE_2486_length_8343_cov_8.54272_0009
Methylene-H4MPT reductase mer MN_NODE_95_length_110750_cov_8.29821_0019
Methylene H4MPT mtd MN_NODE_503_length_33150_cov_8.59089_0023 dehydrogenase
H4MPT S-methyltransferase mtrH MN_NODE_477_length_34189_cov_8.53931_0038 mtrG MN_NODE_477_length_34189_cov_8.53931_0037 mtrF MN_NODE_477_length_34189_cov_8.53931_0036 mtrA MN_NODE_477_length_34189_cov_8.53931_0035 mtrA MN_NODE_72_length_129713_cov_13.8014_0097 mtrB MN_NODE_477_length_34189_cov_8.53931_0034 mtrC MN_NODE_477_length_34189_cov_8.53931_0033 Tungsten formyl-MFR mtrD MN_NODE_477_length_34189_cov_8.53931_0032 dehydrogenase mtrE MN_NODE_477_length_34189_cov_8.53931_0031
Molybdenum formyl-MFR fwdD MN_NODE_359_length_43084_cov_7.70445_0019 dehydrogenase fwdB MN_NODE_359_length_43084_cov_7.70445_0020 fwdG MN_NODE_359_length_43084_cov_7.70445_0021 fmdA MN_NODE_418_length_38049_cov_8.11492_0008 fmdB MN_NODE_418_length_38049_cov_8.11492_0007 fmdD MN_NODE_418_length_38049_cov_8.11492_0006 fmdE1 MN_NODE_72_length_129713_cov_13.8014_0052 fmdE2 MN_NODE_142_length_83068_cov_8.62489_0036 fmdC MN_NODE_418_length_38049_cov_8.11492_0009
Formyl-MFR H4MPT ftr MN_NODE_1682_length_11726_cov_7.04552_0005 transferase Ca. Scalindua brodae Hydrazine synthase hzsA A1_NODE_833_length_21377_cov_15.3185_0015 hzsBC A1_NODE_833_length_21377_cov_15.3185_0016
Hydrazine hydrolase hdh A1_NODE_304_length_47790_cov_14.7889_0044
Nitrite oxidoreductase nxrA A1_NODE_12_length_270402_cov_12.653_0038 nxrB A1_NODE_12_length_270402_cov_12.653_0042 nxrC A1_NODE_12_length_270402_cov_12.653_0043
Nitrite reductase nirS A1_NODE_65_length_139106_cov_13.2364_0030
Nitrite extrusion protein nark A1_NODE_294_length_48537_cov_12.4514_0007
Nitrite transporter focA A1_NODE_39_length_167139_cov_14.0435_0144
60 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
Ca. Kuenenia stuttgartiensis Hydrazine synthase hzsA Not binned hzsBC Not binned
Nitrite reductase nirS A3_NODE_3664_length_6029_cov_4.94815_0001
Nitrate reductase narG A3_NODE_608_length_28001_cov_5.34649_0015 2 narH A3_NODE_608_length_28001_cov_5.34649_0012
Nitrite extrusion protein narK A3_NODE_1151_length_16256_cov_5.4748_0012
Nitrite transporter focA A3_NODE_282_length_49931_cov_5.83449_0007 focA A3_NODE_282_length_49931_cov_5.83449_0006 focA A3_NODE_1534_length_12554_cov_6.4001_0001
61 CHAPTER 2 (84.9%) (83.2%) (81.2%) (78.4%) (84.6%) (75.6%) (52.9%) (69%) (77%) (86.6%) (88.1%) (78%) (94.5%) (84.2%) (74.8 %) (49.9%) (71.8%) (84%) sp. (81%) sp. (84%) sp. (81%) Blast hit (% identity) S. denitrificans S. denitrificans S. denitrificans S. denitrificans S. denitrificans Rubrivivax S. denitrificans S. denitrificans Sulfuricella S. denitrificans denitrificans T. S. denitrificans denitrificans T. S. denitrificans S. denitrificans S. denitrificans S. denitrificans Sulfuricella S. denitrificans S. denitrificans S. denitrificans skB26. The genome coverage was 28 times, with . Sulfuricella denitrificans Protein subunit Protein A (HdrA) Heterodisulfide reductase subunit A (HdrA) Heterodisulfide reductase subunit Heterodisulfide reductase subunit C (HdrC) Heterodisulfide reductase subunit B (HdrB) Sulfide-quinone reductase (Sqr) Dissimilatory sulfite reductase gamma subunit (DsrC) Sulfide dehydrogenase (SoxF) Cytochrome c553 (SoxE) Dissimilatory sulfite reductase gamma subunit (DsrC) Thioredoxin-related protein-like protein (SoxW) Dissimilatory sulfite reductase gamma subunit (DsrC) Dissimilatory sulfite reductase alpha subunit (DsrA) Dissimilatory sulfite reductase alpha subunit (DsrB) Sulfur relay protein (DsrE) Sulfur relay protein (DsrF) Sulfur relay protein (DsrH) Dissimilatory sulfite reductase gamma subunit (DsrC) Sulfur relay protein (DsrM) Reductase, iron-sulfur binding subunit (DsrK) Glutamate synthase (NADPH) small subunit (DsrL) Sulfur relay protein (DsrJ) most abundant organism. pSox1: putative sulfur oxidizer number 1; NODE: contig number; length: contig number 1; NODE: contig number; length: sulfur oxidizer pSox1: putative most abundant organism. th Analysis of a reconstructed genome (bin das_tool.binsanity.asm_contigs_metaspades_gt1500-bin_1-refined_1.fa or pSox1_ANNOTATED_ Sulfur metabolism loci identifier Sulfur pSox1_NODE_6_length_345834_cov_13.6869_0110 pSox1_NODE_6_length_345834_cov_13.6869_0111 pSox1_NODE_6_length_345834_cov_13.6869_0112 pSox1_NODE_6_length_345834_cov_13.6869_0113 pSox1_NODE_11_length_273096_cov_13.8588_0112 pSox1_NODE_11_length_273096_cov_13.8588_0121 pSox1_NODE_11_length_273096_cov_13.8588_0198 pSox1_NODE_11_length_273096_cov_13.8588_0199 pSox1_NODE_11_length_273096_cov_13.8588_0204 pSox1_NODE_11_length_273096_cov_13.8588_0217 pSox1_NODE_15_length_257136_cov_13.092_0042 pSox1_NODE_15_length_257136_cov_13.092_0044 pSox1_NODE_15_length_257136_cov_13.092_0045 pSox1_NODE_15_length_257136_cov_13.092_0046 pSox1_NODE_15_length_257136_cov_13.092_0047 pSox1_NODE_15_length_257136_cov_13.092_0048 pSox1_NODE_15_length_257136_cov_13.092_0049 pSox1_NODE_15_length_257136_cov_13.092_0050 pSox1_NODE_15_length_257136_cov_13.092_0051 pSox1_NODE_15_length_257136_cov_13.092_0052 pSox1_NODE_15_length_257136_cov_13.092_0053 Supplementary Table 3: contigs_1000.genes.fna) with metabolic potential for sulfur oxidation and nitrate reduction. This genome is 98.53% complete with 0.87% of contamination as estimated by analysis of single copy marker genes. The S3 ribosomal protein was 82.6% similar to the one in 1.98% of assembled reads mapping to this bin, making it the 7 length; cov: contig coverage; last underscore followed by digit: gene number; % identity: amino acid percent similarity
62 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor %) 64.6 (75.1%) (71.1%) (67.3%) (65.5%) (64.7%) (90.8%) ( (66%) (54.8%) (82.1%) (70.9%) (81.4%) (52.8%) (69.6%) (52.1%) (58%) sp. (66%) sp. (89%) sp. (82%) sp. (90%) sp. (92%) (41.9%) 2 (66%) (75%) S. denitrificans S. denitrificans S. denitrificans S. denitrificans S. denitrificans S. denitrificans Sulfuricella Sulfuricella drewsii T. drewsii T. S. denitrificans S. denitrificans S. denitrificans Thiobacillus Thiobacillus Thiobacillus S. denitrificans denitrificans T. S. denitrificans S. denitrificans S. denitrificans S. denitrificans S. denitrificans R. marinus DsrN) DsrR) Ferredoxin iron-sulfur binding domain protein (DsrO) Polysulfide reductase (DsrP) Sulfur relay protein ( Sulfur relay protein ( Sulfur oxidation protein (SoxH) Sulfate adenylyltransferase (Sat) Adenylylsulfate reductase subunit beta (AprB) Adenylylsulfate reductase subunit alpha (AprA) Polysulfide reductase (NrfD) Iron-sulfur binding domain-containing protein (NrfC) Cytochrome c oxidase (SoxE) Cytochrome c class I (SoxE) Protein involved in sulfur oxidation (DsrS) Adenylylsulfate reductase membrane anchor (aprM) Adenylylsulfate reductase subunit beta (AprB) Adenylylsulfate reductase subunit alpha (AprA) Sulfate thiol esterase (SoxB) Diheme cytochrome (SoxA) Sulfur oxidation protein (SoxZ) protein (SoxY) Transmembrane Cytochrome C class I (SoxX) Beta lactamase (SoxH) Dissimilatory sulfite reductase gamma subunit (DsrC) Sulfate adenylyltransferase (Sat) pSox1_NODE_15_length_257136_cov_13.092_0054 pSox1_NODE_15_length_257136_cov_13.092_0055 pSox1_NODE_15_length_257136_cov_13.092_0056 pSox1_NODE_15_length_257136_cov_13.092_0057 pSox1_NODE_15_length_257136_cov_13.092_0179 pSox1_NODE_21_length_213610_cov_13.1922_0015 pSox1_NODE_21_length_213610_cov_13.1922_0016 pSox1_NODE_21_length_213610_cov_13.1922_0017 pSox1_NODE_21_length_213610_cov_13.1922_0160 pSox1_NODE_21_length_213610_cov_13.1922_0161 pSox1_NODE_25_length_190517_cov_14.1198_0160 pSox1_NODE_25_length_190517_cov_14.1198_0163 pSox1_NODE_25_length_190517_cov_14.1198_0165 pSox1_NODE_26_length_183268_cov_13.5706_0004 pSox1_NODE_26_length_183268_cov_13.5706_0005 pSox1_NODE_26_length_183268_cov_13.5706_0006 pSox1_NODE_34_length_176386_cov_14.356_0132 pSox1_NODE_34_length_176386_cov_14.356_0133 pSox1_NODE_34_length_176386_cov_14.356_0134 pSox1_NODE_34_length_176386_cov_14.356_0135 pSox1_NODE_34_length_176386_cov_14.356_0136 pSox1_NODE_55_length_151951_cov_14.1099_0067 pSox1_NODE_89_length_118088_cov_13.7997_0079 pSox1_NODE_128_length_87608_cov_14.0674_0079
63 CHAPTER 2 (92 %) (87.9%) (89.8%) (63.1 %) sp. (75.4%) (77.9%) (83%) (46.2%) (83%) (78.7%) (63.6 %) (89.8 %) (85.2 %) (68.4 %) (87.7 %) (87.5 %) sp. (78.1%) sp. (85 %) (66.4 %) (62.1 %) (80.1 %) (60%) (60%) (72.6%) oryzae oryzae oryzae Blast hit (% identity) S. lithotrophicus S. lithotrophicus A. S. denitrificans S. denitrificans S. denitrificans S. denitrificans S. denitrificans A. S. denitrificans S. denitrificans A. S. denitrificans S. denitrificans S. denitrificans S. denitrificans phenylacetica T. Thiobacillus M. mobilis M. mobilis denitrificans T. Thiohalomonas Thiobacillus M. mobilis Protein subunit Protein Nitric oxide reductase subunit C (NorC) Nitric oxide reductase subunit B (NorB) Nitrate reductase (NapB) Quinol dehydrogenase membrane component (NapH) Quinol dehydrogenase periplasmic component(NapG) Nitrate reductase (NapA) Nitrate reductase biosynthesis protein (NapD) Nitrite reductase precursor (NapG) Cytochrome c-type protein (NapC) Nitrite reductase (NirS) Protein (NosL) Ferredoxin-type protein (NapH) Nitrous-oxide reductase (NosZ) Nitric oxide reductase activation protein (NorQ) Nitric oxide reductase activation protein (NorD) Nitrate transporter (Ntr) Nitrite reductase small subunit (NirD) subunit (NirB) Nitrite reductase large Respiratory nitrate reductase subunit gamma (NarI) Respiratory nitrate reductase subunit delta (NarJ) Respiratory nitrate reductase subunit beta (NarH) Respiratory nitrate reductase subunit alpha (NarG) Nitrate/nitrite antiporter (NarK) Nitrate/nitrite antiporter (NarK) Nitrogen metabolism loci identifier Nitrogen pSox1_NODE_11_length_273096_cov_13.8588_0237 pSox1_NODE_11_length_273096_cov_13.8588_0238 pSox1_NODE_15_length_257136_cov_13.092_0213 pSox1_NODE_15_length_257136_cov_13.092_0214 pSox1_NODE_15_length_257136_cov_13.092_0215 pSox1_NODE_15_length_257136_cov_13.092_0216 pSox1_NODE_15_length_257136_cov_13.092_0217 pSox1_NODE_15_length_257136_cov_13.092_0218 pSox1_NODE_15_length_257136_cov_13.092_0219 pSox1_NODE_15_length_257136_cov_13.092_0229 pSox1_NODE_15_length_257136_cov_13.092_0249 pSox1_NODE_15_length_257136_cov_13.092_0251 pSox1_NODE_15_length_257136_cov_13.092_0257 pSox1_NODE_21_length_213610_cov_13.1922_0019 pSox1_NODE_21_length_213610_cov_13.1922_0020 pSox1_NODE_21_length_213610_cov_13.1922_0022 pSox1_NODE_21_length_213610_cov_13.1922_0025 pSox1_NODE_21_length_213610_cov_13.1922_0026 pSox1_NODE_21_length_213610_cov_13.1922_0139 pSox1_NODE_21_length_213610_cov_13.1922_0140 pSox1_NODE_21_length_213610_cov_13.1922_0141 pSox1_NODE_21_length_213610_cov_13.1922_0142 pSox1_NODE_21_length_213610_cov_13.1922_0143 pSox1_NODE_21_length_213610_cov_13.1922_0144
64 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 % identity S. denitrificans skB26 85 77 81 87 88 78 95 85 85 100 44 75 71 -- 63 79 64 53 79 82 55 skB26. % identity to both strains both to identity % skB26. Sulfuricella denitrificans Sulfuricella % identity denitrificans T. 25259) (ATCC 81 74 84 78 74 56 82 72 76 65 49 66 62 -- 51 66 59 ------44 (ATCC 25259) or 25259) (ATCC Thiobacillus denitrificans Thiobacillus Protein subunit Protein Sulfide-quinone reductase Sqr Dissimilatory sulfite reductase alpha subunit DsrA Dissimilatory sulfite reductase alpha subunit DsrB TusD/DsrE Sulfur relay protein TusC/DsrF Sulfur relay protein TusB/DsrH Sulfur relay protein TusE/DsrC Sulfur relay protein TusE/DsrM Sulfur relay protein Reductase iron-sulfur binding subunit/DsrK Glutamate synthase (NADPH) small subunit/DsrL Hypothetical protein/DsrJ Ferredoxin iron-sulfur binding domain protein/DsrO Polysulfide reductase NrfD/DsrP Cobyrinat a,c-diamide synthase/DsrN protein/DsrR HesB/YadR/YfhF-family TusE/DsrC Sulfur relay protein TusE/DsrC Sulfur relay protein TusE/DsrC Sulfur relay protein TusE/DsrC Sulfur relay protein DsrE family protein Sulfur oxidation protein DsrS The analysis targeted at the presence of key enzymes involved in nitrogen and sulfur metabolism. The derived amino acid sequence of the Comparison of the genome bin potentially belonging to a sulfide-dependent denitrifier obtained from the lab-scale bioreactor fed with ammonium,
Sulfide oxidation DFBLFAKA_01496 Dissimilatory sulfate reduction/oxidation DFBLFAKA_00071 DFBLFAKA_00072 DFBLFAKA_00073 DFBLFAKA_00074 DFBLFAKA_00075 DFBLFAKA_00076 DFBLFAKA_00077 DFBLFAKA_00078 DFBLFAKA_00079 DFBLFAKA_00080 DFBLFAKA_00081 DFBLFAKA_00082 --- DFBLFAKA_00086 DFBLFAKA_02873 DFBLFAKA_00069 DFBLFAKA_00740 DFBLFAKA_01486 DFBLFAKA_00838 DFBLFAKA_01195 Supplementary Table 3: Supplementary Table sulfide, nitrate and methane. in found proteins either to identity highest showed enzymes respective are indicated; please note that not all proteins found encoded in the here presented genome bin had a homologue both genomes.
65 CHAPTER 2 91 91 90 53 100 71 60 82 56 76 65 66 83 54 71 69 74 50 83 85 81 78 90 89 85 52 69 72 61 78 -- -- 63 51 -- -- 64 35 59 43 80 72 69 75 Sulfate adenylyltransferase Sat AprA Adenylylsulfate reductase alpha subunit AprB Adenylylsulfate reductase beta subunit Sulfur oxidizing protein SoxX Sulfur oxidizing transmembrane protein SoxY Sulfur oxidizing protein SoxZ Sulfur oxidizing protein SoxA Sulfur oxidizing protein SoxB SoxE Sulfide dehydrogenase flavoprotein subunit SoxF SoxE SoxE SoxE SoxK Beta lactamase SoxH Beta lactamase SoxH Thioredoxin related protein SoxW SoxW A1 Heterodisulfide reductase subunit A2 Heterodisulfide reductase subunit Heterodisulfide reductase subunit C Heterodisulfide reductase subunit B DFBLFAKA_02559 DFBLFAKA_02561 DFBLFAKA_02560 DFBLFAKA_02112 DFBLFAKA_02113 DFBLFAKA_02114 DFBLFAKA_02115 DFBLFAKA_02116 DFBLFAKA_00530 DFBLFAKA_00531 DFBLFAKA_01190 DFBLFAKA_01193 DFBLFAKA_01372 DFBLFAKA_01599 DFBLFAKA_00770 DFBLFAKA_00853 DFBLFAKA_02886 DFBLFAKA_01174 DFBLFAKA_02652 DFBLFAKA_02653 DFBLFAKA_02654 DFBLFAKA_02655
66 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 . Protein annotation Protein Hybrid cluster protein (Hcp) Formate-hydrogen lyase-like membrane complex (HyfG) Hydrogenase 4 membrane component (HyfE) Formate-hydrogen lyase subunit 4 (HycD) Formate-hydrogen lyase subunit 3 (HycC) NAD(P)-dependent iron-only hydrogenase Formate dehydrogenase family accessory protein (FdhD) Phosphoglycerate kinase 6-phosphofructokinase Pyrophosphate-dependent 6-phosphofructokinase D-lactate dehydrogenase Dissimilatory sulfite reductase alpha subunit (DsrA) Dissimilatory sulfite reductase beta subunit (DsrB) Dissimilatory sulfite reductase gamma subunit (DsrC) Nitrate reductase gamma subunit (NarI) hydrogenase subunit Fe-S-cluster-containing Polysulfide reductase ABC transporter High-affinity branched-chain amino acid Dimethylamine corrinoid protein (MtbC) Monomethylamine methyltransferase (MtmB) hydrogenase component 1 Fe-S-cluster-containing Analysis of a reconstructed genome or (das_tool.binsanity.asm_contigs_metaspades_gt1500-bin_18.fa Nitrospirae_ANNOTATED_contigs_1000. Loci identifier Nitrospirae_NODE_10_length_273981_cov_107.768_0179 Nitrospirae_NODE_10_length_273981_cov_107.768_0201 Nitrospirae_NODE_10_length_273981_cov_107.768_0202 Nitrospirae_NODE_10_length_273981_cov_107.768_0219 Nitrospirae_NODE_10_length_273981_cov_107.768_0221 Nitrospirae_NODE_10_length_273981_cov_107.768_0223 Nitrospirae_NODE_10_length_273981_cov_107.768_0224 Nitrospirae_NODE_10_length_273981_cov_107.768_0225 Nitrospirae_NODE_1296_length_14510_cov_134.68_0008 Nitrospirae_NODE_1296_length_14510_cov_134.68_0009 Nitrospirae_NODE_14_length_261974_cov_129.332_0044 Nitrospirae_NODE_14_length_261974_cov_129.332_0048 Nitrospirae_NODE_14_length_261974_cov_129.332_0122 Nitrospirae_NODE_14_length_261974_cov_129.332_0123 Nitrospirae_NODE_14_length_261974_cov_129.332_0124 Nitrospirae_NODE_14_length_261974_cov_129.332_0155 Nitrospirae_NODE_14_length_261974_cov_129.332_0157 Nitrospirae_NODE_14_length_261974_cov_129.332_0158 Nitrospirae_NODE_14_length_261974_cov_129.332_0162 Nitrospirae_NODE_14_length_261974_cov_129.332_0164 Nitrospirae_NODE_14_length_261974_cov_129.332_0167 Supplementary Table Supplementary 4: Table genes.fna) with metabolic potential for oxygen was reduction, enriched sulfate and reduction, became and the nitrate This reduction organism to nitrous oxide or ammonium. dominant microbial member in the representing bioreactor, a new group in the Nitrospirae phylum. Proteins of interest are highlighted in this table. NODE: contig number; length: contig length; cov: coverage; last underscore followed by digit: gene number
67 CHAPTER 2 Pyruvate ferredoxin oxidoreductase gamma subunit (PorC) Pyruvate ferredoxin oxidoreductase delta subunit (PorD) Pyruvate ferredoxin oxidoreductase alpha subunit (PorA) Pyruvate ferredoxin oxidoreductase beta subunit (PorB) hydrogenase component 1 (HybA) Fe-S-cluster-containing Pyruvate ferredoxin oxidoreductase, gamma subunit (PorC) Pyruvate ferredoxin oxidoreductase, delta subunit (PorD) Pyruvate ferredoxin oxidoreductase, alpha subunit (PorA) Pyruvate ferredoxin oxidoreductase, beta subunit (PorB) 6-phosphofructokinase Pyruvate-flavodoxin oxidoreductase family) Lactate transporter (LctP Pyruvate, water dikinase corrinoid protein 1 (MttC) Trimethylamine Methylcobamide:CoM methyltransferase (MtbA) S-methyltransferase subunit H (MtrH) Tetrahydromethanopterin Iron-containing alcohol dehydrogenase Pyruvate dehydrogenase E1 component subunit alpha C20-methyltransferase Precorrin-2/cobalt-factor-2 Precorrin-4 C11-methyltransferase Precorrin-3B C17-methyltransferase DsrH-like protein DsrE-family protein DsrE/DsrF-like family DsrE/DsrF-like family Respiratory nitrate reductase subunit gamma (NarI) Nitrospirae_NODE_14_length_261974_cov_129.332_0168 Nitrospirae_NODE_14_length_261974_cov_129.332_0188 Nitrospirae_NODE_16_length_247750_cov_112.379_0014 Nitrospirae_NODE_16_length_247750_cov_112.379_0015 Nitrospirae_NODE_16_length_247750_cov_112.379_0019 Nitrospirae_NODE_16_length_247750_cov_112.379_0086 Nitrospirae_NODE_16_length_247750_cov_112.379_0087 Nitrospirae_NODE_16_length_247750_cov_112.379_0088 Nitrospirae_NODE_16_length_247750_cov_112.379_0089 Nitrospirae_NODE_16_length_247750_cov_112.379_0104 Nitrospirae_NODE_16_length_247750_cov_112.379_0117 Nitrospirae_NODE_16_length_247750_cov_112.379_0118 Nitrospirae_NODE_16_length_247750_cov_112.379_0168 Nitrospirae_NODE_173_length_72978_cov_128.513_0027 Nitrospirae_NODE_173_length_72978_cov_128.513_0029 Nitrospirae_NODE_173_length_72978_cov_128.513_0030 Nitrospirae_NODE_173_length_72978_cov_128.513_0040 Nitrospirae_NODE_179_length_69887_cov_126.242_0037 Nitrospirae_NODE_1831_length_10944_cov_157.996_0002 Nitrospirae_NODE_1831_length_10944_cov_157.996_0004 Nitrospirae_NODE_1831_length_10944_cov_157.996_0006 Nitrospirae_NODE_1831_length_10944_cov_157.996_0010 Nitrospirae_NODE_1831_length_10944_cov_157.996_0011 Nitrospirae_NODE_1831_length_10944_cov_157.996_0012 Nitrospirae_NODE_185_length_69324_cov_106.086_0007 Nitrospirae_NODE_185_length_69324_cov_106.086_0033
68 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 Alcohol dehydrogenase Quinol-cytochrome c reductase iron-sulfur subunit Quinol-cytochrome c reductase, fused cytochrome b/c subunit Cytochrome c oxidase subunit I (CoxA) Cytochrome c oxidase subunit III (CoxC) (CoxD) Cytochrome c oxidase subunit IV Cytochrome C oxidase subunit II (CoxB) Nitrogen assimilation regulatory protein (NtrX) Nitrogen regulation protein (NtrY) Cytochrome c nitrite reductase (NrfH) Cytochrome c-552, ammonia-forming nitrite reductase (NrfA) Dissimilatory sulfite reductase, gamma subunit (DsrC) protein ATP-binding Branched-chain amino acid transport system; Branched-chain amino acid transport system; substrate-binding protein High-affinity branched-chain amino acid transport system permease Branched-chain amino acid transport system permease protein ATPase ABC transporter Branched-chain amino acid synthetase A Acetyl-coenzyme DsrE/DsrF-like family Anaerobic dimethyl sulfoxide reductase subunit B (DsmB) Methylcobalamin:coenzyme M methyltransferase (MtaA) precursor (DmsA) A Anaerobic DMSO reductase chain Anaerobic DMSO reductase chain B iron-sulfur subunit (DmsB) family methyltransferase MtaA/CmuA Methyl-viologen-reducing hydrogenase subunit delta (MvhD) A (HdrA) Heterodisulfide reductase subunit Nitrospirae_NODE_185_length_69324_cov_106.086_0035 Nitrospirae_NODE_185_length_69324_cov_106.086_0041 Nitrospirae_NODE_185_length_69324_cov_106.086_0042 Nitrospirae_NODE_185_length_69324_cov_106.086_0045 Nitrospirae_NODE_185_length_69324_cov_106.086_0046 Nitrospirae_NODE_185_length_69324_cov_106.086_0047 Nitrospirae_NODE_185_length_69324_cov_106.086_0048 Nitrospirae_NODE_187_length_68788_cov_135.343_0041 Nitrospirae_NODE_187_length_68788_cov_135.343_0042 Nitrospirae_NODE_187_length_68788_cov_135.343_0060 Nitrospirae_NODE_187_length_68788_cov_135.343_0061 Nitrospirae_NODE_192_length_66469_cov_116.05_0029 Nitrospirae_NODE_204_length_64731_cov_130.135_0005 Nitrospirae_NODE_204_length_64731_cov_130.135_0006 Nitrospirae_NODE_204_length_64731_cov_130.135_0007 Nitrospirae_NODE_204_length_64731_cov_130.135_0008 Nitrospirae_NODE_204_length_64731_cov_130.135_0009 Nitrospirae_NODE_204_length_64731_cov_130.135_0010 Nitrospirae_NODE_204_length_64731_cov_130.135_0011 Nitrospirae_NODE_204_length_64731_cov_130.135_0018 Nitrospirae_NODE_204_length_64731_cov_130.135_0049 Nitrospirae_NODE_204_length_64731_cov_130.135_0054 Nitrospirae_NODE_204_length_64731_cov_130.135_0055 Nitrospirae_NODE_204_length_64731_cov_130.135_0057 Nitrospirae_NODE_217_length_60863_cov_127.207_0004 Nitrospirae_NODE_217_length_60863_cov_127.207_0005
69 CHAPTER 2 A (MvhA) A Heterodisulfide reductase subunit B (HdrB) Heterodisulfide reductase subunit C (HdrC) Glyceraldehyde-3-phosphate dehydrogenase Phosphoglycerate kinase Nitric oxide reductase (NorD) Cytochrome d ubiquinol oxidase subunit II (CydB) Cytochrome c oxidase cbb3-type subunit I (CcoP) Cytochrome c oxidase, cbb3-type subunit II (CcoO) NADH ubiquinone oxidoreductase; F420-non-reducing hydrogenase subunit G (MvhG) Nickel-dependent hydrogenase; F420-non-reducing hydrogenase subunit (MvhA) A F420-non-reducing hydrogenase subunit A (HdrA) Heterodisulfide reductase subunit Methyl-viologen-reducing, F420-non-reducing hydrogenase subunit D (MvhD) family methyltransferase MtaA/CmuA Methyltransferase cognate corrinoid protein S-methyltransferase, subunit H (MtrH) Tetrahydromethanopterin Ammonia-forming nitrite reductase (NrfA) Periplasmic nitrate reductase (NapA) Ferredoxin-type periplasmic nitrate reductase (NapG) Phosphopyruvate hydratase; enolase Alcohol dehydrogenase Hybrid cluster protein (Hcp) Dimethylamine corrinoid protein (MtbC) Methyltransferase corrinoid activation protein Methylcobalamin:coenzyme M methyltransferase (MtbA) family methyltransferase MtaA/CmuA Nitrospirae_NODE_217_length_60863_cov_127.207_0006 Nitrospirae_NODE_217_length_60863_cov_127.207_0007 Nitrospirae_NODE_217_length_60863_cov_127.207_0018 Nitrospirae_NODE_217_length_60863_cov_127.207_0019 Nitrospirae_NODE_217_length_60863_cov_127.207_0054 Nitrospirae_NODE_22_length_201353_cov_112.578_0014 Nitrospirae_NODE_22_length_201353_cov_112.578_0016 Nitrospirae_NODE_22_length_201353_cov_112.578_0017 Nitrospirae_NODE_22_length_201353_cov_112.578_0036 Nitrospirae_NODE_22_length_201353_cov_112.578_0037 Nitrospirae_NODE_22_length_201353_cov_112.578_0038 Nitrospirae_NODE_22_length_201353_cov_112.578_0040 Nitrospirae_NODE_22_length_201353_cov_112.578_0041 Nitrospirae_NODE_22_length_201353_cov_112.578_0144 Nitrospirae_NODE_22_length_201353_cov_112.578_0145 Nitrospirae_NODE_22_length_201353_cov_112.578_0146 Nitrospirae_NODE_22_length_201353_cov_112.578_0148 Nitrospirae_NODE_22_length_201353_cov_112.578_0150 Nitrospirae_NODE_22_length_201353_cov_112.578_0151 Nitrospirae_NODE_23_length_195492_cov_121.132_0064 Nitrospirae_NODE_263_length_52389_cov_120.581_0031 Nitrospirae_NODE_271_length_50783_cov_123.089_0008 Nitrospirae_NODE_271_length_50783_cov_123.089_0010 Nitrospirae_NODE_271_length_50783_cov_123.089_0012 Nitrospirae_NODE_271_length_50783_cov_123.089_0013 Nitrospirae_NODE_271_length_50783_cov_123.089_0015
70 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 Methylenetetrahydrofolate reductase Methylenetetrahydrofolate reductase Acetaldehyde dehydrogenase (PduP) DsrE/DsrF-like family DsrE/DsrF-like family protein ABC-type nitrate/sulfonate/bicarbonate transport system Anaerobic nitric oxide reductase (NorV) Formate dehydrogenase subunit alpha (FdhA) Menaquinol-Cytochrome c reductase cytochrome b subunit (QcrB) NAD-dependent aldehyde dehydrogenase (PuuC) synthetase (AcsA) Acetyl-CoA Pyruvate dehydrogenase E1 component subunit alpha Pyruvate dehydrogenase E1 component subunit beta Pyruvate dehydrogenase E2 component Signal transduction histidine kinase, nitrogen specific (NtrB) Phosphoenolpyruvate synthase Pyruvate, water dikinase D-lactate dehydrogenase Phosphoglycerate mutase DsrE/DsrF-like family Amt family Ammonium transporter, Nitrogen regulatory protein P-II (GlnB) Amt family Ammonium transporter, Nitrogen regulatory protein P-II 1 ABC transporter permease Peptide Alcohol dehydrogenase Nitrospirae_NODE_271_length_50783_cov_123.089_0017 Nitrospirae_NODE_271_length_50783_cov_123.089_0018 Nitrospirae_NODE_271_length_50783_cov_123.089_0022 Nitrospirae_NODE_271_length_50783_cov_123.089_0039 Nitrospirae_NODE_271_length_50783_cov_123.089_0043 Nitrospirae_NODE_271_length_50783_cov_123.089_0047 Nitrospirae_NODE_290_length_49149_cov_145.004_0013 Nitrospirae_NODE_290_length_49149_cov_145.004_0028 Nitrospirae_NODE_290_length_49149_cov_145.004_0046 Nitrospirae_NODE_309_length_47493_cov_139.218_0022 Nitrospirae_NODE_316_length_46906_cov_144.392_0027 Nitrospirae_NODE_338_length_44926_cov_118.054_0017 Nitrospirae_NODE_338_length_44926_cov_118.054_0018 Nitrospirae_NODE_338_length_44926_cov_118.054_0019 Nitrospirae_NODE_37_length_171455_cov_121.767_0002 Nitrospirae_NODE_37_length_171455_cov_121.767_0064 Nitrospirae_NODE_37_length_171455_cov_121.767_0065 Nitrospirae_NODE_37_length_171455_cov_121.767_0066 Nitrospirae_NODE_37_length_171455_cov_121.767_0074 Nitrospirae_NODE_37_length_171455_cov_121.767_0136 Nitrospirae_NODE_37_length_171455_cov_121.767_0139 Nitrospirae_NODE_37_length_171455_cov_121.767_0140 Nitrospirae_NODE_37_length_171455_cov_121.767_0141 Nitrospirae_NODE_37_length_171455_cov_121.767_0145 Nitrospirae_NODE_37_length_171455_cov_121.767_0149 Nitrospirae_NODE_411_length_38387_cov_112.61_0027
71 CHAPTER 2 Succinate dehydrogenase, flavoprotein subunit (SdhA) Succinate dehydrogenase and fumarate reductase iron-sulfur protein (SdhA) Succinate dehydrogenase, cytochrome b-556 subunit (SdhC) Succinate dehydrogenase membrane subunit (SdhD) 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase (gpmA) Amino acid transporter Dimethyl sulfoxide reductase subunit B (DmsB) Polysulfide reductase E3 component of Pyruvate and 2-oxoglutarate dehydrogenase complexes Heterodisulfide reductase subunit D (HdrD) Nitrate reductase gamma subunit (NarI) DsrH like protein DsrE/DsrF-like family DsrE/DsrF-like family DsrE family protein Pyruvate, water dikinase Pyruvate phosphate dikinase protein ATP-binding Branched-chain amino acid transport system protein ATP-binding Branched-chain amino acid transport system protein ABC transporter permease/ATP-binding Branched-chain amino acid ABC transporter permease High-affinity branched-chain amino acid S-methyltransferase subunit H (MtrH) Tetrahydromethanopterin family methyltransferase MtaA/CmuA Methyltransferase cognate corrinoid protein ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ABC-type nitrate/sulfonate/bicarbonate transport system Nitrospirae_NODE_415_length_38193_cov_125.345_0020 Nitrospirae_NODE_415_length_38193_cov_125.345_0021 Nitrospirae_NODE_415_length_38193_cov_125.345_0022 Nitrospirae_NODE_415_length_38193_cov_125.345_0023 Nitrospirae_NODE_432_length_36830_cov_163.154_0028 Nitrospirae_NODE_462_length_35123_cov_123.715_0010 Nitrospirae_NODE_5_length_349784_cov_116.222_0025 Nitrospirae_NODE_5_length_349784_cov_116.222_0028 Nitrospirae_NODE_5_length_349784_cov_116.222_0035 Nitrospirae_NODE_5_length_349784_cov_116.222_0042 Nitrospirae_NODE_5_length_349784_cov_116.222_0043 Nitrospirae_NODE_5_length_349784_cov_116.222_0046 Nitrospirae_NODE_5_length_349784_cov_116.222_0047 Nitrospirae_NODE_5_length_349784_cov_116.222_0048 Nitrospirae_NODE_5_length_349784_cov_116.222_0049 Nitrospirae_NODE_5_length_349784_cov_116.222_0056 Nitrospirae_NODE_5_length_349784_cov_116.222_0073 Nitrospirae_NODE_5_length_349784_cov_116.222_0078 Nitrospirae_NODE_5_length_349784_cov_116.222_0079 Nitrospirae_NODE_5_length_349784_cov_116.222_0080 Nitrospirae_NODE_5_length_349784_cov_116.222_0081 Nitrospirae_NODE_5_length_349784_cov_116.222_0133 Nitrospirae_NODE_5_length_349784_cov_116.222_0134 Nitrospirae_NODE_5_length_349784_cov_116.222_0135 Nitrospirae_NODE_5_length_349784_cov_116.222_0140 Nitrospirae_NODE_5_length_349784_cov_116.222_0141
72 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 ABC-type nitrate/sulfonate/bicarbonate transport system Pyruvate, water dikinase Formate dehydrogenase beta subunit (FdhB) Anaerobic dimethyl sulfoxide reductase subunit B (DmsB) reductase (cytochrome c) Trimethylamine-N-oxide Hydrogenase 3 maturation protease Nickel-dependent hydrogenase F420-non-reducing hydrogenase vhu subunit G (VhuG) NiFe hydrogenase gamma subunit Ni/Fe hydrogenase subunit beta Respiratory nitrate reductase beta chain (NarH) Respiratory nitrate reductase alpha chain (NarG) Menaquinol-cytochrome c reductase cytochrome b subunit (QcrB) Aldehyde:ferredoxin oxidoreductase Formate dehydrogenase, alpha subunit (FdoG/FdhF) Soluble hydrogenase 42 kDa subunit Formate-dependent nitrite reductase periplasmic cytochrome c552 subunit (NrfA) 2,3-bisphosphoglycerate-independent phosphoglycerate mutase Hydrogenase nickel incorporation protein HypA/HybF Hydrogenase nickel incorporation protein (HypB) (NiFe) hydrogenase maturation protein (HypF) Hydrogenase expression/formation protein (HypC) Hydrogenase expression/formation protein (HypD) Hydrogenase expression/formation protein (HypE) Nitrogen assimilation regulatory protein Formate dehydrogenase subunit alpha (FdoG/FdhF) Nitrospirae_NODE_5_length_349784_cov_116.222_0152 Nitrospirae_NODE_5_length_349784_cov_116.222_0153 Nitrospirae_NODE_5_length_349784_cov_116.222_0155 Nitrospirae_NODE_5_length_349784_cov_116.222_0157 Nitrospirae_NODE_5_length_349784_cov_116.222_0158 Nitrospirae_NODE_5_length_349784_cov_116.222_0213 Nitrospirae_NODE_5_length_349784_cov_116.222_0214 Nitrospirae_NODE_5_length_349784_cov_116.222_0215 Nitrospirae_NODE_5_length_349784_cov_116.222_0216 Nitrospirae_NODE_5_length_349784_cov_116.222_0217 Nitrospirae_NODE_5_length_349784_cov_116.222_0234 Nitrospirae_NODE_5_length_349784_cov_116.222_0235 Nitrospirae_NODE_5_length_349784_cov_116.222_0236 Nitrospirae_NODE_50_length_155641_cov_101.572_0004 Nitrospirae_NODE_50_length_155641_cov_101.572_0066 Nitrospirae_NODE_53_length_154223_cov_139.117_0025 Nitrospirae_NODE_53_length_154223_cov_139.117_0054 Nitrospirae_NODE_53_length_154223_cov_139.117_0115 Nitrospirae_NODE_58_length_149903_cov_116.186_0024 Nitrospirae_NODE_58_length_149903_cov_116.186_0025 Nitrospirae_NODE_58_length_149903_cov_116.186_0026 Nitrospirae_NODE_58_length_149903_cov_116.186_0027 Nitrospirae_NODE_58_length_149903_cov_116.186_0028 Nitrospirae_NODE_58_length_149903_cov_116.186_0029 Nitrospirae_NODE_58_length_149903_cov_116.186_0096 Nitrospirae_NODE_66_length_136969_cov_108.216_0039
73 CHAPTER 2 Cytochrome c oxidase subunit II (CoxB) (CoxD) Cytochrome c oxidase subunit IV Cytochrome c oxidase subunit III (CoxC) Cytochrome c oxidase subunit I (CoxA) family methyltransferase MtaA/CmuA Cbb3-type cytochrome oxidase component FixQ family (CcoQ) Cytochrome c oxidase cbb3-type subunit II (CcoO) Cytochrome c oxidase cbb3-type subunit I (CcoP) Dissimilatory sulfite reductase alpha subunit (DsrA) Dissimilatory sulfite reductase beta subunit (DsrB) Sulfate adenylyltransferase (Sat) adenylylsulfate reductase subunit beta (AprB) Adenylylsulfate reductase subunit alpha (AprA) A (HdrA) Heterodisulfide reductase iron-sulfur subunit Methyl-viologen-reducing hydrogenase delta subunit (MvhD) family methyltransferase MtaA/CmuA Monomethylamine methyltransferase (MtmB) Dimethylamine corrinoid protein (MtbC) Nitrogen regulatory protein P-II 1 Alcohol dehydrogenase Pyruvate, water dikinase isomerase Triosephosphate Phosphoglycerate mutase 1 family Glucose-6-phosphate isomerase Pyruvate kinase Nitric oxide reductase subunit C (NorC) Nitric oxide reductase subunit B (NorB) Nitrospirae_NODE_66_length_136969_cov_108.216_0049 Nitrospirae_NODE_66_length_136969_cov_108.216_0050 Nitrospirae_NODE_66_length_136969_cov_108.216_0051 Nitrospirae_NODE_66_length_136969_cov_108.216_0052 Nitrospirae_NODE_698_length_24518_cov_135.006_0002 Nitrospirae_NODE_698_length_24518_cov_135.006_0013 Nitrospirae_NODE_698_length_24518_cov_135.006_0017 Nitrospirae_NODE_698_length_24518_cov_135.006_0018 Nitrospirae_NODE_713_length_24193_cov_118.834_0020 Nitrospirae_NODE_713_length_24193_cov_118.834_0021 Nitrospirae_NODE_785_length_22437_cov_135.664_0003 Nitrospirae_NODE_785_length_22437_cov_135.664_0004 Nitrospirae_NODE_785_length_22437_cov_135.664_0005 Nitrospirae_NODE_785_length_22437_cov_135.664_0006 Nitrospirae_NODE_785_length_22437_cov_135.664_0007 Nitrospirae_NODE_807_length_21922_cov_135.687_0013 Nitrospirae_NODE_807_length_21922_cov_135.687_0014 Nitrospirae_NODE_807_length_21922_cov_135.687_0015 Nitrospirae_NODE_83_length_122074_cov_112.405_0006 Nitrospirae_NODE_83_length_122074_cov_112.405_0023 Nitrospirae_NODE_86_length_120864_cov_109.806_0004 Nitrospirae_NODE_86_length_120864_cov_109.806_0027 Nitrospirae_NODE_86_length_120864_cov_109.806_0090 Nitrospirae_NODE_86_length_120864_cov_109.806_0091 Nitrospirae_NODE_91_length_117031_cov_131.529_0003 Nitrospirae_NODE_91_length_117031_cov_131.529_0103 Nitrospirae_NODE_91_length_117031_cov_131.529_0104
74 Microbial interactions under nitrate-AOM conditions in an anoxic bioreactor
2 . Nitrobium versatile and its twenty closest representatives with available genome Ca Average Amino Acid Identity (AAI) table of the novel Amino Average Supplementary Table 5: Table Supplementary sequences. Nitrospina gracilis was used as outgroup.
75 Arslan Arshad1, Mike S. M. Jetten1,2, Huub J. M. Op den Camp1 and Cornelia U. Welte1,3
1 Department of Microbiology, Institute for Water and Wetland Research, Radboud University, Nijmegen, The Netherlands 2 Soehngen Institute for Anaerobic Microbiology, Radboud University, Nijmegen, The Netherlands 3 Netherlands Earth Systems Science Center, Utrecht University, The Netherlands. Dissimilatory nitrate reduction to ammonium (DNRA) in a laboratory scale bioreactor mimicking estuarine conditions
3 CHAPTER 3
Abstract
Denitrification and Dissimilatory nitrate reduction to ammonium (DNRA) are two microbial processes that compete for oxidized nitrogen compounds in the environment. The goal of this study was investigate feasibility of anammox microbial population that might be sustained through the combined activity of DNRA and partial denitrification coupled to sulfide and methane oxidation in an enrichment culture mimicking estuarine or brackish conditions under ammonium limitation. Potential candidates for performing DNRA were anaerobic nitrate-reducing methanotroph Candidatus Methanoperedens nitroreducens and a novel Nitrospirae bacterium, Candidatus Nitrobium versatile. In order to facilitate DNRA we provided - high electron donor (CH4 and sulfide) to nitrogen (NO3 ) ratios to the bioreactor. The composition of the microbial community as well as their substrate turnover was monitored over a period of 10 weeks with physiological assays, fluorescence in situ hybridization imaging and meta-transcriptome sequencing. A cross feeding of nitrite and competition for nitrate and methane between autotrophic sulfide denitrifiers, nitrate and nitrite dependent methane methanotrophs was observed. The gene expression of nrfAH from Ca. M. nitroreducens significantly increased from T1 (t1= week 1) to T10 (t10 = week 10). However, the ammonium production by Ca. M. nitroreducens alone did not appear to be sufficient to sustain anammox population and therefore anammox sp. were outcompeted and disappeared from the enrichment culture. As a consequence, the nitrite-reducing methane oxidizing bacteria Ca. Mehtylomirabilis oxyfera became the most abundant member of the microbial community. The previously enriched most abundant member of the microbial community, Ca. N. versatile disappeared from the enrichment culture.
78 Dissimilatory nitrate reduction to ammonium in estuarine conditions
Introduction
Estuaries are transition zones between river and marine environments. The rivers transport nitrogen compounds from agricultural runoff into these deltas. Beside nitrogenous waste, estuaries also receive sulfidic compounds along with methane from marine sediments due to tidal currents. Hence, the resulting brackish oxygen- limiting ecosystems provide an excellent niche for a diverse microbial population involved in nitrogen, carbon and sulfur cycling. These biogeochemical cycles are dependent on each other, particularly through the activity of microorganisms that 3 use metabolites of different cycles. Driven by the prevailing conditions, estuarine sediments may be either nitrogen sources or nitrogen sinks (Bu et al., 2017). Denitrification, dissimilatory nitrate reduction to ammonium (DNRA) and anaerobic ammonium oxidation (anammox) are key processes of nitrate reduction that occur in the absence of oxygen or at very low oxygen concentrations (Tiedje et al., 1982; Kraft et al., 2014). Denitrification and anammox are the main processes for nitrogen- loss in brackish environments and up to 50 % of inorganic nitrogen is removed solely through denitrification (Nedwell et al., 1999). For a long time denitrification has been considered the dominant nitrate reduction process in estuarine and other marine environment. Denitrification and anammox are both well studied and deeply understood processes of the nitrogen cycle (Jetten et al., 2001; Kraft et al., 2011; Kartal et al., 2013; Isobe and Ohte, 2014; Russ et al., 2014). In comparison to the aforementioned microbial processes DNRA has received little attention and only recently, studies performed with stable isotope labelling of N substrates have established that DNRA might also be a significant contributor towards nitrate reduction (Burgin and Hamilton, 2007; Kraft et al., 2011; Rütting et al., 2011; Brin et al., 2015). Denitrification and DNRA both compete for nitrate as electron acceptor. Denitrification is responsible for nitrogen removal from the ecosystems while DNRA converts nitrate to ammonium via nitrite and conserves nitrogen instead. Denitrification consists of a five electron reduction of nitrate to N2 involving nitrite, nitric oxide, nitrous oxide as intermediates (Kraft et al., 2011). DNRA consists of eight electron reduction of nitrate to ammonium: the first step is nitrate reduction to nitrite, similar to denitrification, which is catalysed by periplasmic (Nap) or membrane bound (Nar) nitrate reductases. Following the nitrate reduction, nitrite is reduced to ammonium through pentaheme cyctochrome c nitrite reductase (NrfA). Nitrate utilization as electron acceptor either by denitrification or DNRA is influenced by several environmental and physiological factors that include, C/N ratio, pH, nitrite versus nitrate concentrations, availability
79 CHAPTER 3
of fermentable carbon compounds, temperature and sulfide concentrations(Tiedje et al., 1983; Akunna et al., 1993; Ogilvie, 1997; Tobin O Strohm et al., 2007; Tugtas and Pavlostathis, 2007; Dong et al., 2011; Schmidt et al., 2011; Behrendt et al., 2013). However, which environmental factors are most important, and under which conditions, remains unclear. Nevertheless, DNRA is one of the main processes that conserve nitrogen in form of ammonium in brackish, estuarine environments (Dong et al., 2009; Papaspyrou et al., 2014; Bu et al., 2017). In recent years it has been reported that in marine environments, the conserved nitrogen from DNRA can be removed due to anammox activity thus, anammox coupled to DNRA might be an important nexus of nitrogen removal in marine ecosystems (Jensen, Lam, Revsbech, Nagel, Gaye, Mike Sm Jetten, et al., 2011). Other studies focusing on DNRA in estuarine ecosystems have revealed that temperature, availability of organic matter and limiting nitrate concentrations have a positive impact on DNRA (Tomaszek and Gruca-Rokosz, 2007; Bernard et al., 2015; Lisa et al., 2015; Robertson et al., 2016). Furthermore, availability of nitrate instead of nitrite as terminal electron acceptor and elevated sulfide concentrations are also known to favour ammonification over denitrification (Joye and Hollibaugh, 1995; Bru et al., 2011). Regardless of several pure culture studies, which investigated the physiology and bioenergetics of DNRA process, the quantitative scope of DNRA in engineered and natural environments and its relative contribution to the global nitrogen cycle have received little attention. The quantification of DNRA is particularly challenging since many fermentative, sulfur and anammox bacteria can be disguised as DNRA microorganisms (Tiedje et al., 1983; Kartal et al., 2007). Therefore, investigating the prevalence of DNRA in a complex microbial system that involves nitrogen, sulfur and methane cycling microorganisms would be relevant to understand natural ecosystems where nitrate reduction is a dominant microbial process. In such anoxic environments additional nitrogen removal could take place through anammox that might be sustained by the combined activity of DNRA and partial denitrification coupled to sulfide and methane oxidation, rather than by direct ammonium (and nitrite) input into the ecosystem. To test this hypothesis, we enriched a denitrifying, methane and sulfide-oxidizing microbial community in a laboratory scale anoxic bioreactor that mimicked estuarine or brackish growth conditions (Arshad et al., 2017). At the start of the experiment, the bioreactor contained anaerobic methanotrophs, sulfide-dependent denitrifiers and anammox bacteria. Subsequently, ammonium was removed from the feed of the bioreactor so that anammox bacteria would have to rely on DNRA by other microorganisms to supply sufficient ammonium. Potential candidates for this reaction were the highly enriched anaerobic nitrate-reducing methanotroph Candidatus
80 Dissimilatory nitrate reduction to ammonium in estuarine conditions
Methanoperedens nitroreducens which encodes an NrfAH nitrite ammonium oxidoreductase and presumably reduces a significant amount its substrate nitrate to ammonium and a novel Nitrospirae bacterium, Candidatus Nitrobium versatile. This bacterium encoded genes for metabolizing sulfur and nitrogen compounds in addition to genes encoding the full set of enzymes required for DNRA. In order to facilitate - DNRA we provided high electron donor (CH4 and sulfide) to nitrogen (NO3 ) ratios (Kraft et al., 2011; van den Berg et al., 2015) to the bioreactor. The composition of the microbial community as well as their substrate turnover was monitored over a period of 10 weeks with physiological assays, fluorescence in situ hybridization 3 imaging and meta-transcriptome sequencing. We observed a cross feeding of nitrite and competition for nitrate and methane between autotrophic sulfide denitrifiers, nitrate and nitrite dependent methane methanotrophs. The previously enriched most abundant member of the microbial community, Ca. N. versatile (Arshad et al., 2017) disappeared over the course of these 10 weeks. Additionally, ammonium production by Ca. M. nitroreducens alone did not appear to be sufficient to sustain anammox population and therefore anammox sp. were outcompeted and disappeared from the enrichment culture. As a consequence, the nitrite-reducing methane oxidizing bacteria Ca. Mehtylomirabilis oxyfera became the most abundant member of the microbial community.
Experimental procedures
Bioreactor operation A double-jacket glass 2.5 L bioreactor with a working volume of 1.5 L (Applikon, Delft, The Netherlands) was used for cultivation of the enrichment culture. The inoculum consisted of biomass from a marine enrichment culture containing sulfide- dependent autotrophic denitrifiers and anammox bacteria (Russ et al., 2014) and biomass from a freshwater methane-oxidizing denitrification culture (Ettwig et al., 2016b). The reactor was operated at 150 r.p.m with a stirrer that contained two standard six-blade turbines. The flow of methane gas to the reactor was keptat 7.5 ml min-1 using a mass flow controller (Brooks Instrument, Ede, The Netherlands). The bioreactor was operated at room temperature and was constantly flushed with Ar/CO2 (95:5) to ensure anoxic conditions. The pH of the reactor liquid was monitored with a pH electrode (Applisens, Applikon, Delft, The Netherlands) and -1 was maintained at 7.1 with 100 g L KHCO3 solution. The pH pump was controlled by an ADI 1010 bio-controller (Applikon, Delft, The Netherlands). The mineral
81 CHAPTER 3
medium per liter contained 10 g coral pro salt (Red Sea), 15 mM NaNO3, 0.6 ml anammox specific trace element solution (van de Graaf et al., 1996) (15 g/L EDTA,
0.43 g/L ZnSO4 x7H2O, 0.24 g/L CoCl2x6H2O, 0.99 g/L MnCl2x4H2O, 0.25 g/L
CuSO4x5H2O, 0.22 g/L Na2MoO4x2H2O, 0.2 g/L NiCl2x6H2O, 0.067 g/L SeO2,
0.014 g/L H3BO3, 0.05 g/L Na2WO4x2H2O), 0.6 mL FeSO4, 0.5 mL 100 g K2HPO4,
1.25 mL (288 mg/L) MgSO4, 1.25 mL (192 mg/l) CaCl2, and 1 mL trace element solution for DAMO microorganisms (0.5 g/L ZnSO4x7H2O, 0.12 g/L CoCl2x6H2O,
2 g/L CuSO4, 0.2 g/L NiCl2x6H2O, 0.014 g/L H3BO3, 0.3 g/L MnCl2x4H2O, 0.04 g/L
Na2WO4x2H2O, 0.2 g/L Na2MoO4x2H2O, 0.02 g/L SeO2, 0.8 g/L CeCl2). The 6.7 mM sulfide solution was provided as separate anaerobic medium with a flow rate 100 mL day-1. The nitrate and nitrite concentrations in the bioreactor were measured daily with MQuant™ colorimetric test strips (Merck, Darmstadt, Germany).
Fluorescence in situ hybridization (FISH) Biomass samples were routinely prepared as previously described (Russ et al., 2014). FISH was performed as described by Amann et al. (1990) using a hybridization buffer containing either 30% or 20% (v/v) formamide. Specifications and the details of the probes used in this study are provided in Table 1. For image acquisition, a Zeiss Axioplan 2 epifluorescence microscope equipped with a CCD camera was used together with the Axiovision software package (Zeiss, Germany). Vectashield mounting fluid with DAPI (4,6-diamidino-2-phenylindole) was used on all samples to stain all DNA.
Nitrate, nitrite and ammonium analysis - - + To determine nitrite (NO2 ), nitrate (NO3 ) and ammonium (NH4 ) concentrations in the bioreactor, 2 ml liquid sample was centrifuged and the supernatant stored at ‑20ºC. The nitrite concentration was measured by mixing 70 µl sample with 70 µl of reagent A (1% w/v sulfanilic acid in 1M HCl; kept in dark) with 70 µl of reagent B (0.1 % w/v naphtylethylene diaminedihydrochloride (NED) in water; kept at 4ºC in dark) in a 96 well plate. After incubation at room temperature for 15 min, the absorbance was measured at 540 nm. Similarly, ammonium was measured at 420 nm through a 96 well fluorescence spectrophotometer after reaction with 10% ortho-phthaldialdehyde, as described previously (Taylor et al., 1974). Nitrate was measured in combination with the nitrite determination assay. Once the nitrite measurements were taken, 27 µl vanadium chloride was added to the same samples to reduce nitrate to nitrite. The absorbance was measured a second time for the combined nitrate + nitrite signal. To distinguish nitrate concentration, initial nitrite values were subtracted from the final concentration. All sample measurements were carried out in triplicates.
82 Dissimilatory nitrate reduction to ammonium in estuarine conditions Formamide 30-20 % 30% 30% 30% 20% 20% 35% 35% , 2006) , 2006)
et al. et al. , 2000) , 2001) , 2006) , 1999) , 1992) , 1992) 3 et al. et al. et al. et al. et al. et al. Reference (Daims (Manz (Manz (Haaijer (Schmid (Schmid (Raghoebarsing (Raghoebarsing Label Cy5 Cy3 FLUOS FLUOS Cy3 Cy5 Cy3 FLUOS sp. . K. stuttgartiensis . M. oxyfera . M. nitroreducens Specifity Most bacteria Betaproteobacteria Gammaproteobacteria Thiobacillus Anammox sp. Ca Ca Ca Sequence (5’- 3‘) GCTGCCTCCCGTAGGAGT GCCTTCCCACTTCGTTT GCCTTCCCACATCGTTT CTTAGCACGTCATTTGGGACC CCTTTCGGGCATTGCGAA AAAACCCCTCTACTTAGTGCCC CGCTCGCCCCCTTTGGTC GGTCCCAAGCCTACCAGT Overview of the FISH probes used during this study Name Eub338 I-III Bet42a Gam42a Betthio1001 Amx368 Amx820 D-bact-193 D-arch-641 Table 1: Table
83 CHAPTER 3
RNA isolation and metatranscriptome sequencing The first biomass sample for RNA isolation and subsequent transcriptome sequencing was collected at the time when the bioreactor started receiving medium without ammonium (T0), while the second sample was collected after 10 weeks of stable operation. The medium composition remained constant during this period. The T0 sample was collected from the reactor, centrifuged at 10,000 r.p.m for 5 min at 4ºC to remove the supernatant, and instantly flash frozen in liquid nitrogen. Additionally, a second T0 sample was treated with RNA later® solution (Ambion, Life Technologies, Carlsbad, CA USA). After collection of the 70 Day sample, total RNA was extracted from all biomass pellets using the RiboPure™-Bacteria kit (Thermofisher, Waltham, USA) according to the manufacturer’s protocol. Briefly, cells were disrupted by cold zirconia beads and after centrifugation, 0.2 volumes of chloroform was added to the supernatant for initial RNA purification. Next, 0.5 volumes of 100 % ethanol was added to the aqueous phase obtained after chloroform addition and the whole sample was transferred to a filter cartridge. After washing, the RNA was eluted from the filter cartridge. Following RNA extraction, residual genomic DNA was removed using a DNase I treatment, provided with the RNA extraction kit. Total RNA quality and quantity was subsequently checked with the Bioanalyzer 2100 (Agilent, Santa Clara, CA USA) to ensure only high-quality RNA was used for downstream analysis. Next, the MICROBexpress™ Kit (Thermofisher, Waltham, USA) was used to remove ribosomal RNAs from the total RNA. Additionally, 5S and 23S rRNAs were removed through MEGAclear™ kit (Ambion, Life Technologie, Carlsbad, CA USA). Eventually, the RNA samples (0.1 – 4 µg) were used to construct strand specific RNA-Seq libraries. Non-rRNA in RNA-Seq libraries were enriched by selective priming during the first strand cDNA synthesis reaction, as well as in the final library construction steps using TruSeq Stranded mRNA sample preparation guide (Illumina proprietary catalog RS-122-9004DOC). RNA from both samples was sequenced on the Illumina MiSeq platform (Illumina, CA, USA) to generate 150 bp paired-end reads.
Metatranscriptome analysis Raw paired-end reads from the MiSeq platform were initially filtered based on a minimum quality score of 30, and a minimum sequence length of 150 bp. Next, rRNA sequences were filtered from the metatranscriptomic dataset using ribosomal reads as reference from recently published metagenome data (NCBI: PRJNA397647) along with 16S and 23S ribosomal genes acquired from the SILVA database. The ribosomal filtering was performed through mapping of metatranscriptomic reads
84 Dissimilatory nitrate reduction to ammonium in estuarine conditions
against aforementioned reference data sets on the CLC genomics workbench (v8.5.1, CLCbio, Aarhus, Denmark). Resulting non-rRNA reads were mapped to coding sequences of eight metagenome bins previously recovered from the enrichment culture (PRJNA397647; Arshad et al., 2017). These mappings were performed on the RNA-seq analysis tool from the CLC Genomics workbench (v8.5.1, CLCbio, Aarhus, Denmark), applying 0.5 length fraction and 0.8 similarity fraction parameters. The gene expression values were expressed as RPKM (Reads per kilo base of exon model per million mapped reads) (Mortazavi et al., 2008). 3
Results
Enrichment culture and meta-transcriptome sequencing An enrichment culture consisting of chemolithoautotrophic microorganisms involved in nitrogen, carbon and sulfur cycles was maintained in a laboratory scale anoxic bioreactor for 10 weeks. Previously, the metagenome sequencing, assembly and binning of the aforementioned culture yielded 50 bins, including eight high quality bins to which over 50% of all sequencing data mapped (Chapter 2). The metagenome data belonging to these eight bins were used as a reference data set for the meta-transcriptome analysis performed during this study. In order to resemble the microbial interactions present in a natural ammonium-limited environment, the enrichment culture was gradually adapted by lowering the ammonium supply in the medium without altering any other parameter. RNA was isolated from the biomass sample at t = 0 (no ammonium present), and from t = 10 after 10 weeks of ammonium-limitation. A total of six RNA samples (triplicate from each time point) were sequenced on the Illumina Miseq sequencing platform. The sequencing of whole community RNA extracted from all six samples generated a total of 41,251,327 reads, out of which 30,740,546 reads passed the quality filtering criteria. To acquire 150 bp long paired-end reads, the sequencing was successfully continued for 150 cycles; a large proportion of the reads (80%) revealed a high quality score (Q score > 35; Supplementary Figure. S1). Initially, to filter out the mRNA reads, a reference data-set was created which consisted of ribosomal and tRNAs from the previously obtained eight metagenome bins (Supplementary Table S1) and 16S and 23S ribosomal RNA sequences from the Silva database. The sequencing reads were first mapped to the rRNA and all tRNA genes, the mapped reads were saved for separate analysis on diversity (not reported in this study). A quantitative overview of the RNA reads mapping is provided in Table 2.
85 CHAPTER 3
The remaining reads were mapped to the CDS extracted from the eight meta-genome bins (Supplementary Table S1).
Table 2: Overview of reads mapped against the rRNA and tRNA reference data-set
T0_S1 T0_S2 T0_S3 T10_S1 T10_S2 T10_S3 Raw reads 4,186,143 4,953,802 5,042,474 4,912,431 4,286,661 5,688,709 Mapped rRNA/tRNA reference 3,713,111 4,484,315 4,572,347 4,546,622 3,849,226 5,098,044 Non-rRNA/tRNA reads 472,998 469,465 470,098 365,809 437,435 590,665 Mapped to CDS of 8 bins 216,255 231,206 256,747 132,819 131,747 267,724
According to the mapping results, about 10% of the sequences from each sample could be mapped to mRNA encoding genes. The manual removal of 16S, 23S and 5S rRNA through rRNA removing kits did not succeed since majority (about 90%) of the sequenced reads belonged to the ribosomal RNAs. On average 49.1% reads from sample T0 mapped to CDS sequences of 8 reference bins while, the proportion of reads mapped further decreased to 37.1% in T10 sample (Table 2). Therefore, the reference dataset was further expanded to include complete meta-genome data (binned and unbinned; (Arshad et al., 2017) and a new mapping was performed. The mRNA mapping results did not improve (data not shown) and still about 50% of the non-rRNA/tRNA reads remained un-mapped. The failure to map all mRNA reads suggests possible enrichment of new community members, or incomplete removal of rRNA reads. Additionally, de novo assemblies and subsequent BLAST inquiries of un-mapped reads did not yield valuable information about their origin and might represent the noise caused by all minority community members. The further analysis included investigation of microbial community abundance and gene expression of the mapped reads.
Microbial community abundance We obtained the reads per kilobase per million mapped reads (RPKM) values for transcripts that mapped to CDS sequences and these values were used as a representation for relative gene expression. More specifically, the quantity of reads mapped against each genome bin corresponded quite well to the abundance of each microbial member in the enrichment culture. The overview of CDS reads from T0 and T10 samples mapped against reference genomes is presented in Figure 1. The transcriptome based microbial community analysis of sample T0 revealed that key microorganisms identified previously (Chapter 2: Arshad et al., 2017) also covered the majority population in Figure 1A. A comprehensive quantitative summary of the CDS mapping of the T0 sample is provided in Supplementary Table S2. The transcripts of the nitrate-reducing methane-oxidizing anaerobic methanotrophic
86 Dissimilatory nitrate reduction to ammonium in estuarine conditions
archaeon Ca. M. nitroreducens constituted on average 61.5% of the total mapped sequences suggesting it to be the most abundant member of the microbial community. Furthermore, 26% and 6.6% reads mapped to the two methanotrophic Ca. M. oxyfera- like species present in the community. The recently enriched metabolically versatile Ca. Nitrobium versatile was the third highest expressed bin of the enrichment culture. Surprisingly, Ca. N. versatile was less abundant on transcript level (only 6%) compared to the 26% calculated from the metagenome (Arshad et al., 2017). This low abundance might have resulted from the RNA extraction bias and less by alteration in the growth conditions, as sulfide and nitrate concentrations in the 3 medium were kept unchanged. Interestingly, anammox species related reads (about 2%) were also present (Supplementary Table S 2). The detection of Ca. Kuenenia stuttgartiensis suggested that anammox bacteria were still present and active during the initial stages of bioreactor operation under amended medium. Lastly, less than 1% reads from sample T0 and T10 each mapped to the proposed sulfide-oxidizing Sulfuricella denitrificans. Similarly, less than 1% reads from each sample mapped to the Gammaproteobacterial bin belonging to microorganisms of the family Xanthomonadaceae, possibly another nitrate reducing or sulfur oxidizing member of the enrichment culture since the genome encoded an incomplete denitrification pathway to N2O (narGHI, nirKS and norBC) and sulfide-quinone oxidoreductase (Sqr) and two rhodanese-related sulfur transferases (Chapter 2: Arshad et al., 2017).
87 CHAPTER 3
Figure 1: Microbial community expression levels based on functional gene mapping. A: mRNA reads of sample T0 mapped to reference metagenome bins B: mRNA read mapping of sample T10 after 10 weeks to reference metagenome bins
The mapping results of the T10 samples are presented in Figure. 1B. similarly, the actual quantities of reads mapped to each genome bin are presented in Supplementary Table S3. Overall mRNA mapping of sample T10 showed a similar trend as that observed in the T0 sample, with the denitrifying methanotrophic microorganisms, Ca. M. nitroreducens and Ca. M. oxyfera as the members of the enrichment with the highest expression levels. The anammox species completely disappeared in the T10 sample, which suggests that they experience severe ammonium-limitation and the surplus of nitrite was available for the nitrite-reducing methanotroph Ca. M. oxyfera hence, the total Ca. M. oxyfera abundance increased from 30% to almost 50% in the T10 sequencing run. Consequently, we performed an in depth survey of functional gene expression linked to microbial activities to establish the relative activity of each microbial member.
88 Dissimilatory nitrate reduction to ammonium in estuarine conditions
Microbial activity and gene expression To examine the functional potential of microbial community in the bioreactor the mRNA transcripts from both sequencing runs were mapped against all ORFs from meta-genome bins presented in Supplementary Table S1. As expected, genes involved in methane metabolism from denitrifying- methanotrophic consortia were among the highest genes expressed. Most notably, metabat2.9_01821, metabat2.9_01818, metabat2.9_01820, metabat2.9_01819 annotated as methyl-coenzyme M reductase (MCR) subunit alpha, beta, gamma and delta encoded in Ca. M. nitroreducens genome was most highly transcribed gene cluster (Table 3). Similarly, the particulate 3 methane monooxygenase (pMMO) encoding gene cluster from the two nitrite- reducing methane oxidizing Ca. M. oxyfera species was also highly expressed. The abundant expression of genes involved in the methane metabolism is consistent with the high methane utilization by the enrichment culture observed previously (Arshad et al., 2017). Moreover, expression of pMMO (Ca. M. oxyfera_2) in sample T10 was elevated which, corresponded with the overall increased abundance of Ca. M. oxyfera_2 in the enrichment culture. In addition, expression of the nitrate reductase encoded in Ca. M. nitroreducens remained un-altered throughout both sequencing runs. MCR and nitrate reductase both are essential central metabolic proteins of nitrate-reduction coupled to anaerobic methane oxidation (Arshad, Speth, De Graaf, et al., 2015). Besides methane, sulfide was the other electron donor provided to the enrichment culture, with nitrate was the sole electron acceptor. Therefore, sulfide- or methane-oxidizing microorganisms would compete for nitrate. Sulfide-quinone reductase (Sqr) and dissimilatory sulfite reductase (Dsr) are two enzymes, which have been shown to oxidize sulfide. Based on the metagenome analysis we predicted that a Sulfuricella denitrificans species containing both Dsr and Sqr enzymes was the primary autotrophic-sulfide dependent denitrifier member of the enrichment culture (Arshad et al., 2017). However, in the transcriptome data none of the aforementioned genes of this bacterium were expressed. Additionally, no expression of denitrifying enzymes from the suggested autotrophic sulfide oxidizing denitrifiers was observed.
89 CHAPTER 3
Table 3: The transcriptome profiles of the genes involved in the methane, nitrate and sulfide metabolism retrieved through mapping with reference metagenome bins Enzyme Gene Locus identifier Expression level (RPKM) name T0 T10 Particulate methane pmoA M.oxyfera1.maxbin2.002_02854 1542 ± 264 677 ± 318 monooxygenase pmoB M.oxyfera1.maxbin2.002_02853 1206 ± 178 837 ± 240
pmoA M.oxyfera2.metabat2.42_02564 344 ± 105 750 ± 342 pmoB M.oxyfera2.metabat2.42_02563 479 ± 80 934 ± 460
Methyl coenzyme-M mcrA M.nitroreducens.metabat2.9_01821 37668 ± 2547 38061 ± 7629 reductase mcrB M.nitroreducens.metabat2.9_01818 40312 ± 2323 36377 ± 13297 mcrG M.nitroreducens.metabat2.9_01820 43860 ± 3822 41783 ± 15635 mcrC M.nitroreducens.metabat2.9_01819 36659 ± 3399 33038 ± 13894
narG M.nitroreducens.metabat2.9_00103 52 ± 1 49 ± 5 Nitrate reductase narH M.nitroreducens.metabat2.9_00102 25 ± 8 36 ± 2 narJ M.nitroreducens.metabat2.9_00101 53 ± 14 41 ± 0.7 Orf7 M.nitroreducens.metabat2.9_00100 36 ± 3 35 ± 6
narG Flavobacteriales.maxbin2.010_00677 19 ± 1 13 ± 4 Nitrate reductase narH Flavobacteriales.maxbin2.010_00676 27 ± 0.7 20 ± 3
Sulfide-quinone reductase sqr Xanthomonadales.concoct.4_02106 56 ± 17 60 ± 13
Dissimilatory sulfite dsrA1 N.versatile.bin_18_00730 54 ± 1 No expression reductase dsrB1 N.versatile.bin_18_00731 61 ± 24 No expression dsrA2 N.versatile.bin_18_03727 19 ± 7 No expression dsrB2 N.versatile.bin_18_03728 13 ± 0.4 No expression
We identified one Sqr protein that belonged to microbes of the Gammaproteobacterial family Xanthomondaceae (Table 3). The low transcription levels of this gene were similar in both samples. However, no denitrifying genes from these microorganisms showed expression. Although, the only Sqr protein clearly belonged to metagenome bin of Xanthomonadaceae, the proportion of total mRNA reads mapped to this bin was less than 1% (Figure. 1) hence, making it one of the least abundant members of the enrichment population. The genome of the newly discovered Ca. Nitrobium versatile encodes two copies of dsrAB genes, both copies appeared to be expressed in the sequencing data obtained from sample T0 (Table 3). However, read abundance of this bacterium decreased from 6% to 0.1% at T10. Consequently, beside the aforementioned Sqr from a Xanthomonadaceae family member we could not identify any other Sqr or Dsr proteins having a significant transcriptional value. Furthermore, we investigated prevalence of anammox species within both sequenced samples. During the earliest stage of ammonium depletion, genes involved in anammox metabolism were still abundantly expressed most notably, the hydrazine synthase subunits A, C, and B (unbinned_contig_09437, unbinned_contig_09436, and
90 Dissimilatory nitrate reduction to ammonium in estuarine conditions
unbinned_contig_09435, respectively). Although these proteins were wrongly annotated, we identified them through Blast analysis and compared their expression to the sample T10 (Figure. 2A). The expression of all three hydrazine synthase subunits significantly decreased over the period of 10 weeks of ammonium limitation. Furthermore, hydroxylamine oxidoreductases (hao) were also among the highest expressed anammox genes in sample T0 and showed a trend of expression similar to hydrazine synthase. Neither nirK nor nirS from anammox sp. could be identified. However, a monoheme cytochrome c protein (NirC), which is an integral part of nitrite reduction operon in Ca. Kuenenia stuttgartiensis was expressed (metabat2.29_00068 3 RPKM: 280) in the T0 sample while its expression was diminished in the T10 sample. In the enrichment culture, nitrite could only become available through nitrate reduction which its production was either coupled to methane oxidation or sulfide oxidation. Thus, nitrite reducing bacteria, Ca. K. stuttgartiensis and Ca. M. oxyfera each would compete for nitrite. However, after anammox sp. diminished from the enrichment culture more nitrite would be available for Ca. M. oxyfera sp.
Figure 2: Expression levels of key nitrogen metabolising genes from Ca. M. oxyfera, Ca. K. stuttgartiensis and Ca. M. nitroreducens. A: expression of hydrazine synthase at Day 1 (T0) and after 10 weeks (T10) from Ca. K. stuttgartiensis. B: expression of nitrite reductase from both metagenome bins of Ca. M. oxyfera. C: Expression of NrfA and NrfH from Ca. M. nitroreducens from both RNA sequenced samples.
91 CHAPTER 3
This observation was supported by significantly elevated nirS expression (Figure. 2B) of Ca. M. oxyfera_2 in sample T10. It was hypothesized that in the bioreactor, ammonium for anammox bacteria would be produced through DNRA since, the Ca. N. versatile and Ca. M. nitroreducens genomes encoded nrfAH, genes responsible of dissimilatory nitrite reduction to ammonium (DNRA). According to meta- transcriptome analysis, the nrfAH operon of Ca. M. nitroreducens showed expression (Figure. 2C), while for Ca. N. versatile no expression was observed. Interestingly, expression levels of the NrfA and NrfH subunits were higher in sample T10 confirming the potential DNRA activity of Ca. M. nitroreducens (Arshad, Speth, de Graaf, et al., 2015; Ettwig et al., 2016b).
Substrate consumption and Fluorescence in situ hybridization The bioreactor received same the quantities of nitrate, methane and sulfide as described in Chapter 2. A comprehensive investigation of daily substrate consumption was carried out in the aforementioned study that showed, sulfide being completely consumed with a nitrate consumption rate of 2.6 mmol per day. The residual nitrate concentrations were determined and fluctuated around 4 mM while, no nitrite could be measured in the bioreactor Chapter 2 (Arshad et al., 2017) Similarly, during this study nitrogenous substrate consumption was measured as well, we monitored concentration of nitrate, nitrite and ammonium in the bioreactor for a period of 12 days prior to T10 sample collection. Nitrate determination revealed residual concentrations of 3 mM (Figure. 3A) while, ammonium, nitrite and sulfide concentrations remained below detection limit. The overall nitrate and nitrite concentrations appeared consistent to the previously observed concentrations.
92 Dissimilatory nitrate reduction to ammonium in estuarine conditions
3
Figure 3: Nitrate concentration and FISH micrographs of the bioreactor. A: Nitrate concentration in the bioreactor over a 12 day period. B: Anammox bacteria visible in green (Amx368-FLUOS) and general bacteria visible in blue (Eub338 I-III-Cy5) on 1st day of reactor operation with no ammonium supply (T0). C: Anammox bacterial visible in magenta (Amx368-Cy3) and general bacteria hybridized with (Eub338 I-III-Cy5) after 10 weeks (T10).
Furthermore, molecular characterization of the microbial community in reactor was performed through fluorescencein situ hybridization (FISH). The FISH micrographs from biomass collected at T0 (0 days) and T10 (10 weeks) revealed the presence of anammox bacteria in the enrichment culture (Figures. 2B, 2C). No decrease in anammox abundance was observed after 10 weeks of reactor operation without ammonium. These FISH results contradicted the findings that anammox bacteria had been out competed in the T10 sample as concluded from the transcription data. Furthermore, the anaerobic methanotrophic archaeon Ca. M. nitroreducens and its bacterial partner Ca. M. oxyfera were detected in both samples (Supplementary Figure. 2A, 2C). The apparently denitrifying, sulfide-oxidizing proteobacteria related to Thiobacillus sp. (Supplementary Figure. 2B, 2D) were also detected. The substrate concentrations and FISH results suggested a similar microbial community profile of enrichment culture as described in Chapter 2 Arshad( et al., 2017).
Discussion
Microbial cooperation and competition In order to acquire substrates, microorganisms compete, cross feed or collaborate with other microorganisms in natural as well as man-made ecosystems. Therefore we investigated the changes in microbial community composition and expression levels in a laboratory scale anoxic bioreactor mimicking brackish (1% NaCl), or estuarine
93 CHAPTER 3
conditions supplied with nitrate, sulfide, and methane under severe ammonium- limitation. Nitrogen was emitted from enrichment culture as gaseous nitrogen N2 which was brought about by microbial activities of anammox bacteria, sulfide- dependent denitrifiers, and a consortium of nitrate- and nitrite-dependent anaerobic methanotrophs (Chapter 2: Arshad et al., 2017). The metagenomic characterization of the aforementioned enrichment culture revealed that two members of the microbial community, Ca. M. nitroreducens and a novel Nitrospirae bacterium Ca. Nitrobium versatile, both contained genetic potential to perform DNRA. The capability of Ca. M. nitroreducens-like archaea to perform DNRA has been suggested previously ((Arshad, Speth, de Graaf, et al., 2015; Ettwig et al., 2016b), but lacked physiological evidence so far. Here, we investigated the possibility of DNRA in the enrichment culture and further hypothesized that ammonium produced through DNRA could be utilized by anammox. In order to study the anammox activity with ammonium supplied by DNRA, we gradually removed ammonium from the mineral medium. Next, metatranscriptome sequencing was performed on samples (T0) collected on day 1 and samples (T10) collected after 10 weeks of reactor operation with no ammonium supply. Metatranscriptome analysis indicated that, there was a clear community shift between the start and at the end of 10 weeks reactor operation. The mRNA reads abundance for Candidatus K. stuttgartiensis decreased from 1% to 0.1% furthermore, stable isotope labelling based activity measurements did not provide any evidence of anammox activity during the ammonium-limitation (data not shown). However, the successful detection of anammox bacteria by FISH may be explained through the high stability of anammox ribosomes which are known to persist over prolonged periods of starvation or inhibition (Schmid et al., 2001). Besides anammox, methane- dependent denitrifiers were the main contributors towards overall nitrogen loss. Ca. M. nitroreducens (60% abundance) and sulfide-dependent denitrifiers provided nitrite for Ca. M. oxyfera and anammox bacteria. The decrease of anammox activity meant that more nitrite became available for Ca. M. oxyfera thus, resulting in high read abundance (50%) of Ca. M. oxyfera species. Although, both Ca. M. oxyfera and anammox bacteria have low affinity constants for nitrite (Strous and Jetten, 2004; Ettwig et al., 2008), the nitrite consumption rates reported in literature by anammox bacteria are much higher than that of Ca. M. oxyfera (Hu et al., 2015) therefore, once anammox sp. disappeared from the enrichment culture nitrite-reducing methanotrophic bacteria Ca. M. oxyfera clearly thrived. Furthermore, the identification of sulfide–oxidizing member could not be performed successfully. The extremely low (less than 1%) reads abundance of the
94 Dissimilatory nitrate reduction to ammonium in estuarine conditions
A previously (Chapter 2) identified sulfide oxidizing members related toS. denitrificans (82.6% identity of RpsC, S3 protein to S. denitrificans skB26) and Thiobacillus spp. in both sequencing samples suggested a possible bias of RNA isolation method. This notion was also supported by successful detection of Thiobacillus spp. in T10 and T10 samples through FISH (Figure S2. 2B and 2D). Therefore, it seems highly unlikely that sulfide oxidizing autotrophic denitrifiers were out competed from the enrichment culture. Most surprisingly, the novel Nitrospirae bacterium Ca. Nitrobium versatile disappeared over 10 weeks of cultivation. The disappearance of Ca. N. versatile poses an interesting question with regards to the link between cultivation 3 conditions and the possible physiological role of these microorganisms. Previously, the genome based metabolic reconstruction of Ca. N. versatile revealed the potential for use of a wide range of electron donors including, hydrogen, pyruvate, lactate, acetate and formate, as well as complete pathway for oxygen, nitrate, and sulfate respiration. Additionally, it harboured a complete Wood-Ljungdahl pathway for
CO2 fixation or acetate oxidation. Hence, this microorganism is suggested to be a versatile facultative anaerobe, which is capable of either an organoheterotrophic or chemolithoautotrophic lifestyle (Arshad et al., 2017). Additionally, the Nitrospirae genome did not encode enzymes needed for ammonium and methane activation thereby suggesting that it does not metabolize these substrates. Therefore, it remains puzzling as to what factors caused the disappearance of these microbes from the enrichment culture.
Dissimilatory nitrate reduction We investigated the prevalence of the DNRA process in the enrichment culture that contained microorganisms of carbon, nitrogen and sulfur cycles, cultivated under anoxic conditions. A clear increase in the expression of the nrfAH operon from Ca. M. nitroreducens suggested that part of nitrate was reduced to ammonium. The metatranscriptome analysis did not reveal expression of an nrfAH operon from any other member of the microbial community besides Ca. M. nitroreducens. The members of sulfide-dependent denitrifying community and nitrate-nitrite dependent methanotrophs were both present in the enrichment culture. It is known that, denitrification and DNRA performing microorganisms both compete for nitrate as electron acceptor in absence of oxygen or at low oxygen concentrations. Furthermore, the C:N ratio is one of the most dominant parameter that guides the competition between DNRA and denitrification (Kraft et al., 2014; van den Berg et al., 2016; van den Berg, Elisário, et al., 2017; van den Berg, Rombouts, et al., 2017). A full array of studies performed on sediments or sludge samples have reported production
95 CHAPTER 3
of ammonium at higher C:N ratios(Tiedje et al., 1982; King and Nedwell, 1985;
Akunna et al., 1993). Thus, a high electron donor (CH4, sulfide) to low nitrogen - (NO3 ) ratio was provided to the bioreactor. Although, the expression of NrfA and NrfH subunits increased over time (Figure. 2C) we could not detect any ammonium production through colorimetric assays. Since, the ammonium was removed from the supply of the reactor, the the ammonium produced during DNRA might be utilized as the nitrogen source for biomass assimilation. Moreover, the limited DNRA capacity of our enrichment culture could be due to lack of stringent cultivation conditions. Several laboratory studies performed on environmental samples and on pure cultures have shown physiological evidence of DNRA but these bacterial cultures have not been enriched and isolated based on their DNRA capacity (Dunn et al., 1979; Cole and Brown, 1980; King and Nedwell, 1985; Rehr and Klemme, 1989; T. O. Strohm et al., 2007; Rütting et al., 2011; Hardison et al., 2015). Only recently, two studies (Kraft et al., 2014; van den Berg et al., 2015) successfully enriched DNRA bacteria in a marine mesocosm continuous system and in a chemostat set-up started from activated sludge. In both of these systems nitrate was provided as exclusive electron acceptor. Both studies confirmed that limitation of nitrate as electron acceptor was absolutely necessary for successful enrichment of DNRA bacteria. Although a lower nitrate to carbon ratio was supplied in this study, the nitrate concentration was not limiting as shown in Figure. 3A. there was about 3 mM residual nitrate present in the bioreactor and such cultivation condition might favour denitrification over DNRA (Tiedje et al., 1983; Schmidt et al., 2011). Therefore in the future, a study with nitrate-limiting conditions might result in higher DNRA activity in our enrichment culture. The presence of NrfA and NrfH proteins in the Ca. M. nitroreducens genome is considered an acquired potential for nitrite removal as the NO producing nitrite reduction machinery is absent in these anaerobic methanotrophs (Arshad, Speth, de Graaf, et al., 2015; Timmers et al., 2017). Nevertheless, future physiological studies focusing on DNRA capacity of Ca. M. nitroreducens could be essential in further expanding our understanding of microbial interactions linked to DNRA, nitrate-reduction coupled to methane oxidation and anammox bacteria in brackish or estuarine environments.
96 Dissimilatory nitrate reduction to ammonium in estuarine conditions
Supplementary materials
3 Supplementary Fig. S1: Quality score threshold and % of the reads corresponding to the set quality threshold.
Supplementary Table S1: Overview of metagenome bins used as reference data set for meta-transcriptome analysis BioProject BioSample Accession Organism PRJNA397647 SAMN07483517 NSJJ00000000 Sulfuricella denitrificans (Ru_enrich_SD) PRJNA397647 SAMN07483511 NSJK00000000 Xanthomonadales bacterium (Ru_enrich_XN) PRJNA397647 SAMN07483510 NSJL00000000 Nitrospira sp. (Ru_enrich_NS) PRJNA397647 SAMN07483406 NSJM00000000 Candidatus Methylomirabilis sp. (Ru_enrich_MO2) PRJNA397647 SAMN07483405 NSJN00000000 Candidatus Methylomirabilis oxyfera (Ru_enrich_MO1) PRJNA397647 SAMN07483404 NSJO00000000 Candidatus Methanoperedens sp. (Ru_enrich_MN) PRJNA397647 SAMN07483403 NSJP00000000 Candidatus Kuenenia stuttgartiensis (Ru_enrich_A3) PRJNA397647 SAMN07482833 NSJQ00000000 Candidatus Scalindua rubra (Ru_enrich_A1)
97 CHAPTER 3
Supplementary Table S2: Number of total mRNA from sample T0 reads mapped to each genome bin T0_S1 T0_S2 T0_S3 Ca. M.nitroreducens 139,841 145,997 193,838 Ca. M.oxyfera_1 45,793 57,581 44,878 Ca. K.stuttgartiensis 3,924 1,606 1,282 Ca. Scalindua brodae 428 215 131 Ca. N.versatile 14,053 10,077 5,772 S.denitrificans 189 151 97 Ca. M.oxyfera_2 11,833 15,320 10,588 Xanthomonodales 194 259 161 Total mapped reads 216,255 231,206 256,747
Supplementary Table S3: Number of total mRNA from sample T10 reads mapped to each genome bin T10_S1 T10_S2 T10_S3 Ca. Mm.nitroreducens 78,661 81,291 219,351 Ca. M.oxyfera_1 27,935 26,555 25,113 Ca. K.stuttgartiensis 120 147 190 Ca. S.brodae 92 131 100 Ca. N.versatile 92 83 88 S.denitrificans 167 156 197 Ca. M.oxyfera_2 25,090 22,703 22,346 Xanthomonodales 662 681 339 Total mapped reads 132,819 131,747 267,724
98 Dissimilatory nitrate reduction to ammonium in estuarine conditions
3
99 Arslan Arshad1, Mike S. M. Jetten1,2, Huub J. M. Op den Camp1 and Cornelia U. Welte1,3
1 Department of Microbiology, Institute for Water and Wetland Research, Radboud University, Nijmegen, The Netherlands 2 Soehngen Institute for Anaerobic Microbiology, Radboud University, Nijmegen, The Netherlands 3 Netherlands Earth Systems Science Center, Utrecht University, The Netherlands.
Frontiers in Microbiology (2015) doi: 10.3389/fmicb.2015.01423 A metagenomics-based metabolic model of nitrate-dependent anaerobic oxidation of methane by Methanoperedens-like archaea
4 CHAPTER 4
Abstract
Methane oxidation is an important process to mitigate the emission of the greenhouse gas methane and further exacerbating of climate forcing. Both aerobic and anaerobic microorganisms have been reported to catalyze methane oxidation with only a few possible electron acceptors. Recently, new microorganisms were identified that could couple the oxidation of methane to nitrate or nitrite reduction. Here we investigated such an enrichment culture at the (meta)genomic level to establish a metabolic model of nitrate-driven anaerobic oxidation of methane (nitrate-AOM). Nitrate-AOM is catalyzed by an archaeon closely related to (reverse) methanogens that belongs to the ANME-2d clade, tentatively named Methanoperedens nitroreducens. Methane may be activated by methyl-CoM reductase and subsequently undergo full oxidation to carbon dioxide via reverse methanogenesis. All enzymes of this pathway were present and expressed in the investigated culture. The genome of the archaeal enrichment culture encoded a variety of enzymes involved in an electron transport chain similar to those found in Methanosarcina species with additional features not previously found in methane-converting archaea. Nitrate reduction to nitrite seems to be located in the pseudoperiplasm and may be catalyzed by an unusual Nar-like protein complex. A small part of the resulting nitrite is reduced to ammonium which may be catalyzed by a Nrf-type nitrite reductase. One of the key questions is how electrons from cytoplasmically located reverse methanogenesis reach the nitrate reductase in the pseudoperiplasm. Electron transport in M. nitroreducens probably involves cofactor F420 in the cytoplasm, quinones in the cytoplasmic membrane and cytochrome c in the pseudoperiplasm. The membrane-bound electron transport chain includes F420H2 dehydrogenase and an unusual Rieske/cytochrome b complex. Based on genome and transcriptome studies a tentative model of how central energy metabolism of nitrate-AOM could work is presented and discussed.
102 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea
Introduction
Methane is an important greenhouse gas that is produced by microbiological processes, mainly methanogenesis in freshwater and marine ecosystems (Thauer et al., 2008) and the demethylation of methylphosphonates in the ocean (Metcalf et al., 2012). Part of the produced methane is oxidized by methanotrophic microorganisms leading to a reduced amount of methane escaping into the atmosphere. Methanotrophic microorganisms can be divided into two classes. Aerobic methanotrophs are bacteria that make use of the enzyme methane monooxygenase to activate the inert methane molecule (Sirajuddin and Rosenzweig, 2015). Anaerobic methanotrophs use an external electron acceptor other than oxygen and can be found in both prokaryotic domains, Bacteria and Archaea (Boetius et al., 2000; Ettwig et al., 2010; Haroon et al., 2013). 4 Nitrite-dependent anaerobic oxidation of methane (AOM) is catalyzed by the anaerobic bacterium Methylomirabilis oxyfera that belongs to the NC10 phylum (Ettwig et al.,
2010). After reduction of nitrite to NO it presumably dismutates NO to N2 and O2 to subsequently make use of the produced oxygen for an aerobic-type methane activation reaction via methane monooxygenase (Ettwig et al., 2010; Ettwig et al., 2012). All other anaerobic methanotrophs have been reported to belong to the domain Archaea and presumably use the reverse reaction of methyl-coenzyme M reductase – the key enzyme in methanogenesis – for the activation of methane (Krüger et al., 2003; Scheller et al., 2010). So far, enrichment cultures were reported to couple the oxidation of methane to the reduction of sulfate or nitrate (Boetius et al., 2000; Raghoebarsing et al., 2006; Haroon et al., 2013). Sulfate-dependent AOM seems to be catalyzed by the symbiotic association of an anaerobic methanotrophic archaeon (ANME) with a bacterial sulfate reducing partner (Knittel and Boetius, 2009; Ruff et al., 2015). Nitrate-dependent AOM, in contrast, seems to be catalyzed by an archaeal methanotroph alone that was named Methanoperedens nitroreducens and is affiliated to the ANME-2d clade (Raghoebarsing et al., 2006; Haroon et al., 2013). In this study, we report on the environmental genome and transcriptome of a Methanoperedens-like archaeon that was found in an enrichment culture performing nitrate-dependent AOM. This draft genome was used to establish a putative model of how nitrate-dependent methanotrophy could work. We discuss how the cytoplasmic process of methane oxidation via reverse methanogenesis may be coupled to the pseudoperiplasmically located reduction of nitrate to nitrite and ammonium by Nar- and Nrf-type nitrogen cycle enzymes. Several cytoplasmic and membrane-bound enzyme complexes homologous to enzymes in methanogens were found and are apparently combined with several metabolic traits not previously found in methanogenic or methanotrophic archaea.
103 CHAPTER 4
Materials and Methods
Biological source material An initial enrichment culture that contained Methylomirabilis oxyfera and Anaerobic oxidation of methane Associated Archaea (AAA) (Raghoebarsing et al., 2006) was further enriched with the effluent of another reactor that was dominated by M. oxyfera. It contained mineral medium saturated with CH4, low nitrite (50 µM) and high nitrate (2–3 mM). After about 1 year of enrichment, the reactor was uncoupled from the M. oxyfera reactor, and kept flushed with CH4-CO2 (v:v; 95:5). Nitrate was added daily as sole electron acceptor (1-3 mM final concentration) for over 2 years. The reactor was operated in batch mode. Every two weeks, approximately 30 % of the supernatant was removed and the reactor replenished with fresh anoxic mineral medium (as previously described by (Ettwig et al., 2009), omitting nitrate and nitrite). The AAA microbe in the reactor was closely related to Methanoperedens nitroreducens identified by Haroon et al. (Haroon et al., 2013) and will subsequently be referred to as M. nitroreducens MPEBLZ whereas the strain identified by Haroon et al. will be referred to as M. nitroreducens ANME2D.
Metagenome and -transcriptome sequencing DNA of the M. nitroreducens MPEBLZ enrichment culture was isolated with a method based on bead beating and SDS lysis as described previously (Ettwig et al., 2009). Total RNA was isolated with the Ambion RiboPureTM Bacteria Kit (MO BIO Laboratories, Uden, The Netherlands) according to the manufacturer’s manual. DNA and RNA quality was checked by agarose gel electrophoresis, and concentrations were measured in triplicate with the NanoDrop (ND-1000; Isogen Life Science, The Netherlands). All kits used in library preparation and sequencing were obtained from Life technologies (Life Technologies, Carlsbad, CA, USA). Genomic DNA was sheared for 5 minutes using the Ion Xpress™ Plus Fragment Library Kit. Further library preparation was performed using the Ion Plus Fragment Library Kit following manufacturer’s instructions. Size selection of the library was performed using an E-gel 2% agarose gel. The library was used for two sequencing runs. For both runs, emulsion PCR was performed using the OneTouch 200bp kit and sequencing was performed on an IonTorrent PGM with the Ion PGM 200bp sequencing kit and an Ion 318 chip, resulting in a total of 10 million reads with an average length of 170 bp. RNA was sequenced after removal of ribosomal RNA using the MicrobExpress kit (Thermo Scientific, Amsterdam, The Netherlands). The library for RNA-seq was prepared using the RNA-seq kit v2 (Life Technologies,
104 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea
Carlsbad, CA, USA) and two sequencing runs were performed as described above for the metagenomic library.
Assembly, binning and annotation of the Methanoperedens nitroreducens MPEBLZ draft genome For the construction of the environmental genome, reads were trimmed on quality and length (>100bp). The remaining 8.1 million reads, average length 196bp, were assembled de novo using the CLC genomics workbench (v6.5.1, CLCbio, Aarhus, Denmark) with word size 31 and bubble size 5000. Contigs were assigned to M. nitroreducens MPEBLZ based on coverage and GC content. The obtained 514 contigs were annotated using Prokka (version 1.10 (Seemann, 2014)) using an additional custom database containing the genomes of methanogens Methanosarcina 4 barkeri str. Fusaro (NC_007355), Methanosarcina mazei Gö1 (NC_003901) and Methanosarcina acetivorans C2A (NC_003552). After annotation, a round of manual curation was performed to correct detected frameshifts and the contigs were re-annotated. Of the total 4528 ORF’s identified 2004 were marked as hypothetical proteins after manual curation. CLC genomics workbench and the sequence visualization and annotation tool Artemis was used to analyse the features of annotated contigs (Rutherford et al., 2000). Initially, reference protein sequences belonging to several methanogenic archaea were retrieved in CLC genomics workbench and homologous protein sequences from M. nitroreducens MPEBLZ were identified through local BLASTp. Next, BLASTp was used to identify homologues of M. nitroreducens target proteins in strain ANME2D. Results were analysed based on % sequence identity and expectation value (e-value). Homologues to strain ANME2D were defined as exhibiting an e-value-10 <10 and a sequence identity higher than 40%. Signal peptides were predicted with the PRED-SIGNAL tool (Bagos et al., 2009). This Whole Genome Shotgun project has been deposited at DDBJ/EMBL/ GenBank under the accession LKCM00000000. The version described in this paper is version LKCM01000000.
Transcriptome analysis The draft genome sequence of the Methanoperedens nitroreducens MPEBLZ was used as the template for the transcriptome analysis. Expression analysis was performed with the RNA-Seq Analysis tool from the CLC Genomic Workbench software (version 8.0, CLC-Bio, Aarhus, Denmark) and values are expressed as RPKM (Reads Per Kilobase of exon model per Million mapped reads (Mortazavi et al., 2008)).
105 CHAPTER 4
Cofactor analysis of Methanoperedens nitroreducens MPEBLZ For the analysis of lipid soluble electron carriers, reactor biomass was first investigated with fluorescencein situ hybridization (FISH) at the time of sampling to quantify the relative amount of M. nitroreducens. FISH was performed as described in (Daims et al., 2005) with the probes Arch915 and Eubmix (Stahl and Amann, 1991; Daims et al., 1999). About 50 % archaea were found with M. nitroreducens as the only archaeon present as found by metagenome sequencing. Subsequently, 50 mg freeze dried cells were grinded with a 5/32” steel ball with a Retsch MM 300 mixer mill at 60 Hz for 2 min. To each of the grinded samples 1 mL water and 500 µL pentane (GC grade) was added. The samples were vortexed for 2 min at maximum speed, placed in an ultrasonic bath for 2 min and centrifuged for 5 min at 12000 x g. The upper pentane phase was transferred to a new tube. Another 500 µL pentane was added to the lower (water) phase and the extraction procedure was repeated as described above. Both pentane phases were combined and evaporated to dryness under a nitrogen flow. The dried extracts were dissolved in 200 µL methanol/ethanol (80:20) and aliquots of 90 µL were injected on an Agilent 1100 HPLC containing a Merck LiChrospher 100 RP-18 (5µm) column (250mm x 4.6mm; flow 0.750 mL/min, peak detection by diode array detector [DAD], integration wavelength 248 nm). The DAD was also used to obtain UV/Vis spectra from 200 to 600 nm. After 3 min isocratic elution with 20% ethanol in methanol a linear gradient to 100% ethanol in 12 min followed by 10 min isocratic elution with 100% ethanol was used for separation. Methanol and ethanol were of HPLC grade. Ubiquinone 10 (UQ10, Sigma-Aldrich), menaquinone 4 (MK4, Supelco) and a methanophenazine standard provided by Uwe Deppenmeier (University of Bonn, Germany) were used as reference compounds. Phase contrast and fluorescent micrographs were taken with a Leitz Dialux microscope according to the method by (Doddema and Vogels, 1978).
Results and Discussion
Re-construction of the Methanoperedens nitroreducens MPEBLZ genome The here presented genome was reconstructed from a metagenome dataset of a bioreactor enrichment culture that coupled the anaerobic oxidation of methane to nitrate reduction to nitrite and ammonium (Zhu, 2014). Contigs from a de novo metagenome assembly were binned based on coverage and GC-content (Supplementary Figure S1). The community in the reactor was dominated by two organisms, Methanoperedens nitroreducens MPEBLZ and an organism closely
106 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea
related to Methylomirabilis oxyfera that will not be discussed here (the analysis of all 16S rRNA gene reads of the metagenome is displayed in Supplementary Table 1). The 16S rRNA gene of M. nitroreducens MPEBLZ and M. nitroreducens ANME2D were 95% identical. Manual curation of the binned contigs resulted in a 3.74 Mb draft genome of M. nitroreducens MPEBLZ, on 514 contigs longer than 500 bp. Based on variation present in the reads supporting the draft genome, it is a consensus genome composed of (at least) two very closely related strains. The draft genome contains homologs of all 103 proteins used by Haroon et al. to assess the completeness of the M. nitroreducens ANME2D draft genome (Haroon et al., 2013). Additionally, we have assessed completeness of the draft genome using the lineage specific workflow of checkM, resulting in an estimated completeness higher than 96%, based on 228 markers (Parks et al., 2015). Although the coverage of two contigs that encoded the 4 nitrate reductases is higher than that of the contigs containing the core proteins, the sequence composition and gene content of these contigs support their inclusion in the M. nitroreducens MPEBLZ draft genome sequence.
The core pathway of methanotrophy is well conserved and located in the cytoplasm We found a full reverse methanogenesis pathway in the M. nitroreducens MPEBLZ genome which is in accordance with the study of Haroon et al. (Haroon et al., 2013) and Wang et al. for ANME-2a (Wang et al., 2014). Methane is probably activated by methyl-coenzyme M reductase (Krüger et al., 2003; Shima and Thauer, 2005; Scheller et al., 2010) which was also the most highly transcribed gene cluster detected in the transcriptome. The methyl group is then transferred to the cofactor methanopterin by the action of a Na+ translocationg methyl transferase (Hallam et al., 2004). In methanotrophy, this reaction may dissipate part of the membrane potential (Becher et al., 1992); the sodium/proton gradient to drive this reaction has to be built up in the subsequent steps of methanotrophy. After the transfer to methanopterin, the methyl group is oxidized to CO2 by the reverse reaction of methanogenic enzymes (Hallam et al., 2004; Scheller et al., 2010; Thauer, 2011). The reverse methanogenesis pathway also contained a mer gene which encodes the F420-dependent 5, 10-methenyltetrahydromethanopterin reductase. Within the ANME archaea, this gene seems to be confined to members of the ANME-2 clade (Haroon et al., 2013; Wang et al., 2014) and is missing in ANME-1 clade archaea. We investigated whether biosynthesis pathways for the crucial C1 carrier molecules were encoded in the genome. For the first acceptor of the methyl group, coenzyme M (2-mercaptoethanesulfonate), we observed that the canonical pathway employing
107 CHAPTER 4
the enzymes ComABCDEF was not encoded but instead the pathway as described for Methanosarcinales and Methanomicrobiales that consists of ComDEF together with cysteate synthase (Graham et al., 2009). Both the biosynthesis pathways for methanofuran and methanopterin are not fully resolved in methanogenic archaea; we could however assign putative biosynthesis proteins according to the report of Kaster et al. ((Kaster et al., 2011a), Supplementary Table 2).
According to our model, electrons from the core methanotrophic pathway are transferred to the cytoplasmic cofactors F420, coenzyme B and ferredoxin. The biosynthetic pathways for coenzyme B and cofactor F420 were, as far as resolved for methanogens (Kaster et al., 2011a), also encoded in the Methanoperedens genomes (Supplementary Table 2). Cells sampled from the bioreactor showed typical
F420 fluorescence as also found in methanogens (Figure 1). The M. nitroreducens MPEBLZ genome harbored 9 genes encoding soluble [4Fe4S] ferredoxins whereas Methanosarcina spp. encode up to 20 (Welte and Deppenmeier, 2011a).
Figure 1: F420 fluorescence of aggregated biomass in the nitrate-AOM enrichment culture. (A) Phase contrast micrograph, (B) fluorescence micrograph with an excitation wavelength of 390 nm and an emission wavelength of 420 nm, (C) overlay of the phase contrast and the fluorescence micrograph showing that not all cells in the aggregates exhibit F420 fluorescence.
Nitrate and nitrite reducing enzymes are predicted to be located in the pseudoperiplasm Nitrate reduction in archaea is a process that is not yet well characterized (Martinez- Espinosa et al., 2007). Bacterial Nar-type nitrate reductase has its active site directed towards the cytoplasm, whereas archaeal nitrate reduction by the Nar enzyme seems to take place at the extracellular side of the cytoplasmic membrane (Yoshimatsu et al., 2000; Martinez-Espinosa et al., 2007; de Vries et al., 2010). If, or how, this process is coupled to the build-up of a proton motive force is not yet known. Different protein interaction partners were suggested to anchor the soluble subunits NarGH to the
108 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea
cytoplasmic membrane (Martinez-Espinosa et al., 2007; Yoshimatsu et al., 2007). De Vries et al. (2010) co-purified a protein designated NarM together with NarGH from the Pyrobaculum aerophilum membrane fraction and consequently suggested that it forms the membrane anchor spanning the cytoplasmic membrane with one transmembrane helix. It is encoded in an operon with narGH and is conserved in most archaeal nar operons (de Vries et al., 2010) but not in M. nitroreducens MPEBLZ and ANME2D. The M. nitroreducens MPEBLZ genome contains two nitrate reductase operons, whereas in the genome of the culture investigated by Haroon et al. (Haroon et al., 2013) only one was found. One narG copy appeared to be part of a conserved gene cluster between the two methanotrophs (MPEBLZ_02035-02041, Table 1) and the respective protein was 24 % identical on amino acid level to the second copy in the M. nitroreducens MPEBLZ genome (RPKM value 342). The 4 narG operon conserved in the two methanotrophs was further investigated. The gene cluster comprises seven genes with the alpha and beta subunits of the nitrate reductase (NarG and NarH, respectively) encoded in the beginning of the cluster. The NarG protein contains an N-terminal TAT signal peptide for translocation across the cytoplasmic membrane (Table 1); the M. nitroreducens genomes also encoded the biosynthetic proteins needed for production and insertion of the molybdopterin cofactor (Supplementary Table 2, (Vergnes et al., 2004)). In P. aerophilum and other archaea, narGH are followed by the narM gene encoding the putative membrane anchor (de Vries et al., 2010). In Methanoperedens, we could not find a homologue to narM in the respective nar gene cluster or elsewhere in the genome indicating that this organism contains a nitrate reductase with an unusual subunit composition. Other proteins encoded in the gene cluster comprised the chaperone NarJ and a pseudoperiplasmic b-type cytochrome homologous to the Haloferax mediterranei Orf7 protein which was hypothesized to interact with NarGH in this organism (Martinez-Espinosa et al., 2007). Furthermore, a protein homologous to NapH was encoded in the gene cluster. This protein is a membrane integral subunit with four transmembrane helices of some periplasmic nitrate reductases in bacteria (Brondijk et al., 2002; Brondijk et al., 2004; Kern and Simon, 2008). It usually co-occurs with NapG that mediates the electron transfer to the catalytic subunits NapAB (Brondijk et al., 2004). In M. nitroreducens MPEBLZ and ANME2D, we could not find homologues to NapG or NapAB. The C-terminus of the NapH-like protein is instead extended and contains five additional transmembrane helices. Two other proteins that were encoded in the same gene cluster were homologous to subunit II of heme copper oxidases (Pereira et al., 2001). As all of the genes encoding these proteins were considerably expressed (Table 1) they may form an unusual nitrate reducing
109 CHAPTER 4
(transient) membrane-bound protein complex (Figure 2), a possibility that has to be addressed by further biochemical studies.
Table 1: Description of proteins encoded in the nar operon of Methanoperedens species. All listed proteins have a well conserved homologue in the M. nitroreducens ANME2D genome and the respective genes are highly transcribed in M. nitroreducens MPEBLZ (high RPKM values). Locus identifier Homologue Homologue in % identity RPKMc Transmembrane Signal to ANME2D between helices peptide described ANME2D protein and MPEBLZb MPEBLZ_02035 NarG ANME2D_03460 81 739 no 1-42 MPEBLZ_02036 NarH ANME2D_03461 83 685 no no MPEBLZ_02037 NarJ ANME2D_03462 73 792 no no MPEBLZ_02038 Orf7 ANME2D_03463 66 1209 no 1-32 MPEBLZ_02039 HCO IIa ANME2D_03464 74 630 1 1-23 MPEBLZ_02040 NapH ANME2D_03465 80 1367 9 no MPEBLZ_02041 HCO IIa ANME2D_03466 65 1396 1 no a Heme copper oxidase subunit II b alignment covers more than 90 % of the query protein sequence, In the bioreactor that contained the enriched M. nitroreducens MPEBLZ culture, part of the nitrite was further reduced to ammonium (Zhu, 2014). It is evident that not all nitrite was reduced to ammonium as so far M. nitroreducens was always co-enriched with dedicated nitrite utilizers like Methylomirabilis oxyfera (Haroon et al., 2013; Zhu, 2014) or anaerobic ammonium oxidizers (Haroon et al., 2013) that reduced nitrite to dinitrogen gas. In Escherichia coli, the activities of nitrate and nitrite reductases are concerted by a complicated regulatory network (Rabin and Stewart, 1993; Tyson et al., 1993; Chiang et al., 1997; Wang and Gunsalus, 2000; Noriega et al., 2010). Besides the oxygen availability, one of the key factors in E. coli for the regulation of transcription of nar and nrf genes seems to be the concentration of nitrate and nitrite in the culture medium (Wang et al., 1999; Wang and Gunsalus, 2000). In the same studies it was demonstrated that not all nitrite was converted to ammonium under all experimental conditions but is instead excreted into the medium. As a similar finding was observed in the here presented enrichment culture it is probable that also the archaeon M. nitroreducens contains regulatory mechanisms for gene expression of nitrogen cycle enzymes. When we searched the Methanoperedens protein complement for enzymes potentially responsible for nitrite-dependent ammonium production, we found proteins that were homologous to the NrfAH type cytochrome c nitrite reductase (Figure 2), an enzyme 110 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea complex that is well characterized in δ- and ε-proteobacteria (Simon et al., 2000; Simon, 2002; Rodrigues et al., 2008). The catalytic subunit NrfA (MPEBLZ_01114, ANME2D_3312) contains – like in bacteria – a signal peptide to be translocated across the cytoplasmic membrane and therefore resides in the archaeal pseudoperiplasm. The amino acid sequence encodes four canonical CxxCH and one CxxCK heme c binding motifs for the coordination of five heme c. Amino acids required for catalysis and binding of the Ca2+ ion were conserved both in MPEBLZ_01114 and the homologous ANME2D_3312 protein (Lys126, Arg106, Tyr216, Gln263, His264, Glu215, Lys 261; Escherichia coli NrfA numbering (Bamford et al., 2002)). The nrfA gene is encoded in an operon next to a gene homologous to nrfH (MPEBLZ_1115; ANME2D_3311). The corresponding protein NrfH contains the canonical four CxxCH heme c binding sites as well as the conserved amino acid residues Lys82 4 and Asp89. It anchors the NrfAH complex in the cytoplasmic membrane and allows the interaction with the quinone pool. As all amino acids known to be involved in catalysis as well as in cofactor coordination are conserved between the bacterial and the here presented archaeal proteins, and furthermore both proteins were expressed (RPKM value of 102 and 113, respectively), this enzyme complex is the best candidate to catalyze the reduction of nitrite to ammonium also in Methanoperedens species. Membrane-bound, quinone-dependent electron transport proteins may couple reverse methanogenesis to nitrate reduction During reverse methanogenesis, electrons are probably transferred to cytoplasmic electron carriers to yield reduced cofactor F420 (F420H2) and reduced ferredoxin. As nitrate reduction seems to take place in the pseudoperiplasm, one of the key questions in generating a metabolic model for nitrate-dependent AOM is how electrons travel across the cytoplasmic membrane and reach the nitrate reductase in the pseudoperiplasm. In the M. nitroreducens MPEBLZ genome, we identified several membrane-integral electron transport proteins that may be involved in this process (Figure 2, Supplementary Table 2). We found an F420H2 dehydrogenase closely related to the F420H2 dehydrogenase of methanogenic archaea that couples the oxidation of F420H2 to the build-up of a proton gradient (Welte and Deppenmeier, 2014). All subunits of this complex are well conserved and expressed which strongly indicates that F420H2 is oxidized by this complex in Methanoperedens. 111 CHAPTER 4 Figure 2: Tentative metabolic pathway model of membrane-bound electron transport in Methanoperedens. Reverse methanogenesis produces F420H2 and the thiol cofactors CoM-SH and CoB-SH as well as reduced ferredoxin (Fdred). F420H2 may be oxidized by the F420H2 dehydrogenase (Fqo) and electrons transferred to menaquinone (MQ, menaquinone; MQH2, menaquinol). The heterodisulfide reductase (Hdr) reaction is reversed resulting in quinone reduction upon CoM-S-S-CoB (heterodisulfide) production. Menaquinol can be oxidized by a Rieske-cytochromeb complex comprising two additional cytochrome c subunits. Electrons are transferred to an unusual nitrate reductase (Nar) complex, presumably via soluble cytochrome c (cytcox/red, oxidized/reduced cytochrome c), to reduce nitrate to nitrite. A small part of the nitrite can further be reduced to ammonium by nitrite reductase (Nrf) with menaquinol as electron donor. The fate of reduced ferredoxin is unclear. It could either be oxidized by Ech hydrogenase, by FrhB or FqoF (homologous to each other) alone or by the hypothesized confurcating HdrABC-FrhB enzyme complex. For more details, see text. Methyltransferase (Mtr) and A1AO ATP synthase make use of the proton motif force built up by the respiratory chain. This metabolic construction is solely based on genome analysis. HCO II, heme copper oxidase subunit II like proteins; cytb, cytochrome b; cytc, cytochrome c; FeS, iron-sulfur cluster; FMN, flavin mononucleotide; FAD, flavin adenine dinucleotide; MPT, molybdopterin, NiFe, nickel-iron center. The genomic arrangement of the corresponding gene cluster in Methanoperedens resembles the one found in Methanosarcina mazei: the F420H2 interacting subunit FpoF/FqoF is encoded apart from the core F420H2 dehydrogenase gene cluster at a different location on the chromosome. The F420H2 dehydrogenase gene cluster also comprises the gene fpoO which is only found in Methanosarcinales but for which there is no known function. The F420H2 dehydrogenase in Methanosarcinales transfers electrons to the membrane integral electron carrier methanophenazine. The 112 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea enzyme is also found in the related Euryarchaeal lineage Archaeoglobales where a homologous complex mediates electron transport to menaquinone (Kunow et al., 1994; Brüggemann et al., 2000). As methanophenazine (E0’ = ‑165 mV, (Tietze et al., 2003)) and menaquinone (E0’ = -80 mV, (Tran and Unden, 1998)) have considerably different redox potentials that have implications for subsequent electron transport pathways in nitrate-dependent AOM, we investigated which of the two lipid-soluble electron acceptors was present in M. nitroreducens MPEBLZ. As the biosynthesis pathway for methanophenazine is not known, we could not mine the genome for presence or absence of these genes. In contrast, there is a complete menaquinone biosynthesis pathway known for Archaeoglobus (Hemmi et al., 2005; Hiratsuka et al., 2008; Nowicka and Kruk, 2010), which is not present in Methanosarcinales. We found that this pathway was present in both M. nitroreducens genomes (Haroon 4 et al., 2013). To obtain further experimental evidence, we extracted quinones and phenazines from the bioreactor biomass that was dominated by cells of strain MPEBLZ and analyzed this fraction with high performance liquid chromatography coupled to UV/Vis spectroscopy (Figure 3). The elution profile of the HPLC chromatogram is shown in Figure 3A. The main peaks in the chromatogram were analyzed with UV/ Vis spectroscopy and showed either a ubiquinone-like spectrum (peak 2, comparable to the spectrum in the right panel of Figure 3B) or a menaquinone-like spectrum (peaks 1, 3, 4, 5, 6, 7, 8, comparable to the spectrum in the middle panel of Figure 3B). We could, however, not detect any fraction that showed the characteristic UV/ Vis spectrum of methanophenazine (spectrum in the left panel of Figure 3B). 113 CHAPTER 4 Figure 3: Analysis of the lipid-soluble electron carriers of the nitrate-AOM enrichment culture. (A) HPLC elution profile as visualized by the absorption at 248 nm. Numbers indicate the peaks that were further characterized by UV/Vis spectroscopy. (B) UV-Vis spectra of standard compounds (left, methanophenazine; middle, menaquinone-4; right, ubiquinone-4) for comparison with spectra obtained from fractions separated by HPLC. Based on the comparison of the experimental spectra to the spectra obtained from the HPLC fractions, the different peaks were assigned to contain a representative from the classes of ubiquinones, menaquinones or methanophenazines. None of the spectra resembled the standard spectrum for methanophenazine (left), seven spectra (obtained from peaks 1,3,4,5,6,7,) resembled the standard spectrum of menaquinone-4 (middle) and one spectrum (obtained from peak 2) resembled the standard spectrum of ubiquinone-4. Different retention times within one molecule class indicate a difference in the prenoid chain length. Experimental spectra are displayed in Supplementary Figure S2. As the culture is an enrichment culture it was not possible to assign one of the quinone fractions to M. nitroreducens MPEBLZ. From these experiments we conclude that it is highly likely that M. nitroreducens MPEBLZ uses menaquinone and not methanophenazine in membrane-bound electron transport (Figure 3). Besides F420H2 dehydrogenase, a membrane-bound heterodisulfide reductase (HdrDE, Figure 2) may contribute to the reduction of the quinone pool. In the M. nitroreducens MPEBLZ genome we were able to locate the gene for the membrane-integral b-type cytochrome subunit HdrE as well as the hydrophilic subunit HdrD. This complex may couple the oxidation of the reduced thiol cofactors CoM-SH and CoB-SH to 114 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea form the heterodisulfide CoM-S-S-CoB (Figure 2). Electrons may be transferred to the membrane-integral electron carrier menaquinone. As the redox potential E0’ of the CoM‑S‑S‑CoB/CoM-SH+CoB-SH redox couple is -143 mV (Tietze et al., 2003), electron transfer to menaquinone (E0’ = -80 mV) would be exergonic whereas electron transfer to methanophenazine (E0’ = -165 mV) would be endergonic. The reduced quinone pool can subsequently be used by membrane-bound oxidoreductases. We could not find membrane-bound quinol oxidases. Instead, we identified an unusual Rieske/cytochromeb (Rieske/cytb) complex encoded in the M. nitroreducens genomes which is homologous to the cytochrome bc1 and b6f complexes of chemotrophs and phototrophs, respectively. These complexes couple the oxidation of quinones to the reduction of periplasmic cytochrome c and the translocation of protons via the Q-cycle (Berry et al., 2000). The canonical cytochrome bc /b f 1 6 4 complex contains a membrane-integral cytochrome b, a periplasmic Rieske iron- sulfur protein and another cytochrome (cytochrome c1 or f) at the periplasmic face, all of which are also encoded by the M. nitroreducens genome (Supplementary Table 2, MPEBLZ_00818 and MPEBLZ_00820 to 00822). The Rieske/cytb gene cluster also comprises two pentaheme c-type cytochromes (MPEBLZ_00816 and 00817) and two hypothetical proteins (MPEBLZ_00819 and 00823), all of which are conserved between the strains MPEBLZ and ANME2D. All eight genes are expressed at similar levels in M. nitroreducens MPEBLZ. This transcriptional pattern combined with the gene cluster arrangement suggests that the proteins MPEBLZ_00818 to 00823 may form a non-canonical Rieske/cytb complex which is in line with the finding that those complexes often harbor additional subunits to the canonical ones (ten Brink et al., 2013). For the related haloarchaea there is strong indication that the Rieske/cytb complex and nitrate reductase are interacting as they are encoded in the same gene cluster (Martinez-Espinosa et al., 2007; Yoshimatsu et al., 2007; Bonete et al., 2008) and the nitrate reductase reaction is inhibited by a the Rieske/cytb complex inhibitor Antimycin A (Martinez-Espinosa et al., 2007). In M. nitroreducens, electrons from the reduced quinone pool may travel via the Rieske/cytb complex and the pentaheme c-type cytochromes to the pseudoperiplasmic space and at that place they may be used by the nitrate reductase to reduce the external electron acceptor nitrate. Ferredoxin and the heterodisulfide may be re-cycled by a novel electron- confurcating enzyme complex The oxidized cofactors ferredoxin and heterodisulfide are needed as electron acceptors during reverse methanogenesis and thus have to be re-oxidized by cytoplasmic or membrane-bound electron transport processes to become available for a new round 115 CHAPTER 4 of methane oxidation. Members of the Methanosarcinales use membrane proteins for heterodisulfide reduction and ferredoxin oxidation (Welte and Deppenmeier, 2014). The genome of Methanoperedens encodes a membrane-bound heterodisulfide reductase (HdrDE, see above) that is highly expressed (RPKM values 946 and 1396, Supplementary Table 2) and therefore presumably the primary CoM-SH/CoB-SH oxidizing enzyme. For ferredoxin oxidation, we did not find an Rnf complex but identified an Ech hydrogenase lacking the subunit EchD (Supplementary Table 2). In the six-subunit Ech hydrogenase, EchD is the only hydrophilic subunit without prosthetic groups and is missing in Ech hydrogenases of some methanogens (Friedrich & Scheide 2000). This indicates that the Ech hydrogenase of Methanoperedens may be functional. Expression values are, however, low (RPKM 52-80, Supplementary Table 2) so it is unclear whether Ech hydrogenase is used by M. nitroreducens under the investigated growth conditions. In hydrogenotrophic methanogens, the cytoplasmic electron bifurcating enzyme complex heterodisulfide reductase (HdrABC) coupled to a hydrogenase (MvhABG) serves as ferredoxin reducing enzyme (Kaster et al., 2011b): electrons from molecular hydrogen are used to reduce the heterodisulfide in an exergonic reaction which in turn drives the endergonic reduction of ferredoxin. When we analyzed the genome for the presence of this enzyme complex, we found that it encodes three copies of hdrABC that are significantly expressed (RPKM values 137-482, Supplementary Table 2) butwe could not detect the mvhABG gene cluster encoding the hydrogenase used in electron bifurcation by methanogenic archaea. In M. nitroreducens, the thiols CoM-SH and CoB- SH (E0’= ‑143 mV) are produced in reverse methanotrophy and would therefore donate electrons to the HdrABC complex; however, the redox potential is too high to allow for a direct reduction of any of the cytoplasmic electron carriers F420, ferredoxin, H2 or NAD(P)+. Instead, the oxidation of the CoM-SH and CoB-SH thiols may be coupled to an electron confurcation reaction in which ferredoxin (E0’≈ -500 mV, (Thauer et 0 al., 2008)) would be oxidized concomitantly and F420 (E ’ = -360 mV, (Walsh, 1986)) reduced. The overall reaction would turn thermodynamically favorable and allow the backwards electron flow from the CoM-SH and CoB-SH thiols to 420F . A possible protein mediating the interaction with F420 and ferredoxin has been described (FpoF, (Welte and Deppenmeier, 2011b)) and a gene encoding a homologous protein (FrhB) was found in proximity of one of the hdrABC copies, suggesting that an HdrABC-FrhB complex may mediate the above described reaction (Figure 4) in Methanoperedens species. FrhB or FpoF alone might also couple the oxidation of ferredoxin to the reduction of F420 as observed in the cytoplasm of Methanosarcina mazei (Welte & Deppenmeier, 2011b). In this case, the energy liberated by the redox reaction (∆E0’≈140 mV) would not be harnessed but released as heat. 116 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea Figure 4: Hypothesis of a novel cytoplasmic electron confurcating heterodisulfide reductase complex for 0 ferredoxin and CoM-S-S-CoB recycling. The exergonic reduction of F420 (E ’=‑360 mV) with reduced ferredoxin (E0’≈‑500 mV) may be coupled to the endergonic electron transfer from the thiol cofactors CoM-SH and CoB-SH 0 4 (E ’=‑143 mV) to F420. This hypothesis is based on the metabolic reconstruction using genome and transcriptome sequencing and is not yet supported by biochemical experiments. FAD, flavin adenine dinucleotide ; FMN, FMN, flavin mononucleotide; FeS, iron-sulfur cluster; FrhB, F420-reducing hydrogenase subunit B; HdrABC, heterodisulfide reductase subunits A, B, C. Hydrogen does not seem to be an intermediate in the electron transport chain In many Methanosarcina sp., hydrogen is an intermediate in anaerobic respiration. It is produced either by the action of Ech hydrogenase during ferredoxin oxidation or by the action of the cytoplasmic F420 hydrogenase (FrhABG) during oxidation of F420H2 (Meuer et al., 1999; Kulkarni et al., 2009). In both cases, molecular hydrogen is subsequently oxidized by a membrane-bound hydrogenase (VhoACG/ VhtACG/VhxACG) to feed electrons into the methanophenazine pool (Welte and Deppenmeier, 2014). In the M. nitroreducens MPEBLZ and ANME2D genomes, genes encoding the Vho/Vht/Vhx hydrogenase were not found indicating that electrons from molecular hydrogen cannot enter the membrane-bound anaerobic respiratory chain of Methanoperedens species. Furthermore, the M. nitroreducens MPEBLZ genome only contained an frhB gene but not frhABG indicating that the F420 hydrogenase is not functional. Methanoperedens nitroreducens lacks genes required for methanogenesis As methanotrophic archaea are closely related to methanogens we investigated whether all proteins necessary for one of the methanogenesis pathways were encoded in the genome. For methylotrophic methanogenesis, members of the Methanosarcinales contain substrate-specific methyl transferases (Krzycki, 2004). In the genome of M. nitroreducens MPEBLZ we could not find such methyl transferases which make it unlikely that this species is able to perform methanogenesis from 117 CHAPTER 4 methylated compounds. For hydrogenotrophic methanogenesis, dedicated hydrogenases have to be encoded in the genome (Thauer et al., 2010). For classical hydrogenotrophic methanogenesis, the HdrABC-MvhABG electron bifurcating complex supplies reduced ferredoxin for CO2 reduction (Kaster et al., 2011b). As the MvhABG complex was not encoded in the here investigated genome, classical hydrogenotrophic methanogenesis does not seem to be possible. Methanosarcina sp. make use of membrane-bound hydrogenases to eventually reduce CO2 to CH4. The responsible Vho/Vht/Vhx hydrogenase (subunits) could not be found in the Methanoperedens genome which strongly indicates that neither form of hydrogenotrophic methanogenesis is possible. In case of aceticlastic methanogenesis, acetate first has to be activated to acetyl-CoA. In Methanosarcina sp., this happens via acetate kinase and phosphotransacetylase whereas Methanosaeta sp. use AMP-dependent acetyl-CoA synthetases (ACS) (Jetten et al., 1992; Welte and Deppenmeier, 2014). In the genome of M. nitroreducens MPEBLZ we could not detect genes encoding the first acetate activation system. We found one gene encoding an ADP-dependent ACS. Methanosaeta sp. contain several ACS enzymes that are either used in lipid metabolism or aceticlastic methanogenesis; as we only found one ACS enzyme encoded in the M. nitroreducens MPEBLZ genome which was more related to those enzymes involved in fatty acid metabolism it is unlikely that Methanoperedens archaea can make methane from acetate. It cannot be excluded that hitherto unknown mechanisms lead to ability for methanogenesis in Methanoperedens species but regarding well investigated metabolic pathways for methane formation this metabolic trait is not likely to be found in these organisms. Unusual high number of c-type cytochromes may reflect adaption to the metabolic trait of nitrate reduction The genomes of Methanoperedens species encode an unusually high number of c-type cytochromes (Haroon et al., 2013; Kletzin et al., 2015). The occurrence of c-type cytochromes in archaea was recently reviewed (Kletzin et al., 2015) and it was highlighted that the ANME-2 clade contains apparently the highest number of c-type cytochromes encoded in an archaeal genome. We identified 87 proteins containing at least one CxxCH heme c binding motif. Of these 87 proteins, 68 were homologous to proteins found in M. nitroreducens ANME2D. Kletzin et al. (Kletzin et al., 2015) analyzed this protein subset and came to the conclusion that only 43 of these 68 were likely to be true c-type cytochromes. 19 open reading frames in our M. nitroreducens MPEBLZ genome assembly encoded CxxCH motif(s) but did not have a homologue in the strain ANME2D. A total of 23 CxxCH motif containing 118 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea proteins were abundantly expressed (RPKM value > 500) and more closely investigated, 18 with homologues in the ANME2D genome and five without (Table 2). The annotation of these proteins gave no indication on their function as they were all annotated either as hypothetical protein or cytochrome c protein. Most of the proteins (70 %, Table 2) contained three or more CxxCH motifs (even up to 21) and can therefore be regarded as multiheme c-type cytochromes. Several of those harbored an additional CxxxCH (MPEBLZ_00816, MPEBLZ_00817, MPEBLZ_03194, MPEBLZ_04300) or CxxxxCH motif (MPEBLZ_01743, MPEBLZ_03195). c-type cytochromes generally reside in the periplasm or archaeal pseudoperiplasm (Thöny-Meyer, 1997) and most of the here investigated c-type cytochromes contained a putative signal peptide (Table 2) or an N-terminal transmembrane helix (MPEBLZ_01329, MPEBLZ_04299, MPEBLZ_04300). In addition, several 4 of the proteins (e.g. MPEBLZ_00008, MPEBLZ_00016, MPEBLZ_04347) were homologous to each other. Recently, McGlynn and co-workers identified several large multiheme c-type cytochromes in ANME archaea that may bridge the S-layer to donate electrons to extracellular partner organisms or metal oxides (McGlynn et al., 2015). The respective c-type cytochromes are (at least in part) conserved in the MPEBLZ genome (MPEBLZ_02503 and 02608) but were hardly expressed under our experimental conditions (RPKM values of 27 and 37, respectively). To get insight into the potential function of the 23 abundantly expressed, uncharacterized cytochrome c proteins, we looked for homologues in the nr database using BLASTp (Altschul et al., 1990). For the majority of proteins, no close homologues (besides in strain ANME2D) could be found. An exception to this formed MPEBLZ_02042 which had many homologues in the bacterial and archaeal domain albeit with only moderate sequence identity (≤ 37 %). Homologues that were found for many of the other proteins comprised proteins from the Fe(III) reducing Euryarchaeota Ferroglobus placidus and Geoglobus acetivorans (Mardanov et al., 2015; Smith et al., 2015). The sequence identity was generally low and spanned only part of the protein (Table 2). For both the proteins from F. placidus as well as G. acetivorans, there are no biochemical data available as to their function. However, a recent genomic survey (Mardanov et al., 2015) proposed a potential involvement of several c-type cytochromes in Fe(III) reduction which were encoded by four gene clusters (gace_0099 to 0102 and gace_1341 to _1344, gace_1360 to _1361, gace_1843 to _1847). Many of the c-type cytochromes identified in the Methanoperedens genomes showed homology to proteins encoded in the first two gene clusters. The identity of the amino acid sequences was too weak to allow for a functional comparison between the proteins but it indicates that these proteins 119 CHAPTER 4 (which are also highly expressed) may have a function in pseudoperiplasmic electron transport, possibly to nitrate reductase that resides in the pseudoperiplasm. The protein GACE_1847 is speculated to be the direct electron transfer protein from the cytoplasmic membrane to extracellular hematite crystals in G. acetivorans (Fe2O3, (Mardanov et al., 2015)). It seems to be anchored in the cytoplasmic membrane, span the pseudoperiplasm with an array of c-type hemes (16 CxxCH binding motifs) and then bridge the S-layer to make contact to hematite crystals (Fe2O3) making use of hematite binding motifs at the C-terminus of the protein ([ST]-[AVILMFYW]- [ST]-P-[ST], (Lower et al., 2008; Mardanov et al., 2015)). The Methanoperedens homologues, however, lack the C-terminal amino acid sequence, both for crossing of the S-layer as well as the hematite binding motifs. It is thus unlikely that these proteins are involved in binding to Fe(III) minerals. Three of the c-type cytochrome encoding genes (MPEBLZ_00816 to MPEBLZ_00818) were in the same gene cluster as other subunits for a Rieske/cytb complex indicating their involvement in electron transport from the cytoplasm to the pseudoperiplasm where nitrate and nitrite reductases reside. The metabolically and phylogenetically closely related methanogens of the order Methanosarcinales only contain few c-type cytochromes whose functions are largely unknown. The surprisingly large number of c-type cytochromes encoded by ANME-2d archaea may thus be connected to electron transfer from reverse methanogenesis to nitrate reductase. This is in accordance with the anticipated redox potentials of part of these cytochromes and the apparent low number of encoded ferredoxins in the genome: whereas bioenergetics in methanogenic archaea spans 0 the redox range from about -500 mV (E ’ for CO2/CO and at the same time midpoint potential of ferredoxins used in this process) to ‑143 mV (E0’ (CoM‑S‑S‑CoB/ CoM‑SH+CoB‑SH)), nitrate-dependent methanotrophic archaea operate at a wider 0 - - redox potential range (E ’(NO3 /NO2 ) = +433 mV)) that requires electron carriers with a redox potential of up to +400 mV. c-type cytochromes are ideal candidates to operate in the redox potential range of -143 mV to +433 mV and therefore act as redox carriers in nitrate-dependent anaerobic methanotrophy. 120 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea [aa] 1-25 1-28 1-24 1-41 1-21 1-28 1-28 1-28 1-24 1-25 1-26 1-25 1-32 1-33 Signal peptide predicted predicted 32 / 89 59 / 69 38 / 93 38 / 91 47 / 82 28 / 70 55 / 92 31 / 85 30 / 97 39 / 98 25 / 94 the query over [%] of over [%] identity b Geoglobus acetivorans homologue GACE_1846 GACE_1846 GACE_1361 GACE_1847 GACE_1847 GACE_1847 GACE_1846 GACE_1341 GACE_1847 GACE_0102 GACE_1847 binding sites (CxxCH), predicted signal peptides c [%] 38 / 87 56 / 72 35 / 44 54 / 57 34 / 81 34 / 87 32 / 78 59 / 71 34 / 90 25 / 96 42 / 94 43 / 66 30 / 61 identity the query 4 over [%] of over b placidus Ferp_0668 Ferp_0669 Ferp_0668 Ferp_1813 Ferp_0670 Ferp_0672 Ferp_0670 Ferp_0669 Ferp_1270 Ferp_0670 Ferp_1439 Ferp_2064 Ferp_0676 homologue -20 Ferroglobus Potential cytochrome c 993 932 907 771 767 610 578 560 925 776 625 1138 1102 9148 4802 3683 1747 1739 1496 1472 1394 1073 1775 RPKM a MPEBLZ genome. 29 77 68 57 72 71 62 78 73 42 70 63 70 45 / 43 45 / 42 between 38 (78%) 29 (74%) 32 (54%) MPEBLZ % identity ANME2D and -10 M. nitroreducens none none none none none ANME2D_02830 ANME2D_02824 ANME2D_00867 ANME2D_00431 ANME2D_02837 ANME2D_02837 ANME2D_00625 ANME2D_03235 ANME2D_00599 ANME2D_00603 ANME2D_02824 ANME2D_00604 ANME2D_00625 ANME2D_00600 ANME2D_03236 ANME2D_03237 Homologue in ANME2D Homologue in ANME2D_02827 / _02824 ANME2D_02827 / _02824 -type cytochromes in the -type cytochromes c 4 1 4 5 5 2 5 5 5 1 3 4 5 1 1 1 2 of 11 13 12 21 21 18 CxxCH Number Number Analysis of putative Locus identifier MPEBLZ_01126 MPEBLZ_04274 MPEBLZ_04347 MPEBLZ_00016 MPEBLZ_02042 MPEBLZ_01329 MPEBLZ_01877 MPEBLZ_01878 MPEBLZ_01742 MPEBLZ_00816 MPEBLZ_03194 MPEBLZ_04299 MPEBLZ_04340 MPEBLZ_04300 MPEBLZ_01741 MPEBLZ_03195 MPEBLZ_00008 MPEBLZ_00817 MPEBLZ_00818 MPEBLZ_03918 MPEBLZ_01740 MPEBLZ_01743 MPEBLZ_01301 Reads per Kilobase Million mapped reads alignment covers more than 90 % (otherwise indicated in [%]) of the query protein sequence, 121 CHAPTER 4 Bioenergetics of nitrate-dependent AOM The free energy change associated to nitrate-dependent AOM is high with a Gibbs 0 free energy of ΔG ’ = -523 kJ per mol CH4 oxidized (calculated with the standard 0 - ‑ 0 potentials E ’ (NO3 /NO2 ) = +433 mV and E ’ (CO2/CH4) = -244 mV (Thauer et al., 1977)). According to our metabolic reconstruction (Figure 2), the mechanism of energy conservation in Methanoperedens is electron transport phosphorylation and not substrate level phosphorylation. During reverse methanogenesis, 2 mol Na+ per mol of methane are translocated into the cytoplasm and dissipate the proton/ sodium motive force. At the same time, electrons are transferred to the cytoplasmic cofactors F420, ferredoxin and CoM-S-S-CoB. F420H2 is recycled via the membrane- bound F420H2 dehydrogenase complex and electrons are transferred to a membrane- bound electron carrier, probably menaquinone. In Ms. mazei, two protons are translocated across the membrane in the course of this reaction (Bäumer et al., 2000); as Methanoperedens probably uses the more electropositive menaquinone instead of methanophenazine this reaction yields a higher ΔE and subsequently may catalyze the translocation of up to 3 H+/2 e-. Quinols may be oxidized by the Rieske/ cytb complex that transfers electrons to pseudoperiplasmic cytochrome c; in the course of this reaction, usually 4 H+/2 e- are released at the extracellular side of the membrane via a Q-cycle mechanism (Berry et al., 2000). As for CoM-SH+CoB-SH and ferredoxin also cytoplasmic possibilities to be re-oxidized exist (Figure 4) it is unclear whether their re-oxidation is associated to a build-up of proton motive force. For nitrate reduction in the pseudoperiplasm, it is also not known whether this process is associated to the membrane and thus could contribute to the generation of a proton motive force. Taking together the above mentioned observations, it becomes clear that the oxidation of the four electrons of F420H2 reduced during reverse methanogenesis leads to proton translocation that by far compensates for the 2 Na+ per mol methane that are imported during reverse methanogenesis and allows for the build-up of a proton motive force. This can in turn be used by an A1AO ATP synthase to produce ATP for cellular metabolism and growth. The c-subunit of the M. nitroreducens ATP synthase (MPEBLZ_01699) resembles the Methanosarcina acetivorans c-subunit; all residues required for Na+ and H+ binding are conserved (except for the replacement of Thr-67 by Ser which is a common feature of Na+ translocating ATP synthases) and may therefore drive ATP synthesis by both a proton and a sodium ion gradient (Schlegel et al., 2012). 122 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea Acknowledgements This work was supported by the ERC AG 339880 and the SIAM Gravitation Grant 24002002. The authors thank Rolf Thauer for helpful discussions, Uwe Deppenmeier (University of Bonn) for providing a methanophenazine standard and Geert Cremers, Katinka van de Pas-Schoonen and Theo van Alen for their technical assistance. Baoli Zhu and Simon Guerrero are thankfully acknowledged for providing bioreactor samples for sequencing and cofactor analysis. Conflict of Interest Statement The authors declare that there is no competing financial interest. 4 123 CHAPTER 4 Supplementary materials Supplementary figure 1: Binning plots of the Methanoperedens nitroreducens BLZ1 draft genome Scatterplots of the contigs with sequencing depth >10 assembled from the enrichment culture metagenome. Each point represents one contig, with size of the point proportional to contig length. The bin representing the Methanoperedens nitroreducens draft genome is indicated in red. Panel A shows the GC content of the contigs related to Sequencing depth, whereas panel B-D show the first 3 principle components of a PCA of tetranucleotide frequencies of the contigs in relation to the sequence depth. 124 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea Supplementary Figure S2 A B C e c n a b r o s b A 200 400 600 200 400 600 200 400 600 λ [nm] λ [nm] λ [nm] D E F e c n a b r o s 4 A b 200 400 600 200 400 600 200 400 600 λ [nm] λ [nm] λ [nm] G e c n a b r o s b A 200 400 600 λ [nm] Supplementary Figure S2: Experimental UV/Vis spectra obtained from the fractions of the HPLC Supplementarychromatogram figure described 2 in Figure 3. All but one spectrum (spectrum B, peak 2) resemble the Experimentalmenaquinone UV/Vis standard spectra spectrum obtained from(compare the fractions to Figure of the2B). HPLC The images chromatogram in (A) to described (G) refer toin theFigure peak 3. All butnumbering one spectrum 1 to(spectrum 7 in Figure B, peak 3. 2) resemble the menaquinone standard spectrum (compare to Figure 2B). The images in (A) to (G) refer to the peak numbering 1 to 7 in Figure 3. 125 CHAPTER 4 Supplementary Table 1: Analysis of the metagenome 16S rRNA gene read abundance. The two sequencing runs were analyzed separately (Run 1, Run 2) and the two analyses combined (Combined). The table lists read numbers (#) and relative amounts (per cent, %). Run 1 Run 1 Run 2 Run 2 Combined Combined Taxonomy (read #) (%) (read #) (%) read (#) (%) Methylomirabilis oxyfera 576 30.7 1029 35.2 1605 33.4 Methanoperedens nitroreducens 403 21.5 649 22.2 1052 21.9 Proteobacteria 242 12.9 368 12.6 610 12.7 Chloroflexi 209 11.1 274 9.4 483 10.1 Miscellaneous 164 8.7 199 6.8 363 7.6 Bacteroidetes 121 6.4 138 4.7 259 5.4 Acidobacteria 71 3.8 132 4.5 203 4.2 Planctomycetes 38 2.0 92 3.1 130 2.7 Armatimonadetes 52 2.8 43 1.5 95 2.0 126 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea RPKM 304 664 393 672 588 705 645 479 720 752 481 618 730 964 52 58 65 80 69 369 313 335 482 227 137 ANME2D. Presence and % identity between ANME2D and MPEBLZ 76 85 80 81 79 75 58 64 89 84 69 78 73 78 63 78 92 78 71 80 81 84 71 81 83 M. nitroreducens 4 Homolog in ANME_2D Homolog in ANME2D_00974 ANME2D_00973 ANME2D_00972 ANME2D_00971 ANME2D_00970 ANME2D_00969 ANME2D_00968 ANME2D_00967 ANME2D_00966 ANME2D_00965 ANME2D_00964 ANME2D_00663 ANME2D_00662 ANME2D_02258 ANME2D_02724 ANME2D_02723 ANME2D_02718 ANME2D_02720 ANME2D_02719 ANME2D_02156 ANME2D_02157 ANME2D_02158 ANME2D_02551 ANME2D_02552 ANME2D_02553 MPEBLZ in comparison to that of Methanoperedens nitroreducens Methanoperedens dehydrogenase subunit FpoA dehydrogenase subunit FpoB dehydrogenase subunit FpoC dehydrogenase subunit FpoD dehydrogenase subunit FpoH dehydrogenase subunit FpoI dehydrogenase subunit FpoJ_2 dehydrogenase subunit FpoJ_1 dehydrogenase subunit FpoK dehydrogenase subunit FpoL dehydrogenase subunit FpoM dehydrogenase subunit FpoN dehydrogenase subunit FpoO dehydrogenase subunit FpoF 2 2 2 2 2 2 2 2 2 2 2 2 2 2 H H H H H H H H H H H H H H 420 420 420 420 420 420 420 420 420 420 420 420 420 420 Protein subunit Protein F F F F F F F F F F F F F F hydrogenase subunit EchA Energy-conserving hydrogenase subunit EchB Energy-conserving hydrogenase subunit EchC Energy-conserving hydrogenase subunit EchE Energy-conserving hydrogenase subunit EchF Energy-conserving cytoplasmic heterodisulfide reductase subunit HdrC_1 cytoplasmic heterodisulfide reductase subunit HdrB_1 cytoplasmic heterodisulfide reductase subunit HdrA_1 cytoplasmic heterodisulfide reductase subunit HdrC_3 cytoplasmic heterodisulfide reductase subunit HdrB_3 cytoplasmic heterodisulfide reductase subunit HdrA_3 Analysis of the proteome dehydrogenase dehydrogenase 2 H 420 Locus identifier F (Fpo) MPEBLZ_00739 MPEBLZ_00738 MPEBLZ_00737 MPEBLZ_00736 MPEBLZ_00733 MPEBLZ_00732 MPEBLZ_00731 MPEBLZ_00730 MPEBLZ_00729 MPEBLZ_00728 MPEBLZ_00741 MPEBLZ_00742 MPEBLZ_00743 MPEBLZ_02422 (Ech) Energy-conserving hydrogenase MPEBLZ_04052 MPEBLZ_04051 MPEBLZ_04043 MPEBLZ_04046 MPEBLZ_04044 reductase (Hdr) Cytoplasmic Heterodisulfide MPEBLZ_01151 MPEBLZ_01152 MPEBLZ_01153 MPEBLZ_01258 MPEBLZ_01259 MPEBLZ_01260 Supplementary Table 2: Table Supplementary expression (RPKM value) of important enzymes in central metabolism and cofactor biosynthesis were analysed. 127 CHAPTER 4 152 283 237 946 1369 368 217 1333 691 404 511 296 18 446 319 162 1915 1505 2117 1201 369 1018 741 720 1268 81 80 85 83 67 86 30 86 79 86 83 76 72 68 72 72 84 75 81 86 81 83 72 80 80 ANME2D_02162 ANME2D_02156 ANME2D_02157 ANME2D_02158 ANME2D_02796 ANME2D_02797 ANME2D_00417 ANME2D_00639 ANME2D_01681 ANME2D_01680 ANME2D_01679 ANME2D_01678 ANME2D_00408 ANME2D_00408 ANME2D_01940 ANME2D_01941 ANME2D_00495 ANME2D_00494 ANME2D_00493 ANME2D_00492 ANME2D_00492 ANME2D_00491 ANME2D_00490 ANME2D_00489 ANME2D_00488 -reducing hydrogenase subunit FrhB -reducing hydrogenase subunit FrhB 420 420 (reverse methanogenesis) (reverse cytoplasmic heterodisulfide reductase subunit HdrC_2 cytoplasmic heterodisulfide reductase subunit HdrB_2 cytoplasmic heterodisulfide reductase subunit HdrA_2 membrane-bound heterodisulfide reductase subunit HdrD membrane-bound heterodisulfide reductase subunit HdrE F F ormylmethanofuran--tetrahydromethanopterin formyltransferase Molybdenum dependent formyl-MFR dehydrogenase subunit FmdC Molybdenum dependent formyl-MFR dehydrogenase subunit FmdA Molybdenum dependent formyl-MFR dehydrogenase subunit FmdB Molybdenum dependent formyl-MFR dehydrogenase subunit FmdD Molybdenum dependent formyl-MFR dehydrogenase subunit FmdE_2 Molybdenum dependent formyl-MFR dehydrogenase subunit FmdE_1 dependent formyl-MFR dehydrogenase subunit FwdD Tungsten dependent formyl-MFR dehydrogenase subunit FwdB Tungsten tetrahydromethanopterin S-methyltransferase subunit MtrH tetrahydromethanopterin S-methyltransferase subunit MtrG tetrahydromethanopterin S-methyltransferase subunit MtrF tetrahydromethanopterin S-methyltransferase subunit MtrA tetrahydromethanopterin S-methyltransferase subunit MtrA tetrahydromethanopterin S-methyltransferase subunit MtrB tetrahydromethanopterin S-methyltransferase subunit MtrC tetrahydromethanopterin S-methyltransferase subunit MtrD tetrahydromethanopterin S-methyltransferase subunit MtrE 2 reducing hydrogenase (Frh) hydrogenase reducing 420 MPEBLZ_01179 MPEBLZ_01180 MPEBLZ_01181 Membrane bound Hdr MPEBLZ_01018 MPEBLZ_01017 F MPEBLZ_01158 MPEBLZ_02287 Methane oxidation to CO MPEBLZ_03394 MPEBLZ_01216 MPEBLZ_01217 MPEBLZ_01218 MPEBLZ_01219 MPEBLZ_01782 MPEBLZ_01173 MPEBLZ_04481 MPEBLZ_04482 MPEBLZ_02584 MPEBLZ_02585 MPEBLZ_02586 MPEBLZ_02587 MPEBLZ_01133 MPEBLZ_02588 MPEBLZ_02589 MPEBLZ_02590 MPEBLZ_02591 128 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea 1130 1575 374 160 57436 26015 45848 31898 1928 230 54 67 93 129 76 296 172 83 92 87 51 89 89 74 83 88 74 70 73 72 74 76 85 72 4 ANME2D_01636 ANME2D_02259 ANME2D_02789 ANME2D_02789 ANME2D_01104 ANME2D_01103 ANME2D_01102 ANME2D_01101 ANME2D_00875 ANME2D_03361 ANME2D_02039 ANME2D_00233 ANME2D_00699 ANME2D_00698 ANME2D_01719 ANME2D_01328 ANME2D_03455 MPT reductase MPT 4 MPT dehydrogenase MPT 4 -lactate transferase L MPT cyclohydrolase MPT cyclohydrolase MPT 4 4 -dependent methylene H -dependent methylene –H -Tyrosine decarboxylase -Tyrosine L -Lactate kinase 420 420 L Mtd: F Mer: F Mch_1: Methenyl-H Mch_2: Methenyl-H Methyl-coenzyme M reductase subunit McrA Methyl-coenzyme M reductase subunit McrG Methyl-coenzyme M reductase subunit McrC Methyl-coenzyme M reductase subunit McrB Methyl-coenzyme M reductase protein C CofE: conenzyme F420-0 gamma-glutamyl ligase CofD: LPPG:Fo 2-phospho- CofC: 2-phospho-L-lactate guanylyltransferase CofG: Fo synthase subunit 1 CofH: Fo synthase subunit 2 CofA: Lactaldehyde dehydrogenase CofB: MfnA: cyclohydrolase MptA: GTP MptB: Cyclic phosphodiesterase Ribofuranosylaminobenzene 5’-P-synthase 420 MPEBLZ_02677 MPEBLZ_02423 MPEBLZ_00120 MPEBLZ_01356 MPEBLZ_01201 MPEBLZ_01202 MPEBLZ_01203 MPEBLZ_01204 MPEBLZ_03729 Coenzyme biosynthesis Coenzyme F MPEBLZ_03992 MPEBLZ_01508 MPEBLZ_03525 MPEBLZ_01413 MPEBLZ_01414 Methanofuran MPEBLZ_01550 Methanopterin MPEBLZ_03383 MPEBLZ_03533 129 CHAPTER 4 381 775 174 277 21 18 284 325 512 669 310 632 76 193 102 249 762 66 814 911 1643 98 835 14 78 86 85 76 86 80 74 80 89 84 87 87 90 79 39 81 69 75 87 64 70 82 82 74 90 72 ANME2D_03335 ANME2D_01257 ANME2D_01547 ANME2D_01393 ANME2D_03321 ANME2D_03268 ANME2D_01549 ANME2D_01838 ANME2D_00244 ANME2D_00313 ANME2D_03037 ANME2D_00313 ANME2D_01156 ANME2D_03429 ANME2D_03278 ANME2D_01372 ANME2D_03278 ANME2D_03050 ANME2D_03209 ANME2D_00885 ANME2D_03017 ANME2D_00764 ANME2D_01008 leuA_2: Isopropylmalate synthase leuA_1: Isopropylmalate synthase leuB_1: Isopropylmalate dehydrogenase leuB_2: Isopropylmalate dehydrogenase subunit LeuC_1: 3-isopropylmalate dehydratase, large subunit LeuC_2: 3-isopropylmalate dehydratase, large subunit LeuC_3: 3-isopropylmalate dehydratase, large LeuD1: 3-isopropylmalate dehydratase, small subunit LeuD2: 3-isopropylmalate dehydratase, small subunit Threonine synthase thrC: thrC_2 thrC_3 thrC_5 aspartate aminotransferase comDE: Sulfopyruvate decarboxylase 4Fe-4S Ferredoxin Ferredoxin 4Fe-4S Ferredoxin 4Fe-4S Ferredoxin Ferredoxin 4Fe-4S Ferredoxin 4Fe-4S Ferredoxin Ferredoxin Polyferredoxin Coenzyme B MPEBLZ_02136 MPEBLZ_00279 MPEBLZ_01066 MPEBLZ_03522 MPEBLZ_00997 MPEBLZ_01942 MPEBLZ_03757 MPEBLZ_01064 MPEBLZ_03706 Coenzyme M MPEBLZ_01988 MPEBLZ_00046 MPEBLZ_00708 MPEBLZ_03695 MPEBLZ_02613 MPEBLZ_01336 transport Electron MPEBLZ_00485 MPEBLZ_01748 MPEBLZ_01947 MPEBLZ_03155 MPEBLZ_03192 MPEBLZ_03937 MPEBLZ_04240 MPEBLZ_00585 MPEBLZ_01373 130 A metabolic blueprint of nitrate reduction coupled to AOM by Methanoperedens-like archaea 620 554 482 202 541 93 152 102 125 117 100 91 1428 1034 933 494 1094 2136 4079 589 420 69 59 103 122 22 56 1051 90 86 88 79 84 82 79 77 61 76 69 78 89 94 88 77 78 67 76 72 60 60 73 72 64 73 72 88 4 ANME2D_00521 ANME2D_00520 ANME2D_01197 ANME2D_01198 ANME2D_01199 ANME2D_01200 ANME2D_03105 ANME2D_00530 ANME2D_02293 ANME2D_00949 ANME2D_02292 ANME2D_00937 ANME2D_02066 ANME2D_02067 ANME2D_02068 ANME2D_02069 ANME2D_02070 ANME2D_02071 ANME2D_02072 ANME2D_02073 ANME2D_02074 ANME2D_03403 ANME2D_03404 ANME2D_01900 ANME2D_01590 ANME2D_01588 ANME2D_02705 ANME2D_00314 acetyl-CoA synthase subunit cdhD acetyl-CoA synthase subunit cdhE acetyl-CoA synthase subunit cdhA acetyl-CoA synthase subunit cdhB acetyl-CoA synthase subunit cdhC acetyl-CoA synthase accessory protein CooC acetyl-CoA synthetase acetyl-CoA MqnA: chorismate dehydratase MqnB: Futalosine hydrolase MqnC: de-hypoxanthine futalosine cyclase MqnD: 1,4-dihydroxy-6-naphtoate synthase MqnE: aminofutalosine synthase synthase subunit D (A1/A0)-ATP synthase subunit B (A1/A0)-ATP A synthase subunit (A1/A0)-ATP synthase subunit F (A1/A0)-ATP synthase subunit C (A1/A0)-ATP synthase subunit E (A1/A0)-ATP synthase subunit K (A1/A0)-ATP synthase subunit I (A1/A0)-ATP synthase subunit H (A1/A0)-ATP molybdopterin synthase subunit MoaD Molybdopterin biosynthesis protein MoeA bifunctional molybdopterin-guanine dinucleotide biosynthesis protein A MoaE Molybdopterin-guanine dinucleotide biosynthesis protein MobB accessory protein substrate binding- molybdopterin biosynthesis protein MoeA/LysR domain-containing protein molybdenum cofactor biosynthesis protein MoaD Acetate activation MPEBLZ_01317 MPEBLZ_01318 MPEBLZ_03841 MPEBLZ_03842 MPEBLZ_03843 MPEBLZ_03846 MPEBLZ_01103 Quinone biosynthesis MPEBLZ_00322 MPEBLZ_02665 MPEBLZ_03084 MPEBLZ_02664 MPEBLZ_00825 synthase ATP Oxidative phosphorylation: MPEBLZ_01694 MPEBLZ_01695 MPEBLZ_01697 MPEBLZ_01698 MPEBLZ_01699 MPEBLZ_01700 MPEBLZ_01701 MPEBLZ_01702 MPEBLZ_01703 biosynthesis Molybdenum cofactor MPEBLZ_03870 MPEBLZ_03871 MPEBLZ_00500 MPEBLZ_02295 MPEBLZ_02297 MPEBLZ_02670 MPEBLZ_00045 131 Arslan Arshad1, Jesus Gerardo Saucedo Sanchez1, Mike S. M. Jetten1,2, 3, Huub J. M. Op den Camp1 and Cornelia U. Welte1,2 1 Department of Microbiology, Institute for Water and Wetland Research, Radboud University, Nijmegen, The Netherlands 2 Soehngen Institute for Anaerobic Microbiology, Radboud University, Nijmegen, The Netherlands 3 Netherlands Earth Systems Science Center, Utrecht University, The Netherlands Characterization of acetyl-CoA synthetase from the anaerobic methanotrophic archaea clades ANME-2a and ANME-2d 5 CHAPTER 5 Abstract Acetyl-CoA is an essential intermediate for many anabolic and catabolic processes. In aceticlastic methanogens acetate is converted to acetyl-CoA through concerted function of acetate kinase and phosphotransacetylase or by a single acetyl-CoA synthetase (ACS). Multiple copies of acetyl-CoA synthetase in Methanosaeta sp. are hypothesized to be involved either in energy conservation or lipid biosynthesis. Anaerobic methanotrophic archaea (ANME) of clade 2 are distant relatives of methanogens and oxidize methane through (reverse) methanogenesis. Since the discovery of ANME, several genomic studies have speculated about the potential routes of (reverse) methanogenesis in anaerobic methanotrophs. The absence of specialized genes encoding for methyl transferases and hydrogenases in ANME- 2 metagenomes made the possibility of hydrogenotrophic and methylotrophic methanogenesis very unlikely. However, metagenomes of ANME-2a and 2d archaea encode acetyl-CoA synthetase genes, suggesting an acetate activation mechanism similar to Methanosaeta sp. In this study, characterization of putative acs genes from ANME-2a and ANME-2d archaea was performed. The amino acid sequence analysis suggests that both ACS are AMP-forming. The two ACS enzymes were subsequently obtained through heterologous expression in E. coli and purification by affinity chromatography via a Strep-tag. ACS activity was highest for acetate, and only propionate was activated from all the small organic acids tested. ANME-2a ACS converted acetate at a rate of 2.4 µmol.min-1.mg-1 which was 55 % higher than the ANME-2d ACS conversion rate (1.1 µmol.min-1.mg-1). Interestingly, pyrophosphate (PPi), an intermediate of the AMP-forming ACS reaction, could not be detected during activity assays. Nevertheless, the presence of a single copy acs gene in ANME-2 archaea and its acetate specific activation suggested its involvement in carbon assimilation rather than a role in energy conservation. 134 Characterization of acetyl-CoA synthetase from ANME archaea Introduction Acetate is a short chain fatty acid, found in fairly abundant amounts in natural anaerobic environments as diverse as soils and the gastrointestinal tracts of animals, including humans. Prior to metabolic utilization all micro and macro organisms must activate acetate. Prokaryotic organisms have evolved several mechanisms to perform activation of acetate into acetyl-CoA (Starai and Escalante-Semerena, 2004). The acetyl-CoA synthetase (ACS) enzyme catalyzes the formation of acetyl-CoA from acetate, Co-enzyme A and ATP. Acetyl-CoA synthetase (ACS: also known as acetate- CoA ligase or acetate activating enzyme) is a key enzyme of carbon metabolism in Bacteria, Archaea and Eukarya. Acetyl-CoA is an essential precursor for biosynthesis of glucose, fatty acids and cholesterol and also plays a important role in several catabolic processes. As a consequence, the ACS bio-catalytic activity is crucial in maintaining the required levels of acetyl-CoA in almost all living beings (Starai and Escalante-Semerena, 2004; Wolfe, 2005; Ingram-Smith et al., 2006; Reger et al., 2007; Watkins et al., 2007). Till to date, two forms of the ACS enzyme are known: 5 the ADP-forming ACS (EC 6.2.1.13), which catalyzes the reaction of acetate + ATP + CoA ↔ ADP + acetyl-CoA + orthophosphate usually involved in the formation of acetate; and the AMP-forming ACS (EC 6.2.1.1), which catalyzes the reaction ATP + acetate + CoA ↔ AMP + pyrophosphate + acetyl-CoA responsible for the activation of acetate to acetyl-CoA (Schafer et al., 1993). ADP-forming ACS has only been found in some archaeal lineages belonging to halophiles and thermophiles and in anaerobic protists (Reeves et al., 1977; Lindmark, 1980; Sánchez et al., 2000) while AMP-forming ACS is distributed across all three domains of life and serves as a predominant acetate activating enzyme. Similar to the two step reaction mechanism of acyl-adenylate enzyme super family, AMP-forming ACS reaction produces enzyme-bound acetyl-AMP and pyrophosphate as intermediates during the first step, which is followed by the production of acetyl-CoA, and AMP in the final step (Berg, 1956a, 1956b; Leslie T. Webster and Arsena, 1963; Anke and Spector, 1975; Babbitt et al., 1992). Both AMP and ADP-forming ACS encoding genes are found in several archaea which are able to utilize acetate as a carbon and energy source. ACS activity was first detected in the archaeon Methanothermobacter marburgensis, a thermophilic chemolithoautotrophic methanogen that is able to utilize H2/CO2 as sole carbon and energy source (Zeikus and Wolfe, 1972; Oberlies et al., 1980). Interestingly, M. marburgensis can utilize acetate for cellular biomass synthesis irrespective of H2/CO2 presence (Fuchs et al., 1978; Oberlies et al., 1980). Even though genes predicted to encode for ACS enzymes are widely distributed 135 CHAPTER 5 among archaea, only a few have been biochemically characterized. In 1989, Jetten et al. purified and characterized the very first archaeal ACS from Methanothrix soehngenii. Later studies established that acetyl-CoA synthetase is the first enzyme in the activation of acetate to acetyl-CoA during methanogenesis in the obligate aceticlastic methanogens Methanosaeta sp. (Jetten et al., 1989; Teh and Zinder, 1992), whereas in a second genera of aceticlastic methanogens, Methanosarcina sp., acetate activation to acetyl-CoA happens through a concerted action of acetate kinase and phoshotransacetylase (Welte and Deppenmeier, 2014). This route of acetyl-CoA synthesis is adapted to high (≥ 10mM) acetate concentrations, while ACS activation is the preferred route for relatively low environmental acetate concentration (≤ 1mM acetate) (Starai and Escalante-Semerena, 2004). The aceticlastic methanogen Methanosaeta encodes multiple copies of the acs gene (Ingram-Smith and Smith, 2007; Berger et al., 2012), which are either involved in central carbon metabolism, i.e. lipid metabolism, or aceticlastic methanogenesis. Methanosaeta sp. belong to the class II methanogens of the order Methanosarcinales and are phylogenetically related to anaerobic methanotrophic (ANME) archaea (Hinrichs et al., 1999; Boetius et al., 2000a) within the phylum Euryarchaeota (Borrel et al., 2016). Until now, three distinct clades of ANME archaea have been reported, ANME-1, ANME-2 and ANME-3 (Knittel and Boetius, 2009). The ANME-2 clade methanotrophs are particularly interesting due to their apparent metabolic flexibility with respect to the use of different electron acceptors. Members of the ANME-2 clade couple the anaerobic oxidation of methane to the reduction of sulfate, nitrate or oxidized metal ions (Raghoebarsing et al., 2006; Milucka et al., 2012; Haroon et al., 2013; Ettwig et al., 2016a; S. Scheller et al., 2016). In recent years, several meta-omics studies have unravelled the underlying methane- oxidation pathway and energy conservation models of ANME-2 archaea (Haroon et al., 2013; Wang et al., 2014; Arshad, Speth, de Graaf, et al., 2015; Vaksmaa et al., 2017) In ANME-2 archaea methane is activated through methyl-CoM reductase and subsequently undergoes complete oxidation via (reverse) methanogenesis. The evidence of complete and functioning anaerobic oxidation of methane (AOM) in ANME-2a and ANME-2d have been provided by (Haroon et al., 2013; Wang et al., 2014). Additionally, the genes for energy conservation and electron transportation including F420H2 dehydrogenase (Fpo), the cytoplasmic and membrane-bound heterodisulfide reductases, and cytochrome c proteins are encoded and expressed in ANME-2a and ANME-2d genomes (Wang et al., 2014; Arshad, Speth, de Graaf, et al., 2015). The metabolic pathway reconstruction approach for ANME archaea has provided an increased understanding of the underlying biochemical processes 136 Characterization of acetyl-CoA synthetase from ANME archaea and metabolic capacity in different habitats. Nevertheless, many questions regarding metabolic versatility of ANME archaea remain elusive. For instance, it has long been speculated whether ANME archaea can display methanogenic activity (Lloyd et al., 2011; Timmers et al., 2017). Hydrogenotrophic and methylotrophic methanogenesis requires dedicated enzymes such as hydrogenases and methyl-transferases, respectively (Krzycki, 2004; Thauer et al., 2010), that are absent from ANME-2 genomes. However, ANME-2a and ANME-2d genomes do encode the acetate activating enzyme acetyl-CoA synthetase and their physiological function remains unknown (Wang et al., 2014; Arshad, Speth, de Graaf, et al., 2015). Thus, during this study we focused on functional expression and characterization of putative ACS enzymes from two clades of anaerobic methanotrophs, ANME-2a and ANME-2d, which represent the only acetate activating enzymes encoded in (meta) genomes of these ANMEs. To investigate the substrate specificity and kinetic properties of the putative ACS enzymes, the acs genes were overexpressed in E. coli Bl21 (DE3-star). In vitro colorimetric assays revealed successful acetate conversion to acetyl-CoA by both ACS from ANME-2a and ANME2d archaea. This is the first time that proteins 5 from ANME archaea could be purified and consequently functionally characterized from a heterologous host. Insights into substrate spectrum and kinetic properties could provide information that may help to understand the carbon assimilation metabolism in marine and freshwater ANME archaea. Material and methods Identification and phylogenetic analysis of putative ACS enzymes ACS genes from ANME-2d (MPEBLZ_01103, 1959 bp; (Arshad, Speth, de Graaf, et al., 2015)) and ANME-2a (IMG/N Gene ID 2566126471ANME-2a2_03215, 1965 bp (Wang et al., 2014)) archaea were translated into protein sequences and analysed using BlastP. The two protein sequences were aligned together with well investigated representatives (most diverse members) and the full set of the conserved protein domain family (acetyl-CoA synthetases, cd05966). Alignments and phylogenetic analyses were performed using MEGA6 (Tamura et al., 2013). Cloning into expression vectors ACS genes from ANME-2d (MPEBLZ_01103, 1959 bp) and ANME-2a (IMG/N Gene ID 2566126471, 1965 bp) archaea were codon optimized and synthesized for expression in Escherichia coli. The target genes were delivered in pUC57Kan 137 CHAPTER 5 plasmids (Baseclear, Leiden, The Netherlands). The delivery vectors were propagated in Xl-1 blue cells and glycerol stocks of carrier strains containing synthetic genes were generated and stored at -80ºC. BsaI restriction endonuclease sites were inserted on each end of the gene by PCR and enabled the cloning of inserts into pASK-IBA3+ AMP expression vectors (IBA GmbH, Gottingen, Germany). The target vector encoded a ribosomal binding site and a Strep-tag II at the C-terminus of the recombinant protein. The recombinant ACS-pASK-IBA3+ plasmids were transformed into E. coli Bl21 (DE3) Star. The glycerol stocks used for heterologous expression were stored at -80ºC. Heterologous expression and purification Cells were grown in modified maximal induction medium (Mott et al., 1985) supplemented with M9 salts, 0.1 mM CaCl2, 1 mM MgSO4 and 1 µM ammonium iron(III) citrate. Ampicillin (100 µg/ml) was added for plasmid maintenance. Cultures were grown aerobically at 37ºC to an OD600 between 0.4-0.6; the target protein expression was induced by addition of anhydrotetracycline (200 ng/ ml). Cell growth was allowed for another 3-4 h followed by harvesting of the biomass through centrifugation at 5000 rpm for 15 minutes. The cells were lysed by mechanical disruption through French pressure treatment. Three cycles of cell disruptions were performed to ensure a more efficient cell lysis. The soluble protein fraction was separated by centrifugation at 14,000 rpm for 20 minutes at 4ºC. The protein purification by Strep-tactin affinity chromatography was performed with the supernatant of the previously mentioned centrifugation, according to the manufacturer’s instructions (IBA GmbH, Gottingen, Germany). Eventually, purified protein fractions were collected and protein content was quantified through the Bio-rad protein determination assay that is based on the Bradford method (Bio-rad, California, USA). The absorbance was recorded at 595 nm using a SpectraMax 190 microplate reader (Molecular devices, USA). A standard curve using bovine serum albumin was used for comparison. The purified protein fractions were aliquoted in 25-50 µl volumes and stored at -80ºC until further use. Protein visualisation SDS-PAGE was performed according to (Laemmli, 1970) with a 4 % stacking gel and 10 % resolving gel. 4x SDS loading buffer (250 mM Tris-Cl pH 6.8, 8% SDS, 40% glycerol, 20% β-mercaptoethanol, 0.02% bromophenol blue) was used to dilute the protein samples. Prior to loading, the samples were boiled at 95ºC for 10 minutes. Molecular masses of proteins were determined by comparison with a molecular mass standard. The proteins were visualized through Coomassie staining. 138 Characterization of acetyl-CoA synthetase from ANME archaea Enzyme assays The formation of acetyl-CoA from acetate was determined through a discontinuous colorimetric assays adapted from (Jones and Lipmann, 1955; Brown et al., 1977). The assay mixtures for ANME-2d ACS and ANME 2a ACS were routinely performed in a total volume of 200 µl at 37 ºC. In brief, formation of acetyl-CoA from acetate, ATP and CoA was measured by production of a Fe3+-acetyl hydroxamate complex. The absorbance was recorded at 520 nm. The assay mixture per reaction contained 50 mM Tris/HCl (pH 8.1), 100 mM hydroxylamine hydrochloride (pH 7.5), 5 mM MgCl2, 20 mM sodium acetate, 6.7 mM CoA tri-lithium salt, 10 mM ATP, 10 mM glutathione, and purified enzyme. The reaction was stopped by adding 1:1 volumes of 10 % TCA and 2.5 % FeCl3. This assay was used to determine the specific activity and Km values of both ACS enzymes for acetate. One unit was defined as one µmol of acetyl produced per minute. Quantification was done through standard curves (0-2 mM) of lithium potassium acetyl phosphate. 5 Results and discussion Phylogeny of acetate activating archaeal enzymes The amino acid sequence of the two acetyl-CoA sythetase (ACS) enzymes from anaerobic methanotrophs belonging to the ANME-2a and ANME-2d clades were analysed in detail. According to BLAST searches, the ANME-2d enzyme showed 79 and 81% identity, respectively, to two sequences of the closely related anaerobic methanotroph Ca. Methanoperedens nitroreducens (Haroon et al. 2013) and 65-69% identity to bacteria from different phyla. The ANME-2a enzyme showed highest identity (55-65%) to euryarchaeal methanogens. Phylogenetic analysis (Fig. 1) confirmed clustering of the ANME-2a enzyme with ACS of Euryarchaeota while the ANME-2d enzyme seemed to form a separate cluster with two putative ACS proteins from M. nitroreducens. The other closest relatives of ANME-2d ACS were sequences from members of the Proteobacteria and Eukarya which formed the neighbouring cluster. Additionally, in depth phylogenetic analysis revealed the exact placement of ANME-2a ACS among Euryarchaeota (Supplementary Fig. S1). Archaeoglobus sulfaticallidus, Thermoplasmatales and ANME-2a ACS formed one cluster adjoining the well-investigated ACS containing Methanothermobacter sp. 139 CHAPTER 5 Figure 1: Phylogeny of acetyl-CoA synthetase (AMP-forming) homologues. The neighbour-joining tree was estimated by the MEGA 6 software package. Values at the internal nodes represent bootstrap values based on 1000 iterations. The distant clustering of both enzymes suggested low sequence homology among ANME-2a and ANME-2d ACS enzymes. However, the ubiquitous nature of acs genes suggests that the ACS enzyme is well conserved. We performed an amino acid sequence comparison to obtain an overview of the catalytic properties of both ANME ACS enzymes. Based on protein domain inquiry, both protein sequences clearly belong to the acetyl-CoA synthetase conserved domain family ACS (cd5966). An alignment of the most diverse members of this family with our sequences is shown in Fig. 2. The active site residues responsible for acyl substrate affinity remain highly conserved throughout different organisms. Studies featuring the ACS of Methanothermobacter thermautotrophicus have demonstrated that the acyl substrate 140 Characterization of acetyl-CoA synthetase from ANME archaea selection and affinity is influenced by the four highly conserved residues Ile312, Thr313, Val 388 and Gly389 (Ingram-Smith et al., 2006). Amino acid sequences of ANME-2a and 2d ACS revealed the presence of these residues Ile317,318, Thr318,319, Val393,394 and Gly394,395, respectively (Fig. 2). Moreover, the presence of the acetate activating residue Trp421,422 further suggests a substrate preference of ANME-2a and 2d ACS towards acetate. Additionally, the residues involved in AMP and CoA binding could be identified together with the acyl-activating enzyme (AAE) consensus motif. The conserved AMP binding site hinted towards the AMP-forming catalytic nature of both ANME ACS enzymes. Similar to previous studies, we found many conserved regions throughout the length of ACS proteins that are all approximately the same size (70 kDa). Such conservation of size might suggest that the present form of ACS is probably a sufficient structure required to catalyse the two half reactions of AMP- forming ACS (Starai and Escalante-Semerena, 2004). Heterologous expression and characterization of the two ACS enzymes The ACS proteins from ANME-2a and ANME-2d were both successfully produced 5 in E. coli and subsequently purified using the C-terminally fused Strep tag and affinity chromatography (Supplementary Fig. 1). Only one enriched band of each target protein was visible at the expected mass (70 kDa). The purified enzymes were tested for substrate specificity and characterised regarding kinetic properties. For the substrate specificity assays, several small organic acids (acetate, propionate, formate, and butyrate) were tested. Acetate activation enzymes that are used for central energy metabolism typically exhibit a very narrow substrate spectrum with acetate as the only relevant substrate whereas enzymes that are involved in carbon metabolism/ assimilation, i.e. lipid formation, have a more versatile substrate spectrum. When the activities of both ACS enzymes were compared, it became apparent that the acetate conversion rate by the ANME-2d ACS was 45% lower than that measured for the ANME-2a ACS (Table 1, Supplementary Fig. 2). It was found that the ANME-2d ACS only catalysed the activation of acetate with a specific activity of about 1.1 U/ mg, with no detectable activity towards the other small organic acids. The enzyme from ANME-2a, in contrast, showed highest activity with acetate (2.4 U/mg) but exhibited still about 30% of the activity of acetate conversion towards propionate conversion. Both ACS enzymes did not activate formate or butyrate (Table 1). 141 CHAPTER 5 Table 1: Specific activity of the purified ACS enzymesN.D = Not detected Substrate ANME-2d ACS ANME-2a ACS Rate (µmol.min-1.mg-1) Rate (µmol.min-1.mg-1) Acetate 1.10 2.41 Propionate N.D 0.72 Formate N.D N.D Butyrate N.D N.D Propionate conversion by other ACSs has been reported at a significantly lower specific activity (Jetten et al., 1989; de Cima et al., 2007; Ingram-Smith and Smith, 2007). 142 Characterization of acetyl-CoA synthetase from ANME archaea 45 105 126 114 108 89 126 113 116 202 188 108 99 90 102 179 182 194 173 163 164 176 202 187 190 sqs - dea - keng dekg ds -- nep - et -- dv -- tr -- ee -- sc -- dt -- RIAD se RIND ae CIID ss RATD ad RIMD ag RIND sk RVDD sk RIND sk RVND sg RIAD ae RIHD ss RIID sg LA S ACA E AVA G ALA Q ALA V A ALA E SIR D ALA D SIA D ACG D SLV D ALK D K E S Q D G T D Q A D H DRTAIIWEGDDT NKTAIHFVPEPE NKVAIIWEGEPV NKVA IIWEGEPV EKPAILWEGENG NKAA FIWVPEPE DRIAIRWEGDGG NKVAYIFESEQG NQAAFIWEGEDG NKAAYIWVGENG NKAAIICEKEDG SKVAIYWEGENG G R K K S A R E FSG FS g P R R K FGG FS p FGG FS a FAG FG a FSG FS a FSG FS s FSG FS s FAG FS a FSG YS a FSG FS a FSG FS a FAG FS g ### N Y R R K S H T R R R R LQE - LAA - IEQ g VKS w QDS - LAA - LSQ - IGT p LHE - LEQ h IKG n AKS w LNLAANCLDRH INACHNCVDRH TNLAYLCTDWQ LNASYLTVDRH INASHNALDVH LNACYNCVDRH LNASYNCLDRH YNIVHDALDRH LNACYNCVDRH LNVSYNAVDRH LNASYNCVDRH LNMSYQCVDRH T R E E T R K K E K S K PMVAELPITMLACARIGVIHSQV PMVPEAAVAMLACARIGAVHSVI PMVPALPITMLACARIGAPHSVV PMIIEAPVAMLAAARIGAVFSFV PMIPELPIAMLACARIGATHTVI PMMTEAIIAMLACSRIGAIHNVV PMIPEMVYILLACNRVGAIHNVI PMIPQLVISMLACARIGAIHNVV PMIPALPIAMLACAKIGAVHSVV PMIPELPLFMLGVQRIGAKHSIV PMIPELPIFMLAAARIGVVFTVV PMVPELPIAMLACARLGAIHSQV m m l l l m l l m l l l SIKWYEDG 5 KGDVVAIY EDDVVTLH KGDRIVLY KGDRVTLY KGDVVTIY KGDRVTVY KGDRIAIY KGDRVEIY k q k e e g k g ------PYQKV kntsfapgnv YWETT ldts --- npp FWRWFVGG KWDRA ldds --- npp FYRWFVGG PWEKT ldds --- npp FYKWFVGG PWNET ldw ---- qpp FAKWFVGG YWHTT ldts --- npp FWKWFVGG KWEKA nfwd -- peka ICRWFEGG PYDKV ldgs --- kkp FYHWFTNA RWDEV fdgs --- dpp FFEWFTGG KWNKI ldds --- kkp FYRWFVGG TWDKA ldw ---- npp YAKWFKGG PWEKV ldw ---- npp YARWFVGG LREFC glk AGDRVTLH LLDLG i LRDVG v LKDKL gvk KDEILTFY LKEKY glk KGDAIAIY LLNLG i LKSLG v LENLG v LKKLG i LRDFA gvk TGDRVTLH LKNKG a LKQLG v L T S M L A I V L V G A LDWD T LEWD K KFAN V l --- IFWF R --- LSWD A ELHRDVCRFAN DLYREVNKMAA ELFVRVNELA DLYRESNRIAA DLYREVNRVAY GLYRRINNLAK QILTEVQKFSN ELYREVN DLYENVNRYAS ELYRRVNEFAA QLYTEVCKFAN DLYHEVNKLAN 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 LTY Y LTY Y KQSIN DP DT FW GE qgki LDWI T RFSLE RF PE CF KE fadl LDWY K KESIE KW WE AN e SQTVK DY KQ FW AS vase IDWF K IKADS DF VS FW ND qakn LTWF S EQNFP EC FR VY AD l KQSIS DP AS FW AE kaqq LDWF K KRSQD IE WF WG EV qkdl VEWY S DRFDD FP EG FE EY ad - RKSLE DP EN FW AK qaei LTWY S QKALD DP EK FW GE qak c NSALT DS EG FW AK hsdv LSWE K Y E D H R S Y Y ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| Y Y Q Y ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| ----- kh ISY R ----- rt LTY R ---- vhh LTY Q epvevrk npkevrk ----- ki VTY D ----- ri LTY G ----- gi LTY Y ----- qt ISY S ---- tla LTY Q ----- ql FTY E ----- tk LTY L 52 41 32 17 55 38 42 106 109 127 115 109 100 103 127 114 117 36 25 17 29 90 91 28 me othermus cellulolyticus 11B cellulolyticus othermus Ralstonia eutropha H16 eutropha Ralstonia fulgidus Archaeoglobus H16 eutropha Ralstonia fulgidus Archaeoglobus Sulfolobus solfataricus P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzy ANME2a_03215 P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 Acid ANME2d enzyme ANME2a_03215 Salmonella enterica ruber Salinibacter Salmonella enterica ruber Salinibacter 143 CHAPTER 5 46 39 38 260 234 251 270 243 232 246 281 259 258 331 338 361 350 340 323 312 314 326 361 3 3 258 281 PE CE LMFE VMRE VVYE MMYE IMYE IMYE IMYE VLYE VIYE VMYE LMFE LLYE klva PV arve PV rrve PE GAT T GTT S AAS S GAT T GAT E GLT S GAT E GAT I GLT Q GTT S GAT S GVT S c l l c e l h l l l s l FWDELM ggak -- syve PV WWRDLI ekas -- pehq PE YFDEVI kdipqnvyve WYHEIV gdsh -- tyve PE LWNDLM ndas -- dncp AE WAHDML kdad -- kyva PE FVDDIL pqfrn - WWNEEV knas -- teck PE WWHELT sdlp -- sece TE LVSELL anner - ILNDVL agfrg - WFEDLM adigknvkve GHSYLLYGPLA GHSYIVYGPLA GHSYIVYGPLA GHSYIVYGPLM GHS YIVFGPLM GHSYIVFAPLI GHSYVVYAPLL GHTYVVYGPLS GHTYVVYAPLA GHSYIVYGPLA GHSYIVYGPLA GHSYIVYAPLI T T T T T T T T T T T T RD F GRD I GRD V G DVGW V DIGW I DIGW I DIGW I DIGW V DIGW I DIGW V DIGW I DVGW I DIGW I DIGW I DIGW I # ## DIYWCT A DTYWCA A DVYWCM A DIFWCT A DIYWCT A DRWWCA A DVFFCT A DVFWCT A SVFWCT A DTYWCF A DLFWCT A DIWWCA A rypgkyssaallvk ragne ---- ipwnd SRD V rhagqyaskspmvd FDYHP G LDIKP N QDIHP E FDIKD D FDIRD D FNPDE D FDIKD S WGLNE M FKPTD E LDIHP E FDYRD E FDLKP D EKVLIWQ EKVIVVK EKVLVFR TFKY V TSKY V TSKY I TMKL I TMKW V TLKW A TFKW A TMDW T TLKW A TSKY Y TFKW I TLKW V VYAA T SYVA G SYVA W VHLY T TLLH A VWVA S THLY S TYAT K VWAC N SYVA G LYAM Q VGIS F TGGY L TGGY L TGGY L VGGY A IGGY M TGGY S TGGY L TGGY L TGGY G TGGY L TGGY L HGGY A AL lnc ---- nsi KHVVYAK rgiee fnlvs GKE Y AL knpn -- vtsv EHVIVLK rtgsd ---- idwqe GRD L AV eead --- tdi DTVLVWE rhegtlhpeadlee AV aeaasagqqv AV kiceqeghkv AL ekt ---- pti KDVIVVR rignk vnmve GRD K AL emt ---- stv RNVIVIK harnd vnmve DRD I AI edf ---- dfv KNVVVVE rtkne ----- ipmt CKD K AV kst ---- psv EHVLVIK ytgye vvmdp ARD V AV araaqqgctv AI sgnek -- nsv NTVIVYD rtgtk ---- vnmkq GRD F GV eg ----- tev NNTIVYK waecd vqmg EHD L ILD K NVD D KAD T KAD I IVD D IVD K IAD E VVD E IVD E KAD E SVD R QAD E PK GVLH T PK GAQH R PK GCQH S PK GAQH S PK GIVH D PK GAVH S PK GVLH G PK GVVH S PK GILH G PK GCQH S PK GVLH T PK GVLH V DLK k PLK k HHK e DHK e NLK a DLK g ELK k KLK e PLK e DHK v PLK e NLK a I I L L L V V V L L V I E S F L V V V I I L I V SGSTG K RG K AG R RG E GG E RG K RG K NG K RG K RG K AG D GG K KG K # R R R R R R R R R R R LY T MYT SGTTG K MYT SGTTG R LYT SGTTG R LYT SGTTG K LYT SGTTG K LYT SGTTG K LYT SGTTG S LYT SGTTG K MYT SGTTG R LYT SGSTG K LYT SGTTG K LY R AEDPLF I AEDTLF L AEAPLF L SEDFSF I SEDPLY I ANDPLF I SAHPLY I SEHPLF I STDPLF I AESTLF L AEDPLF I SEDPLF I N D P G K D D E D P D D M R M M M M L V M M M M ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| 250 260 270 280 290 300 310 320 ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| SRLVITADEGV SDVIVTIDGYY SRLLITMDAYH ARYVVTADGVY AKLLITADGGW AVLLITADGGF SKVIVTADGGY SKILVTTNL SKMVVTASGGH SKVLITMDGYY CSFVITADAGL AKTLITADGFW A S P K R H K P A S V I 170 180 190 200 210 220 230 240 180 183 203 195 189 174 164 165 177 203 188 191 252 259 282 271 261 244 233 235 247 282 260 259 acidiphilum Ralstonia eutropha H16 eutropha Ralstonia fulgidus Archaeoglobus Salmonella enterica ruber Salinibacter P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 Ralstonia eutropha H16 eutropha Ralstonia fulgidus Archaeoglobus Salmonella enterica ruber Salinibacter P2 solfataricus Sulfolobus Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 144 Characterization of acetyl-CoA synthetase from ANME archaea 47 91 19 18 4 494 486 497 494 517 517 480 469 508 471 483 417 440 440 411 430 406 4 4 403 392 420 394 e n q k e r q k t d a k D D D D S D D D D D S D E I E V I V V V K I R K AVI V AVI V AVI T CPV V VVC S CPI S CPI V CPI M CPI I CPI I VPF G CPI C IGNE D VGKG E IGKG E IGKE K FGRE D IGHE N IGNR R IGNG R IGNS R IGKE K VGRE E IGKE K h e v k v n v n i t l v EP INPEAWEWLWK GNLVMNTPWPAMLRTLYHESGRY GNLVIERPWPGMLQTVYGDDQRF GNLVITDSWPGQARTLFGDHERF GYLVIKNPWPGMPLTIYKDPERY GQLVIKKPWPGMMRTVFGSHERF GNICIRNPWPGIFQTVWKDPDRY GNMCIRNPWPGVFQGIWKQPERF GYIVFRRPWPGMLMTVNNDDERY GYLVVKNPWPGMLLTLWGDDEKY GNLIIKRPWPGMLAGLWNNDERY GFIAIRKPWPGIMLGIYNGDELY GYLVISTPWPGMLMTLFKDPNRF G A VG EP IQPEAWLWYYT A VG EP IEPEVWKWYHR #### # VG EP INPEAWEWYWK VG EP INPEAWRWYYR VG EP INPEAWEWYYK VG EP INPEAWMWYYN VG EP INPEAWIWYYE VG EP INPAAWKWYYE VG EP INPEVWRWYFK V VG EP INPRAWKWYYK gr A FNFRHMTT CHFKHMTT YHFKLM TT VG EP IEPDVWRWYYD SSLRILGS STLRIIHS GTLEMLGS SSLRLLGT DSLRLLGS STLKVLGT STLRLLGT STVRLMHS STLRLLGS SY D KY D KY N TD R YD M HN L RD L NN M HD L FD L HI T HD L A A A p p p - - - VLDH dgntv --- ine G IYDN ngtpveaasgq LVDN eghpq -- egat E VVNE dgkqv -- nlee R VVKA dgtea -- gine G IFDE egnevpagsgk ILDD agkev -- rtge K VVDE ngkdv -- epnt K IYDE ngevvppgs VVDN egnpv -- danv K VVDA egkel -- pane I VLDD egnsv -- kpge R aie G h nyt K lpa K wpk G wtr K e ypq R ipn S e wvk A wvn T L A A D M V A T V D V E A P P P P P P I P V P M 5 PGF S PGI Q FGV Q LGI E PGI E PGI H PGV D PGV N LGV F IGI D PGV D PGV R L C F I F I L I V G L I LMAEGDK YMKWGKE LMRFPEE FMRHGEE LERSGDE HMRFGDE LRRNGPD LMKFGEK FMKFGDD LRKVGPD FMKYGDN LMMYGEK TA IR A TA VR M TA IR M TA IR M TA IR A TS IR M TA IR A TA IR T TA LR M TT IR M TA IR S TA IR M SMRPGSAGRP DMKPGSAGRP ELKAGSATRP PLKPGSATFP PMKPGSTGPG PMKPGSCGPG lv PMKPGTNGPP lp PLKPGSATFP ti PLKPGSGTLP sv PLKPGSATFP sf PLKPGSATLP --- q --- i --- t --- h --- a NLPA l PLPG a HLPG ly - PLPG a PLPL ---- s TLPG i PQRG lg - PLPG le - QLPA l HFPG lgkii PLKPGTNGYP PPIG iq - PCPG iq - VVDKHQVNILYTAP IAERHDVDIFHTSP MIERYGVTIFYTAP IIDKYGVSIFYTSP LIEKYKVTIFYTAP MIERHKVSVLFTSP IAESLGVNIFHTSP IIEKYRVNILYTSP ILQKYKATIFYTTP IAERLGVNIFHTSP IIERYGITILYTSP IVENHGVTILYTAP LI T MI T LI S LI T VI S LC S MI A LI S LG C LT D II Y MI T 410 420 430 440 450 460 470 480 PARMC Q 330 340 350 360 370 380 390 400 KGVTW E VSRWA A VDRWW E PDRFW E PNRLW E PDRLW E ASRMW D AGRPW R AGRPW R PDRWV S PDRLW G D P QT ETGG h QT ETGG f MT ETGG i QT ETGG i QT ETGS f QT ENGG f QT ETGG f QT ETGG m QT ETGG f MT ETGG m QT ETGG h QT ETGG f ID YP E ### ## # VPN WP T APD HP H APD FP D APD YP S VPN YP E APA HP Q VPT W SIT YP E APD FP D TPT YP D ALD YP Q A ##### ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| G TW W G G G G G TW W TW W TW W TW W G G G G TW W TY W TW W TW W G G TW W CY W TW W ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| 339 351 327 340 339 412 421 420 419 362 324 313 362 441 404 393 441 341 315 431 395 407 418 332 ha H16ha lla enterica Ralstonia eutrop fulgidus Archaeoglobus Sulfolobus solfataricus P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 Salmonella enterica ruber Salinibacter Ralstonia eutropha H16 eutropha Ralstonia fulgidus Archaeoglobus Salmone ruber Salinibacter P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 145 CHAPTER 5 48 64 60 550 539 541 553 556 573 567 5 597 581 5 597 657 642 615 633 648 672 625 618 628 672 641 635 EL GDVTTLE EV GDITTLE KI GDVSTLE DL GDTTTLR EP GDVSTLA IP GDLTTLE EI GDVTTLE PI GDTTTLD DV GDTTTLA EV GDISTLS sythetases of the eg -- k tr -- a nn -- e agdts NL GDTSTLA ng -- k nh -- q ln -- q mg -- e ne -- v nf -- t sgdvh DL GDITTLA is -- k AVEAAVFGKPDPVKG VAESAACGIPDEVKG VAESAVVGKPDDVKG VAEAAVASRPDEVKG IAEAAVVGIPHAIKG VAEAAVAARQDDQKG VAEAAVIGVPDPVKG VAEAAVVGYPHDIKG VAEAAVVPVADEVKG VAEAACVGKSDPVKG VSEAAVVGRPDDLKG IAEAAAVPVMDELRG TG L HD D NK M HS S HP K VS E HP A HN A VP D HP D HP H VP E A S S G A Q E S L S S T V V V V V A I V L V V L binding site = green; acetate binding binding acetate = green; site binding - I I L L L V L L A M L T LGTIEIEDA IGTAELESC IGTAELEHE ISTAELEHA LGTAEIESA LGTMELESA LGTYELESA LGTAEIESS LGTKEIESA IGTAEIESA IGNSEVESA LGTKELESA R PKTRSGKIMRRVVRAVA LPKTRSGKIMRRLLKAIG LPKTRSGKIMRRILRKIA LPKTRSGKIMRRLLENIS MPKTRSGKIMRRVLAAIS L LPKTRSGKIMRRVVKAVA LPKTRSGKIMRRILKKLI LPKTRSGKIMRRLLKAVA LPKTRSAKIMRRILAGIS LPKTRSGKIMRRILRKIA LPKTRSGKIMRRVVRSAL ### ------AGH R nt LPKTRSGKIMRRLLRAVA k s d d k l k k d a d binding site = blue; CoA = blue; site binding - 17928275 = Acidothermus cellulolyticus 11B; BLZ1/BLZ2 = Acidothermus cellulolyticus 11B; 17928275 = DEVMNV SGH R DDVLKV AGH R DEVLNV SGH R DEVIKV AGH R DDVLNV SGH R DDVMNV AGH R DEVIKV AG H DDVIKV SGH R DDVINV SGH R DDVIN V DDILKV AGH R DDVLNV SGH R S A S A V L A I I V A G AS DA VITF V LG R LG R LG R LG R TG R LG R LG R MG R LG R LG R LG R QG R V IA TP KQ IYFV S LA TP DV LHWT D FA RP GN VIFV G IA RP HR VVIV P V IA TI DK IFFV G IY VP DE IRIV K IG TP AM IFFV N IA TP EE IIFV E IA RP KS IWIV S IAKP EK LQFA D IARP DT IYFV N DGYYW L DGYLW L DGYIW V DGYLW L DGYYW I DGYFR V DGYFW I DGYFW I TD IG A DGYFR I DGYFR I KE IG P KE IG A SQ IG A AT LG P DK VG P AD LG P DT VG P TA IG T TE IG K NS IG P EE IG K DGYVW V DGYFW V lococcoides ethenogenes 195; gi_117928275 = Acidothermus cellulolyticus 11B; 11B; cellulolyticus = Acidothermus gi_117928275 195; ethenogenes lococcoides # ## EKI R NWV R AAV E AAV V KHL R KTV R KRI R KHI R HHL R KAI E THV R GHV A YAVKD E YALKD A YAIKD Q FSMKD S GARRD E GAVHA Q YAVKD K SARKD E GAMQA A GAVQA A FAMFD E IARVD S ctive site residues = #; AMP # D D D D D D D D D D D D G G S G G G G G G G G G Thermoplasma acidiphilum DSM1728; gi_161528209 = Nitrosopumilus maritimus SCM1; EV KA EL I utropha H16; gi_11497978 = Archaeoglobus fulgidus DSM4304; gi_15899575 = Sulfolobus DSM4304; = Sulfolobus gi_15899575 fulgidus = Archaeoglobus H16; gi_11497978 utropha GYYY C NCYY P NKFS T GWYC P NMYF S GMFY V GVYQ T WPYM A WPYF S GEFI T etk VL EK EL V lsp -- si KI AN KV S ytp -- nt QL SQ EI L nad -- rh EL IS EI R int - yrelpsn vea -- sa DV KR EL T ddwrd WVYE A eep -- sp EL YA EV R vaa -- sd EL RQ DI V vep -- sp DM VN EL K vaa -- st EI TE KV T vtk -- ns DL KA V vdh -- se EL LQ R G G A G K D G G G G G G activating enzyme (AAE) consensus motif = grey; 1PG3_A = Salmonella enterica; gi_83815833 = Salinibacter = Salinibacter gi_83815833 1PG3_A enterica; = grey; = Salmonella motif enzyme (AAE) consensus activating - 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 ------RY cknpdskdwhd KF p KY e RF k RF p KY crnpeskdwrd TF k RF sdvds - KY ks ------kg WYYY T RF p QF p KA ------QYY A TYF S VYW S AYW D TYW S TYY A KVP DL YVSLK P EVP YA FVILR Q EAI SA FVVPK D EVI IA FVVLK E EVP VA FVILN E EAI VV FVTLK K TYF S EYW R VYF G VYW S KYF A HYY N QAI YA YVTLN H NVP DV YVTPR D EIP II YVVLR E RAV EM YVTLK P EAI YA FVTLK E ESI TA FVVLK I Alignment of representatives (most diverse members) of the conserved protein domain family (cd05966) together with the two two the with together (cd05966) family domain protein conserved members) the of diverse (most representatives of Alignment ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| ....*....|....*....|....*....|....*....|....*....|....*....|....*....|....*....| CoA sythetases of the current study. A study. CoA current the of sythetases - 51 8 481 470 472 484 518 598 568 551 540 542 554 487 495 509 498 495 492 557 582 598 565 561 574 Figure 2: acetyl site = underlined; acyl underlined; = site e = Ralstonia gi_113867627 ruber; = SCM1; gi_4535771 maritimus Nitrosopumilus = DSM1728; gi_161528209 acidiphilum Thermoplasma = gi_16081543 P2; solfataricus = Deha gi_57234024 S2; maripaludis Methanococcus BLZ1/BLZ2 = ANME2d ANME2a2_03215= enzyme; ANME2a enzyme. es ethenogenes 195 Alignment of representatives (most diverse members) the conserved protein domain family (cd05966) together with two acetyl-CoA hanococcus S2 maripaludis Ralstonia eutropha H16 eutropha Ralstonia fulgidus Archaeoglobus H16 eutropha Ralstonia fulgidus Archaeoglobus Sulfolobus solfataricus P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus Met Dehalococcoides ethenogenes 195 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 P2 solfataricus Sulfolobus acidiphilum Thermoplasma Nitrosopumilus maritimus S2 maripaludis Methanococcus Dehalococcoid 11B cellulolyticus Acidothermus ANME2d enzyme ANME2a_03215 Salmonella enterica ruber Salinibacter Salmonella enterica ruber Salinibacter Figure 2: Figure AMP-binding site = blue; CoA-binding green; acetate binding underlined; acyl-activating enzyme (AAE) consensus Active site residues = #; current study. Archaeoglobus fulgidus = = Ralstonia eutropha H16; gi_11497978 = Salmonella enterica; gi_83815833 Salinibacter ruber; gi_113867627 motif = grey; 1PG3_A DSM4304; gi_15899575 = Sulfolobus solfataricus P2; gi_16081543 gi_4535771 = Methanococcus maripaludis S2; gi_57234024 Dehalococcoides ethenogenes 195; gi_1 ANME2a enzyme. ANME2a2_03215= ANME2d enzyme; 146 Characterization of acetyl-CoA synthetase from ANME archaea The characterized ACS from Methanothermobacter thermautotrophicus has a strong preference for acetate while propionate is the only other acyl substrate that can be utilized. In M. thermautotrophicus, the Trp416 residue determines ACS substrate specificity and range therefore, this Trp residue remains conserved among ACS enzymes across microorganisms with the exception of Methanosaeta thermophila and Methanosaeta concilii, which both have Phe at the corresponding position (Ingram-Smith et al., 2006). The Trp421, 422 residues in ANME-2a and ANME-2d ACS respectively, are also conserved (Fig. 2) supporting that these enzymes exhibit strong preference towards acetate (Table 1). However, conversion of long chain substrates has been shown by archaeal ACS enzymes in Archaeoglobus fulgidus (ACS2) and Pyrobaculum aerophilum (Bräsen et al., 2005; Ingram-Smith and Smith, 2007). Interestingly, the active site residues are well conserved in the ACS from Archaeoglobus fulgidus, yet it has been shown that this enzyme can utilize isobutyrate, butyrate and propionate in addition to acetate (Ingram-Smith et al., 2006). In the present study, ANME-2a ACS converted 0.72 U/mg propionate, which is only 30 % of the conversion rate compared to acetate. According to phylogenetic 5 analysis, ANME-2a ACS was most identical to the archaeal proteins belonging to Euryarchaeaota while ANME-2d ACS formed a separate cluster with ACS from Ca. Methanoperedens nitroreducens which was adjacently located with the cluster from proteobacteria ACS (Fig. 1). Possibly, ANME-2a ACS affinity towards other organic acids could be explained through its archaeal origin. Similarly, the placement of ANME-2d ACS within the ACS phylogeny (Fig. 1) revealed that it had a bacterial origin and also did not convert any organic acids other than acetate, which is a known trait of bacterial ACS. Only recently, ACS (cd05969) found in the bacterium Kuenenia stuttgartiensis was shown to convert other organic acids besides acetate. Later, the amino acid sequence analysis revealed that the typically conserved Ile312 residue in the acetate binding pocket was substituted by a Val residue, which caused this broader substrate affinity (Russ et al., 2012). Contrary to K. stuttgartiensis, conservation of Ile319 residue in the ANME-2d ACS suggests a more limited capacity of this enzyme towards utilizing longer chain organic acids. 147 CHAPTER 5 A B Figure 3: Rate dependence of ANME-2a (A) and ANME-2d (B) ACS activity at different acetate concentrations. Furthermore, the acetate Km values were estimated at 0.13 ± 0.01 and 0.20 ± 0.07 mM for ANME-2d and ANME-2a ACS, respectively (Fig. 3). Both values are within the range of other described ACS enzymes (0.003-1.2 mM) (Bräsen et al., 2005; Li et al., 2011). We were not able to measure pyrophosphate (PPi) as reaction product in assays with either ANME-2a or ANME-2d. Pyrophosphate is produced during first half reaction of AMP-forming ACS and according to the current understanding of the acetate activating reaction in Methanosaeta sp. the pyrophosphate is hydrolysed by a pyrophosphatase to shift the overall reaction equilibrium towards product formation (Jetten et al., 1992). The aforementioned amino acid sequence analysis revealed that AMP-binding sites were present and conserved in both ACS enzymes (Fig. 2). This observation strengthened the notion that both ACS belong to the AMP-forming and not the ADP-forming class. Interestingly, the positive control, a commercially available AMP-forming ACS from S. cerevisiae, showed PPi formation (data not shown) which demonstrated the functionality of our PPi detection method. Nevertheless, failure to determine PPi during ANME-ACS catalysed in vitro assays could be due to direct hydrolysis of PPi by an undetectable contaminant. We identified a membrane-bound proton translocating pyrophosphatase in the ANME-2d genome (MPEBLZ_02932). Additionally, pyrophosphatase activity of E.coli, the expression host, could not be completely ruled out. The membrane bound pyrophosphatases are known to maintain a considerable proton motive force under low energy situations (Nyren and Strid, 1991). A similar role of pyrophosphatase was suggested in Mt. concilli (Jetten et al., 1992). However, a recent study revealed that the Methanosaeta genome lacked genes encoding a membrane bound pyrophosphatase falsifying the 148 Characterization of acetyl-CoA synthetase from ANME archaea before mentioned hypothesis (Berger et al 2012). Therefore, Berger et al. reevaluated the acetate activation reaction in Mt. thermophila and further speculated about the role of PPi in energy conservation. One possible scenario of PPi utilization could require coupling of PPi hydrolysis to the phosphorylation of cellular compounds thereby producing energy-rich intermediates for biosynthesis (Berger et al., 2012). However, the complete fate of PPi generated during the AMP-forming ACS reaction in Methanosaeta is not yet clear. Whether complete PPi hydrolysis by pyrophosphatases happens for simply shifting the reaction equilibrium or a partial amount is used for the phosphorylation reaction in Mt. thermophila needs further investigation. The confirmation of the role of PPi in aceticlastic methanogens would also provide further insight into the role of this energy-rich molecule in ANME archaea. This study provided the very first functional evidence of putative ACS in ANME archaea. Previously, Wang et al., 2014 highlighted the genomic presence of Acd along with ACS enzymes in ANME-2a and presented a metabolic scheme for acetate production 5 and reutilization by ANME-2a archaea and their syntrophic partners, the sulfate reducing bacteria. The genome of Methanosaeta thermophila encodes five copies of ACS (Berger et al., 2012). Four copies encoded an AMP-forming and one an ADP- forming ACS. The AMP-forming ACS of Methanosaeta sp. involved in aceticlastic methanogenesis requires the hydrolysis of ATP to AMP and pyrophosphate and subsequent non-coupled hydrolysis of pyrophosphate to phosphate, effectively utilizing two ATP equivalents for acetate activation. This greater energy investment in comparison to the ACK-PTA enzyme system employed by Methanosarcina sp. results in a much higher specificity and therefore lowered substrate threshold for Methanosaeta (Welte and Deppenmeier, 2014). Contrary to the AMP-forming ACS, the expression level of the putative ADP-forming ACS was reported to be very low during the exponential growth phase. Hence, the role of this putative ADP-forming ACS remains elusive (Berger et al., 2012). The presence of multiple copies of the ACS gene in Methanosaeta sp. is attributed towards their role in aceticlastic methanogenesis or lipid metabolism. In archaea, isoprenoid precursor compounds are utilized for synthesis of ether-linked membrane lipids that are structurally very different from the membrane lipids of bacteria and eukaryotes (Sehgal et al., 1962; Kates et al., 1963, 1966; De Rosa et al., 1982; Koga et al., 1993). The hydrophobic segments of archaeal membrane lipids constitute chains of isoprene molecules with regularly branching methyl groups (Matsumi et al., 2011). Archaeal isoprenoid molecules are synthesized through the mevalonate pathway. This pathway consists of 149 CHAPTER 5 seven enzymatic reactions and converts acetyl-CoA to isopentenyl diphosphate (IPP) and its isomer dimethylallyl diphosphate (DMAPP). Hence, acetyl-CoA generated through acetate activation by ACS remains indispensable for lipid biosynthesis in archaea. Interestingly, based on the habitat and environmental conditions, the archaeal membrane lipid composition varies significantly. Experimental evidence suggests that in Euryarchaeota and Crenarchaeaota ether-linked isoprenoid membrane lipids are best suited to support growth under extreme conditions (Komatsu and Chong, 1998; Brown et al., 2009; Chong, 2010). However, no strict correlation has been established between an extremophilic lifestyle and ether-linked isoprenoid lipids, as non-extremophilic Euryarchaeota have been known to contain same ether-linked membrane lipids as well (Matsumi et al., 2011). Based on genomic evidence, ANME-2a and ANME-2d archaea contain mechanisms of acetate activation similar to Methanosaeta sp. (Wang et al., 2014; Arshad, Speth, de Graaf, et al., 2015). However, unlike Methanosaeta sp. both ANME archaea do not harbour multiple ACS copies. Therefore, the acetate activating ACS enzymes characterized in this study are more likely to be involved in production of acetyl- CoA for cellular carbon assimilation. Wang et al., 2014 already speculated that ANME-2a ACS could catalyze the integration of acetate into biomass via acetyl- CoA synthesis at the cost of ATP as many methanogens do when acetate is available in the medium (Jetten et al., 1990). Future studies could use 13C labelled acetate in combination with metabolome and lipid analysis to investigate whether acetate is indeed incorporated into ANME biomass. Further analysis including Km values for ATP, along with utilization or production of ATP will further elucidate the role of ANME-2a and 2d ACS enzymes in biomass assimilation. Finally, identification and characterization of lipid biosynthesis pathways in ANME-2a and ANME-2d archaea would provide substantial insights regarding the role of ACS. Acknowledgements We thank Stefanie Berger for discussions and technical support during enzymatic assays. This study was supported by ERC AG EcoMoM 339880; SIAM 024002002; ERC AG Volcano 669371. 150 Characterization of acetyl-CoA synthetase from ANME archaea Supplementary materials Supplementary Fig 1: The strep-tag purified acetyl-CoA synthetase was separated on a 10% SDS-PAGE. The band at about 70 kDa represents the ACS proteins. Approx. 2 µg protein was applied for each sample. M: Marker 1: E. coli cell free extract (ANME-2d) 2: ANME-2d ACS purified 3: empty 5 4:E. coli cell free extract (ANME-2a) 5: ANME-2a ACS purified Supplementary Fig 2: Acetate specific activity of ANME-2a and ANME-2d acetyl-CoA synthetase. (♦) represent acetate conversion activity by ANME-2a ACS. ( ) represent acetate conversion profile by ANME-2d ACS. 151 Integration and Outlook 6 CHAPTER 6 154 Integration and Outlook In the (anaerobic) carbon, nitrogen and sulfur elemental cycles, microorganisms can be both sources and sinks for greenhouse gases. The studies described in this thesis were aimed at extending our knowledge of microbial cooperation and competition of carbon, nitrogen and sulfur cycling in hypoxic environments. Nitrate and to some extent nitrite are common constituents at oxic/anoxic interfaces where ammonium, produced from hydrolysis of dead biomass diffuses upwards from deeper anoxic layers and gets oxidized with oxygen diffusing from top layers. Here, methane can be used as a suitable electron donor to sustain microbial populations of nitrate/nitrite dependent anaerobic methane-oxidizing microorganisms. Furthermore, availability of ammonium and nitrate suggests the presence of other heterotrophic/autotrophic denitrifiers and anammox bacteria as additional competitors. Hence, the findings presented in this thesis contribute to an improved understanding of metabolic cooperation and competition among microorganisms as one of the main drivers that shape microbial communities in natural ecosystems. Furthermore, the knowledge obtained during these investigations might be relevant for making wastewater treatment applications more sustainable. Microbial interactions The very first evidence of nitrate-reduction coupled to anaerobic methane oxidation (AOM) was obtained from freshwater canal sediments (Raghoebarsing et al., 2006). 6 Archaea very similar to those found in these enrichments were characterized in an independent enrichment culture which contained a mixture of freshwater sediments and anaerobic wastewater sludge (Haroon et al., 2013). Although both enrichment cultures had different inoculation sources, the reduction of nitrate showed quite similar physiology: nitrate was reduced to nitrite in combination with methane being oxidized, while nitrite was further reduced to N2 either with methane or ammonium as electron donor. The successful cultivation of these anaerobic methanotrophic archaea (ANME-2d) with different bacterial partners, either Ca. M. oxyfera or anammox bacteria suggests that they do not require as selective a partnership as their marine ANME counterparts. ANME-2d archaea instead require a physiological partner capable of rapidly removing toxic nitrite produced during the nitrate-AOM reaction. The occurrence of the physiological partner is not solely dependent on the availability of nitrite, as an array of different factors may contribute to this selection, e.g. availability and quantities of the suitable electron donor have been shown to determine the dominant physiological partner (Haroon et al., 2013; Hu et al., 2015). The feasibility of enriching a co-culture of Ca. M. oxyfera and anammox bacteria without nitrate reducing ANME-2d has been successfully investigated for 155 CHAPTER 6 wastewater treatment applications (Luesken et al., 2011). However, in a similar investigation when ammonium was supplied in excess of the rate of nitrite reduction, anammox bacteria outcompeted Ca. M. oxyfera, as anammox bacteria have a better substrate affinity for nitrite(Hu et al., 2015). These findings could not be interpreted to anammox activity in natural ecosystems, as anammox bacteria mostly encounter ammonium limiting conditions close to oxic/anoxic interfaces. In addition to laboratory studies under controlled settings, numerous environmental surveys have confirmed the presence of denitrifying AOM microorganisms and anammox bacteria in freshwater, brackish or coastal, and marine ecosystems (see Welte et al., 2016 for review). In aforementioned environments, the presence of organic carbon or reduced sulfur compounds as electron donors creates a competition for nitrate utilization. A low carbon to nitrogen load would clearly yield a competitive advantage for heterotrophic denitrifiers, whereas higher C/N ratio (i.e. nitrate limitation) is shown to favour DNRA (Kraft et al., 2014; van den Berg et al., 2015). Sulfide on the other hand can either be a good electron donor for denitrification and DNRA, or a strong inhibitor for anammox and nitrous oxide reductase. To disentangle the possible microbial interactions, we studied the feasibility of nitrate reduction through sulfide dependent autotrophic denitrification and AOM together in enrichment culture (Chapter 2 and Chapter 3), as all these chemolithoautotrophs require nitrate as electron acceptor and create a three way link between carbon, nitrogen and sulfur biogeochemical cycles. Similar to nitrate- AOM, sulfide dependent autotrophic denitrification have also been shown to support anammox activity (Haroon et al., 2013; Russ et al., 2014; Hu et al., 2015). However, investigations of the aforementioned metabolic cooperation were performed under freshwater and marine conditions respectively. Although these reports provide an insight into formation of microbial interactions the growth conditions provided were only suitable for microbial interactions among carbon and nitrogen or nitrogen and sulfur biogeochemical cycles. The evaluation of the here discussed microbial processes suggests the possibility of an overlap between carbon, nitrogen and sulfur cycling in natural ecosystems. The research presented in Chapter 2 and Chapter 3 of this thesis addressed several underlying questions behind microbial cooperation and competition. Hereafter the findings of these investigations are discussed and directions for future studies are proposed. Metabolic cooperation and competition in a reactor model system To study the microbial interactions in natural ecosystems is challenging as they might be limited to very specific zones or depths in the sediments/interfaces and would 156 Integration and Outlook require sophisticated high resolution methods to visualize the exchange of substrates. The occurrence of other unrelated microbial processes will make these investigations even more complicated. Therefore, we chose to mimick these microbial interactions in a continuous bioreactor system. This allowed us to follow the physiological and molecular responses of the key members of the enrichment culture under selected growth conditions (brackish or coastal sediment, 1% NaCl) over a long period of time. After one year of operation we could show that a stable microbial community in the bioreactor metabolised all substrates and it was possible to attribute tentative removal rates to different physiological groups. Nitrogen loss in the form of N2 was due to the activity of anammox bacteria, sulfide-dependent denitrifiers and the combined activity of nitrate and nitrite dependent anaerobic methanotrophs (Chapter 2). Besides competition and collaboration for substrates, the microbial community in the bioreactor was dependent on the removal of intermediates that might have a toxic effect. It has been demonstrated previously that anammox bacteria are sensitive to sulfide stress (Russ et al., 2014) with maximum tolerance concentration of 10 µM. Thus, anammox bacteria were dependent on the sulfide-oxidizing autotrophic denitrifiers to regulate sulfide concentrations. On the other hand, it seemed that sulfide stimulated growth of Ca. M. nitroreducens, presumably through the maintenance of low redox potential and strictly anoxic conditions, as these methanotrophs rely on enzymes that are readily inactivated by oxygen. 6 A thorough determination of anammox, autotrophic denitrifiers and anaerobic methanotrophs cooperation and competition suggested an added value for demonstrating the recycling of fixed nitrogen on a larger scale. Furthermore, stable enrichment of microorganisms found in either freshwater or marine environments or both under here studied estuarine growth conditions highlights the remarkable adaptability of microorganisms in nature. Our findings provide strong indications for an expanded ecophysiology of these microorganisms. Ultimately, the quest for finding suitable ecosystems and showing that such interactions plays a role in nature and carry a significant environmental relevance should be pursued in further studies. The ecosystems where mineralisation products such as ammonium, and methane would be present along with nitrate could be suitable natural habitats for these microbial interactions. Besides analysing the contribution and enrichment of known microorganisms we enriched a novel Nitrospirae bacterium, which was only distantly related to Thermodesulfovibrio that are frequently found in environments containing sulfur, nitrogen and methane cycling. The newly enriched microorganism was assigned the name Candidatus Nitrobium versatile due to its versatile metabolic capacity predicted by a metagenome-assembled genome analysis. The 16S rRNA gene 157 CHAPTER 6 sequence inquiry provided further clues about potential habitats of this Nitrospirae bacterium. In future, development of molecular tools such as 16S rRNA primers and fluorescence in situ hybridization (FISH) probes specific for Ca. N. versatile would facilitate the identification of its environmental habitats. After showing that these interactions are feasible, the dynamics of such interactions could be investigated in more detail. Therefore, we applied nutrient limiting conditions in the follow up study to further test the stability of this enrichment culture (Chapter 3). The findings revealed that different physiological conditions might be more suitable for Ca. M. nitroreducens to perform dissimilatory nitrate reduction to ammonium (DNRA). The DNRA capability of Ca. M. nitroreducens is hypothesized as a detoxification mechanism against nitrite. Therefore, high nitrate concentrations with limited ammonium supply to nitrate-AOM, anammox enrichment culture might enhance possibility of DNRA by Ca. M. nitroreducens. In addition, future research should focus on re-enrichment of Ca. Nitrobium versatile by restoring the nutrient supplies as provided in Chapter 2. This would provide a direct proof of a possible link between the amendment (ammonium-limitation) in mineral medium and disappearance of Ca. N. versatile. Consequently, the metabolic potential of Ca. N. versatile needs to be investigated in highly enriched or pure cultures and therefore, future studies should include batch activity setups in combination with selected substrates. Metabolic versatility of anaerobic methanotrophic archaea Discovered around the turn of this century, ANME archaea are considered crucial regulators of the methane cycle in sub-oxic and anoxic environments. So far attempts of isolating ANME archaea in a pure culture have been unsuccessful, and slow growth further contributes to the challenges for biochemical research that requires large amounts of biomass. Nonetheless, several meta-genomic and transcriptomic studies have provided blueprints of the putative metabolism of ANME archaea. These metabolic reconstructions are largely based on extrapolation of physiological and genomic knowledge of methanogens (close phylogenetic relatives of ANME archaea), which have been thoroughly studied for decades (Thauer, 1998; Thauer et al., 2008; Buckel and Thauer, 2013; Welte and Deppenmeier, 2014). ANME archaea share the central carbon metabolism with methanogens with a reversal of physiological functions. Thus, key questions to address in the context of their physiology are, how energy is conserved through reverse methanogenesis, and how electrons derived from methane oxidation in the cytoplasm are transferred to either enzyme complexes in the pseudoperiplasm or to associated bacterial partners. A (meta)-genome based metabolic model for nitrate-driven anaerobic oxidation of 158 Integration and Outlook methane (AOM) presented in Chapter 4, addresses the aforementioned questions. Nitrate-AOM performing ANME-2d related Ca. Methanoperedens archaea do not require any bacterial partner for energy conservation, instead electrons are transferred to a membrane bound nitrate reductase complex. Previously, syntrophic coupling through diffusible molecules was considered as a possible electron transfer mechanism in other ANME archaea (see McGlynn, 2017; Timmers et al., 2017 for reviews). Furthermore, direct interspecies electron transfer (DIET) could be a possibility as well, since numerous multiheme cytochrome c (MHC) proteins are encoded in ANME genomes (Meyerdierks et al., 2010; Kletzin et al., 2015). Later studies of sulfate reducing bacteria paired with ANME-1 and ANME-2 consortia showed that cellular activities were independent of aggregate type and distance within the aggregates. These observations could be best explained through DIET (McGlynn et al., 2015). Additionally, for ANME-1 archaea syntrophic coupling was shown to be facilitated through a conductive mesh of MHCs that extended from the archaeal S-layer (Wegener et al., 2015). The ANME-2d genome also encoded most of these MHCs (Chapter 4; Berger et al., 2017) found in other ANME archaea. Under nitrate-AOM conditions only a fraction of MHCs were expressed and were further speculated to be involved in nitrate reduction, given that cytochrome c are capable of operating in the wide range of redox potentials required for coupling nitrate- AOM. The occurrence of MHCs has been reviewed by (Kletzin et al., 2015) and it 6 was highlighted that freshwater methane oxidizing archaea of the ANME-2d clade contained the highest number of c-type cytochromes encoded in an archaeal genome. These findings were quite remarkable, as unlike other ANME archaea, ANME-2d do not require syntrophic coupling to bacterial partners and many of the ANME-2d MHCs were not expressed when grown with nitrate as electron acceptor (Chapter 4). Supposedly, these c-type cytochromes could be involved in the reduction of metal (Fe, Mn) oxides coupled to AOM. Multiple studies have demonstrated that methane oxidation by ANME-1 and ANME-2 can be de-coupled from the bacterial partners when provided with suitable artificial electron acceptors (Wegener et al., 2015; S. Scheller et al., 2016), including soluble iron. Therefore, previous findings along with recent activity evidence from an ANME-2d enrichment culture (Ettwig et al., 2016a), suggests that ANME archaea can couple reduction of various metal oxides with AOM. According to the current views on AOM, sulfate-AOM is performed by ANME-1 and by members of ANME-2 clades while ANME-2d solely performs nitrate-AOM in freshwater ecosystems. Interestingly, the physiological evidence of sulfate-AOM in freshwater ecosystems (Schubert et al., 2011; Flynn et al., 2013; Timmers et al., 2016b), indicates that ANME-2d might be able to perform this 159 CHAPTER 6 reaction by donating electrons to a bacterial partner. Therefore, future studies need to focus on the role of MHC proteins suggested to transfer electrons to metal oxides or bacterial partners (Liu et al., 2014; Shrestha and Rotaru, 2014). Additionally, genome based energy conservation mechanisms of ANME-2d require biochemical characterization but lack of pure cultures represents a major hurdle for carrying out such biochemical investigations. As an alternative of bacterial partners, future research should include growth attempts of ANME-2d archaea in microbial fuel cells (Gao et al., 2017; McAnulty et al., 2017; Ren, 2017). Methanogens or methanotrophs? As the core carbon metabolism pathways are a common feature between methanotrophic archaea and methanogens, an interesting question arises whether methanotrophs are capable of producing methane. The physiological evidence obtained from environmental and laboratory investigations remain inconclusive: only sulfate-AOM related ANME archaea have been reported to produce trace amounts of methane as a result of enzymatic back flux from sediment slurries (Seifert et al., 2006; Treude et al., 2007; Orcutt et al., 2008). Another study showed that when faced with sulfate depletion the enzymatic back flux became more evident leading up to 78% of the rate of AOM (Yoshinaga et al., 2014). However, no evidence of net methanogenesis has been reported by ANME archaea. Recently, two studies investigating metabolic reversibility in ANME archaea confirmed that ANME archaea appear to be incapable of net methanogenesis (Ding et al., 2016; Wegener et al., 2016), This lack of methanogenesis was also in accordance with the genome based metabolic predictions (presented in Chapter 4 of this thesis, Haroon et al., 2013; Wang et al., 2014), since ANME-2d and ANME-2a archaea lack enzymes for H2 or methanol and methylated amine activation. Nevertheless, it is fascinating to ponder if through reversal of their carbon redox reactions and by involving certain sets of proteins ANME could conserve energy. Hence, by using the genomic information from Chapter 4, we conducted a functional investigation for proteins specifically linked to methanogenesis, acetyl-coenzyme A synthetase (ACS) from ANME-2d and ANME-2a as discussed in Chapter 5. Both archaeal enzymes were obtained through heterologous expression in E. coli and revealed an acetate activation capacity during in vitro assays. This was the very first report of successful heterologous expression of ANME proteins. Further studies in the near future should focus on resolving the biochemical nature (AMP-forming or ADP-forming) of these ACS enzymes because this information would be instrumental in defining whether ANME archaea do have a metabolic capacity to perform aceticlastic methanogenesis 160 Integration and Outlook or simply use acetate and other short chain organic acids for lipid metabolism. Additionally, this study suggests that ANME enzymes could be obtained through heterologous expression and therefore is an encouraging sign for future biochemical studies focusing on ANME archaea. Eventually, knowledge obtained from this biochemical characterization might contribute to an increased understanding of ANME ecophysiology. Taken together the findings of this PhD thesis have shown that many intriguing observations can be made at the interplay of the methane, nitrogen and sulfur cycles under anaerobic conditions. Future laboratory and field studies should be performed to translate these findings in 1) understanding the functioning of the methane cycle in natural and man-made ecosystems and 2) in applying the novel methane cycle microorganism in more sustainable wastewater treatment systems. 6 161 Bibliography Acknowledgements Curriculum vitae Publication list Bibliography 164 Bibliography Bibliography Akunna, J.C., Bizeau, C., and Moletta, R. (1993) Nitrate and nitrite reductions with anaerobic sludge using various carbon sources: Glucose, glycerol, acetic acid, lactic acid and methanol. Water Res 27: 1303–1312. Albertsen, M., Hugenholtz, P., Skarshewski, A., Nielsen, K.L., Tyson, G.W., and Nielsen, P.H. (2013) Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes. Nat Biotechnol 31: 533–538. Almeida, M.G., Macieira, S., Gonçalves, L.L., Huber, R., Cunha, C.A., Romão, M.J., et al. (2003) The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774. Re-evaluation of the spectroscopic data and redox properties. Eur J Biochem 270: 3904–3915. Alneberg, J., Bjarnason, B.S., de Bruijn, I., Schirmer, M., Quick, J., Ijaz, U.Z., et al. (2014) Binning metagenomic contigs by coverage and composition. Nat Methods 11: 1144–1146. Altermann, E. (2014) Invited commentary: Lubricating the rusty wheel, new insights into iron oxidizing bacteria through comparative genomics. Front Microbiol 5: 1–4. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. (1990) Basic local alignment search tool. J Mol Biol 215: 403–410. Amann, R.I., Binder, B.J., Olson, R.J., Chisholm, S.W., Devereux, R., and Stahl, D.A. (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 56: 1919–1925. Amos, R.T., Bekins, B.A., Cozzarelli, I.M., Voytek, M.A., Kirshtein, J.D., Jones, E.J.P., and Blowes, D.W. (2012) Evidence for iron-mediated anaerobic methane oxidation in a crude oil- contaminated aquifer. Geobiology 10: 506–17. Anantharaman, K., Brown, C.T., Hug, L.A., Sharon, I., Castelle, C.J., Probst, A.J., et al. (2016) aquifer system. Nat Publ Gr 7: 1–11. Anke, H. and Spector, L.B. (1975) Evidence for an acetyl-enzyme intermediate in the action of acetyl- CoA synthetase. Biochem Biophys Res Commun 67: 767–73. Arshad, A., Dalcin Martins, P., Frank, J., Jetten, M.S.M., Op den Camp, H.J.M., and Welte, C.U. (2017) Mimicking microbial interactions under nitrate-reducing conditions in an anoxic bioreactor: enrichment of novel Nitrospirae bacteria distantly related to Thermodesulfovibrio. Environ Microbiol 19: 4965–4977. Arshad, A., Speth, D.R., de Graaf, R.M., Op den Camp, H.J.M., Jetten, M.S.M., and Welte, C.U. (2015) A metagenomics-based metabolic model of nitrate-dependent anaerobic oxidation of methane by Methanoperedens-like archaea. Front Microbiol 6: 1423. Babbitt, P.C., Kenyon, G.L., Martin, B.M., Charest, H., Slyvestre, M., Scholten, J.D., et al. (1992) Ancestry of the 4-chlorobenzoate dehalogenase: analysis of amino acid sequence identities among families of acyl:adenyl ligases, enoyl-CoA hydratases/isomerases, and acyl-CoA thioesterases. Biochemistry 31: 5594–604. Bagos, P.G., Tsirigos, K.D., Plessas, S.K., Liakopoulos, T.D., and Hamodrakas, S.J. (2009) Prediction of signal peptides in archaea. Protein Eng Des Sel 22: 27–35. Baker, B.J., Lazar, C.S., Teske, A.P., and Dick, G.J. (2015) Genomic resolution of linkages in carbon, nitrogen, and sulfur cycling among widespread estuary sediment bacteria. Microbiome 3: 14. Bamford, V.A., Angove, H.C., Seward, H.E., Thomson, A.J., Cole, J.A., Butt, J.N., et al. (2002) Structure and spectroscopy of the periplasmic cytochrome c nitrite reductase from Escherichia coli. Biochemistry 41: 2921–2931. Barber, R.D. and Ferry, J.G. (2001) Methanogenesis. In, Encyclopedia of Life Sciences. John Wiley & Sons, Ltd, Chichester. Bäumer, S., Ide, T., Jacobi, C., Johann, A., Gottschalk, G., and Deppenmeier, U. (2000) The F420H2 165 Bibliography dehydrogenase from Methanosarcina mazei is a redox-driven proton pump closely related to NADH dehydrogenases. J Biol Chem 275: 17968–17973. BBMap - Bushnell B. - sourceforge.net/projects/bbmap/. Becher, B., Müller, V., and Gottschalk, G. (1992) N5-methyl-tetrahydromethanopterin:coenzyme M methyltransferase of Methanosarcina strain Gö1 is an Na+-translocating membrane protein. J Bacteriol 174: 7656–7660. Behrendt, A., de Beer, D., and Stief, P. (2013) Vertical activity distribution of dissimilatory nitrate reduction in coastal marine sediments. Biogeosciences 10: 7509–7523. van den Berg, E.M., Boleij, M., Kuenen, J.G., Kleerebezem, R., and van Loosdrecht, M.C.M. (2016) DNRA and Denitrification Coexist over a Broad Range of Acetate/N-NO3− Ratios, ina Chemostat Enrichment Culture. Front Microbiol 7:. van den Berg, E.M., van Dongen, U., Abbas, B., and van Loosdrecht, M.C. (2015) Enrichment of DNRA bacteria in a continuous culture. ISME J 9: 2153–2161. van den Berg, E.M., Elisário, M.P., Kuenen, J.G., Kleerebezem, R., and van Loosdrecht, M.C.M. (2017) Fermentative Bacteria Influence the Competition between Denitrifiers and DNRA Bacteria. Front Microbiol 8:. van den Berg, E.M., Rombouts, J.L., Kuenen, J.G., Kleerebezem, R., and van Loosdrecht, M.C.M. (2017) Role of nitrite in the competition between denitrification and DNRA in a chemostat enrichment culture. AMB Express 7: 91. Berg, I.A., Kockelkorn, D., Ramos-Vera, W.H., Say, R.F., Zarzycki, J., Hügler, M., et al. (2010) Autotrophic carbon fixation in archaea.Nat Rev Microbiol 8: 447–460. Berg, P. (1956a) Acyl adenylates; an enzymatic mechanism of acetate activation. J Biol Chem 222: 991–1013. Berg, P. (1956b) Acyl adenylates; the synthesis and properties of adenyl acetate. J Biol Chem 222: 1015–23. Berger, S., Frank, J., Dalcin Martins, P., Jetten, M.S.M., and Welte, C.U. (2017) High-Quality Draft Genome Sequence of “Candidatus Methanoperedens sp.” Strain BLZ2, a Nitrate-Reducing Anaerobic Methane-Oxidizing Archaeon Enriched in an Anoxic Bioreactor. Genome Announc 5:. Berger, S., Welte, C., and Deppenmeier, U. (2012) Acetate Activation in Methanosaeta thermophila : Characterization of the Key Enzymes Pyrophosphatase and Acetyl-CoA Synthetase. Archaea 2012: 1–10. Bernard, R.J., Mortazavi, B., and Kleinhuizen, A.A. (2015) Dissimilatory nitrate reduction to ammonium (DNRA) seasonally dominates NO3 − reduction pathways in an anthropogenically impacted sub-tropical coastal lagoon. Biogeochemistry 125: 47–64. Berry, E.A., Guergova-Kuras, M., Huang, L.S., and Crofts, A.R. (2000) Structure and function of cytochrome bc complexes. Annu Rev Biochem 69: 1005–1075. Bertram, S., Blumenberg, M., Michaelis, W., Siegert, M., Krüger, M., and Seifert, R. (2013) Methanogenic capabilities of ANME-archaea deduced from 13 C-labelling approaches. Environ Microbiol 15: 2384–2393. Betlach, M.R. and Tiedje, J.M. (1981) Kinetic explanation for accumulation of nitrite, nitric oxide, and nitrous oxide during bacterial denitrification.Appl Environ Microbiol 42: 1074–84. Black, E.M., Chimenti, M.S., and Just, C.L. (2017) Effect of freshwater mussels on the vertical distribution of anaerobic ammonia oxidizers and other nitrogen-transforming microorganisms in upper Mississippi river sediment. PeerJ 5: e3536. Bodelier, P. LE and Steenbergh, A.K. (2014) Interactions between methane and the nitrogen cycle in light of climate change. Curr Opin Environ Sustain 9–10: 26–36. Boetius, A., Ravenschlag, K., Schubert, C.J., Rickert, D., Widdel, F., Gieseke, A., et al. (2000a) A marine microbial consortium apparently mediating anaerobic oxidation of methane. Nature 407: 623–6. Boetius, A. and Wenzhöfer, F. (2013) Seafloor oxygen consumption fuelled by methane from cold 166 Bibliography seeps. Nat Geosci 6: 725–734. Bonete, M.J., Martinez-Espinosa, R.M., Pire, C., Zafrilla, B., and Richardson, D.J. (2008) Nitrogen metabolism in haloarchaea. Saline Systems 4: 9. Borrel, G., Adam, P.S., and Gribaldo, S. (2016) Methanogenesis and the Wood–Ljungdahl Pathway: An Ancient, Versatile, and Fragile Association. Genome Biol Evol 8: 1706–1711. Bousquet, P., Ciais, P., Miller, J.B., Dlugokencky, E.J., Hauglustaine, D.A., Prigent, C., et al. (2006) Contribution of anthropogenic and natural sources to atmospheric methane variability. Nature 443: 439–443. Bräsen, C. and Schönheit, P. (2005) AMP-forming acetyl-CoA synthetase from the extremely halophilic archaeon Haloarcula marismortui: purification, identification and expression of the encoding gene, and phylogenetic affiliation.Extremophiles 9: 355–65. Bräsen, C., Urbanke, C., and Schönheit, P. (2005) A novel octameric AMP-forming acetyl-CoA synthetase from the hyperthermophilic crenarchaeon Pyrobaculum aerophilum. FEBS Lett 579: 477–82. Brin, L.D., Giblin, A.E., and Rich, J.J. (2015) Effects of experimental warming and carbon addition on nitrate reduction and respiration in coastal sediments. Biogeochemistry 125: 81–95. ten Brink, F., Schoepp-Cothenet, B., van Lis, R., Nitschke, W., and Baymann, F. (2013) Multiple Rieske/cytb complexes in a single organism. Biochim Biophys Acta 1827: 1392–1406. Broda, E. (1977) Two kinds of lithotrophs missing in nature. Z Allg Mikrobiol 17: 491–493. Brondijk, T.H., Fiegen, D., Richardson, D.J., and Cole, J.A. (2002) Roles of NapF, NapG and NapH, subunits of the Escherichia coli periplasmic nitrate reductase, in ubiquinol oxidation. Mol Microbiol 44: 245–255. Brondijk, T.H., Nilavongse, A., Filenko, N., Richardson, D.J., and Cole, J.A. (2004) NapGH components of the periplasmic nitrate reductase of Escherichia coli K-12: location, topology and physiological roles in quinol oxidation and redox balancing. Biochem J 379: 47–55. Brown, D.A., Venegas, B., Cooke, P.H., English, V., and Chong, P.L.-G. (2009) Bipolar tetraether archaeosomes exhibit unusual stability against autoclaving as studied by dynamic light scattering and electron microscopy. Chem Phys Lipids 159: 95–103. Brown, T.D., Jones-Mortimer, M.C., and Kornberg, H.L. (1977) The enzymic interconversion of acetate and acetyl-coenzyme A in Escherichia coli. J Gen Microbiol 102: 327–36. Bru, D., Ramette, A., Saby, N.P.A., Dequiedt, S., Ranjard, L., Jolivet, C., et al. (2011) Determinants of the distribution of nitrogen-cycling microbial communities at the landscape scale. ISME J 5: 532–542. Bruckner, C.G., Mammitzsch, K., Jost, G., Wendt, J., Labrenz, M., and Jürgens, K. (2013) Chemolithoautotrophic denitrification of epsilonproteobacteria in marine pelagic redox gradients. Environ Microbiol 15: 1505–13. Brüggemann, H., Falinski, F., and Deppenmeier, U. (2000) Structure of the F420H2 : quinone oxidoreductase of Archaeoglobus fulgidus - Identification and overproduction of the F420H2- oxidizing subunit. Eur J Biochem 267: 5810–5814. Brunet, R.C. and Garcia-Gil, L.J. (1996) Sulfide-induced dissimilatory nitrate reduction to ammonia in anaerobic freshwater sediments. FEMS Microbiol Ecol 21: 131–138. Bu, C., Wang, Y., Ge, C., Ahmad, H.A., Gao, B., and Ni, S.-Q. (2017) Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity. Sci Rep 7: 6830. Buckel, W. and Thauer, R.K. (2013) Energy conservation via electron bifurcating ferredoxin reduction and proton/Na+ translocating ferredoxin oxidation. Biochim Biophys Acta - Bioenerg 1827: 94–113. Burgin, A.J. and Hamilton, S.K. (2007) Have we overemphasized the role of denitrification in aquatic ecosystems? A review of nitrate removal pathways. Front Ecol Environ 5: 89–96. Bushnell, B. (2015) BBMap - Bushnell B. - sourceforge.net/projects/bbmap/. Byrne, N., Strous, M., Crépeau, V., Kartal, B., Birrien, J.-L., Schmid, M., et al. (2009) Presence and 167 Bibliography activity of anaerobic ammonium-oxidizing bacteria at deep-sea hydrothermal vents. ISME J 3: 117–23. Caldwell, S.L., Laidler, J.R., Brewer, E.A., Eberly, J.O., Sandborgh, S.C., and Colwell, F.S. (2008) Anaerobic oxidation of methane: mechanisms, bioenergetics, and the ecology of associated microorganisms. Environ Sci Technol 42: 6791–9. Canfield, D.E., Glazer, A.N., and Falkowski, P.G. (2010) The evolution and future of earth’s nitrogen cycle. Science (80- ) 330: 192–196. Canfield, D.E., Stewart, F.J., Thamdrup, B., De Brabandere, L., Dalsgaard, T., Delong, E.F., etal. (2010) A cryptic sulfur cycle in oxygen-minimum-zone waters off the Chilean coast. Science (80- ) 330: 1375–1378. Castelle, C.J., Wrighton, K.C., Thomas, B.C., Hug, L.A., Brown, C.T., Wilkins, M.J., et al. (2015) Genomic Expansion of Domain Archaea Highlights Roles for Organisms from New Phyla in Anaerobic Carbon Cycling. Curr Biol 25: 690–701. Castro-Barros, C.M., Ho, L.T., Winkler, M.K.H., and Volcke, E.I.P. (2017) Integration of methane removal in aerobic anammox-based granular sludge reactors. Environ Technol 1–11. Catalyst, B. (2017) v d n a e c w e i o r s f o v d n a e c w e i s. 0:. Chen, J., Hanke, A., Tegetmeyer, H.E., Kattelmann, I., Sharma, R., Hamann, E., et al. (2017) Impacts of chemical gradients on microbial community structure. ISME J 11: 920–931. Chiang, R.C., Cavicchioli, R., and Gunsalus, R.P. (1997) “Locked-on” and “locked-off” signal transduction mutations in the periplasmic domain of the Escherichia coli NarQ and NarX sensors affect nitrate- and nitrite-dependent regulation by NarL and NarP. Mol Microbiol 24: 1049–1060. Chong, P.L.-G. (2010) Archaebacterial bipolar tetraether lipids: Physico-chemical and membrane properties. Chem Phys Lipids 163: 253–65. Ciasis, P., Sabine, C., Bala, G., Bopp, L., Brovkin, V., Canadell, J., et al. (2013) Carbon and Other Biogeochemical Cycles. Clim Chang 2013 - Phys Sci Basis 465–570. de Cima, S., Rúa, J., del Valle, P., Busto, F., Baroja-Mazo, A., and de Arriaga, D. (2007) Different stabilities of two AMP-forming acetyl-CoA synthetases from Phycomyces blakesleeanus expressed under different environmental conditions. J Biochem 142: 247–55. Cole, J.A. (1988) Assimilatory and dissimilatory reduction of nitrate to ammonia, in: The Nitrogen and Sulphur Cycles. Cambridge Univ Press 281–329. Cole, J.A. and Richardson, D.J. (2008) Respiration of Nitrate and Nitrite. EcoSal Plus 3:. Cole and Brown, C.M. (1980) NITRITE REDUCTION TO AMMONIA BY FERMENTATIVE BACTERIA: A SHORT CIRCUIT IN THE BIOLOGICAL NITROGEN CYCLE. FEMS Microbiol Lett 7: 65–72. Conrad, R. (1996) Soil microorganisms as controllers of atmospheric trace gases (H2, CO, CH4, OCS, N2O, and NO). Microbiol Rev 60: 609–640. Conrad, R. (2009) The global methane cycle: recent advances in understanding the microbial processes involved. Environ Microbiol Rep 1: 285–292. Daims, H., Brühl, A., Amann, R., Schleifer, K.-H., and Wagner, M. (1999) The domain-specific probe EUB338 is insufficient for the detection of all bacteria: development and evaluation of a more comprehensive probe set. Syst Appl Microbiol 22: 434–444. Daims, H., Lebedeva, E. V., Pjevac, P., Han, P., Herbold, C., Albertsen, M., et al. (2015) Complete nitrification by Nitrospira bacteria.Nature 528: 504–509. Daims, H., Stoecker, K., and Wagner, M. (2005) Fluorescence in situ hybridization for the detection of prokaryotes. In, Osborn,A.M. and Smith,C.J. (eds), Molecular Microbial Ecology. Taylor & Francis Group, New York, pp. 213–239. Dairi, T. (2009) An alternative menaquinone biosynthetic pathway operating in microorganisms. Seikagaku 81: 95–99. Dale, O.R., Tobias, C.R., and Song, B. (2009) Biogeographical distribution of diverse anaerobic ammonium oxidizing (anammox) bacteria in Cape Fear River Estuary. Environ Microbiol 11: 168 Bibliography 1194–207. Dalsgaard, F., Bak, T. (1994) Nitrate reduction in a sulfate-reducing bacterium, Desulfovibrio desulfuricans, isolated from rice paddy soil. Appl Environ Microbiol 60: 291–297. Dalsgaard, T., Canfield, D.E., Petersen, J., Thamdrup, B., and Acuña-González, J. (2003) N2 production by the anammox reaction in the anoxic water column of Golfo Dulce, Costa Rica. Nature 422: 606–8. Dannenberg, S., Kroder, M., Dilling, W., and Cypionka, H. (1992) Oxidation of H2, organic compounds and inorganic sulfur compounds coupled to reduction of O2 or nitrate by sulfate-reducing bacteria. Arch Microbiol 158: 93–99. Dedysh, S.N., Berestovskaya, Y.Y., Vasylieva, L. V, Belova, S.E., Khmelenina, V.N., Suzina, N.E., et al. (2004) Methylocella tundrae sp. nov., a novel methanotrophic bacterium from acidic tundra peatlands. Int J Syst Evol Microbiol 54: 151–6. Dekas, A.E., Connon, S. a, Chadwick, G.L., Trembath-Reichert, E., and Orphan, V.J. (2015) Activity and interactions of methane seep microorganisms assessed by parallel transcription and FISH- NanoSIMS analyses. ISME J 10: 1–15. Ding, J., Fu, L., Ding, Z.-W., Lu, Y.-Z., Cheng, S.H., and Zeng, R.J. (2016) Experimental evaluation of the metabolic reversibility of ANME-2d between anaerobic methane oxidation and methanogenesis. Appl Microbiol Biotechnol 100: 6481–90. Ding, Z.-W., Ding, J., Fu, L., Zhang, F., and Zeng, R.J. (2014) Simultaneous enrichment of denitrifying methanotrophs and anammox bacteria. Appl Microbiol Biotechnol 98: 10211–21. Dixon, R. and Kahn, D. (2004) Genetic regulation of biological nitrogen fixation. Nat Rev Microbiol 2: 621–31. Doddema, H.J. and Vogels, G.D. (1978) Improved identification of methanogenic bacteria by fluorescence microscopy.Appl Env Microbiol 36: 752–754. Dong, L.F., Smith, C.J., Papaspyrou, S., Stott, A., Osborn, A.M., and Nedwell, D.B. (2009) Changes in Benthic Denitrification, Nitrate Ammonification, and Anammox Process Rates and Nitrate and Nitrite Reductase Gene Abundances along an Estuarine Nutrient Gradient (the Colne Estuary, United Kingdom). Appl Environ Microbiol 75: 3171–3179. Dong, L.F., Sobey, M.N., Smith, C.J., Rusmana, I., Phillips, W., Stott, A., et al. (2011) Dissimilatory reduction of nitrate to ammonium, not denitrification or anammox, dominates benthic nitrate reduction in tropical estuaries. Limnol Oceanogr 56: 279–291. Dong, L.F., Thornton, D.C.O., Nedwell, D.B., and Underwood, G.J.C. (2000) Denitrification in sediments of the river Colne Estuary, England. Mar Ecol Prog Ser 203: 109–122. Du, R., Cao, S., Li, B., Niu, M., Wang, S., and Peng, Y. (2016) Performance and microbial community analysis of a novel DEAMOX based on partial-denitrification and anammox treating ammonia and nitrate wastewaters. Water Res 1–11. Dunn, G.M., HERBERT, R.A., and BROWN, C.M. (1979) Influence of Oxygen Tension on Nitrate Reduction by a Klebsiella sp. Growing in Chemostat Culture. J Gen Microbiol 112: 379–383. Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797. Egger, M., Rasigraf, O., Sapart, C.J., Jilbert, T., Jetten, M.S.M., Röckmann, T., et al. (2015a) Iron- mediated anaerobic oxidation of methane in brackish coastal sediments. Environ Sci Technol 49: 277–283. Egger, M., Rasigraf, O., Sapart, C.J., Jilbert, T., Jetten, M.S.M., Röckmann, T., et al. (2015b) Iron- Mediated Anaerobic Oxidation of Methane in Brackish Coastal Sediments. Environ Sci Technol 49: 277–283. Einsle, O. and Kroneck, P.M.H. (2004) Structural basis of denitrification.Biol Chem 385:. Eller, G., Kanel, L., and Kruger, M. (2005) Cooccurrence of Aerobic and Anaerobic Methane Oxidation in the Water Column of Lake Plu see. Appl Environ Microbiol 71: 8925–8928. EPA (2010) Methane and Nitrous Oxide Emissions from Natural Sources. US Environ Prot Agency, Washington, DC, USA. 169 Bibliography Ettwig, K.F., van Alen, T., van de Pas-Schoonen, K.T., Jetten, M.S., and Strous, M. (2009) Enrichment and molecular detection of denitrifying methanotrophic bacteria of the NC10 phylum. Appl Env Microbiol 75: 3656–3662. Ettwig, K.F., Butler, M.K., Paslier, D. Le, Pelletier, E., Mangenot, S., Kuypers, M.M.M., et al. (2010) Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature 464: 543–548. Ettwig, K.F., Shima, S., van de Pas-Schoonen, K.T., Kahnt, J., Medema, M.H., Op den Camp, H.J.M., et al. (2008) Denitrifying bacteria anaerobically oxidize methane in the absence of Archaea. Environ Microbiol 10: 3164–73. Ettwig, K.F., Speth, D.R., Reimann, J., Wu, M.L., Jetten, M.S.M., and Keltjens, J.T. (2012) Bacterial oxygen production in the dark. Front Microbiol 3:. Ettwig, K.F., Zhu, B., Speth, D., Keltjens, J.T., Jetten, M.S.M., and Kartal, B. (2016b) Archaea catalyze iron-dependent anaerobic oxidation of methane. Proc Natl Acad Sci USA 113: 12792–12796. Evans, P.N., Parks, D.H., Chadwick, G.L., Robbins, S.J., Orphan, V.J., Golding, S.D., and Tyson, G.W. (2015) Methane metabolism in the archaeal phylum Bathyarchaeota revealed by genome- centric metagenomics. Science 350: 434–8. Falkowski, P. (2000) The Global Carbon Cycle: A Test of Our Knowledge of Earth as a System. Science (80- ) 290: 291–296. Falkowski, P.G., Fenchel, T., and Delong, E.F. (2008) The microbial engines that drive earth’s biogeochemical cycles. Science (80- ) 320: 1034–1039. Finster, K., Liesack, W., and Thamdrup, B. (1998) Elemental sulfur and thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new anaerobic bacterium isolated from marine surface sediment. Appl Environ Microbiol 64: 119–125. Fiore, A.M., Naik, V., and Leibensperger, E.M. (2015) Air Quality and Climate Connections. J Air Waste Manage Assoc 65: 645–685. Flynn, T.M., Sanford, R.A., Ryu, H., Bethke, C.M., Levine, A.D., Ashbolt, N.J., and Santo Domingo, J.W. (2013) Functional microbial diversity explains groundwater chemistry in a pristine aquifer. BMC Microbiol 13: 146. Forouhar, F., Abashidze, M., Xu, H., Grochowski, L.L., Seetharaman, J., Hussain, M., et al. (2008) Molecular insights into the biosynthesis of the F420 coenzyme. J Biol Chem 283: 11832–11840. Frank, Y.A., Kadnikov, V. V., Lukina, A.P., Banks, D., Beletsky, A. V., Mardanov, A. V., et al. (2016) Characterization and genome analysis of the first facultatively alkaliphilicThermodesulfovibrio isolated from the deep terrestrial subsurface. Front Microbiol 7: 2000. Frederiksen, T.-M. and Finster, K. (2003) Sulfite-oxidoreductase is involved in the oxidation of sulfite in Desulfocapsa sulfoexigens during disproportionation of thiosulfate and elemental sulfur. Biodegradation 14: 189–198. Fuchs, G., Stupperich, E., and Thauer, R.K. (1978) Acetate assimilation and the synthesis of alanine, aspartate and glutamate in Methanobacterium thermoautotrophicum. Arch Microbiol 117: 61–6. Galán, A., Molina, V., Thamdrup, B., Woebken, D., Lavik, G., Kuypers, M.M.M., and Ulloa, O. (2009) Anammox bacteria and the anaerobic oxidation of ammonium in the oxygen minimum zone off northern Chile. Deep Sea Res Part II Top Stud Oceanogr 56: 1021–1031. Galloway, J., Aber, J.D., Erisman, J.., Seitzinger, S.P., Howarth, R.W., Cowling, E.B., and Cosby, B.J. (2003) The Nitrogen Cascade. Bioscience 53: 341–356. Galloway, J.N., Dentener, F.J., Capone, D.G., Boyer, E.W., Howarth, R.W., Seitzinger, S.P., et al. (2004) Nitrogen Cycles: Past, Present, and Future. Biogeochemistry 70: 153–226. Gao, Y., Ryu, H., Rittmann, B.E., Hussain, A., and Lee, H.-S. (2017) Quantification of the methane concentration using anaerobic oxidation of methane coupled to extracellular electron transfer. Bioresour Technol 241: 979–984. Giles, M., Morley, N., Baggs, E.M., Daniell, T.J., Taylor, A.E., and State, O. (2012) Soil nitrate reducing processes – drivers , mechanisms for spatial variation , and significance for nitrous oxide production. 3: 1–16. Glaubitz, S., Lueders, T., Abraham, W.-R., Jost, G., Jürgens, K., and Labrenz, M. (2009) 13C-isotope 170 Bibliography analyses reveal that chemolithoautotrophic Gamma- and Epsilonproteobacteria feed a microbial food web in a pelagic redoxcline of the central Baltic Sea. Environ Microbiol 11: 326–37. Glombitza, C., Adhikari, R.R., Riedinger, N., Gilhooly, W.P., Hinrichs, K.-U., and Inagaki, F. (2016) Microbial sulfate reduction potential in coal-bearing sediments down to ~2.5 km below the seafloor off Shimokita Peninsula, Japan.Front Microbiol 7: 1576. van de Graaf, A.A., de Bruijn, P., Robertson, L.A., Jetten, M.S.M., and Kuenen, J.G. (1996) Autotrophic growth of anaerobic ammonium-oxidizing micro-organisms in a fluidized bed reactor. Microbiology 142: 2187–2196. Graham, D.E., Taylor, S.M., Wolf, R.Z., and Namboori, S.C. (2009) Convergent evolution of coenzyme M biosynthesis in the Methanosarcinales: cysteate synthase evolved from an ancestral threonine synthase. Biochem J 424: 467–478. Graham, D.E., Taylor, S.M., Wolf, R.Z., and Namboori, S.C. (2009) Convergent evolution of coenzyme M biosynthesis in the Methanosarcinales: cysteate synthase evolved from an ancestral threonine synthase. Biochem J 424: 467–78. Graham, E.D., Heidelberg, J.F., and Tully, B.J. (2017) BinSanity: unsupervised clustering of environmental microbial assemblies using coverage and affinity propagation.PeerJ 5: e3035. Griess, P. (1879) Bemerkungen zu der Abhandlung der HH. Weselsky und Benedikt „Ueber einige Azoverbindungen”. Berichte der Dtsch Chem Gesellschaft 12: 426–428. Gruber, N. and Galloway, J.N. (2008) An Earth-system perspective of the global nitrogen cycle. Nature 451: 293–6. Haaijer, S.C.M., Van der Welle, M.E.W., Schmid, M.C., Lamers, L.P.M., Jetten, M.S.M., and Op den Camp, H.J.M. (2006) Evidence for the involvement of betaproteobacterial Thiobacilli in the nitrate-dependent oxidation of iron sulfide minerals.FEMS Microbiol Ecol 58: 439–448. Haase, D., Hermann, B., Einsle, O., and Simon, J. (2017) Epsilonproteobacterial hydroxylamine oxidoreductase ( ε Hao): characterization of a “missing link” in the multihaem cytochrome c family. Mol Microbiol 105: 127–138. Hakemian, A.S. and Rosenzweig, A.C. (2007) The biochemistry of methane oxidation. Annu Rev Biochem 76: 223–41. Hallam, S.J., Putnam, N., Preston, C.M., Detter, J.C., Rokhsar, D., Richardson, P.M., and DeLong, E.F. (2004) Reverse methanogenesis: testing the hypothesis with environmental genomics. Science (80- ) 305: 1457–1462. Hansel, C.M., Lentini, C.J., Tang, Y., Johnston, D.T., Wankel, S.D., and Jardine, P.M. (2015) Dominance of sulfur-fueled iron oxide reduction in low-sulfate freshwater sediments. ISME J 9: 2400–2412. Hanson, T.E., Campbell, B.J., Kalis, K.M., Campbell, M.A., and Klotz, M.G. (2013) Nitrate ammonification by Nautilia profundicola AmH: experimental evidence consistent with a free hydroxylamine intermediate. Front Microbiol 4: 180. Haouari, O., Fardeau, M.-L., Cayol, J.-L., Casiot, C., Elbaz-Poulichet, F., Hamdi, M., et al. (2008) Desulfotomaculum hydrothermale sp. nov., a thermophilic sulfate-reducing bacterium isolated from a terrestrial Tunisian hot spring. Int J Syst Evol Microbiol 58: 2529–2535. Hardison, A.K., Algar, C.K., Giblin, A.E., and Rich, J.J. (2015) Influence of organic carbon and nitrate loading on partitioning between dissimilatory nitrate reduction to ammonium (DNRA) and N 2 production. Geochim Cosmochim Acta 164: 146–160. Hardisty, D.S., Olyphant, G.A., Bell, J.B., Johnson, A.P., and Pratt, L.M. (2013) Acidophilic sulfur disproportionation. Geochim Cosmochim Acta 113: 136–151. Haroon, M.F., Hu, S., Shi, Y., Imelfort, M., Keller, J., Hugenholtz, P., et al. (2013) Anaerobic oxidation of methane coupled to nitrate reduction in a novel archaeal lineage. Nature 500: 567–570. Härtig, E., Schiek, U., Vollack, K.U., and Zumft, W.G. (1999) Nitrate and nitrite control of respiratory nitrate reduction in denitrifying Pseudomonas stutzeri by a two-component regulatory system homologous to NarXL of Escherichia coli. J Bacteriol 181: 3658–65. Hatzenpichler, R., Connon, S.A., Goudeau, D., Malmstrom, R.R., Woyke, T., and Orphan, V.J. (2016) Visualizing in situ translational activity for identifying and sorting slow-growing archaeal- 171 Bibliography bacterial consortia. Proc Natl Acad Sci U S A 113: E4069-78. Hausmann, B., Knorr, K.-H., Schreck, K., Tringe, S.G., Glavina del Rio, T., Loy, A., and Pester, M. (2016) Consortia of low-abundance bacteria drive sulfate reduction-dependent degradation of fermentation products in peat soil microcosms. ISME J 10: 2365–2375. He, F. (2011) Laemmli-SDS-PAGE. BIO-PROTOCOL 1:. He, Y., Li, M., Perumal, V., Feng, X., Fang, J., Xie, J., et al. (2016) among multiple lineages of the archaeal phylum Bathyarchaeota widespread in marine sediments. 1–9. Helen, D., Kim, H., Tytgat, B., and Anne, W. (2016) Highly diverse nirK genes comprise two major clades that harbour ammonium-producing denitrifiers.BMC Genomics 17: 155. Hemmi, H., Takahashi, Y., Shibuya, K., Nakayama, T., and Nishino, T. (2005) Menaquinone-specific prenyl reductase from the hyperthermophilic archaeon Archaeoglobus fulgidus. J Bacteriol 187: 1937–1944. Henry, E.A., Devereux, R., Maki, J.S., Gilmour, C.C., Woese, C.R., Mandelco, L., et al. (1994) Characterization of a new thermophilic sulfate-reducing bacterium. Arch Microbiol 161: 62–69. Hernandez, D. and Rowe, J.J. (1987) Oxygen regulation of nitrate uptake in denitrifying Pseudomonas aeruginosa. Appl Environ Microbiol 53: 745–50. Hinrichs, K.-U. and Boetius, A. (2002) The Anaerobic Oxidation of Methane: New Insights in Microbial Ecology and Biogeochemistry. In, Ocean Margin Systems. Springer Berlin Heidelberg, Berlin, Heidelberg, pp. 457–477. Hinrichs, K.U., Hayes, J.M., Sylva, S.P., Brewer, P.G., and DeLong, E.F. (1999) Methane-consuming archaebacteria in marine sediments. Nature 398: 802–5. Hiratsuka, T., Furihata, K., Ishikawa, J., Yamashita, H., Itoh, N., Seto, H., and Dairi, T. (2008) An alternative menaquinone biosynthetic pathway operating in microorganisms. Science (80- ) 321: 1670–1673. Ho, A., Vlaeminck, S.E., Ettwig, K.F., Schneider, B., Frenzel, P., and Boon, N. (2013) Revisiting Methanotrophic Communities in Sewage Treatment Plants. Appl Environ Microbiol 79: 2841– 2846. Hoehler, T.M., Alperin, M.J., Albert, D.B., and Martens, C.S. (1994) Field and laboratory studies of methane oxidation in an anoxic marine sediment: Evidence for a methanogen-sulfate reducer consortium. Global Biogeochem Cycles 8: 451–463. Hovanec, T.A., Taylor, L.T., Blakis, A., and Delong, E.F. (1998) Nitrospira-like bacteria associated with nitrite oxidation in freshwater aquaria. Appl Environ Microbiol 64: 258–64. Hu, S., Zeng, R.J., Haroon, M.F., Keller, J., Lant, P.A., Tyson, G.W., and Yuan, Z. (2015) A laboratory investigation of interactions between denitrifying anaerobic methane oxidation (DAMO) and anammox processes in anoxic environments. Sci Rep 5: 8706. Humbert, S., Zopfi, J., and Tarnawski, S.-E. (2012) Abundance of anammox bacteria in different wetland soils. Environ Microbiol Rep 4: 484–490. Hyatt, D., Chen, G.-L., LoCascio, P.F., Land, M.L., Larimer, F.W., and Hauser, L.J. (2010) Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11: 119. Ingram-Smith, C., Martin, S.R., and Smith, K.S. (2006) Acetate kinase: not just a bacterial enzyme. Trends Microbiol 14: 249–53. Ingram-Smith, C. and Smith, K.S. (2007) AMP-forming acetyl-CoA synthetases in Archaea show unexpected diversity in substrate utilization. Archaea 2: 95–107. Ingram-Smith, C., Woods, B.I., and Smith, K.S. (2006) Characterization of the Acyl Substrate Binding Pocket of Acetyl-CoA Synthetase †. Biochemistry 45: 11482–11490. Isobe, K. and Ohte, N. (2014) Ecological perspectives on microbes involved in N-cycling. Microbes Environ 29: 4–16. Iverson, V., Morris, R.M., Frazar, C.D., Berthiaume, C.T., Morales, R.L., and Armbrust, E. V. (2012) Untangling Genomes from Metagenomes: Revealing an Uncultured Class of Marine Euryarchaeota. Science (80- ) 335: 587–590. 172 Bibliography Ivins, E., Argus, D., Cogley, G., Richey, A., Wada, Y., Nerem, R., et al. Re s ear ch | r e p o r t s. Jensen, M.M., Lam, P., Revsbech, N.P., Nagel, B., Gaye, B., Jetten, M.S., and Kuypers, M.M. (2011) Intensive nitrogen loss over the Omani Shelf due to anammox coupled with dissimilatory nitrite reduction to ammonium. ISME J 5: 1660–1670. Jensen, M.M., Lam, P., Revsbech, N.P., Nagel, B., Gaye, B., Jetten, M.S., and Kuypers, M.M. (2011) Intensive nitrogen loss over the Omani Shelf due to anammox coupled with dissimilatory nitrite reduction to ammonium. ISME J 5: 1660–70. Jeon, J.H., Lim, J.K., Kim, M.S., Yang, T.J., Lee, S.H., Bae, S.S., et al. (2015) Characterization of the frhAGB-encoding hydrogenase from a non-methanogenic hyperthermophilic archaeon. Extremophiles 19: 109–118. Jetten, M.S., Fluit, T.J., Stams, A.J., and Zehnder, A.J. (1992) A fluoride-insensitive inorganic pyrophosphatase isolated from Methanothrix soehngenii. Arch Microbiol 157: 284–9. Jetten, M.S., Stams, A.J., and Zehnder, A.J. (1989) Isolation and characterization of acetyl-coenzyme A synthetase from Methanothrix soehngenii. J Bacteriol 171: 5430–5435. Jetten, M.S., Wagner, M., Fuerst, J., van Loosdrecht, M., Kuenen, G., and Strous, M. (2001) Microbiology and application of the anaerobic ammonium oxidation (’anammox’) process. Curr Opin Biotechnol 12: 283–8. Jetten, M.S.M., Stams, A.J.M., and Zehnder, A.J.B. (1990) Acetate threshold values and acetate activating enzymes in methanogenic bacteria. FEMS Microbiol Lett 73: 339–344. Jetten, M.S.M., Stams, A.J.M., and Zehnder, A.J.B. (1992) Methanogenesis from acetate: a comparison of the acetate metabolism in Methanothrix soehngenii and Methanosarcina spp. FEMS Microbiol Lett 88: 181–198. Jones, M.E. and Lipmann, F. (1955) [96] Aceto-CoA-kinase., pp. 585–591. Joye, S.B. and Hollibaugh, J.T. (1995) Influence of Sulfide Inhibition of Nitrification on Nitrogen Regeneration in Sediments. Science (80- ) 270: 623–625. Kallistova, A.Y., Goel, G., and Nozhevnikova, A.N. (2014) Microbial diversity of methanogenic communities in the systems for anaerobic treatment of organic waste. Microbiology 83: 462– 483. Kang, D.D., Froula, J., Egan, R., and Wang, Z. (2015) MetaBAT, an efficient tool for accurately reconstructing single genomes from complex microbial communities. PeerJ 3: e1165. Kartal, B., de Almeida, N.M., Maalcke, W.J., Op den Camp, H.J.M., Jetten, M.S.M., and Keltjens, J.T. (2013) How to make a living from anaerobic ammonium oxidation. FEMS Microbiol Rev 37: 428–461. Kartal, B., Kuypers, M.M.M., Lavik, G., Schalk, J., Op den Camp, H.J.M., Jetten, M.S.M., and Strous, M. (2007) Anammox bacteria disguised as denitrifiers: nitrate reduction to dinitrogen gas via nitrite and ammonium. Environ Microbiol 9: 635–42. Käserer, H. (1905) uber die oxydation des wasserstoffs und des methans durch mikrorganismen. zeitschrift fur das Landwirtsch Versuchs-und Untersuchungswes Osterr 8: 789–792. Kaster, A.K., Goenrich, M., Seedorf, H., Liesegang, H., Wollherr, A., Gottschalk, G., and Thauer, R.K. (2011) More than 200 genes required for methane formation from H(2) and CO(2) and energy conservation are present in Methanothermobacter marburgensis and Methanothermobacter thermautotrophicus. Archaea 2011: 973848. Kaster, A.K., Moll, J., Parey, K., and Thauer, R.K. (2011) Coupling of ferredoxin and heterodisulfide reduction via electron bifurcation in hydrogenotrophic methanogenic archaea. Proc Natl Acad Sci U S A 108: 2981–2986. Kates, M. (1993) Biology of halophilic bacteria, Part II. Membrane lipids of extreme halophiles: biosynthesis, function and evolutionary significance.Experientia 49: 1027–36. Kates, M., Palameta, B., Joo, C.N., Kushner, D.J., and Gibbons, N.E. (1966) Aliphatic Diether Analogs of Glyceride-Derived Lipids. IV. The Occurrence of Di-O-dihydrophytylglycerol Ether Containing Lipids in Extremely Halophilic Bacteria *. Biochemistry 5: 4092–4099. Kates, M., Sastry, P.S., and Yengoyan, L.S. (1963) Isolation and characterization of a diether analog of 173 Bibliography phosphatidyl glycerophosphate from Halobacterium cutirubrum. Biochim Biophys Acta - Spec Sect Lipids Relat Subj 70: 705–707. Katherine, C., Terlesky, And, James, G., and Ferry (1988) Ferredoxin Requirement for Electron Transport from the Carbon Monoxide Dehydrogenase Complex to a Membrane-bound Hydrogenase in Acetate-grown Methanosarcina thermophila. J Biol Chem 263: 4075–4079. Kern, M. and Simon, J. (2008) Characterization of the NapGH quinol dehydrogenase complex involved in Wolinella succinogenes nitrate respiration. Mol Microbiol 69: 1137–1152. van Kessel, M.A.H.J., Speth, D.R., Albertsen, M., Nielsen, P.H., Op den Camp, H.J.M., Kartal, B., et al. (2015) Complete nitrification by a single microorganism.Nature 528: 555–9. King, D. and Nedwell, D.B. (1985) The influence of nitrate concentration upon the end-products of nitrate dissimilation by bacteria in anaerobic salt marsh sediment. FEMS Microbiol Lett 31: 23–28. Kletzin, A., Heimerl, T., Flechsler, J., van Niftrik, L., Rachel, R., and Klingl, A. (2015) Cytochromes c in Archaea: distribution, maturation, cell architecture, and the special case of Ignicoccus hospitalis. Front Microbiol 6: 439. Knittel, K. and Boetius, A. (2009) Anaerobic oxidation of methane: progress with an unknown process. Annu Rev Microbiol 63: 311–34. Knittel, K., Lösekann, T., Boetius, A., Kort, R., and Amann, R. (2005) Diversity and distribution of methanotrophic archaea at cold seeps. Appl Environ Microbiol 71: 467–79. Koga, Y., Nishihara, M., Morii, H., and Akagawa-Matsushita, M. (1993) Ether polar lipids of methanogenic bacteria: structures, comparative aspects, and biosyntheses. Microbiol Rev 57: 164–82. Komatsu, H. and Chong, P.L. (1998) Low permeability of liposomal membranes composed of bipolar tetraether lipids from thermoacidophilic archaebacterium Sulfolobus acidocaldarius. Biochemistry 37: 107–15. Könneke, M., Bernhard, A.E., de la Torre, J.R., Walker, C.B., Waterbury, J.B., and Stahl, D.A. (2005) Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 437: 543–546. Konno, U., Kouduka, M., Komatsu, D.D., Ishii, K., Fukuda, A., Tsunogai, U., et al. (2013) Novel microbial populations in deep granitic groundwater from grimsel test site, Switzerland. Microb Ecol 65: 626–637. Kox, M.A.R. and Jetten, M.S.M. (2015) The Nitrogen Cycle. In, Principles of Plant-Microbe Interactions. Springer International Publishing, Cham, pp. 205–214. Kraft, B., Strous, M., and Tegetmeyer, H.E. (2011) Microbial nitrate respiration – genes, enzymes and environmental distribution. J Biotechnol 155: 104–117. Kraft, B., Tegetmeyer, H.E., Sharma, R., Klotz, M.G., Ferdelman, T.G., Hettich, R.L., et al. (2014) Nitrogen cycling. The environmental controls that govern the end product of bacterial nitrate respiration. Science 345: 676–9. Krätzer, C., Carini, P., Hovey, R., and Deppenmeier, U. (2009) Transcriptional profiling of methyltransferase genes during growth of Methanosarcina mazei on trimethylamine. J Bacteriol 191: 5108–5115. Krüger, M., Meyerdierks, A., Glöckner, F.O., Amann, R., Widdel, F., Kube, M., et al. (2003) A conspicuous nickel protein in microbial mats that oxidize methane anaerobically. Nature 426: 878–881. Krzycki, J.A. (2004) Function of genetically encoded pyrrolysine in corrinoid-dependent methylamine methyltransferases. Curr Opin Chem Biol 8: 484–491. Krzycki, J.A. (2004) Function of genetically encoded pyrrolysine in corrinoid-dependent methylamine methyltransferases. Curr Opin Chem Biol 8: 484–91. Kuenen, J.G. (2008) Anammox bacteria: from discovery to application. Nat Rev Microbiol 6: 320–326. Kulkarni, G., Kridelbaugh, D.M., Guss, A.M., and Metcalf, W.W. (2009) Hydrogen is a preferred intermediate in the energy-conserving electron transport chain of Methanosarcina barkeri. Proc Natl Acad Sci U S A 106: 15915–15920. 174 Bibliography Kunow, J., Linder, D., Stetter, K.O., and Thauer, R.K. (1994) F420H2:quinone oxidoreductase from Archaeoglobus fulgidus - characterization of a membrane-bound multisubunit complex containing FAD and iron-sulfur clusters. Eur J Biochem 223: 503–511. Kuypers, M.M.M., Lavik, G., Woebken, D., Schmid, M., Fuchs, B.M., Amann, R., et al. (2005) From The Cover: Massive nitrogen loss from the Benguela upwelling system through anaerobic ammonium oxidation. Proc Natl Acad Sci 102: 6478–6483. Kuypers, M.M.M., Sliekers, A.O., Lavik, G., Schmid, M., Jørgensen, B.B., Kuenen, J.G., et al. (2003) Anaerobic ammonium oxidation by anammox bacteria in the Black Sea. Nature 422: 608–11. Labrenz, M., Jost, G., Pohl, C., Beckmann, S., Martens-Habbena, W., and Jürgens, K. (2005) Impact of different in vitro electron donor/acceptor conditions on potential chemolithoautotrophic communities from marine pelagic redoxclines. Appl Environ Microbiol 71: 6664–72. de Lacerda, L., Kowarski, A., and Migeon, C.J. (1973) Integrated concentration of plasma cortisol in normal subjects. J Clin Endocrinol Metab 36: 227–38. Lackner, S., Gilbert, E.M., Vlaeminck, S.E., Joss, A., Horn, H., and van Loosdrecht, M.C.M. (2014) Full-scale partial nitritation/anammox experiences – An application survey. Water Res 55: 292–303. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–5. Lam, P., Lavik, G., Jensen, M.M., van de Vossenberg, J., Schmid, M., Woebken, D., et al. (2009) Revising the nitrogen cycle in the Peruvian oxygen minimum zone. Proc Natl Acad Sci 106: 4752–4757. Lane, N. (2006) Microbiology: batteries not included. What can’t bacteria do? Nature 441: 274–7. Larowe, D.E., Dale, A.W., and Regnier, P. (2008) A thermodynamic analysis of the anaerobic oxidation of methane in marine sediments. Geobiology 6: 436–49. Lau, M.C.Y., Cameron, C., Magnabosco, C., Brown, C.T., Schilkey, F., Grim, S., et al. (2014) Phylogeny and phylogeography of functional genes shared among seven terrestrial subsurface metagenomes reveal N-cycling and microbial evolutionary relationships. Front Microbiol 5: 531. Lenk, S., Arnds, J., Zerjatke, K., Musat, N., Amann, R., and Mussmann, M. (2011) Novel groups of Gammaproteobacteria catalyse sulfur oxidation and carbon fixation in a coastal, intertidal sediment. Environ Microbiol 13: 758–74. Leslie T. Webster, J. and Arsena, J.D. (1963) Studies of the Acetyl Coenzyme A synthetase reaction. I. isolation and characterization of enzyme-bound acetyl adenylate . J Biol Chem 238: 4010–4015. Letunic, I. and Bork, P. (2016) Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res 44: W242–W245. Li, H. and Durbin, R. (2010) Fast and accurate long-read alignment with Burrows–Wheeler transform. Bioinformatics 26: 589–595. Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., et al. (2009) The Sequence Alignment/Map format and SAMtools. Bioinformatics 25: 2078–2079. Li, R., Gu, J., Chen, P., Zhang, Z., Deng, J., and Zhang, X. (2011) Purification and characterization of the acetyl-CoA synthetase from Mycobacterium tuberculosis. Acta Biochim Biophys Sin (Shanghai) 43: 891–9. Liang, M.-H., Qv, X.-Y., Jin, H.-H., and Jiang, J.-G. (2016) Characterization and expression of AMP- forming Acetyl-CoA Synthetase from Dunaliella tertiolecta and its response to nitrogen starvation stress. Sci Rep 6: 23445. Liebner, S., Rublack, K., Stuehrmann, T., and Wagner, D. (2009) Diversity of aerobic methanotrophic bacteria in a permafrost active layer soil of the Lena Delta, Siberia. Microb Ecol 57: 25–35. Lin, J.T. and Stewart, V. (1998) Nitrate assimilation by bacteria. Adv Microb Physiol 39: 1–30, 379. Lindmark, D.G. (1980) Energy metabolism of the anaerobic protozoon Giardia lamblia. Mol Biochem Parasitol 1: 1–12. Lisa, J.A., Song, B., Tobias, C.R., and Hines, D.E. (2015) Genetic and biogeochemical investigation of 175 Bibliography sedimentary nitrogen cycling communities responding to tidal and seasonal dynamics in Cape Fear River Estuary. Estuar Coast Shelf Sci 167: A313–A323. Liu, X., Tremblay, P.-L., Malvankar, N.S., Nevin, K.P., Lovley, D.R., and Vargas, M. (2014) A Geobacter sulfurreducens strain expressing pseudomonas aeruginosa type IV pili localizes OmcS on pili but is deficient in Fe(III) oxide reduction and current production. Appl Environ Microbiol 80: 1219–24. Liu, Y. and Whitman, W.B. (2008) Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Ann N Y Acad Sci 1125: 171–89. Lloyd, K.G., Alperin, M.J., and Teske, A. (2011) Environmental evidence for net methane production and oxidation in putative Anaerobic Methanotrophic (ANME) archaea. Environ Microbiol 13: 2548–2564. Louca, S., Hawley, A.K., Katsev, S., Torres-Beltran, M., Bhatia, M.P., Kheirandish, S., et al. (2016) Integrating biogeochemistry with multiomic sequence information in a model oxygen minimum zone. Proc Natl Acad Sci 201602897. Louie, T.S., Giovannelli, D., Yee, N., Narasingarao, P., Starovoytov, V., Göker, M., et al. (2016) High-quality draft genome sequence of Sedimenticola selenatireducens strain AK4OH1T, a gammaproteobacterium isolated from estuarine sediment. Stand Genomic Sci 11: 66. Lower, B.H., Lins, R.D., Oestreicher, Z., Straatsma, T.P., Hochella Jr., M.F., Shi, L., and Lower, S.K. (2008) In vitro evolution of a peptide with a hematite binding motif that may constitute a natural metal-oxide binding archetype. Env Sci Technol 42: 3821–3827. Lu, Y.Y., Chen, T., Fuhrman, J.A., and Sun, F. (2016) COCACOLA: binning metagenomic contigs using sequence COmposition, read CoverAge, CO-alignment and paired-end read LinkAge. Bioinformatics btw290. Luesken, F.A., Sánchez, J., van Alen, T.A., Sanabria, J., Op den Camp, H.J.M., Jetten, M.S.M., and Kartal, B. (2011) Simultaneous Nitrite-Dependent Anaerobic Methane and Ammonium Oxidation Processes. Appl Environ Microbiol 77: 6802–6807. Luo, C., Rodriguez-R, L.M., Johnston, E.R., Wu, L., Cheng, L., Xue, K., et al. (2014) Soil microbial community Responses to a decade of warming as revealed by comparative metagenomics. Appl Environ Microbiol 80: 1777–1786. Lycus, P., Lovise Bøthun, K., Bergaust, L., Peele Shapleigh, J., Reier Bakken, L., and Frostegård, Å. (2017) Phenotypic and genotypic richness of denitrifiers revealed by a novel isolation strategy. ISME J 11: 2219–2232. Manz, W., Amann, R., Ludwig, W., Wagner, M., and Schleifer, K.-H. (1992) Phylogenetic oligodeoxynucleotide probes for the major subclasses of proteobacteria:problems and solutions. Syst Appl Microbiol 15: 593–600. Mardanov, A. V., Beletsky, A. V., Kadnikov, V. V., Slobodkin, A.I., and Ravin, N. V. (2016) Genome analysis of Thermosulfurimonas dismutans, the first thermophilic sulfur-disproportionating bacterium of the phylum Thermodesulfobacteria. Front Microbiol 7: 950. Mardanov, A. V, Slododkina, G.B., Slobodkin, A.I., Beletsky, A. V, Gavrilov, S.N., Kublanov, I. V, et al. (2015) The Geoglobus acetivorans genome: Fe(III) reduction, acetate utilization, autotrophic growth, and degradation of aromatic compounds in a hyperthermophilic archaeon. Appl Env Microbiol 81: 1003–1012. Martinez-Espinosa, R.M., Dridge, E.J., Bonete, M.J., Butt, J.N., Butler, C.S., Sargent, F., and Richardson, D.J. (2007) Look on the positive side! The orientation, identification and bioenergetics of “Archaeal” membrane-bound nitrate reductases. FEMS Microbiol Lett 276: 129–139. Matsumi, R., Atomi, H., Driessen, A.J.M., and van der Oost, J. (2011) Isoprenoid biosynthesis in Archaea – Biochemical and evolutionary implications. Res Microbiol 162: 39–52. McAnulty, M.J., G. Poosarla, V., Kim, K.-Y., Jasso-Chávez, R., Logan, B.E., and Wood, T.K. (2017) Electricity from methane by reversing methanogenesis. Nat Commun 8: 15419. McGlynn, S.E. (2017) Energy Metabolism during Anaerobic Methane Oxidation in ANME Archaea. 176 Bibliography Microbes Environ 32: 5–13. McGlynn, S.E., Chadwick, G.L., Kempes, C.P., and Orphan, V.J. (2015a) Single cell activity reveals direct electron transfer in methanotrophic consortia. Nature 526: 531–535. Metcalf, W.W., Griffin, B.M., Cicchillo, R.M., Gao, J., Janga, S.C., Cooke, H.A., et al. (2012) Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean. Science (80- ) 337: 1104–1107. Meuer, J., Bartoschek, S., Koch, J., Künkel, A., and Hedderich, R. (1999) Purification and catalytic properties of Ech hydrogenase from Methanosarcina barkeri. Eur J Biochem 265: 325–335. Meyer, R.L., Risgaard-Petersen, N., and Allen, D.E. (2005) Correlation between anammox activity and microscale distribution of nitrite in a subtropical mangrove sediment. Appl Environ Microbiol 71: 6142–9. Meyerdierks, A., Kube, M., Kostadinov, I., Teeling, H., Glöckner, F.O., Reinhardt, R., and Amann, R. (2010) Metagenome and mRNA expression analyses of anaerobic methanotrophic archaea of the ANME-1 group. Environ Microbiol 12: 422–39. Milucka, J., Ferdelman, T.G., Polerecky, L., Franzke, D., Wegener, G., Schmid, M., et al. (2012) Zero- valent sulphur is a key intermediate in marine methane oxidation. Nature 491: 541–546. Morono, Y., Terada, T., Masui, N., and Inagaki, F. (2009) Discriminative detection and enumeration of microbial life in marine subsurface sediments. ISME J 3: 503–511. Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. (2008) Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5: 621–8. Mulder, A., Graaf, A.A., Robertson, L.A., and Kuenen, J.G. (1995) Anaerobic ammonium oxidation discovered in a denitrifying fluidized bed reactor.FEMS Microbiol Ecol 16: 177–184. Murrell, J.C. and Jetten, M.S.M. (2009) The microbial methane cycle. Environ Microbiol Rep 1: 279– 84. Nauhaus, K., Treude, T., Boetius, A., and Krüger, M. (2005) Environmental regulation of the anaerobic oxidation of methane: a comparison of ANME-I and ANME-II communities. Environ Microbiol 7: 98–106. Nawrocki, E.P. (2009) Structural RNA homology search and alignment using covariance models. Ph.D. thesis. Nedwell, D.B., Jickells, T.D., Trimmer, M., and Sanders, R. (1999) Nutrients in Estuaries., pp. 43–92. van Niftrik, L. and Jetten, M.S.M. (2012) Anaerobic ammonium-oxidizing bacteria: unique microorganisms with exceptional properties. Microbiol Mol Biol Rev 76: 585–96. Noriega, C.E., Lin, H.Y., Chen, L.L., Williams, S.B., and Stewart, V. (2010) Asymmetric cross-regulation between the nitrate-responsive NarX-NarL and NarQ-NarP two-component regulatory systems from Escherichia coli K-12. Mol Microbiol 75: 394–412. Nowicka, B. and Kruk, J. (2010) Occurrence, biosynthesis and function of isoprenoid quinones. Biochim Biophys Acta 1797: 1587–1605. Nurk, S., Meleshko, D., Korobeynikov, A., and Pevzner, P.A. (2017) metaSPAdes: a new versatile metagenomic assembler. Genome Res 27: 824–834. Nyren, P. and Strid, Ã. ke (1991) Hypothesis: the physiological role of the membrane-bound proton- translocating pyrophosphatase in some phototrophic bacteria. FEMS Microbiol Lett 77: 265– 270. Oberlies, G., Fuchs, G., and Thauer, R.K. (1980) Acetate thiokinase and the assimilation of acetate in methanobacterium thermoautotrophicum. Arch Microbiol 128: 248–52. Ogilvie, B. (1997) Selection by temperature of nitrate-reducing bacteria from estuarine sediments: species composition and competition for nitrate. FEMS Microbiol Ecol 23: 11–22. Oni, O.E. and Friedrich, M.W. (2016) Metal Oxide Reduction Linked to Anaerobic Methane Oxidation. Trends Microbiol xx: 1–2. Op den Camp, H.J.M., Islam, T., Stott, M.B., Harhangi, H.R., Hynes, A., Schouten, S., et al. (2009) Environmental, genomic and taxonomic perspectives on methanotrophic Verrucomicrobia. Environ Microbiol Rep 1: 293–306. 177 Bibliography Orcutt, B., Samarkin, V., Boetius, A., and Joye, S. (2008) On the relationship between methane production and oxidation by anaerobic methanotrophic communities from cold seeps of the Gulf of Mexico. Environ Microbiol 10: 1108–1117. Padilla, C.C., Bertagnolli, A.D., Bristow, L.A., Sarode, N., Glass, J.B., Thamdrup, B., and Stewart, F.J. (2017) Metagenomic Binning Recovers a Transcriptionally Active Gammaproteobacterium Linking Methanotrophy to Partial Denitrification in an Anoxic Oxygen Minimum Zone. Front Mar Sci 4:. Padilla, C.C., Bristow, L.A., Sarode, N., Garcia-Robledo, E., Gómez Ramírez, E., Benson, C.R., et al. (2016) NC10 bacteria in marine oxygen minimum zones. ISME J 10: 2067–2071. Pandey, A., Suter, H., He, J., and Chen, D. (2016) Dissimilatory nitrate reduction to ammonium , denitrification and anaerobic ammonium oxidation in paddy soil. 2–5. Papaspyrou, S., Smith, C.J., Dong, L.F., Whitby, C., Dumbrell, A.J., and Nedwell, D.B. (2014) Nitrate Reduction Functional Genes and Nitrate Reduction Potentials Persist in Deeper Estuarine Sediments. Why? PLoS One 9: e94111. Parks, D.H., Imelfort, M., Skennerton, C.T., Hugenholtz, P., and Tyson, G.W. (2015) CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res 25: 1043–1055. Penton, C.R., Devol, A.H., and Tiedje, J.M. (2006) Molecular Evidence for the Broad Distribution of Anaerobic Ammonium-Oxidizing Bacteria in Freshwater and Marine Sediments. Appl Environ Microbiol 72: 6829–6832. Pereira, A.D., Cabezas, A., Etchebehere, C., Chernicharo, C.A. de L., and de Araújo, J.C. (2017) Microbial communities in anammox reactors: a review. Environ Technol Rev 6: 74–93. Pereira, M.M., Santana, M., and Teixeira, M. (2001) A novel scenario for the evolution of haem-copper oxygen reductases. Biochim Biophys Acta 1505: 185–208. Pernthaler, A., Dekas, A.E., Brown, C.T., Goffredi, S.K., Embaye, T., and Orphan, V.J. (2008) Diverse syntrophic partnerships from deep-sea methane vents revealed by direct cell capture and metagenomics. Proc Natl Acad Sci U S A 105: 7052–7. Philippot, L. and Hallin, S. (2005) Finding the missing link between diversity and activity using denitrifying bacteria as a model functional community. Curr Opin Microbiol 8: 234–239. Pol, A., Heijmans, K., Harhangi, H.R., Tedesco, D., Jetten, M.S.M., and Op den Camp, H.J.M. (2007) Methanotrophy below pH 1 by a new Verrucomicrobia species. Nature 450: 874–8. Poulter, B., Bousquet, P., Canadell, J.G., Ciais, P., Peregon, A., Saunois, M., et al. (2017) Global wetland contribution to 2000–2012 atmospheric methane growth rate dynamics. Environ Res Lett 12: 94013. Prather, M.J. and Holmes, C.D. (2017) Overexplaining or underexplaining methane’s role in climate change. Proc Natl Acad Sci 114: 5324–5326. Price, M.N., Dehal, P.S., and Arkin, A.P. (2010) FastTree 2 – approximately maximum-likelihood trees for large alignments. PLoS One 5: e9490. Rabin, R.S. and Stewart, V. (1993) Dual response regulators (NarL and NarP) interact with dual sensors (NarX and NarQ) to control nitrate- and nitrite-regulated gene expression in Escherichia coli K-12. J Bacteriol 175: 3259–3268. Raghoebarsing, A.A., Pol, A., van de Pas-Schoonen, K.T., Smolders, A.J.P., Ettwig, K.F., Rijpstra, W.I.C., et al. (2006) A microbial consortium couples anaerobic methane oxidation to denitrification.Nature 440: 918–921. Reeburgh, W.S. (1976) Methane consumption in Cariaco Trench waters and sediments. Earth Planet Sci Lett 28: 337–344. Reeburgh, W.S. (2007) Oceanic Methane Biogeochemistry. Chem Rev 107: 486–513. Reeves, R.E., Warren, L.G., Susskind, B., and Lo, H.S. (1977) An energy-conserving pyruvate-to- acetate pathway in Entamoeba histolytica. Pyruvate synthase and a new acetate thiokinase. J Biol Chem 252: 726–31. Reger, A.S., Carney, J.M., and Gulick, A.M. (2007) Biochemical and Crystallographic Analysis of 178 Bibliography Substrate Binding and Conformational Changes in Acetyl-CoA Synthetase † , ‡. Biochemistry 46: 6536–6546. Rehr, B. and Klemme, J.-H. (1989) Competition for nitrate between denitrifying Pseudomonas stutzeri and nitrate ammonifying enterobacteria. FEMS Microbiol Lett 62: 51–57. Reimann, J., Flock, U., Lepp, H., Honigmann, A., and Ädelroth, P. (2007) A pathway for protons in nitric oxide reductase from Paracoccus denitrificans. Biochim Biophys Acta - Bioenerg 1767: 362–373. Ren, Z.J. (2017) Microbial fuel cells: Running on gas. Nat Energy 2: 17093. Rigby, M., Montzka, S.A., Prinn, R.G., White, J.W.C., Young, D., O’Doherty, S., et al. (2017) Role of atmospheric oxidation in recent methane growth. Proc Natl Acad Sci 114: 5373–5377. Rios-Del Toro, E.E. and Cervantes, F.J. (2016b) Coupling between anammox and autotrophic denitrification for simultaneous removal of ammonium and sulfide by enriched marine sediments. Biodegradation 27: 107–118. Robertson, E.K., Roberts, K.L., Burdorf, L.D.W., Cook, P., and Thamdrup, B. (2016) Dissimilatory nitrate reduction to ammonium coupled to Fe(II) oxidation in sediments of a periodically hypoxic estuary. Limnol Oceanogr 61: 365–381. Rockman, M. V (2008) Reverse engineering the genotype-phenotype map with natural genetic variation. Nature 456: 738–44. Rodrigo Gómez, J.M., Aparisi Quereda, L., Palao Esteve, J., Guix García, J., Serra Desfilis, M.A., Benages Martínez, A., and García-Conde Gómezx (1973) [Parotid hypertrophy in liver cirrhosis. I. Clinico-functional study]. Rev Esp Enferm Apar Dig 41: 527–38. Rodrigues, M.L., Scott, K.A., Sansom, M.S., Pereira, I.A., and Archer, M. (2008) Quinol oxidation by c-type cytochromes: structural characterization of the menaquinol binding site of NrfHA. J Mol Biol 381: 341–350. De Rosa, M., Gambacorta, A., Nicolaus, B., Ross, H.N.M., Grant, W.D., and Bu’Lock, J.D. (1982) An Asymmetric Archaebacterial Diether Lipid from Alkaliphilic Halophiles. Microbiology 128: 343–348. Rotaru, B.A. and Thamdrup, B. (2016) B I O G E O C H E M I ST RY. 351:. Ruff, S.E., Biddle, J.F., Teske, A.P., Knittel, K., Boetius, A., and Ramette, A. (2015) Global dispersion and local diversification of the methane seep microbiome. Proc Natl Acad Sci U S A 112: 4015–4020. Russ, L., Harhangi, H.R., Schellekens, J., Verdellen, B., Kartal, B., Op den Camp, H.J.M., and Jetten, M.S.M. (2012) Genome analysis and heterologous expression of acetate-activating enzymes in the anammox bacterium Kuenenia stuttgartiensis. Arch Microbiol 194: 943–948. Russ, L., Speth, D.R., Jetten, M.S.M., Op den Camp, H.J.M., and Kartal, B. (2014) Interactions between anaerobic ammonium and sulfur-oxidizing bacteria in a laboratory scale model system. Environ Microbiol 16: 3487–3498. Rutherford, K., Parkhill, J., Crook, J., Horsnell, T., Rice, P., Rajandream, M.A., and Barrell, B. (2000) Artemis: sequence visualization and annotation. Bioinformatics 16: 944–945. Rütting, T., Boeckx, P., Müller, C., and Klemedtsson, L. (2011) Assessment of the importance of dissimilatory nitrate reduction to ammonium for the terrestrial nitrogen cycle. Biogeosciences 8: 1779–1791. Sánchez, L.B., Galperin, M.Y., and Müller, M. (2000) Acetyl-CoA synthetase from the amitochondriate eukaryote Giardia lamblia belongs to the newly recognized superfamily of acyl-CoA synthetases (Nucleoside diphosphate-forming). J Biol Chem 275: 5794–803. Schafer, T., Selig, M., and Schonheit, P. (1993) Acetyl-CoA synthetase (ADP forming) in archaea, a novel enzyme involved in acetate formation and ATP synthesis. Arch Microbiol 159: 72–83. Scheller, S., Goenrich, M., Boecher, R., Thauer, R.K., and Jaun, B. (2010) The key nickel enzyme of methanogenesis catalyses the anaerobic oxidation of methane. Nature 465: 606–608. Scheller, S., Yu, H., Chadwick, G.L., McGlynn, S.E., and Orphan, V.J. (2016) Artificial electron acceptors decouple archaeal methane oxidation from sulfate reduction. Science (80- ) 351: 179 Bibliography 703–707. Schink, B. (1997) Energetics of syntrophic cooperation in methanogenic degradation. Microbiol Mol Biol Rev 61: 262–80. Schink, B. and Thauer, R.K. (1987) Energetics of syntrophicmethane formationand the influence of aggregation. Schlegel, K., Leone, V., Faraldo-Gómez, J.D., and Müller, V. (2012) Promiscuous archaeal ATP synthase concurrently coupled to Na+ and H+ translocation. Proc Natl Acad Sci U S A 109: 947–952. Schmid, M., Schmitz-Esser, S., Jetten, M., and Wagner, M. (2001) 16S-23S rDNA intergenic spacer and 23S rDNA of anaerobic ammonium-oxidizing bacteria: implications for phylogeny and in situ detection. Environ Microbiol 3: 450–459. Schmid, M., Twachtmann, U., Klein, M., Strous, M., Juretschko, S., Jetten, M., et al. (2000) Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst Appl Microbiol 23: 93–106. Schmid, M.C., Maas, B., Dapena, A., van de Pas-Schoonen, K., van de Vossenberg, J., Kartal, B., et al. (2005) Biomarkers for In Situ Detection of Anaerobic Ammonium-Oxidizing (Anammox) Bacteria. Appl Environ Microbiol 71: 1677–1684. Schmidt, C.S., Richardson, D.J., and Baggs, E.M. (2011) Constraining the conditions conducive to dissimilatory nitrate reduction to ammonium in temperate arable soils. Soil Biol Biochem 43: 1607–1611. Schubert, C.J., Vazquez, F., Lösekann-Behrens, T., Knittel, K., Tonolla, M., and Boetius, A. (2011) Evidence for anaerobic oxidation of methane in sediments of a freshwater system (Lago di Cadagno). FEMS Microbiol Ecol 76: 26–38. Seemann, T. (2014) Prokka: rapid prokaryotic genome annotation. Bioinformatics 30: 2068–2069. Segarra, K.E.A., Comerford, C., Slaughter, J., and Joye, S.B. (2013) Impact of electron acceptor availability on the anaerobic oxidation of methane in coastal freshwater and brackish wetland sediments. Geochim Cosmochim Acta 115: 15–30. Segarra, K.E. a., Schubotz, F., Samarkin, V., Yoshinaga, M.Y., Hinrichs, K.-U., and Joye, S.B. (2015) High rates of anaerobic methane oxidation in freshwater wetlands reduce potential atmospheric methane emissions. Nat Commun 6: 7477. Sehgal, S.N., Kates, M., and Gibbons, N.E. (1962) Lipids of Halobacterium cutirubrum. Can J Biochem Physiol 40: 69–81. Seifert, R., Nauhaus, K., Blumenberg, M., Krüger, M., and Michaelis, W. (2006) Methane dynamics in a microbial community of the Black Sea traced by stable carbon isotopes in vitro. Org Geochem 37: 1411–1419. Sekiguchi, Y., Muramatsu, M., Imachi, H., Narihiro, T., Ohashi, A., Harada, H., et al. (2008) Thermodesulfovibrio aggregans sp. nov. and Thermodesulfovibrio thiophilus sp. nov., anaerobic, thermophilic, sulfate-reducing bacteria isolated from thermophilic methanogenic sludge, and emended description of the genus Thermodesulfovibrio. Int J Syst Evol Microbiol 58: 2541–2548. Semrau, J.D., DiSpirito, A.A., and Yoon, S. (2010) Methanotrophs and copper. FEMS Microbiol Rev 34: 496–531. Shao, M.-F., Zhang, T., and Fang, H.H.-P. (2010) Sulfur-driven autotrophic denitrification: diversity, biochemistry, and engineering applications. Appl Microbiol Biotechnol 88: 1027–42. Shen, L.-D., He, Z.-F., Zhu, Q., Chen, D.-Q., Lou, L.-P., Xu, X.-Y., et al. (2012) Microbiology, ecology, and application of the nitrite-dependent anaerobic methane oxidation process. Front Microbiol 3:. Shen, L., Liu, S., He, Z., Lian, X., Huang, Q., He, Y., et al. (2015) Depth-specific distribution and importance of nitrite-dependent anaerobic ammonium and methane-oxidising bacteria in an urban wetland. Soil Biol Biochem 83: 43–51. Shen, L., Liu, S., Huang, Q., Lian, X., He, Z., Geng, S., et al. (2014) Evidence for the Cooccurrence of Nitrite-Dependent Anaerobic Ammonium and Methane Oxidation Processes in a Flooded 180 Bibliography Paddy Field. Appl Environ Microbiol 80: 7611–7619. Shi, Y., Hu, S., Lou, J., Lu, P., Keller, J., and Yuan, Z. (2013) Nitrogen removal from wastewater by coupling anammox and methane-dependent denitrification in a membrane biofilm reactor. Environ Sci Technol 47: 11577–11583. Shima, S. and Thauer, R.K. (2005) Methyl-coenzyme M reductase and the anaerobic oxidation of methane in methanotrophic Archaea. Curr Opin Microbiol 8: 643–8. Shrestha, P.M. and Rotaru, A.-E. (2014) Plugging in or going wireless: strategies for interspecies electron transfer. Front Microbiol 5: 237. Sieber, C.M.K. et al. (2017) Recovery of genomes from metagenomes via a dereplication, aggregation, and scoring strategy. bioRxiv (unpublished). Simon, J. (2002) Enzymology and bioenergetics of respiratory nitrite ammonification.FEMS Microbiol Rev 26: 285–309. Simon, J., Gross, R., Einsle, O., Kroneck, P.M., Kroger, A., and Klimmek, O. (2000) A NapC/NirT-type cytochrome c (NrfH) is the mediator between the quinone pool and the cytochrome c nitrite reductase of Wolinella succinogenes. Mol Microbiol 35: 686–696. Simon, J. and Klotz, M.G. (2013) Diversity and evolution of bioenergetic systems involved in microbial nitrogen compound transformations. Biochim Biophys Acta 1827: 114–35. Simon, J., Sänger, M., Schuster, S.C., and Gross, R. (2003) Electron transport to periplasmic nitrate reductase (NapA) of Wolinella succinogenes is independent of a NapC protein. Mol Microbiol 49: 69–79. Sirajuddin, S. and Rosenzweig, A.C. (2015) Enzymatic oxidation of methane. Biochemistry 54: 2283– 2294. Sivan, O., Antler, G., Turchyn, A. V, Marlow, J.J., and Orphan, V.J. (2014) Iron oxides stimulate sulfate- driven anaerobic methane oxidation in seeps. Proc Natl Acad Sci 111: E4139–E4147. Slobodkina, G.B., Mardanov, A. V., Ravin, N. V., Frolova, A.A., Chernyh, N.A., Bonch-Osmolovskaya, E.A., and Slobodkin, A.I. (2017) Respiratory ammonification of nitrate coupled to anaerobic oxidation of elemental sulfur in deep-sea autotrophic thermophilic bacteria. Front Microbiol 8: 87. Smith, J.A., Aklujkar, M., Risso, C., Leang, C., Giloteaux, L., and Holmes, D.E. (2015) Mechanisms involved in Fe(III) respiration by the hyperthermophilic archaeon Ferroglobus placidus. Appl Env Microbiol 81: 2735–2744. Smith, J.M. (1970) © 1970 Nature Publishing Group. Nature 225: 563–564. Smith, R.L., Böhlke, J.K., Song, B., and Tobias, C.R. (2015) Role of Anaerobic Ammonium Oxidation (Anammox) in Nitrogen Removal from a Freshwater Aquifer. Environ Sci Technol 49: 12169– 12177. Söhngen (1906) über Bakterien, welche Methan als Kohlenstoffnahrung und Energiequelle gebrauchen. Zentrabl Bakteriol Parasitenk Infekt 15: 513–517. Sorokin, D.Y., Abbas, B., Geleijnse, M., Pimenov, N. V, Sukhacheva, M. V, and van Loosdrecht, M.C.M. (2015) Methanogenesis at extremely haloalkaline conditions in the soda lakes of Kulunda Steppe (Altai, Russia). FEMS Microbiol Ecol 91:. Sorokin, D.Y., Tourova, T.P., Galinski, E.A., Muyzer, G., and Kuenen, J.G. (2008) Thiohalorhabdus denitrificans gen. nov., sp. nov., an extremely halophilic, sulfur-oxidizing, deep-lineage gammaproteobacterium from hypersaline habitats. Int J Syst Evol Microbiol 58: 2890–2897. Speth, D.R., in ’t Zandt, M.H., Guerrero-Cruz, S., Dutilh, B.E., and Jetten, M.S.M. (2016) Genome- based microbial ecology of anammox granules in a full-scale wastewater treatment system. Nat Commun 7: 11172. Stadnitskaia, A., Muyzer, G., Abbas, B., Coolen, M.J.L., Hopmans, E.C., Baas, M., et al. (2005) Biomarker and 16S rDNA evidence for anaerobic oxidation of methane and related carbonate precipitation in deep-sea mud volcanoes of the Sorokin Trough, Black Sea. Mar Geol 217: 67–96. Stahl, D.A. and Amann, R. (1991) Development and application of nucleic acid probes in bacterial 181 Bibliography systematics. In, Stackebrandt,E. and Goodfellow,M. (eds), Sequencing and hybridization techniques in bacterial systematics. John Wiley & Sons, Chichester, England. Starai, V.J. and Escalante-Semerena, J.C. (2004) Acetyl-coenzyme A synthetase (AMP forming). Cell Mol Life Sci 61: 2020–2030. Strohm, T.O., Griffin, B., Zumft, W.G., and Schink, B. (2007) Growth Yields in Bacterial Denitrification and Nitrate Ammonification.Appl Environ Microbiol 73: 1420–1424. Strous, M., Fuerst, J.A., Kramer, E.H., Logemann, S., Muyzer, G., van de Pas-Schoonen, K.T., et al. (1999) Missing lithotroph identified as new planctomycete.Nature 400: 446–9. Strous, M., Heijnen, J.J., Kuenen, J.G., and Jetten, M.S.M. (1998) The sequencing batch reactor as a powerful tool for the study of slowly growing anaerobic ammonium-oxidizing microorganisms. Appl Microbiol Biotechnol 50: 589–596. Strous, M. and Jetten, M.S.M. (2004) Anaerobic Oxidation of Methane and Ammonium. Annu Rev Microbiol 58: 99–117. Takeuchi, M., Yoshioka, H., Seo, Y., Tanabe, S., Tamaki, H., Kamagata, Y., et al. (2011) A distinct freshwater-adapted subgroup of ANME-1 dominates active archaeal communities in terrestrial subsurfaces in Japan. Environ Microbiol 13: 3206–18. Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol 30: 2725–2729. Taylor, S., Ninjoor, V., Dowd, D.M., and Tappel, A.L. (1974) Cathepsin B2 measurement by sensitive fluorometric ammonia analysis.Anal Biochem 60: 153–162. Team, R.C. (2017) R: A language and environment for statistical computing. R foundation for statistical computing, Vienna, Austria. Teh, Y.L. and Zinder, S. (1992) Acetyl-coenzyme A synthetase in the thermophilic, acetate-utilizing methanogen Methanothrix sp. strain CALS-1. FEMS Microbiol Lett 98: 1–7. Teske, A., Alm, E., Regan, J.M., Toze, S., Rittmann, B.E., and Stahl, D.A. (1994) Evolutionary relationships among ammonia- and nitrite-oxidizing bacteria. J Bacteriol 176: 6623–30. Thamdrup, B. and Dalsgaard, T. (2002) Production of N2 through Anaerobic Ammonium Oxidation Coupled to Nitrate Reduction in Marine Sediments. Appl Environ Microbiol 68: 1312–1318. Thamdrup, B. and Dalsgaard, T. Production of N2 through Anaerobic Ammonium Oxidation Coupled to Nitrate Reduction in Marine Sediments. Appl Environ Microbiol 68: 1312–1318. Thauer, R.K. (2011) Anaerobic oxidation of methane with sulfate: on the reversibility of the reactions that are catalyzed by enzymes also involved in methanogenesis from CO2. Curr Opin Microbiol 14: 292–299. Thauer, R.K. (1998) Biochemistry of methanogenesis: a tribute to Marjory Stephenson:1998 Marjory Stephenson Prize Lecture. Microbiology 144: 2377–2406. Thauer, R.K. (2015) My Lifelong Passion for Biochemistry and Anaerobic Microorganisms. Annu Rev Microbiol 69: 1–30. Thauer, R.K., Jungermann, K., and Decker, K. (1977) Energy conservation in chemotrophic anaerobic bacteria. Bacteriol Rev 41: 100–180. Thauer, R.K., Kaster, A.-K., Goenrich, M., Schick, M., Hiromoto, T., and Shima, S. (2010) Hydrogenases from methanogenic archaea, nickel, a novel cofactor, and H2 storage. Annu Rev Biochem 79: 507–36. Thauer, R.K., Kaster, A.-K., Seedorf, H., Buckel, W., and Hedderich, R. (2008) Methanogenic archaea: ecologically relevant differences in energy conservation. Nat Rev Microbiol 6: 579–591. Thauer, R.K. and Shima, S. (2008a) Methane as fuel for anaerobic microorganisms. In, Annals of the New York Academy of Sciences., pp. 158–170. Thöny-Meyer, L. (1997) Biogenesis of respiratory cytochromes in bacteria. Microbiol Mol Biol Rev 61: 337–376. Thorup, C., Schramm, A., Findlay, A.J., Finster, K.W., and Schreiber, L. (2017) Disguised as a sulfate reducer: growth of the Deltaproteobacterium Desulfurivibrio alkaliphilus by sulfide oxidation with nitrate. MBio 8: e00671-17. 182 Bibliography Tiedje, J.M., Sexstone, A.J., Myrold, D.D., and Robinson, J.A. (1983) Denitrification: ecological niches, competition and survival. Antonie Van Leeuwenhoek 48: 569–583. Tietze, M., Beuchle, A., Lamla, I., Orth, N., Dehler, M., Greiner, G., and Beifuss, U. (2003) Redox potentials of methanophenazine and CoB-S-S-CoM, factors involved in electron transport in methanogenic archaea. Chembiochem 4: 333–335. Timmers, P.H.A., Welte, C.U., Koehorst, J.J., Plugge, C.M., Jetten, M.S.M., and Stams, A.J.M. (2017) Reverse Methanogenesis and Respiration in Methanotrophic Archaea. Archaea 2017: 1–22. Timmers, P.H., Suarez-Zuluaga, D.A., van Rossem, M., Diender, M., Stams, A.J., and Plugge, C.M. (2015) Anaerobic oxidation of methane associated with sulfate reduction in a natural freshwater gas source. ISME J 10: 1–13. Tomaszek, J.A. and Gruca-Rokosz, R. (2007) Rates of dissimilatory nitrate reduction to ammonium in two Polish reservoirs: impacts of temperature, organic matter content, and nitrate concentration. Environ Technol 28: 771–8. Toro, E.E.R. and Cervantes, F.J. (2016) Coupling between anammox and autotrophic denitrification for simultaneous removal of ammonium and sulfide by enriched marine sediments.Biodegradation 27: 107–118. Tran, Q.H. and Unden, G. (1998) Changes in the proton potential and the cellular energetics of Escherichia coli during growth by aerobic and anaerobic respiration or by fermentation. Eur J Biochem 251: 538–543. Treude, T., Krüger, M., Boetius, A., and Jørgensen, B.B. (2005) Environmental control on anaerobic oxidation of methane in the gassy sediments of Eckernförde Bay (German Baltic). Limnol Oceanogr 50: 1771–1786. Treude, T., Orphan, V., Knittel, K., Gieseke, A., House, C.H., and Boetius, A. (2007) Consumption of Methane and CO2 by Methanotrophic Microbial Mats from Gas Seeps of the Anoxic Black Sea. Appl Environ Microbiol 73: 2271–2283. Tugtas, A.E. and Pavlostathis, S.G. (2007) Electron donor effect on nitrate reduction pathway and kinetics in a mixed methanogenic culture. Biotechnol Bioeng 98: 756–763. Tyson, K.L., Bell, A.I., Cole, J.A., and Busby, S.J. (1993) Definition of nitrite and nitrate response elements at the anaerobically inducible Escherichia coli nirB promoter: interactions between FNR and NarL. Mol Microbiol 7: 151–157. Ussiri, D. and Lal, R. (2017) Historical and Contemporary Global Methane Cycling. In, Carbon Sequestration for Climate Change Mitigation and Adaptation. Springer International Publishing, Cham, pp. 227–285. Vaksmaa, A., Guerrero-Cruz, S., van Alen, T.A., Cremers, G., Ettwig, K.F., Lüke, C., and Jetten, M.S.M. (2017) Enrichment of anaerobic nitrate-dependent methanotrophic “Candidatus Methanoperedens nitroreducens” archaea from an Italian paddy field soil. Appl Microbiol Biotechnol 101: 7075–7084. Vergnes, A., Gouffi-Belhabich, K., Blasco, F., Giordano, G., and Magalon, A. (2004) Involvement of the molybdenum cofactor biosynthetic machinery in the maturation of the Escherichia coli nitrate reductase A. J Biol Chem 279: 41398–41403. Vetriani, C., Tran, H. V., and Kerkhof, L.J. (2003) Fingerprinting Microbial Assemblages from the Oxic/Anoxic Chemocline of the Black Sea. Appl Environ Microbiol 69: 6481–6488. van de Vossenberg, J., Woebken, D., Maalcke, W.J., Wessels, H.J.C.T., Dutilh, B.E., Kartal, B., et al. (2013) The metagenome of the marine anammox bacterium “ Candidatus Scalindua profunda” illustrates the versatility of this globally important nitrogen cycle bacterium. Environ Microbiol 15: 1275–1289. de Vries, S., Momcilovic, M., Strampraad, M.J., Whitelegge, J.P., Baghai, A., and Schroder, I. (2010) Adaptation to a high-tungsten environment: Pyrobaculum aerophilum contains an active tungsten nitrate reductase. Biochemistry 49: 9911–9921. Walsh, C. (1986) Naturally occurring 5-deazaflavin coenzymes - biological redox roles.Acc Chem Res 19: 216–221. 183 Bibliography Wang, F.P., Zhang, Y., Chen, Y., He, Y., Qi, J., Hinrichs, K.U., et al. (2014) Methanotrophic archaea possessing diverging methane-oxidizing and electron-transporting pathways. ISME J 8: 1069– 1078. Wang, H. and Gunsalus, R.P. (2000) The nrfA and nirB nitrite reductase operons in Escherichia coli are expressed differently in response to nitrate than to nitrite. J Bacteriol 182: 5813–5822. Wang, H., Tseng, C.P., and Gunsalus, R.P. (1999) The napF and narG nitrate reductase operons in Escherichia coli are differentially expressed in response to submicromolar concentrations of nitrate but not nitrite. J Bacteriol 181: 5303–5308. Wang, Y., Zhu, G., Harhangi, H.R., Zhu, B., Jetten, M.S.M., Yin, C., and Op den Camp, H.J.M. (2012) Co-occurrence and distribution of nitrite-dependent anaerobic ammonium and methane- oxidizing bacteria in a paddy soil. FEMS Microbiol Lett 336: 79–88. Ward, B.B., Devol, A.H., Rich, J.J., Chang, B.X., Bulow, S.E., Naik, H., et al. (2009) Denitrification as the dominant nitrogen loss process in the Arabian Sea. Nature 461: 78–81. Watanabe, T., Kojima, H., and Fukui, M. (2014) Complete genomes of freshwater sulfur oxidizers Sulfuricella denitrificans skB26 and Sulfuritalea hydrogenivorans sk43H : Genetic insights into the sulfur oxidation pathway of betaproteobacteria. Syst Appl Microbiol 37: 387–395. Watkins, P.A., Maiguel, D., Jia, Z., and Pevsner, J. (2007) Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome. J Lipid Res 48: 2736–2750. Weber, H.S., Habicht, K.S., and Thamdrup, B. (2017) Anaerobic Methanotrophic Archaea of the ANME- 2d Cluster Are Active in a Low-sulfate, Iron-rich Freshwater Sediment. Front Microbiol 8: 619. Wegener, G., Krukenberg, V., Riedel, D., Tegetmeyer, H.E., and Boetius, A. (2015) Intercellular wiring enables electron transfer between methanotrophic archaea and bacteria. Nature 526: 587–590. Wegener, G., Krukenberg, V., Ruff, S.E., Kellermann, M.Y., and Knittel, K. (2016) Metabolic Capabilities of Microorganisms Involved in and Associated with the Anaerobic Oxidation of Methane. Front Microbiol 7: 46. Welte, C. and Deppenmeier, U. (2014) Bioenergetics and anaerobic respiratory chains of aceticlastic methanogens. Biochim Biophys Acta 1837: 1130–47. Welte, C. and Deppenmeier, U. (2011a) Membrane-bound electron transport in Methanosaeta thermophila. J Bacteriol 193: 2868–2870. Welte, C. and Deppenmeier, U. (2011b) Re-evaluation of the function of the F420 dehydrogenase in electron transport of Methanosarcina mazei. FEBS J 278: 1277–1287. Welte, C.U., Rasigraf, O., Vaksmaa, A., Versantvoort, W., Arshad, A., Camp, H.J.M.O. Den, and Reimann, J. (2016) Minireview Nitrate- and nitrite-dependent anaerobic oxidation of methane. 8: 941–955. Winkler, M.-K.., Ettwig, K.F., Vannecke, T.P.W., Stultiens, K., Bogdan, A., Kartal, B., and Volcke, E.I.P. (2015) Modelling simultaneous anaerobic methane and ammonium removal in a granular sludge reactor. Water Res 73: 323–331. Winogradsky, S. (1890) Recherches sur les organismes de la nitrification.Ann Inst Pasteur 213–231. Wolfe, A.J. (2005) The Acetate Switch. Microbiol Mol Biol Rev 69: 12–50. Wrighton, K.C., Thomas, B.C., Sharon, I., Miller, C.S., Castelle, C.J., VerBerkmoes, N.C., et al. (2012) Fermentation, hydrogen, and sulfur metabolism in multiple uncultivated bacterial phyla. Science (80- ) 337: 1661–1665. Wu, M., Zhang, Y., Ye, Y., and Lin, C. (2016) In situ Removal of Hydrogen Sulfide During Biogas Fermentation at Microaerobic Condition. Appl Biochem Biotechnol 180: 817–825. Wu, Y.-W., Simmons, B.A., and Singer, S.W. (2016) MaxBin 2.0: an automated binning algorithm to recover genomes from multiple metagenomic datasets. Bioinformatics 32: 605–607. Wuchter, C., Abbas, B., Coolen, M.J.L., Herfort, L., van Bleijswijk, J., Timmers, P., et al. (2006) Archaeal nitrification in the ocean.Proc Natl Acad Sci U S A 103: 12317–22. Xiao, Y. and Roberts, D.J. (2010) A review of anaerobic treatment of saline wastewater. Environ Technol 31: 1025–1043. Yan, J., Haaijer, S.C.M., Op den Camp, H.J.M., van Niftrik, L., Stahl, D.A., Könneke, M., et al. 184 Bibliography (2012) Mimicking the oxygen minimum zones: stimulating interaction of aerobic archaeal and anaerobic bacterial ammonia oxidizers in a laboratory-scale model system. Environ Microbiol 14: 3146–58. Yang, W., Lu, H., Khanal, S.K., Zhao, Q., Meng, L., and Chen, G.H. (2016) Granulation of sulfur- oxidizing bacteria for autotrophic denitrification.Water Res 104: 507–519. Yang, W., Zhao, Q., Lu, H., Ding, Z., Meng, L., and Chen, G.H. (2016) Sulfide-driven autotrophic denitrification significantly reduces N2O emissions.Water Res 90: 176–184. Yilmaz, P., Parfrey, L.W., Yarza, P., Gerken, J., Pruesse, E., Quast, C., et al. (2014) The SILVA and “All- species Living Tree Project (LTP)” taxonomic frameworks. Nucleic Acids Res 42: D643–D648. Yoshimatsu, K., Araya, O., and Fujiwara, T. (2007) Haloarcula marismortui cytochrome b-561 is encoded by the narC gene in the dissimilatory nitrate reductase operon. Extremophiles 11: 41–47. Yoshimatsu, K., Sakurai, T., and Fujiwara, T. (2000) Purification and characterization of dissimilatory nitrate reductase from a denitrifying halophilic archaeon, Haloarcula marismortui. FEBS Lett 470: 216–220. Yoshinaga, M.Y., Holler, T., Goldhammer, T., Wegener, G., Pohlman, J.W., Brunner, B., et al. (2014) Carbon isotope equilibration during sulphate-limited anaerobic oxidation of methane. Nat Geosci 7: 190–194. Yuan, Z. (2015) processes in anoxic environments. 1–9. Zecchin, S., Mueller, R.C., Seifert, J., Stingl, U., Anantharaman, K., van Bergen, M., et al. (2017) Rice paddy Nitrospirae encode and express genes related to sulfate respiration: proposal of the new genus Candidatus Sulfobium. bioRxiv. Zehnder, A.J. and Brock, T.D. (1980) Anaerobic methane oxidation: occurrence and ecology. Appl Environ Microbiol 39: 194–204. Zeikus, J.G. and Wolfe, R.S. (1972) Methanobacterium thermoautotrophicus sp. n., an anaerobic, autotrophic, extreme thermophile. J Bacteriol 109: 707–15. Zhou, J., Bruns, M.A., and Tiedje, J.M. (1996) DNA recovery from soils of diverse composition. Appl Environ Microbiol 62: 316–322. Zhou, W., Li, Y., Liu, X., He, S., and Huang, J.C. (2016) Comparison of microbial communities in different sulfur-based autotrophic denitrification reactors.Appl Microbiol Biotechnol 1–7. Zhu, B. (2014) Microbial and environmental aspects of anaerobic oxidation of methane. PhD thesis, Radboud Univ. Zhu, B., Sánchez, J., van Alen, T.A., Sanabria, J., Jetten, M.S.M., Ettwig, K.F., and Kartal, B. (2011) Combined anaerobic ammonium and methane oxidation for nitrogen and methane removal: Figure 1. Biochem Soc Trans 39: 1822–1825. Zinder, G.W.J.A. · S.H. (1996) Methanogenesis from acetate by cell-free extracts of the thermophilic acetotrophic methanogen Methanothrix thermophila CALS-1. Arch Microbiol 166: 275–281. Zomorrodi, A.R. and Segrè, D. (2016) Synthetic Ecology of Microbes: Mathematical Models and Applications. J Mol Biol 428: 837–861. Zumft, W.G. (1997) Cell biology and molecular basis of denitrification. Microbiol Mol Biol Rev 61: 533–616. 185 186 Curriculum Vitae Curriculum Vitae Arslan Arshad was born on November 8th 1987 in Gujranwala, Pakistan. He completed his secondary education from Gujranwala Institute of Future Technologies in 2005. In September 2006, he moved to The Netherlands where he obtained his bachelor degrees in Life Sciences and Applied Biology from Hogeschool van Arnhem en Nijmegen and Bonn University of Applied Sciences, Germany, in 2010. His graduation dissertation was performed in the department of Ecological Microbiology at Radboud University Nijmegen. After completion of his pre-master he obtained his Master of Science degree in Biology at Radboud University Nijmegen, in 2013. During his MSc studies, he completed two research internships at the Department of Animal Physiology and at the Department of Ecological Microbiology of Radboud University, Nijmegen. Shortly after his MSc graduation he started his PhD project. The findings of his PhD work resulted in this thesis. 187 188 Publication list Publication list • Arshad, A., Speth, D.R., De Graaf, R.M., Op den Camp, H.J.M., Jetten, M.S.M., and Welte, C.U. (2015) A metagenomics-based metabolic model of nitrate-dependent anaerobic oxidation of methane by Methanoperedens-like archaea. Front Microbiol 6. • van Kessel, M.A.H.J., Mesman, R.J., Arshad, A., Metz, J.R., Spanings, F.A.T., van Dalen, S.C.M., et al. (2016) Branchial nitrogen cycle symbionts can remove ammonia in fish gills.Environ Microbiol Rep 8: 590–594. • Welte, C.U., Rasigraf, O., Vaksmaa, A., Versantvoort, W., Arshad, A., Op den Camp, H.J.M., et al. (2016) Nitrate- and nitrite-dependent anaerobic oxidation of methane. Environ Microbiol Rep 8: 941–955. • Arshad, A., Dalcin Martins, P., Frank, J., Jetten, M.S.M., Op den Camp, H.J.M., and Welte, C.U. (2017) Mimicking microbial interactions under nitrate-reducing conditions in an anoxic bioreactor: enrichment of novel Nitrospirae bacteria distantly related to Thermodesulfovibrio. Environ Microbiol 19: 4965–4977. 189 Arslan Arshad Arslan MICROBIAL ECOLOGY OF OF ECOLOGY MICROBIAL OXIDATION ANAEROBIC OF METHANE MICROBIAL ECOLOGY OF ANAEROBIC OXIDATION OF METHANE Arslan Arshad