Environmental Origin of the Genus Bordetella
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes
J Med Bacteriol. Vol. 6, No. 3, 4 (2017): pp.1-13 jmb.tums.ac.ir Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S rRNA and ompA Genes Ali Badamchi 1, Moslem Papizadeh 2* 1 Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran. 2 Department of Microbiology, Pasteur Institute of Iran (IPI), Tehran, Iran. ARTICLE INFO ABSTRACT Article type: Background: The genus Bordetella harbors 16 species; three of them are well-known for their high Original Article medical importance. The phylogenetic diversity of the genus is currently not very well investigated. Methods: In this study, 16S rRNA gene sequence of 16 type strains of the Bordetella species were Article history: analyzed. Also, phylogenies conducted on the same gene of 247 isolates of Bordetella species, Received: 19 Jan 2017 comprising a wide physiological as well as ecological diversity and encompassing ex-type Revised: Jun Mar 2017 representatives of the 16 Bordetella species, were analyzed. Accepted: 11 Sep 2017 Results: It was found that the phylogenetic diversity of the genus may be very different from that is Published: 15 Oct 2017 currently assumed. Interestingly, the 16S rRNA gene signals could not resolve some species with Keywords: promising bootstrap and posterior probability values as our phylogenies, using maximum likelihood Alcaligenaceae, and Bayesian inference methods, showed. Biogeography, Bordetella Conclusion: Our results indicate a probable need for additional phylogenetic signals which can be species, Ecological provided by coding genes. Therefore, sequence data of ompA gene of Bordetella species, a critically distribution, Phylogenetic significant genomic region in pathogenesis, was here analyzed, phylogenetically. -
Product Information Sheet for NR-43502
Product Information Sheet for NR-43502 Bordetella holmesii, Strain 1058 Propagation: 1. Keep vial frozen until ready for use, then thaw. 2. Transfer the entire thawed aliquot into a single tube Catalog No. NR-43502 of broth. 3. Use several drops of the suspension to inoculate an For research use only. Not for human use. agar slant and/or plate. 4. Incubate the tube, slant and/or plate at 37°C for 2 to Contributor: 7 days. Adam Ratner, M.D., M.P.H., Assistant Professor, Department of Pediatrics, Columbia University, New York, New York, Citation: USA Acknowledgment for publications should read “The following reagent was obtained through BEI Resources, NIAID, NIH: Manufacturer: Bordetella holmesii, Strain 1058, NR-43502.” BEI Resources Biosafety Level: 2 Product Description: Appropriate safety procedures should always be used with Bacteria Classification: Alcaligenaceae, Bordetella this material. Laboratory safety is discussed in the following Species: Bordetella holmesii publication: U.S. Department of Health and Human Services, Strain: 1058 Public Health Service, Centers for Disease Control and Original Source: Bordetella holmesii (B. holmesii), strain Prevention, and National Institutes of Health. Biosafety in 1058 was isolated in January 2012 from a human 1 Microbiological and Biomedical Laboratories. 5th ed. bloodstream sample in the United States. Washington, DC: U.S. Government Printing Office, 2009; see Comments: Strain 1058 was deposited as a brown pigment www.cdc.gov/od/ohs/biosfty/bmbl5/bmbl5toc.htm. producing strain. The complete genome sequence of B. holmesii, strain 1058 has been sequenced (GenBank: Disclaimers: NZ_JDTF00000000). You are authorized to use this product for research use only. -
Phylogenetic Analysis Reveals an Ancient Gene Duplication As The
1 Phylogenetic analysis reveals an ancient gene duplication as 2 the origin of the MdtABC efflux pump. 3 4 Kamil Górecki1, Megan M. McEvoy1,2,3 5 1Institute for Society & Genetics, 2Department of MicroBiology, Immunology & Molecular 6 Genetics, and 3Molecular Biology Institute, University of California, Los Angeles, CA 90095, 7 United States of America 8 Corresponding author: [email protected] (M.M.M.) 9 1 10 Abstract 11 The efflux pumps from the Resistance-Nodulation-Division family, RND, are main 12 contributors to intrinsic antibiotic resistance in Gram-negative bacteria. Among this family, the 13 MdtABC pump is unusual by having two inner membrane components. The two components, 14 MdtB and MdtC are homologs, therefore it is evident that the two components arose by gene 15 duplication. In this paper, we describe the results obtained from a phylogenetic analysis of the 16 MdtBC pumps in the context of other RNDs. We show that the individual inner membrane 17 components (MdtB and MdtC) are conserved throughout the Proteobacterial species and that their 18 existence is a result of a single gene duplication. We argue that this gene duplication was an ancient 19 event which occurred before the split of Proteobacteria into Alpha-, Beta- and Gamma- classes. 20 Moreover, we find that the MdtABC pumps and the MexMN pump from Pseudomonas aeruginosa 21 share a close common ancestor, suggesting the MexMN pump arose by another gene duplication 22 event of the original Mdt ancestor. Taken together, these results shed light on the evolution of the 23 RND efflux pumps and demonstrate the ancient origin of the Mdt pumps and suggest that the core 24 bacterial efflux pump repertoires have been generally stable throughout the course of evolution. -
BD-CS-057, REV 0 | AUGUST 2017 | Page 1
EXPLIFY RESPIRATORY PATHOGENS BY NEXT GENERATION SEQUENCING Limitations Negative results do not rule out viral, bacterial, or fungal infections. Targeted, PCR-based tests are generally more sensitive and are preferred when specific pathogens are suspected, especially for DNA viruses (Adenovirus, CMV, HHV6, HSV, and VZV), mycobacteria, and fungi. The analytical sensitivity of this test depends on the cellularity of the sample and the concentration of all microbes present. Analytical sensitivity is assessed using Internal Controls that are added to each sample. Sequencing data for Internal Controls is quantified. Samples with Internal Control values below the validated minimum may have reduced analytical sensitivity or contain inhibitors and are reported as ‘Reduced Analytical Sensitivity’. Additional respiratory pathogens to those reported cannot be excluded in samples with ‘Reduced Analytical Sensitivity’. Due to the complexity of next generation sequencing methodologies, there may be a risk of false-positive results. Contamination with organisms from the upper respiratory tract during specimen collection can also occur. The detection of viral, bacterial, and fungal nucleic acid does not imply organisms causing invasive infection. Results from this test need to be interpreted in conjunction with the clinical history, results of other laboratory tests, epidemiologic information, and other available data. Confirmation of positive results by an alternate method may be indicated in select cases. Validated Organisms BACTERIA Achromobacter -
Biofilm Formation and Cellulose Expression by Bordetella Avium 197N, the Causative Agent of Bordetellosis in Birds and an Opportunistic Respiratory Pathogen in Humans
Accepted Manuscript Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans Kimberley McLaughlin, Ayorinde O. Folorunso, Yusuf Y. Deeni, Dona Foster, Oksana Gorbatiuk, Simona M. Hapca, Corinna Immoor, Anna Koza, Ibrahim U. Mohammed, Olena Moshynets, Sergii Rogalsky, Kamil Zawadzki, Andrew J. Spiers PII: S0923-2508(17)30017-7 DOI: 10.1016/j.resmic.2017.01.002 Reference: RESMIC 3563 To appear in: Research in Microbiology Received Date: 17 November 2016 Revised Date: 16 January 2017 Accepted Date: 16 January 2017 Please cite this article as: K. McLaughlin, A.O. Folorunso, Y.Y. Deeni, D. Foster, O. Gorbatiuk, S.M. Hapca, C. Immoor, A. Koza, I.U. Mohammed, O. Moshynets, S. Rogalsky, K. Zawadzki, A.J. Spiers, Biofilm formation and cellulose expression by Bordetella avium 197N, the causative agent of bordetellosis in birds and an opportunistic respiratory pathogen in humans, Research in Microbiologoy (2017), doi: 10.1016/j.resmic.2017.01.002. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Page 1 of 25 ACCEPTED MANUSCRIPT 1 For Publication 2 Biofilm formation and cellulose expression by Bordetella avium 197N, 3 the causative agent of bordetellosis in birds and an opportunistic 4 respiratory pathogen in humans 5 a* a*** a b 6 Kimberley McLaughlin , Ayorinde O. -
Table S1. Primers Used for PCR Amplification
Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv. -
Phenotypic and Genomic Analyses of Burkholderia Stabilis Clinical Contamination, Switzerland Helena M.B
RESEARCH Phenotypic and Genomic Analyses of Burkholderia stabilis Clinical Contamination, Switzerland Helena M.B. Seth-Smith, Carlo Casanova, Rami Sommerstein, Dominik M. Meinel,1 Mohamed M.H. Abdelbary,2 Dominique S. Blanc, Sara Droz, Urs Führer, Reto Lienhard, Claudia Lang, Olivier Dubuis, Matthias Schlegel, Andreas Widmer, Peter M. Keller,3 Jonas Marschall, Adrian Egli A recent hospital outbreak related to premoistened gloves pathogens that generally fall within the B. cepacia com- used to wash patients exposed the difficulties of defining plex (Bcc) (1). Burkholderia bacteria have large, flexible, Burkholderia species in clinical settings. The outbreak strain multi-replicon genomes, a large metabolic repertoire, vari- displayed key B. stabilis phenotypes, including the inabil- ous virulence factors, and inherent resistance to many anti- ity to grow at 42°C; we used whole-genome sequencing to microbial drugs (2,3). confirm the pathogen was B. stabilis. The outbreak strain An outbreak of B. stabilis was identified among hos- genome comprises 3 chromosomes and a plasmid, shar- ing an average nucleotide identity of 98.4% with B. stabilis pitalized patients across several cantons in Switzerland ATCC27515 BAA-67, but with 13% novel coding sequenc- during 2015–2016 (4). The bacterium caused bloodstream es. The genome lacks identifiable virulence factors and has infections, noninvasive infections, and wound contamina- no apparent increase in encoded antimicrobial drug resis- tions. The source of the infection was traced to contaminat- tance, few insertion sequences, and few pseudogenes, ed commercially available, premoistened washing gloves suggesting this outbreak was an opportunistic infection by used for bedridden patients. After hospitals discontinued an environmental strain not adapted to human pathogenic- use of these gloves, the outbreak resolved. -
Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF). -
Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella. -
Bordetella Trematum Infection: Case Report and Review of Previous Cases
y Castro et al. BMC Infectious Diseases (2019) 19:485 https://doi.org/10.1186/s12879-019-4046-8 CASEREPORT Open Access Bordetella trematum infection: case report and review of previous cases Thaís Regina y Castro1, Roberta Cristina Ruedas Martins2, Nara Lúcia Frasson Dal Forno3, Luciana Santana4, Flávia Rossi4, Alexandre Vargas Schwarzbold1, Silvia Figueiredo Costa2 and Priscila de Arruda Trindade1,5* Abstract Background: Bordetella trematum is an infrequent Gram-negative coccobacillus, with a reservoir, pathogenesis, a life cycle and a virulence level which has been poorly elucidated and understood. Related information is scarce due to the low frequency of isolates, so it is important to add data to the literature about this microorganism. Case presentation: We report a case of a 74-year-old female, who was referred to the hospital, presenting with ulcer and necrosis in both legs. Therapy with piperacillin-tazobactam was started and peripheral artery revascularization was performed. During the surgery, a tissue fragment was collected, where Bordetella trematum, Stenotrophomonas maltophilia, and Enterococcus faecalis were isolated. After surgery, the intubated patient was transferred to the intensive care unit (ICU), using vasoactive drugs through a central venous catheter. Piperacillin- tazobactam was replaced by meropenem, with vancomycin prescribed for 14 days. Four days later, levofloxacin was added for 24 days, aiming at the isolation of S. maltophilia from the ulcer tissue. The necrotic ulcers evolved without further complications, and the patient’s clinical condition improved, leading to temporary withdrawal of vasoactive drugs and extubation. Ultimately, however, the patient’s general condition worsened, and she died 58 days after hospital admission. -
Table S5. the Information of the Bacteria Annotated in the Soil Community at Species Level
Table S5. The information of the bacteria annotated in the soil community at species level No. Phylum Class Order Family Genus Species The number of contigs Abundance(%) 1 Firmicutes Bacilli Bacillales Bacillaceae Bacillus Bacillus cereus 1749 5.145782459 2 Bacteroidetes Cytophagia Cytophagales Hymenobacteraceae Hymenobacter Hymenobacter sedentarius 1538 4.52499338 3 Gemmatimonadetes Gemmatimonadetes Gemmatimonadales Gemmatimonadaceae Gemmatirosa Gemmatirosa kalamazoonesis 1020 3.000970902 4 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas indica 797 2.344876284 5 Firmicutes Bacilli Lactobacillales Streptococcaceae Lactococcus Lactococcus piscium 542 1.594633558 6 Actinobacteria Thermoleophilia Solirubrobacterales Conexibacteraceae Conexibacter Conexibacter woesei 471 1.385742446 7 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas taxi 430 1.265115184 8 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas wittichii 388 1.141545794 9 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas sp. FARSPH 298 0.876754244 10 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sorangium cellulosum 260 0.764953367 11 Proteobacteria Deltaproteobacteria Myxococcales Polyangiaceae Sorangium Sphingomonas sp. Cra20 260 0.764953367 12 Proteobacteria Alphaproteobacteria Sphingomonadales Sphingomonadaceae Sphingomonas Sphingomonas panacis 252 0.741416341 -
Insights Into the Pathogenicity of Burkholderia Pseudomallei
REVIEWS Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei W. Joost Wiersinga*, Tom van der Poll*, Nicholas J. White‡§, Nicholas P. Day‡§ and Sharon J. Peacock‡§ Abstract | Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. Infection is often associated with bacterial dissemination to distant sites, and there are many possible disease manifestations, with melioidosis septic shock being the most severe. Eradication of the organism following infection is difficult, with a slow fever-clearance time, the need for prolonged antibiotic therapy and a high rate of relapse if therapy is not completed. Mortality from melioidosis septic shock remains high despite appropriate antimicrobial therapy. Prevention of disease and a reduction in mortality and the rate of relapse are priority areas for future research efforts. Studying how the disease is acquired and the host–pathogen interactions involved will underpin these efforts; this review presents an overview of current knowledge in these areas, highlighting key topics for evaluation. Melioidosis is a serious disease caused by the aerobic, rifamycins, colistin and aminoglycosides), but is usually Gram-negative soil-dwelling bacillus Burkholderia pseu- susceptible to amoxicillin-clavulanate, chloramphenicol, domallei and is most common in Southeast Asia and doxycycline, trimethoprim-sulphamethoxazole, ureido- Northern Australia. Melioidosis is responsible for 20% of penicillins, ceftazidime and carbapenems2,4. Treatment all community-acquired septicaemias and 40% of sepsis- is required for 20 weeks and is divided into intravenous related mortality in northeast Thailand. Reported cases are and oral phases2,4. Initial intravenous therapy is given likely to represent ‘the tip of the iceberg’1,2, as confirmation for 10–14 days; ceftazidime or a carbapenem are the of disease depends on bacterial isolation, a technique that drugs of choice.