1 Biodiversity in Traditional Polish Cheese Oscypek Determined by
2 Culture-dependent and -independent Approaches
3
4 Ángel Alegría1,2#, Pawel Szczesny1,3, Baltasar Mayo2, Jacek Bardowski1, Magdalena Kowalczyk1#*
5
6 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland 1
7 Departamento de Microbiología y Bioquímica, Instituto de Productos Lácteos de Asturias (CSIC),
8 Villaviciosa, Asturias, Spain 2
9 Faculty of Biology, University of Warsaw, Warsaw, Poland 3
10
11 * Corresponding author. Mailing address: Institute of Biochemistry and Biophysics, PAN, Pawinskiego
12 5A, 02-106 Warsaw, Poland. Phone: 48-22-5921222. Fax: 48-22-6584636. E-mail: [email protected].
13
14 # M. Kowalczyk and Á. Alegría contributed equally to this work
15
16 Journal section: Food Microbiology.
1
17 ABSTRACT
18 Oscypek is a traditional Polish, scalded-smoked cheese, with a protected designation of origin
19 (PDO) status manufactured from raw sheep’s milk without starter cultures in the Tatra Mountains
20 region of Poland. This study was undertaken in order to get some insight on the microbiota which
21 develops and evolves during the manufacture and ripening stages of Oscypek. To this end, we made use
22 of both culturing and the culture-independent methods of PCR-DGGE and pyrosequencing of 16S
23 rRNA gene amplicons. Culturing and culture-independent techniques are known to give
24 complementary results on the diversity and dynamics of microbial populations, thus providing a better
25 description of the cheese ecosystem of traditional Oscypek. Culture-dependent technique and PCR-
26 DGGE fingerprinting detected the predominant microorganisms in the traditional Oscypek whereas the
27 next-generation sequencing technique (454 pyrosequencing) revealed greater bacterial diversity.
28 Besides members of the most abundant bacterial genera in dairy products, e.g. Lactococcus,
29 Lactobacillus, Leuconostoc, Streptococcus and Enterococcus, identified by all three methods, other
30 subdominant bacteria belonging to the families Bifidobacteriaceae and Moraxellaceae (mostly
31 Enhydrobacter) and various minor bacteria were identified by pyrosequencing. In addition to bacteria,
32 a great diversity of yeast species was demonstrated in Oscypek by the PCR-DGGE method. Culturing
33 methods enabled the determination of a number of viable microorganisms from different microbial
34 groups and their isolation for potential future applications in specific cheese starter cultures.
35
36 INTRODUCTION
37 Protected Designation of Origin (PDO) labels are granted to traditional agricultural products and
38 foodstuffs originating in a specific area whose quality or characteristics are essentially or exclusively
39 due to particular geographic environments (with its inherent natural and human factors), and whose
40 production, processing and preparation processes take place in a defined PDO region (European
2
41 Commission, 2006). The quality of PDO cheeses is based on particular species and herds, grazing
42 pastures, and ancient technologies developed and maintained in a shared manner by the human
43 communities within the PDO area. All these factors select for specific microorganisms which have
44 evolved through the ages, whose activity plays a pivotal role in the sensorial, safety and preservative
45 properties of the products (Guinane et al., 2005; Smit et al., 2005). Therefore, identification, typing and
46 characterization of these microorganisms is essential for designing specific starters to control the
47 fermentation while preserving the original sensory profiles.
48 Oscypek is a traditional Polish, scalded-smoked cheese, which enjoys a PDO status since 2008.
49 The cheese has the shape of a spindle with a beautiful characteristic pattern imprinted by the carved
50 wooden moulds which give the cheese its final form. It is manufactured from raw sheep’s milk without
51 starter cultures in the Tatra Mountains region of Poland, according to the diagram flow chart depicted
52 in Figure 1. The traditional manufacturing process maintained throughout centuries may have selected
53 appropriate lactic acid bacteria (LAB) species and/or strains that could be used as specific starters. The
54 new cultures can also be used to complement or replace the starters currently used in large-scale dairy
55 industry (Ayad et al., 2001). In addition, traditional cheese ecosystems may harbor lactic acid bacteria
56 (LAB) strains showing unique flavor-forming capabilities (Ayad et al., 1999), enhanced bacteriophage
57 resistance (Madera et al., 2003) or production of new, broad-range antimicrobial agents (Alegría et al.,
58 2010).
59 Besides conventional microbial characterization, a vast array of culture-independent molecular
60 techniques is now available to address the diversity and evolution of the microbial populations
61 throughout cheese manufacture and ripening (Jany and Barbier, 2008). Among others, techniques such
62 as denaturing gradient gel electrophoresis (DGGE) (Randazzo et al., 2002), single-strand conformation
63 polymorphism (SSCP) (Duthoit, 2007), fluorescent in situ hybridization (FISH) (Ercolini et al., 2003),
64 length-heterogeneity-PCR (LH-PCR) (Lazzi et al., 2004), quantitative real-time PCR (qPCR)
3
65 (Friedrich and Lenke, 2007), terminal-restriction fragment length polymorphism (TR-FLP) (Arteau et
66 al., 2010), complement classic culturing techniques, thus providing a more complete picture of the
67 cheese ecosystem. Next generation sequencing techniques, such as pyrosequencing (Margulies et al.,
68 2005), have recently begun to be applied to study the diversity and dynamics of the microbial
69 populations in natural food fermentations (Humblot and Guyot, 2009; Roh et al., 2010; Jung et al.,
70 2011). This method enables rapid insight into population structure, dynamics, gene content, and
71 metabolic potential of microbial communities.
72 In this study, culturing and the culture-independent methods of DGGE and pyrosequencing of
73 segments of the 16S rRNA gene were used to type major and indicator microbial populations in
74 traditional Oscypek cheeses. This allowed identification of the dominant cultivable bacterial species
75 and assessment of the microbial diversity and dynamics during the manufacture and ripening of several
76 cheese batches.
77
78 MATERIALS AND METHODS
79 Cheese samples and sampling conditions. Cheeses manufactured by four independent cheese
80 makers from the Tatra Mountains in Poland were sampled in September 2009. Microbiological and
81 culture-independent molecular analyses were performed on four batches representing traditional
82 Oscypek cheeses produced mostly from unpasteurized ewe’s milk in shepherds’ huts. Curd, fresh (1
83 day) and smoked (3 day) cheeses were sampled according to FIL-IDF standard 50 B, and kept under
84 refrigeration until analysis.
85
86 Microbial analysis by culturing. Twenty gram samples of curd or cheese were mixed with 180 ml
87 of PS (0.9% sodium chloride solution) at 37ºC and homogenized in a laboratory homogenizer (H500
88 Pol-Eko-Aparatura, Wodzisław Śląski, Poland) for 5 min at 24,000 rpm. Serial 10-fold dilutions in PS
4
89 were then plated in duplicate onto seven general and selective media, as follows.
90 Total mesophilic bacteria. Mesophilic bacteria were counted on plate count agar supplemented
91 with 0.1% skimmed milk (PCMA; Merck, Darmstadt, Germany) after 72 h of incubation under both
92 aerobic and anaerobic (in 2.5 l jars with AnaeroGen; Oxoid Ltd., Basingstoke Hampshire, UK)
93 conditions at 30ºC. In addition, BHI (Oxoid Ltd., Basingstoke Hampshire, UK) agar plates
94 supplemented with 0.2% of cysteine (BHIAC) were used to count total anaerobic bacteria after
95 incubation at 37ºC for 72 h in anaerobiosis (with AnaeroGen).
96 Lactococci. Lactococci were grown on M17 (Oxoid Ltd., Basingstoke Hampshire, UK) agar
97 supplemented with lactose 10 g/l (LM17A) and enumerated after 48 h of incubation at 30ºC.
98 Lactobacilli. Lactobacilli were grown on de Man, Rogosa and Sharpe agar (MRSA; Merck),
99 adjusted to pH 5.4 and counted after 72 h incubation under aerobic and anaerobic conditions at 37ºC
100 (AnaeroGen).
101 Leuconostoc spp. Dextran-producing leuconostoc were grown on sucrose enriched agar
102 supplemented with vancomycin (tryptone 10 g/l, yeast extract 5 g/l, sucrose 10 g/l, CaCO3 20g/l, agar
103 15 g/l, and vancomycin 200 µg/ml), and counted after incubation for five days at 21ºC.
104 Enterobacteria and coliforms. These were grown on MacConkey agar (MCA; Merck), and counted
105 after 48 h of incubation at 37ºC.
106 Yeasts and moulds. Dilutions of the samples were plated on yeast-extract glucose chloramphenicol
107 agar (YGCA; yeast extract 5 g/l, glucose 20 g/l, agar 15 g/l, and chloramphenicol 0.1 g/l). Yeasts and
108 filamentous moulds were independently counted after five days of incubation at 28º C.
109
110 Molecular identification of lactic acid bacteria. After incubation, plates were photographed and
111 colonies of different morphologies were counted and selected for identification. Isolates were purified
112 by subculturing and stored at -80ºC in fresh medium with 15% (v/v) of glycerol.
5
113 Cryoprotected cultures were recovered in the isolation medium, and colonies were used as a source
114 of DNA in amplifications by polymerase chain reaction (PCR). Cell extracts were obtained by a
115 mechanical procedure in a Mini-Beadbeater apparatus (BioSpec Products, Inc., Bartlesville, OK, USA),
116 after suspending a single colonies in 100 µl of sterile water and mixing with 50 mg of sterile glass
117 beads (Sigma-Aldrich, Inc., Saint Louis, MISS, USA). Cell extracts were separated from cellular debris
118 by centrifugation at 13,000×g for 10 min. Supernatants were used as a source of template DNA for
119 PCR amplification of a large segment of 16S rRNA gene with the universal bacterial primer 27F (5’-
120 AGAGTTTGATYMTGGCTCAG-3’) and the universal prokaryotic primer 1492R (5’-
121 GGTTACCTTGTTACGACTT-3’).
122 Amplicons were purified using GenElute PCR Clean-Up columns (Sigma-Aldrich) and sequenced
123 with an ABI 373 DNA sequencer (Applied Biosystems, Foster City, Ca., USA) using primer 27F. On
124 average, 850 bp were obtained and compared with those in the GenBank database, using the online
125 BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/), and in the Ribosomal Database Project
126 (http://rdp.cme.msu.edu/index.jsp). Sequences were assigned to a given species if they shared a
127 similarity equal or higher than 97% to those of that species (Stackebrandt and Goebel, 1994; Palys et
128 al., 1997).
129
130 Denaturing gradient gel electrophoresis (DGGE) analysis. DGGE analysis involved the
131 following steps: isolation of total DNA from curd and cheese samples, PCR amplification with DGGE
132 primers, electrophoresis and identification of bands in gels.
133 Isolation of total microbial DNA. Curd and cheese samples were homogenized in PS. 2-ml
134 samples of homogenates were centrifuged at 9,000×g for 1 min. For the isolation of bacterial DNA the
135 pellets were resuspended in 300 µl of TES buffer (25 mM Tris, 10 mM EDTA, 50 mM sucrose)
136 containing 20 mg/ml of lysozyme (cat. no. 62971, Fluka, Sigma-Aldrich) and 15 µl of mutanolysin 1
6
137 U/μl (cat. no. M9901, Sigma-Aldrich). Then samples were incubated for 1 h at 37°C. After
138 centrifugation at 9,000×g for 1 min pellets were resuspended in 100 µl of Tris buffer (10 mM Tris HCl,
139 pH 8.5) and DNA isolation was performed by using the commercial Genomic Mini DNA Purification
140 kit (A&A Biotechnology, Gdynia, Poland) following the manufacturer’s recommendations. Isolation of
141 DNA from fungi was based on the method of DNA isolation for Saccharomyces cerevisiae (Sherman et
142 al., 1986).
143 PCR amplification. Purified DNA was used as a template for PCR amplification of the V3 variable
144 region of the prokaryotic 16S rRNA gene with primers F357 (5’-TACGGGAGGCAGCAG-3’), to
145 which a 39-bp GC sequence was linked to give rise to GC-F357, and R518 (5’-
146 ATTACCGCGGCTGCTGG-3’) (Muyzer et al., 1993). Group specific amplification of 16S rRNA for
147 the lactococci-enterococci-streptococci group and the lactobacilli-leuconostoc-pediococci group was
148 performed with the primer pairs LB2 GC-(5’-GATTYCACCGCTACACATG-3’) with LAC3 (5’-
149 AGCAGTAGGGAATCTTCGG-3’) and LB2-GC with LB1 (5’-AGCAGTAGGGAATCTTCCA-3’),
150 respectively (Endo and Okada, 2005). Finally, amplification of the D1 domain of the 26S rRNA gene of
151 fungi was obtained with primers NL1 GC-(5’-GCCATATCAATAAGCGGAGGAAAAG-3’) and LS2
152 (5’-ATTCCCAAACAACTCGACTC-3’) (Cocolin et al., 2002). PCR amplification conditions were as
153 reported by various authors.
154 Electrophoresis conditions. Amplicons were analyzed electrophoretically in 8% polyacrilamide gels
155 with 40-60% and 30-50% formamide denaturing gradients for bacteria and fungi, respectively, using a
156 DCode device (Bio-Rad, Richmond, Ca., USA). Electrophoresis proceeded at 75 V for 17 h for bacteria
157 and at 130 V for 4.5 h for yeasts and moulds.
158 Identification of DGGE bands. Bands corresponding to the most common bacterial species were
159 identified as previously reported (Flórez and Mayo, 2006) by migration in comparison to that of a
160 control ladder of known strains. Bands migrating at positions other than the control strains were
7
161 identified by DNA isolation, reamplification with the same primers without the GC clamps, sequencing
162 and comparison of the sequences against the databases.
163
164 Pyrosequencing analysis of Oscypek. In order to address the bacterial diversity, three samples of the
165 same cheese batch were analyzed by pyrosequencing.
166 Amplicon preparation. Primers for the target area were selected to span a region between 250 and
167 500 bp in length (a combination of average mean read length and maximum recommended amplicon
168 size of a 454 Life Sciences, Roche Applied Science GS FLX amplicon sequencing run). A 294-
169 nucleotide sequence of V5 and V6 region of the 16S rRNA gene (with respect to Escherichia coli 16S
170 rDNA position 786 to 1079) was amplified by PCR from the isolated DNA.
171 Fusion primers were designed in which a proprietary primer sequence (Adaptor) of the Roche GS
172 FLX sequencing technology and a sample-specific 10-nucleotide key sequence (Multiplex Identifier -
173 MID) was included, to differentiate between distinct samples. The forward primer was 5’-
174 CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGATTAGATACCCTGGTAGT-3’, where the
175 underlined sequence corresponded to the forward primer E786F (Coloqhoun, 1997) and the reverse
176 primer was 5’-
177 CCATCTCATCCCTGCGTGTCTCCGACTCAGATATCGCGAGTCACGACACGAGCTGACGAC-
178 3’, where the underlined sequence is the universal primer equivalent of E. coli position 1061 to 1079 in
179 L. lactis IL1403.
180 For each sample, a 50-µl PCR mix was prepared containing 1× PCR buffer, 200 µM
181 deoxynucleoside triphosphate mix (Fermentas, St. Leon-Rot, Germany), 0.4 µM of each primer, and
182 1.25 U of Ex Taq polymerase (Takara Bio Inc., Otsu, Shiga, Japan). To each reaction mixture, 1 µl of
183 the extracted template DNA was added. The PCR conditions used were 95°C for 5 min and 30 cycles
184 of 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min, followed by one cycle at 72°C for 7 min.
8
185 Amplicons quality check and quantity measurement. Amplicon samples were purified using
186 Ampure Beads XP (Beckman Coulter Inc., High Wycombe, UK) and run on Agilent Bioanalyzer 2100
187 to check sample quality. Amplicon DNA quantity was estimated using QuantIT Pico Green Assay
188 (Invitrogen, Carlsbad, CAL, USA). Prior to sequencing the samples were diluted to the same
189 concentration and pooled.
190 Ultra-deep amplicon sequencing on 454 GS FLX. DNA amplicons were sequenced on a GS FLX
191 (454) pyrosequencer (Roche). Samples were clonally amplified with emulsion PCR. DNA carrying
192 beads were loaded on the medium region of PTP plate (1/16) and sequenced in one direction on GS
193 FLX Titanium instrument.
194 Sequence reads for each amplicon were extracted from the resulting SFF files (standard flowgram
195 files) into FASTA format and split into separate pools based on the MIDs using the sfffile command.
196 Sequences obtained from pyrosequencing were then processed with Mothur software, version 1.7.2
197 (Schloss et al., 2009) that has implemented the algorithms cited below. In the first step reads were
198 trimmed to analyze only regions with average score over 50 bases, window of at least 35. Then, reads
199 shorter than 150 bases or with ambiguous base call (an “N”) or containing homopolymeric track longer
200 than 8 bases were removed. Afterwards, unique reads were aligned to SILVA-compatible alignment
201 database and based on this alignment potential chimeric sequences were removed using the
202 ChimeraSlayer algorithm (Haas et al., 2011). Finally, the remaining sequences were clustered into
203 OTUs (Operational Taxonomic Units) and assigned to respective taxonomic branches.
204 Structures of communities of all samples were compared using weighted and unweighted Unifrac
205 algorithm (Lozupone et al., 2007) and Yue and Clayton measure (Yue and Clayton, 2005).
206 Trimmed sequences were also used as queries with the BLASTN program (Altschul et al, 1990)
207 against NCBI’s NT database. Results from those searches were then analyzed with MEGAN software
208 (Huson et al., 2007).
9
209
210 RESULTS
211 Basic microbial analysis. Results of the count of majority and indicator microbial populations of
212 the different traditional Oscypek cheese samples analyzed in this work are summarized in Table 1.
213 Counts of total mesophilic bacteria under aerobic (in PCMA), and anaerobic (in PCMA and BHIAC)
214 conditions did not show statistical differences, similarly to counts of lactobacilli in aerobiosis and
215 anaerobiosis (both in MRSA). In general, mesophilic bacteria counts matched those obtained in
216 LM17A, which suggested that Lactococcus spp. was the dominant microorganism in all cheeses (at a
217 level of near 1.0×109 CFU/g). High numbers of Lactobacillus species were also observed in all cheese
218 samples, although at a level of one or two logarithmic units lower than those of lactococci. Dextran-
219 producing Leuconostoc were present in all samples at variable levels (ranging from 5.72 to 7.82
220 logarithmic units per gram). Yeasts and moulds were also present in all cheese samples in numbers
221 ranging from 5 to 6 logarithmic units per gram. Finally, enterobacteria populations were present at
222 similar levels as yeasts and mo