Weatherbee, Bailey.Pdf

THE CATARACT-ASSOCIATED RNA-BINDING PROTEIN

CELF1 POST-TRANSCRIPTIONALLY REGULATES

THE KEY EYE TRANSCRIPTION FACTOR

PAX6 IN LENS DEVELOPMENT

Bailey A. T. Weatherbee

A thesis submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Honors Bachelor of Science in Biological Science with Distinction

Spring 2019

THE CATARACT-ASSOCIATED RNA-BINDING PROTEIN

CELF1 POST-TRANSCRIPTIONALLY REGULATES

THE KEY EYE TRANSCRIPTION FACTOR

PAX6 IN LENS DEVELOPMENT

Bailey A. T. Weatherbee

Approved: ______Salil A. Lachke, Ph.D. Professor in charge of thesis on behalf of the Advisory Committee

Approved: ______Melinda K. Duncan, Ph.D. Committee member from the Department of Department Name

Approved: ______Gary Laverty, Ph.D. Committee member from the Board of Senior Thesis Readers

Approved: ______Earl Lee II, Ph.D. Director, University Honors Program ACKNOWLEDGMENTS

First, I would like to thank Dr. Salil Lachke for his support, encouragement, and lessons throughout my three years in his laboratory. His work ethic, excitement for science, and continuous support have provided such a positive undergraduate research experience for me. He has trusted me with complex and exciting research and guided me through key decisions for my future. He has provided an incredible example of a humble, hard-working, inspiring scientist that I am so lucky to have learned from. I would like to thank the graduate students from the laboratory who have helped to train me, to teach me how to think like a scientist, and who have become my life-long friends. Dr. Archana Siddam truly shaped the way that I think about science. She molded me in the last year of her Ph.D., and I am forever grateful. Sandeep Aryal, since her graduation, has guided me. I am grateful for how our friendship has grown, his constant support, and his belief in my abilities. I would like Dr. Melinda Duncan and Dr. Gary Laverty for serving on my committee. Their commitment to undergraduate research and student success is extremely admirable.

I would like to thank my parents for their unwavering support for my ambitions and interest in science since I was young. Palangga ko ikaw.

Lastly, I would like to thank the faculty and students of the department. I joined this department as a junior in high school. Three labs and six years later, I truly can’t believe this part of my journey is ending. This culture and its people have been formative for me, professionally and personally. Thank you.

iii TABLE OF CONTENTS

LIST OF TABLES ...... vi LIST OF FIGURES ...... vii ABSTRACT ...... xvi

1 INTRODUCTION ...... 1

1.1 The Mammalian Lens and its Development ...... 1

1.1.1 Structure and Function of the Ocular Lens ...... 1 1.1.2 Cataract ...... 3 1.1.3 Vertebrate Ocular Lens Development ...... 4 1.1.4 Lens Fiber Cell Differentiation ...... 7

1.2 Pax6: A Key Regulator of Eye Development ...... 10 1.3 iSyTE: A Systems Tool for Predicting Genes that Function in Lens Development ...... 16 1.4 Post-Transcriptional Control of Gene Expression in Lens Development and Disease ...... 18

1.4.1 RBP-mediated PTC in Lens Development ...... 19

1.5 Celf1 Functions as a Post-Transcriptional Regulator ...... 22

1.5.1 Celf1 Function in Alternative Splicing ...... 22 1.5.2 Celf1 Function in mRNA Localization ...... 23 1.5.3 Celf1 Function in mRNA decay ...... 23 1.5.4 Celf1 Function in Translation ...... 24 1.5.5 Celf1 in Development and Disease ...... 25

1.6 Celf1 Functions Coordinately with other RBPs, including Elavl1, to Regulate Gene Expression ...... 30

2 MATERIALS AND METHODS ...... 32

2.1 Animal Husbandry ...... 32 2.2 DNA Isolation and Genotyping ...... 33 2.3 Immunofluorescence ...... 34 2.4 Western Blot ...... 34 2.5 RNA Isolation and Reverse Transcriptase Quantitative PCR ...... 35 2.6 RNA Immunoprecipitation (RIP) Assay ...... 36 2.7 Cell Culture ...... 37 2.8 Celf1 Knock-Down and Overexpression Cell Lines ...... 37

iv 2.9 Luciferase Reporter Assays ...... 38

3 RESULTS ...... 40

3.1 Pax6 Protein, but not RNA, is Mis-Expressed in Celf1 Knock-out Lenses ...... 40 3.2 Celf1 Protein Binds Pax6 RNA at the 3’ Untranslated Region ...... 44 3.3 Celf1 Exerts Translational Control over Pax6 by Binding to its 3’UTR 48 3.4 Co-immunostaining Reveals Potential Celf1 and Elavl1 Colocalization 54 3.5 Elavl1 Binds Pax6 RNA in the Lens ...... 58

4 DISCUSSION ...... 60

4.1 Conclusions ...... 60 4.2 Future Directions ...... 67

REFERENCES ...... 70

SUPPLEMENTARY METHODS ...... 84

v LIST OF TABLES

Supplementary Table 1: Celf1cKO/lacZKI Genotyping Primers ...... 84

Supplementary Table 2: RT-PCR Primers ...... 84

Supplementary Table 3: Immunofluorescent Conditions ...... 84

Supplementary Table 4: Western Blot Conditions ...... 85

vi LIST OF FIGURES

Figure 1.1: Structure of the eye. The camera-type eye of vertebrates consists of the cornea and lens in the anterior portion, and the retina in the posterior. The lens and cornea are transparent tissues that function to refract and focus light onto the retina. Figure from Dash et al., 2016...... 2

Figure 1.1.2: Schematic of lens fiber cell differentiation. Development of the mouse lens begins at E9.5 when the lens placode thickens following contact with the optic vesicle. The optic vesicle and the lens pit coordinately invaginate, leading to the detachment and formation of the lens vesicle. Anterior cells of the vesicle form the anterior epithelium while the posteriorly localized cells differentiate to lens fiber cells. Throughout life, the epithelial cells in the equatorial region exit the cell cycle and differentiate into secondary lens fiber cells. LP: Lens Placode, OV: Optic Vesicle, LPT: Lens Pit, OC: Optic Cup, LV: Lens Vesicle, C: Cornea, AE: Anterior Epithelium, RT: Retina, PF: Primary Fiber cell, SF: Secondary Fiber cell. Figure modified from Kuszak & Brown, 1994...... 6

Figure 1.1.3: Overview of organelle degradation in the lens. Organelle degradation begins as lens epithelial cells enter the transition zone. Dnase2b becomes expressed, followed by nuclear lamina degradation. Lysosomes containing DNase2b fuse with the nuclease to drive DNA 3- cleavage. It generates 3’ PO4 DNA ends, which endogenous phosphatases convert to 3’-OH ends. The nucleus is then disintegrated and releases particulate material into the cytoplasm. Concurrently, Mitochondria are fragmented and organelles permeabilized, after which proteins are ubiquitinated, degraded, and cleared. Figure from Steven Bassnett, 2009...... 9

vii Figure 1.2.1: Pax6 deficiency causes eye defects. Pax6 function in eye development is evolutionarily conserved, and deficiency causes eye defects ranging from Drosophila to humans. (A) Deficiency in Drosophila results in a failure of eye formation. Mutations in pax6b in zebrafish causes decreased eye and lens size, and retina malformations. Mutations in Pax6 in mouse results in the “small-eye” phenotype with a failure of eye and nasal pit formation. (B) A compound PAX6 heterozygote proband (nonsense mutations in codons 103 and 353) from a family with a variety of ocular defects was born with microcephaly, bilateral anophthalmia with fused eyelids, and craniofacial defects. Post-mortem analysis revealed a lack of brain hemisphere fusion and a complete absence of the corpus callosum. Figure adapted from Tom Glaser et al., 1994; Hogan, Hirst, Horsburgh, & Hetherington, 1988; Kleinjan et al., 2008; Washington, Haendel, Mungall, Ashburner, & Lewis, 2009...... 11

Figure 1.2.2: Ectopic expression of eyeless/Pax6 induces ectopic eye formation in Drosophila and Xenopus. Scanning electron microscopy of fly with Gal4-system driven ectopic eyeless expression shows ectopic eye formation under the wing (white arrow) and antennae head (white arrowhead) (A, A’). Pax6 misexpression by injection of 160pg of Pax6 mRNA into one blastomere at the 16-cell stage in Xenopus leads to ectopic eyecup (white arrowhead) and lens (black arrowhead) (B). Histology of the Xenopus ectopic eye shows lens (L), ganglion cell layer (G), inner nuclear layer (I), outer nuclear layer (O), and retinal pigmented epithelial layer (P) formation (B’). Figure adapted from Chow et al., 1999 and Halder et al., 1995...... 12

Figure 1.2.3: Pax6 gene structure and isoforms. (A) The Pax6 mouse locus featuring the P0 and P1 upstream promoters and the Pα and P4 internal promoters. Coding exons are indicated in color and noncoding exons are depicted in black. (B) The structure of the Pax6 and Pax6(5a) isoforms with phosphorylation sites (*) and sumoylation sites (#) marked. Coding exon colors in (A) correspond to protein domains in (B). (C) The binding dynamics and consensus sequences of canonical Pax6 (P6CON), Pax6(5a) (5aCON), Pax6 homeodomain-only (P3), and the site 2-1 sequences which are bound by the homeodomain, PAI, β- sheet, and linker sequences. Figure from Shaham, Menuchin, Farhy, & Ashery-Padan, 2012...... 14

viii Figure 1.3: iSyTE identifies Celf1 as a candidate gene with highly lens-enriched expression. (A) In iSyTE 2.0, which is based on RNA-sequencing data, Celf1 is identified as highly expressed and lens enriched from E10.5 through E16.5. (B, B’) In iSyTE microarray data, Celf1 is also shown to be highly expressed and enriched in the lens through embryonic and postnatal time points. Based on its high lens-enriched expression (among the top 2-5%-tile of lens expressed genes), iSyTE predicts the RNA-binding protein Celf1 as a high-priority candidate with a potential role in the lens based on both microarray and RNA-sequencing data. ... 17

Figure 1.4.1: RNA-binding proteins (RBPs) function in many steps of post- transcriptional control (PTC). RBP can mediate pre-mRNA processing within the nucleus, as well as mRNA localization, stability, decay, and translation in the cytoplasm. Figure from Dash, Siddam, Barnum, Janga, & Lachke, 2016...... 20

Figure 1.4.2: TDRD7 deficiency are associated with cataract in mouse and human. Left: human pediatric cataract in a two-year-old patient. Right: Cataract in Tdrd7 null mouse at age 3 months. Adapted from Lachke, et al. 2011...... 21

Figure 1.5: Schematic of Celf1 Protein. Celf1 contains three RNA-recognition motifs (RRMs). RRM1 and RRM2 near the N-terminus preferentially bind “UGUU” and AU-rich sequences while RRM3, near the C-terminus, binds UG repeats. Between the RRM1/2 and RRM3 domains is a divergent domain through which it can homo- and hetero-oligomerize through its oligomerization domain. Figure adapted from Dasgupta & Ladd, 2012...... 22

Figure 1.4.3: Celf1 is expressed in lens development, and deficiency is associated with lens defects. (A, A’) Celf1 mRNA and protein are expressed in mouse lens development. (B, B’) Celf1 deficiency results in cataract. (C, C’) Celf1 deficiency results in lens fiber cell morphology defects with large gaps in the lens. Figure adapted from Siddam, et al. 2018. ... 27

Figure 1.4.4: Celf1 regulates key cell cycle components to mediated nuclear degradation. (A, A’, B, B’) p27Kip1 is upregulated in Celf1 knockout lenses. (C, C’) Phosphorylation of laminA/C, which p27Kip1 inhibits, is downregulated in Celf1 knockout lenses. (D) 5’ luciferase assay demonstrates that Celf1 translationally represses p27Kip1 expression through interaction with the 5’ UTR. (E) CLIP analysis demonstrates the Celf1 directly binds p27Kip1 and Dnase2b mRNAs. (F) 3’ luciferase assay demonstrates that Celf1 stabilizes and allows for higher expression of Dnase2b. Figure adapted from Siddam, et al., 2018...... 29

ix Figure 3.1.1: Pax6 protein is abnormally upregulated in Celf1cKO/lacZKI lenses during development. Compared to control, Celf1 protein is notably upregulated in both, the lens epithelium and fiber cells, at E14.5 (A, A’), and markedly upregulated at E16.5 (B, B’), P0 (C, C’) and P10 (D, D’). In addition to the stronger signal intensity, Pax6 appears to be expressed beyond its normal expression pattern restricted to early differentiating fiber cells and is now detected well beyond the transition zone, and deep in maturing fiber cells in Celf1cKO/lacZKI lenses. Scale bar = 300µm. e = epithelium, f = fiber cells, tz = transition zone, asterisks denote abnormal Pax6 expression in fiber cell nuclei...... 40

Figure 3.1.2: Pax6 mRNA expression is consistent between control and Celf1cKO/lacZKI P7 lenses. Both lenses were isolated from three P7 Celf1 compound knockout (Celf1cKO/lacZKI) and three control mice. RNA was extracted, cDNA synthesized, and qRT-PCR performed in technical triplicates with Pax6 primers. There was no significant difference in Pax6 mRNA expression between Celf1cKO/lacZKI lenses and controls. n= 3 biological triplicates with technical triplicates. Fold change calculated using the ΔΔCT method and statistical significance determined using a nested ANOVA...... 41

Figure 3.1.3: Pax6 protein is overexpressed in Celf1 knockdown lens epithelial cells. 21EM15 lens epithelial cells were transduced with lentiviral particles containing Celf1-short hairpin RNAs (shRNAs) or non-targeting controls. After puromycin selection, knockdown was confirmed, and further analysis performed. (A) Western blot demonstrating reduced Celf1 protein in Celf1 KD cell lines that were generated previously and described by Siddam et al., 2018. (B) Western blot (C) and immunostaining analysis demonstrate elevated levels of Pax6 protein in Celf1 KD cell line as compared to controls. Note that immunostaining shows Pax6 protein to be localized to the nucleus and the cytoplasm. Scale bar = 50 µm...... 42

Figure 3.1.4: Pax6 mRNA expression is not significantly different between control and Celf1 knockdown cell lines. RNA was extracted from Celf1 KD and control cell lines in biological triplicates. cDNA was synthesized, and RT-qPCR analysis performed in technical triplicates with Pax6 primers. There was no significant difference in Pax6 mRNA expression between Celf1 KD and control cell lines. n=3 biological replicates with 3 technical replicates. Fold change calculated using the ΔΔCT method and statistical significance was analyzed using a nested ANOVA...... 43

x Figure 3.2.1: Celf1 RNA immunoprecipitation assay followed by RT-PCR demonstrates that Celf1 protein binds Pax6 mRNA in P15 wild-type mouse lens. Lenses from three P15 wild-type mice were isolated. Celf1 protein and its associated mRNA was isolated by incubation with anti- Celf1 mouse monoclonal antibody-coated beads in the presence of RNase inhibitors. For negative control, non-specific anti-IgG rabbit monoclonal antibodies were used. For positive control, no antibody purification step was performed, and total RNA was used (input). Following washes and protein degradation, RNA was isolated by phenol:chloroform extraction. cDNA was synthesized, and enrichment of Pax6 transcript was detected by RT-PCR with Pax6 primers. RT- PCR products were separated on a 1% agarose gel by gel electrophoresis, and Celf1 RIP was enriched for Pax6 transcript as compared to the IgG control. n=3 biological replicates...... 44

Figure 3.2.2: Bioinformatics-based analysis predicts multiple Celf1-binding sites in the untranslated regions of Pax6 mRNA transcript variants. Eight separate mouse transcript variants are annotated in the UCSC genome browser. Variants 1, 2, and 3 include the coding sequence for the Pax6(5a) isoform. Variants 4, 5, and 6 code for canonical Pax6 protein, and variants 7 and 8 encode the ΔPD truncated Pax6. Variants 1 and 4; 2 and 6; 3 and 5 share identical 5’ UTRs. Variants 7 and 8 have similar 5’ UTRs, varying only by a 51 nt insertion in variant 7. Variants 3 and 5, 7, and 8 have predicted Celf1 CUG-binding sites in their 5’ UTR. All variants share a common 3’ UTR with multiple predicted Celf1 binding sites including both CUG- and ARE- binding sites...... 45

Figure 3.2.3: Not all Pax6 transcripts are expressed in the lens. RNA from P7 control and Celf1cKO/lacZKI lenses was isolated and cDNA synthesized. RT-PCR was performed with full-length Pax6 5’ UTR primers of the different transcript variants. The 5’ UTRs of variants 1 and 4, 2 and 6 are expressed in the lens, while that of 3 and 5, 7, and 8 are not. This pattern is unchanged in Celf1cKO/lacZKI lenses. The expressed 5’ UTR variants do not contain a predicted Celf1 binding site...... 46

xi Figure 3.2.4: Celf1 RIP RNA is enriched for the 5’ UTR of Pax6 transcript variants with Celf1 binding sites in the 3’ UTR, only. Celf1 and its mRNA targets were isolated from P15 wildtype lenses through RNA- Immunoprecipitation using anti-Celf1 mouse monoclonal antibody. Following cDNA synthesis, RT-PCR was performed with 5’ UTR variant primers. The RIP assay was enriched for the 5’ UTRs of variants 1 and 4, 2 and 6, only. Thus, the Pax6 transcripts that Celf1 interacts with in the lens are those which contain predicted Celf1 binding sites in the 3’ UTR...... 47

Figure 3.3.1: Luciferase reporter identifies Celf1-based control is mediated via Pax6 3’UTR. Luciferase reporter vector containing the first 920 nt of the Pax6 3’ UTR was transfected into control and Celf1 KD cells. Normalized Fluc/Rluc expression was significantly higher in Celf1 KD versus control cell lines. n= 6 biological replicates with 3 technical replicates each; significance was calculated using a nested ANOVA. ... 49

Figure 3.3.2: 21EM15 Celf1 Transient Overexpression Cell Lines Exhibit Reduced Pax6 Protein Expression. 21EM15 cell lines were transfected with full- length Celf1 coding sequence-containing expression vector. After 48 hours protein was collected for analysis. (A) Western blot with anti- Celf1 rabbit monoclonal antibody confirms successful overexpression of Celf1. (B) In these transient Celf1 overexpression lens epithelial cells, western blot with anti-Pax6 rabbit monoclonal antibody demonstrates reduced Pax6 protein expression...... 50

Figure 3.3.3: Pax6 Partial 3’ Luciferase Assay in 21EM15 Celf1 transient overexpression and control cell lines. Luciferase reporter vector containing the first 920 nt of the Pax6 3’ UTR was transfected into 21EM15 lens epithelial cells by itself (control) or with Celf1 overexpression vector (Celf1 overexpression). Luciferase activity was analyzed 48 hours following transfection. Compared to controls, Celf1 overexpression cell lines exhibited significantly decreased normalized luciferase expression. n= 3 biological replicates. p-value calculated using an unpaired t-test...... 51

xii Figure 3.3.4: Pax6 Partial 3’ UTR Luciferase Assay in NIH3T3 Celf1 Transient Overexpression and Control Cells. Luciferase reporter vector containing the first 920 nt of the Pax6 3’ UTR was transfected into NIH3T3 fibroblast cells either by itself (control) or with a Celf1 overexpression vector (Celf1 overexpression vector). Luciferase activity was analyzed 48 hours following transfection. In Celf1 transient overexpression fibroblast cells, relative luciferase expression is upregulated as compared to controls, differing directionally from the effect of Celf1 in lens cells. n=3 biological replicates. p-value was calculated using an unpaired t-test...... 53

Figure 3.4.1: iSyTE predicts high Elavl1 expression in lens development. (A) In iSyTE 2.0, which is based on RNA-sequencing data, Elavl1 is identified as highly expressed, but not lens enriched from E10.5 through E16.5. (B, B’) In iSyTE microarray data, Elavl1 is also shown to be highly expressed in the lens through embryonic and postnatal time points...... 55

Figure 3.4.2: 21EM15 Celf1 co-immunoprecipitation lysate is enriched for Elavl1 protein. Celf1 protein and its binding partners were immunoprecipitated (Celf1 IP) with a rabbit monoclonal anti-Celf1 antibody. Using the Celf1 IP sample for western blotting, an anti-Elavl1 mouse monoclonal antibody was used to demonstrate that Elavl1 is enriched in the Celf1 IP as compared to the IgG non-specific antibody control. This shows that Celf1 and Elavl1 exhibit protein-protein interactions. Data and figure courtesy of Sandeep Aryal...... 56

Figure 3.4.3: Co-immunostaining of Celf1 and Elavl1 on E16.5 wild-type lens. Both Elavl1 and Celf1 are expressed in the lens, and their expression pattern overlaps in nuclei differentiating lens fiber cells (*). In the anterior epithelium cytoplasm and nuclei, Elavl1 expression is enriched as compared to Celf1 (arrowheads). This data provides preliminary evidence of potential colocalization of Celf1 and Elavl1 proteins in the lens. e= epithelium, tz = transition zone, f = fiber cells. Scale bar = 300µm...... 57

xiii Figure 3.5.1: Elavl1 RIP RNA from wild-type mouse lenses is enriched for Pax6 mRNA compared to IgG control. Elavl1 protein and its associated mRNAs were isolated from P15 lenses in biological triplicates using an anti-Elavl1 rabbit monoclonal antibody. For negative controls, a non- specific IgG antibody was used. For positive controls, total RNA was isolated (input). Following protein degradation, phenol:chloroform RNA extraction, and cDNA synthesis, RT-PCR was performed with Pax6 primers. Pax6 mRNA is enriched in Elavl1 RIP compared to IgG control. This demonstrates that Elavl1 interacts with Pax6 mRNA in the lens...... 58

Figure 3.5.2: Proposed mechanism in which Celf1 and Elavl1 both bind Pax6 mRNA and control its translation. Celf1 and Elavl1 both bind Pax6 in the 3’ UTR leading to translation inhibition. This allows for the fine-tuned protein expression of Pax6 to optimal dosage amounts in the correct cell types. This allows for the correct spatio-temporal pattern of Pax6 expression in the lens, leading to proper lens development...... 59

Figure 4.1.1: Increased copy number of PAX6 in mouse has dosage-dependent effects. (A) Wild type lens with no PAX6 transgene shows normal morphology compared to (B) a Sey/+ mouse with corneal opacification and small eye phenotype. When the PAX77 transgene is introduced, which contains 5-6 copy numbers of the PAX6 gene, the (C) Sey/+ and (D) Sey/Sey small eye, corneal opacification, and anophthalmia phenotypes are rescued. The PAX77 transgene introduced to a wild-type background results in phenotypes ranging from (E) nearly normal eyes to (F) severe microphthalmia. Introduction of the PAX138 transgene carrying 10-12 copy numbers of the PAX6 gene resulted in an infertile founder and very severe microphthalmia comparable to the most severe PAX77 phenotype. This work demonstrates a dosage-dependent response to PAX6 copy number in the eye. Figure adapted from Schedl et al., 1996...... 63

xiv Figure 4.1.2: Spatio-temporal expression analysis of Pax6 through mouse lens development. Pax6 protein (A-D) and mRNA (A’-D’) visualized using immunofluorescence and in situ hybridization, respectively. During lens induction (E8.5; A, A’), Pax6 protein and mRNA are expressed in the optic vesicle (ov) and presumptive lens ectoderm (ple). Then, following the thickening of the ple to form the lens placode (lp) (E9.5; B, B’), Pax6 protein expression is enriched in the lp as compared to the underlying ov, while the mRNA expression levels remain broad. At E10.5 (C, C’) Pax6 protein expression is confined to the lens vesicle (lv) and reduced in the posterior presumptive retina (pr), but still expressed in the nasal and temporal regions. The mRNA expression is similar, though with less exact demarcations. In E18.5 lenses (D), Pax6 protein is expressed highly in the lens epithelium (epi) and is nearly undetectable in the transition zone (t) and fiber cells (fib). (D’) The mRNA expression levels are somewhat similar. However, despite a decrease in mRNA expression in the transition and fiber cell regions, Pax6 mRNA is still detectable where protein expression is not. D, D’ scale bar = 100 µm. Figure adapted from Duncan et al., 2004, Smith et al., 2009, and Wawersik & Maas, 2000...... 64

Figure 4.2: Integration of the mechanism proposed in this study into a broader inter- regulatory network. Here, we present a model where Celf1 and Elavl1 both bind the 3’ UTR of Pax6 mRNA to regulate its translation. This regulation allows for the optimal levels of Pax6 expression in the proper cell types at the proper time in development. When considering this in the context of larger networks, this PTC control mechanism affects the expression of a key TF, which then controls transcription of other key lens genes – including RBPs. Those RBPs then regulate events such as splicing, localization, and translation of key lens proteins. Thus, the PTC and TF networks of gene regulation are interrelated in a large-scale feedback mechanism that optimizes dosage and spatio-temporal expression of key proteins to allow for proper organogenesis...... 66

xv ABSTRACT

The lens is a transparent tissue that, together with the cornea, focuses light on the retina, allowing for high-resolution vision. Lens opacification, termed cataract, is the leading cause of blindness worldwide. Cataract can present commonly as age- dependent or less frequently as congenital. An estimated 25-50% of congenital cataract cases arise from underlying genetic or developmental defects. While several cataract- linked genes are known, it is estimated that many more have yet to be been identified.

Characterization of these novel cataract-linked genes and their function in the lens will lead to a better understanding of the cataract pathology and can potentially identify novel therapeutic targets for non-surgical intervention. Therefore, our lab has developed and applied a systems-based tool, iSyTE (integrated Systems Tool for Eye gene discovery), to identify new candidate genes associated with lens development and cataract. Recently, iSyTE was used to identify a new cataract-associated gene called Celf1.

Celf1 encodes an RNA-binding protein (RBP) that functions in distinct regulatory mechanisms in the mRNA life cycle, controlling diverse post-transcriptional processes such as mRNA decay or stability, alternative splicing, and translation into protein. Our lab recently demonstrated that deficiency of Celf1 causes lens defects or cataract in fish, frog, and mouse – indicating that it has a conserved function in vertebrate lens development. This report demonstrated that in normal lens development, Celf1 negatively regulates the translation of the mRNA encoding a key cell cycle regulator, namely the cyclin-dependent kinase inhibitor p27Kip1, in maturing fiber cells. This function of Celf1 in reducing p27Kip1 in advanced stage maturing fiber cells facilitates the activation of CDK1, which mediates phosphorylation of nuclear

xvi laminA/C proteins, in turn enabling nuclear envelope breakdown. Furthermore, this initial work also showed that Celf1 is required for the increased stability of the mRNA that encodes the nuclease, Dnase2b. Thus, Celf1 controls both, the enzyme involved in DNA degradation, as well as its access to fiber cell nuclear DNA, which ensures removal of fiber cell nuclei, a requirement for lens transparency. Removal of Celf1 perturbs this regulatory module, causing abnormal retention of nuclei in lens fiber cells contributing to lens opacity. However, this elegant model explains only a subset of the molecular changes that contribute to cataract formation in Celf1 deficient animals. There are many other remaining questions, which may have a broader conceptual impact on lens biology. For example, do RBPs such as Celf1, involved in post-transcriptional control, regulate the expression of key DNA-binding transcription factors (TFs) in the lens? Does Celf1 function in coordination with other RBP binding-partners mediate combinatorial control on the expression of such TFs? My research addresses these fundamental questions by identifying a new regulatory relationship between Celf1 protein and the key lens TF Pax6. I find that Celf1 deficient mouse lenses exhibit abnormal over-expression of Pax6 protein in lens epithelium and fiber cells. Furthermore, compared to normal lenses, wherein Pax6 protein is restricted to early differentiating fiber cells, the area of Pax6 protein expression in Celf1 deficient lenses is abnormally expanded to include advanced stage differentiating fiber cells. This is significant as Pax6 is a key regulator of eye and lens development and precise control over its protein levels are critical to lens and eye biology. For example, aberrant Pax6 dosage causes a range of ocular defects such as a complete absence of eye tissue (anophthalmia), small eye (microphthalmia), aniridia (absence of the iris), and cataract. Ectopic over-expression of Pax6 also causes lens

xvii defects. To investigate the effect of Celf1 protein in controlling Pax6 protein dosage, I applied a Cre-loxp-based mouse genetics approach (mouse lines carrying Celf1 floxed allele and the lens-specific Cre driver allele, Pax6GFPCre) to generate Celf1 lens- specific conditional knockout mice (hereafter referred to as Celf1cKO/lacZKI). Using immunofluorescence assays, I demonstrated that Pax6 protein is abnormally high in Celf1cKO/lacZKI lenses compared to control. Interestingly, real-time quantitative polymerase chain reaction (RT-qPCR) demonstrates that Pax6 mRNA levels are not significantly altered in Celf1cKO/lacZKI lenses. Thus, the elevation of Pax6 protein levels without a comparable elevation of Pax6 mRNA suggests a regulatory mechanism functioning on the post-transcriptional level, specifically at the level of translational control. Similar to the Celf1cKO/lacZKI lens, stable Celf1-knockdown (KD) mouse lens- derived epithelial cell lines also show an up-regulation of Pax6 protein compared to control. To gain insight into the molecular mechanism of how Celf1 protein controls Pax6 mRNA translation, I performed Celf1-antibody coupled RNA- immunoprecipitation (RIP) followed by RT-PCR. Celf1 RIP assay demonstrates that Celf1 protein interacts with Pax6 mRNA. Further, cross-linking immunoprecipitation (CLIP) followed by RNA-sequencing (RNA-seq), performed by our collaborator Dr. Luc Paillard, offers independent support that Celf1 protein directly binds to Pax6 mRNA and identifies a potential Celf1 protein binding-site within the Pax6 mRNA 3’ UTR. Further, I show that a partial sequence of the Pax6 3’ mRNA UTR is sufficient in a luciferase assay for Celf1-mediated repression of Pax6 protein translation.

To gain further insight into the molecular mechanism, I next investigated if Celf1 coordinately functions with other RBPs to exert combinatorial control over gene expression of shared mRNA targets. Co-immunoprecipitation performed in cultured

xviii mouse lens epithelial cells demonstrates that Celf1 associates with another RBP, Elavl1. Celf1 and Elavl1 proteins have been shown to coordinately control protein expression of target mRNAs in other systems. Bioinformatics-based analysis identified multiple potential Elavl1-binding sites, including AU-rich elements (AREs), within the Pax6 transcript sequence. By performing Elavl1-antibody RIP coupled with RT-PCR, I show that Elavl1 protein, similar to Celf1 protein, interacts with Pax6 mRNA in the lens. Together, these data indicate that the RBPs Celf1 and Elavl1 bind Pax6 mRNA and likely mediate combinatorial control over Pax6 mRNA to control the translation of Pax6 protein in mouse lens development. This study uncovers a novel RBP-mediated post-transcriptional control mechanism for spatio-temporal regulation of the protein levels of a key TF Pax6 in the lens, in turn, providing a new molecular pathway underlying the cataract pathology in Celf1-deficient lenses.

xix Chapter 1

INTRODUCTION

1.1 The Mammalian Lens and its Development

1.1.1 Structure and Function of the Ocular Lens The eye is a specialized, multicomponent organ that allows the perception of light by converting photon-based signals to electrical impulses. It sends these electrical impulses via the optic nerve to the brain where it is interpreted as an image, thus providing the sense of vision. Among multiple other components, the eye principally consists of the cornea and lens in the anterior, and retina in the posterior. The lens is a transparent, avascular tissue (Figure 1.1) that functions with the cornea to refract and focus light on the retina (Land, 2012).

The lens consists of two cell types: epithelial cells and fiber cells. Lens epithelial cells are located as a monolayer in the anterior of the lens while fiber cells are located in the posterior and make up the bulk of the lens tissue. In mouse, these cell types are determined early during lens vesicle stage (embryonic day E11.5), wherein cells that find themselves in the anterior region become epithelial cells while those in the posterior acquire “primary” fiber cell fate (described in more detail later). Later in development, upon receipt of specific signaling cues, epithelial cells in a distinct region near the lens equator, near the transition zone, proliferate, exit the cell cycle and differentiate into secondary lens fiber cells (Cvekl & Ashery-Padan, 2014). Differentiating secondary fiber cells initiate a complex program that involves cellular elongation, upregulation of key crystallin and other lens proteins, and degradation of organelles, including their nuclei (Cvekl & Ashery-Padan, 2014). These characteristic properties are essential for

2 lens transparency. Given the continued differentiation and tightly controlled morphological and molecular events, the lens tissue serves as a particularly accessible model for investigations of basic developmental mechanisms.

1.1.2 Cataract Opacification of the ocular lens, termed cataract, results in failure of the lens to project an optimal image on to the retina. Age-related cataract is the leading cause of blindness constituting approximately 55% of all blindness cases for individuals over 50 years of age, worldwide (Flaxman et al., 2017). According to the National Eye Institute (NEI), over half of all Americans will have cataract or undergo cataract surgery by the age of 80 (“Cataract,” 2019). Cataract surgery, which replaces the opaque lens with an artificial intraocular lens (IOL), remains the only feasible treatment. However, 20-40% of patients experience decreased visual acuity within two to five years due to posterior capsular opacification (PCO) (Nibourg et al., 2015).

Depending on the age of onset, cataract cases can be classified as either age- related or congenital/pediatric. Congenital cataracts account for 5-20% of childhood blindness cases (Sheeladevi, Lawrenson, Fielder, & Suttle, 2016), of which an estimated 50% have an underlying genetic cause (Santana & Waiswol, 2011). As of 2015, at least 44 loci were identified as cataract-linked, and by 2018, over 52 genes were identified as causing isolated pediatric cataract (Reis & Semina, 2018; Shiels, 2019; Shiels & Hejtmancik, 2015, 2017). While the number of genes associated cataract continues to increase, there are many yet to be identified. Even in the 44 loci identified as of 2015, at least 12 were orphan loci with unknown genes (Shiels & Hejtmancik, 2015). Currently, surgical intervention is the only treatment for cataract, and it is considered that identification of new genetic components can inform on the regulatory circuitry

3 necessary for lens transparency and thus potentially uncover novel targets for non- surgical therapeutic intervention. Indeed, recent reports point to the application of sterol-based compounds to delay or even reverse cataract in animal models (Makley et al., 2015; Zhao et al., 2015). It was known that mutations in lanosterol synthase caused inheritable cataracts in both rats and humans (Mori et al., 2006; Zhao et al., 2015). Understanding the mechanism of sterol-based intervention and of sterol pathway regulation is important regarding cataract treatment. Recently, our laboratory molecularly characterized Mafg-/-:Mafk+/- mouse which exhibited misregulation of sterol pathway genes and early-onset age-related cataract (Agrawal et al., 2015; Anand et al., 2015). These animals provide a model in which to study sterol pathway- misregulation related cataract. Thus, the application of animal models to study basic lens biology can contribute to novel identification of therapeutic targets and strategies for cataract.

1.1.3 Vertebrate Ocular Lens Development The earliest observable development of eye can be traced back to late gastrulation stages when the ectoderm differentiates into three distinct types: neural ectoderm, non-neural ectoderm and in between them, the border ectoderm (Cvekl & Zhang, 2017). The border ectoderm gives rise to the pre-placodal ectoderm, a portion of which forms the prospective lens ectoderm (PLE). At embryonic day (E) 9.5 in the mouse, the optic vesicles arising bilaterally from the developing forebrain extend and contact the overlying PLE (Cvekl & Zhang, 2017). Lens development has been a classical model to study the process of embryonic induction as the underlying optic vesicle secretes signals that induce the PLE to thicken and form the lens placode (Gunhaga, 2011). Specifically, transcription factors (TFs) Rx, Lhx2, Pax6 and Mab21l2

4 (Klimova & Kozmik, 2014; Mathers, Grinberg, Mahon, & Jamrich, 1997; Thein et al., 2016; Yamada, 2003) as well as BMP4 signaling (Furuta & Hogan, 1998) from the optic vesicle are essential for the induction of the lens placode. In turn, the PLE also signals the optic vesicle to induce optic cup formation (Ashery-Padan, Marquardt, Zhou, & Gruss, 2000; Hyer, Kuhlman, Afif, & Mikawa, 2003). The induction process requires the expression of key lens TFs Six3, Pax6 and Sox2, which allow the lens placode and optic vesicle to coordinately invaginate, forming the lens pit and optic cup (Cvekl &

Ashery-Padan, 2014; Donner, Episkopou, & Maas, 2007; Liu, Lagutin, Mende, Streit, & Oliver, 2006). During invagination, cells of the lens pit undergo extracellular matrix (ECM) and cytoskeletal remodeling which, at ~E11.5, results in constriction and detachment of the lens vesicle from the overlying surface ectoderm (Cvekl & Zhang, 2017). This separation is dependent on a cooperative function between E-cadherin and N-cadherin (Pontoriero et al., 2009). The overlying ectoderm later contributes to the formation of the cornea, the lens vesicle forms the lens, and the optic cup develops into the retina. Following the formation of the lens vesicle, the anteriorly localized cells form the epithelium of the lens (referred as the anterior epithelium of the lens, AEL), while the posteriorly localized cells exit the cell cycle and undergo primary lens fiber cell differentiation. This polarization is achieved through signaling gradients of FGFs, BMPs, and other growth factors ( Cvekl & Zhang, 2017; Faber, Robinson, Makarenkova, & Lang, 2002; McAvoy, Chamberlain, de Longh, Hales, & Lovicu,

1999). This process of primary lens fiber cell differentiation requires the TF Prox1, which functions to control FGF receptor expression (Audette et al., 2016), Notch signaling (Cvekl & Zhang, 2017), and BMP signaling (Faber et al., 2002). The AEL

5 maintains progenitor potential with renewed expression of Sox2 (Cvekl & Zhang, 2017). Throughout life, the AEL proliferates, and, upon reaching the equator (Transition Zone; TZ) of the lens, undergo secondary lens fiber cell differentiation.

6 1.1.4 Lens Fiber Cell Differentiation Not all the cells in the anterior epithelium actively proliferate, however, these also do not exit the cell cycle. The proliferation capacity is restricted to the region above the equatorial region called the germinative zone (Bassnett, 2009). The cells in the germinative zone proliferate, migrate and differentiate to form secondary fiber cells. The differentiation process is influenced by FGF signaling from the retinal cells. This signaling helps the epithelial cells to exit the cell cycle. These secondary fiber cells get added over the primary fiber cells and earlier born secondary fiber cells forming growing layers. This process of secondary fiber cell formation continues throughout life in the mouse. Fiber cells (FC) constitute the bulk of the lens and their differentiation program features morphological changes that minimize light scattering and ensure transparency (Bassnett, 2009; Cvekl & Ashery-Padan, 2014; Lachke & Maas, 2010). Defects within this process, or in AEL maintenance, result in lens defects such as cataract. Key features of lens fiber cell differentiation include tight packing of adjacent lens fiber cells to limit any extracellular space within the lens (Steven Bassnett, Shi, & Vrensen, 2011). Additionally, fiber cells elongate to fill the anterior-posterior axis of the lens and form protrusions which interlock with neighboring fiber cells to ensure mechanical strength and continuity (Bassnett et al., 2011). Molecularly, at the TZ, the cells of the AEL exit the cell cycle with marked downregulation of Foxe3 and upregulation of cell cycle inhibitors such as p57KIP2 (Griep, 2008; Landgren, Blixt, & Carlsson, 2008). The FC differentiation program becomes active as TFs such as Mafs, Sox1, and Prox1 become active (Cvekl & Ashery- Padan, 2014). These key TFs activate expression of enriched FC factors including cytoskeletal, gap junction, and crystallin proteins (Cvekl & Ashery-Padan, 2014). α, β,

7 and γ crystallins are key structural proteins that are highly concentrated (greater than 400 mg/ml) in the lens that contribute to its refractive ability. In order to minimize light scattering, mature lens fiber cells lack organelles. It is known that failure to properly degrade organelles contributes to cataract formation (Bassnett, 2009). Nuclear degradation is among the most well-studied, and complex pathway in lens fiber cell differentiation. First, the nuclear lamina is degraded, then the nucleus undergoes morphological changes (Bassnett, 2009; Dahm, Gribbon, Quinlan,

& Prescott, 1998). Next, the lysosomal Dnase2b enzyme is delivered to the nuclease to digest DNA (Nakahara et al., 2007). Mitochondrial and endoplasmic reticulum degradation occurs during nuclear degradation, while the Golgi apparatus becomes fragment as lens epithelial cells approach the transition zone (Bassnett, 1995; Bassnett & Beebe, 1992). Proteins from these organelles are broken down through the ubiquitination pathway (Caceres et al., 2010; Zandy & Bassnett, 2007). Recent studies suggest autophagy and mitophagy may also play a role in mitochondrial breakdown

(Costello et al., 2014). The coordinated execution of these programs results in fiber cells in the central region of the lens constituting the organelle-free zone (OFZ) which enables lens transparency.

Figure 1.1.3: Overview of organelle degradation in the lens. Organelle degradation begins as lens epithelial cells enter the transition zone. Dnase2b becomes expressed, followed by nuclear lamina degradation. Lysosomes containing DNase2b fuse with the nuclease to drive DNA cleavage. It generates 3’ 3- PO4 DNA ends, which endogenous phosphatases convert to 3’-OH ends. The nucleus is then disintegrated and releases particulate material into the cytoplasm. Concurrently, Mitochondria are fragmented and organelles permeabilized, after which proteins are ubiquitinated, degraded, and cleared. Figure from Steven Bassnett, 2009.

9 1.2 Pax6: A Key Regulator of Eye Development Pax6, often referred to as a “master” regulator of eye development, is a homeodomain-containing TF. In Drosophila melanogaster, mutation in the Pax6 homolog, eyeless (eye), results in absence of eye (anophthalmia) or small eye (microphthalmia) phenotype, while its overexpression results in the induction of ectopic eyes (Halder, Callaerts, & Gehring, 1995). In addition, overexpression of pax6 in Xenopus laevis also results in ectopic eye formation (Altmann, Chow, Lang, &

Hemmati-Brivanlou, 1997). Further, ectopic expression of Pax6 in Xenopus laevis induces ectopic eye expression with differentiation of all retinal cells (Chow, Altmann, Lang, & Hemmati-Brivanlou, 1999). In zebrafish, a gene duplication resulted in two pax6 genes, both of which function in eye development (Nornes, Clarkson, Mikkola, Pedersen, & Bardsley, 1998). A missense mutation in the homeodomain of pax6b results in small lens, small eye, and retina malformation phenotypes (Kleinjan, Bancewicz, Gautier, Dahm, & Schonthaler, 2008). Studies with mouse and human embryonic stem cells (mESCs and hESCs) demonstrate that overexpression of Pax6 induces the expression of key lens markers including α- and β-crystallins as well as γA-Crystallin or Prox1-expressing lentoid bodies (Anchan et al., 2014). Conversely, Pax6 deficiency in rodents is associated with small eye (Sey) phenotype (Cvekl & Callaerts, 2017; Hogan, Hirst, Horsburgh, & Hetherington, 1988; Roberts, 1967). PAX6 deficiency in humans is associated with several phenotypes including Aniridia, cataract, corneal opacification, glaucoma, anophthalmia, and more (Cvekl & Callaerts, 2017; Glaser et al., 1994; Jordan et al., 1992). Thus, PAX6 is a highly evolutionarily conserved TF that functions as a key molecular control switch in eye development.

Figure 1.2.1: Pax6 deficiency causes eye defects. Pax6 function in eye development is evolutionarily conserved, and deficiency causes eye defects ranging from Drosophila to humans. (A) Deficiency in Drosophila results in a failure of eye formation. Mutations in pax6b in zebrafish causes decreased eye and lens size, and retina malformations. Mutations in Pax6 in mouse results in the “small-eye” phenotype with a failure of eye and nasal pit formation. (B) A compound PAX6 heterozygote proband (nonsense mutations in codons 103 and 353) from a family with a variety of ocular defects was born with microcephaly, bilateral anophthalmia with fused eyelids, and craniofacial defects. Post-mortem analysis revealed a lack of brain hemisphere fusion and a complete absence of the corpus callosum. Figure adapted from Tom Glaser et al., 1994; Hogan, Hirst, Horsburgh, & Hetherington, 1988; Kleinjan et al., 2008; Washington, Haendel, Mungall, Ashburner, & Lewis, 2009.

Figure 1.2.2: Ectopic expression of eyeless/Pax6 induces ectopic eye formation in Drosophila and Xenopus. Scanning electron microscopy of fly with Gal4- system driven ectopic eyeless expression shows ectopic eye formation under the wing (white arrow) and antennae head (white arrowhead) (A, A’). Pax6 misexpression by injection of 160pg of Pax6 mRNA into one blastomere at the 16-cell stage in Xenopus leads to ectopic eyecup (white arrowhead) and lens (black arrowhead) (B). Histology of the Xenopus ectopic eye shows lens (L), ganglion cell layer (G), inner nuclear layer (I), outer nuclear layer (O), and retinal pigmented epithelial layer (P) formation (B’). Figure adapted from Chow et al., 1999 and Halder et al., 1995.

Transcription of Pax6 is under the control of an upstream ectodermal enhancer (EE), which functions in lens induction (Dimanlig, Faber, Auerbach, Makarenkova, & Lang, 2001), a conserved SIMO enhancer, two upstream promoters, referred to as P0 and P1, and an internal promoter (Pα). These promoters give rise to different protein

12 isoforms – the canonical Pax6 protein, the Pax6(5a) isoform which includes a 14 amino acid insertion that disrupts the paired domain’s (PD) DNA-binding abilities, and a truncated version which lacks the PD altogether (Cvekl & Callaerts, 2017; Epstein et al., 1994; Kozmik, Czerny, & Busslinger, 1997). Chromatin immunoprecipitation experiments (ChIP) have demonstrated Pax6 directly regulates key FGF and Wnt signaling components including Fgfr2, Prox1, Dkk3, Wnt7a, among other genes, in the lens (Sun et al., 2015). Pax6 also functions upstream of other key eye TFs including

Foxe3 (Blixt, Landgren, Johansson, & Carlsson, 2007) and crystallin proteins (Cvekl & Callaerts, 2017). This regulation is accomplished through binding of promoter and enhancer sequences – the motifs of which differ between different isoforms of Pax6 carrying the PD, the alternatively spliced PD, and HD (Epstein et al., 1994; Sun et al., 2015).

Figure 1.2.3: Pax6 gene structure and isoforms. (A) The Pax6 mouse locus featuring the P0 and P1 upstream promoters and the Pα and P4 internal promoters. Coding exons are indicated in color and noncoding exons are depicted in black. (B) The structure of the Pax6 and Pax6(5a) isoforms with phosphorylation sites (*) and sumoylation sites (#) marked. Coding exon colors in (A) correspond to protein domains in (B). (C) The binding dynamics and consensus sequences of canonical Pax6 (P6CON), Pax6(5a) (5aCON), Pax6 homeodomain-only (P3), and the site 2-1 sequences which are bound by the homeodomain, PAI, β-sheet, and linker sequences. Figure from Shaham, Menuchin, Farhy, & Ashery-Padan, 2012.

In addition to being expressed in various isoforms with distinct DNA-binding properties, Pax6 has been shown to interact and function cooperatively with the TF Sox2 in a stage-dependent manner to regulate eye development (Smith, Miller, Radice,

Ashery-Padan, & Lang, 2009). Together, these studies demonstrate the versatility in Pax6 DNA-binding ability, with respect to varying protein isoforms as well as cooperative binding mechanisms to activate gene expression. Additionally, Pax6 has been shown to suppress the expression of some targets. This can be accomplished

14 through an indirect inhibition mechanism in which Pax6 directly activates the expression of intronic microRNA miR-204, which then down-regulates multiple targets, including Sox11 (Shaham et al., 2013). Functionally, Pax6 is essential for several key steps in eye lens development. In Drosophila, Pax6 homolog eye ensures correct head formation by promoting the development of eye-antennal disk in early development (Zhu, Palliyil, Ran, & Kumar, 2017). Pax6 null mice fail to develop the optic cup and induce lens formation (Grindley,

Davidson, & Hill, 1995), and Pax6 in the PLE is necessary for lens development and placement of the retina (Ashery-Padan et al., 2000). The requirement of Pax6 in lens placode formation is dosage-dependent (van Raamsdonk, Tilghman, & Camper, 2000). The activation of Pax6 in the PLE is dependent upon the TF Six3 (Liu et al., 2006) and is later sustained by coordinate control by Sox2 and Oct1 (Donner et al., 2007). Following specification and thickening of the lens placode, Pax6-activation of Shroom3 is required for its invagination and apical constriction (Plageman et al., 2010). Shroom3 functions in the apical localization of cytoskeletal components during constriction (Plageman et al., 2010). Later in lens development, Pax6 plays a key role in secondary lens fiber cell differentiation and lens epithelial cell maintenance (Shaham et al., 2009). Lens-specific disruption of Pax6 at E14.5 results in defects in the ability of lens epithelial cells to exit the cell cycle and initiate lens fiber cell differentiation as well as apoptosis in the AEL (Shaham et al., 2009). Conversely, ectopic overexpression of Pax6 under the direction of the αA-crystallin promoter also results in lens fiber cell defects

(Duncan et al., 2004). Specifically, these mice have cataract, incomplete secondary lens fiber cell elongation, cell-to-cell connection disruptions, protein reduction including

15 crystallins, and more (Duncan et al., 2004). Overall, Pax6 is a known key regulator across many stages of lens development. Pax6, itself, is tightly regulated in lens development. It has autoregulatory- functions where it binds to the EE. The EE and SIMO enhancers of Pax6 are also subject to Meis1 and Meis2 regulation (Antosova et al., 2016; Zhang, Friedman, Heaney, Purcell, & Maas, 2002) among other key TFs. Evidence exists in the mouse eyelid for post-transcriptional regulation of Pax6 transcript variants (Shi et al., 2013); however, post-transcriptional control mechanisms of Pax6 in the lens are not well understood.

1.3 iSyTE: A Systems Tool for Predicting Genes that Function in Lens Development Identifying candidate genes critical for lens development and cataract pathogenesis has traditionally relied on linkage and mutational analysis using mouse models and human cases. These approaches are cumbersome, time-consuming and costly. To effectively and efficiently predict promising new cataract-linked genes that function in the lens, Lachke et. al. developed a novel bioinformatics-based tool called iSyTE (integrated Systems Tool for Eye gene discovery) (Lachke et al., 2012). iSyTE is based on comparison of RNA expression data of mouse developmental lens tissue to mouse whole embryonic body tissue (WB) without the lens. This is termed “in silico subtraction” for its analogy to the principle of the “cDNA subtraction” method and allows for the identification of transcripts enriched in lens development, regardless of their absolute expression. The recently updated iSyTE 2.0 version takes advantage of more comprehensive lens expression data, including new embryonic and post-natal stages, as well as including microarray data from gene-perturbation mouse models (Kakrana et al., 2018). This accessible, enrichment-based approach to identifying

16 candidate genes in lens development has proved effective in identification and characterization of several novel cataract and lens-defect associated genes including TDRD7 (Lachke et al., 2011; Tanaka et al., 2011), PVRL3 (Lachke et al., 2012), Caprin2 (Dash, Dang, Beebe, & Lachke, 2015), Sep15 (Kasaikina et al., 2011), Mafg and Mafk (Agrawal et al. 2015), and, most recently, Celf1 (Siddam et al., 2018).

Figure 1.3: iSyTE identifies Celf1 as a candidate gene with highly lens-enriched expression. (A) In iSyTE 2.0, which is based on RNA-sequencing data, Celf1 is identified as highly expressed and lens enriched from E10.5 through E16.5. (B, B’) In iSyTE microarray data, Celf1 is also shown to be highly expressed and enriched in the lens through embryonic and postnatal time points. Based on its high lens-enriched expression (among the top 2-5%-tile of lens expressed genes), iSyTE predicts the RNA- binding protein Celf1 as a high-priority candidate with a potential role in the lens based on both microarray and RNA-sequencing data.

17 As shown in Figure 1.3, Celf1 exhibits highly lens-enriched expression starting from embryonic day E10.5 in mouse.

1.4 Post-Transcriptional Control of Gene Expression in Lens Development and Disease Several of the novel cataract- and lens defect-associated genes identified by iSyTE have been mediators of post-transcriptional control (PTC) of gene expression (Anand & Lachke, 2017; Dash, Siddam, Barnum, Janga, & Lachke, 2016). PTC refers to the modulation of transcripts after transcription and prior to translation into protein. This process includes control of several distinct events such as pre-mRNA capping, splicing, mRNA transport, its stabilization/decay, and translation. While the transcriptional networks controlling lens development are well studied, the function of PTC is less understood. PTC is facilitated by two broad classes of molecules: noncoding RNAs (microRNAs (miRNAs), long noncoding RNAs (lncRNAs)) and RNA- binding proteins (RBPs).

Several non-coding RNAs and the factors involved in their processing are expressed in the lens, suggesting their function in this tissue. Conditional deletion of the enzyme Dicer that functions in miRNA maturation, specifically in the lens and cornea, results in microphthalmia (Li & Piatigorsky, 2009). This suggests a critical role for miRNAs in lens development. As previously discussed, miR-204 is activated directly by Pax6 to mediated the downregulation of several targets, including Sox11

(Shaham et al., 2013). In addition, it was demonstrated that FGF2 regulates several miRNAs – miR-143, miR-155, and miR-301a – which downregulate the key lens TF c- Maf (Wolf et al., 2013). Another miRNA implicated in lens development is miR-184, mutations of which are associated with familial keratoconus and cataract (Hughes et al.,

18 2011). Lastly, lncRNAs have also been implicated as potential regulators of lens development. The lncRNA H19 is upregulated in age-related cataract, and it is a precursor for miR-675 which regulates CRYAA expression (Liu et al., 2018). Overall, noncoding RNAs are important regulators of lens development, but much work remains to be done to identify and characterize specific candidates and their targets in the lens.

1.4.1 RBP-mediated PTC in Lens Development

RBPs have a variety of PTC functions. These include mediation of pre-mRNA capping, and mRNA alternative splicing, polyadenylation, transport and localization, stabilization/decay and translation. Thus, RBPs function in the expression of different splice variants of the same gene, thereby producing different proteins encoded by the same gene. Additionally, RBPs can regulate translation of mRNA to protein, thus controlling the protein dosage produced from various mRNAs. Using iSyTE, our laboratory has identified several RBPs associated with lens defects – Tdrd7, Rbm24, and Caprin2.

TDRD7 was the first predicted RBP found to be associated with cataract in human, mouse, and chicken. A Tdrd7Grm5 mouse, in which ENU-mutagenesis introduced a nonsense mutation producing a null allele, was obtained from a screen for identifying mouse genes linked to ocular defects. Tdrd7Grm5 homozygous mice exhibit posterior cataract, elevated intraocular pressure (IOP), and ganglion cell death (Lachke et al., 2011). Further, this study identified a human family with an inherited recessive TDRD7 mutation and an isolated human case carrying a heterozygous intrachromosomal inversion of chromosome 9 to be associated with congenital or pediatric cataract (Lachke et al., 2011). A second mouse model with targeted Tdrd7

20 germline deletion also exhibits cataracts (Tanaka et al., 2011). Tdrd7 is an RNA-granule component protein that positively regulates the mRNA for Crybb3 and Hspb1 likely through a direct interaction. Thus, Tdrd7 may directly bind and stabilize targets during fiber cell differentiation, and perturbation of this PTC may contribute to the mechanism of cataracts observed in Tdrd7 deficient animals (Lachke et al., 2011).

Another conserved RBP, Caprin2, is also associated with lens defects. Lens- specific conditional knockout of Caprin2 (Caprin2cKO) is associated with Peters Anomaly-like lenti-corneal stalk in a minority of mutants (Dash et al., 2015).

Additionally, the central lens fiber cells are abnormally compact in the majority of Caprin2cKO mice (Dash et al., 2015). Further, our laboratory has recently identified another highly lens-enriched RBP, Rbm24, which functions to control Sox2 expression (Dash et al., in preparation).

21 Further, Rbm24 knock-out mouse exhibits decreased mRNA and protein expression of Sox2 and Lhx2, and decreased protein levels, but not mRNA levels of Pax6 (Dash et al., in preparation). Further, these knock-out mice exhibit microphthalmia and anophthalmia phenotypes (Dash et al., in preparation).

1.5 Celf1 Functions as a Post-Transcriptional Regulator Celf1 is an evolutionarily conserved RBP with three RNA recognition motifs

(RRMs) (Barreau, Paillard, Méreau, & Osborne, 2006; Dasgupta & Ladd, 2012). RRM1 and RRM2 are located near the N-terminal of the protein and preferentially bind a “UGUU” consensus sequence while RRM3, located near the C-terminus, preferentially binds UG repeats (Edwards, Long, De Moor, Emsley, & Searle, 2013). Celf1 can bind target mRNAs at the 5’ or 3’ UTRs, or at exon/intron boundaries to regulate various post-transcriptional processes such as alternative splicing, localization, decay, and translation.

1.5.1 Celf1 Function in Alternative Splicing Generation of distinct mRNA splice isoforms from individual gene loci involves alternative arrangements of exons from pre-mRNA, a process called alternative

22 splicing. CELF1 binds to UG-rich motifs near splice acceptor sites to control alternative splicing in HeLa cells (Xia et al., 2017). Alternative splicing can generate tissue-specific or developmentally relevant splice variants. For example, Celf1 function in alternative splicing is key in the development of heart (Giudice et al., 2014; Ladd, Charlet-B., & Cooper, 2001) and brain (Ladd, 2013). In heart development, Celf1 regulates the transition from embryonic to adult heart muscle through the alternative splicing of cardiac troponin T (cTNT) (Ladd et al., 2001). Further, Celf1 controls the aberrant mRNA splicing of a muscle-specific chloride channel (CIC-1) protein, the loss of which is a feature of myotonic dystrophy (DM1) (Charlet-B. et al., 2002). Celf1, in coordination with hnRNP H, is also shown to control the alternative mRNA splicing of insulin receptor protein in myoblasts (Paul et al., 2006).

1.5.2 Celf1 Function in mRNA Localization RNA-binding proteins function in asymmetric mRNA localization which is critical for embryonic patterning. Celf1 functions similarly in the localization of key mRNAs in Xenopus oogenesis. A recent study utilized RNA affinity purification and co-immunoprecipitation to demonstrate that Celf1 works within the vegetal localization complex that includes the RBPs Stau1, Igfbp2, and Elavl1/2 to localize key vegetal RNAs (Bauermeister, Claußen, & Pieler, 2015). Celf1 depletion or overexpression interferes with the intracellular localization of these mRNAs (Bauermeister et al., 2015).

1.5.3 Celf1 Function in mRNA decay Celf1 can bind GU-rich element (GRE) with one preferred consensus sequence of UGUUUGUUUGU in 3’ UTR of target transcripts to facilitate mRNA decay (Vlasova-St. Louis & Bohjanen, 2011). The role of Celf1 in mRNA decay has been

23 investigated in several cell lines. For example, in HeLa cells, CELF1 facilitates the decay of c-JUN, JUNB, and TNFRSF1B mRNAs (Vlasova-St. Louis & Bohjanen, 2011). In C2C12 mouse myoblast cells, Celf1 is required for rapid mRNA decay of Tnf, Myod1, and Myog mRNAs (Lee, Lee, Wilusz, Tian, & Wilusz, 2010; L. Zhang, Lee, Wilusz, & Wilusz, 2008). Further, Celf1 functions in de-adenylation of target transcripts which leads to destabilization of transcripts, and results in their increased access to 3’ exonucleases. In

Xenopus, the Celf1 ortholog EDEN-BP functions in the deadenylation and subsequent degradation of Eg5 and c-mos maternal mRNAs following fertilization (Paillard et al., 1998). Interestingly, ectopic expression of recombinant human CUG-BP rescued the deadenylation defects associated with EDEN-BP deficiency in Xenopus, suggesting retention of this deadenylation ability (Paillard, Legagneux, & Osborne, 2003). Indeed, in human cells, namely HeLa cells, in vitro deadenylation assays demonstrate that CELF1 recruits poly(A)-specific ribonuclease (PARN) enzyme to facilitate the poly(A) shortening of c-fos and TNFα (Moraes, Wilusz, & Wilusz, 2006). Thus, Celf1 facilitates mRNA degradation through recruitment of deadenylation machinery.

1.5.4 Celf1 Function in Translation The role of Celf1 in mediating translation of target transcripts is evolutionarily conserved. As previously noted, our laboratory recently identified a mechanism where Celf1 binds to the 5’ UTR of cell cycle regulator p27Kip1 mRNA and represses its translation in the lens (Siddam et al., 2018). Previous studies indicated that Celf1- mediated repression of p27Kip1 expression in a human breast cancer cell line occurs via an internal ribosomal entry site (IRES) (Zheng & Miskimins, 2011). Interestingly, another CELF1 target mRNA, namely SHMT1 (Serine Hydroxymethyltransferase 1),

24 also has IRES. However, in this case, CELF1 promotes, rather than represses, IRES- dependent translation by binding the 3’ UTR of the circularized transcript (Fox & Stover, 2009). This demonstrates the context-dependence of Celf1-mediated translational control. In Drosophila, the Celf1 ortholog Bruno has been shown to translationally repress the key posterior-patterning transcript Oskar during oogenesis, prior to its localization to the posterior region of the embryo (Kim-Ha, Kerr, & Macdonald, 1995).

Celf1 has also been shown to recruit the α- and β-subunits of Eukaryotic Initiation Translation Factor 2 (eIF2) to the 5’ UTR of CCAAT/enhancer-binding protein (C/EBPβ) mRNA and increase its translation in proliferating liver cells (Timchenko, Wang, & Timchenko, 2005). In addition to its role in the localization of mRNAs during development, Celf1 also plays an important part in subcellular localization of mRNAs under stress conditions. Studies in HeLa cells have identified CELF1 as a component of stress granules (SGs) (Fujimura, Kano, & Murata, 2008) that function as translational silencing complexes in the presence of environmental stress. Together, these studies indicated that Celf1 mediates translation of target mRNAs, either positively or negatively, depending upon the specific mRNA target and cellular context.

1.5.5 Celf1 in Development and Disease

Celf1 deficiency results in a number of developmental defects across metazoans. In the nematode worm Caenorhabditis elegans, inactivation of a CUG-BP-like protein, etr-1, results in a failure to elongate, paralysis, and embryonic lethality, likely due to a role of etr-1 in muscle development (Milne & Hodgkin, 1999). In Drosophila and

25 Xenopus, Celf1 deficiency causes defective somite segmentation and left-right asymmetric patterning among other developmental defects (Gautier-Courteille et al., 2004; Geraldine et al., 2012). In mouse, Celf1 inactivation results in a number of defects including growth, survival, and spermatogenesis/fertility defects (Kress, Gautier- Courteille, Osborne, Babinet, & Paillard, 2007). Celf1 overexpression studies in mouse demonstrate that Celf1 accumulation inhibits myogenesis, which corresponds with the overexpression of CELF1 in myotonic dystrophy type 1 (DM1) patients (Timchenko et al., 2004). In addition, CELF1 overexpression or deficiency results in cardiomyopathy (Blech-Hermoni, Dasgupta, Coram, & Ladd, 2016). Studies have identified CELF1 targets such as MYH7B in embryonic heart muscle, indicating that CELF1 is a key regulator of cardiomyocytes (Blech-Hermoni et al., 2016). CELF1 protein is also found to be upregulated in human breast cancer tissues and has been implicated in the underlying epithelial-to-mesenchymal transition (EMT) necessary for tumor progression (Chaudhury et al., 2016).

Celf1 has been implicated in numerous developmental programs, and its misregulation is associated with several human diseases including DM1 (Timchenko et al., 2004) and breast cancer (Chaudhury et al., 2016). Thus, a comprehensive understanding of the role of Celf1 in development corresponds with further understanding of it as a potential therapeutic target. Recently, our lab generated lens-specific Celf1 compound conditional knockout mice, hereafter represented as Celf1cKO/lacZKI (described in Siddam et. al. 2018 and in

Materials and Methods). Briefly, germline heterozygous mice generated with beta- galactosidase coding gene lacZ inserted in exon1 of the Celf1 gene are first crossed with Pax6GFPCre+/- mouse to generate a Celf1+/-:Pax6GFPCre+/- mouse line, which is then

26 crossed with exon 5 floxp homozygous (Celf1floxp/floxp) mice to generate Celf1 compound conditional knockout mice (Celf1cKO/lacZKI). This resulted in early-onset cataract in mouse. Further, Celf1 knockdown resulted in cataract and microphthalmia in zebrafish (Danio rerio) and Xenopus laevis, respectively (Siddam et al., 2018).

Celf1-deficient mouse lenses exhibited gaps in the lens representing defective lens fiber cell morphology, and improper retention of nuclei (Siddam et al., 2018). Upon further investigation, our lab identified the molecular mechanism explaining the nuclear degradation defect in Celf1-deficient lenses through PTC of key cell cycle components

27 p27Kip1 and Dnase2b. Specifically, Celf1 directly binds the 5’UTR of p27Kip1 to translationally repress expression, which is necessary for Cdk1 activation in maturing fiber cells, that in turn leads to phosphorylation of LaminA/C and breakdown of the nuclear envelope. This is necessary so that DNA-hydrolyzing nucleases gain access to fiber cell nuclear DNA. Additionally, Celf1 downregulates expression of p21CIP1, and directly binds and stabilizes the mRNA of Dnase2b, allowing for its high level of expression (Siddam et al., 2018). Thus, Celf1 regulates both, the actual DNase

(DNase2b) and its access to fiber nuclear DNA, which are necessary processes for fiber cell nuclear degradation and lens transparency. Further, Celf1 also mediates the alternative splicing of cytoskeletal components Sptb and Actn2, which may partially help explain fiber cell morphological defects (Siddam et al., 2018).

Together, this work identified a novel mechanism for Celf1-associated cataract formation. However, the full extent of Celf1-based control in the lens, especially on epithelial cells, in addition to fiber cells, and on its potential control of key eye TFs were not investigated, which I seek to address.

29 1.6 Celf1 Functions Coordinately with other RBPs, including Elavl1, to Regulate Gene Expression As previously noted, Celf1 functions in coordination with other RNA-binding proteins including within the Xenopus vegetal localization complex (Bauermeister et al., 2015), in stress granules (Fujimura et al., 2008), and in recruiting PARN complex (Moraes et al., 2006) and the translation factor eIF2 (Timchenko et al., 2005). Recent data from our laboratory suggest that Celf1 functions coordinately with another RBP, Elavl1 (also known as HuR), to regulate gene expression of mutual targets in development (Sandeep Aryal, unpublished observations). Elavl1, like Celf1, contains three RRMs and a dimerization domain (Scheiba et al., 2014; Wang et al., 2013). Elavl1 can bind canonical AU Rich Elements (ARE- domains) as well as U-rich RNA motifs (Scheiba et al., 2014; Wang et al., 2013), and can control translation and mRNA stability, both positively and negatively (Fialcowitz- White et al., 2007; Peng, Chen, Xu, & Shyu, 1998). Like Celf1, Elavl1 deficiency results in spermatogenesis defects (Chi et al., 2011) as well as growth and viability defects (Chi et al., 2011; Kress et al., 2007). Additionally, Elavl1, similar to Celf1, inhibits p27Kip translation through its 5’ IRES (Kullmann, Göpfert, Siewe, & Hengst, 2002). Recent studies have identified coordinate regulation between CELF1 and ELAVL1 in the intestinal epithelium. In one case, CELF1 and ELAVL1 were shown to compete for binding at the same MYC 3’ UTR element (Liu et al., 2015). Here, CELF1 binding inhibited translation while ELAVL1 promoted it. In another study, the same antagonistic regulation between CELF1 and ELAVL1 was identified in epithelial barriers regarding E-cadherin expression (Yu et al., 2016). The study demonstrated that CELF1 facilitated recruitment of bound E-cad to processing bodies (PBs) to repress

30 expression, while ELAVL1 prevented this translocation. A similar phenomenon was observed with Occludin mRNA (Yu et al., 2013). While Celf1 alone is critical to development and disease, it likely functions coordinately with many other key regulators such as Elavl1. Understanding the role of Celf1, individually, as well as its relationship with other PTC regulators can provide insight into the normal development of tissues as well as for potential therapeutic targets.

31 Chapter 2

MATERIALS AND METHODS

2.1 Animal Husbandry All animal-related experiments in this study were performed in accordance with the Association for Research in Vision and Ophthalmology (ARVO) statement for the use of animals in ophthalmic and visual research and were approved by the University of Delaware Institutional Animal Care and Use Committee (IACUC) under protocol 1226. Mice were housed at the University of Delaware animal facility in pathogen-free conditions under 14-hour light and 10-hour dark cycle. Mice were generated as previously described (Siddam et al., 2018). Briefly, Celf1 conditional knock out (Celf1cKO/cKO) animals were produced were animals with exon five flanked by LoxP sites (Celf1flox/flox) were crossed Pax6GFPCRE:Celf1+/flox transgenic mouse. This produced animals with lens-specific depletion of Celf1

(Celf1cKO/cKO). To address incomplete deletion in Celf1cKO/cKO animals, germline Celf1lacZKI/+ heterozygotes were crossed with Celf1cKO/cKO animals to produce compound knockout mice with PaxGFPCre+/-:Celf1flox/lacZKI genotypes (referred to as Celf1cKO/laczKI). Embryo ages were determined by designating the day of vaginal plug observation as embryonic day 0.5 (E0.5). Post-natal mouse age was determined by designating the day of birth as post-natal day 0 (P0). Control animals were either

Celf1flox/flox and/or Celf1+/flox which did not exhibit lens defects. Mice older than one month were sacrificed by standard carbon dioxide protocols at a ramp rate of 10% chamber volume/minute followed by cervical dislocation. Newborn to two-week-old

32 mice were sacrificed by decapitation. RNA immunoprecipitation experiments were performed using wild-type C57/Bl6 mouse tissue.

2.2 DNA Isolation and Genotyping Mouse genomic DNA was extracted from tail samples or ear punches using Puregene genomic DNA purification kit (Qiagen, Gentra systems, Catalog no. 158667) according to manufacturer protocol.

PCRs for Celf1 genotyping were set up using the following recipe per reaction: 20.375 µl molecular grade water (Fisher Scientific), 2.5 µl 10x Coral red PCR buffer, 0.5 µl 10µM dNTPs, 0.5 µl 25 µM forward and reverse primers, 0.125 µl Taq polymerase (Qiagen, catalog no. 201207), and 0.5 µl of isolated DNA (approximately 100ng/µl). Celf1 flox PCR reactions were performed with 30 cycles of 94°C for 2 minutes, 94°C for 1 minute, 58°C for 30 seconds, 72°C for 1 minute, and a final extension at 72°C for 5 minutes. Celf1 lacZ PCR reactions were performed with 35 cycles of 94°C for 2 minutes, 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute and a final extension of 72°C for 5 minutes. Cre PCR reactions were performed with 30 cycles of 95°C for 30 seconds, 52°C for 30 seconds, 72°C for 40 seconds, and a final extension of 72°C for 5 minutes. Gel electrophoresis was performed on a 1% agarose gel (The Lab Depot, Catalog no. TLDA1705) with a 100-bp ladder (Fisher Scientific, catalog no. SM0242) to determine the size of the PCR products. The flox homozygous allele is 377 bp (base pairs), while the wild-type amplicon is 321 bp. Celf1 LacZKI heterogenous allele amplicon is 700 bp, while the Celf1 WT is 490 bp. The Cre amplicon is 300 bp.

33 2.3 Immunofluorescence Embryonic head tissue from mouse day E12.5, 14.5, 16.5 and eye tissue from P0 and P10 were fixed in 4% paraformaldehyde (PFA) for 30 minutes on ice and equilibrated overnight in 30% sucrose at 4°C, then mounted in Tissue-Tek® OCTTM (Sakura, catalog no. 4583). Blocks were sectioned on a Leica CM3050 cryostat to produce 16µm-thick sections for indirect immunofluorescence (reagents presented in the Appendix). For cultured cells, cells were plated in six-well plates with coverslips.

When cells were to be stained, media was removed, cells were washed with PBS, and incubated at 4°C with 4% PFA for 15 minutes. Cells were permeabilized with 0.1% Triton-X for 10 minutes and were then subjected to corresponding indirect immunofluorescence protocols. Slides were imaged using either a Zeiss LSM 780 or 880 confocal configured with Argon/Krypton laser (488 nm and 561 nm excitation) and Helium-Neon laser (633 nm excitation) (Carl Ziess Inc). Brightness and contrast optimization were performed in Adobe Photoshop and applied consistently across images.

2.4 Western Blot For cell lines, cells were lysed in cold lysis buffer (50mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% nonidet P40, 0.1% SDS, and 0.5% sodium deoxycholate) and 1X protease inhibitor (Thermofisher Scientific, catalog no. I-78420) and phosphatase inhibitor (Thermofisher Scientific, catalog no. 87785). Lysis buffer was added to culture plates and incubated at 4°C, shaking, for 30 min. Lysates were centrifuged at 14,000 rpm for 30 min at 4°C to remove cellular debris. Protein concentration was determined using the Pierce BCA protein kit (Thermofisher Scientific, catalog no. 23227) according to the manufacturer’s protocol. Equal amounts of total protein were resolved on either

34 manually poured 1.5mm 4% stacking/10% resolving polyacrylamide gels or TGX stain free polyacrylamide gels (Biorad, catalog no. 4568094) and transferred to a PVDF membrane (Thermofisher Scientific, catalog no. 88518). Blots were blocked with 5% non-fat blocking grade buffer (Biorad, catalog no. 170-6406EDU) for 1.5 hr at room temperature and incubated with primary antibody (Celf1 ab-9547 1:1000 dilution) overnight at 4°C. Blots were washed in 1X TBS-T and incubated with secondary antibodies conjugated to horseradish peroxidase for 1.5 hr at room temperature, and the signal detected with SuperSignalTM West Femto Maximum Sensitivity Substrate (Thermofisher Scientific).

2.5 RNA Isolation and Reverse Transcriptase Quantitative PCR Two lenses each for three biological replicates were collected from stage P7 control and Celf1cKO/lacZKI mice and total RNA was extracted using RNeasy mini kit (Qiagen, catalog no. 74104). Briefly, lenses were homogenized in provided RLT buffer.

Equal volumes of 70% molecular grade ethanol were added to the lysate and mixed by pipetting before adding to the Qiagen RNeasy Mini spin column and centrifuged for 30 seconds. Buffer RW1 was added to the column to wash the membrane-bound RNA and centrifuged briefly. Buffer RPE was added twice to further wash the column, and RNA was eluted with nuclease-free water. Concentration was determined using ND-1000

UV-Vis Spectrophotometer (Nanodrop Technologies; Software V3.8.1) and RNA was stored at -80°C. cDNA was synthesized using total RNA following the manufacturer’s protocol (iScript cDNA synthesis kit, Bio-Rad, catalog no. 1708891). Reverse-transcriptase PCR recipe for each reaction was 20.375µl nuclease-free water, 2.5µl Coral red buffer, 0.5µl 10µM dNTP, 0.5µl 10µM forward and reverse primers, 0.5µl cDNA, and 0.125µl Taq polymerase. The PCR thermocycler program

35 was 2 minutes at 94°C and 40 cycles of 94°C for 15 seconds, 58°C for 30 seconds, 72°C for 30 seconds, and 72°C for 30 seconds, and a final extension of 72°C for 7 minutes. PCR products were analyzed on a 1% agarose gel. RT-qPCR was performed as described on the aBI73000 Real-Time PCR system (Applied Biosystems) using Power Sybr Green PCR master mix (Invitrogen Life Technologies, catalog no. 4367659). Transcript levels were normalized to Gapdh, differential expression was determined using the ΔΔCT method and statistical significance determined using a nested ANOVA.

2.6 RNA Immunoprecipitation (RIP) Assay RIP protocol was performed according to manufacturer instructions (EMD Millipore, catalog no. 17-700). Briefly, fifteen to twenty wild-type lenses were isolated from P15 animals. Lenses were washed once in 1x PBS and homogenized in cold lysis buffer with protease and RNase inhibitors added. Magnetic beads were washed in supplied RIP wash buffer and incubated with 5µg of respective Elavl1 or Celf1 RIP antibody for 45 minutes at room temperature, followed by three washes in RIP Wash buffer. RIP immunoprecipitation buffer was prepared according to the manufacturer’s protocol and beads resuspended in it. Lens lysate was added to the antibody complex and incubated overnight at 4°C.

The following day, samples were washed six times with RIP wash buffer. Proteinase K buffer was added to samples and incubated at 55°C for 30 minutes.

Samples were then centrifuged, and RNA-containing supernatant collected. 500µl of 25:24:1 (v/v) phenol:chloroform-isoamyl alcohol was added, samples were vortexed, and then centrifuged at 14,000 rpm for 10 minutes in room temperature. The aqueous phase was then collected, and 400µl of chloroform was added, samples were vortexed

36 and centrifuged at 14,000 rpm for 10 minutes at room temperature. The aqueous phase was collected, and absolute ethanol, manufacturer supplied Salt Solution I, Salt Solution II, and precipitate enhancer were added. Samples were mixed and kept in -80°C overnight to precipitate RNA. The following day, samples were centrifuged at 14,000 rpm for 30 minutes in 4°C. The supernatant was discarded, and the pellet was washed once in 80% ethanol, followed by centrifugation at 14,000 rpm for 15 minutes at 4°C. Pellet was air-dried and resuspended in 20µl of RNase-free water. Samples were stored at -80°C for downstream analysis.

2.7 Cell Culture The mouse lens epithelial cell line 21EM15, the human lens epithelial cell line SRA01/04, and the mouse fibroblast cell line NIH3T3 were cultured under standard conditions in 10 mm cell culture treated plates (Eppendorf, catalog no. 0030702115).

DMEM media with 4.5 g/L glucose, L-glutamine, and sodium pyruvate included (Corning Cellgro, Manassas VA, Catalog no. 10-013-CV), 10% Fetal Bovine Serum (Fisher Scientific, Pittsburg, PA, catalog no. 03-600-511), and 1% Penicillin- Streptomycin (GE Healthcare Life Sciences, Logan, UT, catalog no. SV30010). Cells were incubated at 37°C and 5% CO2.

2.8 Celf1 Knock-Down and Overexpression Cell Lines

Celf1 stable knockdown (KD) cell lines were generated previously and described by Siddam et al., 2018. Briefly, five different lentiviral particles containing shRNA targeting Celf1 were used to transduce cells as well as non-targeting shRNA control particles. Cells were infected using standard manufacturer protocol and clones

37 were selected at a final concentration of 6µg/ml puromycin and knock-down determined by Western blot. Transient Celf1 KD was performed in SRA01/04 cell lines using siRNAs targeted to human CELF1 (Santa Cruz, catalog no. sc-38251), siRNA transfection media (Santa Cruz, catalog no. sc-36868), siRNA Transfection Reagent (Santa Cruz, sc-29528). Controls were non-targeting siRNAs (Santa Cruz, catalog no. sc-37007). Transfections were performed according to the manufacturer’s protocol. Briefly, cells were plated in six-well plates. At approximately 70% confluency, 80 mM of siRNA in 100µl of transfection media was mixed with transfection reagent diluted in media for 30 minutes and then added directly to cells. After six hours, 1 mL of 2x media (doubled antibiotics and FBS) was added and cells. After 24 hours, media was replaced with normal 1x media, and cells were analyzed a further 24 hours later. Celf1-knockdown was confirmed by performing western blot analysis using a rabbit monoclonal anti- Celf1 antibody (Abcam, catalog no. Ab129115).

Transient Celf1 overexpression was performed in 21EM15 and NIH3T3 cell lines. Overexpression vector was generated previously (Siddam et al., 2018). Transfection was performed with Lipofectamine 3000 reagent (Thermofisher Scientific, catalog no. L3000008) according to the manufacturer’s instructions with 7.5µL of lipofectamine and 4µL of lipofectamine per well in a six-well plate for 21EM15 and NIH3T3, respectively. 4µg of Celf1 overexpression vector was used per well, with 1µg of reporter vector.

2.9 Luciferase Reporter Assays To test translational repression of Pax6 expression, the first 920 bps of the Pax6 3’ UTR (NCBI Nucleotide Database, NM_001244198.2 nucleotides 1596-2517) was

38 cloned downstream of firefly luciferase in the pmirGLO Dual-Luciferase reporter vector (Promega, catalog no. E1330). The vector was then confirmed by Sanger sequencing. This vector was transfected into Celf1-knockdown and control cell lines as well as co- transfected with Celf1 overexpression vector into 21EM15 and NIH3T3 cell lines using Lipofectamine 3000 (Thermofisher Scientific, catalog no. L3000008). After 48 hours lysate was collected and dual luciferase quantification performed using Promega Dual- luciferase reporter assay system (Promega, catalog no. E1910) and the PromegaTM

GloMaxTM 20/20 Luminometry System (Promega, Madison, WI). Luciferase signals were normalized by dividing firefly luciferase activity by Renilla luciferase activity.

39 Chapter 3

RESULTS

3.1 Pax6 Protein, but not RNA, is Mis-Expressed in Celf1 Knock-out Lenses To uncover a potential role for Celf1 in controlling the expression of key TFs in lens development, I examined the expression of the critical eye development regulator Pax6 in Celf1cKO/lacZKI lenses and control at multiple embryonic and post-natal stages

(Figure 3.1.1).

Figure 3.1.1: Pax6 protein is abnormally upregulated in Celf1cKO/lacZKI lenses during development. Compared to control, Celf1 protein is notably upregulated in both, the lens epithelium and fiber cells, at E14.5 (A, A’), and markedly upregulated at E16.5 (B, B’), P0 (C, C’) and P10 (D, D’). In addition to the stronger signal intensity, Pax6 appears to be expressed beyond its normal expression pattern restricted to early differentiating fiber cells and is now detected well beyond the transition zone, and deep in maturing fiber cells in Celf1cKO/lacZKI lenses. Scale bar = 300µm. e = epithelium, f = fiber cells, tz = transition zone, asterisks denote abnormal Pax6 expression in fiber cell nuclei.

40 To understand whether Pax6 protein overexpression in Celf1cKO/lacZKI lenses results from elevated Pax6 mRNA levels, total RNA was collected from stage P7 control and Celf1cKO/lacZKI lenses and RT-qPCRs performed to examine Pax6 mRNA expression. There was no significant difference in Pax6 mRNA expression between Celf1cKO/lacZKI and control lenses (Figure 3.1.2).

This data indicates that Celf1 regulates Pax6 protein expression, but not mRNA expression in the lens. To further investigate the potential control mechanism, Celf1

41 stable knock-down (KD) and control mouse lens epithelial cell lines were examined for differences in Pax6 protein expression (Figure 3.1.3). Immunostaining and western blot analysis demonstrate that, as expected, Pax6 protein is upregulated in Celf1-KD cells. Furthermore, RT-qPCR with these Celf1 KD and control cell lines also show no significant difference in Pax6 mRNA level, in agreement with the data obtained on lens tissue (Figure 3.1.4).

Figure 3.1.4: Pax6 mRNA expression is not significantly different between control and Celf1 knockdown cell lines. RNA was extracted from Celf1 KD and control cell lines in biological triplicates. cDNA was synthesized, and RT- qPCR analysis performed in technical triplicates with Pax6 primers. There was no significant difference in Pax6 mRNA expression between Celf1 KD and control cell lines. n=3 biological replicates with 3 technical replicates. Fold change calculated using the ΔΔCT method and statistical significance was analyzed using a nested ANOVA.

Based on this data, we hypothesized that Celf1 controls Pax6 protein expression, possibly through post-transcriptional control mechanisms involving translational repression.

43 3.2 Celf1 Protein Binds Pax6 RNA at the 3’ Untranslated Region The above data suggests that Celf1 protein may mediate post-transcriptional control over Pax6 mRNA. To determine if Celf1 protein interacts with Pax6 mRNA in the lens, I performed an RNA-immunoprecipitation (RIP) assay with P15 wild-type lens lysate followed by RT-PCR. Pax6 mRNA was enriched in RIP with Celf1-specific antibody compared to that performed with IgG non-specific control (Figure 3.2.1). This indicates that Celf1 protein binds Pax6 mRNA in the lens.

Figure 3.2.1: Celf1 RNA immunoprecipitation assay followed by RT-PCR demonstrates that Celf1 protein binds Pax6 mRNA in P15 wild-type mouse lens. Lenses from three P15 wild-type mice were isolated. Celf1 protein and its associated mRNA was isolated by incubation with anti- Celf1 mouse monoclonal antibody-coated beads in the presence of RNase inhibitors. For negative control, non-specific anti-IgG rabbit monoclonal antibodies were used. For positive control, no antibody purification step was performed, and total RNA was used (input). Following washes and protein degradation, RNA was isolated by phenol:chloroform extraction. cDNA was synthesized, and enrichment of Pax6 transcript was detected by RT-PCR with Pax6 primers. RT-PCR products were separated on a 1% agarose gel by gel electrophoresis, and Celf1 RIP was enriched for Pax6 transcript as compared to the IgG control. n=3 biological replicates.

44 To determine the mechanism by which Celf1 regulates Pax6 protein expression, I next bioinformatically analyzed the transcript variants of Pax6 to predict potential Celf1-binding sites (Figure 3.2.2).

This analysis reveals that, depending on the transcript variant, Celf1 could interact with both the 5’ or 3’ UTRs (untranslated regions). To determine which

45 untranslated region was of interest, I attempted to amplify full-length 5’ UTRs from control and Celf1cKO/laczKI lens cDNA. This revealed that variants 3 and 5, 7, and 8 were not strongly expressed – only the 5’ UTRs of variants lacking predicted Celf1 binding sites were present in the lens (Figure 3.2.3). This pattern was unchanged in Celf1cKO/lacZKI lenses. This was furthered confirmed with 5’ UTR RT-PCR primers with smaller amplicons (<300bp) (data not shown). This suggests that Celf1 was interacting with Pax6 through the 3’ UTR.

46 To further investigate Celf1 binding of transcript variants, RT-PCR on Celf1 RIP cDNA was performed using full-length 5’ UTR primers. This confirmed that Celf1 interacted with transcript variants lacking predicted binding sites in the 5’ UTR (Figure 3.2.4). This further suggested that the RNA regulatory region of interest for Celf1- mediated control of Pax6 protein expression was the 3’ UTR.

Figure 3.2.4: Celf1 RIP RNA is enriched for the 5’ UTR of Pax6 transcript variants with Celf1 binding sites in the 3’ UTR, only. Celf1 and its mRNA targets were isolated from P15 wildtype lenses through RNA-Immunoprecipitation using anti-Celf1 mouse monoclonal antibody. Following cDNA synthesis, RT-PCR was performed with 5’ UTR variant primers. The RIP assay was enriched for the 5’ UTRs of variants 1 and 4, 2 and 6, only. Thus, the Pax6 transcripts that Celf1 interacts with in the lens are those which contain predicted Celf1 binding sites in the 3’ UTR.

47 While investigating this mechanism at the University of Delaware, our collaborators in France, led by Professor Luc Paillard, performed cross-linking immunoprecipitation (CLIP) assays for Celf1 in 21EM15 lens epithelial cell lines and in lens lysates, followed by RNA-sequencing of pulled-down, direct targets. This assay independently identified Pax6 as a direct target of Celf1 binding and identified the most likely binding region and motif in the 3’ UTR, in agreement with my data above (data not shown).

Together, these data demonstrate that distinct transcripts lacking Celf1 binding sites in the 5’ UTR are expressed in the lens and that Celf1 binds Pax6 mRNA in the mouse lens. This data also identifies the most likely binding region in the 3’ UTR of Pax6.

3.3 Celf1 Exerts Translational Control over Pax6 by Binding to its 3’UTR To determine the mechanism by which Celf1 regulates Pax6 expression through interacting with its 3’ UTR, I performed a luciferase reporter assay. Our collaborators in France, led by Professor Luc Paillard, performed a CLIP-seq that identified a likely Celf1 binding site in the 3’ UTR of Pax6 mRNA. Mouse Pax6 3’UTR sequence spanning 920 nucleotides, including the predicted binding sequence, was cloned downstream of the firefly luciferase sequence in the pmirGLO dual luciferase vector

(Promega, catalog no. E1330). Stable Celf1 knockdown and control cell lines were transfected using Lipofectamine 3000 (Thermofisher Scientific catalog no. E3000008) and after 48 hours, luciferase expression was quantified using Promega Dual Luciferase assay kit. Luciferase expression was normalized by dividing firefly luciferase activity by Renilla luciferase activity. Normalized expression was significantly higher in Celf1 KD cells as compared to control (Figure 3.3.1).

This data suggests that Celf1 functions by translationally repressing Pax6 through interacting with its 3’ UTR. However, further analysis demonstrated inconsistent normalized expression of empty pmirGLO backbone vector in Celf1 KD and control cell lines. In order to ensure the results above are not due to intrinsic differences in promoter activities between the stable Celf1 KD and control cell lines, I repeated the assay with transient overexpression of Celf1 in 21EM15 lens epithelial and

49 NIH3T3 fibroblast cell lines. In 21EM15 transient Celf1 overexpression cell lines, Pax6 protein was reduced (Figure 3.3.2).

Figure 3.3.2: 21EM15 Celf1 Transient Overexpression Cell Lines Exhibit Reduced Pax6 Protein Expression. 21EM15 cell lines were transfected with full- length Celf1 coding sequence-containing expression vector. After 48 hours protein was collected for analysis. (A) Western blot with anti-Celf1 rabbit monoclonal antibody confirms successful overexpression of Celf1. (B) In these transient Celf1 overexpression lens epithelial cells, western blot with anti-Pax6 rabbit monoclonal antibody demonstrates reduced Pax6 protein expression.

50 The Pax6 partial 3’ UTR luciferase assay was repeated by co-transfecting the reporter vector with the Celf1 overexpression vector into 21EM15 lens cells. Relative luciferase expression was significantly downregulated in Celf1 overexpression cell lines (Figure 3.3.3), however, empty vector controls were again significant.

51 Given the significant variation in control samples for 21EM15 stable KD, and transient overexpression cell lines, I attempted to use a different cell line for the luciferase assay. NIH3T3 fibroblasts were co-transfected with Celf1 overexpression and Pax6 partial 3’ UTR luciferase reporter vectors, and relative expression was compared with controls. Surprisingly, relative expression was upregulated in NIH3T3 Celf1 overexpression cell lines as compared to controls with a p-value of 0.06, indicating positive regulation of translation (Figure 3.3.4). In this case, empty vector controls were not significantly different with a p-value of 0.88.

Figure 3.3.4: Pax6 Partial 3’ UTR Luciferase Assay in NIH3T3 Celf1 Transient Overexpression and Control Cells. Luciferase reporter vector containing the first 920 nt of the Pax6 3’ UTR was transfected into NIH3T3 fibroblast cells either by itself (control) or with a Celf1 overexpression vector (Celf1 overexpression vector). Luciferase activity was analyzed 48 hours following transfection. In Celf1 transient overexpression fibroblast cells, relative luciferase expression is upregulated as compared to controls, differing directionally from the effect of Celf1 in lens cells. n=3 biological replicates. p-value was calculated using an unpaired t-test.

Overall, this data suggests that Celf1 functions by translationally repressing Pax6 expression via binding its 3’ UTR, but this translation is context-dependent and differs in non-lens cells. However, given the significance of variation between empty-

53 vector controls, further experimentation is necessary to reach conclusions on this regulatory mechanism.

3.4 Co-immunostaining Reveals Potential Celf1 and Elavl1 Colocalization As previously noted, Celf1 is known to coordinately function with other RBPs to synergistically or antagonistically mediate alternative splicing or translation of its targets. In order to investigate Celf1 binding partners in the lens, our laboratory previously performed mass spectrometry on 21EM15 lens epithelial cells and on mouse lenses to identify potential co-regulators. This assay identified the RBP Elavl1 as a potential Celf1 protein-protein binding partner (Sandeep Aryal, unpublished observations). iSyTE identifies Elavl1 as a highly lens expressed, though not lens- enriched, gene in the lens development. (Figure 3.4.1).

Further analysis including a co-immunoprecipitation in 21EM15 cell lines (Figure 3.4.2) suggesting that Celf1 and Elavl1 may function coordinately in the lens. This was performed using a rabbit monoclonal antibody to isolate Celf1 and its binding partners. Following isolation, immunoblotting using a mouse monoclonal antibody against Elavl1 was used to demonstrate relative enrichment in the Celf1-pulldown as compared to the nonspecific IgG control.

To further investigate potential Celf1/Elavl1 interaction in vivo, I performed co- immunostaining of Celf1 and Elavl1 on wild-type E16.5 mouse lenses (Figure 3.4.3). This assay demonstrates that Elavl1 protein is expressed in the mouse lens and shows some potential co-localization with Celf1 protein in both, the nucleus and the cytoplasm.

57 The function of Elavl1 in the lens is unknown, and whether it functions with Celf1 coordinately to regulate mRNA targets in this tissue remains to be answered.

3.5 Elavl1 Binds Pax6 RNA in the Lens In order to further understand if Celf1 and Elavl1 function coordinately in the lens, I sought to determine if they shared common mRNA targets. As denoted in Figure 3.2.2, the Pax6 3’ UTR contains ARE-binding sites, as well as CUG-binding sites.

Elavl1 is known to bind to canonical ARE-binding sites (Wang et al., 2013), therefore it is plausible that Elavl1 also interacts with Pax6 mRNA in the lens. Therefore, I performed a RIP assay followed by qPCR for Pax6 (Figure 3.5.1).

Figure 3.5.1: Elavl1 RIP RNA from wild-type mouse lenses is enriched for Pax6 mRNA compared to IgG control. Elavl1 protein and its associated mRNAs were isolated from P15 lenses in biological triplicates using an anti-Elavl1 rabbit monoclonal antibody. For negative controls, a non-specific IgG antibody was used. For positive controls, total RNA was isolated (input). Following protein degradation, phenol:chloroform RNA extraction, and cDNA synthesis, RT-PCR was performed with Pax6 primers. Pax6 mRNA is enriched in Elavl1 RIP compared to IgG control. This demonstrates that Elavl1 interacts with Pax6 mRNA in the lens.

58 This data reveals that Elavl1, similar to Celf1, binds Pax6 mRNA in the mouse lens, thus identifying a new RBP regulator in the lens. Whether this interaction has a functional relevance requires further experimentation. However, based on the described data in this thesis, a mechanism can be proposed as presented in Figure 3.5.2, in which Celf1 and Elavl1 function coordinately to control the translation of Pax6 mRNA, which is important for controlling its levels and spatio-temporal expression pattern in lens development.

59 Chapter 4

DISCUSSION

4.1 Conclusions Post-transcriptional control (PTC) of gene expression is generally understudied, especially when compared to transcriptional control mechanisms. Yet, nearly all mRNA undergoes some sort of PTC associated with splicing, transportation, translational control, or stability. RBPs are key mediators of these processes. Given the nature of ocular lens development, in which mature lens fiber cells undergo drastic changes in gene expression and cellular morphology while simultaneously undergoing nuclear degradation that compromises their transcriptional capabilities, our laboratory hypothesizes that RBP-mediated PTC is important to spatio-temporally control the levels of protein translated from specific mRNAs in lens development. Understanding the importance of RBPs in lens development and pathology offers new insights into the control of development and maintenance of lens transparency. The application of iSyTE as a bioinformatics systems tool to identify candidate genes important for lens development has been very successful. Regarding the elucidation of key RBPs in the lens, our laboratory has contributed significantly. Previously, Lachke et al., 2011 identified the first RBP, TDRD7, found to be necessary for lens development and whose deficiency causes cataract in chicken, mouse, and human. Next, Dash et al., 2015 demonstrated that deficiency of another evolutionarily conserved, lens-enriched RBP, Caprin2, causes eye defects, including Peters anomaly, at variable penetrance (Dash et al., 2015). Then, Siddam et al., 2018 demonstrated that deficiency of the conserved RBP Celf1 causes cataract in fish, frog, and mouse. This publication elucidated the role of Celf1 in mediating nuclear degradation, but the role

60 of Celf1 in regulating key TFs was not addressed. It is clear that RBPs and PTC are important to lens development, but connections between the PTC network and the well- studied transcriptional network have not been investigated. Additionally, while it is well understood that TFs can act combinatorically to modulate the expression of targets, less is known of coordinate functioning of multiple RBPs. Here, I sought to interrogate the regulatory connection between Celf1-mediated PTC and transcriptional networks, as well as examine the potential combinatorial control modulated by multiple RBPs in the lens. In summary, immunostaining of Celf1cKO/lacZKI lenses indicated that Pax6 protein levels are abnormally overexpressed and spatio-temporally misregulated, while RT- qPCR demonstrates that Pax6 mRNA levels remain unchanged. This pattern in recapitulated in vitro in Celf1 stable knockdown compared to control cell lines. RNA- immunoprecipitation (RIP) and cross-linked immunoprecipitation (CLIP) assays demonstrate that Celf1 protein binds Pax6 mRNA. The CLIP assay shows high levels of interaction in the Pax6 3’ UTR and identifies the likely binding region. Partial Pax6 3’ UTR luciferase assays in 21EM15 mouse lens epithelial Celf1 stable knockdown cell lines, combined with studies on Celf1 transient overexpression, suggest that Celf1 represses Pax6 translation through binding of its 3’ UTR. However, the 21EM15 Celf1

KD and overexpression cell lines have significant differences for the empty backbone controls. Therefore, this data needs to be followed up to reach a solid conclusion in this cell line. This issue is not observed in NIH3T3 fibroblast cells, in which relative luciferase expression of the Pax6 partial 3’ UTR reporter is upregulated with Celf1 overexpression. In this case, empty vector controls are not significantly different. This

61 suggests a context- and cell-type dependent Celf1 translational control mechanism that operates through this region of the Pax6 3’ UTR. Additionally, this study identifies a new RBP regulator, Elavl1 protein, which also interacts with Celf1 protein and Pax6 mRNA in the lens. Mass spectrometry identified Elavl1 as a candidate for the Celf1 protein interactome and co-IP in an established mouse lens epithelial cell line further suggests that Elavl1 and Celf1 exhibit protein-protein interactions. These two proteins have been shown to coordinately and antagonistically control the expression of target mRNAs in other systems (Liu et al., 2015; Yu et al., 2016), and this interaction may be conserved here. Bioinformatics analysis predicted ARE motifs that support both Celf1 and Elavl1 binding, in the Pax6 3’ UTR. Elavl1 RIP demonstrates that Elavl1 protein interacts with Pax6 mRNA in the lens. However, the functional outcome of this interaction remains unaddressed. This study describes a potentially novel Celf1-mediated, possibly in combination with Elavl1, PTC mechanism controlling the expression of the key lens TF

Pax6 in lens development. This is one of the first reported mechanisms of RBP-mediated PTC of this key TF, thus contributing to understanding dosage and spatio-temporal control of Pax6 expression in lens development. Dosage of Pax6 protein expression must be heavily regulated. While Pax6 deficient mouse models exhibit small eye phenotypes, increased copy number of Pax6 also causes a variety of eye defects including microphthalmia (Figure 4.1.1) (Schedl et al., 1996).

Further, Pax6 expression is both required for lens fiber cell morphogenesis (Shaham et al., 2009), but ectopic expression results in fiber cell differentiation defects, including gaps in the lens (Duncan et al., 2004). Thus, the level and dosage of Pax6 expression must be tightly regulated in lens development and maintenance. In addition to dosage regulation, the spatio-temporal expression patterns of Pax6 must also be tightly regulated.

Figure 4.1.2: Spatio-temporal expression analysis of Pax6 through mouse lens development. Pax6 protein (A-D) and mRNA (A’-D’) visualized using immunofluorescence and in situ hybridization, respectively. During lens induction (E8.5; A, A’), Pax6 protein and mRNA are expressed in the optic vesicle (ov) and presumptive lens ectoderm (ple). Then, following the thickening of the ple to form the lens placode (lp) (E9.5; B, B’), Pax6 protein expression is enriched in the lp as compared to the underlying ov, while the mRNA expression levels remain broad. At E10.5 (C, C’) Pax6 protein expression is confined to the lens vesicle (lv) and reduced in the posterior presumptive retina (pr), but still expressed in the nasal and temporal regions. The mRNA expression is similar, though with less exact demarcations. In E18.5 lenses (D), Pax6 protein is expressed highly in the lens epithelium (epi) and is nearly undetectable in the transition zone (t) and fiber cells (fib). (D’) The mRNA expression levels are somewhat similar. However, despite a decrease in mRNA expression in the transition and fiber cell regions, Pax6 mRNA is still detectable where protein expression is not. D, D’ scale bar = 100 µm. Figure adapted from Duncan et al., 2004, Smith et al., 2009, and Wawersik & Maas, 2000.

64 As shown in panels A-D in Figure 4.1.2, Pax6 protein exhibits specific expression patterns throughout embryonic lens development. It is highly expressed in both the presumptive lens ectoderm and optic vesicle at E9.5, but becomes more restricted to the lens placode and lens vesicle rather than the underlying optic cup/presumptive retina later (Smith et al., 2009). In chick, knock-down of Pax6 by morpholinos at Hamburger- Hamilton (HH) stage 10 in the optic vesicle resulted in no optic cup formation, while knock-down at HH stage 11 resulted in a structurally normal optic cup (Canto-Soler &

Adler, 2006). This work highlights the importance of Pax6 expression in a specific spatio-temporal pattern. In more mature lenses, Pax6 protein is expressed in the epithelial cells but is almost undetectable in the transition zone and fiber cells (Duncan et al., 2004). However, as shown in D’ of Figure 4.1.2, the mRNA, while decreased, is still detectable in these regions (Duncan et al., 2004). Overexpression of Pax6 in these regions results in lens fiber cell defects, as previously described (Duncan et al., 2004). The mechanisms that allow for these precise spatio-temporal expression patterns and the dosage control of Pax6 are not well understood. The RBP-based mechanism proposed in Figure 3.5.2 provides insight into how this might be accomplished at a post-transcriptional level for the first time. Celf1, possibly in coordination with Elavl1, functions to inhibit translation of Pax6. This fine-tuning of protein expression allows for the proper level of Pax6 protein expression, in the proper cell type, during a specific time, leading in proper lens development and morphogenesis.

Further, this model provides an interesting inter-regulatory network feedback in which and RBP modulates the expression of a TF, which can then modulate expression of other RPBs and TFs, and so on. Often, transcriptional gene regulatory networks

65 (GRNs) are discussed separately from PTC networks. However, more realistically and as demonstrated here, crosstalk is likely high between the two – especially as cells undergo complex changes.

66 4.2 Future Directions While this study successfully elucidated a novel RBP-mediated PTC mechanism of Pax6 expression in the lens, specific questions remain, and further confirmation are needed. Specifically, an RNA electrophoretic mobility shift assay (RNA EMSA) in which labeled RNA probes containing predicted RNA-binding protein target motifs from the Pax6 3’ UTR and purified Celf1 or Elavl1 protein are mixed to test and potentially demonstrate direct binding would provide conclusive confirmation of their binding sites. In addition, bioinformatics analysis identifies multiple predicted Celf1 protein-binding sites in the Pax6 3’ UTR, which were not all present in the luciferase reporter vector used here, and thus remain untested. Full-length Pax6 3’ UTR reporter assays may provide further insight into the translational control mechanism. In addition, the problem of significant empty vector controls in the Celf1 KD and overexpression 21EM15 mouse lens epithelial cells should be addressed. It is possible that this difference may be due to the presence of a 3’ UTR downstream of the Renilla CDS, while one is not present downstream of the firefly luciferase. Thus, there is no 3’UTR regulatory region that can be subject to more ubiquitous RBP regulation. Therefore, a different control experiment can be performed by cloning a control 3’ UTR downstream of the firefly luciferase that Celf1 cannot bind. Further, transcript variants were differentiated based on their 5’ UTR. However, this disregarded the differences in coding sequence between transcripts with identical 5’ UTRs, specifically the expression patterns of canonical Pax6, and the Pax6(5a) isoform. The relative ratios of canonical

Pax6 to Pax6(5a) isoform expression is subject to PTC in the developing eyelid (Shi et al., 2013), however, the mechanism is not understood, and it is unknown if this occurs in the lens.

67 Further, questions remain about the translational application of Celf1-deficiency related cataract in the mouse, to human pathology. We have generated transient CELF1 knockdown in a human lens epithelial cell line, SRA01/04. We are in the process of analyzing any changes to PAX6 protein expression in these cell lines. In order to further understand the effects of CELF1 deficiency in human lens epithelial cells, RNA from SRA01/04 cells with transient siRNA mediated KD of CELF1 or control siRNA were collected and subjected to RNA sequencing. While this data will potentially provide new insights into the role of Celf1 in the lens, more work is needed to understand the coordinate role of Celf1 along with Elavl1 protein. Recently, we have begun generating a stable Elavl1 KD cell line in 21EM15 mouse lens epithelial cells. Additionally, we will continue to perform luciferase reporter assays and assess protein expression with combinations of Celf1 and Elavl1 siRNA mediated KD or their overexpression to assess how these combinations affect reporter activity and Pax6 protein expression. Further, it is entirely possible that Celf1 or Elavl1 proteins may control the alternative splicing of Pax6 and other targets as well as control translation. Indeed, while Pax6 alternative splice isoforms have been described nearly two decades ago, the factors controlling their expression are still unknown. A recent preprint demonstrates that CELF1 and ELAVL1 interact in the cell nuclei and co-control splicing of targets in HeLa cells (Geraldine et al., 2018). Interestingly, the co- immunofluorescence data shows high overlap in the nuclei of E16.5 wild-type mouse lens. Overall, the function of Elavl1 in lens development is not addressed.

Recently, our laboratory obtained a mouse model with floxp sites flanking the Elavl1 exons 2 through 5, which are being crossed with the Pax6GFPCre mouse line to generate lens-conditional Elavl1 knock-out mouse (Elavl1cKO). This will allow us to

68 investigate the impact of Elavl1 deficiency on the lens in mouse. By comparing these lenses with Celf1cKO/lacZKI lenses, as well as analyzing the single and double KD cell lines, we will better understand this combinatorial control mechanism in addition to the functional contributions made by these RBPs individually. In intestinal epithelial cells, Celf1 and Elavl1 coordinately and antagonistically regulate multiple transcripts (Liu et al., 2015; Yu et al., 2013; Yu et al., 2016). If this mechanism is conserved in the lens, it is possible that Celf1 and Elavl1 regulate other key target transcripts in addition to Pax6, in the lens, which can be further investigated. p27Kip is a promising target of Elavl1 and Celf1 combinatorial control. Our laboratory demonstrated Celf1-mediated translational repression of p27Kip1 in the lens through the 5’ UTR (Siddam et al., 2018) and Elavl1 represses p27Kip1 translation through the 5’ UTR IRES element (Kullmann et al., 2002), representing a possible synergistic RBP-combinatorial control. Further, Prox1 is another key homeodomain-TF in the lens, whose deficiency causes lens fiber cell elongation and differentiation defects (Audette et al., 2016; Wigle, Chowdhury, Gruss, & Oliver,

1999). Data from our laboratory demonstrates that Elavl1 and Celf1 bind and regulate Prox1 in a similar manner as described for Pax6 (Aryal et al. unpublished observations), suggesting a conserved RBP-combinatorial control mechanism on the post- transcriptional level over multiple TFs in the lens.

Overall, my research demonstrates a novel molecular mechanism underlying cataract pathology in Celf1-deficient lens and offers initial evidence in support of a novel, conserved RBP-mediated combinatorial control of key lens genes. Thus, this study presents significant new directions to investigate new regulatory mechanisms in lens development and its associated disease, cataract.

69 REFERENCES

Agrawal, S. A., Anand, D., Siddam, A. D., Kakrana, A., Dash, S., Scheiblin, D. A., … Lachke, S. A. (2015). Compound mouse mutants of bZIP transcription factors Mafg and Mafk reveal a regulatory network of non-crystallin genes associated with cataract. Human Genetics, 134(7), 717–735. https://doi.org/10.1007/s00439- 015-1554-5

Altmann, C. R., Chow, R. L., Lang, R. A., & Hemmati-Brivanlou, A. (1997). Lens Induction by Pax-6 in Xenopus laevis. Developmental Biology, 185(1), 119–123. https://doi.org/10.1006/dbio.1997.8573

Anand, D., Agrawal, S. A., Siddam, A. D., Motohashi, H., Yamamoto, M., & Lachke, S. A. (2015). An integrative approach to analyze microarray datasets for prioritization of genes relevant to lens biology and disease. Genomics Data, 5, 223–227. https://doi.org/10.1016/j.gdata.2015.06.017

Anand, D., & Lachke, S. A. (2017). Systems biology of lens development: A paradigm for disease gene discovery in the eye. Experimental Eye Research, 156, 22–33. https://doi.org/10.1016/j.exer.2016.03.010

Anchan, R. M., Lachke, S. A., Gerami-Naini, B., Lindsey, J., Ng, N., Naber, C., … Maas, R. L. (2014). Pax6- And Six3-mediated induction of lens cell fate in mouse and human ES cells. PLoS ONE, 9(12), 1–15. https://doi.org/10.1371/journal.pone.0115106

Antosova, B., Smolikova, J., Klimova, L., Lachova, J., Bendova, M., Kozmikova, I., … Kozmik, Z. (2016). The Gene Regulatory Network of Lens Induction Is Wired through Meis-Dependent Shadow Enhancers of Pax6. PLoS Genetics, 12(12), 1– 24. https://doi.org/10.1371/journal.pgen.1006441

Ashery-Padan, R., Marquardt, T., Zhou, X., & Gruss, P. (2000). Pax6 activity in the lens primordium is required for lens formation and for correct placement of a single retina in the eye. Genes and Development, 14(21), 2701–2711. https://doi.org/10.1101/GAD.184000

Audette, D. S., Anand, D., So, T., Rubenstein, T. B., Lachke, S. A., Lovicu, F. J., & Duncan, M. K. (2016). Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression. Development (Cambridge, England), 143(2), 318–328. https://doi.org/10.1242/dev.127860

Barreau, C., Paillard, L., Méreau, A., & Osborne, H. B. (2006). Mammalian CELF/Bruno-like RNA-binding proteins: molecular characteristics and biological

70 functions. Journal Biochimie, 88, 515–525. https://doi.org/10.1016/j.biochi.2005.10.011

Bassnett, S. (1995). The fate of the Golgi apparatus and the endoplasmic reticulum during lens fiber cell differentiation. Investigative Ophthalmology and Visual Science, 36(9), 1793–1803. https://doi.org/10.1039/a800175h

Bassnett, S. (2009). On the mechanism of organelle degradation in the vertebrate lens. Experimental Eye Research, 88(2), 133–139. https://doi.org/10.1016/j.exer.2008.08.017

Bassnett, S., & Beebe, D. C. (1992). Coincident Loss of Mitochondria and Nuclei During Lens Fiber Cell Development. Developmental Dynamics, 194, 85–93. https://doi.org/10.1177/0731684406072540

Bassnett, S., Shi, Y., & Vrensen, G. F. J. M. (2011). Biological glass: Structural determinants of eye lens transparency. Philosophical Transactions of the Royal Society B: Biological Sciences, 366(1568), 1250–1264. https://doi.org/10.1098/rstb.2010.0302

Bauermeister, D., Claußen, M., & Pieler, T. (2015). A novel role for Celf1 in vegetal RNA localization during Xenopus oogenesis. Developmental Biology, 405(2), 214–224. https://doi.org/10.1016/j.ydbio.2015.07.005

Blech-Hermoni, Y., Dasgupta, T., Coram, R. J., & Ladd, A. N. (2016). Identification of targets of CUG-BP, elav-like family member 1 (CELF1) regulation in embryonic heart muscle. PLoS ONE, 11(2), 1–22. https://doi.org/10.1371/journal.pone.0149061

Blixt, Å., Landgren, H., Johansson, B. R., & Carlsson, P. (2007). Foxe3 is required for morphogenesis and differentiation of the anterior segment of the eye and is sensitive to Pax6 gene dosage. Developmental Biology, 302(1), 218–229. https://doi.org/10.1016/j.ydbio.2006.09.021

Caceres, A., Shang, F., Wawrousek, E., Liu, Q., Avidan, O., Cvekl, A., … Taylor, A. (2010). Perturbing the ubiquitin pathway reveals how mitosis is hijacked to denucleate and regulate cell proliferation and differentiation in Vivo. PLoS ONE, 5(10). https://doi.org/10.1371/journal.pone.0013331

Canto-soler, M. V., & Adler, R. (2006). Optic cup and lens development requires Pax6 expression in the early optic vesicle during a narrow time window. Developmental Biology, 294, 119–132. https://doi.org/10.1016/j.ydbio.2006.02.033

71 Cataract. (2019). Retrieved from https://nei.nih.gov/health/cataract

Charlet-B., N., Savkur, R. S., Singh, G., Philips, A. V., Grice, E. A., & Cooper, T. A. (2002). Loss of the Muscle-Specific Chloride Channel in Type 1 Myotonic Dystrophy Due to Misregulated Alternative Splicing. Molecular Cell, 10(1), 45– 53. https://doi.org/10.1016/0006-291X(77)91426-7

Chaudhury, A., Cheema, S., Fachini, J. M., Kongchan, N., Lu, G., Simon, L. M., … Neilson, J. R. (2016). CELF1 is a central node in post-transcriptional regulatory programmes underlying EMT. Nature Communications, 7, 1–15. https://doi.org/10.1038/ncomms13362

Chi, M. N., Auriol, J., Jégou, B., Kontoyiannis, D. L., Turner, J. M. A., de Rooij, D. G., & Morello, D. (2011). The RNA-binding protein ELAVL1/HuR is essential for mouse spermatogenesis, acting both at meiotic and postmeiotic stages. Molecular Biology of the Cell, 22(16), 2875–2885. https://doi.org/10.1091/mbc.e11-03-0212

Chow, R. L., Altmann, C. R., Lang, R. A., & Hemmati-brivanlou, A. (1999). Pax6 induces ectopic eyes in a vertebrate. Development, 4222, 4213–4222.

Costello, M. J., Brennan, L. a, Basu, S., Chauss, D., Gilliland, K. O., Johnsen, S., … Kantorow, M. (2014). Autophagy and mitophagy participate in ocular lens organelle degradation. Experimental Eye Research, 116, 1–21. https://doi.org/10.1016/j.exer.2013.08.017.Autophagy

Cvekl, A., & Ashery-Padan, R. (2014). The cellular and molecular mechanisms of vertebrate lens development. Development, 141(23), 4432–4447. https://doi.org/10.1242/dev.107953

Cvekl, A., & Callaerts, P. (2017). PAX6: 25th anniversary and more to learn. Experimental Eye Research, 156, 10–21. https://doi.org/10.1016/j.exer.2016.04.017

Cvekl, A., & Zhang, X. (2017). Signaling and Gene Regulatory Networks in Mammalian Lens Development. Trends in Genetics, 33(10), 677–702. https://doi.org/10.1016/j.tig.2017.08.001

Dahm, R., Gribbon, C., Quinlan, R. A., & Prescott, A. R. (1998). Changes in the nucleolar and coiled body compartments precede lamina and chromatin reorganization during fibre cell denucleation in the bovine lens. European Journal of Cell Biology, 75(3), 237–246. https://doi.org/10.1016/S0171- 9335(98)80118-0

72 Dasgupta, T., & Ladd, A. N. (2012). The importance of CELF control: molecular and biological roles of the CUG-BP, Elav-like family of RNA-binding proteins. Wiley Interdisciplinary Reviews: RNA, 3, 104–121. https://doi.org/10.1002/wrna.107

Dash, S., Dang, C. A., Beebe, D. C., & Lachke, S. A. (2015). Deficiency of the RNA binding protein caprin2 causes lens defects and features of Peters anomaly. Developmental Dynamics, 244(10), 1313–1327. https://doi.org/10.1002/dvdy.24303

Dash, S., Siddam, A., Barnum, C., Janga, S., & Lachke, S. A. (2016). RNA Binding Proteins in Eye Development and Disease: Implication of Conserved RNA Granule Components. Wiley Interdisciplinary Reviews: RNA, 7(4).

Dimanlig, P. V, Faber, S. C., Auerbach, W., Makarenkova, H. P., & Lang, R. A. (2001). The upstream ectoderm enhancer in Pax6 has an important role in lens induction. Development, 128(22), 4415–4424.

Donner, A. L., Episkopou, V., & Maas, R. L. (2007). Sox2 and Pou2f1 interact to control lens and olfactory placode development. Developmental Biology, 303(2), 784–799. https://doi.org/10.1016/j.ydbio.2006.10.047

Duncan, M. K., Xie, L., David, L. L., Robinson, M. L., Taube, J. R., Cui, W., & Reneker, L. W. (2004). Ectopic Pax6 expression disturbs lens fiber cell differentiation. Investigative Ophthalmology and Visual Science, 45(10), 3589– 3598. https://doi.org/10.1167/iovs.04-0151

Edwards, J. M., Long, J., De Moor, C. H., Emsley, J., & Searle, M. S. (2013). Structural insights into the targeting of mRNA GU-rich elements by the three RRMs of CELF1. Nucleic Acids Research, 41(14), 7153–7166. https://doi.org/10.1093/nar/gkt470

Epstein, J. A., Glaser, T., Cai, J., Jepeal, L., Walton, D. S., & Maas, R. L. (1994). Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing, 2022–2034.

Faber, S. C., Robinson, M. L., Makarenkova, H. P., & Lang, R. A. (2002). Bmp signaling is required for development of primary lens fiber cells. Development, 129(15), 3727–3737. https://doi.org/http://dx.doi.org/10.1016/j.surfcoat.2013.07.063

Fialcowitz-White, E. J., Brewer, B. Y., Ballin, J. D., Willis, C. D., Toth, E. A., & Wilson, G. M. (2007). Specific protein domains mediate cooperative assembly of HuR oligomers on AU-rich mRNA-destabilizing sequences. Journal of Biological Chemistry, 282(29), 20948–20959.

73 https://doi.org/10.1074/jbc.M701751200

Flaxman, S. R., Bourne, R. R. A., Resnikoff, S., Ackland, P., Braithwaite, T., Cicinelli, M. V, … Wong, T. Y. (2017). Global causes of blindness and distance vision impairment 1990 – 2020 : a systematic review and meta-analysis, 5(12), 1221–1234. https://doi.org/10.1016/S2214-109X(17)30393-5

Fox, J. T., & Stover, P. J. (2009). Mechanism of the internal ribosome entry site- mediated translation of serine hydroxymethyltransferase 1. Journal of Biological Chemistry, 284(45), 31085–31096. https://doi.org/10.1074/jbc.M109.035576

Fujimura, K., Kano, F., & Murata, M. (2008). Dual localization of the RNA binding protein CUGBP-1 to stress granule and perinucleolar compartment. Experimental Cell Research, 314(3), 543–553. https://doi.org/10.1016/j.yexcr.2007.10.024

Furuta, Y., & Hogan, B. L. M. (1998). BMP4 is essential for lens induction in the mouse embryo. Genes and Development, 12(23), 3764–3775. https://doi.org/10.1101/gad.12.23.3764

Gautier-courteille, C., Clainche, C. Le, Barreau, C., Audic, Y., Graindorge, A., Maniey, D., … Paillard, L. (2004). EDEN-BP-dependent post-transcriptional regulation of gene expression in Xenopus somitic segmentation, (1), 6107–6117. https://doi.org/10.1242/dev.01528

Geraldine, D., Deschamps, S., Padilla-Parra, S., Tramier, M., Audic, Y., & Paillard, L. (2012). The RNA-binding proteins CELF1 and ELAVL1 cooperative control alternative splicing. BioRxiv, 3560, 3553–3560. https://doi.org/10.1242/dev.077263

Geraldine, D., Deschamps, S., Padilla-Parra, S., Tramier, M., Audic, Y., & Paillard, L. (2018). The RNA-binding proteins CELF1 and ELAVL1 cooperative control alternative splicing. BioRxiv. https://doi.org/10.1101/373704

Giudice, J., Xia, Z., Wang, E. T., Scavuzzo, M. A., Ward, A. J., Kalsotra, A., … Cooper, T. A. (2014). Alternative splicing regulates vesicular trafficking genes in cardiomyocytes during postnatal heart development. Nature Communications, 5, 1–15. https://doi.org/10.1038/ncomms4603

Glaser, T., Jepeaf, L., Edwards, J. G., Young, S. R., Favor, J., Maas, R. L., & Hughes, H. (1994). PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and nervous system defects. Nature Genetics, 7, 463–471.

Glaser, T., Jepeal, L., Edwards, J. G., Young, S. R., Favor, J., & Maas, R. L. (1994). PAX6 gene dosage effect in a family with congenital cataracts, aniridia,

74 anophthalmia and central nervous system defects. Nature Genetics, 7(4), 463– 471. https://doi.org/10.1038/ng0894-463

Griep, A. E. (2008). Cell Cycle Regulation in the Developing Lens. Seminars in Cell and Developmental Biology, 17(6), 686–697. https://doi.org/10.1016/j.semcdb.2006.10.004.Cell

Grindley, J. C., Davidson, D. R., & Hill, R. E. (1995). The role of Pax-6 in eye and nasal development. Development, 121, 1433–1442.

Gunhaga, L. (2011). The lens: A classical model of embryonic induction providing new insights into cell determination in early development. Philosophical Transactions of the Royal Society B: Biological Sciences, 366(1568), 1193–1203. https://doi.org/10.1098/rstb.2010.0175

Halder, G., Callaerts, P., & Gehring, W. (1995). Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science, 267(5205), 1788–1792. https://doi.org/10.1126/science.7892602

Hogan, B. L. M., Hirst, E. M. A., Horsburgh, G., & Hetherington, C. M. (1988). Small eye (Sey): a mouse model for the genetic analysis of craniofacial abnormalities, 103, 115–119.

Hughes, A. E., Bradley, D. T., Campbell, M., Lechner, J., Dash, D. P., Simpson, D. A., & Willoughby, C. E. (2011). Mutation Altering the miR-184 Seed Region Causes Familial Keratoconus with Cataract. The American Journal of Human Genetics, 89(5), 628–633. https://doi.org/10.1016/j.ajhg.2011.09.014

Hyer, J., Kuhlman, J., Afif, E., & Mikawa, T. (2003). Optic cup morphogenesis requires pre-lens ectoderm but not lens differentiation. Developmental Biology, 259(2), 351–363. https://doi.org/10.1016/S0012-1606(03)00205-7

Jordan, T., Hanson, I., Zaletayev, D., Hodgson, S., Prosser, J., Seawright, A., … Heyningen, V. Van. (1992). The human PAX6 gene is mutated in two patients with aniridia. Nature Genetics, 1, 328–332.

Kakrana, A., Yang, A., Anand, D., Djordjevic, D., Ramachandruni, D., Singh, A., … Lachke, S. A. (2018). iSyTE 2.0: a database for expression-based gene discovery in the eye. Nucleic Acids Research, 46(D1), D885. https://doi.org/10.1093/nar/gkx837

Kasaikina, M. V., Fomenko, D. E., Labunskyy, V. M., Lachke, S. A., Qiu, W., Moncaster, J. A., … Gladyshev, V. N. (2011). Roles of the 15-kDa selenoprotein (Sep15) in redox homeostasis and cataract development revealed by the analysis

75 of Sep 15 knockout mice. Journal of Biological Chemistry, 286(38), 33203– 33212. https://doi.org/10.1074/jbc.M111.259218

Kim-Ha, J., Kerr, K., & Macdonald, P. M. (1995). Translational regulation of oskar mRNA by Bruno, an ovarian RNA-binding protein, is essential. Cell, 81(3), 403– 412. https://doi.org/10.1016/0092-8674(95)90393-3

Kleinjan, D. A., Bancewicz, R. M., Gautier, P., Dahm, R., & Schonthaler, H. B. (2008). Subfunctionalization of Duplicated Zebrafish pax6 Genes by cis- Regulatory Divergence. PLoS Genetics, 4(2). https://doi.org/10.1371/journal.pgen.0040029

Klimova, L., & Kozmik, Z. (2014). Stage-dependent requirement of neuroretinal Pax6 for lens and retina development. Development, 141, 1292–1302. https://doi.org/10.1242/dev.098822

Kozmik, Z., Czerny, T., & Busslinger, M. (1997). Alternatively spliced insertions in the paired domain restrict the DNA sequence specificity of Pax6 and Pax8. The EMBO Journal, 16(22), 6793–6803.

Kress, C., Gautier-Courteille, C., Osborne, H. B., Babinet, C., & Paillard, L. (2007). Inactivation of CUG-BP1/CELF1 Causes Growth, Viability, and Spermatogenesis Defects in Mice. Molecular and Cellular Biology, 27(3), 1146– 1157. https://doi.org/10.1039/c1jm90181h

Kullmann, M., Göpfert, U., Siewe, B., & Hengst, L. (2002). ELAV/Hu proteins inhibit p27 translation via an IRES element in the p27 5′UTR. Genes and Development, 16(23), 3087–3099. https://doi.org/10.1101/gad.248902

Kuszak, J. R., & Brown, H. G. (1994). Embryology and Anatomy of the lens. Principles and Practice of Ophthalmology: Basic Sciences, 82–96.

Lachke, S. A., Alkuraya, F. S., Kneeland, S. C., Ohn, T., Aboukhalil, A., Howell, G. R., … Maas, R. L. (2011). Mutations in the RNA Granule Component TDRD7 Cause Cataract and Glaucoma. Science, 331(6024), 1571–1576. https://doi.org/10.1126/science.1195970

Lachke, S. A., Higgins, A. W., Inagaki, M., Saadi, I., Xi, Q., Long, M., … Maas, R. L. (2012). The cell adhesion gene PVRL3 is associated with congenital ocular defects. Human Genetics, 131(2), 235–250. https://doi.org/10.1007/s00439-011- 1064-z

Lachke, S. A., Ho, J. W. K., Kryukov, G. V., O’Connell, D. J., Aboukhalil, A., Bulyk, M. L., … Maas, R. L. (2012). iSyTE : Integrated Systems Tool for Eye Gene

76 Discovery. Investigative Opthalmology & Visual Science, 53(3), 1617. https://doi.org/10.1167/iovs.11-8839

Lachke, S. A., & Maas, R. L. (2010). Building the developmental oculome: Systems biology in vertebrate eye development and disease. Wiley Interdisciplinary Reviews: Systems Biology and Medicine, 2(3), 305–323. https://doi.org/10.1002/wsbm.59

Ladd, A. N. (2013). CUG-BP, Elav-like family (CELF)-mediated alternative splicing regulation in the brain during health and disease. Molecular Cell Neuroscience, 3(4), 539–553. https://doi.org/10.1016/j.biotechadv.2011.08.021.Secreted

Ladd, A. N., Charlet-B., N., & Cooper, T. A. (2001). The CELF Family of RNA Binding Proteins Is Implicated in Cell-Specific and Developmentally Regulated Alternative Splicing. Molecular and Cellular Biology, 21(4), 1285–1296. https://doi.org/10.1128/MCB.21.4.1285-1296.2001

Land, M. F. (2012). The evolution of lenses. Ophthalmic and Physiological Optics, 32(6), 449–460. https://doi.org/10.1111/j.1475-1313.2012.00941.x

Landgren, H., Blixt, Å., & Carlsson, P. (2008). Persistent FoxE3 Expression Blocks Cytoskeletal Remodeling and Organelle Degradation during Lens Fiber Differentiation. Investigative Ophthalmology & Visual Science, 49(10), 4269– 4277. https://doi.org/10.1167/iovs.08-2243

Lee, J. E., Lee, J. Y., Wilusz, J., Tian, B., & Wilusz, C. J. (2010). Systematic Analysis of Cis-Elements in Unstable mRNAs Demonstrates that CUGBP1 Is a Key Regulator of mRNA Decay in Muscle Cells, 5(6). https://doi.org/10.1371/journal.pone.0011201

Li, Y., & Piatigorsky, J. (2009). Targeted deletion of dicer disrupts lens morphogenesis, corneal epithelium stratification, and whole eye development. Developmental Dynamics, 238(9), 2388–2400. https://doi.org/10.1002/dvdy.22056

Liu, L., Ouyang, M., Rao, J. N., Zou, T., Xiao, L., Chung, H. K., … Wang, J.-Y. (2015). Competition between RNA-binding proteins CELF1 and HuR modulates MYC translation and intestinal epithelium renewal. Molecular Biology of the Cell, 26(10), 1797–1810. https://doi.org/10.1091/mbc.E14-11-1500

Liu, W., Lagutin, O. V., Mende, M., Streit, A., & Oliver, G. (2006). Six3 activation of Pax6 expression is essential for mammalian lens induction and specification. EMBO Journal, 25(22), 5383–5395. https://doi.org/10.1038/sj.emboj.7601398

77 Liu, X., Liu, C., Shan, K., Zhang, S., Lu, Y., Yan, B., & Luo, Y. (2018). Long Non- Coding RNA H19 Regulates Human Lens Epithelial Cells Function. Cellular Physiology and Biochemistry, 50(1), 246–260. https://doi.org/10.1159/000494003

Makley, L. N., Mcmenimen, K. A., Devree, B. T., Goldman, J. W., Mcglasson, B. N., Rajagopal, P., … Gestwicki, J. E. (2015). Pharmacological chaperone for a - crystallin partially restores transparency in cataract models. Science, 350(6261), 2298–2299.

Mathers, P. H., Grinberg, A., Mahon, K. A., & Jamrich, M. (1997). The Rx homeobox gene is essential for vertebrate eye development. Nature, 387(6633), 603–607. https://doi.org/10.1038/42475

McAvoy, J. W., Chamberlain, C. G., de Longh, R. U., Hales, A. M., & Lovicu, F. J. (1999). Lens development. Eye (Basingstoke), 13(3), 425–437. https://doi.org/10.1038/eye.1999.117

Milne, C. A., & Hodgkin, J. (1999). ETR-1, a homologue of a protein linked to myotonic dystrophy, is essential for muscle development in Caenorhabditis elegans. Current Biology, 9(21), 1243–1247.

Moraes, K. C. M., Wilusz, C. J., & Wilusz, J. (2006). CUG-BP binds to RNA substrates and recruits PARN deadenylase. Rna, 12(6), 1084–1091. https://doi.org/10.1261/rna.59606

Mori, M., Higuchi, K., Shumiya, S., Mori, M., Li, G., Abe, I., … Sawashita, J. (2006). Lanosterol synthase mutations cause cholesterol deficiency – associated cataracts in the Shumiya cataract rat. The Journal of Clinical Investigation, 116(2), 395– 404. https://doi.org/10.1172/JCI20797.metabolic

Nakahara, M., Nagasaka, A., Koike, M., Uchida, K., Kawane, K., Uchiyama, Y., & Nagata, S. (2007). Degradation of nuclear DNA by DNase II-like acid DNase in cortical fiber cells of mouse eye lens. The FEBS Journal, 274(12), 3055–3064. https://doi.org/10.1111/j.1742-4658.2007.05836.x

Nibourg, L. M., Gelens, E., Kuijer, R., Hooymans, J. M. M., Kooten, T. G. Van, & Koopmans, S. A. (2015). Prevention of posterior capsular opacification. Experimental Eye Research, 136, 100–115. https://doi.org/10.1016/j.exer.2015.03.011

Nornes, S., Clarkson, M., Mikkola, I., Pedersen, M., & Bardsley, A. (1998). Zebrafish contains two Pax6 genes involved in eye development. Mechanisms of Development, 77, 185–196.

78 Paillard, L., Legagneux, V., & Osborne, H. B. (2003). A functional deadenylation assay identifies human CUG-BP as a deadenylation factor. Biology of the Cell, 95, 107–113.

Paillard, L., Omilli, F., Legagneux, V., Bassez, T., Maniey, D., & Osborne, H. B. (1998). EDEN and EDEN-BP, a cis element and an associated factor that mediate sequence-specific mRNA deadenylation in Xenopus embryos. EMBO Journal, 17(1), 278–287. https://doi.org/10.1093/emboj/17.1.278

Paul, S., Dansithong, W., Kim, D., Rossi, J., Webster, N. J. G., Comai, L., & Reddy, S. (2006). Interaction of musleblind, CUG-BP1 and hnRNP H proteins in DM1- associated aberrant IR splicing. EMBO Journal, 25(18), 4271–4283. https://doi.org/10.1038/sj.emboj.7601296

Peng, S. S., Chen, C. A., Xu, N., & Shyu, A. (1998). , 17(12), 3461–3470.

Plageman, T. F., Chung, M.-I., Lou, M., Smith, A. N., Hildebrand, J. D., Wallingford, J. B., & Lang, R. A. (2010). Pax6-dependent Shroom3 expression regulates apical constriction during lens placode invagination. Development, 137(3), 405– 415. https://doi.org/10.1242/dev.045369

Pontoriero, G. F., Smith, A. N., Miller, L. A. D., Radice, G. L., West-Mays, J. A., & Lang, R. A. (2009). Co-operative roles for E-cadherin and N-cadherin during lens vesicle separation and lens epithelial cell survival. Developmental Biology, 326(2), 403–417. https://doi.org/10.1016/j.ydbio.2008.10.011

Reis, L. M., & Semina, E. V. (2018). Genetic landscape of isolated pediatric cataracts: extreme heterogeneity and variable inheritance patterns within genes. Human Genetics, (0), 1–17. https://doi.org/10.1007/s00439-018-1932-x

Roberts, R. C. (1967). Small eyes — a new dominant eye mutant in the mouse Short Papers. Genetics Research Cambridge, 9, 121–122.

Santana, A., & Waiswol, M. (2011). The genetic and molecular basis of congenital cataracts. Arquivos Brasileiros de Oftalmologia, 74, 136–142.

Schedl, A., Ross, A., Lee, M., Engelkamp, D., Rashbass, P., Heyningen, V. Van, & Hastie, N. D. (1996). Influence of PAX6 Gene Dosage on Development: Overexpression Causes Severe Eye Abnormalities. Cell, 86, 71–82.

Scheiba, R. M., De Opakua, A. I., Díaz-Quintana, A., Cruz-Gallardo, I., Martínez- Cruz, L. A., Martínez-Chantar, M. L., … Díaz-Moreno, I. (2014). The C-terminal RNA binding motif of HuR is a multi-functional domain leading to HuR

79 oligomerization and binding to U-rich RNA targets. RNA Biology, 11(10), 1250– 1261. https://doi.org/10.1080/15476286.2014.996069

Shaham, O., Gueta, K., Mor, E., Oren-Giladi, P., Grinberg, D., Xie, Q., … Ashery- Padan, R. (2013). Pax6 Regulates Gene Expression in the Vertebrate Lens through miR-204. PLoS Genetics, 9(3), 1–15. https://doi.org/10.1371/journal.pgen.1003357

Shaham, O., Menuchin, Y., Farhy, C., & Ashery-Padan, R. (2012). Pax6: A multi- level regulator of ocular development. Progress in Retinal and Eye Research, 31(5), 351–376. https://doi.org/10.1016/j.preteyeres.2012.04.002

Shaham, O., Smith, A. N., Robinson, M. L., Taketo, M. M., Lang, R. A., & Ashery- Padan, R. (2009). Pax6 is essential for lens fiber cell differentiation. Development, 136(15), 2567–2578. https://doi.org/10.1242/dev.032888

Sheeladevi, S., Lawrenson, J. G., Fielder, A. R., & Suttle, C. M. (2016). Global prevalence of childhood cataract: A systematic review. Eye (Basingstoke), 30(9), 1160–1169. https://doi.org/10.1038/eye.2016.156

Shi, F., Fan, Y., Zhang, L., Meng, L., Zhi, H., Hu, H., & Lin, A. (2013). The Expression of Pax6 Variants Is Subject to Posttranscriptional Regulation in the Developing Mouse Eyelid. PLoS ONE, 8(1), 1–9. https://doi.org/10.1371/journal.pone.0053919

Shiels, A. (2019). Cat-Map. Retrieved from https://cat-map.wustl.edu/

Shiels, A., & Hejtmancik, J. F. (2015). Molecular Genetics of Cataract. Molecular Biology of Eye Disease (1st ed., Vol. 134). Elsevier Inc. https://doi.org/10.1016/bs.pmbts.2015.05.004

Shiels, A., & Hejtmancik, J. F. (2017). Mutations and mechanisms in congenital and age-related cataracts. Experimental Eye Research, 156, 95–102. https://doi.org/10.1016/j.exer.2016.06.011

Siddam, A. D., Gautier-Courteille, C., Perez-Campos, L., Anand, D., Kakrana, A., Dang, C. A., … Lachke, S. A. (2018). The RNA-binding protein Celf1 post- transcriptionally regulates p27Kip1and Dnase2b to control fiber cell nuclear degradation in lens development. PLoS Genetics, 14(3), 1–28. https://doi.org/10.1371/journal.pgen.1007278

Smith, A. N., Miller, L.-A., Radice, G., Ashery-Padan, R., & Lang, R. A. (2009). Stage-dependent modes of Pax6-Sox2 epistasis regulate lens development and eye morphogenesis. Development, 136(17), 2977–2985.

80 https://doi.org/10.1242/dev.043802

Sun, J., Rockowitz, S., Xie, Q., Ashery-Padan, R., Zheng, D., & Cvekl, A. (2015). Identification of in vivo DNA-binding mechanisms of Pax6 and reconstruction of Pax6-dependent gene regulatory networks during forebrain and lens development. Nucleic Acids Research, 43(14), 6827–6846. https://doi.org/10.1093/nar/gkv589

Tanaka, T., Hosokawa, M., Vagin, V. V, Reuter, M., Hayashi, E., Mochizuki, A. L., … Chuma, S. (2011). Tudor domain containing 7 (Tdrd7) is essential for dynamic ribonucleoprotein (RNP) remodeling of chromatoid bodies during spermatogenesis. Proceedings of the National Academy of Sciences of the United States of America, 108(26), 10579–10584. https://doi.org/10.1073/pnas.1015447108

Thein, T., de Melo, J., Zibetti, C., Clark, B. S., Juarez, F., & Blackshaw, S. (2016). Control of lens development by Lhx2-regulated neuroretinal FGFs. Development, 143(21), 3994–4002. https://doi.org/10.1242/dev.137760

Timchenko, N. A., Patel, R., Iakova, P., Cai, Z. J., Quan, L., & Timchenko, L. T. (2004). Overexpression of CUG Triplet Repeat-binding Protein, CUGBP1, in Mice Inhibits Myogenesis. Journal of Biological Chemistry, 279(13), 13129– 13139. https://doi.org/10.1074/jbc.M312923200

Timchenko, N. A., Wang, G. L., & Timchenko, L. T. (2005). RNA CUG-binding protein 1 increases translation of 20-kDa isoform of CCAAT/enhancer-binding protein β by interacting with the α and β subunits of eukaryotic initiation translation factor 2. Journal of Biological Chemistry, 280(21), 20549–20557. https://doi.org/10.1074/jbc.M409563200 van Raamsdonk, C. D., Tilghman, S. M., & Camper, S. A. (2000). Dosage requirement and allelic expression of PAX6 during lens placode formation. Development (Cambridge, England), 127(24), 5439–5448. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11076764

Vlasova-St. Louis, I., & Bohjanen, P. R. (2011). Coordinate regulation of mRNA decay networks by GU-rich elements and CELF1. Current Opinion in Genetics and Development, 21(4), 444–451. https://doi.org/10.1016/j.gde.2011.03.002

Wang, H., Zeng, F., Liu, Q., Liu, H., Liu, Z., Niu, L., … Li, X. (2013). The structure of the ARE-binding domains of Hu antigen R (HuR) undergoes conformational changes during RNA binding. Acta Crystallographica Section D: Biological Crystallography, 69(3), 373–380. https://doi.org/10.1107/S0907444912047828

81 Washington, N. L., Haendel, M. A., Mungall, C. J., Ashburner, M., & Lewis, S. E. (2009). Linking Human Diseases to Animal Models Using Ontology-Based Phenotype Annotation, 7(11). https://doi.org/10.1371/journal.pbio.1000247

Wawersik, S., & Maas, R. L. (2000). Vertebrate eye development as modeled in Drosophila. Human Molecular Genetics, 9(6), 917–926.

Wigle, J. T., Chowdhury, K., Gruss, P., & Oliver, G. (1999). Prox1 function is crucial for mouse lens-fibre elongation, 21(March), 318–322.

Wolf, L., Gao, C. S., Gueta, K., Xie, Q., Chevallier, T., Podduturi, N. R., … Cvekl, A. (2013). Identification and Characterization of FGF2-Dependent mRNA: microRNA Networks During Lens Fiber Cell Differentiation. G3: Genes|Genomes|Genetics, 3(12), 2239–2255. https://doi.org/10.1534/g3.113.008698

Xia, H., Chen, D., Wu, Q., Wu, G., Zhou, Y., Zhang, Y., & Zhang, L. (2017). CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells. Biochimica et Biophysica Acta - Gene Regulatory Mechanisms, 1860(9), 911–921. https://doi.org/10.1016/j.bbagrm.2017.07.004

Yamada, R. (2003). Cell-autonomous involvement of Mab21l1 is essential for lens placode development. Development, 130(9), 1759–1770. https://doi.org/10.1242/dev.00399

Yu, T.-X., Gu, B.-L., Yan, J.-K., Zhu, J., Yan, W.-H., Chen, J., … Cai, W. (2016). CUGBP1 and HuR regulate E-cadherin translation by altering recruitment of E- cadherin mRNA to processing bodies and modulate epithelial barrier function. American Journal of Physiology-Cell Physiology, 310(1), C54–C65. https://doi.org/10.1152/ajpcell.00112.2015

Yu, T.-X., Rao, J. N., Zou, T., Liu, L., Xiao, L., Ouyang, M., … Wang, J.-Y. (2013). Competitive binding of CUGBP1 and HuR to occludin mRNA controls its translation and modulates epithelial barrier function. Molecular Biology of the Cell, 24(2), 85–99. https://doi.org/10.1091/mbc.E12-07-0531

Zandy, A. J., & Bassnett, S. (2007). Proteolytic mechanisms underlying mitochondrial degradation in the ocular lens. Investigative Ophthalmology and Visual Science, 48(1), 293–302. https://doi.org/10.1167/iovs.06-0656

Zhang, L., Lee, J. E., Wilusz, J., & Wilusz, C. J. (2008). The RNA-binding Protein CUGBP1 Regulates Stability of Tumor Necrosis Factor mRNA in Muscle Cells, 283(33), 22457–22463. https://doi.org/10.1074/jbc.M802803200

82 Zhang, X., Friedman, A., Heaney, S., Purcell, P., & Maas, R. L. (2002). Meis homeoproteins directly regulate Pax6 during vertebrate lens morphogenesis. Genes and Development, 16, 2097–2107. https://doi.org/10.1101/gad.1007602.In

Zhao, L., Chen, X., Zhu, J., Xi, Y., Yang, X., Hu, L., … Perry, J. J. P. (2015). Lanosterol reverses protein aggregation in cataracts. Nature, 523, 607–611. https://doi.org/10.1038/nature14650

Zheng, Y., & Miskimins, W. K. (2011). CUG-binding protein represses translation of p27Kip1 mRNA through its internal ribosomal entry site. RNA Biology, 8(3), 365–371. https://doi.org/10.4161/rna.8.3.14804

Zhu, J., Palliyil, S., Ran, C., & Kumar, J. P. (2017). Drosophila Pax6 promotes development of the entire eye-antennal disc, thereby ensuring proper adult head formation. Proceedings of the National Academy of Sciences, 114(23), 5846– 5853. https://doi.org/10.1073/pnas.1610614114

83 Appendix

SUPPLEMENTARY METHODS

Table 1: Celf1cKO/lacZKI Genotyping Primers

Name Forward (5’ → 3’) Reverse (5’ → 3’) Celf1 germline GAATTATGGCCCACACCAGT GAGGGTTTTGGCTCCTATCC lacZKI Celf1 floxed CCATAACATGAAGGTCCTCCCTGGGG GGCTGAACTGCAGGATCACAGCACC alleles Pax6GFPCre TTCAATTTACTGACCGTACACC CCGACGATGAAGCATGTTTAG

Table 2: RT-PCR Primers

Primer name Forward (5’ → 3’) Reverse (5’ → 3’) Pax6 qPCR GCACATGCAAACACACATGA ACTTGGACGGGAACTGACAC Pax6 5’ UTR 1 and 4 Forward ACCCTCTTTTCTTATCGTTGAC GCTGGAGCTGGTTGGC Pax6 5’ UTR 2 and 6 Forward GGATCTGAGAATTGCTCTCAC GCTGGAGCTGGTTGGC Pax6 5’ UTR 3 and 5 Forward ACTTCCAGCGAAAGCCCG GCTGGAGCTGGTTGGC Pax6 5’ UTR 7 and 8 Reverse CATATTCCCCCCTCGTCTATA CTGTTGCTTTTCGCTAGCCA

Table 3: Immunofluorescent Conditions

Target Catalog Permeabilization Blocking Primary Washes Secondary No. Conditions Conditions Pax6 EMD Permeabilize with 2% BSA 1:100 dilution 3×10 in 1X chαrb 1:200 Millipore 0.05% Triton-X in +0.3% in blocking; TBS (after dilution in AB2237 1X TBS Triton-X in overnight 4°C primary and blocking; 1hr 1X TBS; after in RT 1hr in RT secondary) Celf1 Abcam Permeabilize with 5% chicken 1:500 dilution 3×10 in 1X chαms 1:200 ab9549 0.05% Triton-X in serum + in blocking; PBS (after dilution in 1X PBS 0.1% overnight 4°C primary and blocking; 1hr Triton-X in after in RT 1X PBS; 1 secondary) hr in RT Elavl1 Abcam Permeabilize with 5% chicken 1:200 dilution 3×10 in 1X chαrb 1:200 ab200342 0.05% Triton-X in serum + in blocking; PBS (after dilution in 1X PBS 0.1% overnight 4°C primary and blocking; 1hr Triton-X in after in RT 1X PBS; 1 secondary) hr in RT

84 Table 4: Western Blot Conditions

Target Catalog No. Blocking Primary Washes Secondary Conditions Conditions Pax6 (mRb) EMD Millipore 5% Blotto in 1:1000 or 1:500 1X TBS-T for 1:1000 HRP- AB2237 TBS-T; 1.5hr in in 5% Blotto 15 minutes linked αRb RT Celf1 Ab129115 5% Blotto in 1:1000 or 1:500 1X TBS-T for 1:1000 HRP- TBS-T; 1.5hr in in 5% Blotto 15 minutes linked αRb RT Beta-Actin Sigma-Aldrich 5% Blotto in 1:1000 in 5% 1X TBS-T for N/A A3854 TBS-T; 1.5hr in Blotto 15 minutes RT

Sequence of Pax6 partial 3’ UTR used in luciferase assays: AGAGAGAAGGAGAGAGCATGTGATCGAGAGAGGAAATTGTGTTCACTCTG CCAATGACTATGTGGACACAGCAGTTGGGTATTCAGGAAAGAAAGAGAAA TGGCGGTTAGAAGCACTTCACTTTGTAACTGTCCTGAACTGGAGCCCGGGA ATGGACTAGAACCAAGGACCTTTGCGTACAGAAGGCACGGTATCAGTTGG AACAAATCTTCATTTTGGTATCCAAACTTTTATTCATTTTGGTGTATTATTT GTAAATGGGCATTGGTATGTTATAATGAAGAAAAGAACAACACAGGCTGT TGGATCGCGGATCTGTGTTGCTCATGTGGTTGTTTAAAGGAAACCATGATC GACAAGATTTGCCATGGATTTAAGAGTTTTATCAAGATATATCAAATACTT CTCCCCATCTGTTCATAGTTTATGGACTGATGTTCCAAGTTTGTATCATTCC TTTGCATATAATTGAACCTGGGACAACACACACTAGATATATGTAAAAACT ATCTGTTGGTTTTCCAAAGGTTGTTAACAGATGAAGTTTATGTGCAAAAAA GGGTAAGATATGAATTCAAGGAGAAGTTGATAGCTAAAAGGTAGAGTGTG TCTTCGATATAATACAATTTGTTTTATGTCAAAATGTAGTATTTGTCTTCCC TAGAAATCCTCAGAATGATTTCTATAATAAAGTTAATTTCATTTATATTTG ACAAGAATACTCTATAGATGTTTTATACACATTTTCATGCAATCATTTGTTT CTTTCTTGGCCAGCAAAAGTTAATTGTTCTTAGATATAGCTGTATTACTGTT CACAGTCCAATCATTTTGTGCATCTAGAATTCATTCCTAATCAATTAAAAG TGCTTGCAAGAGTTTTAAACCTAAGTGTTTTGCAGTTGTTCACAAATACAT ATCAAAATTAACCATTGTTGATTGTAAAAAAAAAACCATGCCAAAGCCTTT GTATT Highlighted region denotes predicted Celf1 binding site with UGU repeats marked in red.