DOCSLIB.ORG

PIERCE, Naomi Barcode of Life 2015 FINAL.Key

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PIERCE, Naomi Barcode of Life 2015 FINAL.Key Ecological interactions Myrmecophiles of the ants of Vachellia (Acacia) drepanolobium Naomi E. Pierce Museum of Comparative Zoology Harvard University (2006) Molecular prospecting: Ants and symbiotic bacteria Alex Wild Bacteria from some ant groups are specialized and closely related Tetraponera associates are monophyletic Cephalotini associates are monophyletic C. Moreau Key: Jake Ant associates Russell Symbionts of plants Symbionts of invertebrates Ants with Rhizobiales have evolved independently At least 5 separate origins of Rhizobiales associations with herbivorous ants Key: Herbivore Predator Rhizobiales host Phylogeny from Moreau et al. 2006 . PNAS (2009) 106: 21236 Symbiotic gut bacteria are likely to have facilitated the evolution of herbivory in ants 7 Cephalotes Jon Sanders Coevolution of ants and their microbiota ... Characterizing gut bacteria for Cephalotes qPCR corroborates visual evidence 16S copies / ng DNA: ant guts Tetraponera penzigia 1E+07 1E+06 1E+05 1E+04 16S copies / ng DNA 1E+03 1E+02 0.1 1.0 10.0 100.0 extracted DNA concentration Other Guts Cephalotes Guts Polyrachis gasters Cephalotes rohweri 10µm 0.1mm 1mm 1m Host nuclei Bacteria 0 0 1 1 1 pallidoides Verrucomicrobiae clypeatus pusillus atratus persimilis Gammaproteobacteria maculatus Abundances persample eduarduli borgmeieri pellans grandinosus minutus Alphaproteobacteria simillimus spinosus cordatus aff. pallens umbraculatus Betaproteobacteria aff.angustus rohweri bohlsi peruviensis setulifur crenaticeps placidus scutulatus Other mompox Procryptocerus sp. 0.01 Legend: Dataset species_dots fdr_sig_nodes total_nodes Dataset per_species_heatmap 0 16 32 50 3366 6682 10000 Color ranges: c__Clostridia p__GN02 c__Opitutae k__Bacteria p__Bacteroidetes c__Flavobacteria c__Bacteroidia c__Bacilli c__Chloroplast c__Alphaproteobacteria p__Proteobacteria c__Gammaproteobacteria c__Epsilonproteobacteria c__Betaproteobacteria Many OTUs codiversify 204 117 33 26 65 92 350 63 71 136 75 121 60 262 189 67 34 27 113 695 170 57 10 35 896 66 138 361 0 426 275 725 209 208 156 45 174 197 78 391 64 515 74 166 286 738 28 14 119 332 183 817 39 47 13 1 20 888 131 Cephalotes 852 31 195 43 574 pOTU width p < 0.01 (tested) 158 37 468 46 2 487 11 6 99 69 89 19 (83) 23 72 899 44 699 289 272 32 148 115 93 19 (80) 529 186 400 790 191 527 16 706 7 12 36 95 15 (123) 409 836 30 29 368 22 48 405 165 671 900 9 21 97 9 (166) 772 766 880 492 965 162 644 566 3 153 125 90 374 829 15 54 709 76 137 489 323 Molecular Ecology (2014) 23: 1268 18 809 288 8 815 520 394 89 993 5 25 83 58 59 88 122 17 967 157 Pollination biology: the evolution of orchid bees Phylogeny of Euglossini (stingless bees) Fossils used to “calibrate” age of tree Santiago Ramírez Penalized likelihood rate smoothing =10 CO1 + Ef1-alpha (F2) 75 50 25 0 My Mechanical floral isolation in euglossine-pollinated orchids 2 1 5 7 8 6 4 1 – Head 7 2 – Antennae 3 – Leg 1 4 – Ventral thorax 5 – Scutum 3 6 – Scutellum 7 – Thorax-abd 9 8 – Abdomen sequenced nrITS, ycf1 from ~150 pollinaria Pollinaria sampling A 40 30 20 10 0 Eoc Oli Mio Gen sp. Galeandra Cycnoches Dressleria Catasetinae Clowesia Epidendroideae Higher Catasetum Zygopetalinae Macroclinium Dichaea Warczewiczella Kefersteinia Stenia Chondrorhyncha Polycycnis Stanhopea Soterosanthus Sievenkingia Coryanthes Stanhopeinae C Cymbidiinae 0.93 Catasetinae Bromheadiinae Eulophiinae Eriopsidinae Oncidiinae Gongora Zygopetalinae 1.0 Maxillariinae 0.92 Stanhopeinae (+Coeliopsidinae) (My) Tertiary 40 30 20 10 0 Orchids A B 40 30 20 10 0 0 10 20 30 40 Eoc Oli Mio Mio Oli Eoc Gen sp. Galeandra Exaerete Cycnoches 0.99 Catasetinae Dressleria Clowesia Eufriesea fragrance collection fragrance of Origin Epidendroideae Higher Catasetum Zygopetalinae Eulaema Macroclinium Dichaea Warczewiczella Kefersteinia Stenia Chondrorhyncha Polycycnis Stanhopea Euglossa Soterosanthus D Sievenkingia Coryanthes Stanhopeinae C Cymbidiinae 0.93 Catasetinae Bromheadiinae Eulophiinae Eriopsidinae Oncidiinae Gongora Zygopetalinae 1.0 Maxillariinae 0.92 Stanhopeinae (+Coeliopsidinae) (My) (My) Tertiary Tertiary 40 30 20 10 0 0 10 20 30 40 Orchids Bees (Science, 2011) Leonora Bittleston Fluid and insects collected from 3 Nepenthes species in 3 different sites in Singapore. Counts of macroscopic arthropods: 8 common ‘morphospecies’ including flies, mites and ants Frog-biting midge: Corethrella Mosquitoes: Toxorhynchites, Scuttle fly: Endonepenthia Culex, Tripteroides Anoetid mites: Zwickia Gall midge: Lestodiplosis Insect prey: mostly ant heads Biting midge: Dasyhelea Counts by eye versus sequencing diversity Counts Metabarcoding • 8 arthropod • 189 arthropod “OTUs” in “morphospecies” rarefied table • Plus parasites, algae, protozoa, etc. However, it’s difficult to connect sequences to individuals, especially since reference sequences for most of these organisms are not yet in sequencing databases. Inquiline counts and sequences generally match, but on different scales 4 3 Mosquito Mite 2 Endonepenthia Dasyhelea Lestodiplosis Corethrella ln (Counts + 1) 1 0 0 1.125 2.25 3.375 4.5 ln (sqrt (Rarefied Seqs) + 1) Mosquitoes and mites seem to be underrepresented in count data Phylogenetic trees of dipteran inquilines 18S (ribosomal) CO1 (mitochondrial) “Endonepenthia” “Dasyhelea” “Corethrella” “Lestodiplosis” “Mosquitoes” Relative sequence abundance N. ampullaria communities N. gracilis communities N. rafflesiana communities Obligate insect parasites! Bipartite network of arthropods and pitcher plants N. rafflesiana N. gracilis N. ampullaria Networks can reveal which organisms are shared across different host species and samples. Spring-loaded network of core OTUs present in at least 10% of the samples from each host species. Austral Ecology (2015) Myrmecophiles of the ants of Vachellia (Acacia) drepanolobium Chris Baker Jack Boyle Dino Martins Julianne Lori Pelaez Shapiro Ant-plant symbioses • 465+ myrmecophytic plant species • 100+ phytoecious ant species • Restricted to the tropics East Africa... Vachellia drepanolobium is a dominant component of the flora of East Africa Vachellia drepanolobium with swollen thorn ant domatia Up to 16 different ant species have been recorded inhabiting Vachellia drepanolobium: Crematogaster nigriceps Crematogaster mimosae C. sjostedi Tetraponera penzigi Camponotus rufoglaucus Unidentified spp. Nesomyrmex sp. Three primary ant species occupy trees throughout Kenya, typically one colony per tree Crematogaster mimosae Crematogaster nigriceps Tetraponera penzigi CM CN TP Two species of Crematogaster; One Tetraponera Illustrations by Dino Martins The Plants The Ants Domatia Defensive Extra-floral patrolling nectaries Experimental work by Truman Young, Mau Stanton, Todd Palmer, Rob Pringle and others have shown clear differences in patrolling behavior between different ants C. mimosae C. nigriceps T. penzigi For example, Dino Martins showed that browsing giraffe spend less time feeding on plants inhabited by C. mimosae (Martins, 2010) This system has many third party associates Expanding the network A.drepanolobium fungal communities Chris Baker 4/19 Expanding the network A.drepanolobium fungal communities Chris Baker 4/19 Microdon - a parasitic fly Zoraptera in Tetraponera domatium (feed on fungal spores and hyphae— < 3mm long) Third parties in this system appear to interact at both the mutualistic and parasitic end of the spectrum A systematic survey? Lycaenid butterflies Anthene usamba Lycaenid butterfly that lays eggs on the acacias. The larvae are chemically defended against ant attacks. Do females prefer the more aggressive ant mutualist? Preferences tested in bush house Oviposition Experiment Females were given a choice of saplings inhabited by 3 different ant species, or no ants: • C. mimosae • C. nigriceps • T. penzigi • No ants Females of Anthene usamba laid eggs on plants with C. mimosae or no ants Biol. J. Linn. Soc. 2013 Stable isotope analysis indicates that Anthene usamba is carnivorous, and is likely to be eating ants inside the domatia. Biol. J. Linn. Soc. 2013 45 species of lycaenids parasitize acacia-ant mutualisms Our survey has involved collecting and processing many individual ant colonies from each of the three species throughout their range Workflow Field collection and DNA extraction PCR + sequencing processing COI primers aacccctattaggtggatta atgctacgctagcatgctgg actagtgctattcggatatc actgcatgcggggtagctag OTU 2 statistical and centroid sequence OTU 1 ty ri genetic analyses la i im s % 97 treat each OTU other as a distinct taxon sequences group similar assign taxonomy sequences where possible into ‘OTU’s Numbers summary for myrmecophile data 480 trees sorted 176 trees without myrmecophiles (162 CM, 163 CN, 140 TP) 22,229 domatia 304 trees with myrmecophiles Suyian 6 2000 Suyian 2000 2500 0.5 4 2000 2361 myrmecophiles Kenya meters meters 2000 5000 2500 3000 2 0.0 4000 (median = 3 per tree) 2500 4000 3500 2500 3000 3000 3000 0 2000 2500 2000 2000 1000 2000 0 Kitengela 0 20 40 60 km 1091 with 0 200 km 2000 32 34 36 38 40 42 44 35.5 36.0 36.5 37.0 37.5 sequence data Kenya Kitengela 1270 without 82 different OTUs sequence data (6 high abundance taxa) Numbers summary for myrmecophile data 480 trees sorted 176 trees without myrmecophiles (162 CM, 163 CN, 140 TP) 22,229 domatia 304 trees with myrmecophiles 200 80 Kitengela 2013 2361 myrmecophiles 150 60 full dataset (median = 3 per tree) taxa 40 Suyian 2013 100 chao2 estimator Kitengela 2012 20 50 0 0 1091 with 0 100 200 300 400 500 K12 K13 S13 all sequence data trees collection location/year 1270 without
Load more

Recommended publications
  • The Role of Ants and Mammalian Herbivores on the Structure and Composition of Insect Communities Found on Canopies of Acacia Drepanolobium
    African Journal of Agricultural Research Vol. 7(38), pp. 5317-5331, 2 October, 2012 Available online at http://www.academicjournals.org/AJAR DOI: 10.5897/AJAR12.059 ISSN 1991-637X ©2012 Academic Journals Full Length Research Paper The role of ants and mammalian herbivores on the structure and composition of insect communities found on canopies of Acacia drepanolobium S. K. Kuria 1* and M. H. Villet 2 1Department of Biological Sciences, Walter Sisulu University, P/B X1 Mthatha 5117, South Africa. 2Department of Zoology and Entomology, Rhodes University, Grahamstown 6140, South Africa. Accepted 4 June, 2012 Acacia drepanolobium Sjøstedt (Fabaceae) constitutes about 99% of the woody vegetation in the cotton soil ecosystem of Laikipia, Kenya. The tree has symbiotic association with four ant species that discourage large mammalian herbivores from feeding on it. However, there is no information as to whether these ants affect the community of canopy insects. Therefore, this study investigated the effect of the four ant species and differential vertebrate grazing and browsing pressures on the insect community inhabiting canopies of A. drepanolobium trees. Insect samples were collected using standard fogging and beating methods and identified to family and morphospecies. At the morphospecies level, the insect communities separated into two distinct groups, one comprised of samples collected from trees occupied by Crematogaster mimosae and Crematogaster nigriceps , and the other of samples obtained from trees inhabited by C. sjostedti and Tetraponera penzigi . However, differential vertebrate grazing and browsing patterns did not show any significant effect on the insect community occupying canopies of A. drepanolobium . Key words: Community structure, coexistence, diversity, herbivory, Mpala, Kenya.
    [Show full text]
  • Bacterial Infections Across the Ants: Frequency and Prevalence of Wolbachia, Spiroplasma, and Asaia
    Hindawi Publishing Corporation Psyche Volume 2013, Article ID 936341, 11 pages http://dx.doi.org/10.1155/2013/936341 Research Article Bacterial Infections across the Ants: Frequency and Prevalence of Wolbachia, Spiroplasma,andAsaia Stefanie Kautz,1 Benjamin E. R. Rubin,1,2 and Corrie S. Moreau1 1 Department of Zoology, Field Museum of Natural History, 1400 South Lake Shore Drive, Chicago, IL 60605, USA 2 Committee on Evolutionary Biology, University of Chicago, 1025 East 57th Street, Chicago, IL 60637, USA Correspondence should be addressed to Stefanie Kautz; [email protected] Received 21 February 2013; Accepted 30 May 2013 Academic Editor: David P. Hughes Copyright © 2013 Stefanie Kautz et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Bacterial endosymbionts are common across insects, but we often lack a deeper knowledge of their prevalence across most organisms. Next-generation sequencing approaches can characterize bacterial diversity associated with a host and at the same time facilitate the fast and simultaneous screening of infectious bacteria. In this study, we used 16S rRNA tag encoded amplicon pyrosequencing to survey bacterial communities of 310 samples representing 221 individuals, 176 colonies and 95 species of ants. We found three distinct endosymbiont groups—Wolbachia (Alphaproteobacteria: Rickettsiales), Spiroplasma (Firmicutes: Entomoplasmatales),
    [Show full text]
  • Trees and Plants for Bees and Beekeepers in the Upper Mara Basin
    Trees and plants for bees and beekeepers in the Upper Mara Basin Guide to useful melliferous trees and crops for beekeepers December 2017 Contents Who is this guide for? .......................................................................................................................................................................................................................................................................... 1 Introduction to the MaMaSe Project .................................................................................................................................................................................................................................................. 1 Market driven forest conservation initiatives in the Upper Mara basin ............................................................................................................................................................................................. 2 Water, apiculture, forests, trees and livelihoods ................................................................................................................................................................................................................................ 3 Types of bees ....................................................................................................................................................................................................................................................................................... 4 How this
    [Show full text]
  • Causes and Consequences of Coexistence in the Vachellia Drepanolobium Ant-Plant Mutualism
    Causes and consequences of coexistence in the Vachellia drepanolobium ant-plant mutualism The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:40046465 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Causes and consequences of coexistence in the Vachellia drepanolobium ant-plant mutualism A dissertation presented by John Boyle to the Department of Organismic and Evolutionary Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biology Harvard University Cambridge, Massachusetts April 2017 This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License. Dissertation Advisor: Professor Naomi E. Pierce John Boyle Causes and consequences of coexistence in the Vachellia drepanolobium ant-plant mutualism Abstract This thesis focuses on a mutualism between the East African acacia tree Vachellia drepanolobium and the species of canopy-dwelling ants that inhabit it. The tree provides the ants with nesting space in the canopy and extrafloral nectar, and in return the ants defend the tree from herbivores. Several different ant species compete vigorously with each other for this canopy nesting space. Despite this, coexistence is maintained among those species at fine spatial scales, apparently by a colonization-competition tradeoff: ant species that are the best at colonizing unoccupied trees are the worst at defending those trees from neighboring competitors, and vice versa.
    [Show full text]
  • Ant-​Plant Mutualism: Ant-​Acacia Interactions in African Savannas
    20 10 Integrating Ecological Complexity into Our Understanding of Ant- Plant Mutualism: Ant- Acacia Interactions in African Savannas Todd M. Palmer and Truman P. Young* Introduction Ant- plant protection mutualisms, and mutualisms more broadly, are typically defined as “+ / +” interactions, indicating that species on each side of the interac- tion have a positive effect on the per capita growth rate of their partner. But that simple representation belies potentially great complexity: each “+” sign represents the net effects of the interaction’s costs and benefits on the lifetime fitness of par- ticipants, and these costs and benefits may shift both spatially and temporally with environmental conditions, with variation in the guild of mutualist partners, and with variation in the community of interacting species outside of the mutualism. As these conditions change, so too may the strength of mutualism, with consequences that can strongly influence the communities in which these interactions are embed- ded. To understand mutualism, therefore, requires moving beyond traditional pair- wise approaches (Stanton, 2003), and accounting for both the complexity inherent in mutualist networks and the ways in which the surrounding environment affects these interactions. Doing this accounting correctly is important: our entire under- standing of mutualism, from the evolution of traits and behaviors to the stability of mutualism itself, is predicated on understanding how these interactions integrate to influence the lifetime fitness of the participants. To illustrate the complexity of mutualism, and to provide examples of how this complexity may affect its ecological and evolutionary dynamics, in this chapter we review ant- acacia interactions within the savannas and bushlands of East Africa.
    [Show full text]
  • The Influence of Ants on the Insect Fauna of Broad
    THE INFLUENCE OF ANTS ON THE INSECT FAUNA OF BROAD - LEAVED, SAVANNA TREES. by SUSAN GRANT Thesis submitted to Rhodes University in partial fulfilment for the degree of Master of Science Department of Zoology and Entomology Rhodes University Grahamstown SOUTH AFRICA May 1984 TO MY PARENTS AND SISTER, ROSEMARY ---- '.,. ... .... ...... ;; ............. .... :.:..:.: " \ ... .:-: ..........~.~ . .... ~ ... .... ......... • " ".! . " \ ......... :. ........ .................... FRONTISPIECE TOP RIGHT - A map of Southern Africa indicating the position of the Nylsvley Provincial Nature Reserve. TOP LEFT One of the dominant ant species, Crematogaster constructor, housed in a carton nest in a Terminalia sericea tree. R BOTTOM RIGHT - A sticky band of Formex which was applied to the trunk of trees to exclude ants. BOTTOM LEFT - Populations of the scale insect Ceroplastes rusci on the leaves of an unbanded Ochna pulchra shrub. CONTENTS Page ACKNOWLEDGEMENTS 1. ABSTRACT 2. INTRODUCTION 1 - 4 3. STUDY AREA 5 - 10 3.1 Abiotic components 3.2 Biotic components 4. GENERAL MATERIALS AND METHODS 11 - 14 4.1 Ant exclusion 4.2 Effect of banding 5. THE RESULTS OF BANDING 15 - 17 5.1 Effect on plant phenology 5.2 Effect on the insect fauna 6. THE ANT COMMUNITY 18 - 29 6.1 The ant species 6.2 Ant distribution and nesting sites 6.3 Field observations 7. SAMPLING OF BANDED AND UNBANDED TREES 30 - 44 7.1 Non-destructive sampling 7.2 Destructive pyrethrum sampling 8. ASSESSMENT OF HERBIVORY 45 - 55 8.1 Damage records on .banded and unbanded trees 9. DISCUSSION 56 - 60 APPENDICES 61 - 81 REFERENCES 82 - 90 ACKNOWLEDGEMENTS I would like to express my sincere thanks to Professor V.C.
    [Show full text]
  • A Role for Indirect Facilitation in Maintaining Diversity in a Guild of African Acacia Ants
    Ecology, 94(7), 2013, pp. 1531–1539 Ó 2013 by the Ecological Society of America A role for indirect facilitation in maintaining diversity in a guild of African acacia ants 1,2,7 1,2,3 1,2,4 2 2,5,8 TODD M. PALMER, MAUREEN L. STANTON, TRUMAN P. YOUNG, JOHN S. LEMBOI, JACOB R. GOHEEN, 2,6,9 AND ROBERT M. PRINGLE 1Center for Population Biology, University of California, Davis, California 95616 USA 2Mpala Research Centre, Box 555, Nanyuki, Kenya 3Section of Evolution and Ecology, University of California, Davis, California 95616 USA 4Department of Plant Sciences, University of California, Davis, California 95616 USA 5Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131 USA 6Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, Massachusetts 02138 USA Abstract. Determining how competing species coexist is essential to understanding patterns of biodiversity. Indirect facilitation, in which a competitively dominant species exerts a positive effect on one competitor by more strongly suppressing a third, shared competitor, is a potentially potent yet understudied mechanism for competitive coexistence. Here we provide evidence for indirect facilitation in a guild of four African Acacia ant species that compete for nesting space on the host plant Acacia drepanolobium, showing that a competitively dominant acacia ant species indirectly creates establishment opportunities for the most subordinate species that may help to maintain diversity. Using long-term observational data and field experiments, we demonstrate that the competitively dominant ant species outcompetes two competitively intermediate species, while tolerating colonies of the subordinate competitor; this creates opportunities for local colonization and establishment of colonies of the subordinate species within the dominant species’ territories.
    [Show full text]
  • 2 the Vegetation
    The Biology of African Savannahs THE BIOLOGY OF HABITATS SERIES This attractive series of concise, affordable texts provides an integrated overview of the design, physiology, and ecology of the biota in a given habi- tat, set in the context of the physical environment. Each book describes practical aspects of working within the habitat, detailing the sorts of stud- ies which are possible. Management and conservation issues are also included. The series is intended for naturalists, students studying biological or environmental science, those beginning independent research, and professional biologists embarking on research in a new habitat. The Biology of Rocky Shores Colin Little and F. A. Kitching The Biology of Polar Habitats G. E. Fogg The Biology of Lakes and Ponds Christer Brönmark and Lars-Anders Hansson The Biology of Streams and Rivers Paul S. Giller and Bjorn Malmqvist The Biology of Mangroves Peter F. Hogarth The Biology of Soft Shores and Estuaries Colin Little The Biology of the Deep Ocean Peter Herring The Biology of Lakes and Ponds, Second ed. Christer Brönmark and Lars-Anders Hansson The Biology of Soil Richard D. Bardgett The Biology of Freshwater Wetlands Arnold G. van der Valk The Biology of Peatlands Håkan Rydin and John K. Jeglum The Biology of Mangroves and Seagrasses Peter Hogarth The Biology of African Savannahs Bryan Shorrocks The Biology of African Savannahs Bryan Shorrocks Environment Department University of York 1 3 Great Clarendon Street, Oxford OX2 6DP Oxford University Press is a department of the University
    [Show full text]
  • Sue's Pdf Quark Setting
    Cambridge University Press 978-0-521-83488-9 - Insect Ecology: Behavior, Populations and Communities Peter W. Price, Robert F. Denno, Micky D. Eubanks, Deborah L. Finke and Ian Kaplan Index More information AUTHOR INDEX Aanen, D.K., 227 Amman, G.D., 600 Bach, C.E., 152 Abrahamson, W.G., 16, 161, 162, Andersen, A.N., 580 Bacher, 275 165 Andersen, N.M., 401 Bacher, S., 275 Abrams, 274 Anderson, J.M., 114 Bachman, S., 567 Abrams, P.A., 195, 273, 276 Anderson, R.M., 336, 337, 338 Ba¨ckhed, F., 225 Acorn, J., 250 Anderson, R.S., 415 Badenes-Perez, F.R., 400 Adams, D.C., 203 Andersson, M., 82, 83, 87 Baerends, G.P., 29 Adams, E.S., 435 Andow, D.A., 127, 128, 179, 276, 513, Bailey, J.K., 426, 474, 475, 603 Adamson, R.S., 573 528 Bailey, V.A., 279, 356 Addicott, J.F., 242, 507 Andres, M.R., 116, 117, 118 Baker, R.R., 54 Addy, N.D., 574, 601, 602 Andrew, N.R., 566 Baker, I., 247 Adjei-Maafo, I.K., 530 Andrewartha, H.G., 27, 260, 261, 279, Baker, T.C., 53 Adler, L.S., 155 356, 404 Baker, W.L., 166 Adler, P.H., 8 Andrews, J.H., 310 Baldwin, I.T., 121, 122, 125, 126, 127, Agarwal, V.M., 506 Aneshansley, D.J., 48 129, 143, 144, 166, 174, 179, 187, Agnew, P., 369 Anonymous, 18 197, 201, 204, 208, 221, 492, 498 Agrawal, A.A., 99, 108, 114, 118, 121, Anstett, M.-C., 236, 243, 244 Ballabeni, P., 162 122, 125, 126, 128, 129, 130, 133, Antonovics, J., 471 Baltensweiler, 414 136, 139, 156, 161, 197, 204, 205, Aoki, S., 80 Baltensweiler, W., 407, 410, 424 208, 216, 219, 299, 444, 471, 492, Appel, H.M., 124, 128 Bangert, 465, 472 493, 502, 507, 509, 512, 513
    [Show full text]
  • A New Species of Calosima Dietz, 1910 from Kenya (Lepidoptera: Gelechioidea: Blastobasidae) Reared from the Domatia of Vachellia Drepanolobium (Fabaceae)
    A New Species of Calosima Dietz, 1910 from Kenya (Lepidoptera: Gelechioidea: Blastobasidae) Reared from the Domatia of Vachellia drepanolobium (Fabaceae) Author: Adamski, David Source: Proceedings of the Entomological Society of Washington, 119(sp1) : 697-702 Published By: Entomological Society of Washington URL: https://doi.org/10.4289/0013-8797.119.SpecialIssue.697 BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titles in the biological, ecological, and environmental sciences published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use. Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Downloaded From: https://bioone.org/journals/Proceedings-of-the-Entomological-Society-of-Washington on 05 Sep 2020 Terms of Use: https://bioone.org/terms-of-use Access provided by Entomological Society of Washington PROC. ENTOMOL. SOC. WASH. 119(Special Issue), 2017, pp. 697–702 A NEW SPECIES OF CALOSIMA DIETZ, 1910 FROM KENYA (LEPIDOPTERA: GELECHIOIDEA: BLASTOBASIDAE) REARED FROM THE DOMATIA OF VACHELLIA DREPANOLOBIUM (FABACEAE) urn:lsid:zoobank.org:pub:096AE78C-10F7-481E-AE1A-9270831E95D4 DAVID ADAMSKI Department of Entomology, National Museum of Natural History, P.O.
    [Show full text]
  • Large Mammals Generate Both Top-Down Effects and Extended
    Journal of Tropical Ecology Large mammals generate both top-down www.cambridge.org/tro effects and extended trophic cascades on floral-visitor assemblages 1,2,3, 1,3 1 1,4 Research Article Allison Louthan *, Emily Valencia , Dino J. Martins , Travis Guy , Jacob Goheen1,5, Todd Palmer1,4 and Daniel Doak1,3 Cite this article: Louthan A, Valencia E, Martins DJ, Guy T, Goheen J, Palmer T and 1Mpala Research Centre, P.O. Box 555, Nanyuki, Kenya; 2Department of Biology, Duke University, Durham, NC 27708, Doak D (2019) Large mammals generate both 3 4 top-down effects and extended trophic USA; Environmental Studies Program, University of Colorado, Boulder, CO 80309, USA; Department of Biology, 5 cascades on floral-visitor assemblages. Journal University of Florida, Gainesville, FL 32611, USA and Department of Zoology & Physiology, University of of Tropical Ecology 35,185–198. https://doi.org/ Wyoming, Laramie, WY 82071, USA 10.1017/S0266467419000142 Abstract Received: 20 September 2018 Revised: 9 April 2019 Cascading effects of high trophic levels onto lower trophic levels have been documented in Accepted: 9 April 2019 many ecosystems. Some studies also show evidence of extended trophic cascades, in which guilds dependent on lower trophic levels, but uninvolved in the trophic cascade themselves, Keywords: Extended trophic cascade; floral visitor; are affected by the trophic cascade due to their dependence on lower trophic levels. Top-down flowers; large mammals; pollinators; trophic effects of large mammals on plants could lead to a variety of extended trophic cascades on the cascade; top-down effects; trophic ricochet many guilds dependent on plants, such as pollinators.
    [Show full text]
  • Seed Production, Infestation, and Viability in Acacia T
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Enlighten Rugemalila, D. M., Morrison, T., Anderson, T. M. and Holdo, R. M. (2017) Seed production, infestation, and viability in Acacia tortilis (synonym: Vachellia tortilis) and Acacia robusta (synonym: Vachellia robusta) across the Serengeti rainfall gradient. Plant Ecology, (doi:10.1007/s11258-017- 0739-5) This is the author’s final accepted version. There may be differences between this version and the published version. You are advised to consult the publisher’s version if you wish to cite from it. http://eprints.gla.ac.uk/143648/ Deposited on: 07 July 2017 Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk33640 RRH: Serengeti seed demography Title: Seed production, infestation and viability in Acacia tortilis (synonym: Vachellia tortilis) and Acacia robusta (synonym: Vachellia robusta) across the Serengeti rainfall gradient. Deusdedith M. Rugemalila1 *, Thomas Morrison2, T. Michael Anderson1 and Ricardo M. Holdo3 1Department of Biology, Wake Forest University, Winston Salem, NC 27106, USA, 2Institute of Biodiversity, Animal Health and Comparative Medicine, University of Glasgow, Glasgow, United Kingdom 3Odum School of Ecology - University of Georgia, Athens, GA 30602-2202, USA *Corresponding author; e-mail: [email protected] 1 1 Abstract 2 Tree recruitment in savannas proceeds in multiple stages characterized by successive 3 filters occurring at the seed and seedling stages. The “demographic bottleneck” 4 hypothesis suggests that such filters ultimately restrict tree density and prevent trees from 5 dominating grasses in savannas, but many of the demographic transitions underlying this 6 assumption have not been quantified.
    [Show full text]