DOCSLIB.ORG

Sphingobium Baderi Sp. Nov., Isolated from a Hexachlorocyclohexane Dump Site

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sphingobium Baderi Sp. Nov., Isolated from a Hexachlorocyclohexane Dump Site International Journal of Systematic and Evolutionary Microbiology (2013), 63, 673–678 DOI 10.1099/ijs.0.039834-0 Sphingobium baderi sp. nov., isolated from a hexachlorocyclohexane dump site Jasvinder Kaur,13 Hana Moskalikova,23 Neha Niharika,13 Miroslava Sedlackova,3 Ales Hampl,2,3 Jiri Damborsky,2,4 Zbynek Prokop4 and Rup Lal1 Correspondence 1Molecular Biology Laboratory, Department of Zoology, University of Delhi, Delhi-110007, India Zbynek Prokop 2International Clinical Research Centre, St Anne’s University Hospital Brno, Pekarska 53, [email protected] 656 91 Brno, Czech Republic Rup Lal 3 [email protected] Department of Histology and Embryology, Faculty of Medicine, Masaryk University, 625 00 Brno, Czech Republic 4Loschmidt Laboratories and Research Centre for Toxic Compounds in the Environment, Faculty of Science, Masaryk University, 628 00 Brno, Czech Republic A Gram-stain-negative, rod-shaped and white-coloured bacterial strain, designated LL03T, was isolated from hexachlorocyclohexane-contaminated soil at Spolana Neratovice, Czech Republic, where lindane was formerly produced. Strain LL03T was found to be a degrader of a-, c- and d- isomers of hexachlorocyclohexane, although no significant degradation activity was observed for the b-isomer. A neighbour-joining tree based on 16S rRNA gene sequences showed that strain LL03T occupied a distinct phylogenetic position in the Sphingobium cluster, showing the highest similarity with Sphingobium wenxiniae JZ-1T (99.2 %). The DNA G+C content of strain LL03T was 67.0 mol%. DNA–DNA relatedness values of strain LL03T with its close phylogenetic neighbours were below the threshold level of 70 %, supporting its identification as a representative of a novel species of the genus Sphingobium. The predominant respiratory quinone was ubiquinone Q-10. The polar lipid profile of strain LL03T also corresponded to those reported for other Sphingobium species (phosphatidylethanolamine, diphosphatidylglycerol, phosphati- dylcholine, phosphatidylglycerol, phosphatidylmonomethylethanolamine and sphingoglycolipid), supporting its identification as a member of the genus Sphingobium. Spermidine was identified as the major polyamine. The predominant fatty acids were 16 : 0, summed feature 3 (16 : 1v7c and/ or 16 : 1v6c), summed feature 8 (18 : 1v7c and/or 18 : 1v6c) and 14 : 0 2-OH. The polar lipid pattern, the presence of spermidine and ubiquinone Q-10, the predominance of the cellular fatty acids C18 : 1v7c,C16 : 0 and C14 : 0 2-OH and the G+C content of the genomic DNA supported the affiliation of the strain to the genus Sphingobium. The results obtained after DNA–DNA hybridization, biochemical and physiological tests clearly distinguished it from closely related species of the genus Sphingobium. Therefore, strain LL03T represents a novel species of the genus Sphingobium for which the name Sphingobium baderi LL03T sp. nov. is proposed; the type strain is LL03T (5CCM 7981T5DSM 25433T). Hexachlorocyclohexane (HCH) is a saturated chlorinated hydrocarbon and consists of eight variously stable isomers. Out of these isomers, c-HCH or lindane, was widely used Abbreviations: HCH, hexachlorocyclohexane; t-HCH, technical hexa- from the 1940s to the 1990s as a pesticide. Since lindane chlorocyclohexane. production is a highly inefficient process wherein 90 % of 3These authors contributed equally to this work. the production mix is waste, HCH emerged as a major The GenBank accession number for 16S rRNA gene sequence of strain environmental pollutant. The toxicity assessment of HCH T T T LL03 (5CCM 7981 5DSM 25433 ) is JN695620. isomers ranked them as probable human carcinogens, Two supplementary figures and a supplementary table are available with endocrine disruptors with proven teratogenic, genotoxic, the online version of this paper. and mutagenic effects (ATSDR, 2005). In an attempt to Dedication: The authors dedicate this article to Dr Alfred Bader. selectively isolate strains capable of degrading HCH, soil 039834 G 2013 IUMS Printed in Great Britain 673 J. Kaur and others samples were taken from the ground below the former mobilis ATCC 10988T was used as an outgroup. All the production facility of Spolana Neratovice, Czech Republic. selected sequences were aligned using the CLUSTAL_X Strain LL03T was isolated by the enrichment method of Ito program, version 1.81b (Thompson et al., 1997). The and co-workers (Ito et al., 2007). Strain LL03T was found alignment was checked manually for quality. The evolu- to degrade a-, c- and d- isomers, while no significant tionary distance matrix was calculated using the distance degradation activity was observed for the b-isomer of model of Jukes & Cantor (1969) within the TREECON W HCH. It is interesting to note that the strain is novel in the software package, version 1.3b (Van de Peer & De Wachter, respect that it lacks the linB gene which encodes the 1994). A phylogenetic tree was constructed using the enzyme involved in the degradation of b-HCH. None of neighbour-joining method of Saitou & Nei (1987) and the the neighbouring strains could degrade HCH except for resultant tree topology was evaluated by bootstrap analysis Sphingobium quisquiliarum P25T, which could also degrade based on 1000 resamplings. The tree topology was found to a- and c-HCH completely but degraded d-HCH only be similar with maximum-parsimony, neighbour-joining slightly following 24 h incubation. Preliminary studies and maximum-likelihood methods. Evaluation of the with the strain showed it to be a member of the genus topology revealed that strain LL03T clustered with members Sphingobium. The genus Sphingobium, grouped in the of the genus Sphingobium. The signature nucleotides found family Sphingomonadaceae, belongs to the Alphaproteo- in the 16S rRNA gene sequence characteristic for the genus bacteria. The genus was established together with Novo- Sphingobium sensu stricto (Takeuchi et al., 2001) were found sphingobium and Sphingopyxis by Takeuchi et al. (2001). It in the 16S rRNA gene sequence of strain LL03T. These forms cluster II in the phylogenetic tree of Sphingomonas nucleotides were U : A at position 52 : 359, G at position 134, species (Takeuchi et al., 2001). Members of the family are A : U at position 987 : 1218 and U : G at position 990 : 1215, widely distributed in nature and are known to degrade a based on Escherichia coli numbering (Brosius et al., 1978). variety of compounds (Lal et al., 2008). At the time of This observation further supported the placement of strain writing, the genus Sphingobium consisted of 25 species. LL03T within the genus Sphingobium. T Here, we analysed the taxonomic status of strain LL03 by T using a polyphasic approach (Prakash et al., 2007a). Strain LL03 showed the highest 16S rRNA gene sequence similarity (99.2 %) with Sphingobium wenxiniae JZ-1T A soil sample (1 g) was mixed with 2 ml 1/10 W medium (Wang et al., 2011; Fig. 1). DNA–DNA hybridization was 21 T (l :KH2PO4, 170 mg; Na2HPO4, 980 mg; (NH4)2SO4, carried out between strain LL03 and closely related strains 100 mg; MgSO4, 48.7 mg; FeSO4, 0.52 mg; MgO, showing more than 97 % sequence similarity of 16S rRNA 10.75 mg; CaCO3, 2.0 mg; ZnSO4, 0.81 mg; CuSO4, gene sequence with LL03T. Total genomic DNA of all the 0.16 mg; CoSO4, 0.15 mg; and H3BO3, 0.06 mg) and closely related strains was extracted, purified and hybrid- vortexed. The mixture was centrifuged (10006g, 30 min) ization was done by following the protocol as described by and 1 ml supernatant was then inoculated into 100 ml 1/ Kumar et al. (2008) and Tourova & Antonov (1988). DNA 10 W medium saturated with technical HCH (t-HCH). (10 mg) of each strain was transferred onto a positively After static incubation at 25 uC for 10 days, 1 ml of the charged nylon membrane (Hybond-N; Amersham) using a primary enrichment culture was transferred into 100 ml of dot-blot apparatus (Bio-Rad). The membrane was air- fresh 1/10 W medium, and the resultant secondary dried, cross-linked and the DNA probe for each strain was enrichment culture was incubated under the same labelled with [a-P32]-ATP (BRIT) using a nick-translation condition for 4 days. The procedure of transfer and kit (Amersham Pharmacia). Hybridization was performed incubation was once repeated. Serial dilutions of the overnight at 65 uC. After hybridization, the filter was tertiary enriched culture were spread on 1/10 W agar plates washed with SSC and SDS to remove unbound probe. The containing 1.8 mM t-HCH. After incubation at 25 uC for amount of probe bound to the DNA was estimated using a 15 days, a number of colonies with a cleared zone of b-scintillation counter (Perkin Elmer) and hybridization degraded t-HCH were picked up. Single-colony isolation values obtained were expressed as percentage of the probe was repeated several times on t-HCH minimal medium to T bound relative to the homologous reaction. All the DNA– obtain pure cultures. Strain LL03 was found to be a DNA hybridization values were below the threshold value member of the genus Sphingobium for which the name T of 70 % (Table S1, available in IJSEM Online), as is Sphingobium baderi LL03 is proposed for it. recommended for the delineation of bacterial species 16S rRNA gene sequence analysis was carried out as (Wayne et al., 1987), thus confirming that strain LL03T described by Prakash et al. (2007b). A 1462 bp stretch of represents a novel species of the genus Sphingobium. Cell 16S rRNA gene sequence was obtained, which was checked morphology was examined using electron microscopy (Fig. manually to ensure quality of sequences. Searches for S1). Samples were fixed in 300 mmol glutaraldehyde l21 in 21 closely related species were carried out using the BLAST 100 mmol cacodylate buffer l and post-fixed in 40 mmol program (Altschul et al., 1997) from the NCBI (http:// osmium tetroxide l21 in 100 mmol cacodylate buffer l21. www.ncbi.nlm.nih.gov).
Load more

Recommended publications
  • Characterization of the Aerobic Anoxygenic Phototrophic Bacterium Sphingomonas Sp
    microorganisms Article Characterization of the Aerobic Anoxygenic Phototrophic Bacterium Sphingomonas sp. AAP5 Karel Kopejtka 1 , Yonghui Zeng 1,2, David Kaftan 1,3 , Vadim Selyanin 1, Zdenko Gardian 3,4 , Jürgen Tomasch 5,† , Ruben Sommaruga 6 and Michal Koblížek 1,* 1 Centre Algatech, Institute of Microbiology, Czech Academy of Sciences, 379 81 Tˇreboˇn,Czech Republic; [email protected] (K.K.); [email protected] (Y.Z.); [email protected] (D.K.); [email protected] (V.S.) 2 Department of Plant and Environmental Sciences, University of Copenhagen, Thorvaldsensvej 40, 1871 Frederiksberg C, Denmark 3 Faculty of Science, University of South Bohemia, 370 05 Ceskˇ é Budˇejovice,Czech Republic; [email protected] 4 Institute of Parasitology, Biology Centre, Czech Academy of Sciences, 370 05 Ceskˇ é Budˇejovice,Czech Republic 5 Research Group Microbial Communication, Technical University of Braunschweig, 38106 Braunschweig, Germany; [email protected] 6 Laboratory of Aquatic Photobiology and Plankton Ecology, Department of Ecology, University of Innsbruck, 6020 Innsbruck, Austria; [email protected] * Correspondence: [email protected] † Present Address: Department of Molecular Bacteriology, Helmholtz-Centre for Infection Research, 38106 Braunschweig, Germany. Abstract: An aerobic, yellow-pigmented, bacteriochlorophyll a-producing strain, designated AAP5 Citation: Kopejtka, K.; Zeng, Y.; (=DSM 111157=CCUG 74776), was isolated from the alpine lake Gossenköllesee located in the Ty- Kaftan, D.; Selyanin, V.; Gardian, Z.; rolean Alps, Austria. Here, we report its description and polyphasic characterization. Phylogenetic Tomasch, J.; Sommaruga, R.; Koblížek, analysis of the 16S rRNA gene showed that strain AAP5 belongs to the bacterial genus Sphingomonas M. Characterization of the Aerobic and has the highest pairwise 16S rRNA gene sequence similarity with Sphingomonas glacialis (98.3%), Anoxygenic Phototrophic Bacterium Sphingomonas psychrolutea (96.8%), and Sphingomonas melonis (96.5%).
    [Show full text]
  • Comparative Genomic Analysis of Nine Sphingobium Strains: Insights Into
    Verma et al. BMC Genomics 2014, 15:1014 http://www.biomedcentral.com/1471-2164/15/1014 RESEARCH ARTICLE Open Access Comparative genomic analysis of nine Sphingobium strains: insights into their evolution and hexachlorocyclohexane (HCH) degradation pathways Helianthous Verma1†, Roshan Kumar1†, Phoebe Oldach1, Naseer Sangwan1, Jitendra P Khurana2, Jack A Gilbert3,4 and Rup Lal1* Abstract Background: Sphingobium spp. are efficient degraders of a wide range of chlorinated and aromatic hydrocarbons. In particular, strains which harbour the lin pathway genes mediating the degradation of hexachlorocyclohexane (HCH) isomers are of interest due to the widespread persistence of this contaminant. Here, we examined the evolution and diversification of the lin pathway under the selective pressure of HCH, by comparing the draft genomes of six newly-sequenced Sphingobium spp. (strains LL03, DS20, IP26, HDIPO4, P25 and RL3) isolated from HCH dumpsites, with three existing genomes (S. indicum B90A, S. japonicum UT26S and Sphingobium sp. SYK6). Results: Efficient HCH degraders phylogenetically clustered in a closely related group comprising of UT26S, B90A, HDIPO4 and IP26, where HDIPO4 and IP26 were classified as subspecies with ANI value >98%. Less than 10% of the total gene content was shared among all nine strains, but among the eight HCH-associated strains, that is all except SYK6, the shared gene content jumped to nearly 25%. Genes associated with nitrogen stress response and two-component systems were found to be enriched. The strains also housed many xenobiotic degradation pathways other than HCH, despite the absence of these xenobiotics from isolation sources. Additionally, these strains, although non-motile, but posses flagellar assembly genes.
    [Show full text]
  • Proposal of Sphingomonadaceae Fam. Nov., Consisting of Sphingomonas Yabuuchi Et Al. 1990, Erythrobacter Shiba and Shimidu 1982, Erythromicrobium Yurkov Et Al
    Microbiol. Immunol., 44(7), 563-575, 2000 Proposal of Sphingomonadaceae Fam. Nov., Consisting of Sphingomonas Yabuuchi et al. 1990, Erythrobacter Shiba and Shimidu 1982, Erythromicrobium Yurkov et al. 1994, Porphyrobacter Fuerst et al. 1993, Zymomonas Kluyver and van Niel 1936, and Sandaracinobacter Yurkov et al. 1997, with the Type Genus Sphingomonas Yabuuchi et al. 1990 Yoshimasa Kosako*°', Eiko Yabuuchi2, Takashi Naka3,4, Nagatoshi Fujiwara3, and Kazuo Kobayashi3 'JapanCollection of Microorganis ms,RIKEN (Institute of Physical and ChemicalResearch), Wako, Saitama 351-0198, Japan, 2Departmentof Microbiologyand Immunology , AichiMedical University, Aichi 480-1101, Japan, 'Departmentof Host Defense,Osaka City University, Graduate School of Medicine,Osaka, Osaka 545-8585, Japan, and Instituteof SkinSciences, ClubCosmetics Co., Ltd., Osaka,Osaka 550-0005, Japan ReceivedJanuary 25, 2000; in revisedform, April 11, 2000. Accepted April 14, 2000 Abstract:Based on the results of phylogeneticanalysis of the 16SrDNA sequences and the presence of N- 2'-hydroxymyristoyldihydrosphingosine 1-glucuronic acid (SGL-1)and 2-hydroxymyristicacid (non- hydroxymyristicacid in Zymomonas)in cellular lipids,a new family,Sphingomonadaceae, for Group 4 of the alpha-subclassof the classProteobacteria is hereinproposed and a descriptionof the familyis given.The familyconsists of six genera, Sphingomonas,Erythrobacter, Erythromicrobium, Porphyrobacter, Sandara- cinobacterand Zymomonas.Thus, all the validlypublished and currently known genera in Group 4 of the alpha-subclassof
    [Show full text]
  • Supplementary Information for Microbial Electrochemical Systems Outperform Fixed-Bed Biofilters for Cleaning-Up Urban Wastewater
    Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is © The Royal Society of Chemistry 2016 Supplementary information for Microbial Electrochemical Systems outperform fixed-bed biofilters for cleaning-up urban wastewater AUTHORS: Arantxa Aguirre-Sierraa, Tristano Bacchetti De Gregorisb, Antonio Berná, Juan José Salasc, Carlos Aragónc, Abraham Esteve-Núñezab* Fig.1S Total nitrogen (A), ammonia (B) and nitrate (C) influent and effluent average values of the coke and the gravel biofilters. Error bars represent 95% confidence interval. Fig. 2S Influent and effluent COD (A) and BOD5 (B) average values of the hybrid biofilter and the hybrid polarized biofilter. Error bars represent 95% confidence interval. Fig. 3S Redox potential measured in the coke and the gravel biofilters Fig. 4S Rarefaction curves calculated for each sample based on the OTU computations. Fig. 5S Correspondence analysis biplot of classes’ distribution from pyrosequencing analysis. Fig. 6S. Relative abundance of classes of the category ‘other’ at class level. Table 1S Influent pre-treated wastewater and effluents characteristics. Averages ± SD HRT (d) 4.0 3.4 1.7 0.8 0.5 Influent COD (mg L-1) 246 ± 114 330 ± 107 457 ± 92 318 ± 143 393 ± 101 -1 BOD5 (mg L ) 136 ± 86 235 ± 36 268 ± 81 176 ± 127 213 ± 112 TN (mg L-1) 45.0 ± 17.4 60.6 ± 7.5 57.7 ± 3.9 43.7 ± 16.5 54.8 ± 10.1 -1 NH4-N (mg L ) 32.7 ± 18.7 51.6 ± 6.5 49.0 ± 2.3 36.6 ± 15.9 47.0 ± 8.8 -1 NO3-N (mg L ) 2.3 ± 3.6 1.0 ± 1.6 0.8 ± 0.6 1.5 ± 2.0 0.9 ± 0.6 TP (mg
    [Show full text]
  • Characterization of Bacterial Communities Associated
    www.nature.com/scientificreports OPEN Characterization of bacterial communities associated with blood‑fed and starved tropical bed bugs, Cimex hemipterus (F.) (Hemiptera): a high throughput metabarcoding analysis Li Lim & Abdul Hafz Ab Majid* With the development of new metagenomic techniques, the microbial community structure of common bed bugs, Cimex lectularius, is well‑studied, while information regarding the constituents of the bacterial communities associated with tropical bed bugs, Cimex hemipterus, is lacking. In this study, the bacteria communities in the blood‑fed and starved tropical bed bugs were analysed and characterized by amplifying the v3‑v4 hypervariable region of the 16S rRNA gene region, followed by MiSeq Illumina sequencing. Across all samples, Proteobacteria made up more than 99% of the microbial community. An alpha‑proteobacterium Wolbachia and gamma‑proteobacterium, including Dickeya chrysanthemi and Pseudomonas, were the dominant OTUs at the genus level. Although the dominant OTUs of bacterial communities of blood‑fed and starved bed bugs were the same, bacterial genera present in lower numbers were varied. The bacteria load in starved bed bugs was also higher than blood‑fed bed bugs. Cimex hemipterus Fabricus (Hemiptera), also known as tropical bed bugs, is an obligate blood-feeding insect throughout their entire developmental cycle, has made a recent resurgence probably due to increased worldwide travel, climate change, and resistance to insecticides1–3. Distribution of tropical bed bugs is inclined to tropical regions, and infestation usually occurs in human dwellings such as dormitories and hotels 1,2. Bed bugs are a nuisance pest to humans as people that are bitten by this insect may experience allergic reactions, iron defciency, and secondary bacterial infection from bite sores4,5.
    [Show full text]
  • Evolutionary Genomics of an Ancient Prophage of the Order Sphingomonadales
    GBE Evolutionary Genomics of an Ancient Prophage of the Order Sphingomonadales Vandana Viswanathan1,2, Anushree Narjala1, Aravind Ravichandran1, Suvratha Jayaprasad1,and Shivakumara Siddaramappa1,* 1Institute of Bioinformatics and Applied Biotechnology, Biotech Park, Electronic City, Bengaluru, Karnataka, India 2Manipal University, Manipal, Karnataka, India *Corresponding author: E-mail: [email protected]. Accepted: February 10, 2017 Data deposition: Genome sequences were downloaded from GenBank, and their accession numbers are provided in table 1. Abstract The order Sphingomonadales, containing the families Erythrobacteraceae and Sphingomonadaceae, is a relatively less well-studied phylogenetic branch within the class Alphaproteobacteria. Prophage elements are present in most bacterial genomes and are important determinants of adaptive evolution. An “intact” prophage was predicted within the genome of Sphingomonas hengshuiensis strain WHSC-8 and was designated Prophage IWHSC-8. Loci homologous to the region containing the first 22 open reading frames (ORFs) of Prophage IWHSC-8 were discovered among the genomes of numerous Sphingomonadales.In17genomes, the homologous loci were co-located with an ORF encoding a putative superoxide dismutase. Several other lines of molecular evidence implied that these homologous loci represent an ancient temperate bacteriophage integration, and this horizontal transfer event pre-dated niche-based speciation within the order Sphingomonadales. The “stabilization” of prophages in the genomes of their hosts is an indicator of “fitness” conferred by these elements and natural selection. Among the various ORFs predicted within the conserved prophages, an ORF encoding a putative proline-rich outer membrane protein A was consistently present among the genomes of many Sphingomonadales. Furthermore, the conserved prophages in six Sphingomonas sp. contained an ORF encoding a putative spermidine synthase.
    [Show full text]
  • Metaproteomics Characterization of the Alphaproteobacteria
    Avian Pathology ISSN: 0307-9457 (Print) 1465-3338 (Online) Journal homepage: https://www.tandfonline.com/loi/cavp20 Metaproteomics characterization of the alphaproteobacteria microbiome in different developmental and feeding stages of the poultry red mite Dermanyssus gallinae (De Geer, 1778) José Francisco Lima-Barbero, Sandra Díaz-Sanchez, Olivier Sparagano, Robert D. Finn, José de la Fuente & Margarita Villar To cite this article: José Francisco Lima-Barbero, Sandra Díaz-Sanchez, Olivier Sparagano, Robert D. Finn, José de la Fuente & Margarita Villar (2019) Metaproteomics characterization of the alphaproteobacteria microbiome in different developmental and feeding stages of the poultry red mite Dermanyssusgallinae (De Geer, 1778), Avian Pathology, 48:sup1, S52-S59, DOI: 10.1080/03079457.2019.1635679 To link to this article: https://doi.org/10.1080/03079457.2019.1635679 © 2019 The Author(s). Published by Informa View supplementary material UK Limited, trading as Taylor & Francis Group Accepted author version posted online: 03 Submit your article to this journal Jul 2019. Published online: 02 Aug 2019. Article views: 694 View related articles View Crossmark data Citing articles: 3 View citing articles Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=cavp20 AVIAN PATHOLOGY 2019, VOL. 48, NO. S1, S52–S59 https://doi.org/10.1080/03079457.2019.1635679 ORIGINAL ARTICLE Metaproteomics characterization of the alphaproteobacteria microbiome in different developmental and feeding stages of the poultry red mite Dermanyssus gallinae (De Geer, 1778) José Francisco Lima-Barbero a,b, Sandra Díaz-Sanchez a, Olivier Sparagano c, Robert D. Finn d, José de la Fuente a,e and Margarita Villar a aSaBio.
    [Show full text]
  • Sphingomonadaceae: Protective Against Breast Cancer? Ebidor Ufoumanefe Lawani‑Luwaji* and Tolulope Alade
    Lawani‑Luwaji and Alade Bull Natl Res Cent (2020) 44:191 https://doi.org/10.1186/s42269‑020‑00447‑0 Bulletin of the National Research Centre REVIEW Open Access Sphingomonadaceae: Protective against breast cancer? Ebidor Ufoumanefe Lawani‑Luwaji* and Tolulope Alade Abstract Background: Breast cancer is the most common malignancy and one of the leading causes of cancer‑linked deaths in women. The development of the mammary gland is regulated by oestrogen whose activities have also been linked with various diseases including breast cancer. Research has shown that host–microbiota relationship plays a role in human health and disease, so we investigated the association between breast microbiota and breast cancer. A search of the literature was conducted using search tools such as Google Scholar, PubMed, EBSCO and Cochrane library with the terms breast cancer, breast microbiota, microbiome and dysbiosis. A further search included Sphingomonas, Sphingobium yanoikuyae and oestrogen. The search terms were combined in original forms to get relevant stud‑ ies related to the subject under review. All articles written in English were included and publication dates were not limited. Conclusion: Taken together, the studies show that Sphingobium yanoikuyae might have a protective role in breast cancer, especially oestrogen positive, and highlights the need for further investigation into the use of the bacteria for prevention and possibly management of breast cancer. Keywords: Breast cancer, Microbiota, Dysbiosis, Sphingomonas Background to understand oestrogen receptor signalling (Korach Breast carcinoma embraces a group of diseases with def- et al. 2019). nite clinical, molecular and histopathologic properties. Tere are two main types of breast cancer: in situ It is the most common malignancy in females and is one and invasive carcinoma.
    [Show full text]
  • Sphingopyxis Sp. Strain OPL5, an Isoprene-Degrading Bacterium from the Sphingomonadaceae Family Isolated from Oil Palm Leaves
    microorganisms Article Sphingopyxis sp. Strain OPL5, an Isoprene-Degrading Bacterium from the Sphingomonadaceae Family Isolated from Oil Palm Leaves Nasmille L. Larke-Mejía 1 , Ornella Carrión 1 , Andrew T. Crombie 2, Terry J. McGenity 3 and J. Colin Murrell 1,* 1 School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ, UK; [email protected] (N.L.L.-M.); [email protected] (O.C.) 2 School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, UK; [email protected] 3 School of Life Sciences, University of Essex, Colchester CO4 3SQ, UK; [email protected] * Correspondence: [email protected]; Tel.: +44-01603-592959 Received: 2 September 2020; Accepted: 7 October 2020; Published: 10 October 2020 Abstract: The volatile secondary metabolite, isoprene, is released by trees to the atmosphere in enormous quantities, where it has important effects on air quality and climate. Oil palm trees, one of the highest isoprene emitters, are increasingly dominating agroforestry over large areas of Asia, with associated uncertainties over their effects on climate. Microbes capable of using isoprene as a source of carbon for growth have been identified in soils and in the tree phyllosphere, and most are members of the Actinobacteria. Here, we used DNA stable isotope probing to identify the isoprene-degrading bacteria associated with oil palm leaves and inhabiting the surrounding soil. Among the most abundant isoprene degraders of the leaf-associated community were members of the Sphingomonadales, although no representatives of this order were previously known to degrade isoprene. Informed by these data, we obtained representatives of the most abundant isoprene degraders in enrichments, including Sphingopyxis strain OPL5 (Sphingomonadales), able to grow on isoprene as the sole source of carbon and energy.
    [Show full text]
  • Sphingobium Estronivorans Sp. Nov. and Sphingobium Bisphenolivorans Sp
    TAXONOMIC DESCRIPTION Qin et al., Int. J. Syst. Evol. Microbiol. 2020;70:1822–1829 DOI 10.1099/ijsem.0.003978 Sphingobium estronivorans sp. nov. and Sphingobium bisphenolivorans sp. nov., isolated from a wastewater treatment plant Dan Qin1,2, Cong Ma3, Min Lv4 and Chang- Ping Yu1,5,* ABSTRACT Two Gram- stain- negative, aerobic, motile and rod- shaped bacteria, one designated as strain AXBT, capable of degrading estro- gens, and another, YL23T, capable of degrading estrogen and bisphenol A, were isolated from activated sludge in Xiamen City, PR China. The optimum temperature and pH of both strains were 25–35 °C and pH 7.0–8.0. While strain AXBT could tolerate 3 % (w/v) NaCl, YL23T could only grow between 0–1 % (w/v) NaCl. They contained ubiquinone-10 as the major quinone, spermidine as the major polyamine, summed feature 8 (comprising C18:1ω6c and/or C18:1ω7c) as the major fatty acids and diphosphatidyl- glycerol, phosphatidylcholine, phosphatidyldimethylethanolamine, phosphatidylethanolamine, phosphatidylglycerol and sphin- goglycolipid as the major polar lipids. The DNA G+C contents of strains AXBT and YL23T were 63.6 and 63.7 mol%, respectively. Based on the results of 16S rRNA gene sequence analysis, strains AXBT and YL23T belonged to the genus Sphingobium. Strain AXBT was most closely related to Sphingobium chlorophenolicum NBRC 16172T (97.5 %) and Sphingobium chungbukense DJ77T (97.2 %), and strain YL23T was most closely related to S. chlorophenolicum NBRC 16172T (97.4 %) and S. quisquiliarum P25T (97.1 %). Average nucleotide identity values between these two strains and S. chlorophenolicum NBRC 16172T, S. chungbuke- nse DJ77T, Sphingobium chinhatense IP26T, Sphingobium quisquiliarum P25T and Sphingobium japonicum UT26ST were from 80.7 to 85.8 %.
    [Show full text]
  • Kinetics of Mercury Accumulation by Freshwater Biofilms
    Environ. Chem. 2018, 14, 458–467 © CSIRO 2017 doi:10.1071/EN17073_AC Supplementary material Kinetics of mercury accumulation by freshwater biofilms Perrine DranguetA,B Vera I. SlaveykovaA and Séverine Le FaucheurA,C AUniversity of Geneva, Faculty of Sciences, Earth and Environment Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Environmental Biogeochemistry and Ecotoxicology, Uni Carl Vogt, 66 Bvd Carl-Vogt, CH 1211, Geneva, Switzerland. BPresent address: Département de sciences biologiques, Université de Montréal, Pavillon Marie- Victorin CP6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7, Canada CCorresponding author. Email: [email protected] Table S1. Targets and sequences of the primers used to characterise the bacterial communities in biofilms using qPCR and amplicon sequencing Molecular tool Primers Target Sequence (5’-3’) References P338f GCATGGCYGYCGTCAG All bacteria [1] P518r CGACGCCATCTTCATTCACAT merAF ATTCCAGCTCCAATAGCG qPCR Hg resistance [2] merAR GACTACGATGGTATCTAATC hgcAR Hg TCCGTAGGTGAACCTGCGG [3] hgcAR methylation TCCTCCGCTTATTGATATGC Universal 1053F small subunit GCATGGCYGYCGTCAG [4] ribosomal 1319R rRNA gene CGACGCCATCTTCATTCACAT Amplicon sequencing D512F ATTCCAGCTCCAATAGCG Nuclear small ribosomal [5] subunit 18S D978R GACTACGATGGTATCTAATC Table S2. Taxonomic ranks of the major microorganisms living in both biofilms (B1 and B2), as well as the number of sequences and their abundance (%) calculated with OTUs assigned to (a) bacteria and (b) microalgae prior (T0) and after 24h (T24)
    [Show full text]
  • Sphingobium Cupriresistens Sp. Nov., a Copper- Resistant Bacterium Isolated from Copper Mine Soil, and Emended Description of the Genus Sphingobium
    %paper no. ije040865 charlesworth ref: ije040865& New Taxa - Proteobacteria International Journal of Systematic and Evolutionary Microbiology (2013), 63, 000–000 DOI 10.1099/ijs.0.040865-0 Sphingobium cupriresistens sp. nov., a copper- resistant bacterium isolated from copper mine soil, and emended description of the genus Sphingobium Liqiong Li,3 Hongliang Liu,3 Zunji Shi and Gejiao Wang Correspondence State Key Laboratory of Agricultural Microbiology, College of Life Science and Technology, Gejiao Wang Huazhong Agricultural University, Wuhan, 430070, PR China [email protected] or [email protected] A Gram-negative, aerobic, copper-resistant bacterium, designated strain CU4T, was isolated from copper mine soil in Daye, China. Phylogenetic analysis based on 16S rRNA gene sequences showed highest similarity to Sphingobium rhizovicinum CC-FH12-1T (98.4 %), followed by Sphingobium francense Sp+T (97.2 %), Sphingobium japonicum UT26T (97.1 %), Sphingobium abikonense NBRC 16140T (97.0 %), Sphingobium xenophagum DSM 6383T (96.9 %) and Sphingobium yanoikuyae DSM 7462T (95.5 %). The major fatty acids (.5 %) were summed feature 7 (C18 : 1v7c,C18 : 1v9t and/or C18 : 1v12t), summed feature 4 (C16 : 1v7c and/or iso- C15 : 0 2-OH), C16 : 0 and C14 : 0 2-OH, and the predominant quinone was ubiquinone Q-10. Spermidine was the major polyamine component. The major polar lipids were diphosphatidyl- glycerol, phosphatidylethanolamine, phosphatidylglycerol, sphingoglycolipid, phosphatidyldi- methylethanolamine and phosphatidylcholine. The genomic DNA G+C content of strain CU4T was 64.9 mol%. Comparison of DNA–DNA hybridization, phenotypic and chemotaxonomic characteristics between strain CU4T and phylogenetically related strains revealed that the new isolate represents a novel species of the genus Sphingobium, for which the name Sphingobium cupriresistens sp.
    [Show full text]