Identification, Characterization, and Expression of Latrophilin-like Proteins in Parasitic Nematodes

A thesis submitted for the degree of

Doctor of Philosophy (PhD)

in the subject of Parasitology

by

Claudia Annette Felicitas Welz (formerly Ram),

Veterinarian

May 2007

International PhD program “Infection Biology”

Institute for Parasitology

University of Veterinary Medicine Hannover

Identification, Characterization, and Expression of Latrophilin-like Proteins in Parasitic Nematodes

A thesis submitted for the degree of

Doctor of Philosophy (PhD)

in the subject of Parasitology

by

Claudia Annette Felicitas Welz (formerly Ram),

Veterinarian

May 2007

International PhD program “Infection Biology”

Institute for Parasitology

University of Veterinary Medicine Hannover

PhD project funded by the Ministry for Science and Culture of Lower Saxony through the Georg-Christoph-Lichtenberg Scholarship scheme, the University of Veterinary Medicine through a Research Stipend, the Hannover Biomedical Research School through a stipend, and the BAYER HealthCare AG

Acknowledged by the PhD committee and head of Hannover Medical School

President: Prof. Dr. Dieter Bitter-Suermann Supervisor: Prof. Dr. Georg von Samson-Himmelstjerna Co-supervisor: Prof. Dr. Dr. Achim Harder External expert: Prof. Lindy Holden-Dye Internal expert: Prof. Dr. Andreas Klos Day of final exam/public defense: 06 July 2007

Πάντα
ε, οδν ένει.

Everything flows, nothing stands still. Heraklit (540 – 480 ante Christum)

To my big, great family

Contents 9

1 Contents

1 Contents...... 9 2 Summary...... 15 3 Literature...... 17 3.1 Introduction...... 17 3.2 Parasites ...... 17 3.2.1 Taxonomy ...... 17 3.2.2 Morphology of Trichostrongylids...... 18 3.2.3 Biology of Trichostrongylids...... 18 3.3 The Model Nematode Caenorhabditis elegans...... 21 3.3.1 Taxonomy ...... 21 3.3.2 Morphology and Biology of C. elegans...... 22 3.4 G-protein Coupled Receptors ...... 22 3.5 Tools for Functional Gene Analysis in C. elegans ...... 23 3.5.1 Inactivation of Genes ...... 23 3.5.2 Expression of Heterologous Genes in C. elegans...... 25 3.6 Neurobiology of Nematodes...... 26 3.6.1 Neurotransmitters ...... 26 3.7 Control of Parasites...... 31 3.7.1 Benzimidazoles...... 31 3.7.2 Nicotinic Agonists ...... 32 3.7.3 Macrocyclic Lactones ...... 32 3.7.4 Closantel ...... 32 3.7.5 Piperazine ...... 33 3.8 Anthelmintic Resistance...... 33 3.9 Cyclooctadepsipeptides ...... 34 3.9.1 PF1022 A...... 34 3.9.2 Emodepside ...... 34 3.9.3 Cyclohexadepsipeptides...... 36 3.10 Cyclooctadepsipeptides: Mechanism of Action...... 36 3.10.1 Involvement of the GABA System ...... 36 3.10.2 Influence of Cyclooctadepsipeptides on Effects of Neurotransmitters...... 36 3.10.3 Effects of Emodepside on C. elegans ...... 36 3.10.4 Hc110-R ...... 37 3.10.5 Latrophilin-like Protein 1 in C. elegans...... 38 3.10.6 Latrophilin-like Protein 2 in C. elegans...... 42 3.11 Black Widow Spider Venom and α-Latrotoxin ...... 42 3.12 Mammalian Latrophilins ...... 43 3.13 Potassium Channels ...... 44

10 Contents

3.13.1 BK-type Potassium Channels...... 44 3.13.2 The Potassium Channel SLO-1 in C. elegans ...... 45 3.13.3 The Potassium Channel SLO-2 in C. elegans ...... 46 3.14 Real-time PCR ...... 47 3.14.1 Detection of PCR Products ...... 47 3.14.2 Quantification of Template ...... 48 4 Objectives ...... 51 5 Material and Methods ...... 53 5.1 Maintenance and Collection of Parasites...... 53 5.1.1 Haemonchus contortus...... 53 5.1.2 Cooperia oncophora and Ostertagia ostertagi...... 53 5.1.3 Collection of Adult Nematodes ...... 53 5.1.4 Collection of Eggs...... 54 5.1.5 Collection of Larvae ...... 54 5.2 Mammalian Tissue ...... 55 5.3 Isolation of RNA ...... 55 5.3.1 Trizol® Method ...... 55 5.3.2 QuickPrepTM Micro mRNA Purification Kit ...... 56 5.3.3 Quantification of RNA ...... 57 5.4 cDNA Synthesis ...... 57 5.4.1 3’ RACE System for Rapid Amplification of cDNA Ends ...... 58 5.4.2 BD SMARTTM RACE cDNA Amplification Kit...... 58 5.5 Primer Design ...... 60 5.6 Polymerase Chain Reaction (PCR) ...... 60 5.6.1 Qiagen Taq DNA Polymerase ...... 61 5.6.2 BD Advantage® 2 Polymerase Mix ...... 61 5.6.3 Rapid Amplification of cDNA Ends (RACE)...... 62 5.6.4 PhusionTM Hot Start DNA High-Fidelity Polymerase ...... 64 5.7 Analysis of PCR Products...... 64 5.8 Isolation of DNA Bands ...... 65 5.9 Cloning of PCR Products ...... 65 5.9.1 Ligation Using the TOPO TA Cloning® Kit for Sequencing...... 65 5.9.2 Ligation Using the StrataCloneTM PCR Cloning Kit...... 66 5.9.3 Ligation Using the QIAGEN® PCR Cloning Kit ...... 66 5.9.4 Ligation using the Zero Blunt® PCR Cloning Kit ...... 66 5.10 Transformation ...... 67 5.11 Bacterial Cultures for Plasmid Analysis ...... 67 5.11.1 Antibiotics ...... 67 5.12 Glycerol Stocks ...... 67 5.13 Preparation of Plasmid DNA ...... 68 5.13.1 MiniPrep ...... 68 Contents 11

5.13.2 MidiPrep ...... 68 5.14 Quantification of DNA...... 69 5.15 Analysis of Plasmids using Restriction Enzymes ...... 69 5.16 Sequencing ...... 69 5.17 Sequence Analysis...... 70 5.17.1 Aligning and Handling of Sequences ...... 70 5.17.2 Prediction of Transmembrane Domains and Signal Peptides ...... 70 5.17.3 Detection of Conserved Domains...... 71 5.17.4 Phylogenetic Analysis ...... 71 5.18 Prokaryotic Expression ...... 72 5.18.1 Attaching Restriction Sites ...... 72 5.18.2 Digestion of Plasmids for Cloning into pENTRTM 3C...... 73 5.18.3 Double Digest ...... 74 5.18.4 Ligation ...... 74 5.18.5 Gateway® LR ClonaseTM Reaction ...... 75 5.18.6 Empty-vector Control...... 76 5.18.7 TSS (Transforming and Storing Solution) Transforming Procedure ...... 76 5.18.8 Regulation of Expression ...... 77 5.18.9 Inducing Expression Cultures...... 77 5.18.10 Other Bacterial Strains ...... 78 5.18.11 Other Expression Vectors ...... 78 5.18.12 Coexpression...... 79 5.19 Cell Lysis...... 80 5.20 MagneHisTM Protein Purification System ...... 80 5.21 Isolation of Inclusion Bodies...... 81 5.22 Refolding of Solubilized Proteins ...... 81 5.22.1 Dilution and Refolding Buffer...... 81 5.22.2 FPLC and HisTrapTM HP Column...... 82 5.23 Protein Analysis ...... 82 5.23.1 Conventional Methods...... 82 5.23.2 NuPage® System...... 83 5.23.3 Coomassie Staining...... 83 5.23.4 Drying SDS Gels ...... 84 5.23.5 Immunoblot...... 84 5.23.6 Testing of Sera ...... 85 5.23.7 Analysis by MALDI-MS...... 85 5.24 Prokaryotic Expression: Functional Assays ...... 86 5.24.1 α-LTX...... 86 5.24.2 On-Blot Binding of α-LTX ...... 86 5.24.3 Dynabeads® M-270 Carboxylic Acid ...... 87 5.25 Eukaryotic Expression...... 89

12 Contents

5.25.1 Expression Vectors...... 89 5.25.2 Maintenance of Eukaryotic Cells ...... 89 5.25.3 Transient Transfection with LipofectamineTM ...... 90 5.25.4 Transient Transfection with FuGENE 6 Transfection Reagent ...... 90 5.26 Eukaryotic Expression: Functional Assays ...... 91 5.26.1 Ca2+ Influx Measurement after Transfection with LipofectamineTM ...... 91 5.26.2 Ca2+ Influx Measurement after Transfection with FuGENE ...... 92 5.27 Preparation of Raw Antigen ...... 93 5.28 Isolation of Membrane Proteins ...... 93 5.29 Protein Quantification with CB-XTM Protein Assay...... 94 5.30 Removal of Detergents from Protein Samples...... 94 5.31 Specific Anti-Hc110-R Antibodies ...... 95 5.32 Construction of Plasmids for Expression in C. elegans ...... 97 5.33 Real-time PCR ...... 100 5.33.1 Design of Primers and Probes for Real-time PCR ...... 100 5.33.2 Plasmid DNA Dilution Series...... 100 5.33.3 RNA Isolation for Real-time PCR ...... 101 5.33.4 DNase Digestion...... 101 5.33.5 cDNA Synthesis for Real-time PCR ...... 102 5.33.6 Testing for Absence of Genomic DNA ...... 102 5.33.7 Real-time PCR Run...... 103 6 Results ...... 107 6.1 Depsiphilins (Latrophilin-like Protein 1, lat-1)...... 107 6.1.1 Sequences ...... 107 6.1.2 Identities between Depsiphilin Sequences ...... 108 6.1.3 BLAST Results for Depsiphilin Sequences ...... 109 6.1.4 Prediction of Transmembrane Domains and Signal Peptides...... 109 6.2 Latrophilin-like Protein 2 (lat-2) ...... 110 6.2.1 Identities between lat-2 Sequences...... 110 6.2.2 BLAST Results for lat-2 Sequences ...... 111 6.2.3 Prediction of Transmembrane Domains and Signal Peptides...... 112 6.3 Comparison of Sequences...... 112 6.4 Comparison of Predicted Conserved Domains...... 115 6.5 The BK-type Potassium Channel SLO-1 (slo-1) ...... 116 6.5.1 Identities between slo-1 Sequences...... 117 6.5.2 BLAST Results for slo-1 Sequences ...... 118 6.5.3 Comparison of SLO-1 Sequences...... 119 6.5.4 Prediction of Transmembrane Domains and Signal Peptides...... 120 6.5.5 Prediction of Conserved Domains ...... 121 6.6 Bovine and Canine LPH-2...... 121 6.7 Prokaryotic Expression ...... 122 Contents 13

6.7.1 FPLC...... 123 6.7.2 Expression of Canine and Bovine LPH-2 N-termini...... 123 6.7.3 MagneHisTM Protein Purification ...... 123 6.7.4 Antibodies ...... 124 6.7.5 Identification of Protein ...... 126 6.7.6 Functional Assays...... 127 6.8 Eukaryotic Expression...... 131 6.8.1 Ca2+ Influx after Transfection with LipofectamineTM ...... 131 6.8.2 Ca2+ Influx after Transfection with FuGENE...... 135 6.8.3 Detection of Recombinant Protein in Western Blot ...... 139 6.9 Plasmids for Expression of Depsiphilin Genes in C. elegans ...... 140 6.10 Real-time PCR ...... 140 6.10.1 Testing for Absence of Genomic DNA ...... 140 6.10.2 Definition of Standards ...... 142 6.10.3 Comparison of Amplification Efficiencies ...... 143 6.10.4 Real-time PCR Products ...... 143 6.10.5 Analysis of Real-time PCR Raw Data ...... 145 6.10.6 Analysis of Relative Amounts of Transcripts...... 145 6.10.7 Analysis of Copy Numbers ...... 149 7 Discussion...... 151 7.1 Depsiphilins...... 151 7.1.1 Sequences ...... 151 7.1.2 Prediction of Conserved Domains in Depsiphilins...... 152 7.2 Latrophilin-like Protein 2...... 154 7.2.1 Sequences ...... 154 7.2.2 Prediction of Conserved Domains in LAT-2 ...... 154 7.3 Expression of Isolated N-termini of Depsiphilins ...... 155 7.3.1 Antibodies ...... 156 7.3.2 Functional Assays on Isolated N-termini ...... 157 7.4 Eukaryotic Expression...... 159 7.4.1 Western Blot of Membrane Protein...... 159 7.4.2 Calcium Influx Measurements ...... 162 7.5 Real-time PCR ...... 166 7.5.1 Quantification Methods ...... 167 7.5.2 Evaluation of Real-time PCR Data ...... 168 7.5.3 Transcription Levels of Depsiphilin Normalized to 18 S rRNA ...... 169 7.5.4 Significance of Real-time PCR Data...... 169 7.6 Heterologous Expression of Depsiphilin in C. elegans ...... 170 7.7 BK-type Potassium Channel SLO-1 Sequences...... 171 7.7.1 Prediction of Transmembrane Regions in SLO-1...... 171 7.7.2 Prediction of Conserved Domains in SLO-1...... 172

14 Contents

7.8 Conclusions and Perspectives...... 173 8 Appendix ...... 177 8.1 Additional Data...... 177 8.1.1 Predicted Transmembrane Domains...... 177 8.1.2 Real-time PCR Raw Data ...... 179 8.1.3 Comparison of Real-time PCR Amplification Efficiencies ...... 187 8.2 Important Plasmids ...... 190 8.2.1 Plasmids for Real-time PCR Standardization...... 194 8.3 Published Sequences ...... 195 8.3.1 Sequences Used for the Design of Primers ...... 195 8.3.2 Sequences Used for Alignments of Genes...... 196 8.4 Material...... 199 8.4.1 Commercial Primers and Primers as Components of Kits ...... 199 8.4.2 Custom Primers ...... 199 8.4.3 Oligonucleotides for Real-time PCR...... 200 8.4.4 Antibody Concentrations...... 203 8.4.5 Escherichia coli Strains...... 204 8.4.6 Vectors...... 206 8.4.7 Eukaryotic Cell Lines ...... 207 8.4.8 Buffers and Solutions...... 208 8.4.9 Media ...... 212 8.4.10 Reagents and Chemicals ...... 212 8.4.11 Enzymes...... 214 8.4.12 Commercial Kits ...... 215 8.4.13 Disposables ...... 216 8.4.14 Technical Equipment...... 216 8.4.15 Software ...... 219 8.4.16 Databases ...... 220 8.4.17 Custom Services ...... 220 8.5 Abbreviations ...... 221 8.6 IUPAC Code for Nucleotides...... 227 8.7 Standard Amino Acid Abbreviations ...... 228 8.8 Reference List ...... 229 Curriculum Vitae...... 250 List of Publications ...... 252 Declaration ...... 255 Acknowledgements / Danksagung...... 256 Summary 15

2 Summary

Claudia Welz (2007): Identification, Characterization, and Expression of Latrophilin-like Proteins in Parasitic Nematodes

Emodepside belongs to the cyclooctadepsipeptides, a new class of anthelmintically active drugs, and is effective against many parasitic nematodes. In the sheep parasite Haemonchus contortus and in the free-living nematode Caenorhabditis elegans putative G-protein coupled receptors (GPCRs) were previously identified as targets for emodepside. In the present work orthologous receptors were identified in the cattle trichostrongylids Cooperia oncophora and Ostertagia ostertagi. These receptors were named depsiphilins. They showed 88 % amino acid sequence identity with their ortholog Hc110-R in H. contortus, 45 – 47 % identity with the orthologous receptor latrophilin-like protein 1 (LAT-1) in C. elegans, and identities of up to 26 % with mammalian latrophilins (LPH). Hc110-R, C. elegans LAT-1, and mammalian LPH are known to bind α-latrotoxin (α-LTX), a component of the black widow spider venom. The newly identified receptors in parasites were examined as recombinant proteins for their binding affinities for α-LTX. Experiments with the isolated N-termini failed to confirm their role as specific binding partners, potentially due to incorrect folding of the truncated receptors. The results of transiently transfected eukaryotic cells expressing full-length receptors were ambiguous; further experiments are planned. Specific polyclonal antibodies against the N-terminus of Hc110-R were developed and successfully tested. Depsiphilins were shown to be transcribed in males, females, eggs, mixed first and second stage larvae, and third stage larvae of H. contortus and O. ostertagi by real-time PCR. An expression plasmid for the heterologous expression of O. ostertagi depsiphilin in C. elegans was prepared. A further potential target for emodepside was identified in H. contortus and C. oncophora, the putative GPCR latrophilin-like protein 2. It shared structural features with depsiphilins, C. elegans LAT-1, and mammalian LPH. Complete coding sequences for the calcium-gated potassium channel SLO-1 were identified in H. contortus and C. oncophora and, as preliminary sequence, in O. ostertagi. This channel is currently discussed as a participant in the mechanism of action of emodepside. The actual role of the newly described proteins remains to be clarified, but their identification in this work provides a broad basis for future projects.

Literature 17

3 Literature

3.1 Introduction

Infections with parasitic nematodes are responsible for large economic losses in livestock industry. Trichostrongylids can cause severe gastroenteritis, mainly in young ruminants, sometimes even leading to death. The life cycles of gastrointestinal nematodes in cattle and sheep are direct with short generation times. Infection occurs with the ingestion of infectious third-stage larvae on the pasture. Thus the epidemiology of parasitic nematodes is mainly influenced by the access to areas contaminated by infected animals. If the pasture has been contaminated with parasites, elimination of the parasites is difficult. The infectious larvae are viable for months and can survive the winter season on the pasture. Elimination requires interruption of the life cycle, e.g. by alternating pastures between horses and cattle in successive years. Sheep farming in Australia and New Zealand in particular is affected by problems with parasitic nematodes, since large herds are continuously kept on the pasture. Calves for beef production in Germany are in most cases kept in stables, but calves destined for milk production or ecological beef production as well as calves in feedlots, for example in the USA, have access to potentially contaminated environments. Not only the severe and sometimes lethal infections are important for livestock industry, but subclinical effects such as retarded growth and decreased weight gains may result in production losses. Problems are intensified when parasites develop resistances to the main classes of drugs (KAPLAN, 2004). In small ruminants even multidrug resistance has been reported in parasitic nematodes (POMROY, 2006).

3.2 Parasites

3.2.1 Taxonomy The species Haemonchus contortus, Cooperia oncophora, and Ostertagia ostertagi are parasitic nematodes, affecting the gastrointestinal tract of ruminants. All three species belong to the same subfamily, the Trichostrongylinae:

18 Literature

Kingdom Animalia Subkingdom Metazoa Phylum Nematoda Class Chromadorea Subclass Rhabditia Order Rhabditida Suborder Rhabditina Superfamily Strongyloidea Family Trichostrongylidae Subfamily Trichostrongylinae

Terminology is given according to the Standardized Nomenclature of Animal Parasitic Diseases (SNOAPAD) (TENTER and SCHNIEDER, 2006).

3.2.2 Morphology of Trichostrongylids Adult trichostrongylids are wire shaped round worms with tapered ends and a length of 5 – 30 mm. They have a filariform pharynx, which means, that the pharynx is long with a terminal bulb. The gut consists of a single layer of epithelial cells with microvilli (TENTER and SCHNIEDER, 2006). Trichostrongylids are dioecious animals, i.e. one individual is having only either male or female reproductive organs. The females have two uteri, two ovaries, and an organ called the ovijector, consisting of the infundibula and the vagina. The vulva is located in the caudal third of the body. The genital system of the males consists of a single testicle, a vas deferens, and a ductus ejaculatorius, which ends in the cloaca. The males also possess two spicula and a bursa copulatrix, which is a lobular modification of the posterior end. The bursa copulatrix surrounds the female vulva during copulation. The morphology of the bursa copulatrix and spicula, as well as surface patterns on the cuticle, can be used for species identification (SCHNIEDER, 2006).

3.2.3 Biology of Trichostrongylids The life cycles of H. contortus, C. oncophora, and O. ostertagi are monoxenic, i.e. the development cycle does not involve an intermediate host; a schematic life cycle of C. oncophora and O. ostertagi is presented in Figure 1. The adults of all three Literature 19 species live in the gastrointestinal tract of ruminants and the females lay eggs. The eggs are 70 – 80 µm in size, oval, and have a thin shell. They are excreted with the host faeces and at that time contain embryonic cells. Detection of the eggs in the faeces of an animal does not allow an exact diagnosis of the species, since the eggs of gastrointestinal nematodes have very similar morphologies. Embryonic development ends with the hatching of the first-stage larvae (L1), which molts to the second-stage larvae (L2). These stages are microbivorous. During development to the infectious third-stage larvae (L3), the cuticle of the L2 is retained as a sheath. L3 are non-feeding, relying on food resources stored during the earlier stages. L3 are able to endure weeks to months and even the winter period on the pasture and therefore play a key role in epidemiology. Larval development from egg to infectious L3 requires (under optimal conditions) a minimum of 7 – 14 days, usually 21 days, but can take up to three months, depending on environmental conditions. Prepatency, the time period between infection of the host and appearance of parasite eggs in the faeces, is 17 – 22 days (SCHNIEDER, 2006).

Figure 1: Schematic life cycle of C. oncophora and O. ostertagi. Arrows mark the locations of the adult parasites: C. oncophora (Co) in the small intestine and O. ostertagi (Oo) in the abomasum

20 Literature

The stimuli for L3 exsheathment after entering the host are species-dependent. The larvae appear to receive exsheathment stimuli while passing a part of the alimentary tract of the host proximal to that, where the adult nematodes will reside. H. contortus, which lives in the abomasum of sheep, exsheathes best in slightly acid to neutral conditions like in the rumen, whereas Trichostrongylus colubriformis with the adults staying in the small intestine of sheep, exsheathes in acid conditions, as they are present in the abomasum (LEE, 2002).

3.2.3.1 Haemonchus contortus The barber pole worm H. contortus is one of the most important gastrointestinal nematodes in sheep (WALLER and CHANDRAWATHANI, 2005). The blood-sucking adults live in the abomasum and lacerate the mucosa of the host with a dorsal tooth to generate hemorrhagic areas (MUNN and MUNN, 2002). The males are 18 – 21 mm, the females 20 – 30 mm in length. Due to the loss of blood heavily infected lambs suffer from anemia, icterus, and edema. Young animals are generally most severely infected and infections can be lethal (SCHNIEDER, 2006).

3.2.3.2 Cooperia oncophora The adults of C. oncophora are located in the small intestine of cattle. The infection is often observed as a coinfection with O. ostertagi. The main symptoms are diarrhea and lack of appetite resulting in retarded weight gain. The males are 5 – 8 mm, the females 6 – 11 mm (SCHNIEDER, 2006).

3.2.3.3 Ostertagia ostertagi The males of O. ostertagi are 6 – 8 mm, the females 8 – 12 mm in length. The adults stay in the abomasum of cattle. O. ostertagi is, like some other nematodes including H. contortus, able to arrest its development at the L4 stage and to endure several months without further development. This phenomenon is called hypobiosis and is a strategy to overcome unfavourable environmental conditions. Hypobiotic larvae of O. ostertagi can continue their development after 4 – 6 months and can therefore cause a severe disease called winter ostertagiosis without a new infection of the animals. Hypobiosis is mainly induced by low temperatures (5 – 15° C) or hot, dry Literature 21 weather for several weeks, but immunological components of the host seem also to play a role. The triggering stimuli for continuing the development are not yet known in detail (SCHNIEDER, 2006). Hormonal stimuli of the host are proposed as triggers, indicating the upcoming reproduction phase of the host. When the offspring larvae produced by the reactivated hypobiotic nematodes are distributed on the pasture, young animals as naive hosts are accessible. The hypobiosis phenomenon is therefore a mechanism to synchronize the life cycles of parasite and host (WHARTON, 2002). Since the L4 stay in the abomasal glands, characteristic nodules are formed in the mucosa. This stage is called the histotropic stage. The main symptoms of an infection with O. ostertagi are diarrhea, lack of appetite, and retarded weight gain.

3.3 The Model Nematode Caenorhabditis elegans

Caenorhabditis elegans is a free-living nematode. It can easily be maintained on agar plates and has a short life cycle; therefore it is a convenient model organism in helminthology (BRENNER, 1974). The genome of C. elegans has been completely sequenced by the C. ELEGANS SEQUENCING CONSORTIUM (1998).

3.3.1 Taxonomy The non-parasitic nematode C. elegans belongs to a different superfamily than the trichostrongylids (see 3.2.1). The terminology is given according to SNOAPAD (TENTER and SCHNIEDER, 2006):

Kingdom Animalia Subkingdom Metazoa Phylum Nematoda Class Chromadorea Subclass Rhabditia Order Rhabditida Suborder Rhabditina Superfamily Rhabditoidea Family Rhabditidae

22 Literature

3.3.2 Morphology and Biology of C. elegans The adults of C. elegans are 1 mm in size and are transparent. They have a three-part rhabditoid pharynx and an intestinal wall consisting of a single cell layer. The adults are mainly hermaphrodites, only a small percentage of a population is represented by males. Hermaphrodites consist of 959 somatic cells. The gonad of hermaphrodites has two lobes, an anterior and a posterior, both consisting of an ovary, an oviduct, and a spermatheca. The spermatheca is the organ where sperm is stored and fertilization takes place. The two lobes of the gonad open into a single uterus, where the fertilized eggs mature. The vulva is located midventrally. The eggs layed by the adult hermaphrodites develop through four larval stages. The fourth-stage larva (L4) and the males produce sperm. Hermaphrodites can mate with males or themselves. The generation time is 3 – 6 days, and the life-span is 2 – 3 weeks (HOPE, 1999). An additional, developmentally arrested stage after the second moult is known as a dauer larva. The dauer larva is a facultative hypobiotic stage in response to unfavourable environmental conditions such as overcrowding or limited food supply (CASSADA and RUSSELL, 1975; GOLDEN and RIDDLE, 1984).

3.4 G-protein Coupled Receptors

G-protein coupled receptors (GPCRs) are membrane-spanning proteins with characteristic structural properties. The membrane-spanning domain consists of seven transmembrane helices. GPCRs play a key role in signal transmission via second messengers. After binding a ligand, the GPCR activates guanine nucleotide-binding proteins (G-proteins). The binding of one ligand molecule to the receptor leads to the activation of many G-protein molecules, resulting in an increased response. G-proteins consist of three subunits, namely α, β, and γ subunit. Inactive G-proteins bind guanosine-diphosphate (GDP) at the α subunit (Gα). Activation of the G-protein involves the receptor-catalyzed exchange of GDP to GTP (guanosine-triphosphate) in the binding pocket of the G-protein. The activated α subunit of the G-protein dissociates from the other subunits and catalyzes the activation of a target protein. In some cases the complex of the β and γ subunits is the activating unit for the target protein. The target protein itself activates further regulating proteins (STRYER, 1995b). A well known pathway in a GPCR-mediated Literature 23 signaling cascade is the phosphoinositide signaling pathway, which involves the hydrolysis of phosphatidylinositol-4,5-bisphosphate (PIP2).

SIMON and coworkers (1991) defined, dependent on the identities of amino acid sequences, four classes of G-proteins, Gαs, Gαi, Gαq, and Gα12. Gαs proteins are stimulatory, whereas Gαi proteins are inhibtory. The class of Gαi proteins also contains the Gαo proteins. The notation of G-proteins is not uniform: some authors note the α as suffix (e.g. Gqα), some put the name of the family as suffix (e.g. Gαq). In this work the latter form is used. The class names are also not uniform, they are found adapted to Gαi/o, Gαq/11, and Gα12/13 (e.g. in HOLLINGER et al., 2001; MCCUDDEN et al., 2005). In the C. elegans genome genes for 21 Gα subunits are known, with one clear ortholog for each of the four mammalian families of Gα subunits, with C. elegans goa-1, gsa-1, egl-30, and gpa-12 corresponding to mammalian genes for Gαi, Gαs, Gαq, and Gα12, respectively. The remaining

17 Gα subunits, although perhaps more similar to the Gαi/o family, are referred to as the C. elegans specific Gα subunits (BERGAMASCO and BAZZICALUPO, 2006). GPCRs are grouped into at least six families, showing no sequence homologies to each other. The main families are the families 1, 2, and 3. Family 1 contains most GPCRs, including receptors for odorants. Ligands are small molecules such as catecholamines (family 1a), short peptides (family 1b), or large proteins (family 1c). Family 2 receptors are also called the secretin-like family, and bind large peptides. Their relatively long N-termini are involved in ligand binding. Family 3 contains receptors for glutamate and γ-aminobutyric acid (BOCKAERT and PIN, 1999).

3.5 Tools for Functional Gene Analysis in C. elegans

3.5.1 Inactivation of Genes The completely sequenced genome of C. elegans allows resarchers to produce worms with selectively inactivated genes to investigate the function of a certain gene. Currently, two main strategies are used: RNA interference (RNAi) and gene deletion (knockout). The term knockdown is used for RNAi-derived reduction of expression, whereas knockout means the total elimination of gene transcription due to deletion or mutation of the gene (BARSTEAD, 1999; LEE et al., 2004).

24 Literature

3.5.1.1 Gene Knockout Treating C. elegans with chemical mutagens such as ethylmethanesulfonate, diepoxybutane, or trimethylpsoralen combined with UV radiation induces deletions in the DNA. The most appropriate stage for mutagenesis is the L3 / L4 stage, since the germline replicates in these stages. Replicating DNA is most susceptible to chemically induced mutagenesis. The progeny of the treated population can be screened for mutants by polymerase chain reaction (PCR) for mutations in the gene of interest or by their phenotype. Another principle of mutagenesis takes advantage of so-called mutator strains. These strains are relatively active for transpositions of genetic elements. Populations of animals having a transposon-insertion within the gene of interest leading to disruption of the open reading frame, are detected by PCR, and siblings are recovered. Subsequent to the identification of the population containing animals with a mutation or transposition within the respective gene, the mutated animals are selected in several rounds of breeding (BARSTEAD, 1999).

3.5.1.2 RNA Interference (RNAi) in C. elegans Microinjection of double stranded RNA (dsRNA) into C. elegans L4 or young hermaphrodites leads to a knockdown of the gene with the respective sequence in the progeny of the injected worm (FIRE et al., 1998). The phenomenon is called RNA interference (RNAi). Not only microinjection, but also soaking the worms in dsRNA-containing liquid (TABARA et al., 1998), in vivo production of dsRNA in trangenic C. elegans (TAVERNARAKIS et al., 2000), and feeding the worms with genetically modified Escherichia coli (TIMMONS et al., 2001) leads to this phenomenon. In the classical pathway of RNAi, the dsRNA is bound by an RNA binding protein, RDE-4 (PARKER et al., 2006), and cleaved by a complex called Dicer into small interfering RNAs (siRNAs) (BERNSTEIN et al., 2001). The siRNAs are loaded onto an effector complex, the RNA-induced silencing complex (RISC). RISC unwinds and separates the siRNA strands, and the resulting single stranded RNA fragments can bind to complementary messenger RNA (mRNA). This mRNA is then cleaved by the RISC complex and can therefore not be translated into protein. The expression of the respective protein is knocked down (GRISHOK, 2005; HAMMOND, 2005; ZAWADZKI et al., 2006). Another class of siRNAs is derived from direct amplification performed by the RNA-dependent RNA polymerase RdRP Literature 25

(PAK and FIRE, 2007; SIJEN et al., 2001). RNAi screens are widely used in examination of gene functions in C. elegans, and the mechanism also functions in many other organisms (GUNSALUS and PIANO, 2005).

3.5.1.3 RNAi in Parasitic Nematodes In parasitic nematodes the RNAi technique currently has several drawbacks. Efficacy has been extremely variable and experiments were sometimes not easily reproducible (VISSER et al., 2006). Maintaining parasitic stages under culture conditions is difficult and might influence the phenotype of the parasite; observed changes of the phenotype are therefore not necessarily caused by the knockdown of a certain gene. Furthermore, the developmental stages which can be exposed to RNAi technology are principally the free-living stages rather than the parasitic stages, and the effects of RNAi on subsequent stages are not clear (GELDHOF et al., 2007; KNOX et al., 2007). Nevertheless, positive outcomes of RNAi experiments have been reported (ISSA et al., 2005; KOTZE and BAGNALL, 2006; LUSTIGMAN et al., 2004).

3.5.2 Expression of Heterologous Genes in C. elegans The model organism C. elegans can be used as an expression system for heterologous genes or for gene / reporter-gene constructs. Any DNA microinjected into the germline of a hermaphrodite will be replicated (JIN, 1999). To facilitate the handling and maintenance of the DNA, plasmids are usually used. The plasmid contains an ampicillin resistance gene for the maintenance of the plasmid in E. coli. A large set of vectors was developed in the laboratory of FIRE (1990), containing different promotors and different reporter genes, such as the genes for green fluorescent protein (GFP) or β-galactosidase (MOUNSEY et al., 1999). The microinjection of DNA leads to extrachromosomal insertion, which is heritable. The animals are mosaic mutants, with some cells carrying the DNA and some cells without detectable foreign DNA (STINCHCOMB et al., 1985). Another method for transfection of C. elegans is microbombardment with microcarrier gold beads, leading to integration of DNA into chromosomes. The progeny of the transgenic worms are stably transfected and show no mosaic patterns (PRAITIS et al., 2001). The expression of genes in C. elegans can be used for studies of expression patterns, for rescue of knockout mutants with mutated genes (e.g. KLOPFENSTEIN

26 Literature and VALE, 2004; LEE et al., 2005) or with genes of other species (e.g. COOK et al., 2006; COUTHIER et al., 2004; CULLY et al., 1994; KWA et al., 1995).

3.6 Neurobiology of Nematodes

The chemical complexity of the nematode neurosystem has become apparent only within the last ten years. The nervous system of C. elegans is the most complex organ in the worm. 37 % of the cells in a hermaphrodite belong to the neuronal system (HOBERT, 2007). The most complex neuropil in the animal is a nerve ring encircling the pharynx. Efferent from this nerve ring, a dorsal and a ventral cord extend almost to the tail. Both contain motor neurons; the ventral cord additionally carries sensory neurons and interneurons. The system is completed by several ganglia, mainly in the pharyngeal and tail regions, and by sublateral cords. All nerves are located immediately beneath the hypodermis (THOMAS and LOCKERY, 1999). Due to its large size, having a length of 15 – 30 cm and a diameter of 3 – 6 mm, the pig roundworm Ascaris suum is a convenient system for neurological studies. The neuronal system of A. suum consists of three components: the peripheral, central, and enteric nervous systems. Since the nervous systems of nematodes are highly similar, the derived information may be applied to other nematodes. The nervous system of nematodes is a combined nervous and endocrine system with commonly shared messenger molecules, mainly neuropeptides of 3 – 100 amino acids. Nematodes lack endocrine glands and a circulatory system (BROWNLEE et al., 2000).

3.6.1 Neurotransmitters Neurotransmitters are compounds synthesized and stored in neurons where they mediate nerval signals into cellular responses. Their release is dependent on calcium ions (Ca2+) and has inhibitory or stimulatory effects on the postsynaptic cells. The neurotransmitters used by nematodes are mainly classical transmitters also known in mammals. However, some transmitters play a role in nematodes but are uncommon in mammals (THOMAS and LOCKERY, 1999). Which transmitters are used depends on the respective neuron. Neurotransmitters have been studied in C. elegans and A. suum in greater detail. Literature 27

Synaptic transmitters are stored in vesicles in the presynaptic terminal. Influx of calcium into the cell causes vesicle release. For termination of action the released transmitters are recycled or degraded. The proteins involved in forming the vesicles are also recovered. An overview of the proteins potentially involved in vesicle formation is given by HARRIS and colleagues (2001).

3.6.1.1 Acetylcholine A major excitatory transmitter in neuromuscular junctions of C. elegans is acetylcholine (ACh). ACh is used by a third of the cells belonging to the nervous system in C. elegans (RAND, 2007). In C. elegans GPCRs (LEE et al., 1999; LEE et al., 2000; PARK et al., 2003) and ion channels have been identified as receptors for ACh. The ion channels are assumed to consist of five subunits, which are arranged around an ion-pore (MARTIN et al., 2002). Dependent on their affinities, receptors are classified in L-, B-, and N-subtypes. L-subtype receptors have the highest affinity to levamisole, whereas B-type receptors bind bephenium and N-type receptors are sensitive to nicotine (MARTIN et al., 2005). The termination of action is mediated by acetylcholine esterase, which hydrolyzes ACh. The degradation products can be recycled (RAND, 2007). In flatworms, ACh is known to act as an inhibitory transmitter (RIBEIRO et al., 2005).

3.6.1.2 Glutamate As in vertebrates, the main transmitter for rapid excitatory synaptic signaling in nematodes is glutamate. The excitatory action of glutamate in vertebrates is mediated by ionotropic and metabotropic glutamate receptors (NAKANISHI et al., 1998). In C. elegans at least ten subunits of excitatory ionotropic glutamate receptors have been identified, indicating that a number of different functional types of ionotropic glutamate receptors might be expressed in the worm. The other group of receptors known in vertebrates, the metabotropic glutamate receptors, are GPCRs. Recently, three genes for metabotropic glutamate receptors have been identified in C. elegans (DILLON et al., 2006). Another target for glutamate in nematodes are glutamate-gated chloride (GluCl) channels, which are unique to invertebrates. Contrary to the excitatory ionotropic and metabotropic glutamate receptors GluCl channels mediate an inhibitory effect of glutamate by forming channels for

28 Literature chloride ions (BROCKIE and MARICQ, 2006). In Xenopus oocysts expressed homomers of GluCl channel subunits show different binding capacities, depending on the subunits expressed: GluClα 1 homomeric channels are sensitive to the anthelmintic drug ivermectin but not to glutamate, whereas GluClβ homomeric channels react to glutamate but not to ivermectin (CULLY et al., 1994; CULLY et al., 1996). DENT and coworkers (1997) identified the alternatively spliced subunits GluClα 2A and GluClα 2B. Homomeric channels of these subunits are ivermectin and glutamate sensitive. Another subunit in two splicing variants, GluClα 3A and GluClα 3B, has been identified later by the same group. Only simultaneous mutations of the three genes for GluClα 1, GluClα 2, and GluClα 3 leads to highly resistant animals, mutations of only two of these genes in C. elegans confers only modest or no resistance (DENT et al., 2000). In C. oncophora and H. contortus orthologous genes for GluClα 3 and GluClβ have been identified (CHEESEMAN et al., 2001; NJUE and PRICHARD, 2004). In expression studies of these genes amplified from ivermectin-susceptible and ivermectin-resistant C. oncophora in Xenopus oocysts, a single mutation was identified to confer resistance to ivermectin (NJUE et al., 2004). In nematodes the channels are assumed to consist of five subunits, but the composition is still unknown (MARTIN et al., 2002). Ivermectin-sensitive channels were shown to be expressed in the pharynx of nematodes (DENT et al., 1997; LAUGHTON et al., 1997).

3.6.1.3 GABA

γ-aminobutyric acid (GABA) is an inhibitory transmitter in mammals. The receptors for

GABA are GABAA, a chloride channel, and GABAB, a GPCR. Genes for both are also found in the genomes of nematodes, and GABAA receptors have also been shown to be targets for GABA in nematodes (SCHOFIELD et al., 1987). The activation of

GABAA receptors leads, depending on the intracellular chloride concentration, to the influx or efflux of chloride ions and therefore to membrane hyperpolarization or depolarization. In both cases body muscle contraction is inhibited (reviewed in

JORGENSEN, 2005). GABAB GPCRs mediate an inhibition of membrane excitability by opening potassium (K+) channels and inhibiting Ca2+ channels (KAUPMANN et al., 1997). Recently an excitatory effect of GABA was discovered in C. elegans. The mechanism involves a cation-selective channel, and the influx of sodium ions causes Literature 29 contraction of the enteric muscles (BEG and JORGENSEN, 2003). GABA is cleared from the synaptic cleft by a plasma membrane transporter (SCHUSKE et al., 2004).

3.6.1.4 Dopamine In mammals the known dopamine receptors are GPCRs. They are classified as D1- and D2-like receptors. D1-like receptors couple positively to adenylate cyclase and therefore increase the level of cyclic adenosine monophosphate (cAMP), whereas D2-like receptors inhibit cAMP formation. Nevertheless, additional second messengers and effector pathways are also recognized (NEVE et al., 2004). In C. elegans four GPCRs for dopamine are currently known, two D1-like and two D2-like receptors (MCDONALD et al., 2006).

3.6.1.5 Serotonin Serotonin is a modulating transmitter in many physiological mechanisms in C. elegans. According to CARRET-PIERRAT (2006a), C. elegans has 3 – 8 GPCRs for serotonin, which have a predominantly neuronal expression. Another receptor is a serotonin-gated chloride channel (RANGANATHAN et al., 2000).

3.6.1.6 Octopamine and Tyramine C. elegans was further shown to have physiological processes modulated by biogenic amines other than dopamine and serotonin: octopamine and its biosynthetic precursor tyramine. In some nematode species octopamine is metabolized to noradrenaline, synephrine and epinephrine (FRANDSEN and BONE, 1988). The receptors for octopamine were predicted by database searches, but none have been definitively identified (KOMUNIECKI et al., 2004). Two GPCRs are known for tyramine (REX et al., 2004; REX et al., 2005).

3.6.1.7 Neuropeptides Neuropeptides are peptides acting as neuromodulators or neurotransmitters. They are the major class of transmitter compounds in nematodes. 75 % of the nerve cells in A. suum (BROWNLEE et al., 1996), and > 50 % in C. elegans (KIM and Li, 2004)

30 Literature were shown to express neuropeptides. Like other neurotransmitters they are highly specific in their action but have a much higher potency than many other transmitters. Their synthesis involves proproteins or precursors. The cleavage and posttranslational modification of the precursor molecules occurs in the endoplasmatic reticulum. The neuropeptides are then bound to a carrier protein and transported in vesicles through the Golgi complex to the nerve terminal. The release is, like the release of classical neurotransmitters, Ca2+-dependent. They are stored in vesicles different than those containing classical transmitters; a differential release is therefore likely possible and would be necessary for the modulating activities of neuropeptides on neurotransmitters. In the simple invertebrate polyp Hydra no transmitters other than neuropeptides have been identified, therefore, neuropeptides are thought to be the original transmitter molecules (BROWNLEE et al., 2000). In C. elegans the neuropeptides can be subdivided into three main classes: insulin-like peptides, neuropeptide-like proteins, and FMRFamide-like peptides. Some neuropeptide-like proteins are antimicrobial and are expressed in the hypodermis rather than in neurons. Their expression is induced upon bacterial or fungal infection (HUSSON et al., 2007).

FMRFamide-like peptides (FaRPs or FLPs) are the most complex group of neuropeptides known from metazoans. In free-living and parasitic nematodes these peptides are proposed to play a fundamental role (MCVEIGH et al., 2005). The name is derived from their similarity to a molluscan neuropeptide called FMRFamide, containing the sequence Phe-Met-Arg-Phe-NH2. FLPs contain the C-terminal tetrapeptide motif X-Xo-Arg-Phe-NH2, where X is any amino acid except cysteine and Xo is any hydrophobic amino acid except cysteine (MCVEIGH et al., 2006). In the snail Lymnaea stagnalis two groups of FMRFamide-like peptides are known, the N-terminally extended peptides and the tetrapeptides. They are derived from the same gene by alternative splicing. Only one tetrapeptide has been identified to date in nematodes: FIRFamide in A. suum. All other currently known FMRFamide-like peptides in nematodes are N-terminally extended peptides (BROWNLEE et al., 2000). FLPs differing in a single amino acid can have different receptors, leading to different actions (BOWMAN et al., 2002). Neuropeptides containing an RFamide motif are also known from mammals. Several FLPs in C. elegans are known to act via GPCRs (reviewed in MCVEIGH et al., 2006). Another mechanism of action Literature 31 appears to involve an FMRFamide-gated chloride channel (PURCELL et al., 2002). Termination of action occurs by enzymatic degradation. The examination of FLPs and their receptors is still ongoing. BROWNLEE and coauthors (2000) emphasize that in addition to the currently known FLPs in C. elegans and A. suum other FLPs might exist, which could be unique to parasitic nematodes. These FLPs need to be studied in the various parasitic species.

3.7 Control of Parasites

For the control of parasites in sheep and cattle several approaches are currently being pursued, e.g. grazing management, optimization of keeping and feeding conditions for the animals as well as breeding approaches to achieve nematode resistant animals. Vaccination strategies against gastrointestinal nematodes in ruminants are still under development. An overview of these control measures was recently given by STEAR (2007). Biological control with nematophagous fungi is also being explored. Nevertheless, the most important strategy is still anthelmintic treatment. Anthelmintic drugs interact with targets in the nematode that are either not present in the host or have lower affinities to the drugs. The major classes of anthelmintic drugs used in ruminants are benzimidazoles, macrocyclic lactones, and nicotinic agonists.

3.7.1 Benzimidazoles The first member of the class of benzimidazoles was thiabendazole; other commonly used members are fenbendazole, albendazole, and oxfendazole (UNGEMACH, 2003). Thiabendazole was shown to have anthelmintic activity in the early 1960s. The mechanism of action is the inhibition of polymerization of the nematode’s microtubules by binding to β-tubulin (LACEY, 1988). Microtubules are components of the cytoskeleton and contribute to the intracellular transport of nutrients and substrates. Inhibition of polymerization leads to depletion of ATP resources, exhausting the cells (UNGEMACH, 2003). The worm dies and can be expelled. As precursors of this group, the probenzimidazoles are used. They are metabolized to the active compounds by the host.

32 Literature

3.7.2 Nicotinic Agonists The group of nicotinergic agonists contains the imidazothiazoles, such as levamisole, and the tetrahydropyrimidines, such as pyrantel and morantel. Tetrahydropyrimidines and imidazothiazoles are ligands for ACh receptors and lead to membrane depolarization and therefore spastic paralysis of the worm (ECKERT et al., 2005). In higher concentrations the drugs inhibit the acetylcholine esterase (UNGEMACH, 2003). Additionally the drugs cause a flickering open-channel block. The binding site of the drugs is different from the binding site of ACh; the drugs are large cations that might block the cation-selective channel (MARTIN et al., 2002). Morantel induces the greatest block, since the channel possesses two binding sites for morantel (EVANS and MARTIN, 1996).

3.7.3 Macrocyclic Lactones Avermectins and milbemycins are macrocyclic lactones. The substances belonging to this class are fermentation products of the bacteria Streptomyces spp. or are semi-synthetic derivatives (CONDER, 2002). The first compound available was ivermectin, which was introduced into the market in 1980. The effect of macrocyclic lactones is a rapid paralysis of movement and pharyngeal pumping in the nematode.

The target molecules of avermectins and milbemycins are GABAA receptors and, even more importantly, GluCl channels, which are irreversibly opened. As described above, multiple forms of GluCl channels occur in nematodes, differential sensitivity to the current drugs is likely. Some of these receptors are expressed in the neuromuscular system (WOLSTENHOLME and ROGERS, 2005). In C. elegans channels consisting of different subunits are known, and composition may determine sensitivity to ivermectin.

3.7.4 Closantel Closantel is a salicylanilide, which is mainly used for the treatment of liver flukes. It is also effective against H. contortus in sheep. Salicylanilides uncouple oxidative phosphorylation in helminths. Due to its plasma-protein binding, closantel is not effective against non-bloodsucking trichostrongylids (CONDER, 2002; UNGEMACH, 2003). Literature 33

3.7.5 Piperazine

Piperazine, one of the oldest anthelmintics, acts at GABAA receptors as a GABA agonist, causing flaccid paralysis of the worm by opening chloride-ion channels (DEL CASTILLO et al., 1963; MARTIN, 1982; MARTIN, 1997).

3.8 Anthelmintic Resistance

According to PRICHARD and coworkers (1980) anthelmintic resistance “is present when there is a greater frequency of individuals within a population able to tolerate doses of compound than in a normal population of the same species and [resistance] is heritable.” It is most common in parasites with a direct life cycle and short generation periods (SANGSTER and DOBSON, 2002). Gastrointestinal nematodes in sheep were repeatedly reported to have developed anthelmintic resistance (GILL et al., 1991; JACKSON and COOP, 2000; KAPLAN, 2004; KOTZE et al., 2002; WAGHORN et al., 2006). In cattle nematodes resistance is currently less common. Nevertheless, in Argentina resistance to avermectins has been reported in C. oncophora, O. ostertagi, and Haemonchus placei. In O. ostertagi and H. placei an additional benzimidazole resistance was observed (MEJIA et al., 2003). In New Zealand resistance to ivermectin in cattle nematodes was found to appear in 82 %, resistance to albendazole in 60 % of 59 tested farms (JACKSON et al., 2006). Another study detected ivermectin resistant C. oncophora in all five farms tested, furthermore evidence for possibly emerging resistances in O. ostertagi and Trichostrongylus spp. (MASON and MCKAY, 2006). The economic impact of resistance is serious; in South Africa some sheep farmers were even forced to abandon sheep production (VAN WYK et al., 1989). No mechanism of resistance is completely understood, but some are partially known. SANGSTER and DOBSON (2002) classify the mechanisms of resistance as pharmacological and genetic. Pharmacological mechanisms are reduction of anthelmintic concentration and modification of the downstream cascade. Genetic mechanisms include alteration of genes, selective expression of a gene, increased expression of enzymes, and gene deletion. In H. contortus the best studied mechanism of resistance to benzimidazoles is mutation of the β-tubulin gene. Resistance to macrocyclic lactones in H. contortus and in C. oncophora may be related to mutations in the genes coding for glutamate

34 Literature

and GABAA gated chloride channel subunits. Another mechanism of resistance is the overexpression of P-glycoproteins as molecular transporters to pump the compound out of the cells. The alteration of ACh receptors is thought to be the background for resistance to levamisole, but no molecular evidence yet exists (mechanisms reviewed by WOLSTENHOLME et al., 2004). Alteration of the target may not only occur by mutation but also by alteration in phosphorylation (MARTIN et al., 2002). Reversion of resistance is partially possible but occurs slowly. If the population is re-exposed to the anthelmintic, resistance reappears within a generation or two, because the resistance alleles are still present in the population at a high frequency (SANGSTER and DOBSON, 2002).

3.9 Cyclooctadepsipeptides

Cyclooctadepsipeptides are a novel group of anthelmintically active compounds with a new mechanism of action. The first member of this class, PF1022 A, was discovered in the late 1980s.

3.9.1 PF1022 A The compound PF1022 A is a fermentation product of the fungus Mycelia sterilia. The fungus belongs to the microflora of the flower Camellia japonica (SASAKI et al., 1992). PF1022 A consists of four alternating residues of N-methyl-L-leucine and four residues of D-lactate or D-phenyllactate (see Figure 2). The substance was patented in 1990 by the Japanese company Meiji Seika Kaisha. The anthelmintic activity of PF1022 A was shown for several nematode species, e.g. H. contortus, the canine hookworm Ancylostoma caninum, and the bovine lungworm Dictyocaulus viviparus. Against Trichostrongylus colubriformis, a gastrointestinal nematode in sheep, the drug is moderately effective when orally applied (SAMSON-HIMMELSTJERNA et al., 2000).

3.9.2 Emodepside Emodepside is a semi-synthetic derivative of PF1022 A. It was patented in 1993 by Fujisawa Pharmaceutical (Japan), and further examined through a cooperation among Fujisawa Pharmaceutical, Meiji Seika Kaisha (Japan), and Bayer HealthCare Literature 35

(Leverkusen, Germany). Compared to PF1022 A, emodepside carries a morpholine ring at each of the two D-phenyllactic acids in para position (see Figure 2). The substance shows a broad anthelmintic spectrum, including the trichostrongylids H. contortus, O. ostertagi, and Cooperia spp., but also D. viviparus, Trichuris spp., A. suum, Toxocara spp., Parascaris equorum and, species-dependent, adult filarial nematodes. In contrast to PF1022 A, emodepside is also effective against Trichinella spiralis larvae in muscles (HARDER et al., 2003). Larval stages of the mouse nematode Heligmosomoides polygyrus and microfilariae of Brugia malayi and Litomosoides sigmoidontis are only partially affected by the drug, whereas other stages of the species are susceptible (HARDER and SAMSON-HIMMELSTJERNA, 2001; ZAHNER et al., 2001). In benzimidazole-, levamisole-, and ivermectin-resistant populations of H. contortus in sheep, as well as an ivermectin-resistant C. oncophora population in cattle, emodepside was shown to be fully active (SAMSON- HIMMELSTJERNA et al., 2005). A so far unknown mechanism of action was therefore proposed. In 2005 emodepside in combination with praziquantel was introduced into the market as a spot-on preparation for cats. The mode of action of cyclooctadepsipeptides in parasitic nematodes is not yet clarified in detail.

O O O O N N O O N O O O O O O O N N N N O O O O O O O N O N N O O O O O

PF1022 A emodepside

Figure 2: Chemical structure of PF1022 A and its derivative emodepside (modified after HARDER et al., 2005)

36 Literature

3.9.3 Cyclohexadepsipeptides Cyclohexadepsipeptides are an anthelmintically active group related to the cyclooctadepsipeptides. These substances were shown to have a strong anthelmintic activity against H. contortus (JESCHKE et al., 2005; JESCHKE et al., 2006).

3.10 Cyclooctadepsipeptides: Mechanism of Action

3.10.1 Involvement of the GABA System The activity of emodepside, formerly known as BAY 44-4400, is synergistically enhanced by piperazine (NICOLAY et al., 2000). The involvement of the GABA system in the mechanism of action of emodepside is therefore discussed.

3.10.2 Influence of Cyclooctadepsipeptides on Effects of Neurotransmitters The neuropeptide AF2 induces a biphasic muscle tension and increased cAMP levels in isolated A. suum neuromuscular strips. PF1022 A blocks or reverses the muscle tension, while the increase of cAMP remains unaffected (THOMPSON et al., 2003). Emodepside irreversibly reduces the contraction of isolated neuromuscular strips induced by ACh or AF2, in contrast to the action of the inhibitory neurotransmitter GABA, the relaxation is slow and incomplete. The inhibitory effect of the neuropeptide PF 2 is similar to the effect of emodepside on the neuromuscular strips. The electrophysiological response to emodepside is very similar to the response to PF2 (WILLSON et al., 2003).

3.10.3 Effects of Emodepside on C. elegans In experiments with A. suum emodepside causes muscle relaxation by membrane hyperpolarization. Functional studies by WILLSON and colleagues (2003) indicate that the action is presynaptically mediated. The effect of emodepside on neuromuscular strips is enhanced in low external potassium and abolished by blocking potassium channels. The presence of external Ca2+ ions is required for the action of emodepside. This need for Ca2+ ions might be due to the role of calcium in activating calcium-gated potassium channels or in neurotransmitter release. The Literature 37 authors suggest the release of inhibitory neurotransmitters. This suggestion is consistent with the theory of a GPCR being involved (see 3.10.4 and 3.10.5). Furthermore, emodepside decreases the rate of pharyngeal pumping and inhibits locomotion and egg laying behaviour in adults (WILLSON et al., 2004a). BULL and coworkers (2006) examined the phenotypic effects of emodepside on C. elegans in detail. The inhibitory effect of emodepside on locomotion shows two phenotypes: the inability of worms to perform sinusoidal body bends and reduced overall movement of the worm. These effects mainly occur in adults; L4 also show reduced sinusoidal body bends but are still able to move. They are unable to flex the anterior part of the body, movement being restricted to the posterior body region. The reason for the different effects on adults and L4 remains unclear. Differences in expression of proteins involved in the mechanism of action and differential permeability of the cuticle are discussed. The presence of emodepside retards the larval development of C. elegans, but it has no impact on hatching. The reason for not affecting hatching might also be due to impermeability of the egg shell or differentially expressed receptors or proteins involved in the signaling cascade. Another key finding of BULL (2006) was that the egg-laying behaviour is affected by emodepside. Exposed hermaphrodites are bloated with unlaid eggs, and even larvae hatch inside the parent worm, indicating that egg production is not affected. The effect is not observed when the worms are exposed to emodepside only until early L4 stage.

3.10.4 Hc110-R A receptor for emodepside and PF1022 A has been identified in H. contortus (SAEGER, 2000; SAEGER et al., 2001). Based on its molecular weight of 110 kDa and the name of the organism from which it was derived, the receptor was called Hc110-R. The physiological function of Hc110-R is still unknown. The receptor belongs to the GPCR family 2 and possesses an extracellular N-terminus, seven transmembrane helices, and an intracellular C-terminus (see Figure 3). The binding site for emodepside and PF1022 A is located on the N-terminus. The exact position of the binding site remains to be clarified. The receptor has structural similarity to mammalian latrophilins. Like these GPCRs in mammals, the nematode receptor binds α-latrotoxin (α-LTX), a component of the black widow spider venom (see 3.11). In single cell assays the receptor mediates an influx of Ca2+ ions into

38 Literature

Hc110-R transfected HEK-293 cells in response to a stimulus of 75 nM α-LTX. The N-terminus of Hc110-R was expressed in E. coli as a recombinant protein, 445 amino acids in length. In On-Blot binding and ligand precipitation assays, this recombinant protein specifically bound biotinylated PF1022 A and emodepside. The binding of α-LTX at the isolated N-terminus was also demonstrated in a renatured blot (SAEGER, 2000; SAEGER et al., 2001).

lectin SP NH 2 Binding region for T-rich α-latrotoxin and Cys-signature PF1022 A

4 Cys-region extracellular

plasma membrane

intracellular P-rich

PEST COOH

Figure 3: Schematic view of Hc110-R in plasma membrane (modified after SAEGER et al., 2001; HARDER et al., 2003)

3.10.5 Latrophilin-like Protein 1 in C. elegans In C. elegans a receptor similar to Hc110-R and mammalian latrophilins has been identified. The sequence was derived from the cosmid B0457.1. The amino acid sequence of the receptor was published as latrophilin-like protein 1 (LAT-1, gene annotation lat-1) (MASTWAL, S. S. et al., 2003a; MASTWAL, S. S. et al., 2003b). This nomenclature is used in this work as well. The receptor belongs to the GPCR family 2. lat-1 knockdown mutants of C. elegans are less susceptible to the nicotinic agonist levamisole and imipramine, a drug blocking the reuptake of serotonin. The mutants have an elongated period of gut peristalsis and a distended gut, leading to a constipated phenotype (MEE et al., 2004; WILLSON et al., 2004a). The expression pattern of LAT-1, studied by WILLSON and colleagues (2004a), differs between Literature 39 larval stages and adults. In larval stages LAT-1 is predominantly expressed in the muscles of the pharynx. Adults lack the expression in muscles but show expression of the receptor in anterior extrapharyngeal and pharyngeal neurons.

3.10.5.1 LAT-1 Mediated Effects of Black Widow Spider Venom MEE and coworkers (2004) examined the toxicity of black widow spider venom (BWSV) to C. elegans. They found that the microinjection of entire BWSV was toxic to the worms, whereas microinjection of 2 µM highly purified α-LTX had no toxic effect. The nematocidal component of the venom was shown to be a high molecular protein, putatively occurring as dimers. The group surmise the component to be the latroinsectotoxin ε (LIT-ε) of BWSV (see 3.11). The knockdown of the receptor using RNAi technology led to resistance of the worms to microinjection of BWSV. Therefore, the receptor is regarded as the latrophilin homolog in C. elegans, since it is required for toxicity of BWSV.

3.10.5.2 LAT-1 Mediated Effects of Emodepside WILLSON and colleagues (2004a) examined LAT-1 for its involvement in the mode of action of emodepside in C. elegans. lat-1 RNAi treated (knockdown) animals were examined. The mutants had a prolonged duration of pharyngeal pumping and a constipated phenotype. The pharyngeal pumping of these animals was resistant to emodepside, whereas the inhibitory effect on locomotion remained. Therefore, the involvement of other receptors is discussed.

Furthermore, animals carrying a deletion in lat-1 were examined. The putative lat-1 knockout mutants were, however, subsequently identified to be not homozygous for the deletion and to be able to lose the deletion but to remain emodepside resistant. The authors emphasize that the results for the lat-1 knockdown mutants and for knockout mutants for other genes (see 3.10.5.3) are not affected by this finding (WILLSON et al., 2004b).

40 Literature

3.10.5.3 The Signaling Cascade Mediated by LAT-1 WILLSON and coworkers (2004a) examined the mode of action of emodepside mediated by LAT-1. Knockout mutants for several genes were resistant to the effects of emodepside on pharyngeal pumping. Therefore, the proposed signaling cascade includes the G-protein Gαq (egl-30), phospholipase Cβ (PLC-β, egl-8), and UNC-13 (unc-13). UNC-13 is a presynaptic receptor for diacylglycerol (DAG) and mediates the release of neurotransmitters from synaptic vesicles in C. elegans (RICHMOND et al., 1999). The amino acid sequence of UNC-13 contains four domains classified as protein kinase C conserved regions. The knockout mutants for lat-1, egl-8, and egl-30 showed a similar degree of resistance to emodepside, whereas the unc-13 knockout was approximately five times more resistant. Animals lacking snb-1, the gene for synaptobrevin, were also less susceptible to emodepside. Synaptobrevin is one of the key proteins for the fusion of membranes. It is found on the surface of synaptic vesicles and is involved in the release of transmitters (STRYER, 1995a). Synaptobrevin interacts with syntaxin and SNAP-25 forming the SNARE-complex (SNARE-complex: soluble N-ethylmaleimide-sensitive fusion protein attachment receptor complex), which mediates the fusion of the vesicle membrane with the presynaptic membrane (CHEN and SCHELLER, 2001). The described cascade (see Figure 4) is consistent with the phosphoinositide signaling pathway of other known GPCRs (STRYER, 1995b). A cascade including egl-30, egl-8, unc-13, and DAG was previously described for ACh release in C. elegans (LACKNER et al.,

1999). A knockout mutant for Gαo, a G-protein known to act antagonistically to Gαq in the body wall neuromuscular junction, was shown to be hypersensitive to emodepside.

Literature 41

GPCR lat-1

activates

Gq-protein subunit α (Gαq) egl-30

activates

phospholipase C β egl-8

phosphatidylinositol-4,5-

bisphosphate (PIP2)

inositol 1,4,5- diacylglycerol

trisphosphate (IP3) (DAG)

opens activates

Ca2+ channels DAG receptor unc-13

increases activates

intracellular [Ca2+] synaptobrevin snb-1

transmitter release

Muscle paralysis

Figure 4: Schematic diagram of the LAT-1 driven phosphoinositide signaling pathway in C. elegans. Modified from HARDER (2005) and STRYER (1995b)

42 Literature

3.10.6 Latrophilin-like Protein 2 in C. elegans In C. elegans another receptor of the GPCR family 2 showing similarity to mammalian latrophilins is known, the latrophilin-like protein 2 (LAT-2) (MASTWAL, S. S. et al., 2003c). The receptor has a sequence identity of 20 % and structural similarities with LAT-1. The sequence was derived from the cosmid B0286.2. The same groups interested in LAT-1 examined LAT-2 for its involvement in mediating the effects of the drugs known to act on LAT-1. LAT-2 knockdown mutants showed no altered susceptibility to BWSV. LAT-2 is therefore not regarded as a receptor for BWSV (MEE et al., 2004). Animals not expressing LAT-2, either due to a gene deletion or to lat-2 RNAi treatment, were resistant to the effects of emodepside on locomotion. Participation of this receptor in mediating the effects of emodepside is therefore discussed (WILLSON et al., 2004a).

3.11 Black Widow Spider Venom and α-Latrotoxin

The venom of black widow spiders, Latrodectus spp., contains five insecticidal toxins, the latroinsectotoxins (LIT) α, β, γ, δ, and ε. Additional components are α-LCT, a substance toxic to crustaceans, and α-LTX (KRASNOPEROV et al., 1990a; KRASNOPEROV et al., 1990b). α-LTX is the only component of the venom that not only acts on invertebrates but also on mammalian presynaptic vesicles, inducing massive release of neurotransmitters (KNIPPER et al., 1986). α-LTX is a protein with a molecular weight of 130 kDa. It is able to form pores in the membrane (FINKELSTEIN et al., 1976) and also acts at receptors. The formation of pores is performed by tetramers (ASHTON et al., 2000; ORLOVA et al., 2000). The first identified receptor in mammals was neurexin, which requires the presence of extracellular Ca2+ (USHKARYOV et al., 1992). Receptors independent of extracellular Ca2+ were identified nearly simultaneously by two groups (DAVLETOV et al., 1996; KRASNOPEROV et al., 1997). The receptors were called Ca2+ independent receptor for LTX (CIRL), or latrophilins. Mutant latrotoxin (LTXN4C) does not form pores but stimulates the receptors, indicating that the receptor-mediated effects do not depend on pore formation (VOLYNSKI et al., 2003). A third target is the receptor-like protein tyrosine phosphatase σ; binding of α-LTX induces neuronal exocytosis (KRASNOPEROV et al., 2002). Literature 43

3.12 Mammalian Latrophilins

Mammalian latrophilins (LPH) are GPCRs. Although the group of receptors has been intensively studied, the endogenous ligand is still unknown. The receptors belong to GPCR family 2. Three homologous proteins have been reported in cattle (Bos taurus), LPH-1, LPH-2, and LPH-3. LPH-1 from cattle and rat (Rattus norvegicus) are 99.4 % identical, whereas the three bovine LPH have an amino acid sequence identity of 70 – 75 % with each other. The three LPH have differential tissue distributions: LPH-1 and LPH-3 are almost exclusively brain-specific, whereas LPH-2 is abundantly distributed (MATSUSHITA et al., 1999). LPH-1, LPH-2, and LPH-3 have also been identified or predicted in other mammals. LPH-1 has the highest binding affinity for α-LTX (ICHTCHENKO et al., 1999). It interacts with the G-proteins Gαq and Gαo and activates the phosphoinositide signaling pathway, including phospholipase C and IP3. The effect of α-LTX therefore depends on intracellular Ca2+ (ASHTON et al., 2001; RAHMAN et al., 1999). LAJUS and coworkers (2006) describe the ionic events after applying α-LTX to occur in two phases. Phase I includes oscillatory membrane depolarizations and calcium spikes. This phase is independent of pore formation and involves inhibition of BK-type potassium channels. Phase II results in large and mixed membrane conductances. Phase II is not observed using LTXN4C and is therefore regarded as a result of pore formation. In experiments with MIN6 β-cells (mouse insulinoma cells), a cell line expressing endogenous LPH, the group provoked outward potassium currents by applying repeated depolarizing voltage stimuli. Such outward potassium currents are inhibited by the addition of LTXN4C, the amplitude of the potassium currents is reduced. Specific inhibition of BK-type potassium channels using iberiotoxin results in a similarly reduced amplitude of potassium channels. The addition of LTXN4C to the cells in presence of iberiotoxin induces no further reduction of the amplitude of potassium currents. The results indicate that LTXN4C inhibits potassium channels of the BK-type. Furthermore, the influx of calcium induced by LTXN4C is completely inhibited by inhibitors of L-type-calcium channels and an inhibitor for phospholipase C. Inhibitors for the protein kinase C reduce the calcium influx.

44 Literature

3.13 Potassium Channels

Potassium channels are formed by homo- or heteroformation of α subunits or association with cytoplasmic β subunits. α subunits contain two (2 TM), four (4 TM) or six (6 TM) transmembrane helices. 4 TM group members have two pore-forming P domains per subunit, whereas the other groups have only one (WEI et al., 1996). While 4 TM channels consist of two subunits, 2 TM and 6 TM channels, i.e. channels formed by subunits with a single pore-forming P domain, are composed of four α subunits. Hence, each channel possesses four pore-forming domains Within the 6 TM group there are three types of Ca2+-activated potassium channels: large conductance (BK), intermediate conductance (IK), and small conductance (SK) channels. The channels are regulated by voltage and Ca2+ stimuli.

3.13.1 BK-type Potassium Channels BK-type potassium channels, also called maxi-K channels, belong to the SLO family channels (SALKOFF et al., 2006). The first and eponymous calcium-gated potassium channel of the SLO family was identified in the slowpoke mutant of Drosophila melanogaster, a mutant exhibiting an unusual locomotor behaviour with uncoordinated moves and decreased flying ability (ATKINSON et al., 1991; ELKINS et al., 1986). This channel was called SLO-1. Orthologous channels of SLO-1 in mammals are well-studied. BK-type channels have two functional domains: a tail and a core. The tail senses intracellular factors and modulates the voltage range of activation. The core region determines voltage sensitivity (WEI et al., 1994). Contrary to their group annotation (6 TM), the α subunits of BK-type channels do not contain six TM helices, as initially thought, but seven TM helices, an extracellular N-terminus, and a large intracellular C-terminus (see Figure 5) (MEERA et al., 1997; WALLNER et al., 1996). In some tissues, mammalian BK-type channel α subunits interact with β subunits. Experimentally expressed homomeric β subunits of the bovine BK-type channel without coexpression of α subunits have no potassium channel function. Expression of the α subunit of this channel alone leads to qualitatively functional potassium channels, but only coexpression of α and β subunits results in channels with the biophysical and pharmacological properties of the endogenous channels in mammals (MCMANUS et al., 1995). The potential Literature 45 interaction with a β subunit seems to explain differences in channel gating in different tissues (SALKOFF et al., 2006).

NH2 extracellular

0 1 2 3 4 5 6

8 7 intracellular 10 9

COOH

Figure 5: Schematic view of a BK-type potassium channel (modified after MEERA et al., 1997). 0 – 8: core, 9 – 10: tail. 0: additional N-terminal transmembrane region S0, 1 – 3: transmembrane regions S1 – S3, 4: transmembrane region S4 carrying the voltage sensor, 5 – 6: transmembrane regions S5 – S6 flanking the potassium pore, 7: regulator of conductance of K+ (RCK) 1, 8: RCK 2, 9 – 10: calcium bowl

3.13.2 The Potassium Channel SLO-1 in C. elegans In C. elegans the potassium channel SLO-1 has been identified, showing high levels of identity with SLO family channels of Drosophila spp. and mammals. SLO-1 plays a major role in presynaptically modulating and regulating neurotransmitter release in C. elegans. SLO-1 is expressed in the nervous system, including the pharyngeal nerve ring and the nerve cord, as well as in the body wall and the vulval muscle (WANG et al., 2001). Expression in the muscle was observed in the M-line and in the Z-line of striated muscles of C. elegans (CARRE-PIERRAT et al., 2006b). WANG and coworkers (2001) hypothesize that SLO-1 is activated by voltage-gated calcium channels, which trigger the release of neurotransmitters. The activated SLO-1 then terminates the release and repolarizes the neuron. SLO-1 is the target molecule for ethanol in C. elegans, and activation causes inhibition of neuronal activity. Mutants with a gain of function regarding SLO-1 are affected in locomotory and egg-laying behaviour (DAVIES et al., 2003). slo-1 mutants and egl-30 mutants are highly resistant to halothane, a volatile anaesthetic. The mechanism of this resistance

46 Literature seems to be an increased level of excitatory neurotransmitter release (HAWASLI et al., 2004). The group of HOLDEN-DYE observed slo-1 knockout mutants to be resistant to emodepside (personal communication Lindy Holden-Dye, School of Biological Sciences, Southampton). This observation might potentially be consistent with the involvement of BK-type potassium channels in the mechanism of action of α-LTX, as described for mammalian LPH and LTXN4C (LAJUS et al., 2006).

3.13.3 The Potassium Channel SLO-2 in C. elegans A second BK channel, SLO-2, has been identified in C. elegans. SLO-2 shows general structural similarities with SLO-1, but the sequence identity is low (LIM et al., 1999; YUAN et al., 2000). It is a potassium channel widely expressed in neurons and muscles and is dependent on chloride in addition to calcium (YUAN et al., 2000). The physiological function of SLO-2 is still unknown.

Literature 47

3.14 Real-time PCR

The method of choice for quantification of nucleic acids is real-time PCR. In contrast to conventional PCR the amplification is measured and reported proportionally and in real time. As template, genomic DNA or cDNA can be used, or, in reverse transcription real-time PCR, RNA. In reverse transcription real-time PCR a transcription step is performed before the actual real-time PCR run is started. The choice of primers for cDNA synthesis is crucial for exact determination of the amount of target RNA. The use of random hexamer primers and specific hexamers can lead to 4 – 19 x overestimation compared to the use of a specific 22-mer primer due to unspecific binding of the shorter primers (ZHANG and BYRNE, 1999).

3.14.1 Detection of PCR Products Detection relies either on the nonspecific intercalation of a fluorescent dye, such as SYBR Green, with double-stranded DNA (WITTWER et al., 1997), or on hybridization with a specific probe. The use of probes has the advantage that only specifically amplified DNA is detected, so the reaction is less susceptible to errors due to contamination or unspecific amplification. The probe is complementary to a sequence between the primer sequences and carries a donor and a quencher fluorescence dye. The underlying principle of detection based on probes is that the fluorescence of the donor is absorbed by a quencher. The principle is called fluorescence resonance energy transfer (FRET) (HIYOSHI and HOSOI, 1994). When the quencher dye is in the vicinity of the donor dye, the energy of the irradiated donor is transferred to the quencher rather than being released as fluorescence of the donor dye. Quencher molecules that emit energy as heat are called dark quenchers. Other quenchers emit the energy as fluorescence at another, usually longer, wavelength that is not detected in the assay. The fluorescence remains as weak background fluorescence. When the two dyes are separated, the donor dye fluoresces. Currently several types of probes are available, the most commonly used being TaqManTM probes. TaqManTM probes are linear probes with a maximum length of 30 bp with, most often, the donor at the 5’ end and the quencher at the 3’ end. 30 bp, which are approx. 100 Å in length, is the maximum distance between the fluorophores for effective quenching. When the probe binds to its target, the amplicon, the probe is degraded

48 Literature by the 5’ – 3’ exonuclease activity of the Taq polymerase. The probe fragments dissociate from the amplicon, the fluorophores are now separated, and the donor fluoresces (HOLLAND et al., 1991). Other probes are structured probes, e.g. Molecular Beacons. Molecular Beacons consist of a stem-loop structure, with the loop complementary to the target sequence of the amplicon, and the stem formed by flanking sequences complementary to each other. The fluorophores are attached to the ends of the stem-forming arms and are therefore in close proximity for allowing FRET. During denaturation the stem opens and the probe fluoresces. During the annealing step it binds to the target sequence and continues fluorescing, unbound probes stop fluorescing. Binding to the target is thermodynamically more stable than the hairpin structure when the target is exactly complementary to the probe sequence. If even one nucleotide is mismatched between the target and probe sequences, the probe will more likely form the hairpin structure. Therefore these probes are ideal for allele-specific PCR or for detection of single nucleotide polymorphisms (SNP) (BUSTIN and NOLAN, 2004).

3.14.2 Quantification of Template The detection of template nucleic acids occurs by the increasing fluorescence, caused by unquenched donor dye molecules. The fluorescence increases proportionally with the amplification of template, and the beginning of the exponential stage of amplification, which exceeds the background fluorescence, is reported as the threshold cycle (Ct). The larger the input of template, the earlier amplification reaches the exponential stage, and the Ct is accordingly lower. Since raw Ct data are exponential terms, they cannot be used to quantify and compare amounts of template directly (LIVAK and SCHMITTGEN, 2001). The most common approaches are absolute quantification using standard curves, or relative quantification, which compares the samples to a calibrator sample. For relative quantification often reference genes are analyzed, since they allow additional internal control for variations during the procedures. These reference genes ideally are unregulated genes, so-called house-keeping genes, and are therefore constitutively transcribed (MEIJERINK et al., 2001).

Literature 49

The most commonly used reference genes are β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hypoxanthine-guanine phosphoribosyl transferase (HPRT), and 18 S ribosomal RNA (18 S rRNA) (DHEDA et al., 2005). In real-time PCR experiments with parasitic nematodes RNA polymerase subunit II, β-tubulin, elongation factor 1α, and actin were previously used (ABOOBAKER and BLAXTER, 2003; DE MAERE et al., 2005; STEPEK et al., 2004; STRUBE et al., 2007; TRIVEDI and ARASU, 2005). TRIVEDI and ARASU (2005) evaluated the utility of several genes as reference genes in several developmental stages and strains of the canine hookworm A. caninum. They found the 60 S acidic ribosomal protein gene to be a suitable reference gene for real-time analysis of A. caninum and related nematodes. In O. ostertagi the 60 S acidic ribosomal protein gene (National Center for Biotechnology Information (NCBI) Accession Number (Acc. No.) AF052737) was identified in a reverse Northern blot, i.e. blotting PCR-derived probes with sample cDNA, at a similar level of transcription in L2, L3, and adult worms (MOORE et al., 2000). 18 S rRNA is abundant in vertebrate tissues and is used as one of the classical reference genes in vertebrates. It is a suitable reference gene in rats due to its consistent expression levels, especially when cDNA synthesis is performed with 18 S ribosomal RNA-specific primers instead of oligo-(dT)-primers (ZHU and ALTMANN, 2005). 18 S rRNA was also shown to be less affected by conditions altering the mRNA levels in cell cultures (SCHMITTGEN and ZAKRAJSEK, 2000). 18 S rRNA was recently rejected as a reference gene in cattle due to its high abundance. The authors do not specify whether specific, random, or oligo-(dT)-primers were used for reverse transcription (ROBINSON et al., 2007).

Objectives 51

4 Objectives

Trichostrongylids in ruminants are a severe economic problem in the livestock industry. Control of parasitic nematodes is currently mainly achieved using anthelmintic drugs. The main classes of anthelmintic drugs were introduced into the market several decades ago and have been used for many years on a large scale. In several nematode species resistance has arisen, e.g. in the barber pole worm of sheep, H. contortus, but also in some cattle nematode species. In the late 1980s a new class of anthelmintically active compounds was discovered, the cyclooctadepsipeptides. The first member of this class was PF1022 A. The semisynthetic derivative emodepside was introduced into the market in 2005 in combination with praziquantel as a spot-on preparation for cats. The mechanism of action of cyclooctadepsipeptides in parasitic nematodes remains to be clarified in detail, but since emodepside is effective in parasites resistant to other anthelmintic drugs, the mechanism seems to differ from the known pathways of action. To know the mechanism of action helps to adapt anthelmintic substances to their target more exactly and to examine the molecular basis of potentially arising resistance. In H. contortus a G-protein coupled receptor for emodepside has been identified. This receptor was named Hc110-R. Hc110-R also showed binding affinities to α-latrotoxin, a component of the venom of black widow spiders. The studies of binding affinities were carried out on the isolated N-terminus expressed in E. coli and on eukaryotic cells expressing the complete receptor. In the model organism C. elegans a putative ortholog, LAT-1, was identified as a target for emodepside. The signaling cascade was shown to follow the phosphoinositide pathway. Since knockdown mutants for this receptor were not completely resistant to the effects of emodepside, the involvement of other receptors was postulated. In particular, an ortholog of LAT-1, namely LAT-2, was suggested as a potential candidate. The major aim of this study was to identify orthologs of Hc110-R and LAT-1 in the cattle trichostrongylids C. oncophora and O. ostertagi. Once identified, expression of their N-termini and their functional analysis was planned as well as investigation of transcription levels. Another aim was to identify further potential targets for emodepside in parasitic nematodes.

Material and Methods 53

5 Material and Methods

5.1 Maintenance and Collection of Parasites

5.1.1 Haemonchus contortus Sheep were infected with 6000 – 8000 L3 of H. contortus. The sheep were treated with levamisole (7.5 mg / kg) or ivermectin (0.2 mg / kg) before being infected to exclude prior infections with parasitic nematodes. The nematode strains were the McMaster isolate and the ISE strain, both susceptible to the main classes of drugs. The McMaster strain is an inbred strain maintained for > 50 years in laboratory culture without exposure to anthelmintics (GILL et al., 1991; KOTZE et al., 2002). The ISE isolate is a benzimidazole-susceptible strain going back to the SE strain maintained since the late 1950’s in laboratory culture in Edinburgh (ROOS et al., 2004). The ISE strain is the strain currently being used in the H. contortus genome project of the Sanger Institute (personal communication Frank Jackson, Moredun Research Institute, Edinburgh).

5.1.2 Cooperia oncophora and Ostertagia ostertagi Calves with a body weight of about 100 – 200 kg were infected with 30 000 L3 of C. oncophora or O. ostertagi. Prior to infection the calves were treated with albendazol (7.5 mg / kg body weight) to exclude possible prior infections with parasitic nematodes. The nematode strains were kept in laboratories for several generations and were previously shown to be susceptible to the main classes of drugs.

5.1.3 Collection of Adult Nematodes After prepatency of ca. 18 – 21 days, faeces were examined to confirm that the infection was established and to estimate the number of nematode eggs. Faeces were also collected for larval cultures. Approximately 4 – 5 weeks after infection, the animals were slaughtered and the abomasum or the small intestine was removed. The organs were opened and the parasites were either picked directly or washed off and collected from the washing water. The nematodes were sexed, washed firstly in

54 Material and Methods ice-cold 0.9 % NaCl and afterwards in DEPC-water. They were stored either singly or in bulks of 10 – 30 individuals in RNase-free tubes at – 80° C. Worms used for real-time PCR were stored in 500 µl GIT buffer.

5.1.4 Collection of Eggs Faeces containing eggs of parasites were homogenized in tap water. Big particles were removed by rinsing the homogenate through a 200 µm mesh sieve. The eggs were then accumulated by rinsing the filtrate through a 20 µm mesh sieve. The contents within the sieve were transferred to centrifuge buckets and centrifuged for 5 min at 380 x g. The supernatant was discarded. The buckets were filled with saturated sodium chloride (NaCl) solution and centrifuged for 5 min at 170 x g to float the eggs. The supernatant was sieved again through a 20 – 25 µm mesh sieve to retain the eggs, and the salt was washed out with tap water. The eggs were further purified by a gradient of differently concentrated and stained sucrose solutions. The gradient was layered into a Falcon tube as follows: 10 ml 10 % sucrose solution (yellow) were underlayered with 10 ml 25 % sucrose solution (red). 10 ml of 40 % sucrose solution (blue) were then carefully pipetted below the lowest layer (red). The washed nematode eggs were carefully added onto the top of the gradient. The sample was centrifuged for 5 min at 380 x g. The nematode eggs were, depending on their number, now visible as a milky layer between the 10 % and the 25 % sucrose solutions. The eggs were extracted by a glass Pasteur pipet and transferred into a Falcon tube. They were washed then in a 20 µm mesh sieve in tap water to remove the sugar. The eggs were aliquoted into 2 ml tubes and centrifuged at 16 000 x g and room temperature (RT) for 5 min. The tap water was replaced by DEPC water, and the eggs were washed 3 X by resuspending in fresh DEPC water and centrifuging at 16 000 x g for 5 min. Three aliquots of 10 µl each of the last resuspension were counted under the microscope to determine the number of eggs per tube. The eggs were stored without liquid or in 500 µl GIT buffer at – 80° C.

5.1.5 Collection of Larvae To collect larvae, faeces containing eggs were cultured. Bovine faeces were mixed with sawdust to bind excess moisture, whereas ovine faeces were only broken up. Glass jars were half filled with faeces, covered and incubated at 26° C and 70 – 80 % Material and Methods 55 humidity. For cultures of L1 / L2 larvae the incubation time was 2 days, for L3 cultures 7 – 8 days. After incubation, the glass jars were filled with tap water and covered with a glass Petri dish. The glass was inverted and the Petri dish filled with tap water. During the next 12 – 24 h the larvae wandered into the water and gathered in the Petri dish. The next day they were collected. The larvae were further purified using a modified Baermann funnel: the larvae were poured into a sieve, which was covered with 3 – 5 layers of gauze and placed into the funnel. The larvae had to wander actively through the meshes and therefore left the contaminating particles behind. 12 – 18 h later the larvae were collected and microscopically examined. The L1 / L2 were examined for the missing sheath, which differentiates them from L3; L1 / L2 and L3 were examined for the absence of contaminating species. The larvae were aliquoted in tubes and centrifuged at 16 000 x g for 5 min, then washed and counted as described above for the eggs (5.1.4). The larvae were resuspended and lysed in 500 µl of GIT buffer, then stored at – 80° C.

5.2 Mammalian Tissue

Mammalian tissue for RNA isolation was taken from freshly euthanized animals from autopsies independent of this work. Animal material was collected from young beagles (liver, brain) and calves (liver). The tissue was frozen as quickly as possible and stored at – 80° C until use.

5.3 Isolation of RNA

For all handlings of RNA, RNase-free disposables were used.

5.3.1 Trizol® Method Total RNA was isolated using Trizol® reagent (INVITROGEN). Trizol® is a mono-phasic solution of phenol and guanidine isothiocyanate, the method is an improved variation of the phenol-chloroform extraction method (CHOMCZYNSKI and SACCHI, 1987). Samples of 1 to 10 worms were either mechanically homogenized in 1 ml Trizol® or, after lysis in 500 µl GIT buffer, mixed with 1 ml Trizol®, then vortexed. Samples of eggs and L1 / L2 needed no further homogenization, whereas L3 samples had to be homogenized with the TissueRuptorTM for 2 X 30 sec. After an

56 Material and Methods incubation of 5 min at RT, 200 µl chloroform were added, and the tubes were shaken vigorously for 15 sec. After 2 – 3 min incubation at RT, they were centrifuged at 12 000 x g and 4° C for 15 min. The aqueous layer was transfer red into a fresh tube. For precipitation of RNA, 500 µl of 100 % isopropanol and 5 µl glycogen solution (20 mg / ml) were added, and the sample was briefly vortexed. After 10 min incubation at RT the sample was centrifuged at 12 000 x g and 4° C for 10 min. The supernatant was discarded and the RNA pellet was washed by vortexing the sample briefly in 1 ml 75 % DEPC ethanol. The pellet was centrifuged at 7500 x g and 4° C for 5 min, and the ethanol was discarded. The washing step was repeated twice for samples destined for real-time PCR. The pellets were dried and resuspended in an appropriate volume of DEPC water, usually 7 – 12 µl. For small samples like single O. ostertagi worms, the volumes were reduced to 80 %, i.e. 800 µl Trizol®, 160 µl chloroform and so on. After precipitation of RNA the same volumes were used for washing and resuspension as for larger samples.

5.3.2 QuickPrepTM Micro mRNA Purification Kit The QuickPrepTM Micro mRNA Purification Kit (AMERSHAM) utilizes the fact that many eukaryotic mRNAs carry a poly-A tail, which may be caught by thymidine stretches. The binding between mRNA and carrier, in this method oligo-(dT)-cellulose, is quite strong, so the complex can be washed. Therefore the mRNA can be purified from DNA and proteins. Samples of 20 – 100 mg were homogenized mechanically by grinding under liquid nitrogen. The homogenate was resuspended in 400 µl Extraction buffer and mixed with 800 µl Elution buffer. The buffers were warmed to room temperature. For each sample 1 ml of oligo-(dT)-cellulose was transferred into a fresh tube, and both tubes, sample and oligo-(dT)-cellulose, were centrifuged at 16 000 x g for 1 min at RT. The supernatant from the oligo-(dT)-cellulose was discarded and replaced by the sample homogenate. After resuspending and gentle inversion of the tube for 3 min, the sample was centrifuged for 10 sec at 16 000 x g. The supernatant was discarded. The oligo-(dT)-cellulose, which was now carrying the mRNA, was washed 5 X with 1 ml High Salt buffer and centrifuged for 10 sec at 16 000 x g. After each washing step the buffer was replaced with fresh buffer. Then the sample was washed twice with Low Salt buffer in the same manner. After the last washing step the sample was Material and Methods 57 resuspended in 300 µl Low Salt buffer and transferred onto a column. The Low Salt buffer was discarded by centrifuging at 16 000 x g for 5 sec and replaced twice by 500 µl fresh Low Salt buffer, which was discarded after centrifugation at 16 000 x g for 5 sec as well. 200 µl of hot Elution buffer (65° C) were added and the sample centrifuged for 15 sec at 16 000 x g. This step was repeated. The eluate contained the mRNA, which was precipitated by adding 1 ml ice-cold 100 % ethanol and 10 µl glycogen (5 – 10 mg / ml) and 40 µl K acetate solution (2.5 M potassium acetate, pH 5.0). Precipitation took place overnight at – 80° C. The pellet was treated as described in 5.3.1.

5.3.3 Quantification of RNA The amount of isolated RNA was determined by measuring the Optical Density (OD) at wavelengths of 230 nm, 260 nm and 280 nm. 40 µg / ml of RNA give an OD260 of 1, therefore the following formula can be applied:

concentration in µg / ml = (OD260 x dilution factor x 40 µg / ml)

The ratio OD260 / OD280 gives information about contamination by proteins. For pure

RNA it is 1.8 - 2.1. The ratio OD260 / OD230 is another measurement of purity, mainly for detecting residual salt: the higher the amount of salt, the lower the ratio

OD260 / OD230. For pure RNA it is greater than 1.8. Measurements were performed on 1 – 2 µl of RNA either with a NanoDrop (undiluted) or GeneQuantPro spectrophotometer (1 : 50 diluted). Integrity of RNA was not further examined.

5.4 cDNA Synthesis

Reverse transcriptases are DNA polymerases, which use RNA as template and synthesize a complementary DNA (cDNA). These enzymes are specific features of retroviruses; those most commonly used in molecular biology are the reverse transcriptases of the avian myeloblastosis virus and of the Moloney murine leukaemia virus. In contrast to genomic DNA the cDNA contains no introns and therefore gives direct information about the protein sequence coded by the mRNA. For reverse transcription an Adapter Primer is used, which is the initiation point for

58 Material and Methods the reverse transcriptase. Usually this primer is an oligo-(dT) primer, which binds to the poly-A tail of an mRNA molecule. The yield of cDNA is dependent on the amount of the template RNA and the transcription efficiency. In this work, the yield was not further determined.

5.4.1 3’ RACE System for Rapid Amplification of cDNA Ends RACE is the abbreviation for Rapid Amplification of cDNA Ends. For the 3’ RACE System for Rapid Amplification of cDNA Ends (INVITROGEN) a volume of 11 µl of mRNA was mixed with 1 µl Adapter Primer and heated to 70° C for 10 min to melt the secondary structures of the RNA. The sample was chilled on ice for 1 min to allow primer annealing. For first-strand synthesis 2 µl 10 X PCR buffer, 2 µl MgCl2 (25 mM), 2 µl DTT (0.1 M), and 1 µl dNTP (10 mM) were added, the sample mixed and incubated at 42° C for 2 – 5 min. Then 1 µl Sup erScriptTM II Reverse Transcriptase was added and the sample incubated for 50 min at 42° C. The sample was heated to 70° C for 15 min and then chilled on ice. 1 µl RNase H was added to digest the RNA from the RNA-DNA-hybrids at 37° C fo r 20 min. The remaining nucleic acid was single stranded cDNA.

5.4.2 BD SMARTTM RACE cDNA Amplification Kit The BD SMARTTM RACE cDNA Amplification Kit (CLONTECH) provides not only the technique to produce 3’ cDNA with a known adapter sequence at the 3’ end, but also to obtain 5’ cDNA with an adapter sequence at the 5’ end. The adapter sequences can be used later as annealing sites for primers for PCR. The underlying principle for adding the adapter sequence is the so-called SMART (Switching Mechanism At 5’ end of RNA Transcript) technology (CHENCHIK et al., 1996; ZHU et al., 2001). The BD PowerScript Reverse Transcriptase adds 3 – 5 residues, mainly dCTP, to the 5’ end of the RNA. The BD SMART IITM A Oligonucleotide, containing three G at its 3’ end, anneals to this oligo-(dC) sequence. The reverse transcriptase switches the template from the RNA to the attached BD SMART IITM A Oligonucleotide primer (see Figure 6). The resulting cDNA is a complete copy of the mRNA molecule with the additional primer sequence.

Material and Methods 59

Figure 6: Mechanism of SMART™ cDNA synthesis. First-strand synthesis is primed using a modified oligo-(dT) primer. After reverse transcriptase reaches the end of the mRNA template, it adds several dC residues. The SMART IITM A Oligonucleotide anneals to the tail of the cDNA and serves as an extended template for PowerScript Reverse Transcriptase. Figure and text from the SMART™ RACE cDNA Amplification Kit User Manual (CLONTECH, 2006)

5.4.2.1 5’ RACE cDNA For synthesis of 5’ RACE cDNA 3 µl RNA were mixed with 1 µl 5’ RACE CDS primer, containing the oligo-(dT) sequence, and 1 µl BD SMART IITM A Oligonucleotide. In most cases total RNA was used. The sample was heated to 70° C for 2 min and then chilled on ice for 2 min. Then 2 µl First Strand buffer, 1 µl DTT (20 mM), 1 µl dNTP (10 mM), and 1 µl BD PowerScript Reverse Transcriptase were added. After incubation at 42° C for 90 min the sample was dilut ed with 125 µl TE buffer. The cDNA was stored in aliquots of about 45 µl at – 20° C.

5.4.2.2 3’ RACE cDNA For synthesis of 3’ RACE cDNA 4 µl RNA were mixed with 1 µl 3’ RACE CDS primer and incubated at 70° C for 2 min. Subsequent steps were as described for the 5’ RACE cDNA synthesis (5.4.2.1)

60 Material and Methods

5.5 Primer Design

Primers were usually designed based on known fragments of the desired genes, either derived by previous PCR work or by searches using the Basic Local Alignment Search Tool (BLAST) for searching databases for small sequence fragments from expressed sequence tags (EST). For some primers the exact sequence of the primer binding site within the respective gene of the examined species was not known. In these cases the sequences of other, related species were examined and primers positioned preferably within conserved regions. The primers were degenerate at positions at which the input sequences differed. Degenerate primers are a mix of primers mainly having the same sequence, but some primers contain other nucleotides at one or more positions compared to other primers of this mix, according to the differences of the input sequences. The probability that a primer within this mix binds to the target gene is dependent on the conservation of the input sequences compared to the sequence of the target gene. Routine primer selection was performed using the Primer Select Software, a part of the DNAStar Software package. For some primers the default settings had to be changed, especially regarding melting temperature and length. When the program was not able to locate primers, a lower internal stability or dimer formation setting had to be accepted. For RACE experiments, long primers (25 – 40 bp) were selected with a melting temperature as high as 63 – 72° C to ensure specifi city in PCR with only one gene-specific primer. Some primers, especially those with restriction sites, were designed manually. The melting temperature was determined by the Primer Select Software using the nearest neighbour method. The primers were produced by the custom primer service of INVITROGEN.

5.6 Polymerase Chain Reaction (PCR)

The Polymerase Chain Reaction (PCR) is a method to amplify specific DNA fragments. The specificity is mainly dependent on the primers, which anneal to the DNA and are then elongated by the DNA polymerase, and on the temperature during the annealing step. A typical PCR program included an initial denaturation period of 2 min at 95° C, and 20 – 45 cycles consisting of a step at 94° C for 20 sec for DNA denaturation, a primer annealing step at 50 – 70° C , dependent on the melting Material and Methods 61 temperature of the primers, for 30 sec, and an elongation step at 72° C, when the newly amplified DNA was elongated. The duration of elongation is dependent on the length of DNA to be amplified. For amplification of 1 kb, an elongation period of 1 min was calculated. The last step before chilling and end was a terminal elongation step of 72° C for 10 min to complete the generated DNA m olecules. PCR was mainly performed with one of two different polymerases, the Taq DNA Polymerase (QIAGEN) and the BD Advantage® 2 Polymerase Mix (included in the BD Advantage® 2 PCR Kit, CLONTECH). The reactions were prepared in a master mix when applicable. For each PCR a no-template control was included.

5.6.1 Qiagen Taq DNA Polymerase PCR sample size was 25 – 50 µl. Depending on the specificity of the PCR, additional

MgCl2 (25 mM) was added to a final concentration of 2.0 mM to 3.0 mM. The higher the MgCl2 concentration, the less specific the PCR. Setup for samples with a total volume of 25 µl:

Volume Final concentration

H2O variable, brings the final volume to 25 µl 10 X buffer 2.5 µl 1 X

MgCl2 (25 mM) 0.5 – 1.5 µl 2.0 mM to 3.0 mM Forward primer (50 µM) 0.15 µl 0.3 µM Reverse primer (50 µM) 0.15 µl 0.3 µM dNTP (10 mM each) 0.6 µl 240 µM Qiagen Taq DNA Polymerase (5 U / µl) 0.2 µl 1 U / reaction Template 1 µl

5.6.2 BD Advantage® 2 Polymerase Mix The BD Advantage® 2 Polymerase Mix (CLONTECH) is a mixture of a nuclease-deficient Taq DNA Polymerase and a minor amount of a proof-reading polymerase. It was used for long template amplification, for amplification of DNA to be cloned into expression vectors, and for all RACE applications. The sample size was usually 25 µl.

62 Material and Methods

Volume Final concentration

H2O variable, brings the final volume to 25 µl 10 X buffer 2.5 µl 1 X Forward primer (10 µM) 1 µl 0.4 µM Reverse primer (10 µM) 1 µl 0.4 µM dNTP (2 mM each) 0.6 µl 48 µM 50 X BD Advantage® 2 Polymerase Mix 0.2 µl 0.2 µl / reaction Template 1 µl

5.6.3 Rapid Amplification of cDNA Ends (RACE) For RACE the 50 X BD Advantage® 2 Polymerase Mix was used as well. Since the unknown cDNA ends are the aim of the PCR, only one gene-specific primer can be used. The other primer is the Universal Primer Mix (UPM), which is complementary to the adapted 3’ RACE CDS primer and the BD SMART IITM A Oligonucleotide (see 5.4.2), and can be used together with a gene-specific reverse primer for 5’ RACE and a gene specific forward primer for 3’ RACE. The usual sample size was 25 µl.

5.6.3.1 Setup for 5’ RACE Volume Final concentration

H2O variable, brings the final volume to 25 µl 10 X buffer 2.5 µl 1 X Universal Primer Mix A 2.5 µl 0.04 µM Long Universal Primer 0.2 µM Short Universal Primer Reverse primer (10 µM) 1 µl 0.4 µM dNTP (2 mM each) 0.6 µl 48 µM 50 X BD Advantage® 2 Polymerase Mix 0.2 µl 0.2 µl / reaction Template 1 µl Material and Methods 63

5.6.3.2 Setup for 3’ RACE Volume Final concentration

H2O variable, brings the final volume to 25 µl 10 X buffer 2.5 µl 1 X Universal Primer Mix A 2.5 µl 0.04 µM Long Universal Primer 0.2 µM Short Universal Primer Forward primer (10 µM) 1 µl 0.4 µM dNTP (2 mM each) 0.6 µl 48 µM 50 X BD Advantage® 2 Polymerase Mix 0.2 µl 0.2 µl / reaction Template 1 µl

5.6.3.3 PCR Program for RACE The cycler program for a RACE reaction was either a regular PCR program with an annealing temperature of 64° C or higher, or a touc hdown PCR. Touchdown PCR means that the annealing temperature is repeatedly lowered after a few cycles. A typical Touchdown PCR protocol used for this work was:

Initial denaturation 95° C 2 min Cycles 1 – 5: Denaturation 94° C 20 sec Annealing 72° C 30 sec Elongation 72° C 1 min / kb Cycles 6 – 10 Denaturation 94° C 20 sec Annealing 70° C 30 sec Elongation 72° C 1 min / kb Cycles 11 – 45 Denaturation 94° C 20 sec Annealing 68° C 30 sec Elongation 72° C 1 min / kb Terminal Elongation 72° C 10 min Chilling and end

64 Material and Methods

Some Touchdown PCRs had a final annealing temperature of 68° C, some went as low as 64° C, but the total cycle number never exce eded 45.

5.6.4 PhusionTM Hot Start DNA High-Fidelity Polymerase The proof-reading polymerase PhusionTM Hot Start High-Fidelity DNA Polymerase (FINNZYMES) was occasionally used.

Volume Final concentration

H2O variable, brings the final volume to 25 µl 5 X buffer 5 µl 1 X Forward primer (10 µM) 1 µl 0.4 µM Reverse primer (10 µM) 1 µl 0.4 µM dNTP (2 mM each) 0.6 µl 48 µM PhusionTM Hot Start DNA Polymerase 0.5 µl 1 U Template 1 µl

The PCR program had an initial denaturation and polymerase activation period of 1 min at 98° C. All further denaturation periods we re also performed at 98° C for 20 sec.

5.7 Analysis of PCR Products

The PCR products were analyzed by agarose gel electrophoresis. Usually the complete PCR reaction of 25 µl was mixed with 5 µl of 6 X Loading Dye, except when some of the product had to be kept for reamplification. The mixture was loaded onto an agarose gel of the desired concentration. Gels of 2 % were used for PCR products of an expected size of 100 bp or less, 1 % gels were used for amplicons of 100 – 800 bp, whereas products larger than 800 bp were run on a 0.5 % gel. The agarose gels contained GelStar® Nucleic Acid Gel Stain (CAMBREX) at a concentration of 0.1 µl / ml. To determine the actual size of the amplicons, a DNA ladder covering the expected range of size was run in the first lane of each gel. The gel was covered with 1 X TAE buffer in a gel electrophoresis unit. The applied Material and Methods 65 voltage was usually 95 – 105 V. After a running time of about 45 min the gel was examined on the UV transilluminator at a wavelength of 312 nm. The GelStar® Nucleic Acid Gel Stain intercalates with DNA, and this complex fluoresces when excited at 312 nm.

5.8 Isolation of DNA Bands

When a PCR resulted in a band of the desired size in the agarose gel, the band was excised from the gel using a scalpel blade. The piece of gel was centrifuged at 16 000 x g for 10 – 15 min. The liquid eluted from the gel was directly used for cloning, the gel was discarded.

5.9 Cloning of PCR Products

The isolated DNA bands were cloned into plasmids, which carry a gene for antibiotic resistance. The plasmids were then transformed into competent E. coli. Thus transformed bacteria can be selected by the appropriate antibiotic, whereas untransformed bacteria are unable to grow. Furthermore the plasmids contain a marker gene within the multiple cloning site which is inactivated when a PCR product is inserted. Therefore, bacteria transformed with plasmids containing an insert are not able to express the marker gene. This allows the identification of bacteria transformed with a plasmid without insert from those transformed with a plasmid with an insert. The ligation works due to A-overhangs at the 3’ end of PCR products, which are produced by Taq polymerases. The vectors have a T- or U-overhang, so the sticky ends of both DNA fragments will anneal to one another. The ligation is performed by a topoisomerase, a DNA ligase, which is covalently bound to the vector.

5.9.1 Ligation Using the TOPO TA Cloning® Kit for Sequencing The pCR® 4 TOPO vector, part of the TOPO TA Cloning® Kit for Sequencing (INVITROGEN), contains genes for resistance to kanamycin as well as ampicillin or carbenicillin. In the presence of these antibiotics, only bacteria containing a plasmid can grow. The marker gene in this vector is the ccdB-gene, which leads to the death of the bacteria if it remains uninterrupted by an insert. To ligate the DNA fragment

66 Material and Methods into the vector, 4 µl of DNA-containing liquid (5.8) were mixed with 1 µl Salt Solution and 1 µl vector. The ligation reaction was incubated for 20 min at RT.

5.9.2 Ligation Using the StrataCloneTM PCR Cloning Kit The pSC-A vector, a component of the StrataCloneTM PCR Cloning Kit (STRATAGENE), provides a resistance gene to ampicillin or carbenicillin. The plasmid contains the lacZ’ gene, which enables the bacteria to metabolize X-Gal to a blue dye. Inserting DNA into the multiple cloning site inactivates this gene. The colonies without an insert are therefore blue, when X-Gal was spread onto the plate (40 µl stock solution with a concentration of 40 mg / ml per plate), whereas the insert-carrying colonies stay white. For ligation 3 µl of StrataCloneTM Cloning buffer were mixed with 2 µl of DNA-containing liquid and 1 µl StrataCloneTM Vector Mix and incubated for 10 min at RT.

5.9.3 Ligation Using the QIAGEN® PCR Cloning Kit The pDrive Cloning vector is the vector included in the QIAGEN® PCR Cloning Kit. It carries a kanamycin and an ampicillin resistance gene. Screening is performed using the blue-white screening method, since the vector contains the gene for the α peptide of the β galactosidase, which completes the N-terminally truncated enzyme expressed by the cells. 50 M IPTG and 80 µg / ml X-Gal were included in the agar. For ligation of PCR product, 4 µl DNA-containing liquid were mixed with 1 µl Ligation Master Mix 2 X and 1 µl pDrive Cloning vector. The sample was incubated at 4 – 16° C for 30 min.

5.9.4 Ligation using the Zero Blunt® PCR Cloning Kit The Zero Blunt® PCR Cloning Kit (INVITROGEN) was used for blunt end cloning, which was necessary for the cloning of PCR products from PCR with the proof-reading polymerase PhusionTM Hot Start DNA Polymerase.

5 µl DNA-containing liquid were mixed with 1 µl 10 X Ligation buffer, 2 µl ddH2O, 1 µl pCR ®-Blunt vector vector, and 1 µl T4 ligase. The mixture was incubated at 16° C overnight.

Material and Methods 67

5.10 Transformation

Competent E. coli were thawed on ice. The ligation sample was added to the cells, gently stirred and incubated for 20 min on ice. A heatshock at 42° C for 30 sec allows the cells to take up the plasmid. The cells were then chilled for 2 min on ice. 250 µl of prewarmed (37° C) SOC medium were added, and the sa mple was shaken for 1 h at 200 rpm and 37° C. Volumes of 20 – 200 µl were spre ad onto agar plates containing the appropriate antibiotic. The plates were incubated overnight at 37° C.

5.11 Bacterial Cultures for Plasmid Analysis

To analyze the plasmids, which were propagated in bacteria, a single colony was picked from an agar plate. For this purpose a sterile pipette tip was taken with sterile forceps to carefully touch the colony and transfer it into a Falcon tube containing 5 ml LB broth with the appropriate antibiotic. The culture was shaken at 37° C and 200 rpm overnight. For larger cultures with volumes of 50 ml or more, Erlenmeyer flasks were used.

5.11.1 Antibiotics Kanamycin or carbenicillin were used at a concentration of 50 µg per ml broth (0.5 µl stock solution (100 mg / ml) per ml). The choice of antibiotic depended on the resistance gene contained within the respective vectors. For ampicillin selection carbenicillin was used instead. Carbenicillin is like ampicillin a β-lactam antibiotic, but it is more stable than ampicillin.

5.12 Glycerol Stocks

When a plasmid had been transformed for the first time into bacteria, a glycerol stock was made. Equal amounts of bacterial culture and glycerol stock solution were mixed by vortexing and stored at – 20° C. When larger amo unts of the desired plasmid were needed, the stock was added to fresh medium (1 µl stock / ml medium) with antibiotics and incubated at 200 rpm and 37° C over night. Usually 1 µl stock was added to 1 ml broth.

68 Material and Methods

5.13 Preparation of Plasmid DNA

5.13.1 MiniPrep A MiniPrep was performed on 5 ml cultures using the NucleoSpin® Plasmid Kit (MACHEREY & NAGEL), after glycerol stocks had been prepared (5.12). The samples were centrifuged for 20 min at 1550 x g in 4° C. The supernatant was discarded and the bacterial pellet resuspended in 250 µl A1 buffer. The resuspended cells were mixed with 250 µl A2 buffer in a 2 ml Eppendorf tube for lysis, and 300 µl A3 buffer were added to precipitate the proteins. The tube was gently inverted 6 – 8 X and then centrifuged for 10 min at 16 000 x g in 4° C. The supernatant was transferred to a spin column and centrifuged for 1 min at 16 000 x g and 4 – 18° C. The flow-through was discarded. 600 µl of A4 washing buffer were given onto the column and centrifuged for 1 min at 16 000 x g and 4 – 18° C. The flow-through was discarded and the column was centrifuged for another 2 min at 16 000 x g in

4 – 18° C. For elution 50 µl of ddH 2O were pipetted onto the centre of column’s membrane and incubated at RT for 1 – 2 min. The DNA was eluated into a fresh Eppendorf tube by another centrifugation at 16 000 x g and RT for 2 min.

5.13.2 MidiPrep For the preparation of larger amounts of plasmid DNA (MidiPrep), the NucleoBond® AX 100 Kit (MACHEREY & NAGEL) was used. The cultures for this preparation were 50 ml of LB broth containing the appropriate antibiotic. The culture was centrifuged for 20 min at 1550 x g and 4° C. The supernatant was discarded. The cell pellet was resuspended in 4 ml Resuspension buffer S1 and mixed with 4 ml Lysis buffer S2. After 5 min incubation at RT, 4 ml S3 were added to precipitate the proteins, and the Falcon tube was placed on ice. The column was equilibrated with 2.5 ml N2. The lysate was filtered through a moistened filter paper and the filtrate was added onto the column. The column was washed with 12 ml of Wash buffer N3. Elution was performed with 5 ml of Elution buffer N5 into a fresh Falcon tube. 3.6 ml 100 % isopropanol were added and the sample was mixed and distributed to five 2 ml Eppendorf tubes. The DNA was precipitated by centrifuging for 30 min at 16 000 x g and 4° C. The pellets of each sample were pooled, b riefly centrifuged, and after discarding the remaining liquid the resulting pellet was washed Material and Methods 69 with 1 ml 70 % ethanol. The pellet was centrifuged for 10 min at 16 000 x g and 4° C, then the ethanol was discarded and the pellet dried. Usually the pellet was dissolved in 50 µl of ddH2O.

5.14 Quantification of DNA

Plasmid DNA was quantified the same way as RNA (5.3.3). A concentration of

50 µg / ml of DNA gives 1 OD260:

concentration in µg / ml = (OD260 x dilution factor x 50 µg / ml)

The OD260 / OD280 ratio of a pure DNA solution is 1.8 or slightly higher.

5.15 Analysis of Plasmids using Restriction Enzymes

To ensure that the plasmid had an insert of the expected size, the insert was cut out of the vector by restriction enzymes and analyzed on an agarose gel as described in 5.7. For the analysis of routine PCR cloning, the enzyme EcoRI was used, since the vectors pCR® 4 TOPO and pSC-A both have a restriction site for EcoRI at both sides of the multiple cloning site. For restriction analysis of other vectors or of inserts with known internal restriction sites, e.g. expression clones, appropriate enzymes were chosen. The reaction was performed in the buffer system recommended by the manufacturer. The amount of plasmid in a reaction was 250 – 1000 ng, depending on the size of the insert, since small inserts produce weaker bands than large inserts. The digest was usually performed at 37° C for at le ast 1 h.

5.16 Sequencing

Custom sequencing was performed by SEQLAB LABORATORIES GOETTINGEN GmbH. The usually ordered services were HotShots, approx. 300 bp, Advantage Read, approx. 600 bp, and Full Service, up to 1000 bp. For some applications the sequencing primers had to be sent along or to be mixed into the sample before. Sequences were received as data files.

70 Material and Methods

5.17 Sequence Analysis

5.17.1 Aligning and Handling of Sequences The programs AlignTM Plus 4.0 and DNAStar were used to analyze the sequence data. After vector and primer sequences were removed, the data were used to search the NCBI BLAST database for similarities. The NCBI BLAST provides several options to compare sequences with the NCBI database. Guided by the BLAST hits, protein sequences were chosen for comparison with the deduced proteins of the newly identified sequences using the ClustalW software.

5.17.2 Prediction of Transmembrane Domains and Signal Peptides To investigate the complete coding sequences of the putative receptors for transmembrane helices several improved transmembrane helices predicting hidden Markov models (TMHMM) and a transmembrane helix-detecting program called ConPred II were used. ConPred II consists of the two programs ConPred_elite and ConPred_all. ConPred_elite utilizes five prediction models for transmembrane regions: TMpred, TMAP, MEMSAT 1.8, TMHMM 2.0, and HMMTOP 2.0. If all five predict the same number and topology of transmembrane segments, ConPred_elite will analyze the submitted sequence. Otherwise ConPred_all will begin analysis. This second program is built on another combination of prediction models. For prediction of transmembrane helices in eukaryotic sequences the programs KKD, DAS, MEMSAT 1.8, SOSUI, and HMMTOP 2.0 are used, whereas prediction of location of the N-terminus is performed by the programs TMPred, TopPred II, MEMSAT 1.8, TMHMM 2.0 and HMMTOP 2.0. The developers of ConPred II claim an accuracy of 69.9 % for number and topology of TM helices in eukaryotic sequences for ConPred_all and of about 100 % for ConPred_elite (ARAI et al., 2004). Furthermore, two improved TMHMM models, Phobius and TMMOD, were applied. TMMOD outperforms other TM helix prediction methods with an accuracy of 89 %, whereas Phobius provides a method to predict a potential signal peptide and transmembrane topology simultaneously.

Material and Methods 71

5.17.3 Detection of Conserved Domains Conserved domains were detected by the Pfam HMM local and global model applications (Motif Scan) on the PROSITE site and by search of the NCBI database using the Conserved Domain Architecture Retrieval Tool (CDART) search.

5.17.4 Phylogenetic Analysis Multiple sequence alignments were generated using the program ClustalX v1.83, with Protein Weight Matrix PAM 350 for the pairwise alignment parameters and PAM series for the multiple alignment parameters. The aligned sequences were then viewed in the BioEdit software and edited manually. Phylogenies were constructed in MEGA v3.1 by the neighbour-joining method. The relative stability of groups within the phylogenetic tree was tested by bootstrap analysis and the neighbour joining method.

72 Material and Methods

5.18 Prokaryotic Expression

For functional binding assays in aqueous systems, only the isolated N-termini of C. oncophora and O. ostertagi depsiphilin (see 7.1) and of the bovine and canine LPH-2 were expressed. Depending on the prediction of conserved domains, the first 443 amino acids (aa) of the depsiphilins and the first 827 aa of the mammalian latrophilins were chosen to be expressed as recombinant proteins in E. coli. Therefore, the depsiphilin N-termini did not contain the predicted GPS, the transmembrane region and the C-terminus of the receptor. In a previous work on Hc110-R the first 445 aa of this receptor were shown to bind emodepside, α-LTX, and PF1022 A. The recombinantly expressed mammalian latrophilin N-termini included the predicted GPCR proteolytic site (GPS), but also did not contain the transmembrane region and the C-terminus. The transmembrane regions of the receptors cannot be expressed as soluble proteins due to the distinct characteristics of membrane proteins. The protein was examined as described for the isolated N-terminus of Hc110-R in the thesis of SAEGER (2000). Prokaryotic expression was performed using the Gateway® system from INVITROGEN. The system eliminates the need to perform new ligations for each new vector by taking advantage of the site-specific recombination properties of the bacteriophage lambda (LANDY, 1989). Once, the insert is ligated into a pENTR vector, which contains the site-specific attachment sites attL, the insert can easily be subcloned into the expression vectors. The expression vectors possess attR sites, which recombine with the attL sites of the pENTRTM vector in a reaction mediated by Gateway® LR ClonaseTM Enzyme Mix. The resulting expression clone has attB sites; the respective by-product with the pENTRTM backbone contains attP sites (HARTLEY et al., 2000).

5.18.1 Attaching Restriction Sites Prior to cloning the DNA fragments into the pENTRTM 3C vector restriction sites were attached to the ends of the insert to introduce sticky ends for ligation. For this reason a PCR with primers containing specific restriction sites was performed. After PCR the PCR products were analyzed, isolated, cloned into the pCR® 4 TOPO vector, and transformed into One shot® Top 10 chemically competent E. coli as described above (5.7 - 5.10). The aim was to ensure that the DNA fragment was inserted into the Material and Methods 73 vector in the right orientation. The restriction sites had to fulfill the following requirements: they had to be unique within the pENTRTM vector, and, as far as possible, also within the insert. Furthermore, the reaction setup of the two enzymes for each cloning had to be compatible for a double digest. The templates for PCR were plasmids containing the full-length coding sequences of the respective genes, which were to be expressed. To minimize a start of translation behind the N-terminal tag, leading to untagged recombinant protein, the forward primers changed the start codon of the genes in some cases from ATG to ATC.

5.18.1.1 Primers The restriction sites attached to the N-terminus of C. oncophora and O. ostertagi were BamHI and EcoRV. The primers for this approach were, for C. oncophora Co Bam ATC F and Oo N-Term EcoRV Re; the reverse primer was originally designed for O. ostertagi depsiphilin. For O. ostertagi the primers were Oo Bam ATC II F and Oo N-Term EcoRV Re. For the N-termini of bovine and canine LPH-2 identical primers could be used, Lat Bam ATC F and Lat Xho Re. These contained restriction sites for BamHI and XhoI, respectively.

5.18.2 Digestion of Plasmids for Cloning into pENTRTM 3C The resulting plasmids of 5.18.1 were isolated and sequenced as described in 5.13 - 5.17.1. For restriction analysis the respective enzymes for the introduced restriction sites were employed to confirm the expected restriction. For each cloning procedure 400 – 1000 ng of the pENTRTM 3C vector and the insert-containing pCR® 4 TOPO vector were digested. The reaction setup for the digestion of C. oncophora and O. ostertagi depsiphilin (BamHI / EcoRV) and of bovine and canine LPH-2 (BamHI / XhoI) N-terminus is described below.

74 Material and Methods

5.18.3 Double Digest Volume Final concentration ddH2O variable, brings the final volume to 20 µl plasmid variable 400 – 1000 ng / rxn Tango 10 X buffer 4 µl 2 X restriction enzyme I 1 µl 10 U / rxn restriction enzyme II 1 µl 10 U / rxn

The reaction was incubated for 2 – 4 h at 37° C. Fo r some other applications of double-digests a different 10 X buffer was used, with a final concentration of 1 X. The choice of the buffer system and concentration depended on the manufacturer’s recommendations for the respective combination of enzymes.

5.18.4 Ligation After digestion, the samples were analyzed on an agarose gel, and the desired bands of the insert and the vector were excised (see 5.7 and 5.8). The gel slices were centrifuged for 10 min at 16 000 x g and the supernatant was saved for ligation. The ligation setup was as follows:

Volume Final concentration digested insert 8 µl digested vector 8 µl T4 10 X ligase buffer 2 µl 1 X T4 DNA ligase 2 µl 2 U / rxn Total volume 20 µl

The ligation sample was incubated at 22° C overnigh t. The next day the T4 DNA ligase was inactivated by heating the mixture to 65° C for 10 min. After chilling, the entire ligation mixture was used for transforming One shot® Top 10 chemically competent E. coli (5.10). The antibiotic to select for plasmids with a pENTRTM backbone was kanamycin. Plasmid DNA was isolated as described in 5.13 – 5.14. Since the pCR® 4 TOPO vector also carries a kanamycin resistance gene, the plasmids were identified by their restriction pattern. The backbone of the Material and Methods 75 pENTRTM 3C vector is approx. 2.4 kb in size, whereas the pCR® 4 TOPO vector is about 3.9 kb. The insert was checked additionally by PCR with gene-specific internal primers.

5.18.5 Gateway® LR ClonaseTM Reaction The Gateway® LR ClonaseTM Enzyme Mix (INVITROGEN) was used for the LR recombination reaction. The Gateway® LR ClonaseTM Enzyme Mix catalyzes the attL x attR reaction, which is utilized for integrating the insert of a pENTRTM vector into a pDESTTM expression vector. The inserts were subcloned into the pDESTTM 17 vector, which provides an N-terminal His-tag for detection and purification. The plasmid DNA was diluted with TE buffer (pH 8.0) to 150 ng / µl. The setup was as follows:

Volume pENTRTM 3C plasmid DNA 2 µl (300 ng) pDESTTM 17 plasmid DNA 2 µl (300 ng) 5 X LR Clonase reaction buffer 4 µl TE buffer (pH 8.0) 8 µl LR ClonaseTM Enzyme Mix 4 µl Total volume 20 µl

The sample was mixed well and incubated for 3 h at 25° C, then digested with 2 µl proteinase K solution at 37° C for 10 min. 5 µ l of the LR reaction were transformed into 50 µl Library Efficiency® DH5α® chemically competent E. coli (INVITROGEN) as described in 5.10, except that 450 µl SOC medium instead of 250 µl were added. To ensure that no pENTRTM vector was carried over, the antibiotic was switched to carbenicillin. The pDESTTM 17 vector has an ampicillin and carbenicillin resistance gene, which pENTRTM vectors do not have. The plasmid DNA was isolated as described in 5.13 – 5.14 and confirmed by restriction analysis and gene-specific PCR. The backbone of the pDESTTM 17 vector is 6.4 kb in size. The expression plasmid was transformed into BL21 Star (DE3) One Shot® expression cells (INVITROGEN) using the TSS (Transforming and Storing Solution) transforming procedure (see 5.18.7).

76 Material and Methods

5.18.6 Empty-vector Control Some of the expression vectors, e.g. the pDESTTM vectors, contain a ccDB gene, which ensures that no cells containing a vector without insert survive. For propagating and maintaining these vectors, chemically competent E. coli cells of the strain Library Efficiency® DB3.1TM (INVITROGEN) was used. For expression studies an empty-vector control is used as a negative control. For this purpose the ccDB gene was cut out of the vector by restriction enzymes. The digested vector DNA was run on an agarose gel to remove the small DNA fragment containing the ccDB gene. The vector DNA band was excised of the gel and religated in a T4 DNA ligase reaction (5.18.4).

5.18.7 TSS (Transforming and Storing Solution) Transforming Procedure It is not uncommon that an expression clone, which is stored in glycerol stock solution and used for several expression experiments, decreases its protein production rate from experiment to experiment. To avoid this phenomenon, a fresh transformation of expression plasmid was performed for each experiment. The technique applied for this transformation was the TSS transforming procedure (CHUNG et al., 1989). For this transformation method, a special Transforming and Storing Solution (TSS) is used, which can also be used for the storage of E. coli cells. Initially a culture of untransformed E. coli BL21 Star (DE3) One Shot® cells was grown in LB broth over night and a glycerol stock (5.12) was made. The strain lacks lon and OmpT proteases and RNase E. These genetic characteristics enhance the expression of intact recombinant protein by reducing mRNA and protein degradation. These cells were used for transformation: for the TSS transforming procedure, 1 ml LB broth per planned expression culture was inoculated with 15 µl of this glycerol stock and incubated at 37° C and 200 rpm u ntil the culture reached an

OD 600 = 0.3. For each expression sample 1 ml of culture was transferred into a fresh 1.5 ml tube and centrifuged for 10 min at 380 x g at RT. The supernatant was discarded, and the pellet was resuspended gently in 100 µl ice-cold TSS. The cells were kept on ice and gently mixed with 50 – 100 ng of expression plasmid DNA by gentle stirring. The tubes were kept on ice for 5 – 10 min and then placed at RT (the heat-shock) for another 5 – 10 min. The cells were then put on ice again for 5 – 10 min, then 900 µl of LB broth without antibiotics were added. The sample was Material and Methods 77 shaken at 200 rpm and 37° C for 1 h. 100 µl of this culture were cultured in 5 ml LB broth containing the appropriate antibiotic overnight at 37° C and 200 rpm. The antibiotic was carbenicillin for pDESTTM vectors. Approx. 1 – 5 ml of culture were used the following day to inoculate an expression culture of 50 – 250 ml TB broth containing the appropriate antibiotic. The OD600 was adjusted to 0.05 – 0.1 at the beginning of incubation at 37° C and 200 rpm.

5.18.8 Regulation of Expression Regulation of expression was performed by inducing promotors. The promotors were either controlling the T7 RNA polymerase of the cells or, if included in the vector, directly regulating the transcription level of the gene to be expressed. Therefore, induction of expression depended on cells and vector. As the pDESTTM 17 vector, most of the tested vectors contained a T7 promotor for a T7 RNA polymerase regulated expression of the gene. If these vectors are transformed into cells possessing the λ DE3 lysogen, e.g. BL21 Star (DE3) One Shot® competent cells, expression is inducible: λ DE3 lysogen carries the gene for T7 RNA polymerase under control of the lac UV5 promotor, which can be activated by IPTG. The cascade is therefore: IPTG induces the expression of T7 RNA polymerase, which starts the expression of the desired gene within the expression plasmid. Some other vectors and cells had different induction procedures and will be described in 5.18.10 - 5.18.11.

5.18.9 Inducing Expression Cultures The expression cultures (5.18.7) were shaken at 200 rpm and 37° C, until they reached an OD600 = 0.4 – 0.8. Then 1 mM IPTG or another appropriate inducer (see 5.18.10 - 5.18.11) was added to start the expression. After 5 – 18 h the cells were pelleted at 1550 x g and 4° C for 20 – 30 min. The pellets could be stor ed at – 80° C for future use.

78 Material and Methods

5.18.10 Other Bacterial Strains Other strains of E. coli were tested for their ability to produce the desired proteins in a soluble form. As one of the standard strains of the Gateway® system (INVITROGEN), OneShot® BL21 (DE3) was tested. This strain lacks lon and OmpT proteases, like BL21 Star (DE3) One Shot®, but not RNase E. The expression of T7 RNA polymerase is IPTG inducible.

OneShot® BL21 (DE3) pLysS cells (INVITROGEN) share the advantages of OneShot® BL21 (DE3) cells, but they express T7 lysozyme that reduces the basal expression level and therefore facilitates the expression of potentially toxic proteins.

In BL21-AITM One Shot® cells (INVITROGEN), the expression can be tightly regulated by the araBAD promotor: expression is L-arabinose inducible and can be repressed by glucose. This strain is therefore also applicable for expression of potentially toxic proteins.

Expression was also attempted in Rosetta gami 2 (DE3)TM competent cells (NOVAGEN), which are supplemented with tRNA genes for the codons AGG, AGA, AUA, CUA, CCC, and GGA. These codons are naturally rare in E. coli, but common in some mRNAs coding for eukaryotic proteins. Moreover the strain is able to enhance disulfide bond formation due to mutations in both thioredoxin reductase and glutathione reductase.

5.18.11 Other Expression Vectors In addition to the pDESTTM 17 vector several other vectors were tested, for their ability to express soluble proteins rather than inclusion bodies. The vector pBAD-DEST 49, belonging to the Gateway® system, provides an N-terminal HP-thioredoxin tag and a C-terminal 6 X His tag. Thioredoxin, as fusion partner, can increase translation efficiency and, sometimes, the solubility of eukaryotic proteins expressed in E. coli (LAVALLIE et al., 1993). pBAD-DEST 49 is regulated by the araBAD promotor and is therefore L-arabinose inducible. To repress basal expression levels glucose can be added, so expression of proteins can be tightly regulated. This might be advantageous for expression of toxic proteins. Material and Methods 79

Another vector tested was pRSET ATM (INVITROGEN), which was used previously for the expression of the N-terminus of Hc110-R (SAEGER, 2000). It provides an N-terminal 6 X His tag and gets regulated by the T7 promotor.

As a vector with an N-terminal glutathione-S-transferase (GST) tag, pDESTTM 15 (INVITROGEN) was tested. The GST tag can be used for purification and detection. Expression is controlled by the T7 promotor as with the pDESTTM 17 vector. pET-41a(+) (NOVAGEN) was also tested. Inserted genes are expressed as fusion proteins with an N-terminal GST and a C-terminal 6 X His tag. Regulation is by the T7 promotor. The GST tag can be removed. pCold DNA I (TAKARA) is a vector designed for expression at low temperatures. It provides an N-terminal 6 X His tag for detection and purification. Expression at low temperatures retards the growth and metabolism of bacteria, whereas the expression of the recombinant protein, mediated by the cold shock protein promotor (cspA), is facilitated. The promotor is controlled by a lac operator and IPTG. Expression with pCold DNA vectors can increase the expression of soluble protein, or make expression possible at all.

5.18.12 Coexpression For potentially improved folding of the proteins other genes were coexpressed with the target gene. Chaperones are involved in the folding process of proteins, therefore their coexpression might help expression of soluble proteins (THOMAS et al., 1997). The chaperone-coding vectors are described in the appendix (8.4.6). The expression of chaperones and of the desired gene was done on different induction pathways, so the expression levels could be regulated independently. Another attempt was the coexpression of protein disulfide isomerase (PDI) of the canine hookworm A. caninum. The N-terminus of Hc110-R is known to contain a cystein rich region, which might be involved in disulfide bonds. These disulfide bonds likely extend from the N-terminus to the transmembrane region of the receptor, but they might also be important for the tertiary structure of the isolated N-terminus. For this approach expression plasmids of C. oncophora and O. ostertagi depsiphilin N-terminus in a

80 Material and Methods pET-41a(+) vector were transformed into One Shot® BL21 (DE3) competent cells, which already contained an expression plasmid of PDI in a pDESTTM 14 vector, using the TSS transforming procedure (5.18.7). The cultures were induced at an

OD 600 = 0.4 with 1 mM IPTG and shaken at 37° C and 200 r pm overnight.

5.19 Cell Lysis

The cell pellet of a 50 ml expression culture was resuspended in 2 ml Lysis buffer. 500 µg DNase I, 50 µl Complete Solution and 8 mg lysozyme were added. Complete is a cocktail of protease inhibitors. The mixture was incubated for 20 min on ice with occasional mixing. 8 mg deoxycholic acid were added and the sample was incubated for 10 – 20 min at 37° C. 500 µg DNase I were added and the sample gently rocked at RT for 30 min. To destroy the remaining DNA, the sample was vortexed for 10 sec. After centrifugation (15 min, 13 000 x g, 4° C) pellet and supernatant were separated and analysed on an SDS gel or stored at – 80° C.

5.20 MagneHisTM Protein Purification System

The MagneHisTM Protein Purification System (PROMEGA) provides the possibility to purify proteins by binding their His-tag to Ni2+-coated paramagnetic particles. The binding capacity is up to 1 mg of polyhistidine-tagged protein per 1 ml of particles. The particles must be vortexed to a uniform suspension before use. For each ml of cell lysate (5.19), 30 µl MagneHis Ni2+-coated particles were added, and the sample mixed by inverting for 2 – 10 min at RT. The particles were captured by a magnet, which was placed near to the tube, and the supernatant was discarded. The particles were washed with 150 µl MagneHis Binding / Wash buffer for 2 – 10 min at RT, and the tube was again placed near to the magnet. The supernatant was discarded, and this wash step was repeated two more times. The particles were mixed with 100 µl MagneHis Elution buffer and inverted for 2 – 5 min at RT. The supernatant was stored at – 20° C for later analysis. The parti cles were regenerated by washing in MagneHis Regeneration buffer. Material and Methods 81

5.21 Isolation of Inclusion Bodies

For isolation of inclusion bodies the cell pellet of a 50 ml culture was resuspended in 5 ml Inclusion Body Washing buffer I. 5 mg lysozyme were added and the sample was incubated on ice for 30 min. The mixture was sonicated on ice with an amplitude of 16 microns for 5 min with 15 sec pulses alternating with 15 sec breaks, until it was no longer viscous. 55 µl 1 M MgSO4 were added to achieve a final concentration of

10 mM MgSO4, and 55 µg DNase I were added. The sample was incubated for 30 min at RT, and then centrifuged at 6000 x g for 15 min to pellet the inclusion bodies. The supernatant was discarded, and the pellet mixed again with 5 ml Inclusion Body Washing buffer I and sonicated as above until resuspension was complete. The sample was centrifuged again for 15 min at 6000 x g. The supernatant was discarded and the pellet resuspended completely in 5 ml Inclusion Body Washing buffer II by sonication. Centrifugation was performed as above, and the step was repeated. The supernatant was discarded and 5 ml Inclusion Body Solubilization buffer were added. The pellet was broken mechanically and once again sonicated, incubated for 15 min at 40° C, and centrifuged at 1 3 000 x g for 20 min. The solubilized proteins were now in the supernatant, so the pellet was discarded.

5.22 Refolding of Solubilized Proteins

Several approaches were attempted to refold the solubilized proteins, such as On-Column-Refolding and buffer exchange directly in Fast Protein Liquid Chromatography (FPLC) or dialysis in a dialysis cassette. The only successful method was the refolding in Dilution and Refolding buffer, followed by purification and concentration by a HisTrapTM HP column and FPLC.

5.22.1 Dilution and Refolding Buffer The inclusion bodies solubilized in Inclusion Body Solubilization buffer were diluted 1 : 1000 with Dilution and Refolding buffer and left for 7 days at 4° C.

82 Material and Methods

5.22.2 FPLC and HisTrapTM HP Column Purification and concentration was performed by trapping the His-tagged protein by Ni2+-ions within the HisTrapTM HP column in an FPLC run. For this method the FPLC super-loop was loaded with 150 ml Dilution and Refolding buffer, containing 150 µl of inclusion bodies solubilized in Inclusion Body Solubilization buffer (5.21). The flow was set to 1 ml / min. After the volume of the super-loop was loaded onto the column, the column was washed with 10 ml of Binding buffer for HisTrapTM, i.e. 10 column volumes. The elution was performed with 10 ml Elution buffer for HisTrapTM and the eluate was fractionated in aliquots of 0.5 ml. The procedure was performed at RT. For each protein a separate HisTrapTM HP column was used. The protein required storage at 4° C, since it precipitated at – 20° C.

5.23 Protein Analysis

Protein analysis was performed by SDS PAGE and immunoblot. SeeBlue® Pre-Stained Standard or SeeBlue® Pre-Stained Standard Plus2 (INVITROGEN) were used as standards for protein size in SDS PAGE. The identities of the recombinant C. oncophora and O. ostertagi depsiphilin N-termini were also confirmed by MALDI-MS.

5.23.1 Conventional Methods

5.23.1.1 Conventional SDS PAGE Resolving SDS gels of 8 % and 10 % were either precast and stored in a moist milieu at 4° C or freshly poured. The stacking gel was pou red immediately before use. The samples were mixed with 0.1 volume of SDS Loading dye and then boiled for 5 min. The samples were loaded onto the gel, and the gel was run for 20 min at 70 – 80 V and for approx. 1 h at 120 – 130 V. When the blue dye was near the bottom of the gel, the run was stopped and the gel was blotted.

Material and Methods 83

5.23.1.2 Conventional Western Blot The sandwich for a conventional blot of SDS gels consisted (from anode to cathode) of 2 – 3 pieces of filter paper, a nitrocellulose membrane, the gel, and another 2 – 3 pieces of filter paper. The membrane and the filters were soaked in Blotting buffer for Western Blots before building the sandwich. A current of 100 mA was applied for 1 h in a SemiDry Blotting Chamber.

5.23.2 NuPage® System

5.23.2.1 NuPage® Gels INVITROGEN offers a number of precast gels which can be run at higher voltages and therefore in a shorter time than conventional SDS gels. In this work the NuPage® Novex Bis-Tris 4 – 12 % gels were used. The resolution of proteins is better than in a conventional SDS gel. 3 part of sample was mixed with 1 parts of LDS sample buffer and heated to 70° C for 10 min. The gels were run i n the XCell SureLockTM Mini-cell in 1 X MES or 1 X MOPS at 200 V for 35 – 60 min.

5.23.2.2 NuPage® Western Blot The NuPage® blotting sandwich was assembled into the blotting chamber of the NuPage® XCell SureLockTM Mini-cell. The sandwich consisted (from anode to cathode) of 2 – 3 filter pads, a filter paper, a nitrocellulose membrane, the gel, a filter paper, and 2 – 3 filter pads. The filter pads and the membrane were soaked in NuPage® Blotting buffer, and the filter papers were wetted with NuPage® Blotting buffer immediately before building the sandwich. When the sandwich assembly was fixed in the chamber, the whole sandwich was covered with NuPage® Blotting buffer, and the outer chamber was filled with deionized water. The blot was run at 200 V for 1 – 2 h.

5.23.3 Coomassie Staining After blotting the gel was usually stained in Coomassie Staining Solution to visualize the protein. The gel was incubated in approx. 30 ml Coomassie Staining Solution for approx. 1 h under gentle motion. The unbound Coomassie Blue was removed by

84 Material and Methods several washes in Coomassie Stripping Solution. The gel was then washed once in deionized water.

5.23.4 Drying SDS Gels When a Coomassie-stained gel was to be saved, it was dried. For this approach it was placed between two layers of wetted Gel Drying Film (PROMEGA). This sandwich was fixed in a frame. After two days the Gel Drying Films and the gel were dry and could be excised.

5.23.5 Immunoblot Following the protein transfer the membrane was immunoblotted. During the entire immunoblot the membrane was rocked gently. First it was washed for 5 min in 1 X TBS. Blocking was performed by incubating the membrane for 1 h in 1 X Roti®-Block Blocking Reagent (ROTH). Then it was washed 3 – 5 X for 1 – 5 min with TBS Tween. The incubation with primary antibody was performed for 1 h, the concentration depending on the antibody (see 8.4.4.1). Another washing procedure of 3 – 5 X with TBS Tween for 1 – 5 min each followed. The membrane was incubated with the secondary antibody for 1 h and then washed as described above. A final wash with 1 X TBS without Tween followed. The concentration of secondary antibodies is given in 8.4.4.2.

5.23.5.1 Alkaline Phosphatase Most of the secondary antibodies used were conjugated with Alkaline Phosphatase (AP), so the blots were developed with an NBT / BCIP substrate (Staining Solution for Western Blots), which gives a violet to black color. The reaction was stopped by washing the membrane in deionized water.

5.23.5.2 Horse Radish Peroxidase For some approaches a more sensitive detection system was necessary. The SuperSignal West® Femto Maximum Sensitivity Substrate Kit (PIERCE), based on chemiluminescence, detects secondary antibodies coupled with Horse Radish Material and Methods 85

Peroxidase (HRP). After incubation with the secondary antibody the membrane was washed 3 – 5 X with TBS Tween and then 3 – 5 X with 1 X TBS. Equal volumes of Stable Peroxide Solution and Luminol / Enhancer Solution were mixed, and then diluted 1 : 10 with 1 X TBS. The membrane was incubated in the detection reagent for 5 min and then placed into a clean disposable bag (ROTH). Excess liquid and air bubbles were removed. Detection was performed by exposing the membrane to an X-ray film for an appropriate time. The time of exposure depended on the strength of chemiluminescence, which was influenced by the amount of antigen and bound antibodies. Exposure time was between 10 sec and several minutes. The film was developed in replenisher, washed in water, and fixed in fixer for several minutes. The film was then watered for approx. 15 min and dried.

5.23.6 Testing of Sera When the properties of different antibodies were to be tested with the same antigen, e.g. with different sera or different dilutions, a preparative gel was used. The gel had only two wells, a small one for the protein size marker and a broad one for the antigen, so the antigen was distributed over the breadth of the gel except for the marker lane. After blotting such a gel, the membrane was cut into small vertical strips, which were incubated in small single dishes with the different antibodies. These blots were developed using the AP-system. After processing the membrane was reassembled.

5.23.7 Analysis by MALDI-MS Analysis of the expressed and purified proteins by Matrix Assisted Laser Desorption / Ionization Mass Spectrometry (MALDI-MS) was performed by TOPLAB GmbH. The desired protein band was excised from a Coomassie-stained SDS gel and sent to TOPLAB GmbH. The data were received as an interpreted analysis together with the underlying raw data.

86 Material and Methods

5.24 Prokaryotic Expression: Functional Assays

To test the recombinant proteins for their binding capacities, several functional assays were performed. Only the binding affinity to α-latrotoxin (α-LTX) was tested, since emodepside is almost insoluble in aqueous systems, due to its hydrophobic properties.

5.24.1 α-LTX

40 µg α-LTX were dissolved in 250 µl ice-cold ddH2O and then a sterile, ice-cold mixture of 750 µl glycerol and 500 µl ddH2O was added. This mixture had a final α-LTX concentration of 200 nM and was used as a stock solution. It was stored at – 20° C.

5.24.2 On-Blot Binding of α-LTX For the On-Blot binding experiments the proteins first were resolved on an SDS gel (see 5.23.1.1). Since SDS is a denaturing component, the proteins required subsequent renaturation. The gel was incubated in Renaturation buffer 4 X for 60 min, with buffer changes between the steps. The gel was then equilibrated for 30 min in Blotting buffer. This procedure has been described for binding-affinity studies on the isolated N-terminus of Hc110-R (SAEGER, 2000). The gel was blotted as described in 5.23.1.2 and then washed in 1 X TBS for 5 min and blocked with 1 X Roti®-Block Blocking Reagent for 1 h. Occasionally the membrane was stored at 4° C overnight. The membrane was incubated with a 2 0 nM solution of α-LTX in 50 % glycerol for 2 h. Then the membrane was washed thoroughly and transferred to a new dish to avoid downstream contamination with α-LTX. For a no-ligand control, blots were incubated in 50 % glycerol without α-LTX. Immunoblotting was performed as described in 5.23.5.1. The applied antibodies were anti-α-latrotoxin antibody (ALOMONE), as primary antibody to detect the putatively bound α-LTX, and anti-rabbit IgG (whole molecule) Alkaline Phosphatase, as secondary antibody. Antibody dilutions were tested in a dot blot with α-LTX as antigen.

Material and Methods 87

5.24.3 Dynabeads® M-270 Carboxylic Acid Dynabeads® technology was used as a another approach for testing the binding affinities between depsiphilin N-termini and α-LTX. The protein ligand to be tested can be bound to the Dynabead® M-270 Carboxylic Acid particles by a special reaction: the particles are activated by binding the carbodiimide EDC, which catalyzes the formation of an amide bond between the amine-carrying ligand protein and the carboxylic acid residue on the particles (NAKAJIMA and IKADA, 1995). For this procedure, α-LTX was dissolved in 25 mM MES (for the One-Step coating procedure) and 50 mM MES (for the Two-Step coating procedure) at a concentration of 1 µg / µl.

5.24.3.1 Activation and Coating of Dynabeads® One-Step Coating Procedure: 100 µl beads were washed 2 X in 100 µl MES (25 mM) for 10 min, the beads were separated by placing the tube onto a magnet, and the buffer was discarded. 60 µg α-LTX in 25 mM MES were added (60 µl), and the sample was incubated with slow rotation for 30 min at RT. 10 mg EDC were dissolved in 100 µl cold MES (100 mM), and 30 µl of this solution were added to the beads without removing the α-LTX solution. The sample was mixed thoroughly, then 10 µl MES (25 mM) were added to a total volume of 100 µl. The mixture was rotated slowly at 4° C overnight. The following day the supernatant was discarded and the Dynabeads® were washed 5 X with 200 µl Tris (50 mM; pH 7.4) for 20 min each to quench the unreacted activated carboxylic acid groups. Before storing at 4° C, the beads were washed with 200 µl PBS (pH 7.4).

Two-Step Coating Procedure: 100 µl beads were washed twice in 100 µl NaOH (0.01 M) for 10 min each, then

3 X in 100 µl ddH2O for 10 min each. After each washing step the beads were separated by placing the tube onto a magnet, and the supernatant was discarded. For the Two-Step coating procedure, the EDC was dissolved at a concentration of

76 mg / ml (0.4 M) in cold ddH2O. The beads were resuspended in 200 µl of 0.4 M EDC, and the tube was rotated slowly for 30 min at RT. The tube was placed onto a magnet for 4 min, then the supernatant was removed and discarded. The

88 Material and Methods

beads were washed in cold ddH2O and then washed in MES (50 mM). The washing steps were performed quickly. 60 µg α-LTX in 100 µl MES (50 mM) were added, and the sample was rotated for 30 min at RT. The supernatant was discarded, and the beads were washed in Tris buffer and stored in PBS as described for the One-Step coating procedure.

5.24.3.2 Capturing the Target Molecule 500 µl of FPLC eluate containing the depsiphilin N-terminus were added to 100 µl coated Dynabeads® and rotated slowly for 1.5 h at RT. The beads were separated by placing the tube onto a magnet for 4 min and washed 3 X with 500 µl PBS (pH 7.4).

5.24.3.3 Elution of Target Molecule For elution the beads were incubated with 30 µl Citrate (0.1 M; pH 3.1) for 2 min and placed onto a magnet. The supernatant was retained. This procedure was repeated once. The eluates were analyzed on an SDS gel. Since the target protein could also be released from the beads by boiling, in some experiments the beads were directly mixed with SDS loading dye, boiled for 5 min and the entire bead mixture loaded onto the gel.

Material and Methods 89

5.25 Eukaryotic Expression

5.25.1 Expression Vectors For eukaryotic expression of the complete receptors, full-length coding sequences were cloned into eukaryotic expression vectors. For expression, the depsiphilin of O. ostertagi and the H. contortus latrophilin-like protein 2 were chosen. The O. ostertagi depsiphilin gene was cloned into the tagless vector pcDNA 3, whereas H. contortus lat-2 was cloned into the pcDNA 3.1 His B© vector, which expresses an N-terminal His-tagged fusion protein. The desired restriction sites were added by a PCR with specific primers containing the restriction sites as previously described (5.18.1). PCR template was a completely sequenced full-length plasmid of the respective gene. The PCR product was cloned into the pCR® 4 TOPO vector, and the resulting plasmid was sequenced. The plasmid was double-digested and ligated directly into the expression clone as described above (5.18.3 – 5.18.4). The expression plasmids were transformed into One shot® Top 10 or JM109 competent E. coli and, after isolation, completely sequenced.

5.25.2 Maintenance of Eukaryotic Cells The maintenance and storage of eukaryotic cell lines was done externally by the cooperating working groups. All works on cells which were to be further cultured were performed under sterile conditions. Cultivation was performed in 6-well plates, 25 cm2 or 75 cm2 culture bottles or in Petri dishes (diameter 100 mm). The medium used was DMEM + 10 % fetal calf serum (FCS). The incubator maintained an environment of 37° C, 5 % CO 2 and 100 % humidity. When changing the medium in a 25 cm2 culture bottle, the cells were washed carefully with 10 ml warm 1 X PBS before the prewarmed medium was added. For counting and distribution of cells the medium was removed and the cells were detached by adding 1 ml EDTA (2 mM) per 25 cm2 culture bottle. An aliquot of this suspension was mixed with 3 parts of trypane blue. Trypane blue stains dead cells, allowing the counting of live cells in a Neubauer counting chamber. The sample volume in a Neubauer counting chamber is 0.1 µl (1 mm 2 x 0.1 mm = 0.1 mm 3).

90 Material and Methods

5.25.3 Transient Transfection with LipofectamineTM Transient transfection with LipofectamineTM (INVITROGEN) was performed with COS-7 cells. 1.33 x 106 cells were seeded in a 25 cm2 culture bottle the day prior to each transfection. Cell numbers and volumes were adjusted as needed. 2 µg of plasmid DNA were diluted with Opti-MEM® to a total volume of 200 µl. 12 µl LipofectamineTM were mixed with 188 µl Opti-MEM® in a 5 ml Falcon tube. The DNA was added to the LipofectamineTM mixture drop by drop, while the tube was tapped on the bench. The sample was vortexed gently and incubated for 30 min at RT. Meanwhile the cells were washed carefully 2 X with warm PBS (10 mM). 1200 µl Opti-MEM® were added to the DNA / LipofectamineTM mixture drop by drop with tapping for better mixing. The diluted DNA / LipofectamineTM mixture was added carefully to the cells, and the sample was incubated for 5 h at 37° C, 5 % CO 2 and 100 % humidity. After this incubation 3.5 ml DMEM / Ham’s F 12 + 20 % FCS were added. After an incubation of 18 – 24 h, the medium was changed to DMEM / Ham’s F 12 + 10 % FCS. Cells were harvested on day 3 post transfection.

5.25.4 Transient Transfection with FuGENE 6 Transfection Reagent Transient transfection with FuGENE 6 Transfection Reagent (ROCHE) was also performed with COS-7 cells. The cells transfected with FuGENE were cultured in Petri dishes (diameter 100 mm). Different ratios of DNA and FuGENE were tested, namely 10 µg DNA with volumes of 15 µl, 20 µl and 25 µl FuGENE. The DNA was diluted in Hank’s Buffered Salt Solution (HBSS) in a sterile tube, to give a final volume of 500 µl after the addition of FuGENE. The FuGENE reagent was warmed to RT and pipetted directly into the DNA solution. The sample was vortexed very briefly and incubated for 15 min at RT. The transfection sample was then added drop by drop to the medium in the culture dish. The dish was gently swirled to mix the reaction with the medium. The cells were incubated for 48 h at 37° C, 5 % CO 2 and 100 % humidity, then the medium was changed. The cells were harvested 3 days post transfection.

Material and Methods 91

5.26 Eukaryotic Expression: Functional Assays

For the measurement of Ca2+ influx into cells, the cells were loaded with Fura-2, a chelator. Fura-2 fluoresces at an excitation wavelength of 340 nm when bound by 2+ Ca ions, and at 380 nm when unbound. The fluorescence intensities F340 and F380 were measured, and the intracellular Ca2+ concentration was determined by the ratio

R = F340 / F380. For calibration Rmax and Rmin were measured. Rmax is given by the maximum of F340, which was determined by adding Triton X-100 or digitonin. Triton X-100 and digitonin render the cell membrane permeable, allowing Ca2+ ions to enter the cell and maximizing binding with Fura-2. For determination of Rmin, EDTA or EGTA were added. EDTA and EGTA chelate the Ca2+ ions more powerfully than

Fura-2, so the maximum of F380 and therefore Rmin can be surveyed. Calculation of the intracellular concentration of Ca2+ was based on the equation of GRYNKIEWICZ et al. (1985):   S  2+  R - Rmin  f 2  []Ca = Kd     Rmax - R  Sb2  with [Ca2+] = concentration of Ca2+ ions and Kd = effective dissociation constant and R = F340 / F380 = ratio of fluorescence intensities F at wavelengthes λ = 340 nm and λ = 380 nm 2+ and Rmin = ratio of fluorescence intensities at minimum [Ca ] 2+ and Rmax = ratio of fluorescence intensities at maximum [Ca ] and Sf2 = factor for free dye measured at wavelength λ = 380 nm and Sb2 = factor for bound dye measured at wavelength λ = 380 nm

5.26.1 Ca2+ Influx Measurement after Transfection with LipofectamineTM The cells were centrifuged at 300 x g for 10 min, resuspended in 10 mM PBS (pH 7.4) and again pelleted by centrifugation. The supernatant was discarded and the concentration of cells adjusted with enriched HBSS to 1 x 107 cells / ml. Fura-2 was added to a final concentration of 10 µg / ml. Probenecid was added in a final concentration of 2.5 mM to avoid potential export of Fura-2 out of the cells. The sample was incubated for 30 min in the dark and with occasional shaking. The

92 Material and Methods sample was diluted 1 : 10 with 9 parts of enriched HBSS, and incubated again for 30 min at RT in the dark and occasional shaking. The cells were centrifuged at 300 x g for 10 min, and the supernatant was discarded. The sample was washed with enriched HBSS and again centrifuged as above. The concentration of cells was again adjusted to 1 x 107 cells / ml in enriched HBSS. For measurements 50 µl of cell suspension were diluted with 450 µl enriched HBSS in a cuvette containing a magnetic stirrer. The optimal concentration of α-LTX as stimulus was determined by testing several dilutions. For calibration 25 µl Triton (1 % in ddH2O) and 25 µl EDTA (0.5 M) were used.

5.26.2 Ca2+ Influx Measurement after Transfection with FuGENE The cells in a culture dish (diameter 100 mm) were washed twice with 10 ml HBSS. The cells were then incubated with 5 ml HBSS containing 5 µl / ml Fura-2 for 30 min at 37° C. The Fura-2 was removed, and the cells wer e washed with 5 ml cold HBSS. The HBSS was replaced by 5 ml fresh cold HBSS and the cells were incubated at 4° C for 30 min. The cells were detached with a sil icone scraper and transferred into a Falcon tube. The cells transfected with different ratios of DNA and FuGENE were examined independently. Two experiments were carried out: the first experiment was performed with COS-7 cells transfected with depsiphilin at day 1 after transfection, the second was performed with COS-7 cells transfected with O. ostertagi depsiphilin, H. contortus lat-2, and pEGFP-N2 empty vector. These cells were used on day 3 after transfection. Due to low cell numbers of the depsiphilin transfected cells for the second experiment, the cells of the samples transfected with 15 and 20 µl FuGENE were pooled and treated as one sample. The pEGFP-N2 empty-vector transfected cells were also pooled, then two fractions of the pool were measured. The samples were centrifuged at 875 x g for 10 min. The supernatant was discarded. The cells were resuspended in 1800 µl HBSS and stored in the dark until measured. 1800 µl cell suspension were transferred into a cuvette containing a magnetic stirrer to avoid precipitation of cells. As stimulus 200 pM α-LTX were used. When cellular response was low, the viability of the cells was tested with 100 µM ATP. Digitonin, in a final concentration of 25 µM, and EGTA, in a final concentration of 4 mM, were used for calibration. Material and Methods 93

5.27 Preparation of Raw Antigen

For the preparation of raw antigen from adult O. ostertagi, 10 – 30 worms were homogenized in an Eppendorf tube using a micropistill. For complete tissue disruption, 500 µl PBS were added and the homogenate was sonicated on ice with an amplitude of 16 microns for 3 min with 15 sec pulses alternating with 15 sec breaks. The sample was centrifuged at 16 000 x g and 4° C for 30 min. The supernatant was transferred to a fresh tube, and pellet and supernatant were stored at – 20° C.

5.28 Isolation of Membrane Proteins

The isolation of membrane proteins from eukaryotic cells and tissues was performed using the Membrane Protein Extraction Reagent Kit Mem-PER® (PIERCE). The kit contains the lysis reagent Reagent A and the extraction reagents Reagent B and C. Approx. 5 x 106 cells were pelleted at 850 x g for 2 min, washed with PBS and repelleted. The supernatant was discarded. For extraction of membrane proteins from worms, approx. 20 mg of homogenized tissue were used instead of cells. This homogenate was washed with TBS and pelleted at 1000 x g for 5 min at 4° C. The pellet of cells or of homogenized tissue was then resuspended in 150 µl Reagent A, the lysis reagent. These mixtures were incubated at RT for 10 min with occasional vortexing. After lysis, which was verified under the microscope, the sample was placed on ice. 450 µl of a mixture of equal amounts of Reagent B and Reagent C were added, and the sample was vortexed. The mixture was incubated on ice for 30 min with vortexing every 5 min. The tubes were centrifuged at 10 000 x g for 3 min at 4° C. The supernatant was transferred to a fresh tube and incubated at 37° C for 20 min. The following centrifugation at 10 000 x g and RT for 2 min was performed quickly, since the phase separation was unstable at RT, disappearing as the sample cooled. The upper layer was the hydrophilic phase, whereas the lower hydrophobic phase contained the membrane proteins. A second extraction was possible by adding an equal volume of Reagent C to the hydrophilic phase and repeating the extraction procedure.

94 Material and Methods

5.29 Protein Quantification with CB-XTM Protein Assay

Aliquots of 1 µl and 5 µl of each sample were examined using the CB-XTM Protein Assay (GENOTECH) to determine the concentration of protein in the sample. The aliquots were mixed with 1000 µl ice-cold (– 20° C) CB-XTM reagent each and incubated at – 20° C for 30 min to precipitate the protein. The sample was centrifuged for 5 min at 16 000 x g and 4° C, and the supernatant was discarded. The protein pellet was resuspended in 50 µl CB-XTM Solubilization buffer I and 50 µl CB-XTM Solubilization buffer II by vortexing. 1000 µl CB-XTM Assay Dye were added, and the sample was briefly vortexed. The OD595 was determined, and the respective amount of protein per aliquot was calculated using the CB-XTM table. The concentration of the protein sample was estimated based on these data.

5.30 Removal of Detergents from Protein Samples

To analyze the Mem-PER® samples (5.28) on an SDS gel it was necessary to remove the detergents. The PAGEprep® Advance Clean-Up Kit (PIERCE) provides the possibility to bind the protein to a resin consisting of modified diatomaceous earth and to remove the detergents by washing. 20 µl resin, with a binding capacity of 70 µg protein, were transferred onto the centre of a column. An appropriate volume of protein sample was added and the column briefly vortexed. An equal volume of 100 % DMSO was added. The column was vortexed and incubated for 5 min with occasional vortexing. 3 washing steps were performed by adding 300 µl 50 % DMSO and centrifugation at 2000 x g for 2 min. The column was incubated with 50 µl Elution buffer at 60° C for 5 min, and the protein eluted by centrifugation at 2000 x g for 2 min. Samples were stored at – 20° C.

Material and Methods 95

5.31 Specific Anti-Hc110-R Antibodies

Specific antibodies for Hc110-R, the depsiphilin from H. contortus, were developed by the custom services of QCB QUALITY CONTROLLED BIOCHEMICALS. Potentially immunogenic epitopes within the primary structure of the N-terminus of Hc110-R were predicted, and three chosen for peptide synthesis. Two rabbits were immunized with each peptide. The synthesized peptides were:

Ac-EVEDDVKEDMSAKSAPSTC-amide for project 8213 Ac-CRAMTSDTRRPMVAGDLPKL-amide for project 8214 Ac-CPVEISAGSEQKPTGLERR-amide for project 8215

The peptides had a cysteine residue either C-terminally or N-terminally to facilitate the binding of the peptide to a carrier protein via Thiol chemistry. Therefore, a cysteine residue was added to the N-terminus of the peptides for projects 8214 and 8215 (printed in bold). This addition was unnecessary for the peptide of project 8213 since it already contained a cysteine at the C-terminus.

The respective primary sequences in C. oncophora and O. ostertagi compared to H. contortus were the following (variable amino acids underlined):

Sequence Identity with H. contortus Project 8213 H. contortus (aa 148 -166) EVEDDVKEDMSAKSAPSTC C. oncophora EVEDDVKKDMSVKPAPSTC 84 % O. ostertagi EVDDDVKKDMSVKSAPLTC 78 %

Project 8214 H. contortus (aa 246 – 264) RAMTSDTRRPMVAGDLPKL C. oncophora RAMTSDTRRPMVAGDLPKL 100 % O. ostertagi RAMTSDTRRPMVAGDLPKL 100 %

96 Material and Methods

Sequence Identity with H. contortus Project 8215 H. contortus (aa 414 -431) PVEISAGSEQKPTGLERR C. oncophora PVETLPSSEEQPSGVERR 55 % O. ostertagi PVEELPVSEQLPTGGERR 66 %

Immunziation and bleeding of the rabbits to produce sera were performed according to the following time schedule:

Task Day Pre Bleed and Injection 1 0 Injection 2 14 Injection 3 28 Injection 4 42 Bleed 1 (25 ml + 2 ml sample 1) 52 Bleed 2 (25 ml + 2 ml sample 2) 56 Injection 5 63 Bleed 3 (25 ml + 2 ml sample 3) 73 Bleed 4 (25 ml + 2 ml sample 4) 77

The samples of 2 ml serum were sent to the Institute for Parasitology to be tested with the recombinant proteins, and samples were chosen for affinity purification of antibodies:

Project Samples 8213 sample 1, rabbit 5059; sample 1, rabbit 5060 8214 samples 1 and 2, rabbit 5062 8215 sample 1, rabbit 5063; sample 1, rabbit 5064

After the projects were completed, the rabbits were euthanized and bled terminally. All sera were sent lyophilized containing 0.1 % sodium azide. They were restored with ddH2O and 5 % glycerol and stored in aliquots at – 80° C. One aliquot of each sample was stored at – 20° C, and the working aliqu ots were kept at 4° C. Material and Methods 97

5.32 Construction of Plasmids for Expression in C. elegans

To test the function of the depsiphilins, eukaryotic expression and rescuing experiments were planned in C. elegans lat-1 knockout mutants. An expression plasmid was constructed containing the putative promotor region of C. elegans lat-1, the complete coding sequence of O. ostertagi depsiphilin, and the 3’ UTR of C. elegans unc-54. The cloning strategy is presented in Figure 7. The backbone of the plasmid was pPD30.69, a vector of the Fire Lab Vector Kit (ADDGENE; the vector was kindly provided by Lindy Holden-Dye, School of Biological Sciences, Southampton). The myo-2 promotor of pPD30.69 was removed by restriction digestion with HindIII and NheI. The lat-1 promotor was amplified with primers containing restriction sites (primers are listed in 8.4.3.5). The forward primer had a HindIII restriction site, whereas at the 3’ end two restriction sites were added, for SanDI and for NheI. The addition of two restriction sites at the 3’ end of the promotor sequence required two subsequent PCR steps.Cosmid B0457 was used as template, and the amplicon was 3 kb in size. The PCR product was ligated into the pCR® 4 TOPO vector and transformed into JM109 competent E. coli. The plasmid was sequenced. The lat-1 promotor region was then excised using the HindIII and NheI restriction sites and ligated into the HindIII and NheI restricted pPD30.69 vector. This plasmid was transformed into JM109 competent E. coli, which were then characterized for antibiotic resistance: cultures were grown in duplicate, one with carbenicillin, since pPD30.69 carries an ampicillin resistance gene, and one with kanamycin, to verify that the pCR® 4 TOPO vector was not the backbone of the plasmid. pPD30.69 does not contain a kanamycin resistance gene. Only clones, which grew in carbenicillin, but not in kanamycin, were used for plasmid preparation. The restriction patterns of the isolated plasmid were examined in digests with HindIII and NheI or with EcoRI. Only clones with the expected restriction pattern were sequenced. The coding sequence of depsiphilin was amplified by PCR with a forward primer including a SanDI restriction site and a reverse primer with an NheI restriction site. The depsiphilin gene was then cloned in between the SanDI and NheI restriction sites of the lat-1 promotor reverse primer sequence within the plasmid described above. The restriction digestion had to be performed in two subsequent steps: the first digestion step was performed with NheI in 1 X Buffer TangoTM (FERMENTAS), resulting in 33 mM Tris-acetate (pH 7.9), 10 mM Mg-acetate, 66 mM K-acetate, and

98 Material and Methods

0.1 mg / ml BSA, for the second step SanDI was added and the buffer concentrations increased to 2 X Buffer TangoTM (FERMENTAS) (66 mM Tris-acetate (pH 7.9), 20 mM Mg-acetate, 132 mM K-acetate, 0.2 mg / ml BSA).

HindIII HindIII lat-1 promotor myo-2 promotor SanDI NheI pPD30.69 HindIII / NheI pPD30.69

unc-54 SpeI NheI 3‘ UTR unc-54 SpeI 3‘ UTR HindIII lat-1 promotor

SanDI pPD30.69 SanDI / NheI depsiphilin coding SpeI sequence unc-54 3‘ UTR NheI

Figure 7: Cloning scheme for the construction of a plasmid for expression of O. ostertagi depsiphilin in C. elegans. The colored fragments were produced in PCR with primers containing restriction sites. The PCR products were cloned into the pCR® 4 TOPO vector, and the plasmids were analyzed, before the cloning procedure was continued

The plasmids were examined for restriction patterns and sequenced as described above. The restriction patterns of the final plasmid for the expression of O. ostertagi depsiphilin in C. elegans in a double digest with HindIII and NheI and in a digest with EcoRI were influenced by additional restriction sites (see Figure 8). The fragments after a double digest with HindIII and NheI were expected to be approx. 4400 bp, 3800 bp, and 1600 bp in size, whereas the fragments after an EcoRI digest were expected to be approx. 4900 bp, 3500 bp, and 1400 bp in size. Material and Methods 99

HindIII EcoRI

SanDI pPD30.69

SpeI HindIII EcoRI EcoRI NheI

Figure 8: Restriction sites within the final plasmid for expression of O. ostertagi depsiphilin in C. elegans. Red: lat-1 promotor, blue: depsiphilin coding sequence, black: pPD30.69 backbone including the unc-54 3’ UTR. The restriction sites printed as fine lines determine additional restriction sites influencing the restriction patterns of a digest with EcoRI or a double digest with HindIII and NheI

100 Material and Methods

5.33 Real-time PCR

Real-time PCR was performed to quantify the level of transcription of depsiphilin in different developmental stages of H. contortus (McMaster strain) and O. ostertagi. As reference genes for normalization, the levels of transcription of the 18 S rRNA gene (18 S) and of the 60 S acidic ribosomal protein gene (60 S) were also determined. The genes chosen as reference genes had not been evaluated before for H. contortus and O. ostertagi. A conventional PCR was previously performed for each target gene with primers amplifying a larger fragment including the target sequence for real-time PCR. This PCR product was cloned and the plasmid sequenced. For standardization, dilution series of the plasmid for each gene were analyzed with each assay.

5.33.1 Design of Primers and Probes for Real-time PCR The primers and probes were designed with either the Primer Express software or the Beacon Designer software.

5.33.2 Plasmid DNA Dilution Series To generate standard curves for each gene examined, plasmid dilution series were prepared. For the plasmid dilution series a MidiPrep (5.13.2) was performed, and

DNA concentration was determined by measuring the OD260 of plasmid samples (5.14). For calculation of copy numbers, the length of the plasmid was considered applying the formula:

concentration µg / ml copies = = weight per copy µg /copy ml

with concentration in µg / ml = (OD 260 x dilution factor x 50 µg / ml) and weight per copy in µg / µmol = number of bp x weight per bp and weight per bp = 660 g / Mol = 660 µg / µMol and 1 Mol = 6.022 x 1023 and 1 µMol = 6.022 x 1017 Material and Methods 101

This results in:

concentration [µg / ml] concentration [µg / ml] =  660 /   660   number of bp × µg µMol   number of bp × µg   17   17   .6 022×10 copies / µMol   .6 022×10 copies 

concentration copies = 15   number of bp × .1 096×10  ml 

Copy number was adjusted to 1 x 1012 copies / ml = 1 x 109 copies / µl. This stock solution was serially diluted 1 : 10 by mixing 100 µl of a dilution with 900 µl ddH2O and so forth. This was performed down to a concentration of 1 x 101 copies / µl.

5.33.3 RNA Isolation for Real-time PCR Total RNA for real-time PCR was isolated from pools of 5000 eggs, 3000 larvae, or 10 adult H. contortus males or females or 20 adult O. ostertagi males or females using the Trizol® method (5.3.1). The RNA pellets were washed 3 X in 75 % DEPC ethanol before resuspension in 9 µl DEPC water.

5.33.4 DNase Digestion To ensure that the real-time PCR results are a measurement of the transcription level, it is crucial to avoid amplification of genomic DNA within the real-time PCR experiment. This can be ensured either by using a probe that is unable to bind to genomic DNA, e.g. due to an intron within its binding site, or by thorough removal of genomic DNA. Intron-spanning probes were not applicable for all assays, so the DNase digestion was a very important step.

1 µl RNAsin® Rnase Inhibitor (PROMEGA), 1 µl 10 x DNase buffer (PROMEGA) and 0.5 µl RQ1 RNase-free DNase (PROMEGA) were added and mixed with the RNA sample. The reaction was incubated at 37° C for 30 min. 1 µl Stop Solution

102 Material and Methods

(PROMEGA) was added, and the sample was heated to 65° C for 10 min to inactivate the DNase. The sample was chilled on ice, and RNA concentration was determined as described in 5.3.3. cDNA synthesis was performed with 1 µg of total RNA of each sample.

5.33.5 cDNA Synthesis for Real-time PCR With an oligo-(dT) primer, reverse transcription usually starts at the poly-A tail of an mRNA molecule. The probability that the reverse transcription is interrupted or reduced in efficiency increases with the length of transcription. To ensure that all transcripts contained the probe sequence, gene-specific reverse primers were used in addition to the oligo-(dT) primer. The gene-specific primers were positioned maximally 500 bp downstream of the probe sequence. 18 S rRNA does not produce mRNA but has been shown to be transcribed in reactions with an oligo-(dT) primer. It contains several poly-A stretches. Nevertheless, the transcription was performed for all three genes with gene-specific primers in addition to the oligo-(dT) primer. For cDNA synthesis, 1 µg of total RNA in a volume of 9.5 µl DEPC-treated ddH2O was mixed with 1 µl oligo-(dT) primer, 1 µl 18 S primer, 1 µl 60 S primer, 1 µl depsiphilin primer and 1 µl dNTP (10 mM). For exact primer nomenclature see 8.4.3.1. The sample was heated to 70° C for 7 min a nd then chilled on ice for 2 min. The sample was briefly centrifuged and 4 µl 5 X First Strand buffer, 1 µl DTT (0.1 M) and 0.5 µl SuperScriptTM III Reverse Transcriptase (INVITROGEN) were added. The sample was mixed, incubated for 60 min at 55° C and heated to 72° C for 10 min. The cDNA was stored at – 20° C.

5.33.6 Testing for Absence of Genomic DNA To test samples of H. contortus cDNA for the absence of genomic DNA, they were run in a conventional PCR with different sets of primers. The chosen primer sets for Hc110-R and for 60 S were intron-spanning, e.g. in genomic DNA an intron is placed between the forward and the reverse primer. In a PCR with genomic DNA a larger amplicon was expected than with cDNA. Genomic DNA was used as positive control. The primer pairs were the following (for primer sequences see 8.4.3.2):

Material and Methods 103

Gene Forward primer Reverse primer Intron size Hc110-R Hc110-R qPCR 3 F Hc110-R VII Re 69 bp Hc110-R Hc110-R qPCR 3 F Hc110-R qPCR 3 Re 69 bp Hc 60 S Hc 60 S F Hc 60 S Re 87 bp

For the primer pair Hc110-R qPCR 3 F / Re, no PCR product was expected in a PCR with genomic DNA as template, since the reverse primer spanned an exon / intron junction.

5.33.7 Real-time PCR Run For each run of real-time PCR, standardization curves were created by running plasmid dilution series for each gene. The eventually used dilutions were chosen for each gene individually to ensure that the amounts of transcript within the sample were covered by the standard curve. All samples were run as duplicates.

5.33.7.1 Reaction Setup The reaction was set up as a master mix for each probe / primer pair, i.e. three master mixes per run. Names and sequences of primers and probes are listed in 8.4.3.2 and 8.4.3.4. To ensure that there was enough master mix for all samples two additional reaction volumes of 25 µl each were calculated per master mix. For reaction setup the Brilliant® QPCR Master Mix (STRATAGENE) was used:

Volume Final concentration ddH2O 9.2 µl 2 X Brilliant® QPCR Master Mix 12.5 µl 1 X Forward primer (10 µM) 0.75 µl 300 nM Reverse primer (10 µM) 0.75 µl 300 nM Probe (100 µM) 0.05 µl 200 nM Reference dye ROX (2 µM) 0.75 µl 60 nM Template (plasmid or cDNA sample) 1 µl Total volume 25 µl

The reference dye ROX (1 mM) provided with the kit was diluted 1 : 500 immediately

104 Material and Methods before each run. Real-time PCR was run in a Strip Tube 8 X with Optical caps (STRATAGENE). For each pair of duplicates 48 µl of master mix were mixed with 2 µl cDNA or plasmid in one tube of the Strip Tube 8 X. 25 µl were then transferred to another tube, ensuring that both duplicates had the same DNA concentration. For 18 S analysis the cDNA was diluted 1 : 10 000, whereas the cDNA for 60 S and depsiphilin analysis were diluted only 1 : 10 to obtain threshold cycles (Ct) within a range of 18 – 29. Samples were briefly centrifuged before loading to remove air bubbles.

5.33.7.2 Real-time PCR Program Real-time PCR was performed in an Mx 4000 cycler (STRATAGENE). The program was the same 3-step program for all six assays: an initial denaturation step at 95° C for 10 min to fully activate the polymerase, 40 cycles of 95° C for 30 sec, 57° C for 1 min, and 72° C for 30 sec.

5.33.7.3 Comparison of Amplification Efficiencies To compare the efficiency of amplification of target gene and reference gene in different dilutions, cDNA dilution series were prepared from the cDNA samples of the H. contortus and O. ostertagi males. The cDNA was diluted 1 : 2, 1 : 5, 1 : 10, 1 : 20, and 1 : 50. Since the cDNA for the 18 S assay had to be diluted for usual runs 1 : 10 000, it was prediluted for the dilution series 1 : 1000. Therefore, the dilution 1 : 10 of the dilution series was corresponding to the dilutions of cDNA used in real-time PCR runs for analysis of transcription levels in samples, i.e. 1 : 10 for depsiphilin and 60 S assay and 1 : 10 000 for the 18 S assay.

5.33.7.4 Analysis of Real-time PCR Results For each sample tested, the copy number of each gene was calculated by comparing the threshold cycle (Ct) to the standard curve of the respective run and gene. Subsequent evaluation was performed on the mean of the duplicates for each sample. Determination of Ct values, copy numbers, standard deviations, and means was performed automatically by the Mx 4000 software. The copy number determined by the Mx 4000 software was the number of copies within the reaction sample, so the Material and Methods 105 dilution factor had still to be considered. Thus, for 18 S rRNA samples the determined averaged number of the duplicates was multiplied by 10 000, whereas the multiplication factor for 60 S and for depsiphilin was 10. The resulting figures were the copy numbers of the respective gene in 1 µl of cDNA. To facilitate the weighting of the differences, the copy numbers estimated for females, eggs, L1 / L2, and L3 were compared to the copy numbers in males, which were set as 100 %. To normalize the numbers of the target gene to those of the reference genes, the ratios of the copy numbers for each sample were determined for depsiphilin / 18 S and depsiphilin / 60 S. To compare the putative reference genes, additionally the ratio of copy numbers for 60 S / 18 S was determined.

Furthermore, as another method the 2 –Ct method (LIVAK and SCHMITTGEN, 2001) was used for normalization of depsiphilin to 18 S rRNA, depsiphilin to 60 S, and 60 S to 18 S. The method utilizes the raw Ct values of samples and is therefore independent of a standard curve in each run. The efficiencies of the real-time PCR reactions for a target and a reference gene have to be determined once, and if they are the same and close to 100 %, they can be excluded. For each sample the

Ct = Ct target gene - Ct reference gene has to be determined. One sample is used as a calibrator, all other samples are normalized to the Ct of the calibrator. The relative amount of target is therefore given by

amount of target = 2 –Ct

with - Ct = -(Ct sample - Ct calibrator) and Ct = Ct target gene - Ct reference gene

Again, the males were used as calibrator. Standard deviations and coefficients of variance of the duplicates, slope of the standardization curve, and R2 values were determined.

Results 107

6 Results

6.1 Depsiphilins (Latrophilin-like Protein 1, lat-1)

Putatively orthologous genes of the latrophilin-like protein 1 in C. elegans and Hc110-R were identified for C. oncophora and O. ostertagi. Based on their assumed function, they were grouped together with the receptor Hc110-R of H. contortus as depsiphilins.

6.1.1 Sequences The EST search in the database of the European Molecular Biology Laboratory (EMBL), using the nucleotide sequence of Hc110-R as template, revealed two small EST fragments of O. ostertagi depsiphilin. Using primers designed from these sequences in a PCR with O. ostertagi cDNA, the respective fragments were amplified. For C. oncophora a small fragment had been identified from previous work in this lab, and nested PCR with the primers designed for O. ostertagi revealed a further fragment. In several RACE experiments the cDNA ends of the depsiphilin gene were amplified for both organisms. To ensure that the fragments were assembled correctly, a final PCR was performed with primers amplifying the full coding sequence. Two full-length clones were completely sequenced from both C. oncophora and O. ostertagi. The abbreviated names of the plasmids used in the following are Co Depsi 2, Co Depsi 4, Oo Depsi 8, and Oo Depsi 10. The sequences differed slightly between the respective clones of each species. Since the UTRs (Untranslated Regions) at the 5’ and 3’ ends of the full-length cDNA were derived from RACE reactions, they could not be confirmed to belong exactly to the sequences of the full-length clones. They should be regarded as putative UTRs of depsiphilins in C. oncophora and O. ostertagi. These UTR sequences were, however, included with Co Depsi 4 and Oo Depsi 8 when submitted to GenBank. Accession numbers, full names and primer sequences are given in the appendix (8.2). An overview of the depsiphilin sequence traits is presented in Table 1.

108 Results

Hc110-R Co Depsi 2 Co Depsi 4 Oo Depsi 8 Oo Depsi 10

Coding sequence 2958 bp 2982 bp 2982 bp 2988 bp

Amino acids (aa) 986 994 994 996

5’ UTR 99 111 96 (bp)

3’ UTR 466 446 488 (bp)

Table 1: Sequence traits of the depsiphilins of H. contortus (Hc110-R), C. oncophora (Co Depsi), and O. ostertagi (Oo Depsi). Coding sequence starts with the start codon and excludes the stop codon. 3’ UTR is given as the number of base pairs (bp) of the untranslated region including the stop codon but excluding the poly-A tail

6.1.2 Identities between Depsiphilin Sequences Co Depsi 2 and Co Depsi 4 had an identity of 99 % within the cDNA coding and amino acid sequences. Oo Depsi 8 and Oo Depsi 10 shared 96 % of their cDNA sequences, whereas the identity based on the amino acid sequence was 98 %. These differences in clone sequences had little effect on the percent of identity between species. The percentages of identity are given in Table 2.

cDNA Amino acids

Hc110-R / Co Depsi 81 % 88 %

Hc110-R / Oo Depsi 82 - 83 % 88 %

Co Depsi / Oo Depsi 86 % 91 %

Table 2: Identity of the coding sequences of Hc110-R and depsiphilins of C. oncophora and O. ostertagi, based on cDNA and amino acid sequences Results 109

The identities of the depsiphilin amino acid sequences with latrophilin-like protein 1 in C. elegans were in the range of 45 – 47 %.

6.1.3 BLAST Results for Depsiphilin Sequences The NCBI BLAST blastn (nucleotide sequence versus nucleotide sequence) server found a significant alignment only with Hc110-R and a fragment of C. elegans lat-1, whereas the NCBI BLAST tblastx server results (translated sequence versus translated database) showed further related sequences: the hypothetical protein CBG03206 of C. briggsae (discussed in chapter 6.3), two splicing variants of C. elegans lat-1, LAT-1A and 1B, an unnamed protein of Tetraodon nigroviridis, and mammalian latrophilins (LPH). The NCBI blastx (translated sequence versus protein database) server indicated the latrophilin-like proteins LAT-1A and 1B of C. elegans as the closest matches apart from Hc110-R, followed by murine LPH-3.

6.1.4 Prediction of Transmembrane Domains and Signal Peptides The translated sequences of the depsiphilins were analyzed for transmembrane domains. For all four sequences, namely Co Depsi 2 and 4 and Oo Depsi 8 and 10, the applied prediction programs predicted a transmembrane region (TMR) consisting of seven TM helices and an extracellular N-terminus. The only deviant result was ConPred II’s determination of 8 transmembrane helices for Hc110-R, whereas Phobius and TMMOD predicted seven. A signal peptide was identified for each depsiphilin as well. A table containing the exact positions and numbers of TM helices for each clone by each program is given in the appendix (8.1.1, Table 9).

110 Results

6.2 Latrophilin-like Protein 2 (lat-2)

Since in C. elegans a second latrophilin-like protein, LAT-2, was discussed to be involved in mediating the toxic effects of emodepside, a search was conducted for possible orthologous genes in parasitic nematodes. The H. contortus database of the Sanger Institute was scanned for gene fragments of a putative ortholog of this receptor. The search revealed a 143 bp fragment, which was amplified and elongated in RACE experiments with H. contortus cDNA. Using degenerate primers putative orthologs were also found in C. oncophora and O. ostertagi. Full-length clones were aquired for H. contortus (Hc lat-2) and for C. oncophora (Co lat-2). An overview is given in Table 3. Again, the UTRs should be regarded as putative UTRs, since the sequences derived from RACE experiments were appended to the full-length coding sequences. The accession numbers are given in the appendix (8.2).

H. contortus lat-2 C. oncophora lat-2

Coding sequence 3906 bp 3930 bp

Amino acids (aa) 1302 1310

5’ UTR (bp) 36 20

3’ UTR (bp) 585 511

Table 3: Sequence traits of latrophilin-like protein 2 of H. contortus and C. oncophora. Coding sequence starts with the start codon and excludes the stop codon. 3’ UTR is given as the number of base pairs of the untranslated region including the stop codon but excluding the poly-A tail

6.2.1 Identities between lat-2 Sequences The latrophilin-like proteins 2 in H. contortus and C. oncophora shared 82 % of the amino acid sequence and had an identity of 77 % based on the cDNA sequence. The identity between parasitic LAT-2 and LAT-2 of C. elegans was 47 %. This was comparable to the percentage of identity between depsiphilins and C. elegans LAT-1.

Results 111

cDNA Amino acids

Hc lat-2 / Co lat-2 77 % 82 %

Hc lat-2 / Ce lat-2 54 % 47 %

Co lat-2 / Ce lat-2 54 % 47 %

Table 4: Identity of the coding sequences of lat-2 of H. contortus, C. oncophora, and C. elegans, based on cDNA and amino acid sequences

The identity between the nucleotide sequences of parasitic and C. elegans lat-2 was 54 %. The percentages of identity are presented in Table 4.

6.2.2 BLAST Results for lat-2 Sequences An NCBI BLAST blastn (nucleotides vs. nucleotides) search with H. contortus lat-2 found a best match with C. elegans lat-2, but only in a small fragment of 75 bp. A blastn search with C. oncophora lat-2 matched best with a 24 bp fragment of human LPH-1, with 100 % identity. The C. elegans lat-2 had an identity of 93 % with C. oncophora lat-2 over a fragment of 31 bp. An NCBI BLAST blastx (translated vs. protein) search with H. contortus lat-2 matched best with LAT-2 of C. elegans, followed by the hypothetical protein CBG03673 of C. briggsae (NCBI accession number CAE60128), which will be discussed in chapter 6.3. The next best match was human LPH-2, followed by the LPH-2 of chimpanzee. The blastx search with C. oncophora lat-2 matched, after C. elegans LAT-2 and the hypothetical protein CBG03673 of C. briggsae, with LPH-3 of chimpanzee (predicted), human, and mouse. The predicted protein sequences of LPH-2 and 3 in chimpanzee have an identity of 60 % with each other. A ClustalW alignment of H. contortus LAT-2, C. oncophora LAT-2, and chimpanzee LPH-2 and 3 showed an overall identity of the amino acid sequence of 20 % for H. contortus LAT-2 and chimpanzee LPH-2 and 3 as well as C. oncophora LAT-2 and chimpanzee LPH-2 and 3.

112 Results

6.2.3 Prediction of Transmembrane Domains and Signal Peptides For H. contortus and C. oncophora LAT-2, seven transmembrane domains were predicted consistently by the programs Phobius, TMMOD, and ConPred II. All three also predicted an extracellular N-terminus and an intracellular C-terminus. A signal peptide was detected by Phobius and by ConPred II. TMMOD gives no particulars about signal peptides. A table containing the exact positions of the predicted TM helices is given in the appendix (8.1.1, Table 10).

6.3 Comparison of Sequences

The ClustalW alignment program was used to compare the amino acid sequences of depsiphilins and H. contortus and C. oncophora LAT-2 with other nematode latrophilin-like proteins and selected mammalian LPH. For accession numbers refer to the appendix (8.2). The alignment showed an identity of 98 % between C. elegans LAT-1 A and B, and of 81 % between C. elegans LAT-1 A or B and C. briggsae CBG03206. A similar level of identity (82 %) was found between C. elegans LAT-2 and C. briggsae CBG03673, whereas the sequences of C. briggsae CBG03673 and C. elegans LAT-1 A or B and of C. briggsae CBG03206 and C. elegans LAT-2 were about 20 % identical. In the following text C. briggsae CBG03206 will therefore be assumed to be a LAT-1 ortholog, whereas C. briggsae CBG03673 will be considered as LAT-2 ortholog. C. briggsae LAT-1 had a similar identity to the depsiphilins (46 %) as had LAT-1 A and B of C. elegans (45 - 47 %). The identity between parasitic LAT-2 and LAT-2 of C. elegans and C. briggsae were 45 – 48 %. The level of identity between depsiphilins and parasitic LAT-2, C. elegans LAT-2, and C. briggsae LAT-2 was 19 – 23 %. This level of identity was lower than some of those between depsiphilins and the different mammalian LPH, which showed identities as high as 26 %. The identities between parasitic LAT-2 and mammalian LPH were in a range of 19 – 22 %. C. elegans and C. briggsae LAT-1 had 22 – 26 % identity with mammalian LPH, C. elegans and C. briggsae LAT-2 showed identity levels of 16 – 20 % with mammalian LPH. A phylogenetic tree built with the Mega 3.1 software based on ClustalX alignments showed the depsiphilins grouping with C. elegans LAT-1 and C. briggsae LAT-1, whereas parasitic LAT-2 cluster with C. elegans and C. briggsae LAT-2 (Figure 9). Results 113

C. familiaris LPH-2 83 99 B. taurus LPH-2 60 H. sapiens LPH-2 100 M. musculus LPH-2 100 R. norvegicus LPH-2 B. taurus LPH-1

100 100 R. norvegicus LPH-1 92 M. musculus LPH-1 B. taurus LPH-3

100 M. musculus LPH-3 95 R. norvegicus LPH-3 100 C. elegans LAT-1 C. briggsae LAT-1

100 H. contortus Hc110-R

100 C. oncophora depsiphilin 99 O. ostertagi depsiphilin

100 H. contortus LAT-2 C. oncophora LAT-2 100 C. elegans LAT-2 100 C. briggsae LAT-2

0.1

Figure 9: Phylogenetic tree of depsiphilins, latrophilin-like proteins, and mammalian LPH based on amino acid sequence comparison. The numbers on the branches indicate the bootstrap values (in percent; 1000 replicates), the bar indicates the number of substitutions per site

NCBI accession numbers: B. taurus LPH-1: AAD09191; Mus musculus LPH-1: NP_851382; R. norvegicus LPH-1: NP_075251; B. taurus LPH-2: AAD05306; M. musculus LPH-2: XP_131258; R. norvegicus LPH-2: NP_599235; Canis familiaris LPH-2 (predicted): XP_547314; Homo sapiens LPH-2 (predicted): CAI22398; B. taurus LPH-3: AAD05329; M. musculus LPH-3: NP_941991; R. norvegicus LPH-3: NP_570835; H. contortus Hc110-R: translated AJ272270; C. oncophora depsiphilin: clone 4, translated DQ356247; O. ostertagi depsiphilin: clone 8, translated DQ356248; C. elegans LAT-1: translated AY314770; C. briggsae LAT-1: hypothetical protein CBG03206, CAE59757; H. contortus LAT-2: translated EF137716; C. oncophora LAT-2: translated EF494183; C. elegans LAT-2: translated AY314772; C. briggsae LAT-2: hypothetical protein CBG03673, CAE60128

114 Results

N-Terminus A

Gal HormR GPS 7-TMR

N-Terminus B

C-Lect Gal C-Lect HormR GPS 7-TMR

N-Terminus C

C-Lect Gal HormR GPS 7-TMR

N-Terminus D

Gal OLF HormR GPS 7-TMR

Figure 10: Schematic drawing of the conserved domains within depsiphilins, latrophilin-like proteins, and mammalian LPH. A: depsiphilins, C. elegans and C. briggsae LAT-1; B: parasitic LAT-2; C: C. elegans and C. briggsae LAT-2; D: mammalian LPH

Legend: OLF Olfactomedin-like domain C-Lect C-type lectin domain 7-TMR seven transmembrane region Gal Galactose-binding lectin domain HormR domain present in hormone receptors GPS GPCR proteolytic site

Results 115

6.4 Comparison of Predicted Conserved Domains

The conserved domains predicted for depsiphilins were compared to those predicted for parasitic LAT-2 and related proteins. Depsiphilins were predicted to have the same conserved domains as LAT-1 in C. elegans and C. briggsae, e.g. a galactose binding lectin domain, a GPCR proteolytic site (GPS), a domain present in hormone receptors (HormR), and a seven transmembrane region (7-TMR). Both groups, depsiphilins and LAT-1 of the free-living nematodes, lacked the C-type lectin domain predicted for all nematode LAT-2. Parasitic LAT-2 contained an additional different C-type lectin domain compared to LAT-2 of C. elegans and C. briggsae. All nematode latrophilin-like proteins lacked a domain, an olfactomedin-like domain (OLF), which was additionally predicted for mammalian LPH. Nevertheless, all conserved domains predicted for depsiphilins were also found in mammalian LPH and in all nematode LAT-2. Figure 10 shows a diagram presenting the domains predicted consistently by both programs. The global Pfam model of Motif Scan also detected an IMP dehydrogenase / GMP reductase domain (IMPDH) in all tested sequences, but in variable positions. This domain was not confirmed by the NCBI CDART software.

116 Results

6.5 The BK-type Potassium Channel SLO-1 (slo-1) slo-1 is the gene annotation for a SLOwpoke potassium channel family member. The protein SLO-1 is a large conductance calcium-gated potassium channel (BK-type channel). C. elegans slo-1 knockout mutants were observed to be highly resistant to emodepside (personal communication Lindy Holden-Dye, School of Biological Sciences, Southampton). Therefore, a search for potential orthologs of slo-1 in H. contortus, C. oncophora, and O. ostertagi was conducted. A BLAST search using the sequence of C. elegans slo-1 as input in the database of the Sanger BLAST Server found matches with H. contortus in four short fragments of 83 – 150 bp within the coding sequence and a 599 bp fragment containing the last twenty codons of the coding sequence, the stop codon, and part of the 3’ UTR. A PCR using primers based on these sequences amplified a 1352 bp fragment in H. contortus and C. oncophora, and a 1355 bp fragment in O. ostertagi. These fragments were elongated by RACE experiments. For H. contortus and C. oncophora slo-1, PCR products of the size of the complete coding sequence were obtained. A test PCR with internal specific primers confirmed the identity of slo-1.

Routine cloning of these PCR products using the StrataCloneTM PCR Cloning Kit or the TOPO TA Cloning® Kit for Sequencing was unsuccessful: either no colonies grew or the colonies did not contain the full-length slo-1 sequence. For H. contortus slo-1, routine cloning using the TOPO TA Cloning® Kit for Sequencing produced plasmids containing an insertion of 145 bp, similar to an intron, which interrupted all three reading frames. Blunt end cloning was also unsuccessful. Transformation of ligation samples into JM109 competent cells, either after TOPO TA ligation or blunt end ligation, produced few clones containing the complete coding sequence of slo-1. The amplification of a full-length coding sequence of O. ostertagi slo-1 was unsuccessful. Hence, the contig of O. ostertagi slo-1 should be regarded as preliminary sequence. The coding sequence of C. oncophora and O. ostertagi slo-1 were found to have six additional N-terminal amino acids compared to H. contortus slo-1. An overview of the sequence traits is presented in Table 5, the UTRs should be regarded as putative UTRs. Accession numbers are given in the appendix (8.2). Results 117

H. contortus slo-1 C. oncophora slo-1 O. ostertagi slo-1

Coding sequence 3315 bp 3333 bp 3378

Amino acids (aa) 1105 1111 1126

5’ UTR (bp) 148 766 411

3’ UTR (bp) 530 529 465

Table 5: Sequence traits of slo-1 of H. contortus, C. oncophora, and O. ostertagi. Coding sequence starts with the start codon and excludes the stop codon. 3’ UTR is given as the number of base pairs (bp) of the untranslated region including the stop codon but excluding the poly-A tail

6.5.1 Identities between slo-1 Sequences The nucleotide sequences of parasitic slo-1 have 84 – 86 % identity with each other, whereas the amino acid sequences of the translated proteins have 96 – 98 % identity. The percentages of identity are presented in detail in Table 6. H. contortus and O. ostertagi slo-1 have an identity of 71 % with C. elegans slo-1 based on cDNA sequence, whereas C. oncophora slo-1 has 72 %. All three parasitic SLO-1 have 87 % identity in amino acid sequence with C. elegans SLO-1.

cDNA Amino acids

Hc slo-1 / Co slo-1 85 % 98 %

Hc slo-1 / Oo slo-1 84 % 96 %

Co slo-1 / Oo slo-1 86 % 96 %

Table 6: Identity of the coding sequences of slo-1 of H. contortus, C. oncophora, and O. ostertagi, based on cDNA and amino acid sequences

118 Results

6.5.2 BLAST Results for slo-1 Sequences NCBI BLAST blastn (nucleotides vs. nucleotides) searches using H. contortus and C. oncophora slo-1 sequences as input retrieved several BK-type potassium channels from different organisms. The identities of C. elegans slo-1 fragments, mainly 100 – 450 bp in size, with parasitic slo-1 were as high as 85 %. The next best matches were fragments of genes for a potassium channel in Cancer borealis, the Jonah crab, and the fruit fly Drosophila melanogaster. Further matches for H. contortus slo-1 included fragments of calcium-activated potassium channels from the red flour beetle Tribolium castaneum and the wasp Nasonia giraulti, with identities of 78 – 79 %. The blastn search for C. oncophora slo-1 found matches with 80 – 180 bp fragments of genes for calcium-activated potassium channels in the insects Drosophila pseudoobscura and Manduca sexta. These fragments had identities with C. oncophora slo-1 of 80 – 85 %; very short fragments of approx. 25 bp had identities as high as 96 %. The order of the listed matches varied for H. contortus and C. oncophora slo-1. A blastn search with the preliminary O. ostertagi slo-1 found, following C. elegans and C. briggsae slo-1, matches with gene sequences for potassium channels of D. melanogaster. For all three parasitic slo-1 several other sequences of BK-type potassium channels, mainly less than 100 bp in size, matched in addition to the sequences derived from insects and crustaceans listed above. Among these further matches were sequences of molluscs (Aplysia californica), fishes (Danio rerio), birds (Gallus gallus), and mammals (C. familiaris, B. taurus and others).

The NCBI BLAST blastx (translated vs. protein) server retrieved matches with higher identities over larger ranges than the blastn search for all three parasitic slo-1 sequences: The best matches were C. elegans and C. briggsae SLO-1, followed by a D. melanogaster calcium-activated potassium channel and the predicted channel in T. castaneum. Other matches were BK-type potassium channels of various species. All fragments had identities of 57 – 59 %, and 70 – 71 % positives, (amino acids with a similar function) with the parasitic SLO-1. The spectrum of species contained molluscs, insects, turtles, mammals, and birds. The order of the listed species differed slightly between the results for H. contortus, C. oncophora and O. ostertagi SLO-1. Results 119

6.5.3 Comparison of SLO-1 Sequences Using the ClustalW software to compare sequences of calcium-gated potassium channels, the insect channels were found to have an identity of 63 – 65 %, the molluscan 59 %, chicken potassium channels 54 – 55 %, and mammalian 53 – 55 % with the nematode SLO-1 (including C. elegans). The identity between C. elegans SLO-1 and parasitic SLO-1 was 87 %. A phylogenetic tree based on these data is presented in Figure 11. The sequences used for this analysis were SLO-1 of human (H. sapiens), rat (R. norvegicus), dog (C. familiaris), cattle (B. taurus), chicken (G. gallus), fruit fly (D. melanogaster), tobacco hornworm (M. sexta), red flour beetle (T. castaneum), and seahare (A. californica).

96 H. contortus 100 C. oncophora 100 O. ostertagi 99 C. elegans T. castaneum

100 D. melanogaster 89 M. sexta A. californica

G. gallus H. sapiens 100 100 B. taurus 79 C. familiaris 0.05

Figure 11: Phylogenetic tree of BK-type potassium channels based on amino acid sequence comparison. The numbers on the branches indicate the bootstrap values (in percent; 1000 replicates), the bar indicates the number of substitutions per site

NCBI accession numbers: H. contortus: translated EF494184; C. oncophora: translated EF494185; O. ostertagi: translated preliminary contig (unpublished); C. elegans: translated NM_001029089; H. sapiens: EAW54600; C. familiaris: Q28265; B. taurus: AAK54354; G. gallus: AAC35370; D. melanogaster: AAX52990; M. sexta: AAT44358; T. castaneum: XP_968651; A. californica: AAR27959

120 Results

6.5.4 Prediction of Transmembrane Domains and Signal Peptides For H. contortus, C. oncophora, and O. ostertagi SLO-1, Phobius predicted seven transmembrane regions, an intracellular N-terminus, and an extracellular C-terminus. TMMOD predicted only six transmembrane helices with extracellular N- and C-termini. ConPred II also predicted seven transmembrane helices with intracellular N-terminus and extracellular C-terminus. The transmembrane helix not marked by TMMOD was congruently detected by the other programs as the fourth helix. The distance between the third and fourth transmembrane helices was five amino acids predicted by Phobius and was three amino acids in the ConPred II prediction, for all three sequences. Anyhow, TMMOD did not predict the region of this additional TM helix to be included in another predicted TM helix; the respective TM helix was not recognized to be hydrophobic at all. The extracellular C-terminus was predicted by all three programs to be very large, approx. 750 - 770 aa of 1105 - 1126 aa in total. None of the programs detected a signal peptide.

The prediction results were partially unexpected, as in literature BK-type potassium channels were described to have an extracellular N-terminus and an intracellular C-terminus (MEERA et al., 1997). For comparison, the sequences of the human and Drosophila potassium channels were analyzed using the three prediction programs. Providing the sequence of D. melanogaster, which was cited in the respective paper (NCBI Acc. No. JH0697, record had been discontinued but could still be found as Acc. No. 321029) to the prediction programs, similar results as for the parasitic SLO-1 were achieved: seven TM helices with an intracellular N-terminus and an extracellular C-terminus were predicted by Phobius and ConPred II, six TM helices with extracellular N- and C-termini were predicted by TMMOD. The sequence of the human potassium channel (NCBI Acc. No. U11058) cited in the same paper was predicted to have eight TM helices with extracellular N- and C-terminus by Phobius, eight TM helices with intracellular N- and C-terminus by ConPred II, and six TM helices with extracellular N- and C-termini.

Results 121

6.5.5 Prediction of Conserved Domains The domains predicted by the NCBI CDART program were an ion transport protein domain and a calcium-activated BK-type potassium channel α subunit. A scheme is given in Figure 12.

C-Terminus

ion-trans BK channel

Figure 12: Conserved domains of parasitic SLO-1.

Legend: ion-trans ion transport protein BK channel calcium-activated BK potassium channel α subunit

6.6 Bovine and Canine LPH-2

For comparison of binding affinities of depsiphilins to those of mammalian LPH, the N-termini of canine and bovine LPH-2 were expressed as recombinant proteins in E. coli. Primers were designed from known sequences: published cDNA and amino acid sequences of bovine LPH-2 and canine LPH-2, published as a predicted protein. Since the canine genome has been completely sequenced and published, primers could be designed based on this information, and the full coding sequence could be derived. The N-termini of bovine and canine LPH-2 had an identity of 96 % based on the nucleotide sequence and 98 % based on the amino acid sequence.

122 Results

6.7 Prokaryotic Expression

The expression of depsiphilin N-termini as soluble protein was not reproducibly possible. Immunoblots showed weak bands within the supernatant of the lysate of expression cells in only a few experiments. Most of the recombinant protein was detected within the pellet of the lysate (see Figure 13). Several approaches were undertaken to obtain soluble protein in larger amounts: expression in different E. coli strains, use of different vectors, and coexpression of proteins potentially involved in correct folding. None of these strategies led to reliable production of soluble protein (data not shown). The ultimate choice for obtaining protein for functional assays was to purify inclusion bodies, refold the protein, and then concentrate and further purify it by FPLC.

kDa 250

64 50

36

L 1 2 3 4

Figure 13: Pellet and supernatant after lysis of E. coli BL21-AITM One Shot® cells transformed with C. oncophora depsiphilin N-terminus expression plasmid (Co pDEST 17). Primary antibody QIAexpress Penta-HisTM Antibody (QIAGEN) 1 : 1000; secondary antibody anti-mouse IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 20 000. Lane L: SeeBlue® Pre-Stained Standard; lane 1: pellet of an induced culture, lane 2: supernatant of an induced culture; lane 3: pellet of an uninduced culture, lane 4: supernatant of an uninduced culture. The arrow marks the expected size of the recombinant protein

Results 123

6.7.1 FPLC The elution of protein after purification by FPLC was confirmed in SDS-gels. As indicated by Coomassie-stained gels, the protein was eluted within the fractions 2 – 9 (lanes 3 – 18); the main band had the expected size of approx. 55 kDa (see Figure 14). The identity of the protein was confirmed by MALDI-MS.

kDa kDa 250 250 98 98 64 64 50 50

L 1 2 3 4 5 6 7 8 9 L 10 11 12 13 14 15 16 17 18

Figure 14: FPLC eluate fractions of two FPLC runs for purification of recombinant O. ostertagi depsiphilin N-terminus (Oo pDEST 17) after refolding (20 µl per lane). Lane L: SeeBlue® Plus2 Pre-Stained Standard, lanes 1 and 2: fraction 1, lanes 3 and 4: fraction 2, lanes 5 and 6: fraction 3, lanes 7 and 8: fraction 4, lanes 9 and 10: fraction 5, lanes 11 and 12: fraction 6, lanes 13 and 14: fraction 7, lanes 15 and 16: fraction 8, lanes 17 and 18: fraction 9. Arrows mark the main band of approx. 55 kDa

6.7.2 Expression of Canine and Bovine LPH-2 N-termini The expression of canine and bovine LPH-2 N-termini was mainly possible as inclusion bodies. In contrast to the nematode N-termini, the refolding in Dilution and Refolding buffer was not applicable, since the proteins precipitated in the aqueous solution. Another approach, using a dialysis cassette, also failed due to protein precipitation.

6.7.3 MagneHisTM Protein Purification The MagneHisTM Protein Purification System was tried not only to purify, but also to concentrate recombinant proteins expressed in a soluble form, which were present in

124 Results very low amounts, if any. The eluted protein was analyzed in an SDS-gel. The main result was a strong band of approx. 80 kDa in the Coomassie-stained gel. This band was detected in all samples, whether induced or not induced, resulting from clones containing a plasmid carrying an insert or an empty vector. Therefore, it had to be accepted as an unspecifically purified E. coli protein. The size of this protein was similar to the expected size of the mammalian LPH N-termini, so the MagneHisTM Protein Purification System was abandoned to avoid contamination of the LPH N-termini with the co-purified E. coli protein.

6.7.4 Antibodies

6.7.4.1 Penta-His Antibody Before the specific anti-Hc110-R antibodies were produced, most blots were probed with Penta-His antibody as primary antibody to detect the 6 X His-tag of the recombinant protein. Most proteins were weakly stained. In addition to the recombinant proteins containing the His-tag, many other proteins were also detected. Whether these bands represented bacterial proteins with His-stretches or non-specific binding is unknown.

6.7.4.2 Anti-Hc110-R Antibodies The specific anti-Hc110-R antibodies produced by the custom service of QCB were tested with the recombinant N-termini of Hc110-R, C. oncophora depsiphilin, and O. ostertagi depsiphilin. The recombinant protein from all three organisms was detected by the antibody from project 8214. The immune sera from rabbit 5062 (project 8214) stained the protein bands much more intensively than the immune sera from rabbit 5061 from the same project. The immune serum sample 4 from rabbit 5062 was tested in dilutions from 1 : 50 to 1 : 8000. It detected the isolated N-terminus of Hc110-R as two strong bands approx. 55 kDa and 36 kDa in size (see Figure 16). The N-termini of C. oncophora and O. ostertagi depsiphilin were reproducibly detected within the FPLC eluate and within cell lysates as three bands. The bands were approx. 55 kDa, 50 kDa, and 36 kDa in size (see Figure 15). The usual dilution was 1 : 2000. There was no obvious difference between the affinity-purified antibody and sample 4 of rabbit 5062, which was used as reference Results 125

(data not shown). The antibodies from project 8213 gave a signal with C. oncophora (data not shown) and O. ostertagi depsiphilin (see Figure 15) at a dilution of 1 : 50. The antibody from project 8215 gave no signal with the C. oncophora and O. ostertagi depsiphilins (data not shown). This result was expected, since the peptide the antibody was based on had the lowest identity among the three species.

kDa 250

98 64 50

36

L 1 2 3 4 5 6 7 8 9 10 11 12

Figure 15: Immunoblot of a preparative SDS gel with purified recombinant O. ostertagi depsiphilin N-terminus (Oo pDEST 17) with specific anti-Hc110-R antibodies from projects 8213 and 8214; secondary antibody anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000. Lane L: SeeBlue® Pre-Stained Standard. Lanes 1 – 6: sera from project 8213 at a dilution of 1 : 50; lane 1: preimmune serum rabbit 5059, lane 2: sample 1 rabbit 5059, lane 3: sample 2 rabbit 5059; lane 4: preimmune serum rabbit 5060, lane 5: sample 1 rabbit 5060, lane 6: sample 2 rabbit 5060. Lanes 7 – 12: sera from project 8214 at a dilution of 1 : 100; lane 7: preimmune serum rabbit 5061, lane 8: sample 1 rabbit 5061, lane 9: sample 2 rabbit 5061; lane 10: preimmune serum rabbit 5062, lane 11: sample 1 rabbit 5062, lane 12: sample 2 rabbit 5062. Arrows mark the size of the three prominent bands stained by immune sera from project 8214

The antibodies from all three projects were tested at a dilution of 1 : 2000 with recombinant Hc110-R N-terminus. The only antibody detecting strong bands was from rabbit 5062, as described above. The immune sera from rabbit 5061 from the same project detected only very weak bands. The immune sera from the projects 8213 and 8215 detected no bands in this dilution (see Figure 16). Anyhow, for detection of Hc110-R in transfected eukaryotic cells the antibody from project 8215 was the best of all three projects (personal communication Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf).

126 Results

kDa 98 64

50

36

L 0 1 2 3 4 5 6 7 8 9

Figure 16: Immunoblot of a preparative SDS gel with purified recombinant Hc110-R N-terminus (protein kindly provided by Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf) with specific anti-Hc110-R antibodies 1 : 2000; secondary antibody anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000. Lane L: SeeBlue® Pre-Stained Standard; lane 0: empty; lanes 1 – 3: antibodies from project 8213; lane 1: preimmune serum rabbit 5059, lane 2: preimmune serum rabbit 5060, lane 3: affinity-purified sample from project 8213 (rabbits 5059 and 5060); lanes 4 – 6: antibodies from project 8214; lane 4: preimmune serum rabbit 5061, lane 5: preimmune serum rabbit 5062, lane 6: affinity-purified sample from project 8214 (only rabbit 5062); lanes 7 – 9: antibodies from project 8215; lane 7: preimmune serum rabbit 5063, lane 8: preimmune serum rabbit 5064, lane 9: affinity-purified sample from project 8215 (rabbits 5063 and 5064). Arrows mark the two strong bands detected by the affinity-purified sample from project 8214

6.7.5 Identification of Protein The final identification of the recombinant protein was performed by MALDI-MS of the FPLC purified protein. The three bands of approx. 55 kDa, 50 kDa, and 35 kDa of C. oncophora and O. ostertagi depsiphilin N-termini, which were detected by the antibody from project 8214, were excised and sent for MALDI-MS analysis. The identity of the N-terminus of C. oncophora depsiphilin was confirmed for all three bands, even though the 35 kDa band was contaminated with E. coli chaperone protein dnaJ. For O. ostertagi both larger bands were confirmed to be depsiphilin fragments. The 35 kDa band was an E. coli elongation factor.

Results 127

6.7.6 Functional Assays

6.7.6.1 α-LTX Blots In dot blots the anti-α-LTX antibody (ALOMONE) reacted to 20 nM α-LTX at a dilution of 1 : 100 but not at a dilution of 1 : 500. This low sensitivity was confirmed when 60 ng α-LTX (15 µl of 20 nM solution) was run as a protein sample on an SDS-gel and analyzed in an immunoblot. Only a weak band appeared in the blot with the antibody diluted 1 : 500, but at a dilution of 1 : 100, the reaction seemed to be strong enough to detect lower amounts of α-LTX (data not shown). Another anti-α-LTX antibody from a different supplier (SIGMA) failed to react with α-LTX.

The detection of α-LTX by anti-α-LTX antibody in binding assays with N-termini of C. oncophora and O. ostertagi depsiphilin within FPLC eluates (described in chapter 5.24.2) revealed three very weak bands, approx. 55 kDa, 45 kDa, and 36 kDa in size. The largest and the smallest bands had the same size as the bands detected by the specific anti-Hc110-R antibody from project 8214; the middle band was different (see Figure 17). In control blots with 50 % glycerol without α-LTX, no bands were detected by the anti-α-LTX antibody. To test α-LTX for nonspecific binding to proteins, several other highly expressed recombinant proteins and O. ostertagi raw antigen were run in an α-LTX binding assay and tested for their binding capacities. Specific binding of α-LTX to depsiphilins could not be confirmed; moreover, the best binding partner for α-LTX in this experiment was N-methyl-transferase (NMT) of the bovine lungworm D. viviparus (see Figure 18). The stained band in lane 1 was not identical with the main depsiphilin band in the Coomassie-stained gel.

The On-Blot binding assays of α-LTX to refolded recombinant depsiphilin N-termini of C. oncophora and O. ostertagi can therefore not be regarded as specific binding.

128 Results

kDa 250

98 64 50

36

L 1 2 3 4 5 6

Figure 17: α-LTX blot of a preparative SDS gel with recombinant C. oncophora depsiphilin N-terminus (Co pDEST 17). Lane L: SeeBlue® Pre-Stained Standard, lanes 1 – 3: blot incubated with α-LTX in 50 % glycerol, lanes 4 – 6: blot incubated in 50 % glycerol without α-LTX. Lane 1: primary antibody anti-α-LTX antibody 1 : 500, lane 2: primary antibody anti-α-LTX antibody 1 : 100, lane 3 and 4: primary antibody Sample 4 rabbit 5062 1 : 2000, lane 5: primary antibody anti-α-LTX antibody 1 : 100, lane 6: primary antibody anti-α-LTX antibody 1 : 500. Secondary antibody anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000. Arrows mark the very weak bands in the lane with α-LTX and anti-α-LTX antibody

kDa kDa 98 98 64 64 50 50

36 36

L 1 2 3 4 5 6 7 8 L 1 2 3 4 5 6 7 8

Figure 18: Coomassie-stained gel (left) and α-LTX blot (right) with recombinant O. ostertagi depsiphilin N-terminus (Oo pDEST 17) and other proteins. Primary antibody anti-α-LTX antibody 1 : 100, secondary antibody anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000. Lane L: SeeBlue® Pre-Stained Standard, lane 1: Oo pDEST 17, lane 2: raw antigen (supernatant) of O. ostertagi adults, lane 3: raw antigen (pellet) of O. ostertagi adults, lane 4: raw antigen (pellet and supernatant) of O. ostertagi adults, lane 5: major sperm protein of D. viviparus, lane 6: protein disulfide isomerase of D. viviparus, lane 7: NMT of D. viviparus, lane 8: paramyosin of A. caninum. Arrows mark the stained bands in lane 1 (depsiphilin) and lane 7 (NMT)

Results 129

6.7.6.2 Dynabeads® α-LTX coated Dynabeads® were also used for testing α-LTX for specific binding to the recombinant depsiphilin N-termini. In experiments with Dynabeads® coated with the One-Step coating procedure, no α-LTX was detected after boiling the particles for elution. A band the size of depsiphilin’s N-terminus was found. These results indicate a nonspecific binding of recombinant protein to the beads and a failure of the coating procedure.

In experiments with particles coated with the Two-step coating procedure, two bands were present in the Coomassie-stained gel after loading the supernatant of boiled particles; one of approx. 130 kDa (α-LTX) and one of approx. 55 kDa. The pattern of bands in the immunoblot with the anti-Hc110-R antibody from project 8214 was identical to the pattern of the depsiphilin’s N-terminus, whereas the anti-α-LTX -antibody seemed to partially stain the depsiphilin as well (Figure 19).

kDa kDa 250 250 98 98 64 64 50 50

36 36

L 1 L 2 L 1 L 2

Figure 19: Coomassie-stained gel (left) and immunoblot (right) of an experiment with Dynabeads® coated with α–LTX with the Two-Step coating procedure. Target was purified recombinant O. ostertagi depsiphilin N-terminus. Lane L: SeeBlue® Plus2 Pre-Stained Standard, lanes 1 and 2: boiled dynabeads (= eluate). Arrows indicate the expected sizes of α–LTX (130 kDa) and depsiphilin N-terminus (approx. 55 kDa). Immunoblot: Lane 1 blotted with specific anti-Hc110-R antibody sample 4 of rabbit 5062 (project 8214) 1 : 2000, presenting the typical pattern of three bands; lane 2 blotted with anti-α–LTX 1 : 100. Secondary antibody for both lanes anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000

130 Results

This result was tested for its specificity. One experiment compared the binding affinities of α–LTX coated particles to the depsiphilin N-terminus in presence of bovine serum albumin (BSA) and the binding to BSA alone without the depsiphilin N-terminus. These experiments showed a nonspecific binding of BSA to the beads and, moreover, a nonspecific binding of anti-α–LTX antibody to BSA (data not shown). In another experiment a sample of beads was processed with the Two-Step coating procedure but without α–LTX. The nonreacted activated carboxylic acid groups were quenched as previously described (5.24.3). These beads were incubated with depsiphilin N-terminus protein, and elution was performed by boiling the particles. The eluate contained the protein (Figure 20). Hence the recombinant N-terminus bound to the particles nonspecifically.

kDa 250 98 64 50

36

L 1 2 3 4

Figure 20: Immunoblot with samples of an experiment with Dynabeads® coated without protein. Primary antibody sample 4 of rabbit 5062 (project 8214) 1 : 2000, secondary antibody anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate 1 : 3000. Lane L: SeeBlue® Pre-Stained Standard, lane 1: target sample O. ostertagi depsiphilin N-terminus, lane 2: supernatant after wash step with Tris buffer, lane 3: supernatant after wash step with PBS buffer, lane 4: beads loaded onto the gel after boiling (eluate). Arrow marks the size of the main depsiphilin band

Results 131

6.8 Eukaryotic Expression

6.8.1 Ca2+ Influx after Transfection with LipofectamineTM COS-7 cells transfected with either O. ostertagi depsiphilin (lat-1) pcDNA 3 expression construct, empty vector pcDNA 3, H. contortus latrophilin-like protein 2 (lat-2) pcDNA 3.1 His B© expression construct, or empty vector pcDNA 3.1 His B© were examined for their reaction to an α–LTX stimulus. The response of transfected cells was observed previously to differ between different lots of α–LTX in experiments with Hc110-R transfected cells, so the optimal concentration had to be determined for each lot (personal communication Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf). Therefore, cell aliquots were exposed in subsequent experiments to α–LTX stimuli of 50 pM, 200 pM, 500 pM, and 2000 pM. lat-1 and lat-2 transfected cells reacted to 500 pM α–LTX with a peak of the F340 / F380 ratio, followed by an elevated level (plateau), indicating an increase in the intracellular Ca2+ concentration. The calculated increase in the intracellular Ca2+ concentration was about 50 nM for lat-1 transfected cells and about 30 nM for lat-2 transfectants. The optimal concentration of α–LTX was therefore determined as 500 pM for the respective setup of cells and α–LTX lot. Subsequent replicate measurements with 500 pM α–LTX and a new aliquot of cells for each experiment provided different results. One sample of lat-1 transfected cells reacted to 500 pM α–LTX as before, with a peak followed by a plateau, indicating an increase in the intracellular Ca2+ concentration of 80 nM; two other samples did not react. The baseline of the sample that reacted was initially lower than the baselines of the other samples. After reaction, the line reached approximately the level the others had before. This pattern was also observed in the experiments performed for determining the optimal concentration of stimulus for lat-1 and for lat-2 transfected cells. The cells transfected with pcDNA 3 empty vector did not react to α–LTX. The replicated measurements with lat-2 transfected cells indicated no reaction to α–LTX, although the cells had previously reacted during the experiments for determining the optimal concentration of 500 pM α–LTX. The pcDNA 3.1 His B© empty-vector transfected cells also did not react, but showed an increasing intracellular Ca2+ concentration after the addition of water as a negative control. The graphs illustrating these results are shown in Figure 21, Figure 22, and Figure 23.

132 Results

A α–LTX

200

180

160

140

120 [nM] i ] 100 2+

[Ca 80 lat-1lat- 150 50 pM pM 60 lat-1lat- 1200 200 pM pM lat-1lat- 1500 500 pM pM 40 lat-1lat- 12000 2000 pM pM 20

0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

B α–LTX / water

350

300

250

200 [nM] i ] 2+ 150 [Ca lat-1lat- 1measurement measurement 1 1 100 lat-1lat- 1measurement measurement 2 2 lat-1lat- 1measurement measurement 3 3 lat-1 water control 50 lat-1 water control

0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

Figure 21: Reaction of O. ostertagi depsiphilin (lat-1) transfected COS-7 cells to α–LTX stimuli and water control (Lipofectamine™ transfected cells). Arrows mark the addition of α–LTX after approx. 30 sec. A: reaction to different concentrations of α–LTX, B: subsequent measurements with 500 pM α–LTX and water control Results 133

A α–LTX / water 200

180

160

140

120 [nM] i ] 100 2+

[Ca 80

60 pcDNA 3 measurementpcDNA 13 measurement 1 pcDNA 3 measurementpcDNA 23 measurement 2 40 pcDNA 3 water controlpcDNA 3 water control 20

0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

B

400

350

300

250 α–LTX / water [nM] i ] 200 2+

[Ca 150

100 pcDNA 3.1 measurement 1 pcDNA 3.1 measurement 1 pcDNA 3.1 measurement 2 50 pcDNA 3.1 measurement 2 pcDNA 3.1pcDNA water 3.1 control water control 0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

Figure 22: Reaction of empty-vector transfected COS-7 cells to 500 pM α–LTX and water control (Lipofectamine™ transfected cells). Arrows mark the addition of α–LTX after approx. 30 sec. A: pcDNA 3 transfected cells as control for pcDNA 3 / lat-1 transfected cells, B: pcDNA 3.1 His B© transfected cells as control for pcDNA 3.1 His B© / lat-2 transfected cells

134 Results

A α–LTX 400

350

300

250 [nM] i ] 200 2+

[Ca 150

lat-2 50 pM 100 lat-2 50 pM lat-2 200 pM lat-2 200 pM 50 lat-2 500 pM lat-2 500 pM lat-2 2000 pM lat-2 2000 pM 0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

B

400 α–LTX / water

350

300

250 [nM] i ] 200 2+

[Ca 150

100 lat-2 measurement 1 lat-2 measurement 1 lat-2 measurement 2 lat-2 measurement 2 50 lat-2 measurement 3 lat-2 measurement 3 lat-2 water control lat-2 water control 0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 time [s]

Figure 23: Reaction of H. contortus latrophilin-like protein 2 (lat-2) transfected COS-7 cells to α–LTX stimuli (Lipofectamine™ transfected cells). Arrows mark the addition of α–LTX after approx. 30 sec. A: reaction to different concentrations of α–LTX, B: subsequent measurements with 500 pM α–LTX and water control

Results 135

6.8.2 Ca2+ Influx after Transfection with FuGENE The first experiment with lat-1 transfected cells was performed with each sample having a different DNA / FuGENE ratio. The optimal concentration for a stimulus was previously determined as 200 pM α-LTX for this lot. In all samples a peak was observed, followed by a plateau of the intracellular Ca2+ concentration. The higher the initial amount of FuGENE, the higher the peak and the higher the following plateau, which was 10 – 40 nM higher than the initial concentration (see Figure 24). For the second experiment the lat-1 transfected cell samples transfected with 15 and 20 µl of FuGENE were pooled due to their low cell numbers. The Ca2+ influx measurement was performed on the pooled sample, whereas the lat-1 transfected cells transfected with 25 µl FuGENE were examined independently. The pEGFP-N2 empty-vector transfected cells were also pooled, then two fractions of the pool were measured. The cells of the lat-1 pool did not react to α–LTX, whereas the other sample of lat-1 transfected cells showed a peak followed by a plateau of the intracellular Ca2+ concentration of approx. 40 nM higher than the initial concentration (Figure 25). The lat-2 transfected cells showed peaks of approx. 70 – 125 nM, and the subsequent plateau in the Ca2+ concentration was in a range of about 30 – 70 nM higher than the initial concentration (Figure 26). One sample of the cells transfected with pEGFP-N2 empty vector used as negative control reacted with a peak of 85 nM, followed by a rise in the intracellular Ca2+ concentration of 50 nM. Another sample did not react, a second stimulus of α–LTX produced only a peak without the following plateau observed in lat-1 or lat-2 transfected cells (Figure 27). In other experiments with pEGFP-N2 empty-vector transfected COS-7 cells, the cells did not react to an α–LTX stimulus (personal communication Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf).

136 Results

A

600 ATP

500

400 [nMol] i

] 300 α–LTX 2+ [Ca 200

100 lat-1lat- 1measurement measurement 1 1

0 0 100 200 300 400 500 600 700 800 900 1000

time [s]

B ATP

600

500

400

[nMol] α–LTX i

] 300 2+ [Ca 200

100 lat-1lat- 1measurement measurement 2 2

0 0 100 200 300 400 500 600 700 800 900 1000

time [s]

Figure 24: Reaction of lat-1 transfected COS-7 cells to α–LTX and ATP (FuGENE transfected cells). Arrows mark the addition of 200 pM α–LTX after approx. 100 sec and of 100 µM ATP after approx. 700 sec. A: 15 µl FuGENE, B: 20 µl FuGENE, C (next page): 25 µl FuGENE used for transfection Results 137

C

600 ATP

500

400 α–LTX [nMol] i

] 300 2+ [Ca 200

100 lat-1lat-1 measurement measurement 3 3

0 0 100 200 300 400 500 600 700 800 900 1000

time [s]

ATP

1000

900

800

700

600 [nM] i ] 500 2+ α–LTX [Ca 400

300 lat-1 measurement 1 lat-1 pool 200

100 lat-1 measurement 4 lat-1 pool 0 0 100 200 300 400 500 600 700 800 900 1000 time [s]

Figure 25: Reaction of O. ostertagi depsiphilin (lat-1) transfected COS-7 cells to 200 pM α–LTX (FuGENE transfected cells). Arrows mark the addition of α–LTX after approx. 100 sec and of 100 µM ATP after approx. 760 sec

138 Results

400

350 α–LTX

300

250 [nM] i ] 200 2+ [Ca 150 lat-2lat -measurement2 measurement 1 1 lat-2lat- measurement2 measurement 2 2 100 lat-2lat- measurement2 measurement 3 3

50

0 0 100 200 300 400 500 600 700 800 900 1000 time [s]

Figure 26: Reaction of H. contortus latrophilin-like protein 2 (lat-2) transfected COS-7 cells to 200 pM α–LTX (FuGENE transfected cells). Arrow marks the addition of α–LTX after approx. 100 sec

400 α–LTX

350

300

α–LTX 250 [nM] i ] 200 2+ [Ca 150

pEGFP-N2pEGFP-N2 measurement measurement 1 1 100 pEGFP-N2pEGFP-N2 measurement measurement 2 2

50

0 0 100 200 300 400 500 600 700 800 900 1000 time [s]

Figure 27: Reaction of pEGFP-N2 empty-vector transfected COS-7 cells to 200 pM α–LTX (FuGENE transfected cells). Arrows mark the addition of α–LTX after approx. 100 and 700 sec

Results 139

6.8.3 Detection of Recombinant Protein in Western Blot With specific anti-Hc110-R antibody from project 8214 (affinity-purified antibody from rabbit 5062) and the HRP conjugated anti-rabbit antibody, the COS-7 cells transfected with LipofectamineTM were shown to contain fragments of depsiphilin within membrane-protein preparations. The detection was performed using the chemiluminescence method. The detected bands were approx. 60 and 45 kDa in size. These bands were detected only and specifically in the depsiphilin (lat-1) transfected cells, not in cells transfected with the pcDNA 3 empty vector. In the Coomassie-stained gel no prominent bands differed between the lanes (see Figure 28).

A B C D

kDa kDa kDa kDa 191 191 191 191

97 97 97 97

64 64 64 64

51 51 51 51

39 39 39 39

26 26 26 26

L 1 2 L 1 2 L 1 2 L 1 2

Figure 28: Chemiluminescence blot of 10 µg of a membrane-protein preparation of lat-1 and pcDNA 3 empty-vector transfected COS-7 cells. Primary antibody affinity-purified anti-Hc110-R antibody from project 8214, 1 : 200. Secondary antibody HRP-conjugated anti-rabbit antibody, 1 : 10 000. Substrate diluted 1 : 10. Lane L: SeeBlue® Plus2 Pre-Stained Standard (resolution in 1 X MOPS buffer different from conventional SDS system!) Lane 1: lat-1 transfected cells, lane 2: empty-vector transfected cells. A: developed X-ray film, exposure period 1 min, B: nitrocellulose membrane, C: overlay of X-ray film and membrane, D: Coomassie-stained gel

140 Results

This detection system was also used to examine membrane-protein preparations from adult H. contortus, C. oncophora, and O. ostertagi. The procedure was performed as above, but no specific bands were detected with the affinity-purified anti-Hc110-R antibody from project 8214. The detection system for the lat-2 transfected cells, including the anti-His antibody and HRP conjugated anti-mouse antibody, also could not be optimized. Initial experiments failed to detect prominent bands.

6.9 Plasmids for Expression of Depsiphilin Genes in C. elegans

Sequencing of a cloned PCR product from a PCR using the proof-reading PhusionTM Hot Start DNA High-Fidelity Polymerase showed that the aliquot of the cosmid B0457 had, compared to the published sequence of this cosmid, the following differences within the 3 kb fragment containing the putative lat-1 promotor region: a point mutation, two insertions of one and of two nucleotides, and a deletion of eight nucleotides. Since this clone was previously used for expression experiments in the group of Lindy Holden-Dye, School of Biological Sciences, Southampton, these differences were accepted. The successful construction of the plasmids was confirmed by restriction digestion (data not shown). At the time of writing, the final plasmid was being sequenced.

6.10 Real-time PCR

6.10.1 Testing for Absence of Genomic DNA A sample of H. contortus cDNA used for real-time PCR was tested with intron-flanking primers for the absence of genomic DNA. The PCR with cDNA as template produced smaller PCR products than the PCR with genomic DNA did. This was shown with a primer pair within the sequence encoding the 60 S acidic ribosomal protein as well as for two primer pairs within the Hc110-R sequence. For the primer pair Hc110-R qPCR 3F / Re, no PCR product was expected from genomic DNA, since the reverse primer spanned an exon / intron junction (Figure 30). Results 141

bp A bp B

500 500 200 100 200 100

L 1 2 3 4 5 N L 1 2 N

Figure 29: 1 % agarose gels with PCR products from the PCR to test cDNA from H. contortus for the absence of genomic DNA. A: PCR with Hc110-R-specific primers; lane L: 100 bp ladder; lane 1: primer pair Hc110-R qPCR 3 F / Re, template cDNA; lane 2: primer pair Hc110-R qPCR 3 F / Re, template genomic DNA; lane 3: primer Hc110-R qPCR 3F without additional reverse primer, template cDNA; lane 4: primer pair Hc110-R qPCR 3 F / Hc110-R VII Re, template cDNA; lane 5: primer pair Hc110-R qPCR 3 F / Hc VII Re, template genomic DNA; lane N: no-template control. B: PCR with 60S specific primers; lane L: 100 bp ladder; lane 1: primer pair 60S F / Re, template cDNA; lane 2: primer pair 60S F / Re, template genomic DNA; lane N: no-template control

Hc110-R qPCR 3F Hc110-R qPCR 3Re genomic DNA cDNA genomic DNA cDNA genomic DNA cDNA genomic DNA Hc110-R VII Re cDNA

Figure 30: Positions of Hc110-R-specific primers used for testing H. contortus cDNA destined for real-time PCR for the absence of genomic DNA within an alignment of Hc110-R cDNA and genomic DNA sequences. The sequence at the 5’ end of the intron (intron sequence taken from WAERING, 2002) was partially complementary to the reverse primer Hc110-R qPCR 3 Re (dotted box)

142 Results

Nevertheless, in the PCR with genomic DNA as template a product was observed. It was larger than the product derived from the PCR with cDNA. The difference in size was approximately in the range of the intron’s size. An image of the agarose gel is presented in Figure 29. A closer look at the intron’s sequence showed that the 3’ end of the intron was partially complementary to the reverse primer’s sequence and therefore provided a binding site for the primer (see Figure 30). Since only the small bands were observed in the products of the PCR with cDNA as template, the absence of genomic DNA within the cDNA destined for real-time PCR was confirmed. The size of the band in lane 3 in Figure 29 A is consistent with the size of a PCR product with the primers Hc110-R qPCR 3 F, which was added as primer in the PCR reaction, and the primer Hc110-R qPCR 1 Re, used for cDNA synthesis.

6.10.2 Definition of Standards To establish standard curves covering the range of copy numbers detected in the samples, test runs were performed with standards containing 106 to 101 copy numbers per reaction. Although the cDNA used for the 18 S assay was already used at a dilution of 1 : 10 000, the detected amounts in the samples were still in the range of approx. 106. The copy numbers detected in the 60 S and depsiphilin assays were approx. 103 to 104. Therefore, the standards were chosen as presented in Table 7.

Standard 1 2 3 4 5 6

18 S 108 107 106 105 104 103

60 S 107 106 105 104 103 102

depsiphilin 107 106 105 104 103 102

Table 7: Standards used for establishment of standard curves. The numbers give the copy numbers of plasmid per µl and therefore per real-time PCR reaction

Results 143

6.10.3 Comparison of Amplification Efficiencies The comparison of amplification efficiencies in different dilutions of cDNA did not indicate large differences of amplification of the target gene depsiphilin and the reference genes 60 S and 18 S. For diagrams and tables presenting these results refer to the appendix (8.1.3).

6.10.4 Real-time PCR Products The products of the real-time PCR assays were analyzed in a 1 % agarose gel. Since the products of the 60 S assays initially showed two bands instead of one, the setup had to be optimized (data not shown). The second band was identified as a product of the respective 60 S forward primer used for real-time PCR and the reverse primer Hc 60S Re, used in the cDNA synthesis reaction. Contrary to the assays of the other genes examined, the cDNA synthesis primer was only 75 bp (H. contortus) or 123 bp (O. ostertagi) downstream of the real-time PCR reverse primer. To avoid competition between two PCR reactions, the cDNA synthesis primer Hc 60S Re was also used for the real-time PCR reaction. Therefore, the real-time PCR products of the 60 S assays were slightly larger than those of the other assays.

The cDNA synthesis primers used for the other genes were more than 300 bp downstream and produced no additional bands. The bands resulting from the depsiphilin real-time PCR appeared weaker than the bands of the other assays. The expected products in the depsiphilin assays were less than 100 bp, whereas the expected products of the other assays were larger, up to 214 bp for the O. ostertagi 60 S assay. The smaller size makes the absolute amount of DNA lower, and the bands appear weaker. The PCR products of the analyzed runs in a 1 % agarose gel are presented in Figure 31.

144 Results

bp bp 500 500 100 100 A L 1 2 3 4 5 6 N M F E L1 L3 1 2 3 4 5 6 L L N M F E L1 L3 1 2 3 4 5 6 N M F E L1 L3 L 18 S 60 S Hc110-R

bp bp 500 500

100 100

B L 1 2 3 4 5 6 N M F E L1 L3 1 2 3 4 5 6 L L N M F E L1 L3 1 2 3 4 5 6 N M F E L1 L3 L 18 S 60 S depsiphilin

Figure 31: Real-time PCR products analyzed on a 1 % agarose gel

A: H. contortus, B: O. ostertagi. Box 18S: PCR products from 18 S assay, box 60S: PCR products from 60 S assay, boxes Hc110-R and depsiphilin: PCR products from assays for Hc110-R and O. ostertagi depsiphilin, respectively. Lane L: 100 bp ladder, lanes 1 – 6: standards 1 – 6 (for standard definition see Table 7), lane N: no-template control, lane M: males, lane F: females, lane E: eggs, lane L1: first / second stage larvae, lane L3: third stage larvae

Assay Efficiency Slope R2 values

Hc 18 S 91.5 % -3.544 1

Hc 60 S 98.9 % -3.349 0.995

Hc110-R 92.5 % -3.517 0.999

Oo 18 S 92.9 % -3.506 0.999

Oo 60 S 97.5 % -3.383 1

Oo depsiphilin 93.5 % -3.489 0.999

Table 8: Efficiencies, slopes of standard curves, and R2 values of the real-time PCR assays Hc: H. contortus, Oo: O. ostertagi

Results 145

6.10.5 Analysis of Real-time PCR Raw Data Optimization and evaluation of the real-time PCR required several preliminary experiments; consequently only one pool sample of each stage was left for the final analysis. The samples were run as duplicates. Therefore, a complete statistical analysis was not applicable. The efficiencies, slopes of the standard curves, and 2 R values are presented in Table 8. Mean Ct values, mean copy numbers, standard deviations and coefficients of variance of the duplicates are presented in the appendix (8.1.2, Table 12 - Table 17).

6.10.6 Analysis of Relative Amounts of Transcripts

The means of the Ct values and of the automatically estimated copy numbers of the target genes were normalized to the values of the reference genes. The results of the two methods were similar. As a target gene the depsiphilin transcript was normalized to 18 S and to 60 S; additionally 18 S was normalized to 60 S. The normalized relative amounts of gene transcripts are presented in the diagrams of Figure 32 (H. contortus) and Figure 33 (O. ostertagi); all amounts were compared to the amounts determined in the male sample, which were set to 100 %. These data are additionally presented as percentages in Table 18 and Table 19 in the appendix (8.1.2). The diagrams show that the determined relative transcription levels heavily depended on the reference gene used. Using 18 S as reference gene, the transcription of depsiphilin appeared to be upregulated in the eggs of both species, H. contortus and O. ostertagi, whereas the other stages were not or only weakly different from the males, which were used as calibrator. Using 60 S as a reference gene, the outcome was different for the two species. In H. contortus the transcription level of Hc110-R appeared to decrease from males over females, eggs, L1 / L2 to L3. In O. ostertagi the transcription levels appeared similar in males and eggs, whereas L3 had approx. 50 %, females 40 % and L1 / L2 20 % of the amount of transcript in males. The ratio of 18 S to 60 S transcripts appeared also to be variable between the stages. The pattern of relative amounts was not the same in the stages of H. contortus and O. ostertagi.

146 Results

A Hc 110-R normalized to 18 S 800% DeltaDelta Ct 700% Copy 600% numbers 500% 400% 300%

Relative amount Relative 200% 100% 0% Males Females Eggs L1/L2 L3

Hc110-R normalized to 60 S B 120% DeltaDelta Ct 100% Copy numbers 80%

60%

40% Relative amount Relative 20%

0% Males Females Eggs L1/L2 L3

18 S normalized to 60 S C 120% DeltaDelta Ct 100% Copy numbers 80%

60%

40% Relative amount Relative 20%

0% Males Females Eggs L1/L2 L3

Figure 32: Relative amounts of gene transcripts in developmental stages of H. contortus determined using the 2 -Ct method (Delta Delta Ct) and the comparison of absolute copy numbers. The values determined for males were set to 100 % Results 147

A Oo depsiphilin normalized to 18 S 400% DeltaDelta Ct 350% Copy 300% numbers 250% 200% 150%

Relative amount Relative 100% 50% 0% Males Females Eggs L1/L2 L3

Oo depsiphilin normalized to 60 S B 120% DeltaDelta Ct

100% Copy numbers 80%

60%

40% Relative amount Relative 20%

0% Males Females Eggs L1/L2 L3

18 S normalized to 60 S C 120% DeltaDelta Ct 100% Copy numbers 80%

60%

40% Relative amount Relative 20%

0% Males Females Eggs L1/L2 L3

Figure 33: Relative amounts of gene transcripts in developmental stages of O. ostertagi determined using the 2 -Ct method (Delta Delta Ct) and the comparison of absolute copy numbers. The values determined for males were set to 100 %

148 Results

Copy numbers (Hc)

900% Males 800% Females 700% 600% Eggs 500% L1/L2 400% L3 300%

Relative amount Relative 200% 100% 0% 18 S 60 S Hc110-R Transcript

Figure 34: Relative copy numbers of gene transcripts in developmental stages of H. contortus in comparison to the copy numbers in males (males used as a calibrator, number of copies set to 100%)

Copy numbers (Oo)

500% Males 400% Females Eggs 300% L1/L2

200% L3

Relative amount Relative 100%

0% 18S 60S depsiphilin Transcript

Figure 35: Relative copy numbers of gene transcripts in developmental stages of O. ostertagi in comparison to the copy numbers in males (males used as a calibrator, number of copies set to 100%)

Results 149

6.10.7 Analysis of Copy Numbers To examine the relative transcription levels of the target gene for the influence of unstable transcription of a putative reference gene, the numbers of copies were determined by applying the standard curve and then compared. The copy numbers were then related to the amount determined for the males, for which the value was set to 100 %. The data are presented in Figure 34 (H. contortus) and Figure 35 (O. ostertagi).

The percentages are also presented in Table 18 and Table 19 in the appendix (8.1.2). In both examined species the 60 S transcripts appeared to produce the most heterogenous results with H. contortus eggs having more than 800 % of 60 S transcripts compared to the males. Except for H. contortus L3, the relative amount of 18 S transcripts was the most homogenous between the stages in both species. The relative amount of depsiphilin transcripts in H. contortus females and eggs was approx. 3.7 fold higher than in males, whereas the transcripts in L3 appeared to be only 30 % of the amount detected in males. In O. ostertagi the transcription level of depsiphilin was within a narrow range for males, females, L1 / L2, and L3, whereas the amount of transcript detected in eggs was approx. 2.5 fold higher.

Discussion 151

7 Discussion

Due to rising resistance of parasitic nematodes to anthelmintic drugs, the need for new classes of drugs is increasing. Cyclooctadepsipeptides not only have broad anthelmintic activity but also a new mechanism of action. To understand the development of potential resistance and to possibly adapt compounds to their targets more exactly, it is crucial to understand the mechanism of action of the anthelmintic in detail. In H. contortus and C. elegans receptors for the cyclooctadepsipeptide emodepside have been previously identified. In the present study putative orthologs of these receptors are described for C. oncophora and O. ostertagi. Furthermore, orthologs of other putative receptors discussed for C. elegans have been identified in H. contortus and C. oncophora.

7.1 Depsiphilins

7.1.1 Sequences In PCR experiments putatively orthologous genes of Hc110-R and C. elegans latrophilin-like protein 1 (LAT-1) were identified in C. oncophora and O. ostertagi cDNA. To facilitate the nomenclature, the newly identified receptors were grouped together with Hc110-R regarding their putative function as depsiphilins. The genes in C. oncophora and O. ostertagi were shown to be highly similar to each other, sharing 91 % of amino acid sequence. The identity with C. elegans LAT-1 was distinctly lower with only 45 – 47 % identity. As was previously reported for Hc110-R (SAEGER, 2000), the new members of the group of depsiphilins also showed sequence identities with mammalian latrophilins (LPH) as high as 26 %.

Although not a high value of identity, this similarity included structural characteristics showing a relationship between the mammalian and nematode receptors. The programs Phobius, ConPred II and TMMOD, used for prediction of transmembrane regions, predicted seven transmembrane helices for both C. oncophora and O. ostertagi depsiphilin. This prediction met the expectations raised by the high similarity to Hc110-R, since this receptor is thought to act as a GPCR (SAEGER et al., 2001) as was shown previously for C. elegans LAT-1 (WILLSON et al., 2004a). C. elegans LAT-1 is regarded as the nematode ortholog of mammalian LPH

152 Discussion

(MEE et al., 2004), which are also known to be GPCRs (DAVLETOV et al., 1996; KRASNOPEROV et al., 1997). The prediction of signal peptides, extracellular N-termini, and intracellular C-termini were therefore also expected. The N-terminus of GPCRs contains the binding site for ligands, whereas the C-terminus is needed for interaction with the G-protein (STRYER, 1995b). Hc110-R was also examined using the prediction programs, and the results were consistent with those for C. oncophora and O. ostertagi depsiphilin, except for an additional TM helix predicted by ConPred II upstream of the first consistently predicted TM helix. Since the other programs did not detect this TM helix, this result was regarded as misinterpretation.

7.1.2 Prediction of Conserved Domains in Depsiphilins The search for conserved domains in the depsiphilins using the NCBI CDART software resulted in four detected conserved domains, all also predicted in C. elegans LAT-1 and mammalian LPH. In addition to the seven TM helices (7-TMR) mentioned above, a galactose-binding lectin domain, a domain present in hormone receptors, and a GPCR proteolytic site (GPS) were detected. The CDART compares sequences to sequence motifs from databases for conserved domains in proteins, such as the Pfam (WHEELER et al., 2007) and the Simple Modular Architecture Research Tool (SMART) (LETUNIC et al., 2006; SCHULTZ et al., 1998) databases. The prediction is therefore detecting certain patterns of amino acids within the query sequence. The actual function of the respective domain is not necessarily known. Even if the function of a domain is known in a certain protein, the detection of the domain in another protein is only describing the motif, and the function may not be maintained. The 7-TMR, however, is a typical structural characteristic in GPCRs, and the GPS is a characteristic of certain GPCRs. As the name GPS indicates, some GPCRs are known to be cleaved at the GPS during posttranslational modification (KRASNOPEROV et al., 1997; VOLYNSKI et al., 2004). This topic and its potential influence on the depsiphilins will be discussed in chapter 7.4.1. The GPS motif is common for family 2 GPCRs, receptors with a large N-terminus containing structural motifs for interactions with other cells or the extracellular matrix. These receptors are therefore regarded as cell-adhesion GPCRs, which allow fast and sensitive reactions to external stimuli (KRASNOPEROV et al., 2002). The detection of a galactose-binding lectin domain indicates an amino acid pattern similar to a Discussion 153 domain in eggs of the sea urchin Anthocidaris crassispina. This cysteine-rich domain was shown to bind D-galactoside (a galactoside consists of galactose covalently bound to another molecule) and L-rhamnose, both sugar molecules having the same orientation of the hydroxyl group at C2 and C4 of their six-membered pyranose ring (MIAN, N. and A. BATEMAN, 2006). Whether this sugar binding also occurs at the depsiphilins and mammalian LPH, and which physiological role the domain plays, remains to be clarified. The domain present in hormone receptors is in the SMART database merely described as being found in the extracellular part of some hormone receptors (SMART DATABASE, 2006b). According to the entry of the Pfam database (BATEMAN, A., 2006), the domain contains four cysteine residues, which are probably involved in disulfide bonds. The domain is regarded as a potential binding domain for ligands. While C. elegans LAT-1 and the predicted LAT-1 ortholog in C. briggsae were predicted to have exactly the same conserved domains as the depsiphilins, mammalian LPH were predicted to contain an additional domain, the olfactomedin-like domain. This domain was first identified in the eponymous extracellular glycoprotein olfactomedin, which is expressed in the neuroepithelium of the bullfrog (SNYDER et al., 1991). The function of olfactomedin is not known in detail. Mutations in the olfactomedin-like domain of myocilin, which is highly expressed in the trabecal meshwork and sclera of the eye, lead to glaucoma. Olfactomedin-like domains were further shown to be involved in the interaction of myocilin and optimedin, which are expressed in the retina and brain (SMART DATABASE, 2006c; TORRADO et al., 2002). The exact function of this domain in the LPH is still unknown.

Taken together, the prediction of conserved domains in the depsiphilins indicates structural similarity to C. elegans and C. briggsae LAT-1 and to mammalian LPH. However, a statement about the functional meaning of the domains in depsiphilins is not possible.

154 Discussion

7.2 Latrophilin-like Protein 2

7.2.1 Sequences In C. elegans the role of another receptor for emodepside was previously discussed by WILLSON and colleagues (2004a). The group suggests the latrophilin-like protein 2 (LAT-2) as a further potential target protein for emodepside. In this work putative orthologs of this receptor were identified in H. contortus and C. oncophora. The receptors showed, like the depsiphilins, sequence identities to GPCRs, especially other nematode LAT-2 and mammalian LPH. The newly identified parasitic LAT-2 (approx. 1300 aa) were found to be larger than depsiphilins (approx. 990 aa). Compared to each other they had an identity of 82 % at the amino acid level and of 77 % at the cDNA level. The amino acid sequences had an identity of 47 % with C. elegans LAT-2, whereas the nucleotide sequences had an identity of 54 % with C. elegans lat-2 cDNA. These levels of identity between each other and with C. elegans lat-2 are within the same range of identity of the depsiphilins with the lat-1 sequences of free-living nematodes. The different outcomes of the blastx searches, indicating chimpanzee LPH-2 to be the most similar mammalian LPH for H. contortus lat-2, whereas the best match for C. oncophora lat-2 was chimpanzee LPH-3, should not be overestimated. The resulting alignments matched at different regions of the parasitic LAT-2 sequences. Considering the low overall identity (20 %) of the parasitic LAT-2 with the chimpanzee LPH-2 and 3, the resulting order of the best matches was probably influenced by minor differences.

7.2.2 Prediction of Conserved Domains in LAT-2 The structural similarity of the parasitic LAT-2 with the known nematode latrophilin-like proteins and with mammalian LPH is striking. Compared to C. elegans and C. briggsae LAT-2, parasitic LAT-2 have an additional galactose-binding lectin domain of the C-type. In addition to the domains present in the depsiphilins (discussed in 7.1.2 and 7.4.1) parasitic LAT-2 have two galactose-binding lectin domains within their N-terminus. As mentioned above (7.1.2), the prediction of conserved domains is only descriptive, a function can therefore only be assumed. Nevertheless, galactose-binding lectin domains are known to act as calcium-dependent carbohydrate-binding modules, mainly, but not exclusively, found Discussion 155 in vertebrates. Other galactose-binding lectin domains of the C-type bind protein ligands, lipids, and inorganic surfaces. The domains are involved in such functions as extracellular matrix organization, endocytosis, complement activation, pathogen recognition, and cell-cell interactions (SMART DATABASE, 2006a). The functions of the two galactose-binding lectin domains of the C-type in the parasitic LAT-2 remain to be clarified. The presence of two of these domains might indicate their importance for the physiological function of the receptor, perhaps in interactions with other cells or the extracellular matrix.

7.3 Expression of Isolated N-termini of Depsiphilins

The depsiphilin in H. contortus, Hc110-R, was previously shown not only to bind emodepside but also, like mammalian LPH, α-LTX (SAEGER, 2000; SAEGER et al., 2001). The examination of binding of α-LTX to Hc110-R in this previous work was performed, amongst other methods, on the isolated N-terminus expressed in E. coli. The same approach was chosen to investigate the depsiphilins of C. oncophora and O. ostertagi for their binding affinities to α-LTX. The chosen fragments of C. oncophora and O. ostertagi depsiphilins lacked five C-terminal amino acids compared to the examined fragment of Hc110-R. The GPS domain, 7-TMR, and intracellular C-terminus were not included. The prokaryotic expression of the N-termini led to insoluble recombinant protein, present in inclusion bodies. Inclusion bodies often arise as a consequence of misfolded protein. Since misfolding was expected to impair the binding affinities of the N-terminus and insoluble protein was inadequate for the planned experiments, several approaches in manifold E. coli expression systems were tried to obtain soluble protein. The methods included fusion to different tags known to influence solubility, supplementation of rare codons, coexpression with chaperones and with a disulfide isomerase, mechanisms to control for toxicity, and expression at low temperatures. None of these experiments resulted in soluble protein. Whether or not the formation of inclusion bodies was due to misfolding remains unclear. The fragment was chosen to exclude the transmembrane region, which would have led unavoidably to insolubility. The interaction of amino acids within the N-terminus with amino acids in the TMR to potentially support correct folding was therefore not possible. These considerations, however, were subordinated, since the previous experiments with the Hc110-R N-terminus had been

156 Discussion successful (SAEGER, 2000). Some recombinant proteins in inclusion bodies are still active (DE GROOT and VENTURA, 2006), and the formation of inclusion bodies also has advantages: the protein is present in large amounts, purification is simple, and contamination low. However, for further examinations and for testing the binding affinities, the protein needed to be solubilized. The method of choice was to purify the inclusion bodies, to solubilize the protein under denaturing conditions, and to refold the protein in Dilution and Refolding buffer. Concentration and further purification was performed using FPLC technology. The eluted protein was confirmed by MALDI-MS analysis to be the recombinant depsiphilin N-terminus. In addition to the band with the expected size, two smaller fragments were detected by the specific anti-Hc110-R-antibody from project 8214 (see 7.3.1). For C. oncophora both additional bands were confirmed to be fragments of depsiphilin, whereas for O. ostertagi only the larger additional band was a depsiphilin fragment. Since the bands were relatively weak, the deviant result for the smallest band of O. ostertagi might be due to inaccurate excision.

7.3.1 Antibodies For this work, specific polyclonal antibodies for Hc110-R were produced by a custom service. The three epitopes within the N-terminus chosen for peptide synthesis and immunization were differently conserved between the sequences of Hc110-R and the new depsiphilins. Only the peptide sequence from project 8214 was 100 % identical for the three sequences. The peptide sequence from project 8213 was 78 – 84 % identical to the respective peptide in C. oncophora and O. ostertagi depsiphilin, whereas the peptide sequence from project 8215 was the least conserved, with 55 – 66 % identity. Serum samples of the immunized rabbits were taken at different time points. These samples were analyzed for their reactivity with the recombinant proteins, and the samples for affinity purification were selected. From each project affinity-purified antibodies, immune sera, and preimmune sera were received. As expected, the most appropriate antibody for detecting the new depsiphilins was the antibody from project 8214. The sera from rabbit 5062 in this project reacted better than the sera from rabbit 5061 from the same project, therefore, subsequent experiments were usually performed with antibodies from rabbit 5062. The affinity-purified sample and sample 4 from rabbit 5062 did not show large differences Discussion 157 in their sensitivity to purified recombinant depsiphilin N-terminus. The specificity could not be determined in raw antigen of worms, since either the amount of specific antigen was too low or the sensitivity of the antibody was insufficient for this amount. This issue remains to be further examined. In lysates of E. coli cells expressing the depsiphilin N-terminus, the specificity was high enough to detect clear bands of recombinant protein. In purified samples of depsiphilin N-terminus the antibody reproducibly detected three bands, the two smaller bands not being prominent in the Coomassie-stained gel. Guided by the antibody staining, these bands were sent to MALDI-MS analysis and, at least for C. oncophora, confirmed to be depsiphilin fragments (see above, 7.3). In lysates of eukaryotic cells expressing O. ostertagi depsiphilin strong bands were detected that were absent in empty-vector transfected cells. The antibodies from project 8213 were not as sensitive to the recombinant depsiphilin N-terminus as the antibodies from project 8214. Nevertheless, at higher concentrations they also reacted with the recombinant N-termini. The antibodies from project 8215 were reported to be most suitable to detect Hc110-R in transfected eukaryotic cells (personal communication, Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf). In conclusion, the antibodies produced during this work were shown to be a useful tool for investigating depsiphilins.

7.3.2 Functional Assays on Isolated N-termini As with the isolated N-terminus of Hc110-R (SAEGER, 2000), the prokaryotically expressed N-termini of C. oncophora and O. ostertagi depsiphilin were examined for their binding affinities to α-LTX.

7.3.2.1 α-LTX Blots For On-Blot assays the recombinant depsiphilin N-termini were run on an SDS-gel, subsequently renatured, and incubated with α-LTX in 50 % glycerol. These blots produced a pattern of three weak bands in the lanes of recombinant depsiphilin N-terminus. This pattern was not completely identical with the pattern of the Hc110-R-specific antibody from project 8214, the middle band was different. To challenge this result, several other recombinant proteins were tested in the same procedure; the depsiphilins were not stained more intensely than the other proteins. Moreover, the most intensely stained band was N-methyl-transferase (NMT) of the

158 Discussion bovine lungworm D. viviparus. This result may be due to nospecific detection of NMT by the anti-α-LTX antibody. The anti-α-LTX antibody was applied at a dilution of 1 : 100, since it was not sensitive enough to detect low amounts of α-LTX at dilutions higher than 1 : 100. This high concentration might have contributed to nonspecific staining. Staining NMT might also be due to binding of α-LTX to NMT, but this seems unlikely to be a specific binding. Since depsiphilins did not outperform other proteins in this assay, the previously observed band staining was not regarded as specific detection. False conformation of the recombinant N-terminus due to the lack of conformational stabilizing structures within the TMR might be a possible reason for this result. The staining might have occurred due to inefficient removal of α-LTX, since 50 % glycerol is much more viscous than the aqueous buffers usually used for immunoblotting or unspecific staining by the anti-α-LTX antibody. The absence of evidence for specific binding of α-LTX to depsiphilins in this experiment therefore does not exclude the potential for binding of α-LTX to native depsiphilins.

7.3.2.2 Dynabeads® The experiments with Dynabeads® used for capturing α-LTX with depsiphilin N-terminus and vice versa resulted in nonspecific binding of proteins to the Dynabeads®. An explanation for this result might be an insufficient quenching of unreacted activated carboxylic acid groups. In this assay the nonspecifically bound proteins were the depsiphilin N-terminus and bovine serum albumin, which were presented in aqueous buffers. An explanation involving the viscosity of the α-LTX solution, as in the On-Blot assays, is therefore not applicable.

Evaluating the results of Dot-Blot assays and experiments with Dynabeads®, the functional assays on the isolated N-termini of depsiphilins did not reveal reliable information about the binding affinities, neither confirming nor excluding potential binding affinities.

Discussion 159

7.4 Eukaryotic Expression

To examine the properties of the newly identified proteins as complete receptors, O. ostertagi depsiphilin and H. contortus latrophilin-like protein 2 were transiently expressed in COS-7 cells. This procedure was also described for Hc110-R by SAEGER (2000).

7.4.1 Western Blot of Membrane Protein A Western Blot of membrane-protein preparations of COS-7 cells expressing O. ostertagi depsiphilin indicated strong bands of approx. 60 kDa and 45 kDa. Mammalian latrophilins were previously described to be cleaved at their GPS, a proteolytic site upstream of the first transmembrane region. In fact, the first report on a protein involved in the calcium-independent action of α-LTX described only a 120 kDa N-glycosylated polypeptide chain, purified by affinity-chromatography with immobilized α-LTX (DAVLETOV et al., 1996). This polypeptide chain represented the N-terminus of a GPCR, later known as CIRL or LPH-1, which undergoes cleavage during maturation (KRASNOPEROV et al., 1997). The size of the subunits predicted from the cDNA sequence of rat LPH-1 was approx. 93 kDa for the N-terminus and approx. 70 kDa for the C-terminus. The observed sizes of the subunits were approx. 120 kDa and approx. 85 kDa. These differences are assumed to be caused by extensive glycosylation, as it was shown for the N-terminus by DAVLETOV and coworkers (1996; KRASNOPEROV et al., 1997). Cleavage occurs in the endoplasmatic reticulum and is required for the transport of the receptor to the membrane. The fragments behave as independent proteins in the membrane, each having a membrane anchor of their own. Regarding the N-terminal fragment, a short hydrophobic residue was suggested to be the anchor, which might be added posttranslationally. Induced by ligand binding at the N-terminal fragment, the parts reassemble, and a signaling cascade is mediated by the C-terminal fragment (VOLYNSKI et al., 2004). In HIT-T15 β-cells, a cell line lacking endogenous LPH, transiently expressed LPH is completely cleaved. The antibody against an N-terminal epitope only detects a protein 120 kDa in size, consistent with the size of the extracellular N-terminus (LAJUS et al., 2006). The expression of an isolated N-terminus fragment in HIT-T15 β-cells does not induce susceptibility of the cells to

160 Discussion

α-LTX. The expression of the same construct in cells expressing endogenous LPH enhances the effects of α-LTX on the cells. LAJUS and coworkers (2006) therefore assume complementation between the transiently expressed N-terminal fragment and the endogenous full-length LPH. The cleavage in mammalian LPH is assumed to occur between a leucine and a threonine residue, three amino acids downstream of a Cys-X-Cys-motif within the GPS, with X standing for any amino acid. In rat LPH-1, 2, and 3 the pattern is Cys-X-Cys-X-His-Leu-Thr (LPH-1: aa 832 – 838; LPH-2: aa 823 – 829; LPH-3: aa 916 – 922. All positions are based on the protein sequences listed in the appendix (8.3.2)). The same pattern is observed in C. elegans LAT-1 (LAT-1A: aa 524 – 530; LAT-1B: aa 522 - 528) and LAT-2 (aa 868 – 874) (SUGITA et al., 1998). In Hc110-R the pattern is modified to Cys-Ala-Cys-Ser-His-Met-Thr (Hc110-R: aa 505 – 511). The same pattern Cys-Ala-Cys-Ser-His-Met-Thr was found in the depsiphilin of C. oncophora (Co 2 and Co 4: aa 507 – 513); in O. ostertagi depsiphilin the pattern was further modified to Cys-Ala-Cys-Asn-His-Met-Thr (Oo 8: aa 509 – 515; Oo 10: aa 507 – 513). Therefore, the newly described depsiphilins had a modification of Cys-X-Cys-X-His-Leu-Thr to Cys-X-Cys-X-His-Met-Thr. LAT-2 of H. contortus and C. oncophora showed the pattern Cys-Ala-Cys-Asn-His-Leu-Thr, the sequences therefore matched the conserved pattern Cys-X-Cys-X-His-Leu-Thr.

KRASNOPEROV and coworkers (2002) define the consensus sequence of receptors with a GPS in more detail as Cys-(X)2-Trp-(X)6–16-Trp-(X)4-Cys-(X)10–22-Cys-(X)-Cys (the cysteine residues printed in bold are identical to the cysteine residues in the motifs listed above). This pattern was also found in Hc110-R, C. oncophora depsiphilin, O. ostertagi depsiphilin, H. contortus LAT-2, and C. oncophora LAT-2.

Interestingly, when the heptahelical receptor Hc110-R from H. contortus was transiently expressed in HEK-293 and COS-7 cells, it was detected in a Western Blot as a full-length protein. Cleavage at the GPS was therefore not observed (SAEGER, 2000). In the present study the depsiphilin of O. ostertagi was expressed in COS-7 cells. In a Western Blot using a specific antibody against an epitope within the N-terminus, prominent bands of approx. 60 and 45 kDa were detected in membrane-protein preparations exclusively of depsiphilin-transfected cells. The facts that the antibody was directed against an epitope within the N-terminus and in the Discussion 161 membrane-protein preparation of empty-vector transfected cells no antigen was detected, indicate that the bands were specifically detected fragments of the N-terminus of O. ostertagi depsiphilin. Assuming that the cleavage observed in mammalian LPH also occurred in the GPS of O. ostertagi depsiphilin transiently expressed in COS-7 cells, the respective fragment would be expected to be 57 kDa in size. The size of approx. 60 kDa is therefore nearly consistent with the size of the putative N-terminal fragment of the cleaved depsiphilin; the size of the protein was, however, only roughly estimated. Specific experiments regarding glycosylation have not been performed, therefore, assumptions regarding the actual size of the potentially glycosylated N-terminus cannot be made. The N-glycosylation prediction program Net-N-Glyc (GUPTA et al., 2004) detected three potential N-glycosylation sites within the O. ostertagi and C. oncophora depsiphilin sequences (data not shown). The same number of potential N-glycosylation sites was determined for Hc110-R. The positions of the predicted N-glycosylation sites within the depsiphilins are almost identical. The glycosylation state of the native protein in the nematode and of the recombinant protein in the COS-7, i.e. monkey cells, might differ from each other and from the predictions. The actual extent of glycosylation would have to be determined in an experimental approach.

Other explanations for the detected receptor fragment might be protein degradation or incomplete translation. The smaller band might also be derived from protein degradation or disturbed translation. A specific antibody for detection of the C-terminus was not available. Such an antibody would have clarified if a C-terminal fragment of the expected size of approx. 50 kDa, or larger, in case the C-terminus was glycosylated, would have been detectable in the membrane-protein.

162 Discussion

7.4.2 Calcium Influx Measurements Like other GPCRs, mammalian LPH, Hc110-R, and C. elegans LAT-1 mediate influx of Ca2+ ions into the cell upon activation (LAJUS et al., 2006; RAHMAN et al., 1999; SAEGER, 2000; WILLSON et al., 2004a). COS-7 cells were shown to be an appropriate system for calcium influx experiments with recombinantly expressed mammalian LPH and Hc110-R (LELIANOVA et al., 1997; SAEGER, 2000). Whereas the calcium influx measurements in the work of SAEGER (2000) were performed in single-cell assays, subsequent experiments were performed on cell pools in a cuvette, as was performed in this work. In such experiments, the Hc110-R transfected COS-7 cells react to an α-LTX stimulus with a peak of the intracellular Ca2+ concentration, followed by a plateau (personal communication, Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf). The observed reaction of the depsiphilin (lat-1) and lat-2 transfected COS-7 cells in this work was similar to these former results, although the results were partially not reproducible.

In the experiments with LipofectamineTM transfected cells, the intracellular Ca2+ concentration of cells that gave a response started at a lower level than the Ca2+ concentration in cell samples that did not react. The importance of this observation is not clear. Furthermore, of seven measurements of depsiphilin (lat-1) transfected cells, four with a stimulus of 500 pM, only two samples did react at all. The lat-2 transfected cells from the experiments with LipofectamineTM transfection reacted only in one out of seven measurements, again four of them with a stimulus of 500 pM. The observed initial peak must be regarded as a nonspecific event, since the peak was also observed in response to the injection of water. It was also observed as a response to the different stimuli in empty-vector transfected cells.

A peak was also observed in the experiments with FuGENE transfected cells, although the peak was broader, lasting for 40 – 60 sec instead of 5 – 10 sec as with LipofectamineTM transfected cells. A comparable peak was observed in the pEGFP-N2 transfected cells used as reference. This broader peak must therefore also be regarded as a nonspecific response of the cells to the injection in general. In FuGENE transfected cells, an increased level (plateau) of the intracellular Ca2+ concentration was observed in all measurements with depsiphilin (lat-1) and Discussion 163 lat-2 transfected cells, except for one experiment with a sample of depsiphilin (lat-1) transfected cells that were pooled due to low cell numbers. These cells did react to a stimulus of 100 µM ATP, indicating their viability. The cells might be regarded as an outlying sample, as their impaired growth causing the decreased cell number might indicate negative impacts during their growth phase. Perhaps these cells did not express the receptor as efficiently as the other samples or were impaired in another manner. In contrast, the positive response of one sample of pEGFP-N2 empty-vector transfected cells, used as reference, is not as easily explained. Since the responding sample was a fraction of pooled cells and the other fraction did not respond, it is unlikely that the whole pool of cells was contaminated, e.g. with depsiphilin (lat-1) or lat-2 transfected cells. It is more likely that only the responding sample was contaminated, potentially with ATP, which was used in previous measurements to test the viability of the cells. The shape of the response, however, was comparable to the responses of other samples to α-LTX rather than to ATP, which usually caused a sharp peak without a plateau. The presence of functional endogenous receptors for α-LTX in empty-vector transfected COS-7 cells is also unlikely, since responses of these cells to α-LTX stimuli were neither observed in the second control sample nor in other experiments with pEGFP-N2 empty-vector transfected COS-7 cells (personal communication, Hans-Peter Schmitt-Wrede, Heinrich-Heine University Duesseldorf).

The group of MEE (2004) identified LAT-1, but not LAT-2, as a target for BWSV in C. elegans. In this work, the function of the parasitic LAT-2 as a target for α-LTX could not be clarified. The experiments were performed although it was unknown whether or not LAT-2 acts through a signaling cascade similar to the LAT-1 mediated pathway. The results of calcium influx measurements in the cells upon an α-LTX stimulus were ambiguous, as discussed above. Since the expression of H. contortus LAT-2 in COS-7 cells could not be confirmed by a Western Blot, no statement is possible on whether an intact receptor was expressed in the cells or not. However, the results do not exclude that parasitic LAT-2 expressed in COS-7 cells might mediate a similar response to α-LTX stimuli as the parasitic LAT-1 orthologs. The different results of the experiments with LipofectamineTM and FuGENE might be due to different transfection efficiencies of these transfection reagents for lat-2.

164 Discussion

Subsequent experiments with larger sample size are planned to further examine the responses of depsiphilin (lat-1) and lat-2 transfected cells and empty-vector transfected cells to α-LTX stimuli.

Accordingly, the results of the calcium influx measurements must be regarded as preliminary results and evaluated carefully. As there were unexpected results which had to be explained, a concluding statement seems not reasonable. The observed responses might be nonspecific events. Recalling the results of the Western Blot of membrane-protein preparations for depsiphilin transfected cells, a possible explanation for the ambiguous results might be the absence of intact receptors due to degradation or impaired translation. Even if depsiphilin was translated correctly and only underwent the potentially natural cleavage at its GPS, the localization of the receptor might not have been in the cell membrane. The receptor fragments detected in the membrane-protein preparations of depsiphilin transfected cells might also be derived from internalized receptors in acidic lysosomes. In previous work, in transiently transfected COS-7 cells expressing an Hc110-R-GFP construct, GFP signals were detected 24 h post transfection in 64 % of the cells in vesicles, in 30 % in vesicles and membrane, and in 6 % solely in the membrane. 48 h post transfection Hc110-R was detected in 83 % of the cells solely in vesicles, in 14 % in cell membrane and vesicles, and in only 3 % in the membrane alone (SAEGER, 2000). Internalization of the receptor may also have occurred in cells expressing O. ostertagi depsiphilin or H. contortus LAT-2. Localization studies were not performed in this study. Therefore, the results of the calcium influx measurements should only be regarded as preliminary, demanding further and more intensive experiments to clarify the potential involvement of parasitic latrophilin-like receptors in mediating the action of α-LTX.

An interesting question that should be considered in future experiments is therefore the localization of the transiently expressed receptors in the cell. If the examined receptors of the present study were also internalized during the measurements, their potential functionality might not have been detectable. Localization could be examined using a GFP-tagged expression construct of the receptor, visualizing the recombinant protein within the cells. A GFP-tag would also allow determination of transfection rate. In this work the receptors were expressed either untagged Discussion 165

(depsiphilin) or only with a small His-tag (LAT-2) to exclude potential negative impacts on the receptor functionality.

For the design of further experiments, the following factors might be of interest: In the present experiments as well as in the previous work of SAEGER (2000), the native α-LTX was used, purified from natural BWSV produced by milking spiders. This toxin was previously described to be involved in pore-formation. VOLYNSKI and coworkers (2000) observed that the pore-forming properties of α-LTX were facilitated by the receptors for α-LTX, although the receptors themselves were not involved in pore-formation. The group proposed that the receptors bind α-LTX and bring it into the vicinity of the membrane. Subsequently the toxin forms pores within the membrane. In single-cell assays for calcium influx measurements in cells expressing LPH constructs, LAJUS and coworkers (2006) observed a biphasic response. Phase I of the response, consisting of calcium spikes or an increase in frequency and amplitude of calcium spikes in already active cells, was assigned to the GPCR induced cascade, whereas phase II was a plateau-phase, which was regarded as the effect of pore-formation: phase II was observed also in endogenous LPH deficient HIT-T15 β-cells expressing a truncated LPH construct, lacking all but the first TM helix and therefore the C-terminus carrying the structural characteristics of a GPCR. This observation supports the facilitation of pore-formation by the N-terminus independently of the GPCR-characteristic region of the receptor. Therefore, an influx of calcium into the cells might not be evidence for a signaling cascade mediated by a GPCR.

However, in Hc110-R the influx of calcium ions could be blocked to a large extent with cadmium ions or nifedipine, a blocker for calcium channels of the L-type (SAEGER, 2000). These results indicate a specific influx of calcium via channels rather than through pores. Experiments using calcium channel blockers would clarify whether or not the observed effects of α-LTX on depsiphilin (lat-1) and lat-2 transfected cells were due to a receptor-mediated signaling cascade or to a potential receptor-facilitated formation of membrane pores. Another approach would be the use of the mutant LTXN4C (VOLYNSKI et al., 2003), which is deficient in pore-forming properties. The use of LTXN4C would also clarify if the responses are specific to the α-LTX component of the venom. MEE and coworkers (2004)

166 Discussion suggested that α-LTX might potentially not be the active ligand for nematode LAT-1 but more likely another component of the BWSV, since they observed no effect of highly purified α-LTX on C. elegans, whereas BWSV had a toxic effect on the worms. The α-LTX-preparations used in the present experiments were bought from ALOMONE Labs. The purity is > 98 % (ALOMONE LABS, 2007). Whether the remaining < 2 % contained the ligand causing the observed responses of Hc110-R transfected cells or whether the response was specific to the α-LTX component, could be clarified using LTXN4C, as mentioned above, or highly purified α-LTX as described by MEE (2004).

Anyhow, the most interesting task within any future work would be to investigate the reaction of depsiphilin and lat-2 transfected cells to emodepside. The design of these experiments would have to consider the hydrophobic character of the component.

7.5 Real-time PCR

Real-time PCR is a convenient method to examine the quantity of nucleic acids in biological samples. To correct the data for processing variabilities, e.g. different efficiencies in cDNA synthesis in different samples for an analysis of transcription levels, the data can be normalized to reference genes. In the present work developmental stages of H. contortus and O. ostertagi were analyzed for their transcription levels of depsiphilin. Since no reference genes had been previously evaluated, two genes were chosen as putative reference genes: the 18 S rRNA (18 S) gene and the 60 S acidic ribosomal protein (60 S) gene. Both had been previously tested as reference genes in the canine hookworm A. caninum. 60 S was the most stable reference gene in several developmental stages and different strains of this parasitic nematode (TRIVEDI and ARASU, 2005). In the experiments of TRIVEDI and ARASU (2005) 18 S was not rated as an appropriate reference gene. The cDNA synthesis was performed using an oligo-(dT)-primer. 18 S rRNA does not have a poly-A tail, so the authors relied on sufficient accidental internal priming for cDNA synthesis. In the present work, cDNA-synthesis was performed using gene-specific primers in addition to an oligo-(dT)-primer.

Discussion 167

7.5.1 Quantification Methods Quantification can be performed as relative or as absolute quantification. Absolute quantification estimates the number of copies of a target gene in a sample by comparing the threshold cycle (Ct) value to a standard curve derived from samples with defined copy numbers. Relative quantification relates the detected

Ct value to that of a calibrator sample, without the need of a standard curve. The data are usually normalized to Ct values of reference genes. In this work, the relative transcription levels of depsiphilin in the different stages were related to that detected in males, which were used as calibrator.

The relative quantification was performed by two methods: the 2 -Ct method (LIVAK and SCHMITTGEN, 2001) and by relating copy numbers of target gene and reference gene, which were estimated using a standard curve. These ratios were also related to a calibrator sample. This second method includes a step of absolute quantification, giving the values as copy numbers. Relating these values to the copy numbers of the reference gene and to a calibrator sample renders the method relative again. The data from both methods were very similar. This finding was not surprising, since both methods utilize the Ct values of target gene and reference gene for comparison. The main difference is that the 2 -Ct method excludes the efficiencies by equating them, whereas the other method compares the Ct values to a standard curve with a run-specific efficiency. The advantages and drawbacks are therefore obvious. The 2 -Ct method does not require the establishment of a standard curve, once the efficiency is determined. The disadvantage is that decreasing efficiencies or run-to-run differences might go unnoticed. The method utilizing a standard curve for each run detects run-to-run differences, but the requirement of a standard curve in each run is cost and labour intensive. The efficiency determined by a plasmid-based standard curve can vary not only with parameters affecting the reaction, but also with the quality of the plasmid dilution series. The efficiencies decrease when using plasmid dilutions that are repeatedly thawed and frozen. The most secure method would be to prepare a large dilution series and to use fresh aliquots of the same dilution series for each run. Different efficiencies of cDNA synthesis of target and reference gene, which might impair the determined ratio of transcript amounts, go unnoticed. This impact might be

168 Discussion disregarded, because the differences are likely to be similar between the samples and the determined transcript levels are given as relative amounts compared to a calibrator.

Since the data of target gene transcript amount normalized to a reference gene were heterogenous and ambiguous, the absolute amounts of transcript by means of estimating the copy numbers of transcript in 1 µl of cDNA were also estimated. This method was also considered to be useful by BUSTIN (2000). To visualize the data, the amounts were again related to the amount of transcript in the males.

7.5.2 Evaluation of Real-time PCR Data The results differed between the two species. In O. ostertagi the amount of 18 S transcript in 1 µl cDNA was nearly consistent through all stages examined. The amount of 60 S transcript was variable among the stages. The amount of depsiphilin transcript was very similar throughout the stages, except in eggs where it was 2.5 fold higher. The results for H. contortus were different: the amounts of 18 S transcripts were very similar between males, females, eggs, and L1 / L2. In L3 the amount was only approx. 20 % of the amount in males. The amount of 60 S transcripts was highly variable among the stages. Hc110-R transcripts were nearly 3.5 fold higher in females and eggs compared to males but were reduced to 30 % in L3. Omitting the 60 S data, the results for 18 S and depsiphilin transcription levels differed between the two species only in the data for L3. Although speculative, the difference might be due to a difference in material collection: the L3 of O. ostertagi were freshly cultured, whereas the L3 of H. contortus had been stored for 4 months at approx. 8° C. Since the populations of the different parasites held at the Institute for Parasitology cannot be permanently kept in infected animals, they are stored as free-living stages prior to new infections of animals. This difference in larval cultures might have had an impact on the transcriptome of the samples, and a new analysis will be required when freshly cultured H. contortus L3 are available.

Discussion 169

7.5.3 Transcription Levels of Depsiphilin Normalized to 18 S rRNA Due to the highly variable amounts of 60 S transcripts discussed above, the data for depsiphilin transcription levels in H. contortus and O. ostertagi were evaluated after normalization to the 18 S data. The results were qualitatively similar between the two species: the relative amount of depsiphilin was increased in the eggs. The degree of the increase in eggs, however, was different. In H. contortus a slight increase was observed in females.

7.5.4 Significance of Real-time PCR Data The data derived from the real-time PCR should be weighed carefully. The small sample size raises the possibility of severe over- or underestimation of the results. However, the results indicate the need for thorough evaluation of reference genes for the parasitic nematode species chosen for examination. The 60 S acidic ribosomal protein, previously described to be the optimal reference gene in A. caninum (TRIVEDI and ARASU, 2005), could not be confirmed to be useful in the present experiment. Further experiments with larger sample size are planned. Once having collected data from more samples, the data will be analyzed using an evaluation program for reference genes. Currently, several programs are available for the evaluation of putative reference genes, such as qBase (HELLEMANS et al., 2007) or BestKeeper (PFAFFL et al., 2004).

Nevertheless, the results from the real-time PCR are interesting. The qualitative detection of depsiphilin transcripts in eggs is itself important. In previous experiments in this lab, emodepside was shown not to affect the hatching of H. contortus and cyathostomin larvae from eggs (personal communication Sandra Schuermann, Institute for Parasitology, University of Veterinary Medicine, Hannover). This observation is consistent with those regarding the development of C. elegans eggs in presence of emodpeside (BULL et al., 2006). The qualitative detection was albeit not unexpected, since SAEGER (2000) had detected LAT-1 by immunostaining in the pharynxes of embryos in eggs of C. elegans. The higher levels of transcript in H. contortus females might be only an apparent increase. The worms examined were collected from infected animals during patency, so that the worms were highly active in producing offspring. Therefore, the female worms were full of eggs. The increased

170 Discussion transcript level detected in the females may have originated in the eggs. These considerations, though, are speculative, and the statistical and biological significance of the detected increase in transcription remain to be determined. The amount of transcript is not equivalent to the actual amount of protein or its biological activity in a sample. In fact, the number of mRNA molecules of a certain gene is regulated by, for example, microRNA (miRNAs) and small interfering RNAs (siRNAs), leading to RNAi (AMBROS et al., 2003). miRNAs and siRNAs target complementary RNAs for destruction and translational inhibition (LEE et al., 2006). Furthermore, posttranslational modification, protein stability, activation and deactivation, and the presence or absence of other key components of a certain mechanism of action can all influence protein levels or activity. Also, the observed insensitivity of the embryos within the eggs might be due to impermeability of the eggshell.

7.6 Heterologous Expression of Depsiphilin in C. elegans

The expression of parasitic genes in transgenic C. elegans worms is a useful tool to examine the functionality of parasitic proteins (COOK et al., 2006; KWA et al., 1995; REDMOND et al., 2001). COOK and coworkers (2006) were able to restore motor movement in C. elegans lacking the endogenous α subunit of the glutamate-gated chloride channel GluClα with the orthologous gene of H. contortus, indicating that the parasitic protein fulfilled the physiological tasks of the C. elegans protein. Such studies have yet to be performed with depsiphilin. The exact physiological role of LAT-1 in C. elegans is so far unknown. However, LAT-1 was shown to mediate the inhibiting effect of emodepside on pharyngeal pumping in C. elegans (WILLSON et al., 2004a). Therefore, even if the parasitic depsiphilin would be unable to perfectly substitute the endogenous protein regarding physiological tasks, a potential functionality as a receptor mediating the effects of emodepside on pharyngeal pumping could probably be surveyed in electropharyngeograms.

A plasmid containing a 3 kb fragment including the C. elegans lat-1 promotor region, the complete coding sequence of the O. ostertagi depsiphilin gene, and the unc-54 3’ UTR in a pPD30.69 backbone was prepared in this work for such an experiment in near future. Discussion 171

7.7 BK-type Potassium Channel SLO-1 Sequences

In C. elegans the BK-type potassium channel SLO-1 was proposed to be involved in the mediation of action of emodepside, since slo-1 knockout mutants were observed to be highly resistant to emodepside (personal communication Lindy Holden-Dye, School of Biological Sciences, Southampton). Orthologs of SLO-1 had not yet been identified in parasitic nematodes. To provide data as a basis for further examination of this protein, which is potentially important for the understanding of emodepside’s mechanism of action in parasitic nematodes, EST databases were searched for orthologous sequence fragments. Based on these fragments of H. contortus slo-1, full-length coding sequences of H. contortus and C. oncophora slo-1 were identified, and a contig of the preliminary sequence of O. ostertagi slo-1 was constructed. The translated sequences were 1105 – 1126 aa in size. C. oncophora and O. ostertagi SLO-1 had six additional N-terminal amino acids compared to H. contortus SLO-1. The identities of 84 – 86 % of cDNA and of 96 – 98 % of amino acid sequence were relatively high. A BLAST search of the NCBI database revealed various potassium channel sequences of many diverse species. The identities of the newly identified parasitic nematode SLO-1 with selected sequences were 63 – 65 % for insect, 59 % for molluscan, 54 – 55 % for chicken, and 53 – 55 % for mammalian potassium channels. The BK-type potassium channels including parasitic nematode SLO-1 therefore appeared to be relatively highly conserved throughout various species and phyla.

7.7.1 Prediction of Transmembrane Regions in SLO-1 The prediction of TM helices within the sequences of parasitic SLO-1 varied between the prediction programs used. Phobius and ConPred II detected seven TM helices and no signal peptide. Accordingly, the N-terminus was predicted to be intracellular and the C-terminus extracellular. TMMOD detected only six TM helices, both, N- and C-terminus being extracellularly. The presence of seven TM helices in BK-type potassium channels was previously described (MEERA et al., 1997; WALLNER et al., 1996). In fact, the group describes seven TM helices (S0 – S6) and four additional hydrophobic regions within an intracellular C-terminus. According to Phobius and ConPred II, the TM helix undetected by TMMOD was in very close

172 Discussion proximity to the preceding TM helix. TMMOD did not determine this region to be hydrophobic. Based on the agreement of the predictions of seven TM helices by Phobius and ConPred II, the prediction by TMMOD may be disregarded. More important is the unexpected result of an intracellular N-terminus and an extracellular C-terminus. MEERA and coworkers (1997) examined human BK-type potassium channels for the localization of N- and C-termini. Using immunostaining they confirmed the N-terminus to be extracellular and the C-terminus intracellular. Due to the sequence similarities, the authors extrapolated this result also to the Drosophila potassium channel. In the present work, the respective sequences cited in the paper of MEERA and colleagues (1997) were also examined using the programs TMMOD, Phobius, and ConPred II to predict transmembrane regions. The prediction results were inconsistent with the experimental results of MEERA (1997). Whereas the Drosophila potassium channel was predicted to have a similar configuration as the parasitic nematode SLO-1, the predictions for the human potassium channel were deviant. In conclusion, the prediction of TM helices in SLO-1 must be regarded carefully. The actual localizations of N- and C-termini remain to be clarified in appropriate experiments.

7.7.2 Prediction of Conserved Domains in SLO-1 The prediction of the conserved domains in SLO-1 met the expectations. The large C-terminus of the protein showed structural characteristics of a BK-type channel α subunit. As described by MEERA (1997), the C-terminus of a BK-type channel α subunit possesses four intracellular hydrophobic regions that are thought to contain the calcium binding site involved in channel activation (GRIFFITHS-JONES, 2006). The region containing the predicted TM helices was found to have similarities with an ion transport protein. The main characteristic of the ion transport protein domain is a region containing six TM helices, according to the TM helices S1 – S6 in the model from MEERA (1997). The TM helix S0 is described as a unique transmembrane segment at the N-terminus. Ion selectivity is determined by a loop flanked by the last two TM helices (FINN, 2006). The final BK-type potassium channel consists of four α subunits. Mammalian BK-type potassium channels were shown to consist of an α and a β subunit. For interaction of α and β subunits, the extracellular N-terminus and the first TM region of the α subunit are required (MCMANUS et al., 1995). Discussion 173

7.8 Conclusions and Perspectives

In H. contortus a receptor for emodepside and α-LTX was previously identified (SAEGER et al., 2001). Hc110-R transfected HEK-293 cells responded with calcium influx to an α-LTX stimulus. The influx was shown to occur via voltage-dependent calcium channels of the L-type (SAEGER, 2000). In the free-living nematode C. elegans the putative signaling cascade for emodepside was described to be mediated by the receptor LAT-1 (WILLSON et al., 2004a). The mechanism of action engages a characteristic GPCR-mediated pathway, including the G-protein Gαq (egl-30), phospholipase Cβ (PLC-β, egl-8), and a presynaptic receptor for diacylglycerol (DAG), UNC-13 (unc-13). The involvement of the BK-type potassium channel SLO-1 is proposed (personal communication Lindy Holden-Dye, School of Biological Sciences, Southampton). Previously, SLO-1 was described to be important for precise regulation of neurotransmitter release, most likely activated by the influx of calcium via voltage-gated calcium channels (WANG et al., 2001).

In mammals, the action of α-LTX is also mediated by GPCRs, the LPH. The binding of α-LTX to mammalian LPH leads to calcium influx, also occuring through calcium channels of the L-type. Outward potassium currents, which are provoked by repeated depolarizing voltage stimuli, are inhibited by α-LTX in endogenous LPH-expressing and therefore α-LTX-susceptible MIN 6 β-cells. This effect does not occur when BK-type potassium channels are blocked by the inhibitor iberiotoxin, indicating that the potassium currents occur through BK-type potassium channels. The phospholipase C inhibitor U73122 also blocked the effect of α-LTX on the potassium currents in MIN6 β-cells (LAJUS et al., 2006). LIU and coworkers (2005) showed the involvement of protein kinase C in mediating the effects of α-LTX.

These results indicate that mammalian LPH utilize for mediating the effects of α-LTX a pathway similar to that previously described for C. elegans LAT-1 (WILLSON et al., 2004a). Therefore, it seems reasonable to propose, that the pathway might be conserved, and that depsiphilins could potentially engage a similar signaling cascade. The endogenous ligands of C. elegans LAT-1 and of mammalian LPH are unknown. About 7 % of all genes in the genome of C. elegans, namely approx. 1300 genes and approx. 400 pseudogenes, code for GPCRs. GPCRs in C. elegans

174 Discussion are involved in developmental and behavioural functions as well as in chemoreception (BERGAMASCO and BAZZICALUPO, 2006). As described above (3.6), many GPCRs are receptors for neurotransmitters. The involvement of the LAT-1 mediated pathway in transmitter release indicates a potential physiological role as a receptor for neurotransmitters as well. The utilization of components of the nervous system of nematodes as targets is also known from other anthelmintic drugs such as the macrocyclic lactones, nicotinergic agonists or piperazine. The endogenous ligand of LAT-1, however, remains to be identified.

In this work, LAT-1 orthologs were identified in C. oncophora and O. ostertagi and were called depsiphilins. They show high identities with their ortholog Hc110-R in H. contortus and moderate identities with LAT-1 in C. elegans and C. briggsae. Structural similarities with these receptors and with mammalian LPH indicate a function as a GPCR. Polyclonal antibodies against three epitopes in Hc110-R were developed in rabbits and were tested on the prokaryotically expressed N-termini of the receptors. A specific binding of α-LTX to the isolated N-termini could not be confirmed. This result, however, does not exclude potential binding affinities of the native receptors to α-LTX. Furthermore, orthologs of LAT-2, a receptor previously discussed as an alternative target for emodepside, were identified in H. contortus and C. oncophora. O. ostertagi depsiphilin and H. contortus LAT-2 were also expressed in eukaryotic cells. The transiently transfected COS-7 cells were examined for their responses to α-LTX by means of calcium influx. The results were ambiguous, but did not exclude binding of α-LTX to the receptors. Speculating, depsiphilin and LAT-2 might be targets for similar endogenous ligands, or for the same ligand that activates different pathways.

An interesting experiment would be the stimulation of depsiphilin or lat-2 expressing cells with emodepside, to examine the properties of the receptors as targets for this anthelmintically active compound. The setup of respective experiments, however, would have to consider the hydrophobic nature of emodepside.

The experiments planned for the near future include more intensive examination of the receptor-mediated responses of depsiphilin or lat-2 expressing cells to α-LTX. For this purpose, expression plasmids for GFP-tagged receptors will be prepared and a Discussion 175 larger sample size for receptor expressing and empty-vector transfected cells will be examined.

The real-time PCR based investigation of transcription levels of depsiphilins in developmental stages of H. contortus and O. ostertagi showed that depsiphilin was transcribed in all motile stages, and at even higher levels in eggs. In previous studies hatching of nematode eggs was unaffected by emodepside. This observation therefore does not indicate a reduced or absent transcription of the putative receptor depsiphilin. The comparison of 18 S rRNA and the 60 S acidic ribosomal protein gene as reference genes in real-time PCR indicated 18 S to be the more stable reference gene in the present experiments. The small sample size and the different results for H. contortus and O. ostertagi L3, however, demand more experiments with larger sample size. These experiments are also planned for the near future.

The contribution of a calcium-gated potassium channel to the action of emodepside was previously suggested by WILLSON and coworkers (2003) and recently emphasized by HOLDEN-DYE (personal communication), who observed knockout mutants for the potassium channel SLO-1 to be highly resistant to emodepside. The observations are partially consistent with the involvement of BK-type potassium channels in the effect of α-LTX on mammalian cells, as described by LAJUS (2006). Orthologs of BK-type potassium channels had not yet been identified in parasitic nematodes. In the present work, orthologs of SLO-1 were identified in H. contortus and C. oncophora, and as a preliminary sequence in O. ostertagi. The sequences showed relatively high identities with potassium channels of the BK-type in several other organisms. To date, no functional investigations of the role of the parasitic nematode SLO-1 in mediating the actions of emodepside have been undertaken. Nevertheless, their identification is the first step toward further experiments.

The extent to which all newly identified proteins contribute to the anthelmintic action of cyclooctadepsipeptides needs to be determined. The experiments planned for the near future are further calcium influx measurements in eukaryotic cells expressing the receptors as discussed above and the examination of transcription levels in larger sample size in real-time PCR.

176 Discussion

Most promising experimental setups include the expression of the parasitic genes in C. elegans knockout mutants. A plasmid for the expression of O. ostertagi depsiphilin driven by the C. elegans lat-1 promotor was already prepared. Such experiments could clarify, whether the parasitic genes were able to fulfill the physiological and pharmacological tasks of the respective endogenous genes. Another interesting project will be the functional comparison of mammalian LPH with parasitic depsiphilins and parasitic LAT-2, and of mammalian BK-type potassium channels with parasitic SLO-1. The results could be of value for the optimal adaptation of the anthelmintic components to their targets in parasites. Appendix 177

8 Appendix

8.1 Additional Data

8.1.1 Predicted Transmembrane Domains The prediction programs used were ConPred II, TMMOD, and Phobius.

Sequence Position of N-terminus Position of TM helices Length ConPred II TMMOD Phobius ConPred II TMMOD Phobius Hc110-R extracellular extracellular extracellular 435 – 455 537 – 557 534 – 558 534 – 558 986 aa SP 1 - 24 SP 1 – 18 568 – 588 566 – 586 570 – 589 N 1 – 3 596 – 616 595 – 615 595 – 615 H 4 – 13 635 – 655 635 – 655 635 – 655 C 14 – 18 675 – 695 674 – 701 675 – 701 724 – 744 721 – 744 722 – 744 753 – 773 750 – 770 750 – 774 Co depsi 2 extracellular extracellular extracellular 538 – 558 536 – 560 536 – 560 570 – 590 568 – 588 572 – 591 994 aa SP 1 - 24 SP 1-20 598 – 618 597 – 617 597 – 617 N 1 – 3 636 – 656 637 – 657 637 – 657 H 4 – 15 677 – 697 676 – 703 677 – 703 C 16 – 20 726 – 746 723 – 746 724 – 746 755 – 775 752 – 776 752 – 776 Co depsi 4 extracellular extracellular extracellular 538 – 558 536 – 560 536 – 560 570 – 590 568 – 588 572 – 591 994 aa SP 1 - 24 SP 1-20 598 – 618 597 – 617 597 – 617 N 1 – 3 636 – 656 637 – 657 637 – 657 H 4 – 15 677 – 697 676 – 703 677 – 703 C 16 – 20 726 – 746 723 – 746 724 – 746 755 – 775 752 - 772 752 – 776 Oo depsi 8 extracellular extracellular extracellular 540 – 560 538 – 562 538 – 562 572 – 592 570 – 590 574 – 593 996 aa SP 1 - 24 SP 1 – 20 600 – 620 599 – 619 599 – 619 N 1 – 5 638 – 658 639 – 659 639 – 659 H 6 – 16 680 – 700 678 – 705 679 – 705 C 17 – 20 728 – 748 725 – 748 726 – 748 757 – 777 754 – 778 754 – 778 Oo depsi 10 extracellular extracellular extracellular 538 – 558 536 – 560 536 – 560 570 – 590 568 – 588 572 – 591 994 aa SP 1 - 24 SP 1 – 20 598 – 618 597 – 617 597 – 617 N 1 – 3 636 – 656 637 – 657 637 – 657 H 4 – 15 678 – 698 676 – 703 677 – 703 C 16 – 20 726 – 746 723 – 746 724 – 746 755 – 775 752 – 776 752 – 776

Table 9: Predicted localization of the N-terminus and of predicted transmembrane helices in depsiphilin sequences of C. oncophora (Co depsi), O. ostertagi (Oo depsi), and H. contortus (Hc110-R), SP: signal peptide, N: positively charged n-region, H: hydrophobic region, C: polar and uncharged region between h-region and cleavage site

178 Appendix

Sequence Position of N-terminus Position of TM helices Length ConPred II TMMOD Phobius ConPred II TMMOD Phobius Hc LAT-2 extracellular extracellular extracellular 914 – 934 914 – 934 914 – 937 948 – 968 946 – 966 949 – 966 Full 4 SP 1 – 25 SP 1 - 18 975 – 995 975 – 995 972 – 995 N 1 - 2 1018 – 1038 1015 – 1038 1016 – 1036 H 3 - 13 1059 – 1079 1058 – 1082 1056 – 1082 1302 aa C 14 - 18 1100 – 1120 1095 – 1115 1103 – 1122 1129 – 1149 1127 – 1151 1128 - 1151 Co LAT-2 extracellular extracellular extracellular 922 – 942 922 – 942 922 – 945 SP 1 – 18 956 – 976 954 – 974 957 – 974 Full 3 SP 1 - 25 N 1 984 – 1004 983 – 1003 980 – 1003 H 2 – 13 1026 – 1046 1023 – 1046 1024 – 1044 C 14 – 18 1068 – 1088 1066 – 1090 1064 – 1090 1310 aa 1109 – 1129 1103 – 1123 1111 – 1130 1137 – 1157 1135 – 1159 1136 – 1159

Table 10: Predicted localization of the N-terminus and of predicted transmembrane helices in sequences of H. contortus (Hc) and C. oncophora (Co) LAT-2, SP: signal peptide, N: positively charged n-region, H: hydrophobic region, C: polar and uncharged region between h-region and cleavage site

Sequence Position of N-terminus Position of TM helices Length ConPred II TMMOD Phobius ConPred II TMMOD Phobius Hc SLO-1 intracellular extracellular intracellular 47 – 67 45 – 69 45 – 69 pCR 4 138 – 158 140 – 160 140 – 160 JM 2 181 – 201 180 – 200 181 – 199 205 – 225 205 – 228 1105 aa 264 – 284 264 – 284 264 – 285 303 – 323 301 – 319 301 – 320 329 – 349 331 – 351 327 – 348 Co SLO-1 intracellular extracellular intracellular 53 – 73 51 – 75 51 – 75 Full 4 2 144 – 164 146 – 166 146 – 166 187 – 207 186 – 206 187 – 205 1111 aa 211 – 231 211 – 234 270 – 290 270 – 290 270 – 291 309 – 329 307 – 325 307 – 326 335 – 355 337 – 357 333 – 354 Oo SLO-1 intracellular extracellular intracellular 53 – 73 51 – 75 51 – 75 contig 145 – 165 147 – 167 147 – 167 188 – 208 187 – 207 188 – 106 1126 aa 212 – 232 212 – 235 271 – 291 271 – 291 271 – 292 310 – 330 308 – 326 308 – 327 336 – 356 338 – 358 334 – 355

Table 11: Predicted localization of the N-terminus and of predicted transmembrane helices in SLO-1 sequences of H. contortus (Hc), C. oncophora (Co), and O. ostertagi (Oo) Appendix 179

8.1.2 Real-time PCR Raw Data

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+08 - - 13.22 0 0.00% Standard 2 1.00E+07 - - 17.02 0.24 1.41% Standard 3 1.00E+06 - - 20.35 0.07 0.34% Standard 4 1.00E+05 - - 24.04 0.05 0.21% Standard 5 1.00E+04 - - 27.39 0.09 0.33% Standard 6 1.00E+03 - - 31.07 0.08 0.26%

NTC No Ct No Ct - No Ct No Ct - Hc males 1.54E+06 5.17E+05 33.56% 19.79 0.53 2.68% Hc females 2.19E+06 2.83E+05 12.91% 19.21 0.2 1.04% Hc eggs 9.07E+05 1.03E+05 11.31% 20.56 0.17 0.83% Hc L1/L2 1.09E+06 2.37E+05 21.66% 20.29 0.34 1.68% Hc L3 2.67E+05 3.74E+04 13.97% 22.45 0.22 0.98%

Table 12: Raw data of real-time PCR H. contortus 18 S assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control

180 Appendix

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+06 - - 16.38 0.52 3.17% Standard 2 1.00E+05 - - 18.86 0.52 2.76% Standard 3 1.00E+04 - - 22.33 0.34 1.52% Standard 4 1.00E+03 - - 25.73 0.09 0.35% Standard 5 1.00E+02 - - 29.38 0.16 0.54% Standard 6 1.00E+01 - - 32.83 0.43 1.31%

NTC No Ct No Ct - No Ct No Ct - Hc males 1.87E+03 2.94E+02 15.75% 25.03 0.23 0.92% Hc females 1.29E+04 6.14E+02 4.77% 22.21 0.07 0.32% Hc eggs 1.62E+04 2.45E+03 15.15% 21.89 0.22 1.01% Hc L1/L2 5.30E+03 4.17E+02 7.87% 23.5 0.11 0.47% Hc L3 6.48E+03 5.64E+02 8.71% 23.21 0.13 0.56%

Table 13: Raw data of real-time PCR H. contortus 60 S assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control Appendix 181

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+07 - - 15.26 0.22 1.44% Standard 2 1.00E+06 - - 18.84 0.1 0.53% Standard 3 1.00E+05 - - 22.1 0.14 0.63% Standard 4 1.00E+04 - - 25.73 0.25 0.97% Standard 5 1.00E+03 - - 29.13 0.15 0.51% Standard 6 1.00E+02 - - 32.98 0.12 0.36%

NTC No Ct No Ct - No Ct No Ct - Hc males 3.24E+03 8.86E+01 2.73% 27.49 0.04 0.15% Hc females 1.22E+04 4.25E+02 3.48% 25.46 0.05 0.20% Hc eggs 1.20E+04 7.03E+02 5.85% 25.49 0.09 0.35% Hc L1/L2 3.52E+03 6.48E+02 18.43% 27.37 0.28 1.02% Hc L3 9.56E+02 3.36E+01 3.52% 29.35 0.05 0.17%

Table 14: Raw data of real-time PCR Hc110-R assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control

182 Appendix

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+08 - - 14.58 0.03 0.21% Standard 2 1.00E+07 - - 18.12 0.35 1.93% Standard 3 1.00E+06 - - 21.24 0.13 0.61% Standard 4 1.00E+05 - - 25.04 0.17 0.68% Standard 5 1.00E+04 - - 28.41 0.01 0.04% Standard 6 1.00E+03 - - 32.19 0.25 0.78%

NTC No Ct No Ct - No Ct No Ct - Oo males 9.07E+05 2.99E+04 3.30% 21.66 0.05 0.23% Oo females 1.36E+06 4.59E+03 0.34% 21.04 0.01 0.05% Oo eggs 6.41E+05 3.04E+04 4.73% 22.19 0.07 0.32% Oo L1/L2 1.20E+06 8.34E+04 6.95% 21.24 0.11 0.52% Oo L3 1.03E+06 6.38E+04 6.21% 21.47 0.09 0.42%

Table 15: Raw data of real-time PCR O. ostertagi 18 S assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control Appendix 183

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+07 - - 13.8 0 0.00% Standard 2 1.00E+06 - - 17.03 0.27 1.59% Standard 3 1.00E+05 - - 20.42 0.04 0.20% Standard 4 1.00E+04 - - 23.96 0.03 0.13% Standard 5 1.00E+03 - - 27.35 0.13 0.48% Standard 6 1.00E+02 - - 30.58 0.15 0.49%

NTC No Ct No Ct - No Ct No Ct - Oo males 4.20E+03 9.71E+02 23.10% 25.17 0.34 1.35% Oo females 1.49E+04 4.22E+03 28.39% 23.33 0.42 1.80% Oo eggs 1.06E+04 1.61E+02 1.52% 23.8 0.02 0.08% Oo L1/L2 1.65E+04 4.56E+03 27.57% 23.17 0.41 1.77% Oo L3 6.77E+03 2.08E+03 30.66% 24.49 0.46 1.88%

Table 16: Raw data of real-time PCR O. ostertagi 60 S assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control

184 Appendix

Copies Ct values Sample Mean SD CV Mean SD CV Standard 1 1.00E+07 - - 16.28 0.14 0.86% Standard 2 1.00E+06 - - 19.42 0.1 0.51% Standard 3 1.00E+05 - - 22.9 0.03 0.13% Standard 4 1.00E+04 - - 26.44 0.03 0.11% Standard 5 1.00E+03 - - 30.12 0.08 0.27% Standard 6 1.00E+02 - - 33.58 0.1 0.30%

NTC No Ct No Ct - No Ct No Ct - Oo males 1.41E+03 8.36E+01 5.91% 29.5 0.09 0.31% Oo females 1.90E+03 2.06E+01 1.08% 29.05 0.02 0.07% Oo eggs 3.61E+03 4.85E+02 13.46% 28.09 0.2 0.71% Oo L1/L2 1.18E+03 1.92E+01 1.62% 29.77 0.02 0.07% Oo L3 1.31E+03 2.41 0.18% 29.61 0 0.00%

Table 17: Raw data of real-time PCR O. ostertagi depsiphilin assay

SD standard deviation of duplicates CV coefficient of variance of duplicates

Ct threshold cycle NTC no-template control Appendix 185

-Ct Relative ratio of relative Relative copy Hc 2 method copy numbers numbers

Hc110-R Hc110-R 18S / Hc110-R Hc110-R 18S / Hc110- Sample 18S 60S / 18S / 60S 60S / 18S / 60S 60S R

Males * 100% 100% 100% 100% 100% 100% 100% 100% 100%

Females 273% 58% 21% 265% 55% 21% 142% 691% 377%

Eggs 682% 45% 7% 629% 43% 7% 59% 867% 371%

L1/L2 154% 38% 24% 153% 38% 25% 71% 284% 109%

L3 174% 8% 4% 170% 8% 5% 17% 347% 29%

Table 18: Amounts of gene transcripts of H. contortus stages related to the amounts in males * males used as a calibrator, values set to 100%

186 Appendix

Relative ratio of relative copy Relative copy Oo 2 -Ct method numbers numbers

depsi / depsi / 18S / depsi / depsi / 18S / Sample 18S 60S depsi 18S 60S 60S 18S 60S 60S

Males * 100% 100% 100% 100% 100% 100% 100% 100% 100%

Females 89% 38% 43% 89% 38% 43% 150% 354% 135%

Eggs 384% 103% 27% 361% 101% 28% 71% 252% 255%

L1/L2 62% 21% 33% 63% 21% 34% 132% 393% 84%

L3 81% 58% 71% 82% 58% 70% 113% 161% 93%

Table 19: Amounts of gene transcripts of O. ostertagi stages related to the amounts in males * males used as a calibrator, values set to 100%

Appendix 187

8.1.3 Comparison of Real-time PCR Amplification Efficiencies

A Delta Ct Hc110-R / 18S 15 Delta Ct Hc110-R / 18S 10 Delta Ct Delta 5

0 1 : 5 1 : 10 1 : 20 1 : 50 cDNA dilution *

B Delta Ct Hc110-R / 60S 6 Delta Ct Hc110-R / 60S 4

Delta Ct Ct Delta 2

0 1 : 2 1 : 5 1 : 10 1 : 20 1 : 50 cDNA dilution

Figure 36: Delta Ct values of a dilution series of cDNA from H. contortus males (pool sample)

A: Delta Ct Hc110-R / 18 S = Ct Hc110-R – Ct 18 S

B: Delta Ct Hc110-R / 60 S = Ct Hc110-R – Ct 60 S

* cDNA for 18 S real-time PCR was pre-diluted 1 : 1000. The cDNA dilution used for the real-time PCR runs to determine transcription levels were therefore corresponding to the 1 : 10 dilution in both diagrams

Ct values, standard deviations, and coefficients of variance for the duplicates are listed in Table 20

188 Appendix

A Delta Ct Oo Depsi / 18S 15 Delta Ct Depsi / 18S 10

Delta Ct Delta 5

0 1 : 5 1 : 10 1 : 20 1 : 50 cDNA dilution *

B Delta Ct Oo Depsi / 60S 3 Delta Ct Depsi / 60S 2

Delta Ct Delta 1

0 1 : 2 1 : 5 1 : 10 1 : 20 1 : 50 cDNA dilution

Figure 37: Delta Ct values of a dilution series of cDNA from O. ostertagi males (pool sample)

A: Delta Ct depsiphilin / 18 S = Ct depsiphilin – Ct 18 S

B: Delta Ct depsiphilin / 60 S = Ct depsiphilin – Ct 60 S

* cDNA for 18 S real-time PCR was pre-diluted 1 : 1000. The cDNA dilution used for the real- time PCR runs to determine transcription levels were therefore corresponding to the 1 : 10 dilution in both diagrams

Ct values, standard deviations, and coefficients of variance for the duplicates are listed in Table 21

Appendix 189

Delta Ct

Data Dilution (Mean of Mean Delta Ct SD Delta Ct CV Delta Ct dupl.) 1 : 5 * 10.73 Hc110-R / 1 : 10 * 8.79 9.83 0.81 8.28 % 18 S 1 : 20 * 9.68 1 : 50 * 10.1 1 : 2 4.5 1 : 5 4.15 Hc110-R / 1 : 10 4.07 4.27 0.23 5.47 % 60 S 1 : 20 4.09 1 : 50 4.55

Table 20: Delta Ct values, standard deviations, and coefficients of variance for the duplicates of a dilution series of cDNA from H. contortus males (pool sample) analyzed in real-time PCR; * cDNA for 18 S real-time PCR was pre-diluted 1 : 1000. The cDNA dilution used for the real- time PCR runs to determine transcription levels were therefore corresponding to the 1 : 10 dilution. Dupl.: duplicates

Delta Ct

Data Dilution (Mean of Mean Delta Ct SD Delta Ct CV Delta Ct dupl.) 1 : 5 * 11.07 Depsiphilin / 1 : 10 * 9.18 9.87 0.91 9.23 % 18 S 1 : 20 * 10.07 1 : 50 * 9.14 1 : 2 0.37 1 : 5 0.27 Depsiphilin / 1 : 10 0.25 0.23 0.10 44.16 % 60 S 1 : 20 0.19 1 : 50 0.09

Table 21: Delta Ct values, standard deviations, and coefficients of variance for the duplicates of a dilution series of cDNA from O. ostertagi males (pool sample) analyzed in real-time PCR; * cDNA for 18 S real-time PCR was pre-diluted 1 : 1000. The cDNA dilution used for the real- time PCR runs to determine transcription levels were therefore corresponding to the 1 : 10 dilution. Dupl.: duplicates

190 Appendix

8.2 Important Plasmids

Restriction sites within the primers written (in brackets) after primer name and underlined, restriction sites within the primers underlined.

C. oncophora depsiphilin Full length (insert length 3089 bp): Plasmid: Co Sal Not 2 and 4 (pCR® 4 TOPO vector, 31.8.2004) Primer: Co Full Sal F (SalI): 5’- GTC GAC AGC TTG GTT TAA TAC CAA TAT GA -3’ Co Full Not 3 Re (NotI): 5’- GCG GCC GCA TCC TCA AAA ACC GTG -3’ Published as: DQ356246 C. oncophora clone Co 2 depsiphilin mRNA, complete cds DQ356247 C. oncophora clone Co 4 depsiphilin mRNA, complete cds (Co 4 with UTRs added)

N-terminus (insert length 1345 bp): Plasmid: Co ATC II 1 (pCR® 4 TOPO vector, 28.01.2005) Co pENTR 3 C 1 and 2 (pENTRTM 3C vector, 28.02.2005) Co pDEST 17 1 and 2 (pDESTTM 17 vector, 02.03.2005) Primer: Co Bam ATC F (BamHI): 5’- GGA TCC AAT ATC AAG AAA CTG CCG AT -3’ Oo N-Term EcoRV Re (EcoRV) (primer was initially designed for O. ostertagi): 5’- GAT ATC AAG CGG CCA CCA CAC G -3’

C. oncophora lat-2 Full length (insert length 4198 bp): Plasmid: Co lat-2 Full 3 (pCR® 4 TOPO vector, 26.01.2007) Primer: forward primer contains start codon ATG, printed in bold Co lat-2 Full 3F: 5’- TGC CAG TCG ATC TGT GTT AGA TGT GT -3’ Co lat-2 Full 3Re: 5’- AAC GCC TCG GTT AGC GTT CG -3’ Published as: EF494183 C. oncophora latrophilin-like protein 2 mRNA, complete cds (with UTRs added)

Appendix 191

C. oncophora slo-1 Full Length (insert length 3440 bp): Plasmid: Co slo-1 Full 4 2 (pCR® 4 TOPO vector, in E. coli JM109, 09.02.2007) Primer: Co slo-1 Full 4F: 5’- CTG TAC AGC GCC AAT TTG TTT ATG GTC TTT G -3’ Co slo-1 Full 4Re: 5’- CGA GGT CCA TGG GAG GAC CAG AAT TT -3’ Published as: EF494185 C. oncophora SLOwpoke potassium channel family member (slo-1) mRNA, complete cds (with UTRs added)

H. contortus lat-2 Full length: Plasmid (insert length 4415 bp): Hc lat-2 Full 2 4 (pSC-A vector, 09.05.2006) Primer: Hc lat-2 Full F 2: 5’- GGT AAT AGT ACG GGA GTG CCA GTC -3’ Hc lat-2 Full Re 2: 5’- GAA CGC ATT CAA AGA CCT CTT TTC -3’ Published as: EF137716 H. contortus latrophilin-like protein 2, mRNA, complete cds EF494182 H. contortus latrophilin-like protein 2, mRNA, complete cds (with UTRs added)

Plasmid (insert length 4014 bp): Hc lat-2 pcDNA pSC-A 7 (pSC-A vector, 06.09.2006) Hc lat-2 pcDNA 3.1 His B 73 (pcDNA 3.1 His B© vector, 28.09.2006) Primer: 1st PCR: Hc lat-2 Kozak F (containing Kozak sequence GCC ACC): 5’- GCC ACC ATG TCT GCT CTG TTC TAT TTG -3’ Hc lat-2 Full 1 Re: 5’- GTG GCG TCC GTG CTT GTG AT -3’

2nd PCR: Hc lat-2 Kozak Not F(NotI): 5’- GCG GCC GCC ACC ATG TCT -3’ Hc lat-2 pcDNA XhoI Re (XhoI): 5’- CTC GAG ATT CCT CGA TCG GCT AAG TC -3’

192 Appendix

H. contortus slo-1 Full Length (insert length 3495 bp): Plasmid: Hc slo-1 pCR 4 JM 2 (pCR® 4 TOPO vector, in JM109 E. coli, 09.02.2007) Primer: Hc slo-1 Full 1F: 5’- CGC CTC GGG TTC ACT TCG GAT TC -3’ Hc slo-1 Full 1 Re: 5’- TCA CCG AAA GAA AAT CAA CGA AAG GAA GAG -3’ Published as: EF494184 H. contortus SLOwpoke potassium channel family member (slo-1) mRNA, complete cds (with UTRs added)

O. ostertagi depsiphilin Full length (insert length Oo 8: 3042 bp / Oo 10: 3036 bp): Plasmid: Oo Bam Not 8 and 10 (pCR® 4 TOPO vector, 31.8.2004) Primer: Co Full F (BamHI) (primer was initially designed for C. oncophora) 5’- GGA TCC GCT TGG TTT AAT ACC AAT ATG A -3’ Oo Full Re (NotI): 5’- GCG GCC GCC GCA TCA ACA GGA GCA ATC T -3’ Published as: DQ356249 O. ostertagi clone Oo10 depsiphilin mRNA, complete cds DQ356248 O. ostertagi clone Oo8 depsiphilin mRNA, complete cds (Oo 8 with UTRs added)

Plasmid (insert length 3030 bp): Oo pcDNA 3 21 (pcDNA 3 vector, 25.08.2006) Primer: Oo pcDNA 3 F (BamHI), containing Kozak sequence GCC ACC: 5’- GGA TCC GCC ACC ATG AGG AAC TC -3’ Oo pcDNA 3 Re (NotI): 5’- GCG GCC GCC GCA TCA AC -3’

N-terminus (insert length 1345 bp): Plasmid: Oo ATC II 1 (pCR® 4 TOPO vector, 25.1.2005) Oo pENTR 3 C 1 and 2 (pENTRTM 3C vector, 28.02.2005) Oo pDEST 17 1 and 2 (pDESTTM 17 vector, 02.03.2005) Primer: Oo Bam ATC II F (BamHI): 5’- GGA TCC AAT ATC AGG AGT ACA CAA ATC TTT CT -3’ Oo N-Term EcoRV Re (EcoRV): 5’- GAT ATC AAG CGG CCA CCA CAC G -3’

Appendix 193

Oo slo-1 contig was assembled from: Plasmid (insert length 550 bp): Oo slo-1 5’1 (RACE) (pSC-A vector, 25.04.2006) Primer: Universal Primer Mix A was used as forward primer Co / Oo slo-1 5’ Re 2: 5’- GCA ATT CAT CGG ATA GCC ATA GGG CTG ATT ATA G -3’

Plasmid (insert length 1402 bp): Oo slo-1 1 Mini 1 (pDrive vector, 13.02.2006) Primer: Hc slo-1 F 1: 5’- TGG GGG AAC ACT ATG TGG GTA GC -3’ Hc slo-1 Re 1: 5’- GCA TCT TCA GCA TCC GGA TTA GTG -3’ (Primers were initially designed for H. contortus slo-1)

Plasmid (insert length 3287 bp): Oo slo-1 3’ 3 3 (pSC-A vector, 12.07.2006) Primer: Oo slo-1 3’3 F: 5’- TTT CTT CGC GCC TTA CGT CTG ATG ACT GTG -3’ Universal Primer Mix A was used as reverse primer

Bovine LPH-2 N-terminus (insert length 2501 bp): Rd ATC II 1 (pCR® 4 TOPO vector, 18.2.2005) Rd pENTR 3 C 1 and 2 (pENTRTM 3C vector, 28.02.2005) Rd pDEST 17 1 and 2 (pDESTTM 17 vector, 02.03.2005) Primer: Lat Bam ATC F (BamHI): 5’- GGA TCC AAG GGA TCA ATA ATC GTG TCT TCT G -3’ Lat Xho Re (XhoI) 5’- CTC GAG TTG TAT GCA ATT TCC CTG TGG G -3’

Canine LPH-2 N-terminus (insert length 2501 bp): Hd ATC 2 (pCR® 4 TOPO vector, 20.1.2005) Hd pENTR 3 C 1 and 2 (pENTRTM 3C vector, 28.02.2005) Hd pDEST 17 1 and 2 (pDESTTM 17 vector, 02.03.2005) Primer: see bovine LPH-2, N-terminus

194 Appendix

8.2.1 Plasmids for Real-time PCR Standardization H. contortus: Plasmid (insert length 429 bp): Hc 18S St 1 Midi (pCR® 4 TOPO vector, 02.11.2006) Primer: Hc / Oo 18 S St F: 5’- CGC CGA TAT TCC GAA AAA GTG T -3’ Hc / Oo 18 S St Re: 5’- AGC CGA AAC CTC AAT AGA AAA CCA -3’

Plasmid (insert length 257 bp): Hc 60S 4 Midi (pCR® 4 TOPO vector, 02.11.2006) Primer: Hc 60 S F: 5’- GCC AAG CGC ACA AAG AAG GT -3’ Hc 60 S Re: 5’- CGC AGA CGA CGG ATT GTT GA -3’

Plasmid: Hc110-R pEGFP-N3 1A Midi (pEGFP-N3 vector, 02.11.2006) Full-length coding sequence of Hc110-R, described in SAEGER (2000)

O. ostertagi: Plasmid (insert length 429 bp): Oo 18S St 1 Midi (pCR® 4 TOPO vector, 02.11.2006) Primer: see H. contortus Plasmid (insert length 257 bp): Oo 60S Hc 1 Midi (pCR® 4 TOPO vector, 02.11.2006) Primer: see H. contortus Plasmid (insert length 3042 bp): (pCR® 4 TOPO vector, 31.8.2004) Oo 8 Midi (Oo Bam Not 8): Primer: see above

Appendix 195

8.3 Published Sequences

8.3.1 Sequences Used for the Design of Primers H. contortus Hc lat-2 fragment 1 (143 bp) Sanger BLAST Server inverted contig072923

Hc slo-1 fragments Sanger BLAST Server: Frag Start (150 bp) inverted contig 001213 Frag 1 (140 bp) contig 004261 Frag 2 (83 bp) contig 004261 Frag 3 (131 bp) contig 045106 Frag 3’ UTR (599 bp) contig 057289

Hc 18 S rRNA (1758 bp) NCBI L04153 Hc 60S fragment (325 bp) Sanger BLAST Server contig 026873

O. ostertagi Oo depsiphilin fragment 1 (529 bp) EMBL BQ099596 Oo depsiphilin fragment 2 (426 bp) EMBL BQ097838

Oo 18 S rRNA (1738 bp) NCBI AJ920352

Oo 60 S fragment (367 bp) NCBI AF052737

196 Appendix

8.3.2 Sequences Used for Alignments of Genes H. contortus Hc110-R orphan receptor, mRNA NCBI AJ272270 Hc110-R orphan receptor, protein NCBI CAC01096

C. elegans Ce lat-1 A lat-1 mRNA, splicing variant A NCBI AY314770 Ce LAT-1 A LAT-1 A protein NCBI AAQ84877 Ce lat-1 B lat-1 mRNA, splicing variant B NCBI AY314771 Ce LAT-1 B LAT-1 B protein NCBI AAQ84878 Ce lat-2 lat-2 mRNA NCBI AY314772 Ce LAT-2 LAT-2 protein NCBI AAQ84879 Ce SLO-1 translated slo-1 NCBI NM_001029089

C. briggsae putative LAT-1 hypothetical protein CBG03206 NCBI CAE59757 putative LAT-2 hypothetical protein CBG03673 NCBI CAE60128

B. taurus LPH-1 splice variant aa, protein NCBI AAD09191 LPH-2 splice variant baaaf, protein NCBI AAD05306 LPH-3 splice variant bbah, protein NCBI AAD05329 calcium-activated potassium channel protein, isoform C NCBI AAK54354

C. familiaris LPH-2 predicted similar to LPH-2 precursor isoform 1 NCBI XP_547314 calcium-activated protein, subfamily M subunit α1 NCBI Q28265 potassium channel

Appendix 197

H. sapiens LPH-2 protein NCBI CAI22398 calcium-activated protein, subfamily M, NCBI EAW54600 potassium channel α member 1 isoform CRA_d calcium-activated cDNA NCBI U11058 potassium channel (cited in MEERA et al.,1997)

M. musculus LPH-1 protein NCBI NP 851382 LPH-2 protein NCBI XP 131258 LPH-3 protein NCBI NP 941991

R. norvegicus LPH-1 protein NCBI NP 075251 LPH-2 protein NCBI NP 599235 LPH-3 protein NCBI NP 570835 calcium-activated protein NCBI AAD34786 potassium channel

G. gallus calcium-activated protein NCBI AAC35370 potassium channel

D. melanogaster calcium-activated protein, CG10693-PP, NCBI AAX52990 potassium channel isoform P calcium-activated protein NCBI JH0697, potassium channel (cited in MEERA et al.,1997) record had been discontinued but could still be found as NCBI 321029

198 Appendix

M. sexta calcium-activated protein NCBI AAT44358 potassium channel

T. castaneum calcium-activated predicted, similar to NCBI XP_968651 potassium channel CG10693-PM (D. melanogaster)

A. californica calcium-activated protein NCBI AAR27959 potassium channel Appendix 199

8.4 Material

8.4.1 Commercial Primers and Primers as Components of Kits Adapter Primer (INVITROGEN): 5’- GGC CAC GCG TCG ACT AGT ACT TTT TTT TTT TTT TTT T -3’ BD SMART IITM A Oligonucleotide (CLONTECH): 5’- AAG CAG TGG TAT CAA CGC AGA GTA CGC GGG -3’ 3’ RACE CDS primer (CLONTECH):

5’- AAG CAG TGG TAT CAA CGC AGA GTA C(T)30 -3’ 5’ RACE CDS primer (CLONTECH):

5’- (T)25VN -3’ 10 X Universal Primer A Mix (CLONTECH) Long (0.4 µM): 5’- CTA ATA CGA CTC ACT ATA GGG CAA GCA GTG GTA TCA ACG CAG AGT -3’ Short (2 µM): 5’- CTAATACGACTCACTATAGGGC -3’

8.4.2 Custom Primers RACE primers and primers for PCR amplifying only fragments of the genes are not listed. Primers used for amplification of full-length and other important sequences are listed for each plasmid in 8.2.

200 Appendix

8.4.3 Oligonucleotides for Real-time PCR

8.4.3.1 Primers for cDNA Synthesis H. contortus:

oligo-(dT) primer: 5’- NV(T)17 -3’ Hc 18 S St Re: 5’- AGC CGA AAC CTC AAT AGA AAA CCA -3’ Hc 60 S Re: 5’- CGC AGA CGA CGG ATT GTT GA -3’ Hc110-R qPCR Re 1: 5’- ATC TTC TCC GAT GTG GGA TAG ATG -3’

O. ostertagi: oligo-(dT) primer: see H. contortus Hc 18 S St Re: see H. contortus Hc 60 S Re: see H. contortus Oo 7-9 B Re: 5’- CTC GGA TGT GGG ATA GAT GA -3’

8.4.3.2 Primers for Testing for Absence of Genomic DNA H. contortus: Hc110-R qPCR 3 F: see 8.4.3.3 Hc110-R qPCR 3 Re: see 8.4.3.3 Hc110-R VII Re: 5’- TAC AAT GCA CAT AGT CAT GAA -3’ Hc 60 S F: see 8.4.3.3 Hc 60 S Re: see 8.4.3.3

8.4.3.3 Primers for Real-time PCR H. contortus: Hc 18 S qPCR F 1: 5’- GGA GAG GGA GCC TTA GAA ACG -3’ Hc 18 S qPCR Re 1: 5’- TCA TTG AAA TGA CCG TTC CAT AGG -3’ PCR product: 130 bp

Hc 60 S qPCR F 1: 5’- TGG TCA AGA AGA TGG AGG TTA CAC -3’ Hc 60 S Re: 5’- CGC AGA CGA CGG ATT GTT GA -3’ PCR product: 187 bp Appendix 201

Hc110-R qPCR 3 F: 5’- GGA GCA GCC GCT TAT TAC GA -3’ Hc110-R qPCR 3 Re: 5’- TCG GTG CGT AAC CAG CAA -3’ PCR product: 65 bp

O. ostertagi: Hc 18 S qPCR F 1: see H. contortus Hc 18 S qPCR Re 1: see H. contortus PCR product: 130 bp

Oo 60 S qPCR F 1: 5’- CCC GAT ATG GAG CGT CTT TGC -3’ Hc 60 S Re: see H. contortus PCR product: 214 bp

Oo Depsi qPCR 3 F: 5’- GAA GAA AAG TTC GAA TGT GGT ATG ATT -3’ Oo Depsi qPCR 3 Re: 5’- CAT CCA AGT CAG GGC CGA TA -3’ PCR product: 72 bp

8.4.3.4 Taqman TM Probes APPLIED BIOSYSTEMS, Warrington, Cheshire, UK All probes were labelled at the 5’ end with the reporter dye FAM and at the 3’ end with the quencher dye TAMRA.

H. contortus: Hc 18 S: 5’- CCA CAT CCA AGG AAG GCA GCA GGC -3’ Hc 60 S: 5’- CCG GCA GCT TTA CGC TTC ATG GCC -3’ Hc110-R: 5’- CCG ACT GGT TTT GGA ACA CGC AAT C -3’

O. ostertagi: Oo 18 S: 5’- CCA CAT CCA AGG AAG GCA GCA GGC -3’ Oo 60 S: 5’- ACC GAG AGT GCT GGG TCA CCT CCA -3’ Oo Depsi: 5’- CGG GTT GTC TGC TGT ATT TCT T -3’

202 Appendix

8.4.3.5 Primers for C. elegans Expression Plasmid Restriction sites within the primers written after primer name and underlined, restriction sites within the primers underlined.

C. elegans lat-1 promotor region: 1st PCR: lat-1 prom BIG HindIII F: 5’- AAG CTT TTC CTG CCA TAC TGA AGG C -3’ lat-1 prom SanDI Re: 5’- GGG TCC CTC GCA TCA GTG CAT AC -3’

2nd PCR: lat-1 prom BIG HindIII F: see 1st PCR lat-1 prom NheI Re (SanDI restriction site twofold underlined): 5’- GCT AGC TTC GCC CTT GGG TCC -3’

C. oncophora depsiphilin: Co Depsi SanDI F (start codon ATG printed in bold): 5’- GGG ACC CAT ATG AAG AAA CTG CCG A -3’ Co Depsi NheI Re (complementary stop TAA codon printed in bold): 5’- GCT AGC TAG GAA TGT GCT AAA CGT TTC GC -3’

O. ostertagi depsiphilin: Oo 8 Depsi SanDI F (start codon ATG printed in bold): 5’- GGG ACC CAT ATG AGG AAC TCA CAA ATC TT -3’ Oo 8 Depsi NheI Re (complementary stop TAA codon printed in bold): 5’- GCT AGC AGG AGC AAT CTT AAA CGT TTC -3’

Appendix 203

8.4.4 Antibody Concentrations Antibodies were diluted in TBS Tween.

8.4.4.1 Primary Antibodies QIAGEN, Hilden QIAexpress Penta-HisTM Antibody 1: 500 – 1: 1000

ALOMONE, Jerusalem, Israel Anti-α-latrotoxin antibody 1: 100 – 1: 500

QCB, Hopkinton, Massachussetts, USA

Anti-Hc110-R-antibodies 1: 100 – 1: 8000

INVITROGEN, Karlsruhe Anti-His(C-term) Antibody 1: 5000 Anti-Xpress Antibody 1: 5000 Anti-Thio AntibodyTM 1: 5000

SIGMA-Aldrich, Steinheim Monoclonal Anti-Glutathione-S-Transferase 1: 1000 – 1: 5000 (GST) antibody clone GST-2

8.4.4.2 Secondary Antibodies AP conjugated antibodies:

SIGMA-Aldrich, Steinheim Anti-mouse IgG (whole molecule), Alkaline 1: 10 000 – 1: 25 000 Phosphatase conjugate, developed in goat Anti-rabbit IgG (whole molecule) Alkaline 1: 3000 Phosphatase conjugate, developed in goat

204 Appendix

HRP conjugated antibodies:

PIERCE, Rockford, Illinois, USA ImmunoPure® Peroxidase Conjugated Goat 1 : 10 000 anti-rabbit IgG (H+L)

8.4.5 Escherichia coli Strains INVITROGEN, Karlsruhe One Shot® Top 10 Chemically Competent Cells F- mcraA (mrr-hsdRMS-mcrBC) Φ80lacZM15 lacX74 rec A1 araD139 (ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Part of the TOPO TA Cloning® Kit for Sequencing, also used for routine transformations BL21 Star (DE3) One Shot® Competent Cells - F ompT hsdSB (rB-,mB-) gal dcm rne 131(DE3) Used for expression cultures; lacks RNase E as well as lon and OmpT proteases; IPTG inducible Library Efficiency® DB3.1TM Competent Cells - F gyrA462 endA1 (sr1-recA) mcrB mrr hsdS20 (rB-,mB-) supE44 ara-14 galK2 lacY1 proA2 rpsL20(SmR) xyl-5 λ-leu mtl1 Used for propagating plasmids containing ccdB gene, which is lethal for other strains OneShot® BL21 (DE3) Competent Cells - F ompT hsdSB (rB-mB-) gal dcm (DE3) Lacks lon and OmpT proteases; IPTG inducible OneShot® BL21 (DE3) pLysS Competent Cells - R F ompT hsdSB (rB-mB-) gal dcm (DE3) pLysS (Cam ) Lacks lon and OmpT proteases; IPTG inducible; reduces the basal expression level and therefore facilitates the expression of potentially toxic proteins Appendix 205

BL21-AITM One Shot® Competent Cells - F ompT hsdSB (rB-mB-) gal dcm araB::T7RNAP-tetA Lacks lon and OmpT proteases; ara BAD promotor (L-arabinose inducible; expression can be repressed by glucose); expression level is controllable, which facilitates the expression of potentially toxic proteins Library Efficiency® DH5α® Chemically Competent Cells - - + F Φ80lacZM15 (lacZYA-argF)U169 recA1 endA1 hsdR17(rk , mk ) phoA supE44 thi-1 gyrA96 relA1 λ- Alternatively used for routine transformations NOVAGEN / MERCK, Darmstadt Rosetta gami 2 (DE3)TM Competent Cells (ara – leu) 7697 lacX74 phoA PvuII phoR a raD139 ahpC gale rpsL (DE3) F’ (lac+ lacIq pro) gor522::Tn10 trxB pRARE2 (CamR, StrR, TetR) Supplementation of the rare codons in bacteria AGG, AGA, AUA, CUA, CCC, and GGA; enhanced disulfide bond formation

STRATAGENE, Amsterdam, Netherlands StrataCloneTM SoloPack® Competent Cells Complete genotype not accessible Part of the StrataCloneTM PCR Cloning Kit, alternatively used for cloning of PCR products JM109 Competent Cells e14–(McrA–) recA1 endA1 gyrA96 thi-1 hsdR17 (rK– mK+) supE44 relA1 (lac-proAB) [F´ traD36 proAB lacIqZM15] Used for propagating expression plasmids and some other very large plasmids

206 Appendix

8.4.6 Vectors ADDGENE, Cambridge, USA pPD30.69 for expression in C. elegans, containing myo-2 promotor and unc-54 3’ UTR

CLONTECH, Saint-Germain-en-Laye, France pEGFP-N2 used as control vector in eukaryotic expression experiments

INVITROGEN, Karlsruhe pCR® 4 TOPO for cloning of PCR products pCR® -Blunt for cloning of blunt end PCR products pENTRTM 3C entry vector for Gateway® system pDESTTM 17 N-terminal 6 X His; T7 promotor pcDNA 3 tagless, for expression in eukaryotic cells pcDNA 3.1 His B© N-terminal 6 X His, for expression in eukaryotic cells; SV 40 early promotor and origin pDESTTM 14 tagless vector; T7 promotor pDESTTM 15 N-terminal GST tag; T7 promotor pBAD-DEST 49 N-terminal HP-thioredoxin, C-terminal 6 X His tag; ara BAD promotor (L-arabinose inducible) pRSET ATM N-terminal 6 X His; T7 promotor

NOVAGEN / MERCK, Darmstadt pET-41a(+) N-terminal GST tag, C-terminal 6 X His tag; T7 promotor

QIAGEN, Hilden pDrive Cloning vector for cloning of PCR products

STRATAGENE, Amsterdam, Netherlands pSC-A for cloning of PCR products

Appendix 207

TAKARA BIO EUROPE, Saint-Germain-en-Laye, France pCold DNA I N-terminal 6 X His; cspA promotor (cold shock protein promotor), controlled by lac operator and IPTG Chaperone expressing plasmids for coexpression (intending better protein folding): pG-KJE 8 chaperones dnaK-dnaJ-grpE (ara B promotor, L-arabinose inducible) and groES-groEL (Pzt 1, tetracyclin-inducible) pGro 7 chaperones groES-groEL (ara B promotor, L-arabinose inducible) pKJE 7 chaperones dnaK-dnaJ-grpE (ara B promotor, L-arabinose inducible) pGTf 2 chaperones groES-groEL-tig (Pzt 1, tetracyclin-inducible) pTf 16 chaperone tig (ara B promotor, L-arabinose inducible)

8.4.7 Eukaryotic Cell Lines HEK-293 Human embryonic kidney cells COS-7 Cercopithecus aethiops (African green monkey) kidney cells

208 Appendix

8.4.8 Buffers and Solutions

α–LTX 40 µg of α–LTX in 15 ml 50 % glycerol or ddH2O give a 20 nM solution 0.5 % / 1 % / 2 % agarose gel 0.5 % (w / v) agarose / 1 % (w / v) agarose / 2 % (w / v) agarose solubilzed by boiling in 1 x TAE buffer. After cooling down to 56° C and immediately before use 1 µl GelStar® Nucleic Acid Gel Stain was added per 1 ml agarose

AP buffer 100 mM NaCl; 5 mM MgCl2 x 6 H2O; 100 mM Tris-HCl; pH 9.5 in deionized water BCIP Stock Solution 50 mg/ml 5-bromo-4-chloro-3-indoxyl phosphate in 100 % dimethylformamide TM Binding buffer for HisTrap 20 mM NaH2P04, 500 mM NaCl, 20 mM imidazole, pH 7.4 in deionized water Blotting buffer for Western Blot 24 mM Tris; 192 mM glycine; 20 % methanol in deionized water Blotting buffer for Western Blot see NuPage® Blotting buffer of NuPage® gels

0.1 M Citrate 0.1 M Citrate in ddH2O; pH 3.1

Complete Solution 1 tablet Complete in 1.5 ml ddH2O Coomassie Blue Staining Solution 40 % methanol; 10 % pure acetic acid; 10 % Coomassie Blue Stock solution; 40 % deionized water Coomassie Blue Stock Solution 0.1 % Brilliant blue R 250 in deionized water Coomassie Blue Stripping Solution 10 % pure acetic acid, 90 % deionized water DEPC ethanol for RNA washing 75 % ethanol in DEPC treated water DEPC treated water 0.1 % diethylpyrocarbonate in Aqua bidest., stirred for 12 hours at room temperature, then autoclaved Dilution and Refolding buffer 20 mM Tris (pH 8.1); 150 mM NaCl; 1 mM DTT; 1.3 mM reduced glutathione; 1.0 mM oxidized glutathione in deionized water; 1 tablet Complete per 50 – 150 ml; buffer was sterilized by filtering Appendix 209

Direct Lysis buffer 62.5 mM Tris-HCl (pH 6.8); 2 % (w / v) SDS; 10 % glycerol; 50 mM DTT; 0.01 (w / v) bromo-phenol blue DNase 2 mg / ml DNase I in DNase Storing buffer DNase Storing buffer 10 mM Tris-HCl (pH 7.5); 50 mM NaCl;

10 mM MgCl2; 1 mM DTT; 50 % (v / v) glycerol TM Elution buffer for HisTrap 20 mM NaH2PO4; 500 mM NaCl; 500 mM imidazole; pH 7.4 in deionized water Enriched HBSS HBSS, additionally containing 10 mM glucose and 0.5 % BSA GIT buffer 4 M guanidine; 0.1 M Tris (pH 7.5); 1 % β-mercapto-ethanol in autoclaved Aqua bidest.

Glycerol Stock Solution 65 % glycerol; 100 mM MgSO4; 25 mM Tris-HCl (pH 8.0) in autoclaved Aqua bidest., sterilized by filtrating

HBSS 120 mM NaCl; 5 mM KCl; 1 mM MgCl2;

20 mM HEPES (pH 7.4); 1 mM CaCl2; autoclaved Inclusion Body Solubilization buffer 50 mM Tris-HCl (pH 8); 0.3 M NaCl; 6 M guanidine HCl; 0.1 % Triton X 100; 10 mM imidazole in deionized water Inclusion Body Washing buffer I 50 mM Tris-HCl (pH 8); 0.1 M NaCl; 0.1 % Triton-100 in deionized water; immediately before use 1 mM DTT Inclusion Body Washing buffer II 50 mM Tris-HCl (pH 8); 0.1 M NaCl in Aqua bidest. Loading Dye for agarose gels, 6 X 0.25 % bromophenol blue; 40 % sucrose in Aqua bidest. Lysis buffer 50 mM Tris-HCl (pH 8.0); 1 mM EDTA; 100 mM NaCl MagneHis Binding / Wash buffer 100 mM HEPES; 10 mM imidazole; pH 7.5 MagneHis Elution buffer 100 mM HEPES; 500 mM imidazole; pH 7.5 MagneHis Regeneration buffer 100 mM HEPES; pH 7.0 MES, 20 X 50 mM MES, 50 mM Tris, 0.1 % SDS, 1 mM EDTA, pH 7.3 in deionized water

210 Appendix

® 100 mM MES for Dynabeads 100 mM MES in ddH2O; pH 5.0 MOPS, 20 X 50 mM MOPS, 50 mM Tris, 0.1 % SDS, 1 mM EDTA, pH 7.7 in deionized water NBT Stock Solution 50 mg/ml nitro-tetrazolium-chloride in 70 % dimethylformamide 20 X NuPage® Transfer buffer 25 mM Bicine; 25 mM Bis-Tris (free base); 1 mM EDTA; pH 7.2 NuPage® Blotting buffer 1 X NuPage® Transfer buffer, containing 10 % methanol for blotting one gel (20 % methanol for blotting two gels) Physiological NaCl 0.9 % NaCl in deionized water

1 X PBS 150 mM NaCl; 16 mM Na2HPO4 x 7 H2O;

4 mM NaH2PO4 x 2 H2O in deionized water Renaturation buffer for SDS gels 4 M Urea; 50 mM NaCl; 2 mM EDTA; 0.2 mM DTT; 10 mM Tris-HCl; in deionized water; pH 7.5 Running buffer for SDS-PAGE, 10 X 0.025 M Tris; 0.192 M glycine; 0.1 % SDS (pH 8.5) in deionized water Running buffer for NuPage® gels 1 X MES or 1 X MOPS Saturated NaCl solution approx. 400 g NaCl per liter tap water (density at 20° C: 1.2) Saturated sucrose solution 60 g sucrose in 40 ml deionized water 40 % sucrose solution 40 ml of saturated sucrose solution in 100 ml; in deionized water; colored with blue food color 25 % sucrose solution 25 ml of saturated sucrose solution in 100 ml; in deionized water; colored with red food color 10 % sucrose solution 10 ml of saturated sucrose solution in 100 ml; in deionized water; colored with yellow food color SDS Loading Dye 5.4 ml Aqua bidest.; 0.5 ml 1.0 M Tris (pH 6.8); 2 ml 10 % SDS; 1 ml glycerol; 0.1 ml bromophenol blue stock solution (5 mg / 100 µl); 0.1 volume of 1 M DTT added immediately before use Appendix 211

SDS resolving gel, 10 % For 5 ml gel: 1.9 ml Aqua bidest., 1.7 ml 30 % NF-acrylamide / Bis solution; 1.3 ml 1.5 M Tris (pH 8.8); 0.05 ml 10 % SDS; 0.05 ml 10 % ammoniumpersulfate; 2 µl TEMED SDS resolving gel, 8 % For 5 ml gel: 2.3 ml Aqua bidest., 1.3 ml 30 % NF-acrylamide / Bis solution; 1.3 ml 1.5 M Tris (pH 8.8); 0.05 ml 10 % SDS; 0.05 ml 10 % ammoniumpersulfate; 3 µl TEMED SDS stacking gel, 5 % For 5 ml gel: 2.7 ml Aqua bidest.; 0.67 ml 30 % NF-acrylamide / Bis solution; 0.5 ml 1.0 M Tris (pH 6.8); 40 µl 10 % SDS; 40 µl 10 % ammoniumpersulfate; 4 µl TEMED Staining Solution for Western Blot 10 ml AP buffer; 66 µl NBT stock solution; 33 µl BCIP stock solution TAE-Puffer, 50 X 2 M Tris; 5,71 % pure acetic acid; 1 mM EDTA (pH 8.0) in deionized water TBS, 10 X 1.37 M NaCl; 100 mM Tris-Base (pH 7.3) in deionized water TBS Tween 1 X TBS; 0.05 % Tween 20 TE buffer 10 mM Tris; 1 mM EDTA in Aqua bidest.; autoclaved

TSS-Solution 5 g PEG 6000, 2.5 ml DMSO, 2.5 ml 1 M MgSO4 filled to 50 ml with LB broth, pH 6.5, filter sterilized, stored at -20° C X-Gal 4 % (w / v) 5-bromo-4-chloro-3-indolyl-β-D-galacto- pyranoside (X-Gal) in dimethylformamide

212 Appendix

8.4.9 Media For culturing E. coli: LB broth 1 % bactotryptone; 0.5 % yeast extract; 1 % NaCl; pH 7 in deionized water LB agar plates: LB broth containing 15 % agar / l TB broth: 1.2 % caseine, 2.4 % yeast extract,

0.23 % KH2PO4, 1.25 % K2HPO4; pH 7.2 in deionized water. 4 ml glycerol / l

Broths and agar were sterilized by autoclaving. Prior to use antibiotics were added, either kanamycin or carbenicillin at a concentration of 50 µg / ml.

For culturing eukaryotic cells: DMEM / Ham’s F 12 + 10 % FCS; DMEM / Ham’s F 12 + 20 % FCS; DMEM + 10 % FCS

8.4.10 Reagents and Chemicals Not listed chemicals were obtained from ROTH, Karlsruhe.

ALOMONE, Jerusalem, Israel α-Latrotoxin; anti-α-Latrotoxin Antibody

CAMBREX, East Rutherford, New Jersey, USA GelStar® Nucleic Acid Gel Stain

FERMENTAS GeneRulerTM 100 bp DNA Ladder

FRESENIUS KABI, Bad Homburg Ampuwa

Appendix 213

INVITROGEN, Karlsruhe Anti-Thio antibodyTM; 250 bp DNA Ladder; custom primers; LipofectamineTM Transfection Reagent; NuPage® LDS sample buffer (4x); NuPage® Bis-Tris gels; Opti-MEM®; SeeBlue® Pre-Stained Standard; SeeBlue® Plus2 Pre-Stained Standard; Trizol Reagent®

KODAK, Rochester, New York, USA GBX Developer and Replenisher; GBX Fixer and Replenisher; KODAK® BioMax Light Film Light-1

MERCK, Darmstadt Chloroform

PROMEGA, Mannheim RNAsin® RNase inhibitor, dNTPs (dATP, dCTP, dGTP, dTTP)

QIAGEN, Hilden QIAexpress Penta-HisTM antibody

ROCHE, Mannheim Complete Mini Tablets (Protease Inhibitor Cocktail), FuGENE 6 Transfection Reagent

ROTH, Karlsruhe Agarose NEEO ultra quality Roti®garose; ammoniumpersulfate; carbenicillin disodium salt; deoxycholic acid sodium salt; isopropanol; isopropyl-ß-D-thiogalactoside (IPTG); kanamycinsulfate; L-arabinose; LB broth; Roti®-Block 10 X concentrated blocking reagent; Rotiphorese® NF Acrylamide / Bis solution 30 % (29 : 1); SDS ultra pure; Terrific Broth; TEMED 99 % pro analysi; Tris Pufferan® ultra quality

214 Appendix

SIGMA-Aldrich, Steinheim Glycogen, from Mytilus edulis (Blue mussel) (20 mg / ml); monoclonal anti-Glutathione-S-Transferase (GST) antibody produced in mouse, clone GST-2, ascites fluid; anti-mouse IgG (whole molecule) Alkaline Phosphatase conjugate, developed in goat; anti-rabbit IgG (whole molecule) Alkaline Phosphatase conjugate, developed in goat

8.4.11 Enzymes Nomenclature of restriction enzymes is given according the rules published by ROBERTS et al. (2003)

CLONTECH, Saint-Germain-en-Laye, France BD Advantage® 2 Polymerase Mix

FERMENTAS, St. Leon-Roth T4 DNA Ligase; BamHI; EcoRI; EcoRV; HindIII; NheI; NotI; SalI

FINNZYMES, Espoo, Finland PhusionTM Hot Start DNA High-Fidelity Polymerase

INVITROGEN, Karlsruhe Gateway® LR ClonaseTM Enzyme Mix; SuperScriptTM III Reverse Transcriptase

PROMEGA, Mannheim RQ1 RNase-free DNase

QIAGEN, Hilden Qiagen Taq DNA Polymerase

STRATAGENE, Amsterdam, Netherlands SanDI

Appendix 215

8.4.12 Commercial Kits AMERSHAM BIOSCIENCES QuickPrepTM Micro mRNA Purification Kit

CLONTECH, Saint-Germain-en-Laye, France BD SMARTTM RACE cDNA Amplification Kit; BD Advantage® 2 PCR Kit

GENOTECH, St. Louis, Missouri, USA CB-XTM Protein Assay

INVITROGEN, Karlsruhe 3’ RACE System for Rapid Amplification of cDNA ends; Dynabeads® M-270 Carboxylic Acid; TOPO TA Cloning® Kit for Sequencing¸ Zero Blunt® PCR Cloning Kit

MACHEREY & NAGEL, Düren NucleoBond® AX 100, NucleoSpin® Plasmid

PIERCE, Rockford, Illinois, USA Mem-PER® Eukaryotic Membrane Protein Extraction Kit; PAGEprep® Advance Clean-Up Kit; SuperSignal West® Femto Maximum Sensitvity Substrate (including ImmunoPure® Peroxidase Conjugated Goat anti-Mouse IgG (H+L) and ImmunoPure® Peroxidase Conjugated Goat anti-Rabbit IgG (H+L))

PROMEGA, Mannheim MagneHisTM Protein Purification System

QIAGEN, Hilden QIAGEN® PCR Cloning Kit

STRATAGENE, Amsterdam, Netherlands Brilliant® QPCR Master Mix; StrataCloneTM PCR Cloning Kit

216 Appendix

8.4.13 Disposables BIOZYM, Hessisch-Oldendorf 10 µl filter tips; 100 µl filter tips; 1000 µl filter tips; 0.2 ml PCR tubes; 1.5 ml reaction tubes; 2 ml reaction tubes

EPPENDORF, Hamburg Safe-lock reaction tubes, 0.5 ml

PROMEGA, Mannheim Gel Drying Film

RATIOLAB, Dreieich 1000 µl tips

SARSTEDT 10 µl tips; 100 µl tips; 10 ml pipettes; 25 ml pipettes; 25 cm2 and 75 cm2 cell culture bottles

STRATAGENE, Amsterdam, Netherlands Optical Caps, 8 X Strip; Strip Tube 8 X, 0.2 ml Format

8.4.14 Technical Equipment AMERSHAM BIOSCIENCES, Freiburg ÄktaTM FPLC; HisTrapTM HP; GeneQuant pro RNA/DNA Calculator (spectrophotometer); Ultrospec 2000 Photometer

BECKMAN COULTER, Krefeld J2-21 M/E Centrifuge

BIOMETRA, Göttingen Standard Power Pack P25; Trio-Thermoblock; Personal Cycler

Appendix 217

BIO-RAD, München Mini-Protean IITM (for electrophoresis of conventional SDS-PAGE gels)

EPPENDORF, Hamburg Centrifuge 5415 R; pipettors: 1 – 10 µl; 10 – 100 µl; 100 – 1000 µl; 500 – 5000 µl

GFL, Burgwedel Incubator “Wärmeschrank 3033“, rotator “Überkopf-Schwenker 3025“

HERAEUS SEPATECH, Osterode Biofuge Pico; Omnifuge 2 ORS; incubator “Wärmeschrank BT 5042 E

HOEFER, San Francisco, USA HE33 Mini Submarine Electrophoresis Unit (for electrophoresis of agarose gels); TE 70 Blotting chamber

INTAS, Göttingen UV illuminator TF-M 20x40 cm, 312nm

INVITROGEN, Karlsruhe XCell SureLockTM Mini-cell (for electrophoresis of NuPage® gels)

JANKE & Kunkel, Staufen Water quench

JOUAN, Unterhaching Centrifuge BR4i

LABORTECHNIK FRÖBEL, Lindau Blotshaker 1200

MJ RESEARCH INCORPORATION, Watertown, Massachussetts, USA PTC-200 Peltier Thermo Cycler (PCR cycler)

218 Appendix

PERKIN ELMER, Wellesley, USA GeneAmp PCR System 9700 (PCR cycler)

PEQLAB BIOTECHNOLOGIE GmbH, Erlangen Spectrophotometer Nanodrop ND 1000

PHARMACIA LKB BROMMA, Stockholm, Schweden 2303 Multidrive XL Power supply

QIAGEN, Hilden TissueRuptorTM (for mechanical tissue disruption)

SARTORIUS, Göttingen Electronic precision scale L610D

STRATAGENE, Amsterdam, Netherlands Mx 4000 (real-time PCR cycler)

ZEISS, Jena Microscope “Stereomikroskop Standard 14“

Appendix 219

8.4.15 Software AlignTM Plus 4.0 SCIENTIFIC AND EDUCATIONAL SOFTWARE

Beacon Designer PREMIER BIOSOFT INTERNATIONAL

BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html)

ClustalW v1.83 (http://www.ebi.ac.uk/clustalw/); (CHENNA et al., 2003)

ClustalX v1.83 (http://bips.u-strasbg.fr/fr/Documentation/ClustalX/)

ConPred II (http://bioinfo.si.hirosaki-u.ac.jp/~ConPred2/)

DNAStar (BURLAND, 2000)

MEGA 3.1 (KUMAR et al., 2004)

Mx 4000 software STRATAGENE

NCBI BLAST (ALTSCHUL et al., 1997)

NCBI CD-Search (MARCHLER-BAUER et al., 2007; MARCHLER-BAUER

and BRYANT, 2004)

Net-N-Glyc (GUPTA et al., 2004)

Pfam HMM local and (http://myhits.isb-sib.ch/cgi-bin/motif_scan); global model (FALQUET et al., 2002) applications (Motif Scan)

Phobius (http://phobius.cgb.ki.se/index.html); (KALL et al., 2004)

Primer Express APPLIED BIOSYSTEMS

Reference Manager THOMSON ISI RESEARCHSOFT

Sigma Stat JANDEL

TMMOD (http://liao.cis.udel.edu/website/servers/TMMOD)

220 Appendix

8.4.16 Databases NCBI database (http://www.pubmed.gov); (ALTSCHUL et al., 1997)

8.4.16.1 EST Databases Genome Sequencing Center (http://www.nematode.net/)

EMBL-EBI (http://www.ebi.ac.uk/blast2/parasites.html)

H. contortus (http://www.sanger.ac.uk/cgi-bin/blast/submitblast/h_contortus) BLAST server Wellcome Trust Sanger Institute

8.4.17 Custom Services SEQLAB LABORATORIES GOETTINGEN GmbH, Göttingen

Custom sequencing of plasmid DNA

QCB, Quality controlled Biochemicals, Hopkinton, Massachussetts, USA

Peptide antibodies against Hc110-R N-terminus

TOPLAB GmbH, Martinsried MALDI-Mass spectrometry analysis

Appendix 221

8.5 Abbreviations

Å Ångstrom (10 Å = 1 nm) α-LTX α-latrotoxin A. californica Aplysia californica A. caninum Ancylostoma caninum A. suum Ascaris suum aa amino acids Acc. No. accession number ACh acetylcholine AP Alkaline Phosphatase approx. approximately Aqua bidest. double distilled water (Latin: Aqua bidestillata) B. taurus Bos taurus BCIP 5-bromo-4-chloro-3-indoxyl phosphate BK-type channel large conductance Ca2+-activated potassium channel BLAST Basic Local Alignment Search Tool blastn BLAST (nucleotide sequence versus nucleotide sequence database) blastx BLAST (translated sequence versus protein database) bp base pairs BSA bovine serum albumin BWSV black widow spider venom © copyright ° C centigrade C. briggsae Caenorhabditis briggsae C. elegans Caenorhabditis elegans C. familiaris Canis familiaris C. oncophora Cooperia oncophora ca. circa Ca2+ calcium ions cAMP cyclic adenosine monophosphate

222 Appendix

CDART Conserved Domain Architecture Retrieval Tool cDNA coding or complementary DNA CDS primer cDNA synthesis primer Ce (within nomenclature) C. elegans CIRL Ca2+ independent receptor for LTX Co (within nomenclature) C. oncophora Co Depsi 2 depsiphilin plasmid Co Sal Not 2 Co Depsi 4 depsiphilin plasmid Co Sal Not 4

Ct threshold cycle CV coefficient of variation D. melanogaster Drosophila melanogaster D. pseudoobscura Drosophila pseudoobscura D. viviparus Dictyocaulus vivparus DAG diacylglygerol dATP deoxyadenosine triphosphate dCTP deoxycytydine triphosphate ddH2O autoclaved double distilled water DEPC diethylpyrocarbonate DEPC ethanol 75 % ethanol in DEPC treated water DEPC water DEPC treated water dGTP deoxyguanosine triphosphate DNA deoxyribonucleic acid dNTP mixture of the deoxynucleotides dATP, dCTP, dGTP, and dTTP dsRNA double-stranded RNA DTT dithiothreitol dTTP deoxythymidine triphosphate E. coli Escherichia coli Ed. editors EDC 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride EDTA Ethylenedinitrilotetraacetic acid e.g. for example (Latin: exempli gratia) egl-30 gene annotation for G-protein Gαq Appendix 223 egl-8 gene annotation for phospholipase Cβ EMBL European Molecular Biology Laboratory EST expressed sequence tag et al. and others (Latin: et alii) FAM carboxyfluorescein FaRP FMRFamide-like peptides FCS fetal calf serum FLP FMRFamide-like peptides FPLC Fast Protein Liquid Chromatography FRET fluorescence resonance energy transfer x g multiples of the earth's gravitational field G-protein guanine nucleotide-binding protein G. gallus Gallus gallus Gα α subunit of a G-protein GABA γ-aminobutyric acid GAPDH glyceraldehydes-3-phosphate GDP guanosine diphosphate GFP Aequorea victoria green fluorescent protein GluCl glutamate-gated chloride channel GPCR G-protein coupled receptor GPS GPCR proteolytic site GST glutathione-S-transferase GTP guanosine triphosphate h hour H. contortus Haemonchus contortus H. placei Haemonchus placei H. sapiens Homo sapiens HBSS Hank’s Buffered Salt Solution Hc (within nomenclature) H. contortus Hc110-R depsiphilin in H. contortus HPRT hypoxanthine-guanine phosphoribosyl transferase HormR domain present in hormone receptors HRP Horse Radish Peroxidase i.e. that is (Latin: id est)

224 Appendix

IK channel intermediate conductance Ca2+-activated potassium channel

IP3 inositol 1,4,5-triphosphate K+ potassium ions kb kilobasepairs (1000 bp) kDa kilodalton l liter L1 first stage larva L2 second stage larva L3 third stage larva L4 fourth stage larva lat-1 gene annotation for latrophilin-like protein 1 LAT-1 latrophilin-like protein 1 (protein) lat-2 gene annotation for latrophilin-like protein 2 LAT-2 latrophilin-like protein 2 (protein) LIT-ε latroinsectotoxin ε LPH latrophilin LTX latrotoxin LTXN4C pore-forming deficient latrotoxin mutant µl microliter µM micromolar µm micrometer M molar concentration (moles per liter) M. sexta Manduca sexta mA milliampere MALDI-MS matrix assisted laser desorption / ionization mass spectrometry MES 2-(N-morpholino) ethane sulfonic acid

MgCl2 magnesium chloride

MgSO4 magnesium sulfate min minute ml milliliter mm millimeter MOPS 3-(N-morpholino)-propane sulfonic acid Appendix 225 mRNA messenger RNA NaCl sodium chloride N. giraulti Nasonia giraulti NBT nitro-tetrazolium-chloride NCBI National Center for Biotechnology Information ng nanograms nM nanomolar NMT N-methyl-transferase O. ostertagi Ostertagia ostertagi OD optical density OLF olfactomedin-like domain Oo (within nomenclature) O. ostertagi Oo Depsi 8 depsiphilin plasmid Oo Bam Not 8 Oo Depsi 10 depsiphilin plasmid Oo Bam Not 10 PBS phosphate buffered saline PCR Polymerase Chain Reaction PDI protein disulfide isomerase pH negative logarithm of the concentration of protons

PIP2 phosphatidylinositol-4,5-bisphosphate PLC-β phospholipase Cβ ® registered trademark R. norvegicus Rattus norvegicus RACE Rapid Amplification of cDNA ends RCK regulator of conductance of K+ RdRP RNA-dependent RNA polymerase RISC RNA-induced silencing complex RNA ribonucleic acid RNAi RNA interference rRNA ribosomal RNA RT room temperature rxn reaction 18 S 18 S rRNA (in real-time PCR) 60 S 60 S acidic ribosomal protein (in real-time PCR) SD standard deviation

226 Appendix

SDS sodium dodecyl sulfate SDS PAGE sodium dodecyl sulfate poly-acrylamide gel electrophoresis sec second siRNA small interfering RNA SK channel small conductance Ca2+-activated potassium channel slo-1 gene annotation for the SLOwpoke calcium-gated potassium channel 1 SLO-1 SLOwpoke calcium gated potassium channel 1 (protein) SMART (mechanism) switching mechanism at 5’ end of RNA transcript SMART (database) simple modular architecture research tool SNAP-25 synaptosome-associated protein (25 kDa) SNARE-complex soluble N-ethylmaleimide-sensitive fusion protein attachment receptor complex snb-1 gene annotation for synaptobrevin SNOAPAD Standardized Nomenclature of Animal Parasitic Diseases SNP single nucleotide polymorphism spp. species T. castaneum Tribolium castaneum T. colubriformis Trichostrongylus colubriformis TAMRA 6-carboxy-tetramethyl-rhodamine tblastx BLAST (translated sequence versus translated database) TBS Tris buffered saline TM trademark TM helix transmembrane helix TMHMM transmembrane helices predicting Hidden Markov Models 7-TMR transmembrane region consisting of seven helices TMR transmembrane region TSS Transforming and Storing Solution Appendix 227

TSS transforming procedure transforming procedure using the TSS U activity unit (used for enzymes) unc-13 gene annotation for the diacylglycerol receptor UNC-13 UNC-13 diacylglycerol receptor UNC-13 UPM Universal Primer Mix A UTR untranslated region UV ultraviolet (light) V Volt vs. versus X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galacto-pyranoside

8.6 IUPAC Code for Nucleotides

A deoxyadenine C deoxycytosine G deoxyguanidine T deoxythymidine U deoxyuracil I deoxyinosine W A+T S C+G K T+G M A+C Y C+T R A+G V A+C+G D A+T+G B T+C+G H A+T+C N A+G+C+T

228 Appendix

8.7 Standard Amino Acid Abbreviations

Amino acid 3-letter code 1-letter code Alanine Ala A Arginine Arg R Asparagine Asn N Aspartic acid Asp D Cysteine Cys C Glutamic acid Glu E Glutamine Gln Q Glycine Gly G Histidine His H Isoleucine Ile I Leucine Leu L Lysine Lys K Methionine Met M Phenylalanine Phe F Proline Pro P Serine Ser S Threonine Thr T Tryptophan Trp W Tyrosine Tyr Y Valine Val V

Appendix 229

8.8 Reference List

ABOOBAKER, A. A. and M. L. BLAXTER (2003) Use of RNA interference to investigate gene function in the human filarial nematode parasite Brugia malayi Mol Biochem Parasitol, 129, 41-51

ALOMONE LABS (2007): Alpha-latrotoxin http://www.alomone.com/p_postcards/database/205.htm

ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, Z. ZHANG, W. MILLER, and D. J. LIPMAN (1997): Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res, 25, 3389-3402

AMBROS, V., R. C. LEE, A. LAVANWAY, P. T. WILLIAMS, and D. JEWELL (2003): MicroRNAs and other tiny endogenous RNAs in C. elegans Curr Biol, 13, 807-818

ARAI, M., H. MITSUKE, M. IKEDA, J. X. XIA, T. KIKUCHI, M. SATAKE, and T. SHIMIZU (2004): ConPred II: a consensus prediction method for obtaining transmembrane topology models with high reliability Nucleic Acids Res, 32, W390-W393

ASHTON, A. C., M. A. RAHMAN, K. E. VOLYNSKI, C. MANSER, E. V. ORLOVA, H. MATSUSHITA, B. A. DAVLETOV, M. VAN HEEL, E. V. GRISHIN, and Y. A. USHKARYOV (2000): Tetramerisation of alpha-latrotoxin by divalent cations is responsible for toxin-induced non-vesicular release and contributes to the Ca2+-dependent vesicular exocytosis from synaptosomes Biochimie, 82, 453-468

ASHTON, A. C., K. E. VOLYNSKI, V. G. LELIANOVA, E. V. ORLOVA, C. VAN RENTERGHEM, M. CANEPARI, M. SEAGAR, and Y. A. USHKARYOV (2001): alpha-Latrotoxin, acting via two Ca2+-dependent pathways, triggers exocytosis of two pools of synaptic vesicles J Biol Chem, 276, 44695-44703

ATKINSON, N. S., G. A. ROBERTSON, and B. GANETZKY (1991): A component of calcium-activated potassium channels encoded by the Drosophila slo locus Science, 253, 551-555

BARSTEAD, R. J. (1999): Reverse Genetics in: HOPE, I. A. (Ed.): C. elegans - A Practical Approach Chapter 6, 97-118. Publisher: Oxford University Press

BATEMAN, A. (2006): Hormone receptor domain, Acc. No. PF02793 Pfam database, Wellcome Trust Sanger Institute http://www.sanger.ac.uk/Software/Pfam/

BEG, A. A. and E. M. JORGENSEN (2003): EXP-1 is an excitatory GABA-gated cation channel Nat Neurosci, 6, 1145-1152

230 Appendix

BERGAMASCO, C. and P. BAZZICALUPO (2006): Chemical sensitivity in Caenorhabditis elegans Cell Mol Life Sci, 63, 1510-1522

BERNSTEIN, E., A. A. CAUDY, S. M. HAMMOND, and G. J. HANNON (2001): Role for a bidentate ribonuclease in the initiation step of RNA interference Nature, 409, 363-366

BOCKAERT, J. and J. P. PIN (1999): Molecular tinkering of G-protein coupled receptors: an evolutionary success EMBO J, 18, 1723-1729

BOWMAN, J. W., A. R. FRIEDMAN, D. P. THOMPSON, A. G. MAULE, S. J. ALEXANDER-BOWMAN, and T. G. GEARY (2002): Structure-activity relationships of an inhibitory nematode FMRFamide-related peptide, SDPNFLRFamide (PF1), on Ascaris suum muscle Int J Parasitol, 32, 1765-1771

BRENNER, S. (1974): The genetics of Caenorhabditis elegans Genetics, 77, 71-94

BROCKIE, P. J. and A. V. MARICQ (2006): Ionotropic glutamate receptors: genetics, behavior and electrophysiology in: THE C. ELEGANS RESEARCH COMMUNITY (Ed.): WormBook doi/10.1895/wormbook.1.61.1. http://www.wormbook.org.

BROWNLEE, D., L. HOLDEN-DYE, and R. WALKER (2000): The range and biological activity of FMRFamide-related peptides and classical neurotransmitters in nematodes Adv Parasitol, 45, 109-180

BROWNLEE, D. J., I. FAIRWEATHER, L. HOLDEN-DYE, and R. J. WALKER (1996): Nematode neuropeptides: Localization, isolation and functions Parasitol Today, 12, 343-351

BULL, K., A. COOK, N. A. HOPPER, A. HARDER, L. HOLDEN-DYE, and R. J. WALKER (2006): Effects of the novel anthelmintic emodepside on the locomotion, egg-laying behaviour and development of Caenorhabditis elegans Int J Parasitol, doi:10.1016/j.ijpara.2006.10.013, article in press

BURLAND, T. G. (2000): DNASTAR's Lasergene sequence analysis software Methods Mol Biol, 132, 71-91

BUSTIN, S. A. (2000): Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays J Mol Endocrinol, 25, 169-193

BUSTIN, S. A. and T. NOLAN (2004): Chemistries in: BUSTIN, S. A. (Ed.): A-Z of Quantitative PCR Chapter 6, 215-278. Publisher: International University Line Appendix 231

C.ELEGANS SEQUENCING CONSORTIUM (1998): Genome sequence of the nematode C. elegans: a platform for investigating biology Science, 282, 2012-2018

CARRE-PIERRAT, M., D. BAILLIE, R. JOHNSEN, R. HYDE, A. HART, L. GRANGER, and L. SEGALAT (2006a): Characterization of the Caenorhabditis elegans G-protein coupled serotonin receptors Invert Neurosci, 6, 189-205

CARRE-PIERRAT, M., K. GRISONI, K. GIESELER, M. C. MARIOL, E. MARTIN, M. JOSPIN, B. ALLARD, and L. SEGALAT (2006b): The SLO-1 BK channel of Caenorhabditis elegans is critical for muscle function and is involved in dystrophin-dependent muscle dystrophy J Mol Biol, 358, 387-395

CASSADA, R. C. and R. L. RUSSELL (1975): The dauerlarva, a post-embryonic developmental variant of the nematode Caenorhabditis elegans Dev Biol, 46, 326-342

CHEESEMAN, C. L., N. S. DELANY, D. J. WOODS, and A. J. WOLSTENHOLME (2001): High-affinity ivermectin binding to recombinant subunits of the Haemonchus contortus glutamate- gated chloride channel Mol Biochem Parasitol, 114, 161-168

CHEN, Y. A. and R. H. SCHELLER (2001): SNARE-mediated membrane fusion Nat Rev Mol Cell Biol, 2, 98-106

CHENCHIK, A., L. DIACHENKO, F. MOQADAM, V. TARABYKIN, S. LUKYANOV, and P. D. SIEBERT (1996): Full-length cDNA cloning and determination of mRNA 5' and 3' ends by amplification of adaptor-ligated cDNA Biotechniques, 21, 526-534

CHENNA, R., H. SUGAWARA, T. KOIKE, R. LOPEZ, T. J. GIBSON, D. G. HIGGINS, and J. D. THOMPSON (2003): Multiple sequence alignment with the Clustal series of programs Nucleic Acids Res, 31, 3497-3500

CHOMCZYNSKI, P. and N. SACCHI (1987): Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem, 162, 156-159

CHUNG, C. T., S. L. NIEMELA, and R. H. MILLER (1989): One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution Proc Natl Acad Sci USA, 86, 2172-2175

CLONTECH (2006): SMARTTM PCR cDNA Synthesis Kit User Manual Protocol No. PT3041-1; Version No. PR6Z2173 http://www.clontech.com/images/pt/PT3041-1.pdf

232 Appendix

CONDER, G. A. (2002): Chemical Control in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 21, 521-529. Publisher: Taylor and Francis

COOK, A., N. APTEL, V. PORTILLO, E. SINEY, R. SIHOTA, L. HOLDEN-DYE, and A. WOLSTENHOLME (2006): Caenorhabditis elegans ivermectin receptors regulate locomotor behaviour and are functional orthologues of Haemonchus contortus receptors Mol Biochem Parasitol, 147, 118-125

COUTHIER, A., J. SMITH, P. MCGARR, B. CRAIG, and J. S. GILLEARD (2004): Ectopic expression of a Haemonchus contortus GATA transcription factor in Caenorhabditis elegans reveals conserved function in spite of extensive sequence divergence Mol Biochem Parasitol, 133, 241-253

CULLY, D. F., D. K. VASSILATIS, K. K. LIU, P. S. PARESS, L. H. VAN DER PLOEG, J. M. SCHAEFFER, and J. P. ARENA (1994): Cloning of an avermectin-sensitive glutamate-gated chloride channel from Caenorhabditis elegans Nature, 371, 707-711

CULLY, D. F., H. WILKINSON, D. K. VASSILATIS, A. ETTER, and J. P. ARENA (1996): Molecular biology and electrophysiology of glutamate-gated chloride channels of invertebrates Parasitology, 113 Suppl, S191-S200

DAVIES, A. G., J. T. PIERCE-SHIMOMURA, H. KIM, M. K. VANHOVEN, T. R. THIELE, A. BONCI, C. I. BARGMANN, and S. L. MCINTIRE (2003): A central role of the BK potassium channel in behavioral responses to ethanol in C. elegans Cell, 115, 655-666

DAVLETOV, B. A., O. G. SHAMOTIENKO, V. G. LELIANOVA, E. V. GRISHIN, and Y. A. USHKARYOV (1996): Isolation and biochemical characterization of a Ca2+-independent alpha-latrotoxin-binding protein J Biol Chem, 271, 23239-23245

DE GROOT, N. S. and S. VENTURA (2006): Effect of temperature on protein quality in bacterial inclusion bodies FEBS Lett, 580, 6471-6476

DE MAERE V., I. VERCAUTEREN, K. GEVAERT, J. VERCRUYSSE, and E. CLAEREBOUT (2005): An aspartyl protease inhibitor of Ostertagia ostertagi: molecular cloning, analysis of stage and tissue specific expression and vaccine trial Mol Biochem Parasitol, 141, 81-88

DEL CASTILLO, J., T. A. MORALES, and V. SANCHEZ (1963): Action of Piperazine on the Neuromuscular System of Ascaris lumbricoides Nature, 200, 706-707

DENT, J. A., M. W. DAVIS, and L. AVERY (1997): avr-15 encodes a chloride channel subunit that mediates inhibitory glutamatergic neurotransmission and ivermectin sensitivity in Caenorhabditis elegans EMBO J, 16, 5867-5879 Appendix 233

DENT, J. A., M. M. SMITH, D. K. VASSILATIS, and L. AVERY (2000): The genetics of ivermectin resistance in Caenorhabditis elegans Proc Natl Acad Sci U S A, 97, 2674-2679

DHEDA, K., J. F. HUGGETT, J. S. CHANG, L. U. KIM, S. A. BUSTIN, M. A. JOHNSON, G. A. ROOK, and A. ZUMLA (2005): The implications of using an inappropriate reference gene for real-time reverse transcription PCR data normalization Anal Biochem, 344, 141-143

DILLON, J., N. A. HOPPER, L. HOLDEN-DYE, and V. O'CONNOR (2006): Molecular characterization of the metabotropic glutamate receptor family in Caenorhabditis elegans Biochem Soc Trans, 34, 942-948

ECKERT, J., K. T. FRIEDHOFF, H. ZAHNER, and P. DEPLAZES (2005): Grundlagen der Therapie und Bekämpfung von Parasiten in: ECKERT, J., K. T. FRIEDHOFF, H. ZAHNER, and P. DEPLAZES (Ed.): Lehrbuch der Parasitologie für die Tiermedizin Chapter 5, 500-519. Publisher: Enke

ELKINS, T., B. GANETZKY, and C. F. WU (1986): A Drosophila mutation that eliminates a calcium-dependent potassium current Proc Natl Acad Sci U S A, 83, 8415-8419

EVANS, A. M. and R. J. MARTIN (1996): Activation and cooperative multi-ion block of single nicotinic-acetylcholine channel currents of Ascaris muscle by the tetrahydropyrimidine anthelmintic, morantel Br J Pharmacol, 118, 1127-1140

FALQUET, L., M. PAGNI, P. BUCHER, N. HULO, C. J. SIGRIST, K. HOFMANN, and A. BAIROCH (2002): The PROSITE database, its status in 2002 Nucleic Acids Res, 30, 235-238

FINKELSTEIN, A., L. L. RUBIN, and M. C. TZENG (1976): Black widow spider venom: effect of purified toxin on lipid bilayer membranes Science, 193, 1009-1011

FINN, R. D. (2006): Ion transport protein, Acc. No.PF00520 Pfam database, Wellcome Trust Sanger Institute http://www.sanger.ac.uk/Software/Pfam/

FIRE, A., S. W. HARRISON, and D. DIXON (1990): A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans Gene, 93, 189-198

FIRE, A., S. XU, M. K. MONTGOMERY, S. A. KOSTAS, S. E. DRIVER, and C. C. MELLO (1998): Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans Nature, 391, 806-811

FRANDSEN, J. C. and L. W. BONE (1988): Derivatives of epinephrine, norepinephrine, octopamine and histamine formed by homogenates of Trichostrongylus colubriformis, a nematode parasite of ruminants Comp Biochem Physiol C, 91, 385-387

234 Appendix

GELDHOF, P., A. VISSER, D. CLARK, G. SAUNDERS, C. BRITTON, J. GILLEARD, M. BERRIMAN, and D. KNOX (2007): RNA interference in parasitic helminths: current situation, potential pitfalls and future prospects Parasitology, 1-11

GILL, J. H., J. M. REDWIN, J. A. VAN WYK, and E. LACEY (1991): Detection of resistance to ivermectin in Haemonchus contortus Int J Parasitol, 21, 771-776

GOLDEN, J. W. and D. L. RIDDLE (1984): The Caenorhabditis elegans dauer larva: developmental effects of pheromone, food, and temperature Dev Biol, 102, 368-378

GRIFFITHS-JONES, S. R. (2006): Calcium-activated BK potassium channel alpha subunit, Acc. No. PF03493 Pfam database, Wellcome Trust Sanger Institute http://www.sanger.ac.uk/Software/Pfam/

GRISHOK, A. (2005): RNAi mechanisms in Caenorhabditis elegans FEBS Lett, 579, 5932-5939

GRYNKIEWICZ, G., M. POENIE, and R. Y. TSIEN (1985): A new generation of Ca2+ indicators with greatly improved fluorescence properties J Biol Chem, 260, 3440-3450

GUNSALUS, K. C. and F. PIANO (2005): RNAi as a tool to study cell biology: building the genome-phenome bridge Curr Opin Cell Biol, 17, 3-8

GUPTA, R., E. JUNG, and S. BRUNAK (2004): Prediction of N-glycosylation sites in human proteins (in preparation) http://www.cbs.dtu.dk/services/NetNGlyc/abstract.php

HAMMOND, S. M. (2005): Dicing and slicing: the core machinery of the RNA interference pathway FEBS Lett, 579, 5822-5829

HARDER, A., L. HOLDEN-DYE, R. WALKER, and F. WUNDERLICH (2005): Mechanisms of action of emodepside Parasitol Res, 97 Suppl 1, S1-S10

HARDER, A. and G. SAMSON-HIMMELSTJERNA (2001): Activity of the cyclic depsipeptide emodepside (BAY 44-4400) against larval and adult stages of nematodes in rodents and the influence on worm survival Parasitol Res, 87, 924-928

HARDER, A., H. P. SCHMITT-WREDE, J. KRUCKEN, P. MARINOVSKI, F. WUNDERLICH, J. WILLSON, K. AMLIWALA, L. HOLDEN-DYE, and R. WALKER (2003): Cyclooctadepsipeptides--an anthelmintically active class of compounds exhibiting a novel mode of action Int J Antimicrob Agents, 22, 318-331 Appendix 235

HARRIS, T. W., K. SCHUSKE, and E. M. JORGENSEN (2001): Studies of synaptic vesicle endocytosis in the nematode C. elegans Traffic, 2, 597-605

HARTLEY, J. L., G. F. TEMPLE, and M. A. BRASCH (2000): DNA cloning using in vitro site-specific recombination Genome Res, 10, 1788-1795

HAWASLI, A. H., O. SAIFEE, C. LIU, M. L. NONET, and C. M. CROWDER (2004): Resistance to volatile anesthetics by mutations enhancing excitatory neurotransmitter release in Caenorhabditis elegans Genetics, 168, 831-843

HELLEMANS, J., G. MORTIER, A. DE PAEPE, F. SPELEMAN, and J. VANDESOMPELE (2007): qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data Genome Biol, 8, R19

HIYOSHI, M. and S. HOSOI (1994): Assay of DNA denaturation by polymerase chain reaction-driven fluorescent label incorporation and fluorescence resonance energy transfer Anal Biochem, 221, 306-311

HOBERT, O. (2007): Specification of the nervous system in: THE C. ELEGANS RESEARCH COMMUNITY (Ed.): WormBook doi/10.1895/wormbook.1.12.1. http://www.wormbook.org

HOLLAND, P. M., R. D. ABRAMSON, R. WATSON, and D. H. GELFAND (1991): Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase Proc Natl Acad Sci U S A, 88, 7276-7280

HOLLINGER, S., J. B. TAYLOR, E. H. GOLDMAN, and J. R. HEPLER (2001): RGS14 is a bifunctional regulator of G alpha i/o activity that exists in multiple populations in brain J Neurochem, 79, 941-949

HOPE, I. A. (1999): Background on Caenorhabditis elegans in: HOPE, I. A. (Ed.): C. elegans - A Practical Approach Chapter 1, 1-15. Publisher: Oxford University Press

HUSSON, S. J., I. MERTENS, T. JANSSEN, M. LINDEMANS, and L. SCHOOFS (2007): Neuropeptidergic signaling in the nematode Caenorhabditis elegans Prog Neurobiol, 82, 33-55

ICHTCHENKO, K., M. A. BITTNER, V. KRASNOPEROV, A. R. LITTLE, O. CHEPURNY, R. W. HOLZ, and A. G. PETRENKO (1999): A novel ubiquitously expressed alpha-latrotoxin receptor is a member of the CIRL family of G-protein-coupled receptors J Biol Chem, 274, 5491-5498

236 Appendix

ISSA, Z., W. N. GRANT, S. STASIUK, and C. B. SHOEMAKER (2005): Development of methods for RNA interference in the sheep gastrointestinal parasite, Trichostrongylus colubriformis Int J Parasitol, 35, 935-940

JACKSON, F. and R. L. COOP (2000): The development of anthelmintic resistance in sheep nematodes Parasitology, 120 Suppl, S95-107

JACKSON, R., A. P. RHODES, W. E. POMROY, D. M. LEATHWICK, D. M. WEST, T. S. WAGHORN, and J. R. MOFFAT (2006): Anthelmintic resistance and management of nematode parasites on beef cattle-rearing farms in the North Island of New Zealand N Z Vet J, 54, 289-296

JESCHKE, P., J. BENET-BUCHHOLZ, A. HARDER, W. ETZEL, M. SCHINDLER, W. GAU, and H. C. WEISS (2006): Synthesis and anthelmintic activity of substituted (R)-phenyllactic acid containing cyclohexadepsipeptides Bioorg Med Chem Lett, 16, 4410-4415

JESCHKE, P., A. HARDER, M. SCHINDLER, and W. ETZEL (2005): Cyclohexadepsipeptides (CHDPs) with improved anthelmintical efficacy against the gastrointestinal nematode (Haemonchus contortus) in sheep Parasitol Res, 97 Suppl 1, S17-S21

JIN, Y. (1999): Transformation in: HOPE, I. A. (Ed.): C. elegans - A Practical Approach Chapter 5, 69-96. Publisher: Oxford University Press

JORGENSEN, E. M. (2005): GABA in: THE C. ELEGANS RESEARCH COMMUNITY (Ed.): WormBook doi/10.1895/wormbook.1.14.1. http://www.wormbook.org

KALL, L., A. KROGH, and E. L. SONNHAMMER (2004): A combined transmembrane topology and signal peptide prediction method J Mol Biol, 338, 1027-1036

KAPLAN, R. M. (2004): Drug resistance in nematodes of veterinary importance: a status report Trends Parasitol, 20, 477-481

KAUPMANN, K., K. HUGGEL, J. HEID, P. J. FLOR, S. BISCHOFF, S. J. MICKEL, G. MCMASTER, C. ANGST, H. BITTIGER, W. FROESTL, and B. BETTLER (1997): Expression cloning of GABA B receptors uncovers similarity to metabotropic glutamate receptors Nature, 386, 239-246

KIM, K. and C. LI (2004): Expression and regulation of an FMRFamide-related neuropeptide gene family in Caenorhabditis elegans J Comp Neurol, 475, 540-550 Appendix 237

KLOPFENSTEIN, D. R. and R. D. VALE (2004): The lipid binding pleckstrin homology domain in UNC-104 kinesin is necessary for synaptic vesicle transport in Caenorhabditis elegans Mol Biol Cell, 15, 3729-3739

KNIPPER, M., L. MADEDDU, H. BREER, and J. MELDOLESI (1986): Black widow spider venom-induced release of neurotransmitters: mammalian synaptosomes are stimulated by a unique venom component (alpha-latrotoxin), insect synaptosomes by multiple components Neuroscience, 19, 55-62

KNOX, D. P., P. GELDHOF, A. VISSER, and C. BRITTON (2007): RNA interference in parasitic nematodes of animals: a reality check? Trends Parasitol,

KOMUNIECKI, R. W., R. J. HOBSON, E. B. REX, V. M. HAPIAK, and P. R. KOMUNIECKI (2004): Biogenic amine receptors in parasitic nematodes: what can be learned from Caenorhabditis elegans? Mol Biochem Parasitol, 137, 1-11

KOTZE, A. C. and N. H. BAGNALL (2006): RNA interference in Haemonchus contortus: suppression of beta-tubulin gene expression in L3, L4 and adult worms in vitro Mol Biochem Parasitol, 145, 101-110

KOTZE, A. C., R. J. DOBSON, K. L. TYRRELL, and P. A. STEIN (2002): High-level ivermectin resistance in a field isolate of Haemonchus contortus associated with a low level of resistance in the larval stage: implications for resistance detection Vet Parasitol, 108, 255-263

KRASNOPEROV, V., M. A. BITTNER, W. MO, L. BURYANOVSKY, T. A. NEUBERT, R. W. HOLZ, K. ICHTCHENKO, and A. G. PETRENKO (2002): Protein-tyrosine phosphatase-sigma is a novel member of the functional family of alpha-latrotoxin receptors J Biol Chem, 277, 35887-35895

KRASNOPEROV, V. G., M. A. BITTNER, R. BEAVIS, Y. KUANG, K. V. SALNIKOW, O. G. CHEPURNY, A. R. LITTLE, A. N. PLOTNIKOV, D. WU, R. W. HOLZ, and A. G. PETRENKO (1997): alpha-latrotoxin stimulates exocytosis by the interaction with a neuronal G-protein coupled receptor Neuron, 18, 925-937

KRASNOPEROV, V., Y. LU, L. BURYANOVSKY, T. A. NEUBERT, K. ICHTCHENKO, and A. G. PETRENKO (2002): Post-translational proteolytic processing of the calcium-independent receptor of alpha-latrotoxin (CIRL), a natural chimera of the cell adhesion protein and the G-protein coupled receptor. Role of the G-protein coupled receptor proteolysis site (GPS) motif J Biol Chem, 277, 46518-46526

KRASNOPEROV, V. G., O. G. SHAMOTIENKO, and E. V. GRISHIN (1990a): [A crustacean-specific neurotoxin from the venom of the black widow spider Latrodectus mactans tredecimguttatus] Bioorg Khim, 16, 1567-1569

238 Appendix

KRASNOPEROV, V. G., O. G. SHAMOTIENKO, and E. V. GRISHIN (1990b): [Isolation and properties of insect-specific neurotoxins from venoms of the spider Lactodectus mactans tredecimguttatus] Bioorg Khim, 16, 1138-1140

KUMAR, S., K. TAMURA, and M. NEI (2004): MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment Brief Bioinform, 5, 150-163

KWA, M. S., J. G. VEENSTRA, M. VAN DIJK, and M. H. ROOS (1995): Beta-tubulin genes from the parasitic nematode Haemonchus contortus modulate drug resistance in Caenorhabditis elegans J Mol Biol, 246, 500-510

LACEY, E. (1988): The role of the cytoskeletal protein, tubulin, in the mode of action and mechanism of drug resistance to benzimidazoles Int J Parasitol, 18, 885-936

LACKNER, M. R., S. J. NURRISH, and J. M. KAPLAN (1999): Facilitation of synaptic transmission by EGL-30 Gqalpha and EGL-8 PLC beta: DAG binding to UNC-13 is required to stimulate acetylcholine release Neuron, 24, 335-346

LAJUS, S., P. VACHER, D. HUBER, M. DUBOIS, M. N. BENASSY, Y. USHKARYOV, and J. LANG (2006): Alpha-latrotoxin induces exocytosis by inhibition of voltage-dependent K+ channels and by stimulation of L-type Ca2+ channels via latrophilin in beta-cells J Biol Chem, 281, 5522-5531

LANDY, A. (1989): Dynamic, structural, and regulatory aspects of lambda site-specific recombination Annu Rev Biochem, 58, 913-949

LAUGHTON, D. L., G. G. LUNT, and A. J. WOLSTENHOLME (1997): Reporter gene constructs suggest that the Caenorhabditis elegans avermectin receptor beta-subunit is expressed solely in the pharynx J Exp Biol, 200, 1509-1514

LAVALLIE, E. R., E. A. DIBLASIO, S. KOVACIC, K. L. GRANT, P. F. SCHENDEL, and J. M. MCCOY (1993): A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm Biotechnology (N Y ), 11, 187-193

LEE, D. L. (2002): Life cycles in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 3, 61-72. Publisher: Taylor and Francis

LEE, J., S. NAM, S. B. HWANG, M. HONG, J. Y. KWON, K. S. JOENG, S. H. IM, J. SHIM, and M. C. PARK (2004): Functional genomic approaches using the nematode Caenorhabditis elegans as a model system J Biochem Mol Biol, 37, 107-113 Appendix 239

LEE, R. C., C. M. HAMMELL, and V. AMBROS (2006): Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans RNA, 12, 589-597

LEE, W., T. H. LEE, B. J. PARK, J. W. CHANG, J. R. YU, H. S. KOO, H. PARK, Y. J. YOO, and J. AHNN (2005): Caenorhabditis elegans calnexin is N-glycosylated and required for stress response Biochem Biophys Res Commun, 338, 1018-1030

LEE, Y. S., Y. S. PARK, D. J. CHANG, J. M. HWANG, C. K. MIN, B. K. KAANG, and N. J. CHO (1999): Cloning and expression of a G-protein linked acetylcholine receptor from Caenorhabditis elegans J Neurochem, 72, 58-65

LEE, Y. S., Y. S. PARK, S. NAM, S. J. SUH, J. LEE, B. K. KAANG, and N. J. CHO (2000): Characterization of GAR-2, a novel G-protein linked acetylcholine receptor from Caenorhabditis elegans J Neurochem, 75, 1800-1809

LELIANOVA, V. G., B. A. DAVLETOV, A. STERLING, M. A. RAHMAN, E. V. GRISHIN, N. F. TOTTY, and Y. A. USHKARYOV (1997): Alpha-latrotoxin receptor, latrophilin, is a novel member of the secretin family of G-protein coupled receptors J Biol Chem, 272, 21504-21508

LETUNIC, I., R. R. COPLEY, B. PILS, S. PINKERT, J. SCHULTZ, and P. BORK (2006): SMART 5: domains in the context of genomes and networks Nucleic Acids Res, 34, D257-D260

LIM, H. H., B. J. PARK, H. S. CHOI, C. S. PARK, S. H. EOM, and J. AHNN (1999): Identification and characterization of a putative C. elegans potassium channel gene (Ce-slo-2) distantly related to Ca2+-activated K+ channels Gene, 240, 35-43

LIU, J., Q. WAN, X. LIN, H. ZHU, K. VOLYNSKI, Y. USHKARYOV, and T. XU (2005): Alpha-latrotoxin modulates the secretory machinery via receptor-mediated activation of protein kinase C Traffic, 6, 756-765

LIVAK, K. J. and T. D. SCHMITTGEN (2001): Analysis of relative gene expression data using real-time quantitative PCR and the 2-Ct Method Methods, 25, 402-408

LUSTIGMAN, S., J. ZHANG, J. LIU, Y. OKSOV, and S. HASHMI (2004): RNA interference targeting cathepsin L and Z-like cysteine proteases of Onchocerca volvulus confirmed their essential function during L3 molting Mol Biochem Parasitol, 138, 165-170

MARCHLER-BAUER, A., J. B. ANDERSON, M. K. DERBYSHIRE, C. DEWEESE-SCOTT, N. R. GONZALES, M. GWADZ, L. HAO, S. HE, D. I. HURWITZ, J. D. JACKSON, Z. KE, D. KRYLOV, C. J. LANCZYCKI, C. A. LIEBERT, C. LIU, F. LU, S. LU, G. H. MARCHLER, M. MULLOKANDOV, J. S. SONG, N. THANKI, R. A. YAMASHITA, J. J. YIN, D. ZHANG, and S. H. BRYANT (2007): CDD: a conserved domain database for interactive domain family analysis Nucleic Acids Res, 35, D237-D240

240 Appendix

MARCHLER-BAUER, A. and S. H. BRYANT (2004): CD-Search: protein domain annotations on the fly Nucleic Acids Res, 32, W327-W331

MARTIN, R. J. (1982): Electrophysiological effects of piperazine and diethylcarbamazine on Ascaris suum somatic muscle Br J Pharmacol, 77, 255-265

MARTIN, R. J. (1997): Modes of action of anthelmintic drugs Vet J, 154, 11-34

MARTIN, R., J. PURCELL, A. P. ROBERTSON, and M. A. VALKANOV (2002): Neuromuscular Organisation and Control in Nematodes in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 12, 321-343. Publisher: Taylor and Francis

MARTIN, R. J., S. VERMA, M. LEVANDOSKI, C. L. CLARK, H. QIAN, M. STEWART, and A. P. ROBERTSON (2005): Drug resistance and neurotransmitter receptors of nematodes: recent studies on the mode of action of levamisole Parasitology, 131 Suppl, S71-S84

MASON, P. C. and C. H. MCKAY (2006): Field studies investigating anthelmintic resistance in young cattle on five farms in New Zealand N Z Vet J, 54, 318-322

MASTWAL, S. S., D. YU, and E. M. HEDGECOCK (2003a): Caenorhabditis elegans latrophilin-like protein LAT-1A, Acc. No. AAQ84877 NCBI protein database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Protein

MASTWAL, S. S., D. YU, and E. M. HEDGECOCK (2003b): Caenorhabditis elegans latrophilin-like protein LAT-1B, Acc. No. AAQ84878 NCBI protein database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Protein

MASTWAL, S. S., D. YU, and E. M. HEDGECOCK (2003c): Caenorhabditis elegans latrophilin-like protein LAT-2, Acc. No.AAQ84879 NCBI protein database http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Protein

MATSUSHITA, H., V. G. LELIANOVA, and Y. A. USHKARYOV (1999): The latrophilin family: multiply spliced G-protein coupled receptors with differential tissue distribution FEBS Lett, 443, 348-352

MCCUDDEN, C. R., M. D. HAINS, R. J. KIMPLE, D. P. SIDEROVSKI, and F. S. WILLARD (2005): G-protein signaling: back to the future Cell Mol Life Sci, 62, 551-577

MCDONALD, P. W., T. JESSEN, J. R. FIELD, and R. D. BLAKELY (2006): Dopamine signaling architecture in Caenorhabditis elegans Cell Mol Neurobiol, 26, 593-618 Appendix 241

MCMANUS, O. B., L. M. HELMS, L. PALLANCK, B. GANETZKY, R. SWANSON, and R. J. LEONARD (1995): Functional role of the beta subunit of high conductance calcium-activated potassium channels Neuron, 14, 645-650

MCVEIGH, P., T. G. GEARY, N. J. MARKS, and A. G. MAULE (2006): The FLP-side of nematodes Trends Parasitol, 22, 385-396

MCVEIGH, P., S. LEECH, G. R. MAIR, N. J. MARKS, T. G. GEARY, and A. G. MAULE (2005): Analysis of FMRFamide-like peptide (FLP) diversity in phylum Nematoda Int J Parasitol, 35, 1043-1060

MEE, C. J., S. R. TOMLINSON, P. V. PERESTENKO, D. DE POMERAI, I. R. DUCE, P. N. USHERWOOD, and D. R. BELL (2004): Latrophilin is required for toxicity of black widow spider venom in Caenorhabditis elegans Biochem J, 378, 185-191

MEERA, P., M. WALLNER, M. SONG, and L. TORO (1997): Large conductance voltage- and calcium-dependent K+ channel, a distinct member of voltage-dependent ion channels with seven N-terminal transmembrane segments (S0-S6), an extracellular N terminus, and an intracellular (S9-S10) C terminus Proc Natl Acad Sci U S A, 94, 14066-14071

MEIJERINK, J., C. MANDIGERS, L. L. VAN DE, E. TONNISSEN, F. GOODSAID, and J. RAEMAEKERS (2001): A novel method to compensate for different amplification efficiencies between patient DNA samples in quantitative real-time PCR J Mol Diagn, 3, 55-61

MEJIA, M. E., B. M. FERNANDEZ IGARTUA, E. E. SCHMIDT, and J. CABARET (2003): Multispecies and multiple anthelmintic resistance on cattle nematodes in a farm in Argentina: the beginning of high resistance? Vet Res, 34, 461-467

MIAN, N. and A. BATEMAN (2006): Galactose-binding lectin domain, Acc. No. PF02140 Pfam database, Wellcome Trust Sanger Institute http://www.sanger.ac.uk/Software/Pfam/

MOORE, J., L. TETLEY, and E. DEVANEY (2000): Identification of abundant mRNAs from the third stage larvae of the parasitic nematode, Ostertagia ostertagi Biochem J, 347 Pt 3, 763-770

MOUNSEY, A., L. MOLIN, and I. A. HOPE (1999): Gene expression patterns in: HOPE, I. A. (Ed.): C. elegans - A Practical Approach Chapter 9, 181-199. Publisher: Oxford University Press

MUNN, E. A. and P. D. MUNN (2002): Feeding and Digestion in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 8, 211-232. Publisher: Taylor and Francis

242 Appendix

NAKAJIMA, N. and Y. IKADA (1995): Mechanism of amide formation by carbodiimide for bioconjugation in aqueous media Bioconjug Chem, 6, 123-130

NAKANISHI, S., Y. NAKAJIMA, M. MASU, Y. UEDA, K. NAKAHARA, D. WATANABE, S. YAMAGUCHI, S. KAWABATA, and M. OKADA (1998): Glutamate receptors: brain function and signal transduction Brain Res Brain Res Rev, 26, 230-235

NEVE, K. A., J. K. SEAMANS, and H. TRANTHAM-DAVIDSON (2004): Dopamine receptor signaling J Recept Signal Transduct Res, 24, 165-205

NICOLAY, F., A. HARDER, G. SAMSON-HIMMELSTJERNA, and H. MEHLHORN (2000): Synergistic action of a cyclic depsipeptide and piperazine on nematodes Parasitol Res, 86, 982-992

NJUE, A. I., J. HAYASHI, L. KINNE, X. P. FENG, and R. K. PRICHARD (2004): Mutations in the extracellular domains of glutamate-gated chloride channel alpha 3 and beta subunits from ivermectin-resistant Cooperia oncophora affect agonist sensitivity J Neurochem, 89, 1137-1147

NJUE, A. I. and R. K. PRICHARD (2004): Genetic variability of glutamate-gated chloride channel genes in ivermectin-susceptible and -resistant strains of Cooperia oncophora Parasitology, 129, 741-751

ORLOVA, E. V., M. A. RAHMAN, B. GOWEN, K. E. VOLYNSKI, A. C. ASHTON, C. MANSER, M. VAN HEEL, and Y. A. USHKARYOV (2000): Structure of alpha-latrotoxin oligomers reveals that divalent cation-dependent tetramers form membrane pores Nat Struct Biol, 7, 48-53

PAK, J. and A. FIRE (2007): Distinct populations of primary and secondary effectors during RNAi in C. elegans Science, 315, 241-244

PARK, Y. S., S. KIM, Y. SHIN, B. CHOI, and N. J. CHO (2003): Alternative splicing of the muscarinic acetylcholine receptor GAR-3 in Caenorhabditis elegans Biochem Biophys Res Commun, 308, 961-965

PARKER, G. S., D. M. ECKERT, and B. L. BASS (2006): RDE-4 preferentially binds long dsRNA and its dimerization is necessary for cleavage of dsRNA to siRNA RNA, 12, 807-818

PFAFFL, M. W., A. TICHOPAD, C. PRGOMET, and T. P. NEUVIANS (2004): Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations Biotechnol Lett, 26, 509-515

POMROY, W. E. (2006): Anthelmintic resistance in New Zealand: a perspective on recent findings and options for the future N Z Vet J, 54, 265-270 Appendix 243

PRAITIS, V., E. CASEY, D. COLLAR, and J. AUSTIN (2001): Creation of low-copy integrated transgenic lines in Caenorhabditis elegans Genetics, 157, 1217-1226

PRICHARD, R. K., C. A. HALL, J. D. KELLY, I. C. MARTIN, and A. D. DONALD (1980): The problem of anthelmintic resistance in nematodes Aust Vet J, 56, 239-251

PURCELL, J., A. P. ROBERTSON, D. P. THOMPSON, and R. J. MARTIN (2002): PF4, a FMRFamide-related peptide, gates low-conductance Cl - channels in Ascaris suum Eur J Pharmacol, 456, 11-17

RAHMAN, M. A., A. C. ASHTON, F. A. MEUNIER, B. A. DAVLETOV, J. O. DOLLY, and Y. A. USHKARYOV (1999): Norepinephrine exocytosis stimulated by alpha-latrotoxin requires both external and stored Ca2+ and is mediated by latrophilin, G-proteins and phospholipase C Philos Trans R Soc Lond B Biol Sci, 354, 379-386

RAND, J. B. (2007): Acetylcholine in: THE C. ELEGANS RESEARCH COMMUNITY (Ed.): WormBook doi/10.1895/wormbook.1.131.1. http://www.wormbook.org

RANGANATHAN, R., S. C. CANNON, and H. R. HORVITZ (2000): MOD-1 is a serotonin-gated chloride channel that modulates locomotory behaviour in C. elegans Nature, 408, 470-475

REDMOND, D. L., C. CLUCAS, I. L. JOHNSTONE, and D. P. KNOX (2001): Expression of Haemonchus contortus pepsinogen in Caenorhabditis elegans Mol Biochem Parasitol, 112, 125-131

REX, E., V. HAPIAK, R. HOBSON, K. SMITH, H. XIAO, and R. KOMUNIECKI (2005): TYRA-2 (F01E11.5): a Caenorhabditis elegans tyramine receptor expressed in the MC and NSM pharyngeal neurons J Neurochem, 94, 181-191

REX, E., S. C. MOLITOR, V. HAPIAK, H. XIAO, M. HENDERSON, and R. KOMUNIECKI (2004): Tyramine receptor (SER-2) isoforms are involved in the regulation of pharyngeal pumping and foraging behavior in Caenorhabditis elegans J Neurochem, 91, 1104-1115

RIBEIRO, P., F. EL SHEHABI, and N. PATOCKA (2005): Classical transmitters and their receptors in flatworms Parasitology, 131 Suppl, S19-S40

RICHMOND, J. E., W. S. DAVIS, and E. M. JORGENSEN (1999): UNC-13 is required for synaptic vesicle fusion in C. elegans Nat Neurosci, 2, 959-964

244 Appendix

ROBERTS, R. J., M. BELFORT, T. BESTOR, A. S. BHAGWAT, T. A. BICKLE, J. BITINAITE, R. M. BLUMENTHAL, S. K. DEGTYAREV, D. T. DRYDEN, K. DYBVIG, K. FIRMAN, E. S. GROMOVA, R. I. GUMPORT, S. E. HALFORD, S. HATTMAN, J. HEITMAN, D. P. HORNBY, A. JANULAITIS, A. JELTSCH, J. JOSEPHSEN, A. KISS, T. R. KLAENHAMMER, I. KOBAYASHI, H. KONG, D. H. KRUGER, S. LACKS, M. G. MARINUS, M. MIYAHARA, R. D. MORGAN, N. E. MURRAY, V. NAGARAJA, A. PIEKAROWICZ, A. PINGOUD, E. RALEIGH, D. N. RAO, N. REICH, V. E. REPIN, E. U. SELKER, P. C. SHAW, D. C. STEIN, B. L. STODDARD, W. SZYBALSKI, T. A. TRAUTNER, J. L. VAN ETTEN, J. M. VITOR, G. G. WILSON, and S. Y. XU (2003): A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes Nucleic Acids Res, 31, 1805-1812

ROBINSON, T. L., I. A. SUTHERLAND, and J. SUTHERLAND (2007): Validation of candidate bovine reference genes for use with real-time PCR Vet Immunol Immunopathol, 115, 160-165

ROOS, M. H., M. OTSEN, R. HOEKSTRA, J. G. VEENSTRA, and J. A. LENSTRA (2004): Genetic analysis of inbreeding of two strains of the parasitic nematode Haemonchus contortus Int J Parasitol, 34, 109-115

SAEGER, B. (2000): Der heptahelikale Transmembran-Rezeptor HC110-R aus dem parasitischen Nematoden Haemonchus contortus als Target für das Breitspektrum-Anthelminthikum PF1022A Doctoral Thesis, Division of Molecular Parasitology and Center for Biological and Medical Research, Heinrich-Heine-University Duesseldorf http://deposit.ddb.de/cgi-bin/dokserv?idn=960829652

SAEGER, B., H. P. SCHMITT-WREDE, M. DEHNHARDT, W. P. BENTEN, J. KRUCKEN, A. HARDER, G. SAMSON-HIMMELSTJERNA, H. WIEGAND, and F. WUNDERLICH (2001): Latrophilin-like receptor from the parasitic nematode Haemonchus contortus as target for the anthelmintic depsipeptide PF1022 A FASEB J, 15, 1332-1334

SALKOFF, L., A. BUTLER, G. FERREIRA, C. SANTI, and A. WEI (2006): High-conductance potassium channels of the SLO family Nat Rev Neurosci, 7, 921-931

SAMSON-HIMMELSTJERNA, G., A. HARDER, N. C. SANGSTER, and G. C. COLES (2005): Efficacy of two cyclooctadepsipeptides, PF1022 A and emodepside, against anthelmintic-resistant nematodes in sheep and cattle Parasitology, 130, 343-347

SAMSON-HIMMELSTJERNA, G., A. HARDER, T. SCHNIEDER, J. KALBE, and N. MENCKE (2000): In vivo activities of the new anthelmintic depsipeptide PF1022 A Parasitol Res, 86, 194-199

SANGSTER, N. C. and R. J. DOBSON (2002): Anthelmintic Resistance in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 22, 531-567. Publisher: Taylor and Francis

SASAKI, T., M. TAKAGI, T. YAGUCHI, S. MIYADOH, T. OKADA, and M. KOYAMA (1992): A new anthelmintic cyclodepsipeptide, PF1022A J Antibiot (Tokyo), 45, 692-697 Appendix 245

SCHMITTGEN, T. D. and B. A. ZAKRAJSEK (2000): Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR J Biochem Biophys Methods, 46, 69-81

SCHNIEDER, T. (2006): Helminthosen der Wiederkäuer in: SCHNIEDER, T. (Ed.): Veterinärmedizinische Parasitologie Chapter 2.2, 166-234. Publisher: Parey

SCHOFIELD, P. R., M. G. DARLISON, N. FUJITA, D. R. BURT, F. A. STEPHENSON, H. RODRIGUEZ, L. M. RHEE, J. RAMACHANDRAN, V. REALE, T. A. GLENCORSE, P. H. SEEBURG and E. A. BARNARD (1987): Sequence and functional expression of the GABA A receptor shows a ligand-gated receptor super-family Nature, 328, 221-227

SCHULTZ, J., F. MILPETZ, P. BORK, and C. P. PONTING (1998): SMART, a simple modular architecture research tool: identification of signaling domains Proc Natl Acad Sci U S A, 95, 5857-5864

SCHUSKE, K., A. A. BEG, and E. M. JORGENSEN (2004): The GABA nervous system in C. elegans Trends Neurosci, 27, 407-414

SIJEN, T., J. FLEENOR, F. SIMMER, K. L. THIJSSEN, S. PARRISH, L. TIMMONS, R. H. PLASTERK, and A. FIRE (2001): On the role of RNA amplification in dsRNA-triggered gene silencing Cell, 107, 465-476

SIMON, M. I., M. P. STRATHMANN, and N. GAUTAM (1991): Diversity of G-proteins in signal transduction Science, 252, 802-808

SMART DATABASE (2006a): CLECT, C-type lectin (CTL) or carbohydrate-recognition domain (CRD), Acc. No. SM00034 Simple Modular Architecture Research Tool (SMART) database http://smart.embl-heidelberg.de/

SMART DATABASE (2006b): HormR, domain present in hormone recptors, Acc. No. 00008.11 Simple Modular Architecture Research Tool (SMART) database http://smart.embl-heidelberg.de/

SMART DATABASE (2006c): OLF, olfactomedin-like domain, Acc. No. SM00284 Simple Modular Architecture Research Tool (SMART) database http://smart.embl-heidelberg.de/

SNYDER, D. A., A. M. RIVERS, H. YOKOE, B. P. MENCO, and R. R. ANHOLT (1991): Olfactomedin: purification, characterization, and localization of a novel olfactory glycoprotein Biochemistry, 30, 9143-9153

246 Appendix

STEAR, M. J., M. DOLIGALSKA, and K. DONSKOW-SCHMELTER (2007): Alternatives to anthelmintics for the control of nematodes in livestock Parasitology, 134, 139-151

STEPEK, G., K. M. HOUSTON, H. S. GOODRIDGE, E. DEVANEY, and W. HARNETT (2004): Stage-specific and species-specific differences in the production of the mRNA and protein for the filarial nematode secreted product, ES-62 Parasitology, 128, 91-98

STINCHCOMB, D. T., J. E. SHAW, S. H. CARR, and D. HIRSH (1985): Extrachromosomal DNA transformation of Caenorhabditis elegans Mol Cell Biol, 5, 3484-3496

STRUBE, C., T. SCHNIEDER, and G. SAMSON-HIMMELSTJERNA (2007): Differential gene expression in hypobiosis-induced and non-induced third-stage larvae of the bovine lungworm Dictyocaulus viviparus Int J Parasitol, 37, 221-231

STRYER, L. (1995a): Die Zielsteuerung der Proteine in: STRYER, L.: Biochemie Chapter 35, 957-993. Publisher: Spektrum Akademischer Verlag

STRYER, L. (1995b): Signalübertragungsprozesse in: STRYER, L.: Biochemie Chapter 13, 343-380. Publisher: Spektrum Akademischer Verlag

SUGITA, S., K. ICHTCHENKO, M. KHVOTCHEV, and T. C. SUDHOF (1998): alpha-Latrotoxin receptor CIRL/latrophilin 1 (CL1) defines an unusual family of ubiquitous G-protein linked receptors. G-protein coupling not required for triggering exocytosis J Biol Chem, 273, 32715-32724

TABARA, H., A. GRISHOK, and C. C. MELLO (1998): RNAi in C. elegans: soaking in the genome sequence Science, 282, 430-431

TAVERNARAKIS, N., S. L. WANG, M. DOROVKOV, A. RYAZANOV, and M. DRISCOLL (2000): Heritable and inducible genetic interference by double-stranded RNA encoded by transgenes Nat Genet, 24, 180-183

TENTER, A. M. and T. SCHNIEDER (2006): Erreger von Parasitosen: Taxonomie, Systematik und allgemeine Merkmale in: SCHNIEDER, T. (Ed.): Veterinärmedizinische Parasitologie Chapter 1.2, 26-73. Publisher: Parey

THOMAS, J. G., A. AYLING, and F. BANEYX (1997): Molecular chaperones, folding catalysts, and the recovery of active recombinant proteins from E. coli. To fold or to refold Appl Biochem Biotechnol, 66, 197-238

THOMAS, J. H. and S. LOCKERY (1999): Neurobiology in: HOPE, I. A. (Ed.): C. elegans - A Practical Approach Chapter 8, 143-179. Publisher: Oxford University Press Appendix 247

THOMPSON, D. P., J. P. DAVIS, M. J. LARSEN, E. M. COSCARELLI, E. W. ZINSER, J. W. BOWMAN, S. J. ALEXANDER-BOWMAN, N. J. MARKS, and T. G. GEARY (2003): Effects of KHEYLRFamide and KNEFIRFamide on cyclic adenosine monophosphate levels in Ascaris suum somatic muscle Int J Parasitol, 33, 199-208

TIMMONS, L., COURT DL, and A. FIRE (2001): Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans Gene, 263, 103-112

TORRADO, M., R. TRIVEDI, R. ZINOVIEVA, I. KARAVANOVA, and S. I. TOMAREV (2002): Optimedin: a novel olfactomedin-related protein that interacts with myocilin Hum Mol Genet, 11, 1291-1301

TRIVEDI, S. and P. ARASU (2005): Evaluation of endogenous reference genes for real-time PCR quantification of gene expression in Ancylostoma caninum Mol Biochem Parasitol, 143, 241-244

UNGEMACH, F. R. (2003): Anthelminthika in: LÖSCHER, W., F. R. UNGEMACH, and R. KROKER (Ed.): Pharmakotherapie bei Haus- und Nutztieren Chapter O1, 248-278. Publisher: Parey

USHKARYOV, Y. A., A. G. PETRENKO, M. GEPPERT, and T. C. SUDHOF (1992): Neurexins: synaptic cell surface proteins related to the alpha-latrotoxin receptor and laminin Science, 257, 50-56

VAN WYK, J. A., F. S. MALAN, H. M. GERBER, and R. M. ALVES (1989): The problem of escalating resistance of Haemonchus contortus to the modern anthelmintics in South Africa Onderstepoort J Vet Res, 56, 41-49

VISSER, A., P. GELDHOF, M. DE, V, D. P. KNOX, J. VERCRUYSSE, and E. CLAEREBOUT (2006): Efficacy and specificity of RNA interference in larval life-stages of Ostertagia ostertagi Parasitology, 133, 777-783

VOLYNSKI, K. E., M. CAPOGNA, A. C. ASHTON, D. THOMSON, E. V. ORLOVA, C. F. MANSER, R. R. RIBCHESTER, and Y. A. USHKARYOV (2003): Mutant alpha-latrotoxin (LTXN4C) does not form pores and causes secretion by receptor stimulation: this action does not require neurexins J Biol Chem, 278, 31058-31066

VOLYNSKI, K. E., F. A. MEUNIER, V. G. LELIANOVA, E. E. DUDINA, T. M. VOLKOVA, M. A. RAHMAN, C. MANSER, E. V. GRISHIN, J. O. DOLLY, R. H. ASHLEY, and Y. A. USHKARYOV (2000): Latrophilin, neurexin, and their signaling-deficient mutants facilitate alpha-latrotoxin insertion into membranes but are not involved in pore formation J Biol Chem, 275, 41175-41183

248 Appendix

VOLYNSKI, K. E., J. P. SILVA, V. G. LELIANOVA, R. M. ATIQUR, C. HOPKINS, and Y. A. USHKARYOV (2004): Latrophilin fragments behave as independent proteins that associate and signal on binding of LTXN4C EMBO J, 23, 4423-4433

WAERING, J. (2002): Molekulare Untersuchungen zum heptahelikalen Transmembranrezeptor Hc110-R von Haemonchus contortus und Orthologen in verschiedenen parasitischen Nematoden Diploma Thesis, Institute for Parasitology, University of Veterinary Medicine Hannover

WAGHORN, T. S., D. M. LEATHWICK, A. P. RHODES, K. E. LAWRENCE, R. JACKSON, W. E. POMROY, D. M. WEST, and J. R. MOFFAT (2006): Prevalence of anthelmintic resistance on sheep farms in New Zealand N Z Vet J, 54, 271-277

WALLER, P. J. and P. CHANDRAWATHANI (2005): Haemonchus contortus: Parasite problem No. 1 from Tropics - Polar Circle. Problems and prospects for control based on epidemiology Trop Biomed, 22, 131-137

WALLNER, M., P. MEERA, and L. TORO (1996): Determinant for beta-subunit regulation in high-conductance voltage-activated and Ca2+-sensitive K+ channels: an additional transmembrane region at the N terminus Proc Natl Acad Sci U S A, 93, 14922-14927

WANG, Z. W., O. SAIFEE, M. L. NONET, and L. SALKOFF (2001): SLO-1 potassium channels control quantal content of neurotransmitter release at the C. elegans neuromuscular junction Neuron, 32, 867-881

WEI, A., T. JEGLA, and L. SALKOFF (1996): Eight potassium channel families revealed by the C. elegans genome project Neuropharmacology, 35, 805-829

WEI, A., C. SOLARO, C. LINGLE, and L. SALKOFF (1994): Calcium sensitivity of BK-type KCa channels determined by a separable domain Neuron, 13, 671-681

WHARTON, D. A. (2002): Nematode Survival Strategies in: LEE, D. L. (Ed.): The Biology of Nematodes Chapter 16, 389-411. Publisher: Taylor and Francis

WHEELER, D. L., T. BARRETT, D. A. BENSON, S. H. BRYANT, K. CANESE, V. CHETVERNIN, D. M. CHURCH, M. DICUCCIO, R. EDGAR, S. FEDERHEN, L. Y. GEER, Y. KAPUSTIN, O. KHOVAYKO, D. LANDSMAN, D. J. LIPMAN, T. L. MADDEN, D. R. MAGLOTT, J. OSTELL, V. MILLER, K. D. PRUITT, G. D. SCHULER, E. SEQUEIRA, S. T. SHERRY, K. SIROTKIN, A. SOUVOROV, G. STARCHENKO, R. L. TATUSOV, T. A. TATUSOVA, L. WAGNER, and E. YASCHENKO (2007): Database resources of the National Center for Biotechnology Information Nucleic Acids Res, 35, D5-12 Appendix 249

WILLSON, J., K. AMLIWALA, A. DAVIS, A. COOK, M. F. CUTTLE, N. KRIEK, N. A. HOPPER, V. O'CONNOR, A. HARDER, R. J. WALKER, and L. HOLDEN-DYE (2004a): Latrotoxin receptor signaling engages the UNC-13-dependent vesicle-priming pathway in C. elegans Curr Biol, 14, 1374-1379

WILLSON, J., K. AMLIWALA, A. DAVIS, A. COOK, M. F. CUTTLE, N. KRIEK, N. A. HOPPER, V. O'CONNOR, A. HARDER, R. J. WALKER, and L. HOLDEN-DYE (2004b): Latrotoxin receptor signaling Engages the UNC-13-dependent vesicle-priming pathway in C. elegans - ERRATUM Curr Biol, 14, 2310

WILLSON, J., K. AMLIWALA, A. HARDER, L. HOLDEN-DYE, and R. J. WALKER (2003): The effect of the anthelmintic emodepside at the neuromuscular junction of the parasitic nematode Ascaris suum Parasitology, 126, 79-86

WITTWER, C. T., M. G. HERRMANN, A. A. MOSS, and R. P. RASMUSSEN (1997): Continuous fluorescence monitoring of rapid cycle DNA amplification Biotechniques, 22, 130-138

WOLSTENHOLME, A. J., I. FAIRWEATHER, R. PRICHARD, G. SAMSON-HIMMELSTJERNA, and N. C. SANGSTER (2004): Drug resistance in veterinary helminths Trends Parasitol, 20, 469-476

WOLSTENHOLME, A. J. and A. T. ROGERS (2005): Glutamate-gated chloride channels and the mode of action of the avermectin / milbemycin anthelmintics Parasitology, 131 Suppl, S85-S95

YUAN, A., M. DOURADO, A. BUTLER, N. WALTON, A. WEI, and L. SALKOFF (2000): SLO-2, a K+ channel with an unusual Cl - dependence Nat Neurosci, 3, 771-779

ZAHNER, H., A. TAUBERT, A. HARDER, and G. SAMSON-HIMMELSTJERNA (2001): Filaricidal efficacy of anthelmintically active cyclodepsipeptides Int J Parasitol, 31, 1515-1522

ZAWADZKI, J. L., P. J. PRESIDENTE, E. N. MEEUSEN, and M. J. DE VEER (2006): RNAi in Haemonchus contortus: a potential method for target validation Trends Parasitol, 22, 495-499

ZHANG, J. and C. D. BYRNE (1999): Differential priming of RNA templates during cDNA synthesis markedly affects both accuracy and reproducibility of quantitative competitive reverse-transcriptase PCR Biochem J, 337 ( Pt 2), 231-241

ZHU, L. J. and S. W. ALTMANN (2005): mRNA and 18S-RNA coapplication-reverse transcription for quantitative gene expression analysis Anal Biochem, 345, 102-109

ZHU, Y. Y., E. M. MACHLEDER, A. CHENCHIK, R. LI, and P. D. SIEBERT (2001): Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction Biotechniques, 30, 892-897

Curriculum Vitae

Personal Details Claudia Annette Felicitas Welz, formerly Ram; born 19 October 1978 in Hamburg, Germany; married to Michael Welz since 30 June 2004

Adress Stuevestrasse 11, 30173 Hannover Email [email protected]

Studies International PhD program “Infection Biology”, Zentrum für Infektionsbiologie (ZIB), Hannover October 2003 – July 2007

PhD Student, Institute for Parasitology, University for Veterinary Medicine Hannover January 2003 – July 2007

Study of Veterinary Medicine, University for Veterinary Medicine Hannover October 1997 – November 2002

Secondary Schools Kieler Gelehrtenschule, Kiel, 1991 – 1997 Friedrichsgymnasium Herford, 1988 – 1991 Primary Schools Grundschule Bad Oeynhausen-Lohe, 1987 – 1988 Grundschule Broedermannsweg, Hamburg, 1984 – 1987

Stipends Stipend, Hannover Biomedical Research School (Excellence Initiative), June 2007 – July 2007

Research Stipend, University of Veterinary Medicine Hannover, January 2007 – May 2007

Georg-Christoph-Lichtenberg Scholarship, October 2003 – September 2006

Hannover,

List of Publications

Parts of this work were previously published as following (presenting author printed in bold):

Papers: Welz, C., A. Harder, T. Schnieder, J. Hoglund, and G. von Samson-Himmelstjerna, 2005: Putative G protein-coupled receptors in parasitic nematodes - potential targets for the new anthelmintic class cyclooctadepsipeptides? Parasitol. Res. 97 Suppl 1: S22-32.

Posters: WAAVP International Conference (The 20th International Conference of the World Association for the Advancement of Veterinary Parasitology), 16 – 20 October 2005 in Christchurch, Newzealand. C. Welz, G. von Samson-Himmelstjerna, A. Harder, T. Schnieder: Putative receptors for cyclooctadepsipeptides in Cooperia oncophora and Ostertagia ostertagi.

Presentations: 1st Short Course for Young Parasitologists, 15 – 17 March 2004 in Würzburg. C. Ram, A. Harder, G. von Samson-Himmelstjerna, T. Schnieder: Investigations in putative orthologs of the receptor HC 110-R in parasitic nematodes

DVG-Tagung Parasitologie (Annual Meeting of the German Society for Veterinary Medicine, Section Parasitology), 22 – 24 June 2005 in Potsdam. C. Welz, G. von Samson-Himmelstjerna, A. Harder, T. Schnieder. Cyclooctadepsipeptide: Untersuchungen an putativen Rezeptoren für eine neue Anthelminthikaklasse

Molecular and Cellular Biology of Helminth Parasites, 6 – 11 September 2005 in Hydra, Greece. C. Welz, G. von Samson-Himmelstjerna, A. Harder, T. Schnieder: Focus on new drugs: Putative receptors for cyclooctadepsipeptides in parasitic nematodes

2nd Short Course for Young Parasitologists, 20 – 22 February 2006 in Vienna, Austria. C. Welz, G. von Samson-Himmelstjerna, A. Harder, T. Schnieder: Investigation on depsiphilins: Putative receptors for cyclooctadepsipeptides in parasitic nematodes

22. Jahrestagung der Deutschen Gesellschaft für Parasitologie (22nd Annual Meeting of the German Society for Parasitology), 22 – 25 February 2006 in Vienna, Austria. C. Welz, G. von Samson-Himmelstjerna, A. Harder, T. Schnieder: Depsiphilins - Receptors for cyclooctadepsipeptides in parasitic nematodes

DVG-Tagung Parasitologie (Annual Meeting of the German Society for Veterinary Medicine, Section Parasitology), 07 – 09 June 2006 in Wetzlar. C. Welz, A. Harder, T. Schnieder, G. von Samson-Himmelstjerna: Expression putativer Emodepsid-Rezeptoren

Further Publications: Papers: Epe, C., G. von Samson-Himmelstjerna, N. Wirtherle, V. von der Heyden, C. Welz, J. Beening, I. Radeloff, K. Hellmann, T. Schnieder, and K. Krieger, 2005: Efficacy of toltrazuril as a metaphylactic and therapeutic treatment of coccidiosis in first-year grazing calves Parasitol Res, 97 Suppl 1, S127-S133

Samson-Himmelstjerna, G.von, C. Epe, N. Wirtherle, V. von der Heyden, C. Welz, I. Radeloff, J. Beening, D. Carr, K. Hellmann, T. Schnieder, and K. Krieger, 2006: Clinical and epidemiological characteristics of Eimeria infections in first-year grazing cattle Vet Parasitol, 136, 215-221

Declaration

Herewith, I confirm that I have written the present PhD thesis myself and independently, and that I have not submitted it at any other university worldwide.

Hannover,

Acknowledgements / Danksagung

Ich danke Prof. Dr. Georg von Samson-Himmelstjerna und Prof. Dr. Thomas Schnieder für die Überlassung des Themas und die Bereitstellung des Arbeitsplatzes. Die Arbeit hat mir großen Spaß und viel Freude gemacht, und ich habe eine ganze Menge gelernt. Ich danke dafür, dass ich an so vielen Kongressen und Tagungen teilnehmen durfte, auf denen ich interessante Menschen kennen gelernt und viele nette und intensive Gespräche geführt habe. Meine Welt ist größer geworden!

Dem Zentrum für Infektionsbiologie (ZIB) danke ich für die Möglichkeit, im Rahmen des Promotionsstudienganges das Thema meiner These bearbeiten zu können und dabei viele nette und kooperationsbereite Menschen kennen zu lernen. Ich danke dem Land Niedersachsen für das Georg- Christoph-Lichtenberg-Stipendium für drei Jahre und der Stiftung Tierärztliche Hochschule Hannover für das Promotionsstipendium für weitere fünf Monate. Dem ZIB danke ich für ein weiteres Stipendium über zwei Monate im Rahmen der Exzellenzinitiative, das mir den Abschluss der Arbeit ermöglicht hat.

Der Bayer HealthCare AG danke ich für die finanzielle und ideelle Unterstützung des Projekts. Allen Mitarbeitern, die ich im Laufe der Zeit kennen gelernt habe, war die Begeisterung für das Projekt deutlich anzumerken.

Prof. Dr. Georg von Samson-Himmelstjerna danke ich für sein Vertrauen in mich, die intensive und sehr gute Betreuung, die immer konstruktive Kritik, die phantasievollen Ideen und für seine Einstellung, dass nichts unmöglich ist. Ich danke ihm für unsere Feierabendgespräche, in denen die besten Ideen entstanden sind, für sein immer offenes Ohr bei allen Problemen und dafür, dass meine „Darf ich…?“-Fragen nie mit Nein beantwortet wurden. Sein Humor und seine eigene Freude an der Arbeit und an dem Projekt haben mir oft genug weiter geholfen.

Prof. Dr. Dr. Achim Harder danke ich für die Betreuung der Arbeit als Co-Supervisor, für seine Begeisterung und seine Unterstützung in allen Phasen des Projekts. Insbesondere hat mir die gute Einbettung des Projekts in die Kooperation mit anderen Arbeitsgruppen gefallen. Es war ein tolles Gefühl, wenigstens ein kleines Stück zum großen Werk beitragen zu können.

Many thanks to Prof. Lindy Holden-Dye for reviewing my thesis as an external expert. I further thank her for her wonderful support regarding slo-1 and the plans for expression experiments in C. elegans and for her great ideas how to test the receptors for their functionality.

Prof. Dr. Andreas Klos danke ich dafür, dass er als Gutachter und Experte die Arbeit bewertet. Ich danke für die überaus freundliche Aufnahme in seine Arbeitsgruppe und die kooperative Unterstützung und Beratung bei den Experimenten mit der Expression der Rezeptoren in Säugerzellen.

Prof. Dr. Thomas Schnieder danke ich für seine konstruktive Kritik, die manchmal erfrischend anderen Ansichten und für seine Offenheit. Ich danke dafür, dass er sich immer Zeit für mich genommen hat, sowie für die Bestätigung und die Ermutigung, die ich durch ihn erfahren habe.

I am deeply grateful to William Blackhall, PhD, for his advices in english grammar and his help to put the thesis into “readable english“. Without him the whole thing would be the worst chaos!

Kay-Ole Johswich aus der Arbeitsgruppe von Prof. Dr. Andreas Klos danke ich für die intensive Unterstützung und Hilfe bei den Versuchen der Expression der Rezeptoren in Säugerzellen. Auch als ich nicht selbst kommen konnte, hat er weiter daran gearbeitet, um Ergebnisse zu erzielen. Das Gelingen der Experimente war ihm ein persönliches Anliegen, und ohne ihn wäre vieles für mich deutlich schwieriger gewesen. Claudia Rheinheimer aus derselben Arbeitsgruppe danke ich für die zeitintensive Hilfe und ihre Unterstützung bei den Calcium-Messungen. Allen anderen Arbeitsgruppenmitgliedern danke ich für ihre Freundlichkeit und die Nachsicht mit mir.

Der Arbeitsgruppe Prof. Dr. Frank Wunderlich in Düsseldorf danke ich für die gute Kooperation und die Unterstützung bei der Expression der Rezeptoren in Säugerzellen, aber auch für die überaus freundliche Aufnahme in die Gruppe. Insbesondere Dr. Hans-Peter Schmitt-Wrede danke ich für die exklusive und intensive Betreuung während meiner Zeit in Düsseldorf, aber auch für die Beratung und Hilfe während des gesamten Projektes. Dr. Peter Benten danke ich für die Unterstützung bei den Calcium-Messungen. Seine Erfahrung war eine große Hilfe. Ich danke Stefanie Mühlfeld und allen anderen Mitarbeitern der Gruppe für ihre Hilfsbereitschaft und Freundlichkeit.

Der Arbeitsgruppe Prof. Dr. Wolfgang Baumgärtner und insbesondere Bettina Buck danke ich für die Hilfe bei den ersten Immunhistolokalisierungsversuchen, die es leider bislang noch nicht zur Auswertbarkeit gebracht haben.

Prof. Dr. Irene Greiser-Wilke danke ich besonders für die Hilfe bei der Erstellung der phylogenetischen Bäume, aber auch für viele interessante und nette Gespräche.

Dr. Christian Epe danke ich für seine Freundschaft, seinen Humor und für viele ernste, lustige und interessante Gespräche.

Ingelore Schwethelm danke ich für die Hilfe, im Institut überhaupt ein Bein an Deck bekommen zu haben. Ihr und Sylvia Gotzmann danke ich für die Hilfe in allen bürokratischen Angelegenheiten.

Christina Strube, PhD, danke ich für viele fachliche und nicht-fachliche Diskussionen, die sich manches Mal bis in den Abend erstreckten, und für ihre Freundschaft und Hilfsbereitschaft, sowie für ihr Fachwissen, das sie immer gerne mit mir geteilt hat.

Sandra Buschbaum danke ich dafür, dass sie mich vom ersten Tag an im Institut an die Hand genommen hat, mir alles erklärt, gezeigt und mich unterstützt hat. Ich danke ihr für die Freundschaft, für ihre Beratung und Hilfe, für die immer mal wieder ungewöhnlichen Lösungen für ungewöhnliche Probleme.

Nina Fischer als meiner Partnerin im „Emo-Projekt“ danke ich ganz besonders für ihr spontanes und selbstloses Einspringen in Notfällen und für viele fachliche und nicht-fachliche Gespräche und für ihre Freundschaft.

Dr. Ricarda Hüsken danke ich für ihre Freundschaft und für unsere täglichen Fahrradtouren, mit denen ein Tag erst so richtig anfing. Ich danke für die Hilfe, für das spontane Einspringen bei manchen Experimenten und die Diskussionen über die jeweiligen Projekte.

Dr. Sonja Wolken danke ich für so manches Gespräch, wenn wir mal wieder die „Letzten“ waren und für ihre Freundschaft.

Ich danke Dr. Vera von der Heyden, Dr. Janina Demeler, Stefan Pachnicke und Ulla Küttler für die Stammhaltung der Nematoden, so dass ich in den meisten Fällen nur „die Hand aufhalten“ musste, um an mein Material zu kommen.

Ich danke allen Mitarbeitern des Institutes für Parasitologie für die freundliche Aufnahme im Institut und die Hilfsbereitschaft bei allen kleineren und größeren Problemen.

Meinen Eltern danke ich für ihre Unterstützung und für den Rückhalt. Meinen Geschwistern und meinem Schwager danke ich für das gute Gefühl, dass es auch noch andere Dinge auf der Welt gibt als meine „ekligen Würmer“.

Meinem Mann Micha danke ich für seine Liebe, für sein Verständnis und für seine Unterstützung. Ich danke ihm für seine Gutmütigkeit, wenn ich mich mal wieder „fest gearbeitet“ hatte und noch später kam als angekündigt. Ich danke ihm dafür, dass er jedes einzelne Ergebnis mit mir gefeiert und jeden Rückschlag mit mir betrauert hat.

Danke!