And T Cells Production in Human NK Γ Enhances IFN- IL-21 in Synergy with IL-15 Or IL-18

IL-21 in Synergy with IL-15 or IL-18 Enhances IFN- γ Production in Human NK and T Cells

This information is current as Mari Strengell, Sampsa Matikainen, Jukka Sirén, Anne of September 27, 2021. Lehtonen, Don Foster, Ilkka Julkunen and Timo Sareneva J Immunol 2003; 170:5464-5469; ; doi: 10.4049/jimmunol.170.11.5464 http://www.jimmunol.org/content/170/11/5464 Downloaded from

References This article cites 43 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/170/11/5464.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on September 27, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-␥ Production in Human NK and T Cells1

Mari Strengell,2* Sampsa Matikainen,* Jukka Sire´n,* Anne Lehtonen,* Don Foster,† Ilkka Julkunen,* and Timo Sareneva*

NK and T cell-derived IFN-␥ is a key cytokine that stimulates innate immune responses and directs adaptive T cell response toward Th1 type. IL-15, IL-18, and IL-21 have significant roles as activators of NK and T cell functions. We have previously shown that IL-15 and IL-21 induce the expression of IFN-␥, T-bet, IL-12R␤2, and IL-18R genes both in NK and T cells. Now we have studied the effect of IL-15, IL-18, and IL-21 on IFN-␥ gene expression in more detail in human NK and T cells. IL-15 clearly activated IFN-␥ mRNA expression and protein production in both cell types. IL-18 and IL-21 enhanced IL-15-induced IFN-␥ gene expression. IL-18 or IL-21 alone induced a modest expression of the IFN-␥ gene but a combination of IL-21 and IL-18 efficiently up-regulated IFN-␥ production. We also show that IL-15 activated the binding of STAT1, STAT3, STAT4, and STAT5 to the Downloaded from regulatory sites of the IFN-␥ gene. Similarly, IL-21 induced the binding of STAT1, STAT3, and STAT4 to these elements. IL-15- and IL-21-induced STAT1 and STAT4 activation was verified by immunoprecipitation with anti-phosphotyrosine Abs followed by Western blotting with anti-STAT1 and anti-STAT4 Abs. IL-18 was not able to induce the binding of STATs to IFN-␥ gene regulatory sites. IL-18, however, activated the binding of NF-␬B to the IFN-␥ promoter NF-␬B site. Our results suggest that both IL-15 and IL-21 have an important role in activating the NK cell-associated innate immune response. The Journal of Immu- nology, 2003, 170: 5464–5469. http://www.jimmunol.org/

he immune system of vertebrates is composed of innate KO mice (16). In addition, IL-18 is an important cofactor in IFN-␥ and adaptive immunity. Innate immunity represented by gene activation and it is required for both bacteria- and virus- T dendritic cells, macrophages, and NK cells exhibits early induced IFN-␥ production (5, 8, 17–19). IL-21 is structurally re- response to foreign Ags without previous sensitization. IFN-␥ has lated to IL-15 and its receptor is expressed mainly on B, NK, and an important role in the activation of both innate and adaptive T cells (20). In contrast to IL-15R KO mice, NK and T cells of immunity. During early phases of infection, NK cell-derived IL-21R KO mice develop normally (21). However, these mice IFN-␥ activates macrophages and promotes adaptive Th1 immu- have impaired NK cell functions (21). The common cytokine re- ␥ ␥ by guest on September 27, 2021 nity (1, 2). Direct cellular interaction with APCs and NK or T cells ceptor -chain ( c), shared by the receptors for IL-2, IL-4, IL-7, enhances the production of IFN-␥ (3). IFN-␥ is also produced in IL-9, and IL-15, is also a functional component of the IL-21R response to cytokines secreted by macrophages. In response to complex (22, 23). Therefore, it is not surprising that IL-21 acti- microbial infection, macrophages produce IFN-␣␤, IL-12, IL-15, vates the Janus kinase/STAT pathway. In contrast to IL-15, which and IL-18, which stimulate NK cell-derived IFN-␥ production utilizes STAT5 in signaling, IL-21 preferentially activates STAT3 (4–9). (22, 24, 25). IL-15, IL-18, and IL-21 are cytokines that have important func- In the present study, we investigated the role of IL-15, IL-18, tions in NK and T cells. IL-15 and IL-18 are macrophage-derived and IL-21 in the regulation of IFN-␥ gene expression in human NK cytokines while IL-21 is mainly produced by activated T cells (10, and T cells. Our results suggest that synergistic interactions be- 11). IL-15 is essential for peripheral T cell maturation and studies tween IL-15, IL-18, and IL-21 play an important role in NK and T with IL-15 and IL-15R knockout (KO)3 mice have shown that the cell functions by enhancing IFN-␥ gene expression. lack of functional IL-15 system leads also to a severe reduction in NK cell numbers (12–14). In contrast, IL-15-transgenic mice suffer from fatal leukemia due to early expansions in NK and memory Materials and Methods ϩ CD8 T cells (15). NK cell responses are also impaired in IL-18 T cell culture Leukocyte-rich buffy coats were obtained from healthy blood donors (Finn- *Department of Microbiology, National Public Health Institute, Helsinki, Finland; ish Red Cross Blood Transfusion Service, Helsinki, Finland). Mononuclear and †Department of Cytokine Biology, ZymoGenetics, Seattle, WA 98102 cells were isolated by density gradient centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech, Uppsala, Sweden). Monocytes were re- Received for publication November 8, 2002. Accepted for publication March 31, 2003. moved by adherence and T cells were further purified by nylon wool columns. The purity of T cells was ensured by FACS analysis using anti-CD3, The costs of publication of this article were defrayed in part by the payment of page anti-CD14, anti-CD19, and anti-CD56 mAbs (Caltag Laboratories, Burlin- charges. This article must therefore be hereby marked advertisement in accordance game, CA). The T cell population was pure, except it contained ϳ10% with 18 U.S.C. Section 1734 solely to indicate this fact. CD56ϩ NK cells. Purified T cells were activated with 0.5 ␮g/ml anti-CD3 1 This work was supported by the Medical Research Council of the Academy of and 0.5 ␮g/ml anti-CD28 mAbs (R&D Systems, Abingdon, U.K.) and were Finland, the Sigrid Juselius Foundation, and the Finnish Cancer Foundations. cultured in RPMI 1640 medium supplemented with 10% FCS (Integro, 2 Address correspondence and reprint requests to Dr. Mari Strengell, Department of Zaandam, The Netherlands), 20 mM HEPES, 2 mM L-glutamine, 0.6 Microbiology, National Public Health Institute, Mannerheimintie 166, FIN-00300 ␮g/ml penicillin, 60 ␮g/ml streptomycin, and 100 IU/ml human rIL-2 Helsinki, Finland. E-mail address: mari.strengell@ktl.fi (R&D Systems) for 5–6 days. T cells were then expanded for 5–6 days in 3 ␥ ␥ Abbreviations used in this paper: KO, knockout; GAS, IFN- -activated site; c, RPMI 1640 supplemented with 100 IU/ml human rIL-2. In each experi- common ␥-chain. ment, T cells from two to four donors were used.

Purification of NK cells from PBMCs Nonidet P-40) supplemented with protease inhibitors, 1 mM NaF, and 1 ϩ mM NaVO4. Cleared cell lysates were immunoprecipitated at 4°C for Mononuclear cells were isolated by density gradient centrifugation as de- 18 h with anti-phosphotyrosine Abs: anti-phosphotyrosine (4G10) agarose scribed above using Ficoll-Paque. NK cells were purified from nonadherent conjugate (Upstate Biotechnology, Lake Placid, NY), phosphotyrosine- PBMCs by nylon wool columns and two-step density gradient centrifuga- RC20: biotin (Transduction Laboratories, Lexington, KY), and Immuno- tion by Percoll (Amersham Pharmacia Biotech), followed by purification Pure immobilized streptavidin (Pierce, Rockford, IL). After washing, the with magnetic beads coated with anti-CD3, anti-CD14, and anti-CD19 Abs precipitated proteins were released to SDS sample buffer and separated on (Dynal Biotech, Oslo, Norway). As determined by flow cytometry with 10% SDS-PAGE. Proteins in gel were transferred onto Immobilon-P mem- Ͼ anti-CD3 and anti-CD56 Abs, NK cells were 90% pure. branes (Millipore) and visualized with anti-STAT1 and anti-STAT4 Abs (Santa Cruz Biotechnology). NK cell line The human NK-92 cell line was maintained in continuous culture in Results ␣MEM medium (Life Technologies, Grand Island, NY) supplemented with Synergistic effects of IL-15, IL-18, and IL-21 on IFN-␥ 12% horse serum (Life Technologies), 12% FCS, 0.2 mM L-inositol, 20 production in human NK and T cells mM folic acid, 40 mM 2-ME, 2 mM L-glutamine, antibiotics, and 100 IU/ml rIL-2. We have previously shown that IL-15 or IL-21 stimulation of ␥ Cytokines NK-92 and T cells enhances their IFN- mRNA synthesis (25). However, in vivo cytokines often appear simultaneously and may Human rIL-15 and rIL-18 were purchased from R&D Systems. The cyto- thus have synergistic effects on their target cells. We stimulated kine concentrations used, unless otherwise indicated, were 5 ng/ml for IL-15 and 10 ng/ml for IL-18 and IL-21 (ZymoGenetics, Seattle, WA). Downloaded from IFN-␥ ELISA Supernatants from cytokine-stimulated cells were analyzed for IFN-␥ production by ELISA using matched Ab pairs for IFN-␥ (Diaclone, Besan- cone, France) according to the manufacturer’s recommended procedure. The sensitivity limit in the ELISA was 20 pg/ml using human rIFN-␥ (Diaclone) as a standard. http://www.jimmunol.org/ RNA isolation and Northern blot analysis NK-92 or T cells were treated with different cytokines for 3 h. The cells were collected and total cellular RNA was isolated as previously described (26). Equal amounts of RNA (10 ␮g) were size fractionated on a 1% formaldehyde-agarose gel, transferred to a nylon membrane (Hybond; Am- ersham, Buckinghamshire, U.K.), hybridized with an IFN-␥ probe (27), and labeled with [␣-32P]dCTP (3000 Ci/mmol; Amersham) using a random primed DNA labeling kit (Boehringer Mannheim, Mannheim, Germany). Ethidium bromide staining of ribosomal RNA bands was used to ensure equal RNA loading. The membranes were hybridized under conditions of by guest on September 27, 2021 high stringency (50% formamide, 5ϫ Denhardt’s solution, 5ϫ SSPE, and 0.5% SDS), washed twice at room temperature and once at 60°Cin1ϫ SSC/0.1% SDS for 30 min each time, and exposed to Kodak AR X-Omat films at Ϫ70°C using intensifying screens. Oligonucleotide DNA precipitation The NK-92 cell line or primary NK and T cells were stimulated with IL-15, IL-18, or IL-21 as indicated in the figures and figure legends. The cells were harvested, washed, and lysed in a buffer containing 10 mM HEPES, 400 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton

X-100, 0.5 mM DTT, 1 mM NaVO4, and protease inhibitors (Complete; Roche, Basel, Switzerland). Cleared cell lysates were incubated with streptavidin-agarose beads coupled to 5Ј-biotinylated oligonucleotides; IFN-␥ promoter IFN-␥ activation site (GAS) (5Ј-GGATCCAGTCCTTGAATGGT GTGAAGTAAAAGTGCCTTCAAAGAATCCC), mutated IFN-␥ promoter GAS (5Ј-GGATCCAGTCCTTGAATGGTGTGAAGTAAAAGTGCCT*CA AAcAATCCC), IFN-␥ ﬁrst intron GAS (5Ј-GGATCCTGTTTAAAAATTT TAAGTGAATTTTTTGAGTTTCTTTTAAAATTTT), or NF-␬B(5Ј-GGA TCCCACTGGGTCTGGAACTCCCCCTGGGAATATTCTCT) oligonucleotides (DNA Technology, Aarhus, Denmark). The binding reactions were per- formed for2hatϩ4°C in binding buffer containing 10 mM HEPES, 133 mM KCl, 10% glycerol, 2 mM EDTA, 1 mM EGTA, 0.01% Triton X-100, 0.5 mM

DTT, 1 mM NaVO4, and protease inhibitors. After washing, the oligonucleotide-bound proteins were released in SDS sample buffer, separated on 10% SDS-PAGE, and transferred onto Immobilon-P membranes (Millipore, Bed- ford, MA). Rabbit-anti-STAT1, anti-STAT3, anti-STAT4, anti-STAT5 Abs (IFN-␥ GAS precipitated) or anti-p50 and anti-p65 Abs (NF-␬B precipitated; all from Santa Cruz Biotechnology) were allowed to bind for1hatroom temperature in PBS containing 5% nonfat milk. Peroxidase-conjugated goat FIGURE 1. IFN-␥ production in NK and T cells in response to IL-15, anti-rabbit IgG (1/2000 dilution; DAKO, Glostrup, Denmark) was allowed to IL-18, or IL-21. Primary human NK cells (A), NK-92 cell line (B), or bind for1hatroom temperature and the proteins on membranes were visu- primary T cells (C) were stimulated for 24 h with IL-15, IL-18, or IL-21 or alized by the ECL system (Amersham). with their combinations. IFN-␥ levels in cell culture supernatants were determined by ELISA. The results from primary NK cells are from seven Anti-phosphotyrosine analysis individual blood donors and NK-92 and T cells represent three separate Cytokine-stimulated cells were collected and lysed in modiﬁed RIPA experiments. Note that the scale is different in A (picograms per milliliter) buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, and 1% than in B or C (nanograms per milliliter). 5466 ENHANCED IFN-␥ PRODUCTION BY IL-21

NK-92 cells, human primary NK, and T cells with IL-15, IL-18, 3B). IL-21-induced STAT4 binding to the IFN-␥ promoter GAS and IL-21 alone or in different combinations and analyzed the pro- was modest compared with that of STAT3 and diminished after duction of IFN-␥ at protein level. In primary NK cells, IFN-␥ 1 h. IL-21 was not able to induce any detectable STAT5 binding production was clearly up-regulated by IL-15, whereas IL-18 or (Fig. 3, A and B). Primary NK cells were stimulated with IL-15 or IL-21 had a modest enhancing effect on IFN-␥ production (Fig. IL-21 for 1 h and the proteins in whole-cell lysates were precipi- 1A). IL-15 in combination with IL-18 or IL-21 strongly enhanced tated using the IFN-␥ promoter GAS oligonucleotide. IL-21 en- IFN-␥ production. Similarly, IL-21 plus IL-18 enhanced the IFN-␥ hanced STAT1, STAT3, and STAT4 binding to IFN-␥ promoter production in primary NK cells (Fig. 1A). GAS (Fig. 3C). IL-21-induced STAT3 DNA binding was more In NK-92 (Fig. 1B) and T cells (Fig. 1C), IL-15, IL-18, or IL-21 efficient compared with those of STAT1 or STAT4. STAT5 bind- alone induced IFN-␥ production. IL-21 plus IL-15 enhanced IFN-␥ ing to the IFN-␥ promoter GAS was induced by IL-15 but not by production in both cell types significantly, similarly to that seen in IL-21 in primary NK cells. primary NK cells. IL-21 plus IL-18 enhanced IFN-␥ production In T cells, IL-15 efficiently stimulated STAT5 binding to the compared with that of either cytokine alone. In all cell types, the IFN-␥ promoter and first intron GAS. The induction remained at a combination of IL-15 plus IL-18 was the most efficient up-regu- high level for 24 h. In addition, IL-15 induced STAT1, STAT3, lator of IFN-␥ production. and STAT4 binding to both elements (Fig. 4). IL-21 induced We also examined cytokine-induced IFN-␥ production at STAT1 and especially STAT3 binding to the IFN-␥ promoter and mRNA level in NK-92 cells and activated T cells. IL-15 induced first intron GAS that lasted up to 24 h (Fig. 4A). IL-21-induced clear IFN-␥ mRNA expression in NK-92 cells whereas IL-18- or STAT4 binding was clearly detectable at 1 h after cytokine stim-

IL-21-induced IFN-␥ mRNA synthesis was not detectable (Fig. 2). ulation with both of these elements (Fig. 4). Downloaded from In T cells, all three cytokines alone weakly induced IFN-␥ expres- ␥ sion. IL-15 plus IL-18 or IL-18 plus IL-21 had a synergistic effect Mutations in the IFN- gene promoter GAS inhibits on IFN-␥ mRNA expression in both cell types. IL-21 also en- cytokine-induced STAT DNA binding hanced IL-15-induced IFN-␥ mRNA synthesis (Fig. 2). To verify the specificity of cytokine-induced STAT DNA binding, we conducted oligonucleotide binding experiments with the mu- IL-15 and IL-21 activate STAT DNA binding to IFN-␥ tated IFN-␥ promoter GAS element as described in Materials and http://www.jimmunol.org/ regulatory elements Cytokine-induced IFN-␥ gene expression in NK and T cells re- quires the activation of the Janus kinase-STAT signaling pathway. Phosphorylated STATs can interact with specific STAT binding sites in the regulatory elements of the IFN-␥ gene (28), which then initiates IFN-␥ mRNA synthesis. To reveal which of the STAT molecules would be responsible for initiating IFN-␥ mRNA synthesis, we conducted oligonucleotide binding experiments with the IFN-␥ gene promoter and first intron GAS sites. NK-92 cells were by guest on September 27, 2021 stimulated with IL-15 or IL-21 for 1, 3, 9, or 24 h and the proteins in whole-cell lysates were precipitated using the GAS oligonucleotides from the IFN-␥ promoter and the first intron. IL-15 clearly activated STAT1, STAT3, STAT4, and STAT5 binding to both of these elements (Fig. 3, A and B). IL-21 induced STAT3 DNA binding to the IFN-␥ gene promoter and first intron GAS (Fig. 3, A and B). In addition, IL-21 induced STAT1 and STAT4 binding to the IFN-␥ promoter GAS (Fig. 3A) and first intron GAS (Fig.

FIGURE 3. IL-15- and IL-21-induced STAT DNA binding to the IFN-␥ promoter GAS and first intron GAS elements in NK-92 cell line and primary NK cells. NK-92 cells were stimulated for different time periods with IL-15 or IL-21. The cells were collected and proteins in whole-cell lysates were precipitated with IFN-␥ promoter GAS (A) or IFN-␥ first intron GAS FIGURE 2. IL-21 in combination with IL-15 or IL-18 induce IFN-␥ (B) oligonucleotides. C, Primary NK cells were left untreated or stimulated mRNA synthesis in NK-92 and T cells. NK-92 cell line or T cells from four for 1 h with IL-15 or IL-21, after which the cells were collected and pro- individual blood donors were stimulated with IL-15, IL-18, or IL-21 as teins in whole-cell lysates were precipitated with the IFN-␥ gene promoter indicated. The cells were collected at 3 h after stimulation, prepared for GAS oligonucleotides. The precipitated proteins were analyzed by Western Northern blotting, and analyzed by IFN-␥ probe. Ethidium bromide stain- blotting using anti-STAT1, STAT3, STAT4, or STAT5 Abs. The experi- ing of ribosomal RNA bands was used to ensure equal RNA loading. ment was repeated twice with consistent results. The Journal of Immunology 5467 Downloaded from FIGURE 4. IL-21 induces STAT3 binding to the IFN-␥ gene promoter GAS (A) and first intron GAS (B) in T cells. T cells from two to four individual blood donors were stimulated with IL-15 or IL-21 for 1–24 h. The cells were harvested at indicated time points and proteins in whole-cell FIGURE 6. IL-15 and IL-18 induce NF-␬B binding to IFN-␥ promoter lysates were oligonucleotide DNA precipitated with IFN-␥ promoter GAS NF-␬B site in NK-92 cells. The cells were stimulated for different time and IFN-␥ first intron GAS oligonucleotides. The precipitated proteins periods with IL-15, IL-18, or IL-21, collected, and proteins in whole-cell were analyzed by Western blotting using anti-STAT1, anti-STAT3, anti- lysates were precipitated with oligonucleotide containing the IFN-␥ gene http://www.jimmunol.org/ STAT4, or anti-STAT5 Abs. The results are representative of three sepa- promoter NF-␬B site. The precipitated proteins were analyzed by Western rate experiments. blotting using anti- NF-␬B p50 (A) or anti- NF-␬B p65 Abs (B).

Methods. NK-92 cells were stimulated with IFN-␣, IL-12, IL-15, or IL-21 for 1 h and the proteins from whole-cell lysates were oligonucleotides from the IFN-␥ promoter NF-␬B site. As shown precipitated using either wild-type or mutated IFN-␥ promoter in Fig. 6, IL-18 induced NF-␬B p50 and p65 binding to the IFN-␥ GAS oligonucleotides. IFN-␣, IL-12, IL-15, and IL-21-induced promoter already at 1 h after cytokine stimulation (Fig. 6). IL-15 STAT DNA binding was also almost completely inhibited by two by guest on September 27, 2021 ␥ mutations in the IFN-␥ promoter GAS (Fig. 5). induced p50 and p65 binding to the IFN- promoter with delayed kinetics compared with that of IL-18. IL-15-induced NF-␬B bind- IL-18 induces NF-␬B binding to the IFN-␥ gene promoter ing was seen at 3 h after cytokine stimulation and was detectable It has been shown earlier that IL-18 in synergy with IL-12 up- up to 24 h. IL-21 was not able to induce the binding of p50 or p65 ␥ ␬ regulates the IFN-␥ gene expression by enhanced binding activity proteins to the IFN- promoter NF- B site. of AP-1 (29). In addition to c-Jun/AP-1, IL-18 also activates the NF-␬B signaling pathway (30). To analyze whether IL-18 induces NF-␬B binding, NK-92 cells were stimulated with IL-15, IL-18, or IL-21 for different times and the proteins were precipitated using

FIGURE 5. Mutant IFN-␥ promoter GAS does not bind cytokine-in- FIGURE 7. IL-15 and IL-21 induce tyrosine phosphorylation of STAT1 duced STATs. IFN-␥ promoter GAS was mutated by deleting one nucle- and STAT4 in NK-92 and T cells. NK-92 cells (A) or T cells (B) were otide and by replacing one guanine with cysteine. NK-92 cells were stim- stimulated with IFN-␣, IL-15, or IL-21. The cells were collected, cell ly- ulated with IFN-␣, IL-12, IL-15, or IL-21 for 1 h. The cells were harvested sates were prepared, and proteins in cell lysates were immunoprecipitated and proteins in whole-cell lysates were oligonucleotide DNA precipitated with anti-phosphotyrosine Abs. Immunoprecipitated proteins were sepa- with IFN-␥ promoter GAS (A) or mutated IFN-␥ promoter GAS (B) oli- rated on 10% SDS-PAGE, transferred to membranes, and stained with gonucleotides. The precipitated proteins were analyzed by Western blotting anti-STAT1 or anti-STAT4 Abs. A representative of three separate exper- using anti-STAT1, anti-STAT3, anti-STAT4, or anti-STAT5 Abs. iments is shown. 5468 ENHANCED IFN-␥ PRODUCTION BY IL-21

IL-15 and IL-21 activate STAT1 and STAT4 tyrosine STAT1, STAT3, and STAT4 to the same element. Our results phosphorylation suggest that IL-15- and IL-21-activated STATs are involved in the ␥ The primary STATs activated by IL-15 and IL-21 appear to be activation of the IFN- gene expression. In contrast to IL-15 and STAT5 and STAT3, respectively. Since IL-15 and IL-21 also in- IL-21, IL-18 was not able to induce any STAT DNA binding to ␥ duced STAT1 and STAT4 DNA binding to the IFN-␥ gene regu- IFN- regulatory elements (data not shown). Instead, IL-18 in- ␬ ␥ ␬ latory sites, we veriﬁed STAT1 and STAT4 activation with anti- duced NF- B binding to IFN- promoter NF- B site. Therefore, it phosphotyrosine analysis. NK-92 and T cells were stimulated with may be that IL-15- or IL-21-activated STATs and IL-18-induced ␬ ␥ IL-15 or IL-21 and proteins in control cell and cytokine-stimulated NF- B are needed for the full activation of IFN- gene cell lysates were immunoprecipitated with anti-phosphotyrosine transcription. Abs followed by Western blot analysis with anti-STAT1 and anti- IL-12 plays an important role in modulating both innate and ␥ STAT4 Abs. As a control, cells were stimulated with IFN-␣, which adaptive immune responses. IL-12 induces IFN- production in is known to activate multiple STAT proteins in lymphocytes (26). NK and T cells and it is the major cytokine driving Th1 differen- As shown in Fig. 7, in unstimulated NK-92 cells (Fig. 7A)orinT tiation (37, 38). IL-12 utilizes STAT4 in signaling and the Th1 cells (Fig. 7B), tyrosine-phosphorylated STAT1 was detected at a response is severely impaired in STAT4 KO mice (39, 40). STAT4 ␥ basal level but IFN-␣, IL-15, and IL-21 further enhanced the phos- contributes to the regulation of IFN- directly by binding to DNA ␥ phorylation of STAT1 (Fig. 7). IFN-␣, IL-15, and IL-21 stimula- sequences in the IFN- promoter to increase gene transcription. ␥ tion clearly induced tyrosine phosphorylation of STAT4 (Fig. 7). However, STAT4 affects IFN- expression and thus innate immunity and also the Th1 response indirectly by serving as an essential

mediator for IL-12-induced up-regulation of IL-12R, IL-18R, and Downloaded from Discussion myeloid differentiation factor MyD88 (41). We have previously Previous studies have shown that IL-15, IL-18, and IL-21 have shown that both IL-15 and IL-21 enhance innate immune response important roles in NK and T cell functions. IL-21 is a recently by inducing IFN-␥, IL-12R␤2, and IL-18R gene expression in hu- identiﬁed, T cell-derived cytokine related to IL-2, IL-4, and IL-15 man NK cells (25). In contrast to NK cells, it was recently shown (11). The IL-2/IL-15R␤ subunit is closely related to IL-21R and, in that IL-21 inhibits IFN-␥ production from developing Th1 cells in

␥ http://www.jimmunol.org/ addition, IL-21R shares the common cytokine receptor c with mice (42). In addition, we and others have shown that IL-15 and IL-15R (20). Despite the shared receptors, IL-15 and IL-21 acti- IL-21 activate STAT5 and STAT3 in NK cells, respectively. Our vate different transcription factors and have diverse effects on dif- results here show that both IL-15 and IL-21 induce the binding of ferent cell types. IL-15 induces the activation of STAT5 in NK and STAT4 to the IFN-␥ gene regulatory sites as well as tyrosine phos- T cells (24), whereas IL-21 preferentially activates STAT3 (22, phorylation of STAT4. Interestingly, Wang et al. (43) have shown 25). IL-21 has been shown to promote cytotoxicity and IFN-␥ that IL-2, a cytokine related to IL-15 and IL-21, is also able to activate production of NK cells. On the other hand, IL-21 has been shown STAT4 in NK cells. Our results show that IL-15- and IL-21-induced to inhibit IL-15-induced proliferation of unstimulated NK cells. STAT4 activation is weaker compared with that of IL-12 (Fig. 5). Therefore, it may be that IL-21 is involved in the transition of However, the production of biologically active IL-12 has been re- immune response from innate to adaptive immunity (21). ported only in a few virus infections. IL-15 is produced by macro- by guest on September 27, 2021 IFN-␥ is a cytokine regulating innate immunity and the devel- phages during viral infections and T cell-derived IL-21 production is opment of adaptive Th1 immune response (31, 32). Macrophage- triggered by macrophages via presentation of viral Ags. It is thus derived IFN-␣, IL-12, and IL-18 have been shown to be important possible that IL-15- or IL-21-induced STAT4 activation contributes to regulators of IFN-␥ gene expression. Individually these cytokines NK cell-derived IFN-␥ production during early phases of viral induce IFN-␥ production relatively poorly. However, IL-18 com- infections. bined with IFN-␣ or IL-12 effectively activates IFN-␥ production In vivo, cytokines are usually present simultaneously in sites of both in NK and T cells (4, 5, 7, 33, 34). In the present report, we infection and their synergistic effects have often an important role have studied the effect of IL-15 and IL-21 on IFN-␥ gene expres- in controlling immune responses. In summary, we demonstrate sion. IL-18 was included in our studies since it is required for here that IL-15, IL-18, and IL-21 in different combinations en- IFN-␥ gene activation both in bacterial and viral infections (5, 8, hance IFN-␥ production in human NK and T cells. The results 17, 18). We show that IL-15 alone is a more potent up-regulator of suggest an important role for IL-15 and IL-21 in the activation of IFN-␥ production compared with IL-21 in human NK and T cells. an innate immune response. In addition, IL-15 and IL-21 may However, IL-15-induced IFN-␥ mRNA synthesis and protein produc- serve as mediator cytokines in the transition of an immune re- tion was clearly enhanced by IL-18 and IL-21. IL-18 or IL-21 alone sponse from innate to adaptive immunity. was weak inducers of IFN-␥ production but the combination of IL-18 ␥ and IL-21 induced a marked activation of IFN- gene expression. Our Acknowledgments results suggest that synergistic actions of IL-15, IL-18, and IL-21 are We thank Hanna Valtonen and Teija Westerlund for expert technical important in activating early NK cell responses. assistance. The IFN-␥ gene has multiple binding sites for different transcription factors including AP-1, NF-␬B, and NFAT, which all contribute to the activation of the IFN-␥ gene transcription in re- References sponse to TCR and/or cytokine stimulation (2, 28, 29, 35, 36). In 1. Le Page, C., P. Genin, M. Baines, and J. Hiscott. 2000. Interferon activation and ␥ innate immunity. Rev. Immunogen. 2:374. addition, the IFN- gene has putative STAT binding sites in its 2. Julkunen, I., S. Matikainen, M. Miettinen, and T. Sareneva. 1999. Regulation of promoter region as well as in the ﬁrst and third intron of the IFN-␥ IFN-␥ gene expression during microbial infections. Rec. Res. Dev. Immunol. gene and IFN-␥ GAS residing in the promoter has two consensus 1:185. 3. Das, S., C. Varalakshmi, A. L. Kumari, M. Patel, and A. Khar. 2001. Target cell binding sites for STATs (28). We have previously shown that both induced activation of NK cells in vitro: cytokine production and enhancement of IFN-␣ and IL-12 activate STAT4 binding to IFN-␥ GAS in human cytotoxic function. Cancer Immunol. 50:428. NK cells (4). In this study, we show that IL-15 activates the bind- 4. Matikainen, S., A. Paananen, M. Miettinen, M. Kurimoto, T. Timonen, ␥ I. Julkunen, and T. Sareneva. 2001. IFN-␣ and IL-18 synergistically enhance ing of STAT1, STAT3, STAT4, and STAT5 to IFN- GAS in IFN-␥ production in human NK cells: differential regulation of Stat4 activation human NK and T cells. Similarly, IL-21 induced the binding of and IFN-␥ gene expression by IFN-␣ and IL-12. Eur. J. Immunol. 31:2236. The Journal of Immunology 5469

5. Sareneva, T., S. Matikainen, M. Kurimoto, and I. Julkunen. 1998. Inﬂuenza A 24. Johnston, J. A., C. M. Bacon, D. S. Finbloom, R. C. Rees, D. Kaplan, K. Shibuya, virus-induced IFN-␣/␤ and IL-18 synergistically enhance IFN-␥ gene expression J. R. Ortaldo, S. Gupta, Y. Q. Chen, and J. D. Giri. 1995. Tyrosine phosphory- in human T cells. J. Immunol. 160:6032. lation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 6. Lauwerys, B. R., N. Garot, J.-C. Renauld, and F. A. Houssiau. 2000. Cytokine 15. Proc. Natl. Acad. Sci. USA 92:8705. production and killer activity of NK/T-NK cells derived with IL-2, IL-15, or the 25. Strengell, M., T. Sareneva, D. Foster, I. Julkunen, and S. Matikainen. 2002. IL-21 combination of IL-12 and IL-18. J. Immunol. 165:1847. up-regulates the expression of genes associated with innate immunity and Th1 7. Fehniger, T. A., M. H. Shah, M. J. Turner, J. B. VanDeusen, S. P. Whitman, response. J. Immunol. 169:3600. M. A. Cooper, K. Suzuki, M. Wechser, F. Goodsaid, and M. A. Caligiuri. 1999. 26. Matikainen, S., T. Sareneva, T. Ronni, A. Lehtonen, P. J. Koskinen, and Differential cytokine and chemokine gene expression by human NK cells fol- I. Julkunen. 1999. Interferon-␣ activates multiple STAT proteins and up-regu- lowing activation with IL-18 or IL-15 in combination with IL-12: implications for lates proliferation-associated IL-2Ra,c-myc, and pim-1 genes in human T cells. the innate immune response. J. Immunol. 162:4511. Blood 93:1980. 8. Nakanishi, K., T. Yoshimoto, H. Tsutsui, and H. Okamura. 2001. Interleukin-18 27. Sareneva, T., J. Pirhonen, K. Cantell, N. Kalkkinen, and I. Julkunen. 1994. Role regulates both Th1 and Th2 responses. Ann. Rev. Immunol. 19:423. of N-glycosylation in the synthesis, dimerization and secretion of human inter- 9. Nguyen, K. B., W. T. Watford, R. Salomon, S. R. Hofmann, G. C. Pien, feron-␥. Biochem. J. 303:831. A. Morinobu, M. Gadina, J. J. O’Shea, and C. A. Biron. 2002. Critical role for 28. Xu, X., Y.-L. Sun, and T. Hoey. 1996. Cooperative DNA Binding and sequence- STAT4 activation by type 1 interferons in the interferon-␥ response to viral selective recognition conferred by the STAT amino-terminal domain. Science infection. Science 297:2063. 273:794. 10. Carson, W. E., T. A. Fehniger, S. Haldar, K. Eckhert, M. J. Lindemann, C. F. Lai, 29. Nakahira, M., H. J. Ahn, W. R. Park, P. Gao, M. Tomura, C. S. Park, T. Hamaoka, C. M. Croce, H. Baumann, and M. A. Caligiuri. 1997. A potential role for in- T. Ohta, M. Kurimoto, and H. Fujiwara. 2002. Synergy of IL-12 and IL-18 for IFN-␥ terleukin-15 in the regulation of human natural killer cell survival. J. Clin. Invest. gene expression: IL-12-induced STAT4 contributes to IFN-␥ promoter activation by 99:937. up-regulating the binding activity of IL-18-induced activator protein 1. J. Immunol. 11. Parrish-Novak, J., S. R. Dillon, A. Nelson, A. Hammond, C. Sprecher, J. A. Gross, 168:1146. J. Johnston, K. Madden, W. Xu, J. West, et al. 2000. Interleukin 21 and its receptor 30. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, are involved in NK cell expansion and regulation of lymphocyte function. Nature S. Menon, R. Kastelein, F. Bazan, and A. O’Garra. 1997. IGIF does not drive Th1 408:57. development but synergizes with IL-12 for interferon-␥ production and activates Downloaded from 12. Becker, T. C., E. J. Wherry, D. Boone, K. Murali-Krishna, R. Antia, A. Ma, and IRAK and NF␬B. Immunity 7:571. R. Ahmed. 2002. Interleukin 15 is required for proliferative renewal of virus- 31. Boehm, U., T. Klamp, M. Groot, and J. C. Howard. 1997. Cellular responses to speciﬁc memory CD8 T cells. J. Exp. Med. 195:1541. interferon-␥. Annu. Rev. Immunol. 15:749. 13. Goldrath, A. W., P. V. Sivakumar, M. Glaccum, M. K. Kennedy, M. J. Bevan, 32. Shtrichman, R., and C. E. Samuel. 2001. The role of ␥ interferon in antimicrobial C. Benoist, D. Mathis, and E. A. Butz. 2002. Cytokine requirements for acute and immunity. Curr. Opin. Microbiol. 4:251. basal homeostatic proliferation of naive and memory CD8ϩ T cells. J. Exp. Med. 33. Okamura, H., H. Tsutsi, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, 195:1515. K. Torigoe, T. Okura, Y. Nukada, and K. Hattori. 1995. Cloning of a new cy- 14. Kennedy, M. K., M. Glaccum, S. N. Brown, E. A. Butz, J. L. Viney, M. Embers, tokine that induces IFN-␥ production by T cells. Nature 378:88.

N. Matsuki, K. Charrier, L. Sedger, C. R. Wilis, et al. 2000. Reversible defects http://www.jimmunol.org/ 34. Ushio, S., M. Namba, T. Okura, K. Hattori, Y. Nukada, K. Akita, F. Tanabe, in natural killer and memory CD8 T cell lineages in interleukin 15-deﬁcient mice. K. Konishi, M. Micallef, M. Fujii, et al. 1996. Cloning of the cDNA for human J. Exp. Med. 191:771. IFN-␥-inducing factor, expression in Escherichia coli, and studies on the biologic 15. Fehniger, T. A., K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, activities of the protein. J. Immunol. 156:4274. S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, and M. A. Caligiuri. 2001. 35. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, and Fatal leukemia in interleukin 15 transgenic mice follows early expansions in ␬ natural killer and memory phenotype CD8ϩ T cells. J. Exp. Med. 193:219. H. A. Young. 1997. Interaction of NF- B and NFAT with the interferon-gamma 16. Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, promoter. J. Biol. Chem. 272:30412. H. Okamura, K. Nakanishi, and S. Akira. 1998. Defective NK cell activity and 36. Young, H. A. 1996. Regulation of interferon-gamma gene expression. J. Inter- Th1 response in IL-18-deﬁcient mice. Immunity 8:383. feron Cytokine Res. 16:563. 17. Pirhonen, J., T. Sareneva, M. Kurimoto, I. Julkunen, and S. Matikainen. 1999. 37. Lamont, A. G., and L. Adorini. 1996. IL-12: a key cytokine in immune regula- Virus infection activates IL-1␤ and IL-18 production in human macrophages by tion. Immunol. Today 17:214.

a caspase-1-dependent pathway. J. Immunol. 162:7322. 38. Trinchieri, G., and F. Gerosa. 1996. Immunoregulation by interleukin-12. J. Leu- by guest on September 27, 2021 18. Pien, G. C., A. R. Satoskar, K. Takeda, S. Akira, and C. A. Biron. 2000. Cutting kocyte Biol. 59:505. edge: selective IL-18 requirements for induction of compartmental IFN-␥ re- 39. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, sponses during viral infection. J. Immunol. 165:4787. R. T. Carson, M. Y. Sangster, D. A. Vignali, P. C. Doherty, G. C. Grosveld, and 19. Akira, S. 2000. The role of IL-18 in innate immunity. Curr. Opin. Immunol. J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12-mediated responses of 12:59. natural killer and T cells. Nature 382:171. 20. Ozaki, K., K. Kikly, D. Michalovich, P. R. Young, and W. J. Leonard. 2000. 40. Kaplan, M. H., Y. L. Sun, T. Hoey, and M. J. Grusby. 1996. Impaired IL-12 Cloning of a type I cytokine receptor most related to the IL-2 receptor ␤ chain. responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature Proc. Natl. Acad. Sci. USA 97:11439. 382:174. 21. Kasaian, M. T., M. J. Whitters, L. L. Carter, L. D. Lowe, J. M. Jussif, B. Deng, 41. Lawless, V. A., S. Zhang, O. N. Ozes, H. A. Bruns, I. Oldham, T. Hoey, K. A. Johnson, J. S. Witek, M. Senices, R. F. Konz, et al. 2002. IL-21 limits NK M. J. Grusby, and M. H. Kaplan. 2000. Stat4 regulates multiple components of cell responses and promote antigen-specific T cell activation: a mediator of the IFN-␥-inducing signaling pathways. J. Immunol. 165:6803. transition from innate to adaptive immunity. Immunity 16:559. 42. Wurster, A. L., V. L. Rodgers, A. R. Satoskar, M. J. Whitters, D. A. Young, 22. Asao, H., C. Okuyama, S. Kumaki, N. Ishii, S. Tsuchiya, D. Foster, and M. Collins, and M. J. Grusby. 2002. Interleukin 21 is a T helper (Th) cell 2 K. Sugamura. 2001. Cutting edge: the common ␥-chain is an indispensable sub- cytokine that specifically inhibits the differentiation of naive Th cells into inter- unit of the IL-21 receptor complex. J. Immunol. 167:1. feron ␥-producing Th1 cells. J. Exp. Med. 196:969. 23. Voshenrich, C. A. J., and J. P. Di Santo. 2001. IL-21 joins the ␥c-dependent 43. Wang, K. S., J. Ritz, and D. A. Frank. 1999. IL-2 induces STAT4 activation in network? Curr. Biol. 11:175. primary NK cells and NK cell lines, but not in T cells. J. Immunol. 162:299.